Molecular Genetics of Tooth Agenesis

Home , Human tooth development, Polyphyodont

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Helsingin yliopiston digitaalinen arkisto

Pekka Nieminen

Department of Orthodontics Institute of Dentisty and Institute of Biotechnology and Department of Biological and Environmental Sciences Faculty of Biosciences University of Helsinki Finland

Academic Dissertation To be discussed publicly with the permission of the Faculty of Biosciences of the University of Helsinki, in the Main Auditorium of the Institute of Dentistry on November 23rd 2007 at 12 noon.

Helsinki 2007 Supervisors Sinikka Pirinen, DDS, PhD Professor emerita Department of Pedodontics and Orthodontics Institute of Dentistry, University of Helsinki, Finland

Irma Thesleff, DDS, PhD Professor Developmental Biology Programme Institute of Biotechnology, University of Helsinki, Finland

Reviewed by Jan Huggare, DDS, PhD Professor Department of Orthodontics Karolinska institutet Huddinge, Sweden

Anu Wartiovaara, MD, PhD Professor FinMIT, Research Program of Molecular Neurology Biomedicum Helsinki Finland

Opponent: Heiko Peters PhD, Reader University of Newcastle

ISBN 978-952-10-4350-5 (nid.) ISBN 978-952-10-4351-2 (PDF) ISSN 1795-7079

Yliopistopaino Oy Helsinki 2007

Contents

LIST OF ORIGINAL PUBLICATIONS 7 ABBREVIATIONS 8 SUMMARY 9

INTRODUCTION 10

REVIEW OF THE LITERATURE 11

OVERVIEW OF TOOTH DEVELOPMENT 11 Principles of development 11 Teeth and dentitions 13 Development of teeth 14 Commitment, morphogenesis and inductive interactions 19 Molecular regulation of tooth development 26 Reciprocal signaling and signaling centers 26 Transcription factors 27 MSX1 and PAX9 28 Initiation 29 Morphogenesis 32 Tooth replacement 34

TOOTH AGENESIS 36 Developmental anomalies 36 Developmental anomalies of teeth 37 Genetic traits of tooth number and shape 37 Supernumerary teeth 38 Tooth agenesis 39 Terminology 39 Diagnostic challenges 40 Prevalences 40 Patterns of agenesis 41 Tooth agenesis in syndromes 43 Dental anomalies associated with agenesis 43 Reduction of tooth size and morphology 44 Delayed development and eruption 45 Root abnormalities 46 Abnormal positions of teeth 47 Enamel defects 48 Etiology and pathogenesis of tooth agenesis 48 Environmental factors 48 Tooth size variation and heritability 50 Twin studies on agenesis 50 Segregation analyses in families 51 Molecular genetics 52

4 Pathogenesis of tooth agenesis 53 Tooth agenesis and cancer 56

HUMAN GENETICS AND GENE DEFECTS 57 The human genome 57 Variation 58 From genotypes to phenotypes 59 Gene identification 60

AIMS 64

MATERIALS AND METHODS 65 Subjects 65 DNA isolation 66 Genotyping 67 Linkage analysis (I, IV) 68 Sequencing (II) 68 FISH Analysis (III) 68 Gene expression data collection (V) 69 WWW implementation (V) 69

RESULTS AND DISCUSSION 70 MSX1 and PAX9 in dominantly inherited severe tooth agenesis (publications II and III) 70 Attempts to unravel the genetic basis of common tooth agenesis (incisor and premolar hypodontia) (publications I, IV) 74 Construction of the gene expression database (publication V) 78

GENERAL DISCUSSION 80 Uncovering the genetic background of tooth agenesis 80 Implications for the pathogenetic mechanisms of tooth agenesis 82

CONCLUDING REMARKS 85

ACKNOWLEDGEMENTS 86

REFERENCES 88

5 6 List of original publications

This thesis is based on the following original articles, which are referred to in the text by their roman numerals. In addition, some unpublished data are also presented.

I Nieminen P, Arte S, Pirinen S, Peltonen L, and Thesleff I (1995). Gene defect in hypodontia - exclusion of MSX1 and MSX2 as candidate genes. Human Genetics 96, 305-308.

II Nieminen P, Arte S, Tanner D, Paulin L, Alaluusua S, Thesleff I, and Pirinen S (2001). Identification of a nonsense mutation in the PAX9 gene in molar oligodontia. European Journal of Human Genetics 9, 743-746.

III Nieminen P, Kotilainen J, Aalto Y, Knuutila S, Pirinen S, and Thesleff I (2003). MSX1 gene is deleted in Wolf-Hirschhorn syndrome patients with oligodontia. Jour- nal of Dental Research 82 , 1012-1016.

IV Nieminen P, Arte S, Luonsi E, Pirinen S, Peltonen L, and Thesleff I. A genome-wide search for hypodontia locus in families, manuscript.

V Nieminen P, Pekkanen M, Åberg T, and Thesleff I (1998). A graphical www- database on gene expression in tooth. European Journal of Oral Sciences 106, 7-11.

7 ABBREVIATIONS

ADULT acro-dermato-ungual-lacrimal-tooth syndrome AEC ankyloblepharon-ectodermal dysplasia-clefting syndrome AI amelogenesis imperfecta APC adenomatous polyposis coli BMP/Bmp bone morphogenetic protein CLPED cleft lip/palate-ectodermal dysplasia syndrome DKK1/Dkk1 dickkopf-1 DLX/Dlx distalless homeobox homolog DNA deoxyribonucleid acid E embryonic day EDA/Eda anhidrotic ectodermal dysplasia EDAR/Edar EDA receptor EDA-ID anhidrotic ectodermal dysplasia with immunodeficiency EEC ectrodactyly-ectodermal dysplasia-clefting syndrome EGF/Egf epidermal growth factor ERS epithelial cell rests of Malassez FAP familial adenomatous polyposis coli FGF/Fgf fibroblast growth factor FGFR/Fgfr fibroblast growth factor receptor HERS Hertwig’s epithelial root sheath IP incontinentia pigmenti LEF1/Lef1 lymphoid enhancer factor 1 LMS limb-mammary syndrome mRNA messenger RNA MSX/Msx muscle segment homeobox homolog NMD nonsense mediated decay OL-EDA-ID anhidrotic ectodermal dysplasia-immunodeficiency-osteopetrosis- lymphoedema. PAX/Pax paired box family member PCR polymerase chain reaction RNA ribonucleic acid RUNX/Runx runt homolog SHH/Shh sonic heghehog SNP single nucleotide polymorphism SRA short root anomaly STRP short tandem repeat polymorphism TGFA transforming growth factor D TGFE/TgfE transforming growth factor E TNF/Tnf tumor necrosis factor

8 SUMMARY

Tooth agenesis is one of the most common developmental anomalies in man. The common forms, in which one or a few teeth are absent, may cause cosmetic or occlusal harm, while severe forms which are relatively rare require clinical attention to support and maintain the dental function. Observation of tooth agenesis and especially the severe forms is also important for diagnosis of malformation syndromes.

Some external factors like pollutants or cancer therapy may cause developmental defects and agenesis in dentition. However, twin and family studies have shown the predominant role of inheritance in the etiology of agenesis. Furthermore, studies on inherited tooth agenesis as well as mouse null mutants have identified several of the genetic factors and helped to understand the molecular mechanisms of tooth development. However, so far success has only been made in identifying the genes involved in syndromic or rare dominant forms of tooth agenesis, while the genes and defects responsible for the majority of cases of tooth agenesis, especially the common and less severe forms, are largely unknown.

In this study, different types of tooth agenesis were studied. It was shown that a dominant nonsense mutation in PAX9 was responsible for severe agenesis (oligodontia) affecting especially permanent molars in a Finnish family. In a study of tooth agenesis associated with Wolf-Hirschhorn syndrome, it was shown that severe tooth agenesis was present if the causative deletion in the short arm of chromosome 4 spanned the MSX1 locus. A conclusion from these studies was that severe tooth agenesis was caused by haploinsufficiency of these transcription factors. During this work several other gene defects in MSX1 and PAX9 have been identified by us and others, and according to an analysis of the associated phenotypes presented in this thesis, similar but significantly different agenesis phenotypes are associated with defects in MSX1 and PAX9, apparently reflecting distinctive roles for these two transcription factors during the development of human dentition.

The original aim of this work was to identify gene defects that underlie the common incisor and premolar hypodontia. For this purpose, several candidate genes were first excluded. Af- ter a genome-wide search with seven families in which tooth agenesis was inherited in an autosomal dominant manner, a promising locus in chromosome 18 was identified for second premolar agenesis in one family. This finding was supported by results from other families. The results also implied existence of other loci both for second premolar agenesis and for incisor agenesis. On the other hand the results from this study did not lend support for comprehensive involvement of the most obvious candidate genes in the etiology of incisor and premolar hypodontia. Rather, they suggest remarkable genetic heterogeneity of tooth agenesis.

Despite the increasing knowledge of the molecular background of tooth agenesis, the patho- logical and developmental mechanisms of tooth agenesis have only become clarified in a few cases. The available evidence suggests that human tooth agenesis usually is a consequence of quantitative defects which predispose to a failure to overcome a developmental threshold. However, the stages and causes may be different in the case of different genes.

9 INTRODUCTION

Mammalian teeth develop as ectodermal organs bearing many similarities to other such organs like hair, feathers and mammary glands (Pispa and Thesleff, 2003). As such, teeth are serially homologous and the developmental mechanisms that produce different tooth types in an organized fashion have long been debated (Butler, 1939; Osborn, 1978; Weiss et al., 1998). The positioning of teeth, their intricate and species-specific morphologies, timing of development and regeneration imply stringent regulatory mechanisms of development and make teeth a relevant and interesting model for several scientific disciplines. Basic problems in developmental biology, including cell commitment, reciprocal tissue interactions, pattern formation, positional information and development of complex morphologies may be ap- proached using teeth and dentitions as a model system (Weiss et al., 1998; Thesleff and Nieminen, 2005). Teeth are useful for the research into evolutionary mechanisms because of the species-specific morphologies based on adaptations of the tooth forms to the changing habitat and lifestyle as well as because of resilience of teeth among the fossil record (Jernvall, 1995; Jernvall et al., 2000). The replacement of teeth and the existence of continuously growing teeth offer a model for tissue regeneration and stem cell research (Huysseune and Thesleff, 2004; Wang et al., 2007). Finally, the differentiation of the hard-tissue forming cells and the coupling of the differentiation into the morphogenesis may be studied to answer questions on regulation of cell differentiation (Wang et al., 2004b; Thesleff and Nieminen, 2005).

The strict genetic control of tooth development ensures that we all have a similar dentition with anterior and posterior teeth of distinct shapes and times of eruption. However, despite this similarity, all dentitions are unique and part of this individuality is created by variation and features caused by genetic factors. Dental anthropologists have paid attention to various morphological features with a hope that they could be used to clarify population history (Dahlberg, 1945; Irish and Guatelli-Steinberg, 2003). The size and shape variation includes all teeth but especially patterns of molar crowns (Dahlberg, 1945). The most salient features involve abnormalities in tooth number. Developmental failure of one or more teeth, tooth agenesis or hypodontia, is one of the most common anomalies in man, and depending on its severity and location may be of aesthetic or clinical significance (Arte, 2001). Recently, a connection between tooth agenesis and colorectal cancer was identified in a Finnish family, suggesting that developmental anomalies of teeth may sometimes be signs of cancer predisposition (Lammi et al., 2004).

As part of a research which aims to understand the molecular mechanisms and genetic networks regulating tooth development, a research project was started in 1992 to look for the genetic factors that are responsible for tooth agenesis. During this project, different types of familial tooth agenesis has been studied, and several gene defects and a new gene involved in tooth agenesis identified. The original aim was to identify gene defects that underlie the common type of tooth agenesis, incisor and premolar hypodontia. In this thesis, I present results from studies into rare forms of tooth agenesis, and summarize results from genome- wide searches in several families with common incisor and premolar hypodontia.

10 REVIEW OF THE LITERATURE

OVERVIEW OF TOOTH DEVELOPMENT

Principles of development

Individuals of all animal species develop from a single cell, a fertilized oocyte. The development includes a massive amount of cell divisions (proliferation), cell differentiation, migration and also cell death. The cells of an early embryo of higher animals are capable to adapt all cell fates, and they may be regarded as embryonic stem cells. During further development, the cells become parts of tissue layers and their options for regulative development become more and more limited. Their fates are regulated by their interactions, limiting their options and causing a stepwise commitment to more restricted cell fates (Gilbert, 2003). However, the cells may still retain a capacity to regulation: cells that will contribute to a certain organ may be able to develop into a normal organ even though part of them is removed. For example, if an early mouse tooth germ is split into two, both halves develop into teeth of normal size and morphology (Glasstone, 1963). The terminal differentiation is associated with a reduced capacity to proliferate. In many adult tissues, however, some cells have retained stem cell-like properties and a capacity to provide new differentiated cells (Fuchs et al., 2004).

In many animals, the unfertilized oocyte is polarized allowing the sperm entry only on certain regions (Gilbert, 2003). The site of the sperm entry further delineates the future development, e.g. the planes of the first cell divisions, and creates the basis for polarity in the growing embryo. Further guides for the prospective commitment of the cells is served by their position in the growing embryo and by their interactions with other cell and tissues. Commitment, morphogenesis and differentiation are regulated by inductive interactions between cells and groups of cells. The positional information may be conveyed from organizing tissues through gradients of inductive substances, often called morphogens, as well as of their antagonists (Hogan, 1999; Gilbert, 2003). Inherent for development and morphogenesis of many organs are self-organizing processes that are thought to act for example during formation of somites from the paraxial mesoderm as well as during positioning of ectodermal placodes and cusps of teeth (Weiss et al., 1998; Salazar-Ciudad and Jernvall, 2002; Giudi- celli and Lewis, 2004; Sick et al., 2006)

In instructive interactions, the inducer dictates the commitment of a responder while in permissive interactions the properties of the inducer are needed to allow the commitment of the responder (Gilbert, 2003). For an induction to happen, the responder must have previously acquired a competence to respond. In the key inductive interaction called primary embryonic induction the dorsal blastopore lip, the Spemann organizer, inducts the neural tube and the dorsal axis. Subsequent inductive evens leading to the development of individual organs have been called secondary inductions (Saxen and Thesleff, 1992; Gilbert, 2003). For many organs, inductive interactions between epithelium and mesenchyme are important, and development of teeth and hair are examples of reciprocal process of epithelial-mesenchymal interactions (Mina and Kollar, 1987; Thesleff and Nieminen, 2005).

11 Figure 1. Scheme of principles of signal transduction. (1) Binding of a ligand to a receptor may cause dimerization and phosphorylation of receptors (in the left) as in FGF, TGFE and EGF signaling. Alternatively (to the right), it may trigger changes in the conformation of the receptor proteins that cause changes in the protein-protein interactions inside the plasma membrane as in hedgehog and canonical WNT signaling. (2) Dimerization and phosphorylation of the receptors may start a cascade of phosphorylation of signal transducing proteins. (3) Receptor activation may lead to a release of an interaction that has inhibited an activity of a signal transducer protein. (4) The active signal transducers enter the nucleus and participate in the activation of transcription of target genes. (5) The target genes may code for antagonists, that act either inside or outside the cell and attenuate the signal. L, ligand, i,e, the signaling molecule; R, receptor; CoR, coreceptor necessary for ligand binding; SP, scaffolding protein; K, kinase that phosphorylates the signaling transducer and renders it susceptible to degradation; ST, signal transducer; TF, transcription factor; I, antagonist; P, phosphate moiety.

Each cell has the same genome, but they express different sets of genes in different levels. The morphology, behaviour and interactions with other cells as well as the commitment and competence are based on the gene products the cell synthesizes. Aberrations of the regulation of gene expression may lead to abnormal growth and cancer. The capacity to gene expression is largely executed through expression of transcription factors that are the proteins regulating the expression of genes. Interactions between cells may be mediated by the adhesion molecules in the cell surface and by the extracellular matrix that cells secrete (Gilbert, 2003; Thesleff et al., 1991). However, instructive interactions typically involve production of signaling molecules ("signals"), often peptides or proteins, which are then bound to a specific receptor on the surface of (or in some cases, inside) the “receiving” cells (Gilbert, 2003; Pires-daSilva and Sommer, 2003; Wang and Thesleff, 2005). The signals may act in

12 paracrine fashion between neighbouring or close-residing cells but they may also exert their effects on relatively long range and on a concentration dependent manner (Gilbert, 2003; Fan et al., 1995; Gritli-Linde et al., 2001). Most important signals are peptide growth factors that belong to the evolutionarily conserved Wnt, Heghehog and fibroblast growth factor (Fgf) families as well as to the transforming growth factor-E (TGFE) superfamily including e.g. TGFEs, bone morphogenetic proteins (BMPs), and activins (Logan and Nusse, 2004; Pires- daSilva and Sommer, 2003; Kitisin et al., 2007). Other important signals include the tumor necrosis factors (TNFs), epidermal growth factor (EGF) family, neurotrophins and Notch ligands. In addition to these signals mediated by peptide ligands, retinoid acid has been considered as a morphogenic signal (Gilbert, 2003).

Cells that are competent to receive the signals must express receptors for each signaling protein (ligand) family (Fig. 1). Binding of a ligand to its receptor or receptor complex leads to mediation of the signal into the cell which through protein interactions activates certain transcription factors thus regulating gene expression (Gilbert, 2003) (Pires-daSilva and Sommer, 2003). The response of a cell to a signal depends on its competence and may be cell division, apoptosis, change of commitment (cell fate), differentiation or production of a reciprocal signal, often of a different signal family, or an extracellular or intracellular antagonist of signaling. Different signals may act synergistically or antagonistically and they may be attenuated by signaling antagonists (Hogan, 1999; Wang and Thesleff, 2005). The signaling, the signal transduction, activation of specific transcription factors, and subsequent responses are conserved during the development of different organ systems and through evolution and can be regarded to constitute modules of genetic networks which are used in variable manners and in different combinations during different stages of organogenesis in different species (Gilbert, 2003; Pires-daSilva and Sommer, 2003).

Teeth and dentitions

Vertebrate teeth may be used as weapons in fighting and self-defence, but they also provide the vertebrates the first tool for feeding, making it possible to trap and swallow prey and, especially in the case of mammals, to render food more suitable for digestion in the gastro- intestinal tract (Brown, 1983; Kardong, 1995). The teeth consist of a crown (protruding to the mouth) and root (embedded or attached to the bone). The crown is composed of an external mineralized enamel (or enameloid) layer, the hardest mineralized tissue, and an inner mineralized dentin which surrounds the pulpal cavity filled by living cells capable of dentin regeneration and sensory function. In the roots of the mammalian teeth, the dentin and pulp are surrounded by a mineralized cementum and a periodontal ligament that attaches the teeth to the surrounding bone.

The whole dentition is composed of units of separate teeth of serial homology, i.e. having a common evolutionary origin, and has been regarded as an example of merism (Butler, 1995; Weiss et al., 1998). Teeth in various vertebrates may reside on the surfaces of mouth or phar- ynx, but during the evolution they became restricted to a horseshoe-shaped dental arch lining the oral cavity (Osborn, 1973; Brown, 1983). The fish and reptile teeth may be replaced several, even hundreds of times during the lifespan of the animal (polyphyodont), but mammals

13 may replace some of them only once (diphyodont dentition). The teeth in different parts of the mouth may have specialized forms in lower vertebrates, but the specialization to true heterodonty with distinct tooth classes, as seen in modern mammalian species, started only during the reptilian evolution (Brown, 1983). The heterodonty of mammals íncludes mor- phologically and developmentally distinct tooth classes or types: the anterior incisors, canines and usually multicusped postcanine teeth, premolars and molars (Butler, 1978). In the ancestral mammalian dentition, three primary incisors, one primary canine and four primary postcanine teeth (premolars) developed in each jaw quadrant (Fig. 2). These could be replaced (in this case also called deciduous) with successional (secondary) teeth developing from the dental lamina lingual to the predecessor (Butler, 1978; Brown, 1983; Luckett, 1993). In addition, three or more molars may develop posterior to these teeth and have no deciduous predecessors. Together with the unreplaced and secondary teeth they constitute the permanent dentition. Luckett (1993) and Butler (1978) considered the molars (e.g. human permanent molars) as primary teeth. Teeth may be regarded as primary or secondary according to whether they develop from the surface epithelium or the dental lamina (Luckett, 1993). Most mammalian species, though, have reduced dentitions as they have lost some or several of the ancestral teeth. Thus, mouse and other muroid rodents develop in each quadrant only one incisor and three molars, which are not replaced, the molars presumably being homologous to the posterior-most postcanine teeth (molars) of other species (Cohn, 1957) (Fig. 2). In human dentition, two primary incisors, a primary canine and two primary postcanine teeth (called primary or deciduous molars) are replaced with two permanent incisors, a permanent canine and two permanent premolars, and in addition three permanent molars develop without deciduous predecessors (Ten Cate, 1994). Thus, during evolution, Homo sapiens has lost one of the incisors and two anteriormost premolars.

Development of teeth

The mammalian teeth develop from the oral epithelium and the underlying mesenchyme. Their development resembles that of the other ectodermal organs such as hair or the sweat and mammary glands (Pispa and Thesleff, 2003). Tooth development has been studied ex- perimentally in many vertebrate species such as dogs and amphibians (reviewed by Lewin, 1997; reviewed by Lumsden, 1988) but most of the recent knowledge relevant for understanding of the development of human dentition has been obtained from studies in rodents, especially in the mouse.

Tooth development has been divided to distinct phases of initiation, morphogenesis, differentiation and eruption. During each phase, different stages can be distinguished (Fig. 3).

The enamel-producing ameloblasts and Hertwig’s epithelial root sheath originate in the epithelium. The mesenchyme contributes to the dentin-forming odontoblasts, dental pulp, cementum and surrounding alveolar bone and originates in the cranial neural crest (for this reason also called ectomesenchyme) (Lumsden, 1988). These cells migrate from the midbrain and the hindbrain and populate the branchial arches and facial region before the tooth development commences, in the mouse during embryonic days (E) 8-10 (Nichols, 1986; Imai et al., 1996; Chai et al., 2000)

14 Figure 2. Comparison of dentitions. One quadrant from the upper jaw is shown. Uppermost, ancestral mammalian dentition. Middle, human dentition. Bottom, mouse dentition. Most common designations of teeth are shown below the teeth. For human teeth, numbers according to the FDI numbering system are shown inside the tooth crowns. Combinations of codes for different quad- rants and numbers shown in figure are commonly used, e.g. 15 denotes maxillary tooth 5 on the right, the second premolar (11 to 18, upper right; 21 to 28, upper left; 31 to 38, lower left; 41 to 48, lower right; 51 to 55, 61 to 65, 71 to 75, 81 to 85 primary teeth in the same order). In mouse, the incisor is continuously growing and there is a toothless diastema between the incisor and the first molar. Assumed evolutionary homologies are delineated by dotted lines. Please note, that human premolars and their predecessors (deciduous molars) correspond to premolars 3 and 4 of the ancestral mammalian dental formula. In human dentition the first postcanine tooth to initiate development (“key” or “stem” tooth) is the first deciduous molar dM1, corresponding to dP3 of the ancestral formula). dP1 of the ancestral formula is colored grey to indicate that a primary tooth in this position may not be replaced. For incisors, it is assumed that mouse incisor corre- sponds to the I2 of the ancestral formula. For references, see Butler (1978) and Luckett (1993).

15 The dental arches are formed along with the development of the oral cavity from the medial nasal processes and maxillary and mandibular processes of the first branchial arch. In hu- §mans, the medial nasal and maxillary processes fuse on the sixth to seventh weeks of development (Sadler, 1990) but the first signs of the future tooth positions, the thickening of the epithelium to form the dental lamina may be seen even before that (Tonge, 1969). In mouse, the dental lamina can be observed as a thickened epithelium on E12, but the specific gene expression can be identified even earlier (Mina and Kollar, 1987; Cohn, 1957; Mina and Kollar, 1987; Mucchielli et al., 1997).

Analogous to the development of the other ectodermal organs, the development of individual teeth is initiated when the epithelial placodes form in the dental lamina (Pispa and Thesleff, 2003; Mikkola and Millar, 2006). In mouse, the first placodes appear in the molar and incisor regions on E11.5-12. In humans, the placodes for the primary teeth have been observed on the seventh week of gestation (Tonge, 1969).

The placode formation is accompanied with the commencement of the condensation of the underlying mesenchymal cells (Cohn, 1957). Subsequently the epithelium grows into the mesenchyme forming an epithelial bud consisting of outermost basal epithelial layer and inner stellate reticulum and surrounded by condensating mesenchyme (“bud stage”). In the tip of the bud the so-called enamel knot of non-dividing cells forms while the epithelium around it continues the growth forming the so-called cervical loops (“cap stage”) (Jernvall et al., 1994). In the mouse molars (and presumably in all multicusped teeth) additional, secondary enamel knots develop in the epithelium to mark the sites of additional cusps (“bell stage”) (Jernvall et al., 2000). The condensed mesenchyme delimited by the cervical loops forms the dental papilla whereas the outermost mesenchyme surrounding the papilla and the cervical loops forms the dental follicle. The basal epithelium becomes divided into the inner (facing the papilla) and the outer enamel epithelium (facing the dental follicle) while the stratum in- termedium forms between the inner enamel epithelium and the loose epithelium of the stellate reticulum.

16 Figure 3. Summary of tooth development and most essential known molecular regulation. Signals emanating from the epithelium are shown above and signals from the mesenchyme below the scheme. Stages when development is arrested in mouse null mutants are indicated (adapted from Thesleff, 2006).

Coupled to the process of morphogenesis, the differentiation of the hard tissue forming cells starts at the tips of future cusps and extends to the cervical direction (Cohn, 1957; Ten Cate, 1994). The mesenchymal cells facing the basement membrane elongate, polarize and termi- nally differentiate into odontoblasts starting to produce predentin matrix. The basement membrane is digested and the epithelial cells differentiate into ameloblasts that also elongate, polarize and start secreting enamel matrix. While the predentin layer thickens the odontoblasts withdraw, leaving behing processes called dentinal tubules, and trigger mineralization of the predentin to form dentin. In the maturation of the enamel, the organic matrix is processed by digestion and simultaneous mineralization. The differentiation of the hard tissue producing cells marks also the fixation of the final form of the tooth crown, except for the contribution by the increasing thickness of the enamel layer.

The morphogenesis of teeth is accompanied by alveolar osteogenesis in the surrounding mesenchyme and the dental follicle and followed by innervation and vascularization of the dental pulp (Cohn, 1957; Gaunt, 1964; Ten Cate, 1994; Luukko, 1997). Because of the formation of the alveolar bone, teeth become enclosed in bony crypts delineated by the dental follicle cells. Therefore, the eruption of teeth requires resorption of the alveolar bone.

In teeth that develop roots, as all human teeth and mouse molars, the differentiation to the ameloblasts ceases when the differentiation front reaches the future cemento-enamel junction. The epithelium now forms a bilayer structure called Hertwig’s epithelial rooth sheath (HERS) which continues its growth into the underlying mesenchyme (Ten Cate, 1994; Thesleff and Nieminen, 2005). The epithelial bilayer that is left behind becomes fragmented and forms the so-called epithelial cell rests of Malassez (ERS). Along with the growth of HERS, the differentiation of the dental papilla mesenchymal cells continues, leading to the deposition and mineralization of the root dentin. Cells from the dental follicle differentiate into cementoblasts that deposit cementum on the surface of the root dentin. Dental follicle cells also form the fibrous periodontal ligament that connects the root to the bone and con-

17 tribute to the alveolar bone itself. In the multicusped teeth, the developing root may get bi- furcated leading to the development of several separate root apices.

In different animal species, various modifications of the general process outlined above may exist. In mouse and other rodents, the incisors grow continuously and only cells on the labial aspect differentiate into ameloblasts (Tummers and Thesleff, 2003). For the continuous growth of these teeth, new ameloblasts must differentiate continuously in the labial cervical loop during the whole life span of the animal, i.e. the epithelium of the cervical loop is never switched from the ameloblast forming fate to the root fate. In other rodents, such as sibling voles and rabbits, also the molars may grow continuously (Tummers and Thesleff, 2003).

In humans and many other mammals, the secondary teeth develop from the lingual exten- sions of the dental lamina that are connected to the enamel organ of the primary tooth (Luckett, 1993; Ten Cate, 1994). According to Luckett (1993), the development of the secondary tooth usually becomes detectable after the primary predecessor has reached the bell stage or after the onset of the terminal differentiation of odontoblasts and ameloblasts in the primary tooth. A similar kind of relationship may be present between the developing molars.

Initiation of teeth of different tooth classes (i.e. incisors, canines and premolars/molars) tend to follow a certain timetable and order in different species. Thus, thickenings for the central- most incisor, the canine and a premolar appear first in different parts of the dental lamina. In the incisor region the central-most incisors are initiated first, although the initiation of the other incisors may happen almost simultaneously (Luckett, 1993). For the postcanine teeth, the first teeth to be initiated are either the teeth corresponding to the third or fourth postcanine teeth of the ancestral formula, and this is followed by initiation of the more anterior and posterior teeth (Butler, 1978; Luckett, 1993). In humans and other primates, the first postcanine tooth to be initiated is the anterior-most deciduous molar (corresponding to dP3 of the ancestral formula). The first permanent molars are initiated early, presumably before the successional permanent teeth, while the more posterior molars develop postnatally from a distal extension of the dental lamina (Ten Cate, 1994). The morphogenesis and the mineralization of the secondary teeth is slow and it takes years before the tooth erupts into the oral cavity. The mineralization of all human deciduous teeth starts early during prenatal development, while mineralization of first permanent molars starts perinatally and that of other permanent teeth except third molars usually before three years of age (Pirinen and Thesleff, 1995). The deciduous teeth erupt during the first postnatal years and the permanent first molars in an age of six to seven years. There is individual variation in the ages of shedding of the deciduous teeth and eruption of the secondary teeth but usually this happens between six and twelve years of age, beginning from the incisors. Second permanent molars usually erupt after 11 years of age. Mineralization of the third molars usually starts before age of 10 but both the mineralization and eruption varies remarkably between individuals.

18 Commitment, morphogenesis and inductive interactions

For understanding the regulatory mechanisms of tooth development, it is relevant to compare it to the development of other ectodermal organs, and to understand the teeth as units with serial homology (Pispa and Thesleff, 2003; Butler, 1978; Weiss et al., 1998). Tooth development shares many similarities with that of other ectodermal organs, including initiation from an epithelial placode, and, analogous to a mammary line, a preceding epithelial thickening, reciprocal interactions of the epithelial and mesenchymal component, activation/inhibition mechanisms to create the separate meristic units, and, analogous to hair cycling, renewal (reviewed by Mikkola and Millar, 2006). As distinctive features, teeth develop complex and genetically stable morphologies, and contain cells that are able to produce specialized mineralized hard tissues.

After comparative anatomical examination of dentitions and morphology of teeth in different species, Butler (1939) proposed the so-called field model. According to Butler’s model, development of mammalian dentitions in each jaw quadrant is dictated by the existence of morphogenetic fields for each tooth class, incisors, canines and molars/premolars which co- incide with a series of tooth forming locations (Butler, 1978). Different mammalian dental formulas and different morphologies could be explained by alterations of strengths and relative placement of the morphogenetic field and the tooth forming locations. The concept explains why morphological features usually exhibit a gradient inside a tooth class and why a morphological alteration usually affects several teeth although to a different extent. The concept also predicts that no separate genes are needed for each tooth but that the different tooth types and morphologies are created by differential regulation of one set of genes (Butler, 1978; see also Miles and Grigson, 1990).

As an experimental support for the existence of a dental morphogenetic field, Glasstone (1963; 1967) showed that teeth developed in tissue culture of parts of mouse mandibles from an E11 embryo, i.e. when the culture was started before tooth initiation. The experiments also showed that the identities and locations of the incisors and molars were already at that time determined (Glasstone, 1963; Glasstone, 1967; Miller, 1969). Glasstone (1963) also showed that individual cap stage tooth germs from various species developed teeth with normal morphology in culture, as did even teeth cut in two halves. Thus, tooth development from at least from cap stage onwards was shown to be independent of the surrounding tissue and teeth showed capacity to regulation, which are the key features of the morphogenetic field concept (see Gilbert, 2003). The commitment of dental cells for tooth development has also been shown by development of tooth-like structures after reaggregation of dissociated cells from tooth germs (e.g. Slavkin et al., 1968; Duailibi et al., 2004).

Knowledge from the development of other ectodermal appendages (reviewed by Hardy, 1992; Pispa and Thesleff, 2003; Gilbert, 2003), as well as from tissue implantation studies in amphibians (reviewed by Lumsden, 1988; MacKenzie et al., 1992), suggested that neural crest-derived mesenchyme contained the instructive potential for tooth development. In support for the instructive role of the dental mesenchyme in tooth development, cultures of recombined tissues showed that mouse E13 or older mandibular mesenchyme recombined with limb bud epithelium was able to instruct tooth development and that incisor or molar mesen-

19 chyme recombined with enamel organs instructed the development of a tooth type according to their source (Kollar and Baird, 1969; Kollar and Baird, 1970).

Lumsden (1979) cultured mouse first molar germs in the anterior chamber of the mouse eye and showed that E12 or older germs were able to give rise also to the second and third molars. He concluded that the results supported an intrinsic control of development and therefore a morphogenetic gradient field was not necessary. Accordingly, Osborn (1978) presented a new model explaining the development of different dentitions, which, according to him, could better explain the diverse morphological aspects in different species (see criticism by Butler, 1978; see also Miles and Grigson, 1990). The “clone model” suggested the presence of specific determined cells, presumably in the mesenchyme of the neural crest origin, that contained the information for the development of the different tooth classes. These cells were able to form and instruct the development of teeth by clonal expansion regulated by inherent inhibition mechanisms. The limited capacity of these cells to expand would be responsible for limiting the extent of tooth rows, and the gradual diminishing of the capacity would be reflected as progressively simplified morphology of the later developing teeth.

The role of the mesenchyme as the instructive tissue was challenged by Miller (1969) who showed that the E11 to E12 mouse incisor or molar dental epithelium was able to instruct the tooth type in the recombination tissue culture on the chick chorioallantoic membrane. Mina and Kollar (1987) recombined the first and second branchial arch epithelia and mesenchyme from mouse embryos and cultured them in the anterior eye chamber. They showed that the first arch epithelium instructed the tooth development with the second branchial arch ectomesenchyme until E11.5, but not thereafter, whereas the first arch mesenchyme instructed tooth development with the second arch epithelium in E12,5 or older embryos. Thus, the instructive potential was present in the oral epithelium until first signs of tooth development, but shifted to the dental mesenchyme at the time when the dental placodes are formed. Con- temporarily, Lumsden (1988) showed that the cultured mouse E9 or E10 mandibular epithelia together with cranial neural crest cells allowed tooth development, confirming the inducing role of the early epithelium and the odontogenic capacity of mouse neural crest cells. Furthermore, his results showed that the odontogenic capacity was largely limited to the cranial neural crest, and that any instructive interactions during the neural crest cell migration were not necessary. The capacity of the early epithelium to instruct tooth type specification has also been shown (Kollar and Mina, 1991). More recently, the instructive role of early mandibular epithelium has also been shown in cell reconstitution experiments with bone marrow cells (Ohazama et al., 2004; Li et al., 2007). The instructive potential of the mouse dental tissues have also been shown by recombination experiments with chick tissues in which variable stages of morphogenesis and differentiation have been observed (Mitsiadis et al., 2003 and references therein).

Tissue interactions are crucial also during later stages for differentiation of hard tissue forming cells and for the development of the alveolar bone (reviewed by Thesleff and Nieminen, 2005). Recently, stem cell properties have been described for ameloblast, odontoblast and periodontal ligament forming cells (Harada et al., 1999; Gronthos et al., 2002; Sonoyama et al., 2006; Wang et al., 2007).

20 Table 1. Mouse mutants and human diseases with tooth agenesis or supernumerary tooth formation mouse human gene in- trait, syndrome mol. cellular/developmental gt tooth phenotype tooth phenotype references her. (OMIM no) pat. consequence

partial agenesis, arrest failure of mes. signaling to Act E A -/- Matzuk et al., 1995 at bud stage epithelium mand. incisor failure of mes. signaling to ActRIIA -/- Matzuk et al., 1995 agenesis in 22 % epithelium ActRIIA; +/-; molar and mand. inc failure of mes. signaling to Ferguson et al., 2000 ActRIIB -/- agenesis in 29 % epithelium adenomatous polyposis no func- supernum. teeth, deregulation of Wnt signal Ida et al., 1981; Wolf APC ad coli, Gardner syndrome tion?*) odontomas transduction et al., 1986 severe agenesis, haplo- deregulation of Wnt signal AXIN2 ad severe agenesis Lammi et al., 2004 colorectal cancer insuff. transduction -/- arrest at early bud impaired BMP signaling in Bmpr1a Andl et al., 2004 epit. stage epit., EK failure? Oculofaciocardiodental no func- male lethal, agenesis, abnormal transcriptional BCOR Xd Ng et al., 2004 syndrome (300166) tion**) fused teeth in females regulation? Lenz micropthalmia abnormal transcriptional BCOR Xr hypodontia (incisors) Ng et al., 2004 (309800) regulation? Osteogenesis im- haplo- abnormal extracellular COL1A1/2 ad hypodontia Lukinmaa et al., 1987 perfecta, type I (166200) insuff. matrix o.e. arrest before or at decreased Wnt signaling in Dkk1 Andl et al., 2002 epit. placode stage early epit., placode failure? -/-; arrest before or at failure of mes. competence Dlx1;Dlx2 Thomas et al., 1997 -/- placode stage or signaling Diastrophic dysplasia no func- hypodontia in 31 %, impaired proteoglycan DTDST ar Karlstedt et al., 1996 (222600) tion hypoplasia synthesis supernum. mesial deregulated BMP and Wnt Ectodin -/- molar, increased cusp Kassai et al., 2005 signaling distance Ruiz-Perez et al., agenesis or fusion of Ellis-Van Creveld no func- agenesis (inc), conical EVC -/- ar abnormal Shh/Ihh signaling 2000; Ruiz-Perez et max. inc, hypoplasia syndrome (225500) tion teeth, AI, taurodontism al., 2007 mouse human gene in- trait, syndrome mol. cellular/developmental gt tooth phenotype tooth phenotype references her. (OMIM no) pat. consequence

Ellis-Van Creveld no func- agenesis (inc), conical EVC2 ar Ruiz-Perez et al., 2003 syndrome (225500) tion teeth, AI, taurodontism partial agenesis, Anhidrotic ectodermal no func- severe agenesis, reduced epithelial and EK Kere et al., 1996; Eda/EDA Y/- reduced size and Xr dysplasia, X-linked tion**) cone/peg shape signaling Srivastava et al., 1997 morphology (305100) hypo- severe agenesis, reduced epithelial and EK Tao et al., 2006; EDA Xr severe agenesis morphs general or inc only signaling Tarpey et al., 2007 ? supernum. mesial Mustonen et al., 2003; o.e. overactivation of Eda Eda mand. molar, impaired Mustonen et al., 2004; epit. signaling in epithelium amelob. differentiation Kangas et al., 204

-/- partial agenesis, dn or Headon and Overbeek, Edar/ ad, Anhidrotic ectodermal severe agenesis, reduced epithelial and EK or reduced size and no 1999; Monreal et al., EDAR ar dysplasia (129490) cone/peg shape signaling +/dn morphology function 1999 partial agenesis, Edaradd/ Anhidrotic ectodermal no severe agenesis, reduced epithelial and EK -/- reduced size and ar Headon et al., 2001 EDARADD dysplasia (224900) function cone/peg shape signaling morphology -/- molar agenesis, failure of epit. signaling to Fgf8 Trumpp et al., 1999 epit. vestigial incisors mesenchyme Kallmann syndrome, haplo- agenesis of max. decreased FGF signal FGFR1 ad Dode et al., 2003 autosomal (147950) insuff. lateral incisors transduction supernum., hypodontia Celli et al., 1998; de Fgfr2IIIb -/-, Apert syndrome gain of failure of epithelial and EK arrest at bud stage ad in 41 %, crowding, Moerlooze et al., 2000; /FGFR2 dn (101200) function FGF signal transduction delayed eruption Letra et al., 2007 reduced mand. failure of regulation of TGFE Matzuk et al., 1995; Fst -/- incisors, shallow signaling Wang et al., 2004a cusps in molars mouse human gene in- trait, syndrome mol. cellular/developmental gt tooth phenotype tooth phenotype references her. (OMIM no) pat. consequence

agenesis of 3rd molars, aberrant cusp o.e. decreased TGFE signaling Fst pattern, failure of Wang et al., 2004a epit. in epithelium ameloblast differentiation Oculodentodigital dom. GJA1 ad small teeth, AI? abnormal gap junctions Paznekas et al., 2003 syndrome (164200) neg. Gas1 -/- fused max. incisors abnormal Shh signaling Seppälä et al, 2007 failure of Shh signal Gli2 -/- fused max. incisors Hardcastle et al., 1998 transduction failure of Shh signal arrest before or at Gli2;Gli3 -/-;-/- transduction and mes. Hardcastle et al., 1998 placode stage competence or signaling severely flattened dom. reduced epithelial and EK I N B D dn cusps, 3rd molar ad EDA-ID (300291) agenesis, conical teeth Courtois et al., 2003 neg. signaling agenesis flattened cusps, reduced epithelial and EK Ikk D -/- incisor epit. Ohazama et al., 2004 signaling evaginates male lethal, females male lethal, agenesis, Makris et al., 2000; Y/-, Incontinentia pigmenti no func- reduced epithelial and EK Ikk J / IKK J as IP with Xd conical teeth in Rudolph et al., 2000; +/- (308300) tion**) signaling immunodeficiency females Smahi et al., 2000 male lethal, agenesis, OL-EDA-ID (300291, hypo- reduced epithelial and EK Zonana et al.,2000; Du- Ikk J / IKK J Xr conical teeth in 300301) morph signaling puis-Girod et al.,2002 females Van der Woude haplo- agenesis in 20 % (2nd epithelial competence and IRF6 ad Kondo et al., 2002 syndrome (119300) insuff. premolars) signaling? van Genderen et al., arrest at late bud failure of enamel knot Lef1 -/- 1994; Kratochwil et al., stage signaling (FGF4) 2002 failure of mes. signaling Msx1/ haplo- severe agenesis (2nd Satokata, Maas 1994; -/- arrest at bud stage ad severe agenesis (BMP4, FGF3; EK failure) or MSX1 insuff. premolars, 3rd molars) Vastardis et al., 1996 condensation mouse human gene in- trait, syndrome mol. cellular/developmental gt tooth phenotype tooth phenotype references her. (OMIM no) pat. consequence

Msx1; arrest before or at failure of mes. signaling -/-;-/- Satokata, Maas 2000 Msx2 placode stage (BMP, FGF?) male lethal, agenesis Ferrante et al.,2001; Oro-facial-digital syn- no func- cilia formation? patterning OFD1 Xd (inc, can), hypoplasia Thauvin-Robinet et drome type 1 (311200) tion**) of neural tube? in females al.,2006 Mills et al., 1999; Yang EEC (604292), Hay- et al., 1999; Celli et arrest before placode Wells (AEC, 106220), failure of epithelial p63/ P63 -/- ad diverse agenesis, conical teeth al., 1999; van stage LMS (603543), ADULT differentiation and signaling Bokhoven, McKeon, (103285) syndromes 2002 supernum. max. abnormal ectodermal Pax6 -/- Kauffman et al., 1995 incisors specification? failure of mes. signaling, Pax9/ haplo- severe agenesis Peters et al., 1998; -/- arrest at bud stage ad Severe tooth agenesis competence, condensation, PAX9 insuff. (especially molars) Stockton et al., 2000 EK failure agenesis of max. inc, Semina et al.,1996; Pitx2/ arrest before or at Rieger syndrome haplo- failure of epithelial -/- ad sometimes mand. inc Lin et al.,1999; Lu et PITX2 placode stage (180500) insuff. competence or signaling and premolars al.,1999 supernum. mesial Polaris hm abnormal Shh signaling Zhang et al., 2003 molar no func- severe agenesis, Suzuki et al., 2000; PVRL1 ar CLPED1 (225060) impaired cell adhesion tion hypoplasia Sözen et al., 2001 Jensen, Kreiborg, failure of mes. competence Runx2/ arrest at late bud Cleidocranial dysplasia haplo- 1990; Mundlos et al., -/- ad supernumerary teeth or signaling (FGF3), EK RUNX2 stage (119600) insuff. 1997; Åberg et al., failure 2004 Dassule, McMahon -/- hypoplastic, retarded Holoprosencephaly hypo- impaired signaling and Shh/ SHH ad fused central incisors 2000; Nanni et al., epit. and fused teeth (142945) morph growth; midline defect 1999 incisor, mand. molar failure of signal transduction Smad2 +/- Ferguson et al., 2001 agenesis in 27 % (activin) mouse human gene in- trait, syndrome mol. cellular/developmental gt tooth phenotype tooth phenotype references her. (OMIM no) pat. consequence

molars fused and failure of Shh signal -/- Smo reduced, abnormal transduction, cell Gritli-Linde et al., 2002 epit. ameloblasts proliferation/differentiation supernum. mand. overactivation of FGF signal Sprouty2 -/- Klein et al., 2006 mesial molar transduction supernum. mand. overactivation of FGF signal Sprouty4 -/- Klein et al., 2006 mesial molar transduction Ulnar-mammary haplo- agenesis, hypoplasia TBX3 ad failure of epithelial signaling Bamshad et al., 1997 syndrome (181450) insuff. (canines) Char syndrome dom. agenesis of premolars decreased transcriptional TFAP2B ad Satoda et al., 2000 (169100) neg. and permanent molars activation, nc specification? failure of eruption, reduced epithelial and EK Naito et al., 2002; Traf6 -/- shortened incisors, signaling Ohazama et al., 2004 molar cusps reduced Treacher-Collins haplo- agenesis in 33 %, da Silva Dalben et al., Treacle ad failure of nuclear trafficking? syndrome (154500) insuff. hypoplasia, AI 2006 Odonto-onycho-dermal no func- severe agenesis, failure of placode and WNT10A ar Adaimy et al., 2007 dysplasia (257980) tion cone/peg shape enamel knot signaling?

Abbreviations: ad, autosomal dominant; ar, autosomal recessive; can, canine; dn or dom. neg. (or repressor form), dominant negative; EK, enamel knot; epit., epithelium; haploinsuff., haploinsufficiency; hm, hypomorph; inc, incisor; inher., inheritance; manb., mandibular; mes. mesenchyme; max. maxillary; mol. pat., molecular pathogenesis; o.e., overexpression; supernum., supernumerary; Xd, X-linked dominant; Xr, X-linked recessive *) no function: both alleles nonfunctional; in case of APC, this has been shown for colorectal neoplasms **) complete loss of function in males, and in females, inactivation in ~50 % of cells (or skewed) Molecular regulation of tooth development

During the last two decades after the advent of molecular biology and genetics, the new technologies have been extensively used to elucidate developmental mechanisms and the genetic regulation of tooth development. The most usual model has been the mandibular molar teeth of the mouse, the most practical laboratory animal that develops teeth. Immunohistology and in situ hybridization have been used to study gene expression during mouse tooth development and differentiation. Natural and transgenic mutant mice have been utilized to reveal gene function. Tissue culture of whole tooth or jaw explants as well as culture of recombined tissues has been used to study effects of proteins and mutations. This knowledge is applica- ble to humans and other mammals because of the conservation of the basic genetic and developmental mechanisms. However, the molecular genetic studies in humans, including the positional cloning of several genes that cause different developmental dental anomalies, have significantly contributed to understanding of the genetic regulation of development and patterning of the human dentition (Table 1).

Reciprocal signaling and signaling centers

Molecular studies have revealed that the instructive and permissive tissue interactions during mouse tooth development described above are mainly mediated by growth factor signaling (reviewed by Thesleff and Mikkola, 2002; Wang and Thesleff, 2005). Development from initiation to eruption is governed by a sequential and reciprocal signaling process rather than simple one-way messages (Fig. 3). The signaling involves all major signaling pathways, including TGFE, FGF, Shh and Wnt as well as Eda, Notch, and EGF signaling, and studies with mouse mutants have shown that they are needed simultaneously during critical stages of development (Table 1). Expression of signals is often redundant: several FGFs are expressed in the initiation stage epithelium (Fgf8, -9), in the enamel knot (Fgf3, -4, -9, -20) and in the dental mesenchyme (Fgf3, -10) and they signal to receptors expressed differentially by mesenchymal and epithelial cells (Kettunen et al., 1998; Kettunen et al., 2000; reviewed by Wang and Thesleff, 2005). Similar co-expressions are evident for BMP and Wnt signals (Åberg et al., 1997; Sarkar and Sharpe, 1999).

The signaling pathways act in an hierarchical, interactive and iterative manner. One pathway often elicits a reciprocal signal of another pathway or different pathways antagonize each other to limit the extent of the cellular response. For example, Wnt signaling is needed for the expression of Fgf4 in the enamel knots as well as Eda in the early epithelium, which subsequently works upstream of Shh and BMP antagonists (Kratochwil et al., 2002; Pummila et al., 2007). Antagonism of FGF and BMP signaling is thought to act to delineate the positions of tooth initiation, to specify tooth identity and to regulate cusp morphogenesis (Neubuser et al., 1997; Tucker et al., 1998; Peters and Balling, 1999; Salazar-Ciudad and Jernvall, 2002). Induction of specific inhibitors have been shown to be important for the fine-tuning of the signaling effects and proper morphogenesis and possibly to tooth renewal (Wang et al., 2004a; Wang et al., 2004b; Kassai et al., 2005; Lammi et al., 2004). BMP4 acts as an iterative signal early in the determination of the tooth positions, has a critical role during morpho-

26 genesis, and finally as an inducer of the differentiation of both odontoblasts and ameloblasts (Neubuser et al., 1997; Vainio et al., 1993; Jernvall et al., 1998; Wang et al., 2004b; reviewed by Wang and Thesleff, 2005).

During development, some parts of an organ rudiment may organize patterning and morphogenesis by active signaling (Hogan, 1999; Gilbert, 2003). Well-characterized examples of such “organizers” or “signaling centers” from vertebrates are the dorsal blastopore lip, the notochord, the zone of polarizing activity in the limb buds, and the isthmus between the developing midbrain and hindbrain. In ectodermal organs, the epithelial placodes that initiate hair, tooth and gland development are thought to signal to the underlying mesenchyme and instruct condensation and gene expression as well as to the surrounding epithelium to pattern the positioning of neighbouring placodes (reviewed by Pispa and Thesleff, 2003; Mikkola and Millar, 2006). In teeth, the enamel knots that form in the late bud stage epithelium signal to the surrounding epithelium to activate proliferation and to the mesenchyme to induce reciprocal signals and inhibitors (reviewed by Thesleff et al., 2001; Wang and Thesleff, 2005). Through this activity, enamel knots mark and stimulate the formation of tooth cusps and pattern tooth crown morphogenesis presumably by regulating formation of additional (secondary) enamel knots (Jernvall et al., 2000; Salazar-Ciudad and Jernvall, 2002).

Transcription factors

Transcription factors are intracellular proteins that bind to DNA and regulate expression of the target genes. They typically contain one or more protein motifs that are able to bind to specific sequence motifs in DNA or to interact with other proteins that are necessary for the activation of transcription. Especially the DNA-binding motifs are conserved and used to classify different factors.

Hox proteins contain a DNA-binding homeobox. The nested expression of the genes of the Hox clusters define the anterio-posterior identities in the trunk and neural tube as well as the proximo-distal and anterio-posterior axes in the limbs (Gilbert, 2003). The homeobox is present also in many transcription factors coded by genes outside the Hox clusters. These genes have important roles in the development for example in the craniofacial region where the genes of the Hox clusters are not expressed (reviewed by Jernvall and Thesleff, 2000; De- pew et al., 2005). Other DNA-binding motifs of the transcription factors taking part in cell regulation during development include e.g. helix-loop-helix, leucine zipper, paired, fork- head, T-box, LIM and runt motifs (reviewed by Dahl et al., 1997; Packham and Brook, 2003; Friedman and Kaestner, 2006; Gilbert, 2003).

Adding or removing expression of a single transcription factor may change a cell's commitment or capacity for differentiation. Manipulations of expression of the Hox genes may lead to changes in the identity of body parts, the so-called homeotic changes. Nested expression of the Dlx homeobox genes specifies the identities of cell populations in the developing jaws (Depew et al., 2002). Inactivation of the Runx2 gene blocks all bone differentiation (Otto et al., 1997). As described below, expression of specific transcription factors during different stages of tooth development is necessary for the competence, commitment and signaling. It

27 is apparent that expression of specific transcription factor genes are needed for the dental specification of the early epithelium and for the regulation of the instructing signaling activity. On the other hand, expression of several transcription factors in the mesenchyme, regulated by signals from the epithelium, are needed for the activation of the odontogenic networks in the mesenchyme. Furthermore, a central role for specific transcription factors has been shown in mediation of the reciprocal signaling networks critical for the tooth morphogenesis and cellular differentiation (reviewed by Peters and Balling, 1999; Jernvall and Thesleff, 2000; Tucker and Sharpe, 2004).

MSX1 and PAX9

MSX1 and PAX9 are transcription factors intimately involved in the genetic networks regulating tooth development. MSX1 contains a homeobox which binds to specific target sequences in the DNA but is also capable to protein-protein interactions. MSX1 has often been considered rather as a repressor than activator of gene expression (Catron et al., 1995; reviewed by Bendall and Abate-Shen, 2000). The mouse Msx1 gene codes also for an antisense transcript which may have a role in the regulation of Msx1 expression (Blin-Wakkach et al., 2001). Mouse Msx1 is expressed during the development and migration of the neural crest as well as during craniofacial and limb development (Tribulo et al., 2003; Monsoro- Burq et al., 2005; reviewed by Bendall and Abate-Shen, 2000). Msx1 is induced by epithelial signals in the dental mesenchyme (Vainio et al., 1993; Kettunen et al., 1998; Tucker et al., 1998; Kettunen et al., 2005), where it is necessary for the expression of the reciprocal signals, especially Bmp4 and Fgf3, as well as for expression of the Shh receptor Patched and the transcription factors Lef1 and Runx2 (Chen et al., 1996; Zhang et al., 1999; Åberg et al., 2004). MSX1 is able to activate transcription from the Bmp4 promoter in vitro (Ogawa et al., 2006). Msx1 null mutant mice exhibit a cleft palate and other craniofacial anomalies as well as a lack of teeth, the development of which is arrested at the bud stage (Satokata and Maas, 1994). In these mice the condensation of the ectomesenchymal cells is impaired. In double null mutants of Msx1 and its homolog Msx2 tooth development usually does not reach the placode stage suggesting that earlier than the bud stage Msx1 function may be redundant with Msx2 (Satokata et al., 2000).

PAX9 belongs to the paired-box containing transcription factor family, and is one of the earliest mesenchymal markers of the future tooth forming positions in mouse (Neubuser et al., 1997). Pax9 is regulated by epithelial signals, especially FGF8, and it apparently regulates reciprocal signaling from the mesenchyme (Neubuser et al., 1997; Peters and Balling, 1999). In the Pax9 null mutant mice, expression of mesenchymal Bmp4 is impaired at the bud stage and that of Msx1 and Lef1 slightly later (Peters et al., 1998). It has been shown that PAX9 is capable to bind the MSX1 protein and synergistically with MSX1 activate Msx1 and Bmp4 transcription in vitro (Ogawa et al., 2006). In mouse null mutants of Pax9, tooth development is arrested at the bud stage, the condensation of the ectomesenchymal cells is reduced, and, in addition to tooth agenesis and cleft palate, several derivatives of the pharyngeal pouches fail to develop and limb abnormalities are observed (Peters et al., 1998). In mice with hypomorphic Pax9 mutations, a partial failure of tooth development was observed, af-

28 fecting in a dose-dependent manner the third molars and incisors and to a smaller extent the other molars. The ameloblast differentiation and dentinogenesis were also affected (Kist et al., 2005).

It has been suggested that the key role of Msx1 and Pax9 is to facilitate the bud to cap stage transition (Peters and Balling, 1999; Thesleff, 2006). Mesenchymal Msx1 expression is initially activated by the epithelial BMP4 signal, and needed for a reciprocal BMP4 signal from the mesenchyme. Bmp4 and Msx1 thus form an autoregulatory loop (Chen et al., 1996). The BMP4 signal to the epithelium is crucial for the formation of the epithelial signaling center, the enamel knot, and the arrest of the development in Msx1 null mutant teeth can be rescued by external BMP4 or transgenically activated Bmp4 expression (Chen et al., 1996; Bei and Maas, 1998; Zhang et al., 2000). The expression of Pax9 is apparently needed to maintain and, by the synergism with Msx1, to enhance this loop. However, as shown by the mice with hypomorphic mutations, Pax9 is also needed later in tooth development (Kist et al., 2005).

Loss of function defects in MSX1 and PAX9 in humans cause partial failure of tooth development, tooth agenesis. As described in the Results and discussion, these defects are selective: defects in MSX1 associate especially with agenesis of second premolars and third molars, whereas the defects in PAX9 affect particularly the permanent molars. The size of the permanent teeth may also be reduced. In one of the families with a defect in MSX1, some patients also presented with nail dysplasia and in another family with oral clefts (Jumlongras et al., 2001; van den Boogaard et al., 2000). Several other sequence changes in MSX1 have also been described in connection with oral clefting (Jezewski et al., 2003; Suzuki et al., 2004). In addition, a microsatellite allele in the intron of MSX1 has been associated with both tooth agenesis and oral clefting, and two promoter region SNP alleles of PAX9 with tooth agenesis (Lidral et al., 1998; Suzuki et al., 2004; Vieira et al., 2004; Peres et al., 2005).

Initiation

In mammals, teeth develop on a special horseshoe-shaped area of a thickened epithelium, the dental lamina (Cohn, 1957; Tonge, 1969). The lamina spans epithelia originating in separate facial processes. The identity of these processes is instructed by specification of neural crest cells by pharyngeal endoderm during their migration (Couly et al., 1998). On the other hand, the growth and identity of these processes is also under the control of signaling from the surface epithelium (Lee et al., 2001; Stottmann et al., 2001; reviewed by Richman and Lee, 2003). It is also assumed that the regional specification of the processes is associated with differential expression of epithelial signals (Tucker et al., 1998; Trumpp et al., 1999; Ha- worth et al., 2004). As reflections of the specification and signaling, several transcription factors show selective or graded expression patterns during the early jaw development (reviewed by Jernvall and Thesleff, 2000; Tucker and Sharpe, 2004; Depew et al., 2005).

The dental lamina apparently defines the region for future tooth development, and subsequently individual dental placodes are initiated at specific positions along the lamina. For hair and mammary glands, it has been assumed that the initial, perhaps permissive, signal is provided by the mesenchyme (Hardy, 1992; reviewed by Pispa and Thesleff, 2003; Mikkola

29 and Millar, 2006). As described above, initial instructive capacity for tooth development appears to reside in the oral epithelium (Mina and Kollar, 1987). However, it is apparent that both epithelial and mesenchymal signaling are needed for the formation of the dental placodes. In several mouse mutants, formation of the placodes is impaired and it appears that in the initiation several signaling pathways interact (reviewed by Mikkola and Millar, 2006).

It has been suggested that the position of odontogenic epithelium is originally defined by signaling organized by the oral-aboral boundary (Harris et al., 2006). Neubuser and colleagues (1997) suggested that tooth positions are defined by antagonistic interactions of FGFs and BMPs, perhaps under organizing control of the ectodermal-endodermal boundary. The expression of Pitx2 becomes restricted to the lamina in mouse embryos at E10.5 (St Amand et al., 2000). Its expression is dependent on Fgf8 (agonist) and Bmp4 (antagonist) (St Amand et al., 2000). Pitx2 is itself needed for the restriction of the epithelial Fgf8 expression to the lamina as well as for tooth development past the placode stage (Lin et al., 1999; Lu et al., 1999). In man, defects in PITX2 cause selective tooth agenesis in the Rieger syndrome (Semina et al., 1996). In addition, it has been shown that e.g. signaling genes Shh, Bmp2 and Wnt10b become expressed early in the odontogenic epithelium, and subsequently upregu- lated in the placodes (Dassule and McMahon, 1998; reviewed by Wang and Thesleff, 2005). Interestingly, Wnt7b and Shh showed complementary expression patterns in the oral epithelium, and forced expression of Wnt7b antagonized expression of Shh and arrested future tooth development, suggesting that antagonism between Wnt and Shh signaling is involved in positioning of the tooth placodes (Sarkar et al., 2000).

The epithelial transcription factor p63 is indispensable for tooth development because in the p63 null mutant mice both tooth and hair placodes fail to form (Mills et al., 1999; Yang et al., 1999). In man, mutations in P63 cause tooth agenesis associated with ectrodactyly- ectodermal dysplasia-clefting (EEC) and other allelic syndromes (Celli et al., 1999; reviewed by van Bokhoven and McKeon, 2002). The expression of mouse p63 is not limited to the tooth forming areas, and normal Fgf8 and Bmp4 expression was observed in the null mutants (Laurikkala et al., 2006). However, p63 is upstream of several signaling molecules including Bmp7, Fgfr2, E-catenin and Edar, thus regulating the signaling that is involved in the initiation and positioning of the dental placodes (Laurikkala et al., 2006).

The formation of the epithelial dental placodes is marked by the expression of several genes, including transcription factor genes Msx2 and Lef2 and signaling genes Shh, Bmp2, Fgf8, Fgf20, Wnt10a, Wnt10b, and Edar (reviewed by Wang and Thesleff, 2005). The role of these genes is apparently to regulate gene expression in the placodes themselves, and signal to the surrounding epithelium and mesenchyme. Shh and FGFs also stimulate the proliferation in the epithelium, presumably promoting the growth of the tooth bud (Hardcastle et al., 1998; Cobourne et al., 2001; Kettunen et al., 1998).

In the mesenchyme, Pax9 is localized to the future tooth forming position already at the E9.5 (molars) to E10 (incisors) in mouse (Neubuser et al., 1997). As shown by inactivating Fgf8 in the epithelium or using an antagonist of FGF signaling in tissue culture, early expression of Pax9 as well as several other transcription factor genes in the mesenchyme is dependent on FGF signaling from the epithelium, but becomes independent of FGFs already before the

30 formation of the dental placodes and the observed shift of the odontogenic potential to the mesenchyme (Trumpp et al., 1999; Mandler and Neubuser, 2001). In tissue culture experiments, it has been shown that FGFs, BMPs, Wnts and Shh, that are expressed in vivo in the epithelium and the placodes, are able to induce expression of specific transcription factor genes in the mesenchyme. FGF8-containing beads induced Msx1, Pax9, Barx1, Dlx1, Dlx2, Lhx6, and Lhx7 (Neubuser et al., 1997; Kettunen and Thesleff, 1998; Tucker et al., 1998; Grigoriou et al., 1998), BMP4 and WNT4 induced Msx1, and Shh induced Gli1 as well as its own receptor, Patched (Vainio et al., 1993; Kettunen et al., 2005; Dassule and McMahon, 1998; Hardcastle et al., 1998). Tooth development may be arrested already prior the placode stage in the double null mutants of Msx1;Msx2, Dlx1;Dlx2 and Gli2;Gli3, which is explained by the need of these transcription factors for induction of reciprocal signals in the mesenchyme (Satokata et al., 2000; Thomas et al., 1997; Hardcastle et al., 1998).

One of the earliest placodal markers, Edar, is originally expressed throughout the oral epithelium and epidermis, but becomes limited to the placodes at an early stage (Laurikkala et al., 2001). In Tabby, the mouse mutant devoid of the function of Eda, the Edar ligand, the limitation to the hair placodes does not happen (Laurikkala et al., 2002). In these mice as well as in mutants of Edar and Edaradd, a gene coding for an Eda signal transduction protein, however, the placode development is not completely inhibited. On the other hand, when Eda was overexpressed in the epithelium, the hair and tooth placodes became larger, probably due to an increased amount of the cells destined to become placode cells (Mustonen et al., 2004). Thus, Eda signaling probably acts rather as a modulator of ectodermal placode formation than as an initiator. Eda signaling may be important as a mediator of effects of Wnts to activate Shh and antagonize BMPs (Pummila 2007). Mutations in the EDA, EDAR and EDARADD genes in humans cause X-linked and autosomal anhidrotic ectodermal dysplasias (EDAs) characterized by sparse hair, failure of sweat gland development, tooth agenesis and size reduction of teeth (microdontia) (reviewed by Mikkola and Thesleff, 2003).

For several reasons, Wnt signaling has been a strong candidate for an ectodermal placode initiator. Wnt reporters become activated in the hair and mammary placodes, and several Wnt ligands are expressed in the dental tissues (Sarkar and Sharpe, 1999; reviewed by Pispa and Thesleff, 2003; Wang and Thesleff, 2005; Mikkola and Millar, 2006). Necessity of Wnt signaling for placode formation was shown by epithelial expression of a Wnt antagonist Dkk1 under the keratin 14 promoter which arrested tooth as well as hair development before the placode stage (Andl et al., 2002). On the other hand, experimental accumulation of the intracellular Wnt signaling mediator, E-catenin, under the keratin 14 promoter in epithelium lead to de novo formation of hair follicles (Gat et al., 1998). Forced overexpression of Lef1 in ectoderm caused extra tooth-like budding in oral epithelium (Zhou et al., 1995). Further- more, the expression of Eda was induced by Wnts in mouse tissue culture and absent in the early dental epithelium of the Lef1 null mutant mice (Laurikkala et al., 2001).

As a summary, it appears that different signaling pathways have different and partially redundant roles in the initiation of dental placodes. It is assumed that FGFs and Wnts as well as Eda promote placode formation, and BMPs and TGFEs antagonize it, analogous to the formation of other ectodermal placodes (reviewed by Wang and Thesleff, 2005; Mikkola and Millar, 2006).

31 Morphogenesis

The most complex morphological variation in mammalian teeth involves the crown patterns of multicusped teeth. The regulatory and molecular basis of morphogenesis of multicusped teeth as well as establishing different cusp arrangements have begun to be understood (Jernvall et al., 2000; Salazar-Ciudad and Jernvall, 2002). Even a quantitative manipulation of one or a few gene activities during molar tooth development may lead to remarkably different cusp arrangements and crown patterns (Kangas et al., 2004; Wang et al., 2004a; Kas- sai et al., 2005).

In the late bud stage, a group of cells at the tip of the epithelial bud, the primary enamel knot, cease to proliferate and are later removed by apoptosis (Jernvall et al., 1994; Vaahtokari et al., 1996). The enamel knot deviates significantly from the surrounding epithelium because of its gene expression. It expresses several transcription factors and numerous signaling molecules as well as signaling inhibitors with a specific schedule of appearance, thus having potential to act as a signaling center that orchestrates the development of the surrounding tissues (reviewed by Thesleff et al., 2001; Wang and Thesleff, 2005). The primary enamel knot is apparently induced and maintained by signals emanating from the underlying mesenchyme (Jernvall et al., 1998; Kratochwil et al., 2002). On the other hand, formation of the primary knot seems to be a prerequisite for the advancing of the tooth development to the cap stage. This is suggested by several mouse null mutants (Msx1, Pax9, Runx2, Lef1, FGFR2IIIb, Bmpr1a) in which tooth development is arrested at the bud stage, apparently because of a failure of formation or function of the primary enamel knots (van Genderen et al., 1994; Satokata and Maas, 1994; Peters et al., 1998; Åberg et al., 2004). In the Msx1, Pax9, and Runx2 mutants, the mesenchyme fails to activate signaling to the epithelium and to induce or maintain the enamel knot (Chen et al., 1996; Jernvall et al., 1998; Bei and Maas, 1998; Åberg et al., 2004). In the Lef1 mutants, the epithelium fails to activate the expression of Fgf4, which leads to a failure of growth of the cervical loops and reciprocal signaling with the mesenchyme (Kratochwil et al., 2002). Shh expressed by the enamel knot induced proliferation in the epithelium, probably by inducing mesenchymal signals, and FGFs both in the epithelium and the mesenchyme (Jernvall et al., 1994; Kettunen et al., 1998; Cobourne et al., 2001; Gritli-Linde et al., 2002). Thus, the enamel knot has potential to guide the formation of the epithelial cervical loops and the dental papilla, the landmarks of the cap stage of tooth development.

In mouse molars, similar structures called secondary enamel knots are formed subsequently in certain positions in the epithelium undergoing folding morphogenesis and these apparently correspond to the positions of the later forming cusps of the molar teeth (Jernvall et al., 2000). It is assumed that the formation and positions of the secondary knots are dependent on the signaling activity of the primary knot, possibly via induction of signals in the mesenchyme (Salazar-Ciudad and Jernvall, 2002). The size of the primary enamel knot and the development of the mouse molar cusps are dependent on Eda signaling (Pispa et al., 1999; Kangas et al., 2004) as well as on normal amounts of follistatin and ectodin, inhibitors of activin, BMP, and Wnt signaling (Wang et al., 2004a; Kassai et al., 2005). Modelling of the molar tooth development has also suggested that positions and sizes of the secondary knots

32 are dependent on slight alterations in the concentrations and diffusion properties of distinct activators and inhibitors of knot differentiation (Salazar-Ciudad and Jernvall, 2002). Quanti- tative adjustment of these parameters may be sufficient to change a mouse type of molar tooth to resemble the molars of another rodent, the vole.

The main difference between the premolars and molars and the other tooth types, incisors and canines, is in the amount of cusps, suggesting that the tooth type specification is associated with the capacity to form the secondary enamel knots. As known from the tissue recombination studies, at the morphogenetic stages the dental mesenchyme is able to instruct tooth development also in a heterologous epithelium as well as to determine the tooth type (Kollar and Baird, 1969). Accordingly, the mesenchyme apparently is competent to instruct whether the secondary enamel knots are induced. However, as the epithelium is able to instruct the tooth type specification during the early stages (Kollar and Mina, 1991), it appears that the early epithelium instructs the dental mesenchyme competent to decide whether and how the secondary knots will de induced. This competence of the mesenchyme could be dependent on specific transcription factor activities. Although the serial homology of teeth suggests that no separate genetic programs exist for each tooth, differences of gene activities must exist during development of teeth of different classes. These differences may be mainly quantitative but at least some genes show specific expression only during development of one tooth class. A LIM-domain transcription factor gene Islet1 appears to be expressed only in the epithelium of the developing incisors, whereas e.g. Barx1, a homeobox transcription factor gene, is specific for the presumptive molar mesenchyme (Mitsiadis et al., 2003; Tissier-Seta et al., 1995).

Inactivations of both Dlx1 and Dlx2, members of the Dlx homeobox gene family, caused an arrest in the development of mouse upper molar teeth only (Thomas et al., 1997), which was suggested to support the concept of an “odontogenic homeobox-code” (Sharpe, 1995; Tho- mas et al., 1997). However, as described above, the expression of the mesenchymal transcription factors is dynamic and dependent on various epithelial signals. Furthermore, in the Dlx1;Dlx2 null mutant, there is no homeotic change of a molar to an incisor. The normal development of lower molars can be explained by redundancy, i.e. the expression of other Dlx genes in the mandibular mesenchyme (Peters and Balling, 1999). The insensitivity of the incisors to inactivation of the Dlx genes suggests that the latter are not critical for the incisor development. Thus, Dlx activity appears to be needed not to determine a molar tooth identity but to make it possible to develop any tooth at a molar location. Interestingly, inactivation of activinEA signaling arrests the development of all mandibular teeth and upper incisors (Matzuk et al., 1995a; Ferguson et al., 2001). The insensitivity of the upper molars may be explained by redundancy of signaling pathways (Ferguson et al., 2001).

Barx1 has been suggested to be a candidate for a factor mediating tooth type determination (Tissier-Seta et al., 1995; Tucker et al., 1998). It is normally expressed only in the presumptive molar region and inducible by FGF8. However, if the epithelial BMP4 activity is blocked by application of an inhibitor Noggin, the expression domain of Barx1 is expanded to the presumptive incisor region (Tucker et al., 1998). Incisor tooth germs cultured in the presence of Noggin grew large, showing resemblance to molar tooth germs. Similar change has been described after injection of Barx1 cDNA to the incisor region (Miletich et al.,

33 2005). Thus, it appears that Barx1 activity would be able to mediate the effect of epithelial gradients of Bmp4 anf Fgf8 expression on tooth type specification (Tucker et al., 1998). However, a reciprocal change of a molar to an incisor in absence of Barx1 has not been reported.

It is reasonable to assume that the epithelial signaling gradients are involved in tooth type specifications, i.e. in the basis of heterodonty (Tucker et al., 1998). Differential signaling may be mediated to the specification of tooth identity by specific expression of transcription factors as described above. The differential timing of the interactive processes during the initiation may also be involved. Pax9 becomes expressed slightly earlier in the presumptive molar region than in the incisor region (Neubuser et al., 1997). On the other hand, Shh expression appears to become prominent earlier in the incisor region than in the molar region (Dassule and McMahon, 1998). Still, the question remains how the epithelial gradients are created. Organizing activity of the ectodermal-endodermal boundary has been suggested (Neubuser et al., 1997). Some evidence suggests that the epithelial cells become specified before the growth of the facial processes, possibly by the endoderm (Haworth et al., 2004; Haworth et al., 2007). Furthermore, the gradients should be able to create three separate specifications, i.e. one for each tooth class, e.g. during human tooth development, and the gradients should lead to similar patterning in the maxilla and mandible even though these are formed from fusing facial processes in a different way.

Tooth replacement

Relatively little is known about the molecular regulation of tooth renewal, i.e. shedding of the deciduous teeth and development and eruption of the secondary teeth. There appears to exist a regulatory relationship between the development of the primary teeth and the successor (Luckett, 1993), and it may be possible that both activating and inhibitory effects are involved.

Within the hair follicle, a specific epithelial compartment, a hair bulge, contains cells with stem cell-like properties. These cells are activated in a certain stage of hair cycling to make it possible for the hair papilla to activate the follicle to start new anagen stage of cycling (reviewed by Blanpain et al., 2007). Existence of a similar stem cell compartment has been suggested to make tooth renewal possible in fish and possibly in other vertebrates (Huysseune and Thesleff, 2004).

Wnt signaling is involved in the activation of the cells of the hair bulge (reviewed by Alonso and Fuchs, 2003). Several observations suggest the involvement of Wnt signaling also to the regulation of the secondary tooth development. Mutations in the human AXIN2 gene that presumably affect the intracellular negative feedback regulation of Wnt signaling, i.e. E- catenin degradation, cause severe tooth agenesis that affects almost exclusively the permanent teeth (Lammi et al., 2004). In the human disease adenomatous polyposis coli, a cancer syndrome with massive colon polyposis caused by deregulation of E-catenin level as a consequence of lack of the functional APC gene product, development of supernumerary teeth is often observed (Ida et al., 1981; Järvinen et al., 1982). Finally, forced overexpression of the

34 epithelial E-catenin disturbs the mouse molar morphogenesis by creating supernumerary budding of the molar epithelium in vivo and, in the kidney capsule culture, numerous tooth structures resembling compound odontomas (Järvinen et al., 2006).

Supernumerary teeth are a regular feature of cleidocranial dysplasia, a syndrome caused by defects in the transcription factor gene RUNX2 (Jensen and Kreiborg, 1990; Mundlos et al., 1997). Whether these teeth reflect a failed suppression of an ancient tooth renewal program is not clear because the teeth seem to develop occlusally to the normal permanent successors. It has been suggested that the development of the supernumerary teeth follows from a failure of degradation of the dental lamina (Jensen and Kreiborg, 1990). Although Runx2 activity is mandatory for tooth development, a reduced amount of RUNX2 may also release the inhibition of tooth renewal, as rudimentary epithelial outgrowths have been observed in the molars of Runx2 null mutant heterozygotes (Åberg et al., 2004).

35 TOOTH AGENESIS

Developmental anomalies

The development of an individual from an fertilized egg to an adult is a tightly regulated process requiring coordination of the patterning, organogenesis, morphogenesis and differentiation. Deviations from normal development may lead to anomalies of structure or function, which when present at birth either as visible or hidden are called birth defects. Structural or anatomical malformations and abnormalities present at birth as signs of abnormal prenatal development are also called congenital anomalies (Gilbert, 2003; Kotilainen, 1996). How- ever, in the case of teeth the development and differentiation continues long after birth, and instead of congenital many anomalies could rather be called developmental anomalies.

Dysmorphic features that may only require cosmetic concern are considered minor anomalies, whereas anomalies that require clinical or cosmetic attention are considered major anomalies (Kotilainen, 1996). Minor anomalies are rather common, and a figure of 15 % was presented by Marden et al (1964), whereas major anomalies are present in 1-2 % of new- borns (Marden et al., 1964; Sadler, 1990; Gilbert, 2003). Observation of several minor anomalies increases the risk for presence of one or more major anomalies. Presence of several anomalies may be called a syndrome (Kotilainen, 1996).

Congenital or developmental anomalies may be caused by external factors such as terato- genic agents, radiation, viral infections and even hyperthermia or mechanical forces, and in this case they are called disruptions or deformations (Kotilainen, 1996). These effects may vary depending on the time of the exposure, and therefore often manifest in an organ- and time-specific fashion (Sadler, 1990). Thalidomide, a drug that was used by pregnant women in the 1950’s, caused ear defects, truncations of hands and truncations of feet depending on the time of exposure during the fourth and fifth weeks of gestation (Sadler, 1990; Gilbert, 2003). As teeth develop during a long period from six weeks of embryonal development to early adulthood, they are also subject to time-specific effects, which are characterized by different defects on the tooth development or the hard tissue formation depending on the time and nature of the deleterious agent (Alaluusua et al., 1999; Hölttä, 2005). Indeed, because hard tissues of teeth are not remodelled or repaired after eruption, anomalies of hard tissues may serve as biomarkers of an experienced environmental insult (Alaluusua et al., 1999).

Normal development may also by affected by genetic causes, and it has been suggested that the term malformation would be reserved for these anomalies (Kotilainen, 1996; Gilbert, 2003). They may affect only one organ system but often a genetic factor has a pleiotrophic effect on many organs (multiorgan malformation syndrome). These may be related or independent, reflecting the roles of a certain molecular mechanism in the development of multiple organ systems (Gilbert, 2003). A term trait has also been used to describe inherited phenotypes, which may be regarded either normal variation but may in some cases be classified as anomalies (Guttman et al., 2002).

Especially syndromes may result from large-scale chromosomal abnormalities such as deletions, translocations or abnormal chromosome number, which affect the functions of several

36 genes. However, syndromes, anomalies, and many other genetic diseases can also be caused by sequence defects in single genes, while other genes may have a modifying effect (Strachan and Read, 1999; Gilbert, 2003). The relationship between a genotype and a phenotype may be rather complex. The dependence of the phenotype on other genetic factors, “the genetic background”, as well as epigenetic and external factors results in variable expressivity, i.e. different phenotypes among affected individuals, and often as reduced penetrance, i.e. some healthy individuals who have the defective genotype.

Developmental anomalies of teeth

Developmental anomalies of the teeth include deviations in tooth number (agenesis or supernumerary teeth), abnormalities of size and form, failure of eruption or precocious or delayed eruption, malpositions, as well as defects of dental hard tissues. Well-known external factors affecting the dental hard tissue formation are vitamin D deficiency in rickets and excess fluor. Apparently many other environmental factors in modern society may cause defects in the maturation of hard tissues (Alaluusua et al., 1999). Alleged increased occlusal deviations as well as increased prevalence of impaction of third molars considered as a result of modern diets may also be regarded as defects caused by environmental factors (Corruccini, 1984; Sengupta et al., 1999). On the other hand, both normal quantitative and qualitative variation as well as many developmental anomalies have been attributed to inheritance (Bailit, 1975; Townsend et al., 1998; Thesleff and Pirinen, 2002). Several gene defects are known that affect the formation of the dental hard tissues. Amelogenesis imperfecta is a failure of normal formation of enamel and it may result from defects in the structural genes of enamel or in proteases and regulatory genes (Wright, 2006; Hu and Simmer, 2007). Dentinogenesis imperfecta and dentin dysplasia that primarily affect dentin deposition and mineralization are known to be caused by defects in the genes that code for the structural components of the dentin matrix, collagen I and dentin sialophosphoprotein (Waltimo, 1996; MacDougall et al., 2006; Kim and Simmer, 2007). Anomalies and variation observed in the morphology, size and number of teeth will be discussed below in more detail.

Genetic traits of tooth number and shape

Most of us develop a similar set of teeth, with similar shapes and timing of the development, but also many kind of individual variation exists. The variation may be quantitative or qualitative, i.e. continuous or discreet, and it is apparent that extremes of quantitative variation may turn into qualitative changes, regarded either as variation or anomalies (Miles and Grig- son, 1990; Bailit, 1975).

Quantitative variation is observed e.g. in the tooth size, the root length and the timing of tooth development, shedding and eruption. Many authors have reported population values and observed variation of tooth sizes (Jensen et al., 1957; Garn et al., 1968) (Steigman et al., 1982; Lysell and Myrberg, 1982) as well as standards and methods of estimation of the timing of development and eruption (Moorrees et al., 1963; Haavikko, 1970; Demirjian, 1978; Kataja et al., 1989). Tooth size, tooth maturation and times of eruption display some differ-

37 ences between populations and men generally have larger teeth than women (Bailit, 1975). On the other hand, different teeth show different magnitudes of size variation.

Qualitative deviations are observed in tooth number, either as agenesis of one of more teeth or as development of extra (supernumerary) teeth (Fig. 4), in cusp and root number as well as in presence of abnormal shapes or positions. Several studies have addressed cusp number and morphology of permanent molar crowns (Dahlberg, 1945; Jörgensen, 1955; Davies, 1968; Lavelle et al., 1970). Considerable variation exist in terms of molar crown shapes and reduction of cusp number among Caucasian populations and also ethnic differences may exist. Other common morphological features include presence of extra cusps in molars, e.g. the so-called Carabelli’s cusp in the medial lingual aspect of the maxillary molars, as well as morphological variation of incisors including shovel-like shape, talon cusps, dens-in- dente/dens invaginatum in the lingual aspect of upper lateral incisors and peg-shape of these teeth (Dahlberg, 1945; Ooshima et al., 1996; Tsai and King, 1998; Alvesalo and Portin, 1969).

Supernumerary teeth

Development of supernumerary teeth is observed in some syndromes, but they also occur in the permanent dentition of about 2-3.5 % of otherwise healthy individuals, with perhaps a slightly higher prevalence among Asian populations than in Caucasians, and in most studies a two-fold higher prevalence among males (Niswander and Sujaku, 1963; Haavikko, 1970; Brook, 1974; Bäckman and Wahlin, 2001; reviewed by Zhu et al., 1996). In the deciduous dentition the occurrence is about one fifth of that in the permanent dentition (Zhu et al., 1996). In Finland the reported prevalences in the permanent and primary dentition are 1.6 % and 0.4 %, respectively (Haavikko, 1970; Järvinen and Lehtinen, 1981). Four fifths of the cases present with one supernumerary tooth and in only 1 % more than two are observed (Zhu et al., 1996). Supernumerary teeth are classified according to their time and place of appearance as well as to their morphology (reviewed by Miles and Grigson, 1990; Zhu et al., 1996; Rajab and Hamdan, 2002). They may be normal by size and morphology (eumorphic or supplemental supernumerary teeth) or they may be rudimentary (conical, tuberculate or molariform). Most commonly the supernumerary teeth develop in the incisor region, and a typical supernumerary tooth is a mesiodens, an extra peg-shaped incisor in the midline between the normal incisors (Russell and Folwarczna, 2003). The majority of anterior supernumerary teeth remain unerupted. Other common findings are supernumerary mandibular premolars, and molars between the normal molars (paramolars) or posterior to the third molar (distomolar), more commonly in the maxilla (Zhu et al., 1996).

Supernumerary teeth have been considered as reflections of atavism, i.e. reappearance of teeth lost during evolution (reviewed by Miles and Grigson, 1990; Zhu et al., 1996; Rajab and Hamdan, 2002). This is based on an idea that in some cases an ancestral developmental program that is normally suppressed during the development of human dentition becomes activated. Another suggestion is that supernumeraries develop from local overactivity of the dental lamina or from a dichotomous tooth bud. A third suggestion considers supernumerary teeth as an expression of a quantitative variation, which in the other end leads to agenesis or

38 size reduction of teeth (Brook, 1984). Support for this view is offered by an observation that supernumerary teeth are often associated with teeth that are bigger than normal in size (Khalaf et al., 2005). These explanations may to some extent represent different aspects (evolutionary, developmental and genetic) of the same explanation, e.g. overactivation of genetic pathways the activity of which may have been reduced during evolution. Studies of mouse mutants have shown that increased quantitative level of signaling may lead to supernumerary teeth (Mustonen et al., 2004; Kassai et al., 2005; Klein et al., 2006).

Development of supernumerary teeth is observed in some syndromes like cleidocranial dysplasia and familial adenomatous polyposis coli (FAP, also called Gardner syndrome} (Jensen and Kreiborg, 1990; Ida et al., 1981; Wolf et al., 1986) in which the causative genes are known. Gene defects in RUNX2 are responsible for cleidocranial dysplasia and gene defects in APC for FAP (Mundlos et al., 1997; reviewed by Järvinen and Peltomäki, 2004). Common to both genes is that they affect well-known signaling pathways and both teeth and the bone. Mouse studies have shown that Runx2 function is obligatory for bone development and that some Runx2 expression is needed for the normal tooth development (Otto et al., 1997; Åberg et al., 2004). Paradoxically, Runx2 null mutant mice do not develop teeth at all, while reduced RUNX2 dosage in humans causes supernumerary teeth. As discussed earlier, Runx2 function may be associated with the prevention of tooth renewal (Wang et al., 2005). In FAP, apparently as a result of overactivation of the intracellular Wnt-signaling (reviewed by Giles et al., 2003; reviewed by Segditsas and Tomlinson, 2006), jaw osteomas and odontomas or supernumerary teeth are observed in 80 % and 20-30 % of the cases, respectively (Ida et al., 1981; Wolf et al., 1986)..

Tooth agenesis

Terminology

Failure to develop all normally developing 20 deciduous and 32 permanent teeth, tooth agenesis, is a common phenomenon and various terms have been used to describe it (reviewed by Schalk-van der Weide, 1992) (Fig. 4). The layman way of speaking about “missing teeth” is prone to cause misunderstandings because teeth may be lost by dental disease or trauma or extracted on clinical grounds. “Congenitally missing teeth” is also prob- lematic, because some teeth start their development only after birth and because of the presence of most of the permanent teeth germs can only be verified during childhood. Tooth aplasia and agenesis have been used to describe developmentally missing teeth. Tooth agenesis is the suitable term because it directly refers to the developmental failure. To be exact it should need to be complemented e.g. with “partial” or “selective” tooth agenesis (Vastardis et al., 1996). In the literature, the term anodontia (ano, Greek for “none”) has sometimes been used to describe tooth agenesis in general even though it should be restricted to the very rare cases of agenesis of whole the dentition. Hypodontia (hypo, Greek for “less”) is the most commonly used term even though it may sound like a scientifically sounding simile of “missing teeth” or may be mixed with reduced size of teeth. The term has been used for tooth agenesis in general, but recently in particular for the common, mild forms. The term oligodontia (oligo, Greek for “few”) has been used for describing more severe forms of

39 agenesis, usually of at least six teeth excluding third molars (Schalk-van der Weide, 1992; Arte, 2001). This definition is, however, somewhat arbitrary, often causes misunderstandings and may not properly reflect the severity of the phenotype as the third molars are excluded.

Diagnostic challenges

The reliability of the diagnosis of tooth agenesis is dependent on a reliable history of dental treatment, trauma and tooth extractions. Therefore, most studies on the prevalence of tooth agenesis focus on children and adolescents. However, for young subjects, radiographic examination is critical for the diagnosis but not always possible, and even then the late- developing teeth may be sometimes scored developmentally missing. Agenesis of the primary teeth can be diagnosed without radiographic examination in three to four year old children, because all primary teeth are at that age normally visible in mouth. Permanent teeth cannot be studied reliably even with radiological methods before the age of six years, and even at that age all the second premolars may not have started mineralization (Arte, 2001). Obviously, the diagnosis of agenesis of third molars is subject to errors caused by a large variation of the onset of mineralization and rather common extractions of these teeth.

Prevalences

Prevalence of tooth agenesis has been addressed by numerous studies (reviewed by Arte, 2001; Polder et al., 2004; Mattheeuws et al., 2004). The reported prevalences show a rather large variation. Extremes are found in some isolated populations (Mahaney et al., 1990), but in most populations the reported prevalences of agenesis of permanent teeth, excluding third molars, varies from 2.2 to 10.1 % (reviewed by Arte 2001; Polder et al., 2004). In their meta- analysis of 33 studies, Polder and collaegues (2004) did not find any significant increase in prevalences when samples from seven year olds or younger were included. Instead, they de- cided to exclude one study reporting low prevalence because of a possible error due to an exceptionally large sample size. Inspection of the data from the meta-analysis suggests a tendency of lower prevalences also in other studies with large sample sizes, and because some of these are from USA, this may undermine their conclusion that tooth agenesis shows a lower prevalence in Northern America. They also noticed signs of an increasing trend in agenesis during the 20th century, a notion also advocated by Mattheeuws and colleagues (2004). While the available data are not sufficient for confirmation of this trend, the data support the conclusion that in Caucasian populations the prevalence of permanent tooth agenesis apart from the third molars is generally in a range of 5 to 8 %. The data also support the conclusion that the prevalence is higher among females than among males (Polder et al., 2004). In the two studies of African Americans, the prevalences were comparable to those of White subjects, whereas in two studies from Saudi-Arabia prevalences of 2.2 and 4 % were reported (Polder et al., 2004). Studies among Japanese and among school children of Chi- nese origin in Hongkong reported prevalences of 6.6 % and 6.9 %, respectively (Niswander and Sujaku, 1963; Davis, 1987).

40 Figure 4. Panoramic tomographies of developmental dental anomalies. Asterisks mark developmentally missing teeth. A. Agenesis of the mandibular second premolars and the right maxillary third molar in a 15 years old boy. B. Agenesis of the left mandibular central incisor and a peg-shaped right maxillary lateral incisor (arrow) in a nine years old girl. C. Severe agenesis (oligodontia) in a six years old boy. D. Unerupted supernumerary incisor, so-called mesiodens, between the maxillary central incisors (arrow) in a nine years old boy.

Agenesis of third molars is much more common than that of other teeth, but because of problems referred above, also much more challenging to study. The reported figures suggest that one or more third molars fail to develop in more than 20 % in populations of Caucasian origin (Grahnen, 1956; Haavikko, 1971). On the other hand, agenesis of deciduous teeth is much more rare, the prevalences among Caucasian populations ranging from 0.3 to 0.9 %, the highest prevalence being reported among Finnish 3-4 year olds (Järvinen and Lehtinen, 1981; reviewed by Arte, 2001). In a study from Japan, a remarkably higher prevalence of 2.4 % was reported (Yonezu et al., 1997).

Thus, tooth agenesis is a very common developmental anomaly. However, if the absense of more than a few teeth is considered, the prevalences become progressively smaller. There- fore, agenesis of more than two teeth (third molars excluded) happens in ~1 % of the population, while the prevalences are in a range of 0.1 to 0.3 % for agenesis of at least six teeth (Grahnen, 1956; Hunstadbraten, 1964; Haavikko, 1971; Rölling, 1980; Rölling and Poulsen, 2001; reviewed by Polder et al., 2004). In the primary dentition, the distribution is similar with the majority of cases lacking only one tooth (Daugaard-Jensen et al., 1997a).

Patterns of agenesis

No general difference in the frequency of agenesis between the left and right sides exists, and for permanent teeth no significant difference between maxilla and mandible has been reported although for individual teeth in different jaws the frequencies differ. For the primary teeth, agenesis is more common in the maxilla (Daugaard-Jensen et al., 1997a).

41 Apart from the third molars, many studies among Caucasian populations have scored the lower second premolars most commonly affected, followed by upper lateral incisors and upper second premolars, while some studies have found that upper lateral incisors are most often affected (Grahnen, 1956; Haavikko, 1971; reviewed by Graber, 1978; Arte, 2001; Polder et al., 2004) (Fig. 5). These differences may reflect diagnostic or real population differences. Among Asian populations agenesis of lower central incisors is much more common than among Caucasians, this tooth actually being the most often affected, and also in the primary dentition (Yonezu et al., 1997). The third molars may account for about 75 % of all affected teeth (Haavikko, 1971). If they are not considered, agenesis of second premolars and upper lateral incisors account for 85 % of all affected teeth among Caucasian populations (as calculated from data by Polder et al., 2004), and their proportion is still higher if cases with agenesis of only one or two teeth are considered. Prevalences of agenesis for all other permanent teeth, third molars excluded, are less than 0.36 % or as proportions of all affected teeth, 3.5 % or less. The most commonly affected other teeth are, in order, lower incisors, maxillary first premolars, mandibular first premolars, maxillary canines and mandibular second molars. Prevalences of agenesis of all other teeth are less than 0.075 %, corresponding to proportions below 0.7 %, and the most stable teeth are maxillary central incisors (prevalence of agenesis 0.016 %) and mandibular first molars and canines (prevalences of agenesis about 0.03 %).

In the primary dentition, the maxillary lateral incisors account for over 50 % and together with mandibular incisors for 90 % of all affected teeth (Daugaard-Jensen et al., 1997a; Jär- vinen and Lehtinen, 1981; Magnusson, 1984; Whittington and Durward, 1996). A correlation of agenesis of primary and secondary teeth also exist: agenesis of a primary tooth is nearly always followed by agenesis of the corresponding secondary tooth (Daugaard-Jensen et al., 1997b; Whittington and Durward, 1996).

Bilateral agenesis is observed for most teeth in almost half of the possible occurrences, i.e. when at two teeth are affected (Grahnen, 1956; Haavikko, 1971; Davis and Brook, 1986; Rasmussen, 1999; Polder et al., 2004; Kirkham et al., 2005). Bilaterality may be more common for maxillary lateral incisors than for premolars in either jaw (Thompson and Popovich, 1974; Davis and Brook, 1986; Polder et al., 2004). In families the occurrence of agenesis within one tooth class appears more common than agenesis of different tooth classes (Grahnen, 1956; Chosack et al., 1975; Arte et al., 2001). However, if agenesis of third molars were taken into account, the tendencies to bilaterality and familial concordance would probably be weakened. According to Grahnen (1956), agenesis of third molars was observable in approximately half of the subjects with agenesis of other teeth.

The teeth that are most often affected, i.e. the third molars as well as the second premolars and upper lateral incisors of the permanent dentition, are the last to develop in their respective tooth classes. This suggests that quantitative mechanisms are involved in the pathogenesis (see below). The tendency to bilaterality and familial concordance, on the other hand, support the existence of mechanisms that tend to affect different tooth classes differentially.

42 Figure 5. Prevalences of agenesis of different tooth types. Prevalences from teeth on the left and right are combined. Figures indicate per- centages. Darkness of color indicates the prevalence. Figures inside the crowns of the maxillary permanent teeth are the second dig- its of the FDI codes. Prevalences of permanent teeth except third molars according to table 4 in Polder et al., 2004.

Tooth agenesis in syndromes

As can be reasoned from the prevalence figures, tooth agenesis is usually an isolated anomaly, without any other observable malformations. It is, however, a constant feature associated with oral clefts and tens of well-defined malformation syndromes (Schalk-van der Weide, 1992; Arte, 2001) (Table 1). In association with oral clefts, agenesis may happen in the region of the cleft, but agenesis in other regions of the mouth is also more common than in the general population, reflecting common etiology (Ranta, 1986). Tooth agenesis that is associated with different malformation syndromes vary in severity but syndromic agenesis accounts for a remarkable proportion of all cases of severe agenesis (Schalk-van der Weide, 1992). In many syndromes there is a typical pattern of agenesis and in some cases it is strikingly different from the frequencies in non-syndromic cases (Table 1). On the other hand, in the association of severe agenesis, occurrence of minor ectodermal anomalies is often observed (Schalk-van der Weide, 1992; Pirinen et al., 2001; Nordgarden et al., 2001).

Dental anomalies associated with agenesis

For dental clinicians, it is familiar that tooth agenesis is associated with other anomalies of teeth. Tooth agenesis is prone to cause abnormal occlusion, the severity of which is dependent on the amount of missing teeth. Agenesis may also affect craniofacial development, and especially maxillary retrognathism and reduced anterior facial height have been reported (Mattheeuws et al., 2004; Nodal et al., 1994; Endo et al., 2006). A reduction in jaw size has also been described (Lavelle et al., 1970). However, as these may be considered secondary to agenesis, they will not be discussed further here. Several studies have addressed associations of agenesis and other dental anomalies (Lai and Seow, 1989; Schalk-van der Weide, 1992; Ooshima et al., 1996; Baccetti, 1998; Bjerklin et al., 1992; Bäckman and Wahlin, 2001). Agenesis is often associated with reduction in tooth dimensions and morphology, delays of development, root anomalies, abnormal positions and also enamel hypoplasia (Ahmad et al., 1998; Baccetti, 1998) (Table 2). However, these studies have not, with some exceptions, considered different subtypes of agenesis. While the following refers to studies concerning

43 isolated tooth agenesis, these anomalies are rather often present in syndromic forms of tooth agenesis (reviewed by Arte, 2001).

Reduction of tooth size and morphology

The term microdontia has been used for occurrence of teeth with reduced tooth size (Brook, 1984), but some authors have reserved this term to extreme size reduction, e.g. to a reduction observable without measurements (Hölttä, 2005), or defined a limit for the deviation (Ooshima et al., 1996). Small but measurable decreases of mesio-distal tooth dimensions were reported in association with the agenesis of the third molars (Garn et al., 1961; Garn et al., 1964; Lavelle et al., 1970), but these were on the average only in a range of a few per- cent. Somewhat more remarkable decreases of size have been observed in association with agenesis of other teeth, and correlations between the amount of missing teeth and the extent of size reduction have been reported (Lysell, 1953; Garn and Lewis, 1970; Baum and Cohen, 1971; Rune and Sarnäs, 1974; Schalk-van der Weide, 1992; Brook et al., 2002). Even then, the tooth sizes were reduced less than 20 % of the normal size. The labio-lingual/palatal dimensions have also been shown to be reduced in association with agenesis (Baum and Cohen, 1971; Schalk-van der Weide, 1992; McKeown et al., 2002). Reduced tooth sizes have also been observed within the healthy relatives of patients with severe tooth agenesis (Schalk-van der Weide and Bosman, 1996; McKeown et al., 2002). From several of these studies it appears that the size reduction affects most strongly the anterior teeth, even in association with the third molar agenesis (Garn and Lewis, 1970; Schalk-van der Weide, 1992; Brook et al., 2002), and, on the other hand, that agenesis is accompanied by an increase of the tooth size variability, and especially that of the posterior teeth (Garn and Lewis, 1970; Schalk-van der Weide, 1992). Reduced tooth size of affected family members has also been reported in association of identified gene defects in MSX1 and PAX9 (see Results).

In addition to reduction in tooth dimensions, agenesis is also associated with changes of tooth crown morphology, especially with simplification of tooth shapes. The occurrence of peg-shaped upper lateral incisors is associated with the absence of a contralateral tooth and occurrence of agenesis of upper lateral incisors among relatives (Mandeville, 1949; Grahnen, 1956; Chosack et al., 1975; Alvesalo and Portin, 1969; Arte et al., 2001), and association of peg-shaped laterals has also been reported to be assosiated with agenesis of other teeth (Grahnen, 1956; Baccetti, 1998). Alvesalo and Portin (1969) concluded that peg shape and agenesis of laterals incisors are different expressions of the same genetic trait while the reduction of mesio-distal size is not. They also proposed that in different populations a combined frequency of missing and peg-shaped teeth may be of the same magnitude while proportions of individual defects may vary.

Several studies have addressed the lower molar cusp patterns in relation to agenesis. Some studies have found that reduction of cusp number from 5 to 4 is increased in association with agenesis (Garn et al., 1966; Davies, 1968) while others have failed to confirm this (Lavelle et al., 1970). Other morphological features possibly associated with agenesis include conicality of canines and reduction of cusps of premolars (Schalk-van der Weide, 1992).

44 Table 2. Anomalies associated with tooth agenesis

agene- agene- cont- sis sis sample notes rols among group *) %%% Peg or small maxillary lateral incisors Swedish schoolchildren and agenesis of contralateral Grahnen, 1956 1.7 50 students incisor Alvesalo and Portin, 1969 1.3 50 43 Finnish island population Australian pediatric dentistry Lai and Seow, 1989 0 8.9**) mean n of missing teeth 4.7 patients Baccetti, 1998 4.7 18 42 Italian orthodontic patients agenesis of 2nd premolars

Short root anomaly max incisors; crown/root > Lind, 1972 2.4 46 Swedish schoolchildren 1.1 all teeth; crown/root > 1 on Apajalahti et al., 1999 1.3 12 Finnish university students both sides

Taurodontism Australian pediatric dentistry Seow and Lai, 1989 7.5 35 mandibular 1st molars patients Dutch patients with severe Schalk-van der Weide, 1992 9.9 22 agenesis 1st and 2nd permanent Arte et al., 2001 22 41 Finnish 6-21 y molars

Ectopic canines Bjerklin et al., 1992 1.8 7.2 5.5 Swedish schoolchildren

Palatally displaced canines Baccetti, 1998 5.2 16 18 Italian orthodontic patients agenesis of 2nd premolars Pirinen et al., 1996 8 36 Finnish orthodontic patients

Infrapositioned/ankylosed primary molars Australian pediatric dentistry Lai and Seow, 1989 1.5 66 mean n of missing teeth 4.7 patients Bjerklin et al., 1992 10.3 19.6 19.4 Swedish schoolchildren Baccetti, 1998 5.6 15 20 Italian orthodontic patients agenesis of 2nd premolars

Ectopic eruption of first molars Bjerklin et al., 1992 4.3 3.1 6.5 Swedish schoolchildren Baccetti, 1998 4.6 11 12 Italian orthodontic patients agenesis of 2nd premolars

Enamel hypoplasia Australian pediatric dentistry Lai and Seow, 1989 0 12 mean n of missing teeth 4.7 patients Baccetti, 1998 4.2 11 16 Italian orthodontic patients agenesis of 2nd premolars

*) percentage of subjects with tooth agenesis among subjects with the anomaly **) bold indicates statistical significance as evaluated by the authors

Delayed development and eruption

Delayed development of posterior permanent teeth in association with the third molar agenesis was reported by Garn and colleagues (Garn et al., 1961). Rune and Sarnäs (1974) reported an average delay of two years, however with great variation, in a group of 85 patients with agenesis of on the average seven permanent teeth. They also reported excessive retardation of development of teeth contralateral to missing teeth. Schalk-van der Weide (1992) re-

45 ported a tendency of early developing teeth of males to be retarded in association with severe agenesis, and in females with severe agenesis second mandibular molars to be significantly delayed in development (only mandibular teeth were studied). In a sample of 135 cases, 50 % of whom had agenesis of one or two permanent teeth, an average delay of 1.5 years was recorded (Uslenghi et al., 2006), and this delay correlated with the extent of agenesis and was most prominent in positions next to the teeth that had failed to develop.

Root abnormalities

Two types of root abnormalities have been described in association with tooth agenesis. The roots may be shorter which with certain criteria is defined as short root anomaly (SRA). The prevalence of SRA was reported as 2.4 % among Swedish school children, 2.7 % among British school children and 1.3 % among Finnish university students (Lind, 1972; Brook and Holt, 1978; Apajalahti et al., 1999). The Swedish and British studies considered only the maxillary central incisors and applied a criteria of crown to root ratio bigger than 1.1, while the Finnish study measured also other permanent teeth, but required that the teeth on both sides would fill a less stringent crown to root ratio of 1. In another abnormality of root development, so-called taurodontism, root bifurcation in molars is observed on an abnormally apical level. Different methods of diagnosing taurodontism have been used and modified (Seow and Lai, 1989; Shifman and Chanannel, 1978), the main difference being the selection of reference points for the crown height and the level of root bifurcation. The reported population prevalences show a considerable variation from 7.5 to 22 %, reflecting probably differences in the study plans more than in real frequencies, i.e. whether only mandibular first molars or all molars were studied (Seow and Lai, 1989; Schalk-van der Weide, 1992; Arte et al., 2001).

Regardless of different ways of measurement and definitions, both root shortening and taurodontism have been reported to be more common in association with tooth agenesis. Tooth agenesis was reported in 46 % of Swedish school children and in 12 % of Finnish students with SRA (Lind, 1972; Apajalahti et al., 1999). In the Australian study, taurodontism was almost five and in a Finnish study two times more frequent among subjects with tooth agenesis (Seow and Lai, 1989; Arte et al., 2001), while among Dutch patients with severe agenesis it was three times more common than among controls (Schalk-van der Weide, 1992)

Root abnormalities have been attributed to an epithelial defect and more specifically to a defect of the function of the Hertwig's epithelial root sheath (Hamner et al., 1964; Seow and Lai, 1989; Apajalahti et al., 1999; Arte et al., 2001). The association between root abnormalities and tooth agenesis suggests the existence of a common primary defect. It may exert its effect independently on different processes or root abnormalities may follow secondarily from an earlier defective event. So far, taurodontism has been associated with defects in the homeobox gene DLX3 in the tricho-dento-osseous-syndrome (TDO) and defects in the EVC, presumably a Shh signaling regulator, in Ellis-van Creveld syndrome (Price et al., 1998; Ruiz-Perez et al., 2007). Shortened roots are observed in association with developmental defects of dentin formation, caused by defective collagen I and DSP/DPP. Increased frequency of tooth agenesis has also been observed in connection with osteogenesis imperfecta

46 (Lukinmaa et al., 1987). Abnormalities of root development were observed in the NFI-C null mutant mice as well as in mice with defective Patched, the Shh receptor (Steele-Perkins et al., 2003; Nakatomi et al., 2006).

Abnormal positions of teeth

Teeth developing in an abnormal position in relation to the dental arch, i.e., ectopically posi- tioned teeth, have been associated with tooth agenesis. Prevalence of ectopically erupted teeth has been estimated to be 4 to 7.8 % in the general population (Bergström, 1977; Kimmel et al., 1982; Bjerklin et al., 1992). The prevalence of ectopic maxillary canines has been reported as about 2 % (Shah et al., 1978; Ericson and Kurol, 1986), and the prevalence of palatally displaced canines among Israeli teenagers as 1.5 % (Brin et al., 1986). A longitudinal Swedish study reported that in the last examination (mean age 17.8 years) impacted canines were found in 1.8 % of study subjects, and that half of them were palatally displaced (Thilander and Jakobsson, 1968). According to this study, dental crowding was mostly related to the buccal displacement of a canine, and the persistence of a deciduous canine seen in six of the 10 cases was rather a consequence than reason for displacement of the permanent successor. Becker and colleagues (1981) showed that the risk for palatal displacement of a maxillary canine was six times higher in association with an abnormal (absent, peg- shaped or mesiodistally reduced) adjacent lateral incisor (Becker et al., 1981; Brin et al., 1986), and that the association was also detected among the relatives of the probands (Zilberman et al., 1990). On the basis of these observations, the palatal displacement was suggested to be based on local etiology, possibly due to the disturbed role of the lateral incisor root in the guidance of eruption of the maxillary canine, rather than general malocclusion or crowding (Brin et al., 1986; Brin et al., 1986; Zilberman et al., 1990).

Palatal displacement of permanent maxillary canines is associated with a four-fold higher prevalence with agenesis of second premolars (Bjerklin et al., 1992; Baccetti, 1998). Palatal canines did also occur in families together with agenesis of incisors, premolars and third molars (Svinhufvud et al., 1988; Pirinen et al., 1996). Thus, a general and presumably genetic etiology related to tooth agenesis, was suggested.

Rotation of premolars and that of maxillary lateral incisors have been found to be associated with the agenesis of the same teeth (Baccetti, 1998; Arte, 2001). Half of the patients with transposition of maxillary canines and first premolars may also present with tooth agenesis (Peck et al., 1993; Camilleri, 2005).

In the molar region, agenesis of permanent premolars and infraposition of primary molars are associated (Bjerklin et al., 1992; Baccetti, 1998). Malposition of first permanent molars occurs with a prevalence of 4.3 % (Bjerklin and Kurol, 1981) and may show familial accumulation (Kurol and Bjerklin, 1982). It has been shown to be increased among patients with premolar agenesis (Bjerklin et al., 1992; Baccetti, 1998). However, eruption failure of first molars was reported to have a significant association with rotated lateral incisors, malpositions of canines, and infraposition of the primary molars, but not with tooth agenesis or peg- shaped lateral incisors (Baccetti, 2000).

47 Enamel defects

Some authors have reported a high incidence of enamel hypoplasia among patients with tooth agenesis (Lai and Seow, 1989; Baccetti, 1998). Enamel hypoplasia was also described as a phenotypic feature in a family with recessive inheritance of tooth agenesis (Ahmad et al., 1998). The co-occurrence of enamel hypoplasia and agenesis could be explained by an underlying defect in the epithelium or a defect in signaling between the tissue layers. Failure of tooth development and enamel defects has been linked e.g. by mutants of Msx2 and Pax9 and disruption of the epithelial Shh signaling affect both tooth formation and ameloblast differentiation in mouse (Aioub et al., 2007; Kist et al., 2005; Gritli-Linde et al., 2002).

Etiology of tooth agenesis

While several potential and verified environmental (postgenetic) etiological factors for tooth agenesis have been presented, there is definitive proof that genetic factors play a major role in the etiology (reviewed by Burzynski and Escobar, 1983; Graber, 1978; Vastardis, 2000). The role of the genetic factors was suggested by observed familial occurrence, prevalence differences between populations, and association with heritable syndromes as well as by twin and family studies, but definitive evidence has been acquired during the molecular genetic era: defects in several genes have been shown to cause agenesis and anomalies in size and morphology (Table 1). On the other hand, the findings have also confirmed the complexity of the relations between genotypes and phenotypes. Postgenetic events are important even for the final manifestation of truly dominant gene defects and it is obvious that they are even more critical for action of predisposing variants considered as risk alleles.

As described above, agenesis and reduction of tooth sizes are associated. As this association is relevant from the pathogenetic point of view, some etiological factors that affect tooth size will also be discussed in the following.

Environmental factors

Tooth agenesis and tooth size reductions have been related to trauma, maternal systemic disease and various external factors (reviewed by Grahnen, 1956; Schalk-van der Weide, 1992; Arte, 2001; Hölttä, 2005). Among the maternal systemic disease, diabetes and different infections have been suggested. For example, developmental dental anomalies and tooth size reduction have been described in association of maternal rubella infection during pregnancy (Kraus et al., 1969). Maternal diabetes and hypothyroidism as well as high birth weight and length have been associated with an increase in tooth size and hypertension and low birth weight and length with a decrease in tooth dimensions (Garn et al., 1979). Small mesio-distal dimensions of the primary teeth among low birth-weight children has been described (Fearne and Brook, 1993; Seow and Wan, 2000) whereas contradictory results were obtained when permanent teeth were studied (Harila-Kaera et al., 2001; reviewed by Paulsson et al., 2004). In animal experiments, maternal low-protein diet were shown to decrease molar size and cusp number of the third molars as well as cause a delay of eruption (Holloway et al., 1961).

48 Definitive evidence for the involvement of environmental pollutants has been presented after studies of the victims of the dioxin accidents in Italy, Taiwan and Japan (Rogan et al., 1988; Wang et al., 2003; Alaluusua et al., 2004). The observed anomalies included natal teeth, delayed eruption of permanent teeth, disturbed root development, agenesis of permanent teeth and enamel defects. In utero or lactational exposure for dioxins leads to increased agenesis of the third molars as well as reduction of the size of other molars in rats (Lukinmaa et al., 2001; Kattainen et al., 2001) and increase of tooth agenesis and anomalies in rhesus monkeys (Yasuda et al., 2005). Maternal tobacco smoking has been associated with small but statistically significant reduction of tooth size (Heikkinen et al., 1994). Same kind of effects of other toxic compounds produced in urban society may be suspected.

The sensitivity of tooth development for childhood anti-cancer treatment by radiotherapy, chemotherapy and stem cell transplantation conditioned by whole body irradiation has been shown in many studies (Jaffe et al., 1984; Näsman et al., 1997; Hölttä, 2005; reviewed by Dahllöf and Huggare, 2004). The dental effects may include agenesis, microdontia (i.e. considerable size reduction), developmental delays, root anomalies and calcification defects. The effects are dependent on the age when the treatment is given. A retrospective study by Hölttä (2005) showed a correlation between the age of the anticancer therapy and the effect on specific teeth. Agenesis of first premolars was mostly observed in the patients, who had received treatment before the age of two years, whereas agenesis and microdontia of second premolars and second molars were common in the patients who were treated before the age of five years. However, in the youngest recipients under the age of two, second molars appeared unharmed. Advancing mineralization may protect the tooth from agenesis, even though a therapy coinciding with a late stage of development of a specific tooth may lead to microdontia. The correlations seem to show that the treatments are most deleterious at a rather late stage of development at the time of differentiation, suggesting that the tooth germ may regress although the morphogenesis has been nearly completed.

Is is generally held that while tooth development is under strict genetic control, jaw growth is dependent on functional demands, principally masticatory activity and needs, and also modified in the case of incomplete dentition (e.g.Brown, 1983). However, some authors consider agenesis of third molars as secondary to a reduction in jaw size (e.g. Kajii et al., 2004). Sengupta et al (1999) presented that, presumably as a result of more processed food, the failure of eruption (impaction) of the third molars has significantly increased since the Medieval Ages and especially since prehistoric times. The prevalence of agenesis could not be studied in the prehistoric samples, and they could not find a significant difference in the agenesis between the Medieval and modern samples even though the data they presented showed higher prevalence for agenesis in the modern samples. It is difficult to envision an evolutionary process or even relaxed selection acting on human dentition in such a short length of time. While the reduction of size of the second and third molars during the hominid evolution has been suggested to be driven by adaptation to the limitation of the available space in the jaws, this process has been considered as a result of selection of genotypes during a considerable length of time (e.g. Sofaer et al., 1970; Sofaer et al., 1972; see also Graber, 1978).

49 Tooth size variation and heritability

Tooth dimensions show some variation in the normal populations. The relative contributions to this variation of genetic and environmental (postgenetic) causes have been estimated either by studying correlations between first degree relatives (Sofaer et al., 1970; Alvesalo and Tigerstedt, 1974; Townsend, 1980; Potter et al., 1983) or differences in the correlations between mono- and dizygotic twins (Osborne et al., 1958; Potter et al., 1976; Dempsey et al., 1995; Boraas et al., 1988; Dempsey and Townsend, 2001). Generally, the studies among the first degree relatives have shown a considerable genetic component for both mesio-distal and labio-lingual/palatal dimensions but the heritability estimates have been rather variable. Some studies suggested lowest heritability estimates as well as higher size variation for the late developing teeth, suggesting that environmental factors would be more significant in the determination of the size of these teeth (Sofaer et al., 1970; Alvesalo and Tigerstedt, 1974). However, heritability estimates from twin studies have not supported specifically small heritabilities for the size of the later-developing teeth (Dempsey et al., 1995; Dempsey and Townsend, 2001). In their studies with 149 monozygotic and 149 dizygotic twin pairs from Australia, Dempsey and collaegues (1995; 2001) estimated that the additive genetic component would in most cases account for over 80 % of the tooth size variation. Interestingly, they found only a 60 % genetic component for first molar dimensions, explained mostly by the relatively large contribution of shared environment. For the teeth most often affected by agenesis, they found only slightly less than average heritabilities for mesio-distal dimensions of maxillary second premolars (mean 76 %) and for labio-palatal dimensions of maxillary lateral incisors (mean 72 %). These estimates imply that agenesis of these teeth is predominantly genetically determined and that the size of these teeth can independently be affected by selection and by an evolutionary process.

Twin studies on agenesis

Several studies have described tooth agenesis in identical (monozygous) and non-identical (dizygous) twins (Table 3). From these studies, it is obvious that non-identical twins have more disconcordant phenotypes. However, in several studies at least some pairs of identical twins were disconcordant for agenesis. Boruchov and Green (1971), and Townsend and collaegues (1995; 2005) found that in majority of pairs of identical twins they studied, only one of the twins presented with tooth agenesis. In addition, if monozygotic twins were concordant for agenesis, they could have had different teeth missing. In a study by Townsend (2005), three of the pairs had identical phenotypes, eight pairs had different agenesis phenotypes and in 13 pairs only one of the twins was affected. Interestingly in all 11 pairs concordant for agenesis, teeth of the same class were affected, suggesting a genetic component underlying the phenotype. These studies showed that tooth agenesis cannot be fully explained by genotype. The variability of phenotypes of identical twins suggests a relatively low penetrance of agenesis and rather high variability of phenotypic expression. Some authors have suggested that the role of genes has been overestimated (Boruchov and Green, 1971), while others consider the heredity as the most important factor but stress the variable expression and reduced penetrance. The latter has been explained by maternal factors as well as by the

50 Table 3. Twin studies on tooth agenesis monozygotic dizygotic

n pairs1) n n concordant concordant tooth group tooth prevalnce of prevalnce agenesis (%) disconcordant disconcordant concordant for concordant concordant with concordant with concordant variable expression variable expression variable Boruchov and Green, 1971 369 5.7 USA 9 2 2 ?2) 5323326 Gravely and Johnson, 1971 3 UK 3 0 3 2 0 Markovic, 1982 99; 66 Yugoslavia 9 ? 82) ?1 5005 Markovic, 1992 11 Yugoslavia 6 63) 0 60 6006 Townsend et al., 19954) 122; 101 2.2 Australia 5 33) 0 32 3003 Australia, Kotsomitis et al., 19965) 59; 42 8.4 82 6 ? 0 Belgium Townsend et al., 20056) 278 6.3 Australia 24 3 8 11 13

1) pairs of monozygotic twins; pairs of dizygotic twins. In three studies, only monozygotic twin pairs were examined. 2) identities of affected teeth not available 3) identities of affected teeth identical if peg shape included 4) includes agenesis of incisors only 5) dizygotic twins significantly less correlated, but exact figures were not reported 6) includes agenesis of maxillary lateral incisors and second premolars only intrinsic randomness of the developmental process, and especially by its self-organizing nature (Gravely and Johnson, 1971; Townsend et al., 1995; Townsend et al., 2005).

Segregation analyses in families

Different modes of inheritance for tooth agenesis have been suggested . For a definite evaluation of modes of inheritance, a segregation analysis in a large population sample together with the access to phenotype data from first degree relatives is mandatory. Grahnen (1956) performed a segregation analysis of 171 families with tooth agenesis and found that altogether 26 % of sibs and 41 % of parents of the probands were affected and that in 73 % of the families at least one of the parents was affected. He concluded that the data were most compatible with an autosomal dominant inheritance with reduced penetrance and variable expression. His data have been revisited, however, with contradictory conclusions. Suarez and Spence (1974) concluded that Grahnen’s data was best fitted to a polygenic inheritance model, while Burzynski and Escobar (1983) reinstated Grahnen’s original conclusions.

A segregation analysis by Chosack and collaegues (1975) concluded that tooth agenesis was determined by polygenic inheritance. The conclusion was based on segregation of agenesis of distinct tooth classes. Thus, agenesis of incisors or premolars were considered as separate traits even inside a family.

Schalk-van der Weide (1992) analysed segregation with cases of severe agenesis as probands while family members with any type of agenesis and even microdontia were considered as affected. Thus, severe agenesis, observed only in some family members, did not segregate in

51 the families. The conclusions were compatible with Grahnen (1956), even though the author made reservations in favor for the polygenic inheritance model.

Special attention has also been paid to agenesis and reduced maxillary lateral incisors. Man- deville (1949) and Alvesalo and Portin (1969) concluded that agenesis of these teeth followed autosomal dominant inheritance and regarded peg shape as variable expression of the same gene.

Based on prevalence and family studies, Brook (1984) presented a modification of the etiological model of Bailit (1975) combining tooth agenesis with a quasicontinuous variation of tooth size. In this model, variation of tooth size is considered to be determined by a quantitative trait. Overcoming certain thresholds leads to agenesis or formation of supernumerary teeth, i.e. continuous quantitative variation predisposes to discreet qualitative phenomena. Observations on which the model was based include association of reduced tooth dimensions (“microdontia") with agenesis and macrodontia with supernumerary teeth formation, dependence of magnitude of tooth size deviation on the amount of agenetic teeth, and a higher risk for the relatives of patients of multiple agenesis (Brook, 1984). Brook modified the model to take into account the sex differences, i.e. smaller tooth dimensions and higher prevalence of agenesis in females and higher prevalence of supernumerary teeth in males, by including separate curves of variation and separate thresholds of agenesis and supernumerary teeth formation for males and females. While proposing that the model is able to accommo- date the observations, he also made a reservation that in some cases a dominant inheritance may be involved (Brook, 1984).

Arte and colleagues (2001) presented the dental characteristics in eleven Finnish families with apparent autosomal dominant inheritance of agenesis of one or more permanent teeth called incisor and premolar hypodontia (IPH). The characteristics of these families included: x An apparent autosomal dominant inheritance, however with cases of obligatory gene car- riers who had normal dentition, especially in older generations, reflecting either reduced penetrance or difficulties of ascertainment. x Concordance of agenesis phenotypes. In all families except two, primarily or exclusively either incisor, usually maxillary lateral incisors, or second premolars were affected. x Association of dental anomalies with agenesis. In addition to peg-shape of maxillary lateral incisors, especially taurodontic molars, ectopic canines and rotated premolars were found to be associated with agenesis in these families.

Molecular genetics

The most compelling evidence for the genetic etiology of tooth agenesis has been provided by the identification of gene defects associated with different types of tooth agenesis (Table 1 and references therein). In many cases, these results are complemented by experimental mouse mutants. So far, gene defects have been identified that either cause severe tooth agenesis (oligodontia) as a sole malformation (isolated or non-syndromic agenesis) or agenesis in association with multiorgan malformation syndromes. The tooth agenesis phenotypes associated with syndromes in which the causative genes are known vary from extremely severe

52 e.g. in anhidrotic ectodermal dysplasias (EDAs) to phenotypes in which tooth agenesis resembling common hypodontia is observed only in a subgroup of patients.

Dominant defects in MSX1, PAX9 and AXIN2 have been described in families with isolated severe tooth agenesis (see Results and discussion). However, in association with defects in MSX1, nail dysplasia and some patients with oral clefts have each been described in single families (Jumlongras et al., 2001; van den Boogaard et al., 2000). In addition to causing severe tooth agenesis phenotype, a defect in AXIN2 also predisposed to colorectal cancer (Lammi et al., 2004). Recently, two defects that affected only dentition were also described in EDA (Tao et al., 2006; Tarpey et al., 2007). All these gene defects cause severe types of agenesis. However, evidence for association of specific intragenic polymorphisms to tooth agenesis, apparently consisting mostly of common types of tooth agenesis, has been presented for MSX1, PAX9, AXIN2, TGFA, IRF6 and FGFR1 (Vieira et al., 2004; Peres et al., 2005; Mostowska et al., 2006; Vieira et al., 2007).

The syndromes include, among others, ectodermal dysplasias and syndromes with oral clefting, revealing common genetic pathways for development of teeth and other ectodermal organs as well as teeth and craniofacial structures. Striking examples are EDAs, in which defects in genes coding for the signaling ligand, its receptor and intracellular mediators of the signal cause rather similar clinical phenotypes affecting teeth, hair and ectodermal glands (reviewed by Mikkola and Thesleff, 2003).

Observation of syndromic features in association with oligodontia in general (Schalk-van der Weide, 1992; Pirinen et al., 2001; Nordgarden et al., 2001) and with defects in MSX1 suggests that especially from the etiological point of view it is difficult to make strict distinction between syndromic and isolated types of tooth agenesis. Furthermore, as described above, e.g. in the Msx1 and Pax9 null mutant mice several other defects besides tooth agenesis are observed, and so far a regulatory gene that would affect only tooth development has not been identified. Therefore, a qualitative distinction between syndromic and isolated phenotypes can be made mainly concerning individual phenotypes, which may reflect different positions on an etiological scale.

In general, the identified genes that are affected in isolated or syndromic agenesis, are almost exclusively regulatory genes the functions of which in many cases have been studied in mouse. Together, identified human and mouse genes in which defects affect tooth development involve all major signaling pathways and the transcription factors mediating these signals.

Pathogenesis of tooth agenesis

While the studies described above have shown that genetic factors are most critical in the etiology of tooth agenesis in humans, they have not clarified the pathogenetic mechanisms. The studies in mouse mutants have helped to understand the underlying genetic networks and developmental consequences of disturbed gene function.

53 It has been suggested that specific vulnerability of certain teeth is explained by their anatomical position either in the distal end of the dental lamina (second premolars) or in the areas of fusion of the facial processes (maxillary lateral incisors and mandibular central incisors) (Svinhufvud et al., 1988). On the other hand, it is also well-recognized that those teeth in each tooth class are most often affected that are initiated and develop latest (Dahlberg, 1945; Clayton, 1956; Miles and Grigson, 1990). In accordance with the morphogenetic models, this suggests that agenesis follows from a quantitative defect. In terms of Butler’s field theory, agenesis can be regarded as a critical decrease of the morphogenetic potential in the periphery of the field, following either from decrease of the field strength in general or change of the steepness of the field gradient. Analogously, in terms of the clone theory, agenesis may be interpreted to follow from a decrease of odontogenic potential of the initial clones or a change in how this potential is consumed or regulated by activation or inhibition. Reduction of tooth number during evolution usually also affects the teeth that are initiated latest (Miles and Grigson, 1990; Weiss et al., 1998), suggesting that mechanisms affected in the evolutionary change may also underlie tooth agenesis. Indeed, some authors have regarded the teeth that are affected by agenesis as vestigial organs (Clayton, 1956).

Mechanisms dependent on quantitative aspects are also suggested by associations of tooth size reduction to tooth agenesis, as described above. This association and observed features of quantitative trait genetics in familial tooth agenesis were used as foundations for the models presented by Bailit (1975) and Brook (1984), which explained tooth size variation by an underlying multifactorial quantitative trait and tooth agenesis and supernumerary teeth formation mainly as extreme expressions of this variation. These concepts were supported by observations of Grüneberg (1951) in an inbred mouse strain. In this strain, the variation of the size of the third molars, determined by a quantitative trait, extended to such exceptionally small values that predisposed for agenesis, apparently precipitated by prenatal conditions. However, tooth agenesis and reduction of tooth sizes are linked also in association of defects in single genes, e.g. in EDA and also in families with mutations in PAX9 (e.g. Lammi et al., 2003). Thus, it is clear that tooth agenesis may not be solely explained by predisposition because of quantitative variation, acknowledged also by reservations made by Brook (1984). Instead, it is probable that in the pathogenesis of tooth agenesis quantitative aspects play an important role, both on the level of tooth classes and on the level of individual teeth.

Tooth size variation is limited to a certain range, apparently by regulative developmental mechanisms capable also to compensate for earlier deviations (Glasstone, 1963). Occurrence of truly microdontic teeth as observed after childhood cancer treatments (Hölttä, 2005) appears to be rather rare (personal communications). Thus, if agenesis follows from a quantitative failure, the quantitative defect must somehow be converted to a qualitative change during development. Regressing rudimentary tooth germs in wild-type animals suggests existence of developmental thresholds that need to be overcome for the development to proceed (Tureckova et al., 1995; Keränen et al., 1999). Developmental thresholds are also recognized from experimental mouse null mutants in which inactivation of specific genes arrest tooth development at specific stages (Table 1). In many of these mutants, complete inactivation of a gene arrested the development of all teeth or a whole tooth class, while heterozygotes for these mutants usually develop normal dentition. Transgenic mice with hypomorphic alleles of Pax9 showed that quantity of activity of a single gene is critical for tooth development

54 and that decreasing this activity leads to gradually more severe phenotypes, the most sensitive teeth being the ones that develop latest. These mice also connected retarded development to agenesis and suggested that developmental arrest may happen at several stages, even at late bell stage (Kist et al., 2005).

Models for the effects of a quantitative change in the amount of a single gene product are also provided by mutants, in which a signaling gene is overactivated or the level of an antagonist is manipulated (Table 1). Particularly interesting are mutants in which Eda is overexpressed in the epithelium or in which signaling antagonists ectodin (antagonist of BMP and Wnt signaling), Sprouty2 or Sprouty4 (antagonists of FGF signaling) are inactivated (Mustonen et al., 2004; Kassai et al., 2005; Klein et al., 2006): in these mice supernumerary teeth develop from rudiments that are arrested in wildtype mice, thus overcoming developmental thresholds. Arrest of organ development at certain stages have been seen as a mechanism for evolutionary change in dentition (Keränen et al., 1999; Peterkova et al., 2002; Klein et al., 2006) but these mice may also serve as useful models for tooth agenesis in humans and for the role of individual genes and genetic networks.

The pathogenesis of human tooth agenesis is perhaps best understood in anhidrotic ectodermal dysplasias. In this case the molecular pathogenesis and the phenotypes in human patients and mouse mutants are directly comparable. The gene defects in EDA, EDAR, EDARADD, IKKJ and their mouse homologs, i.e. the signaling ligand, its receptor and the intracellular mediators of the signaling, cause complete inactivation of this signaling pathway (reviewed by Mikkola and Thesleff, 2003). In the mutant mice, incisors and third molars commonly fail to develop and first molars are hypoplastic, while in the patients with anhidrotic ectodermal dysplasia, both dentitions are severely affected and tooth morphology is simplified (Pispa et al., 1999; Präger et al., 2006; Lexner et al., 2007). The phenotypes of the mice with impair- ment or overexpression of Eda signaling suggest that early defects of ectodermal placodes and, in teeth, the enamel knots would explain the ectodermal defects in human patients (Pispa et al., 1999; Mustonen et al., 2004). Thus, failure of signaling at an early stage leads to anomalies that are present also in the deciduous dentition. On the other hand, as the mutant and disease phenotypes are caused by complete inactivation of the signaling pathway, the partial albeit severe tooth agenesis phenotypes suggest redundancy in the function of the signaling pathways, i.e. that different signaling pathways have overlapping functions. This redundancy adds a further element explaining how different gene defects may cause partial agenesis.

In the report of the first identified gene defect in MSX1, the authors suggested that the partial and selective tooth agenesis reflected a patterning defect possibly related to the “odontogenic homeobox code” underlying the development of different teeth (Vastardis et al., 1996). They suggested that the defect had a dominant negative effect but showed later that it caused loss of function (Hu et al., 1998). As described later (see Results and discussion), the gene defects in human MSX1 and PAX9 are essentially loss of function mutations and cause haploinsufficiency by reducing the amount of the functional protein to one half (Hu et al., 1998; Das et al., 2002; Nieminen et al., 2003). Thus, it is probable that the selective tooth agenesis is explained by differential sensitivity to gene dosage. The phenotypes of the hypomorphic Pax9 mutants (Kist et al., 2005) show that the late developing posterior molars are especially

55 sensitive for a reduced Pax9 dose. The functions of mouse Msx1 and Pax9 are best understood as regulators of the signaling needed for the formation of the enamel knots (Peters and Balling, 1999; Jernvall and Thesleff, 2000), and this function has been connected with tooth agenesis in humans (Thesleff, 2006). It is not clear, however, how this relates to the selective tooth agenesis that affects mainly some teeth in the permanent dentition, i.e. secondary teeth and permanent molars. The pathogenesis of MSX1 and PAX9 defects will be discussed further in the General discussion.

The phenotypes in the family segregating a nonsense mutation of AXIN2 are striking in a sense that even in the two cases when only three permanent teeth had developed, the primary dentition was intact (Lammi et al., 2004). This suggested that AXIN2 function is especially important for the processes involved in tooth replacement and development of the permanent molars. So far, excess E-catenin levels have been mainly associated with enhancement of development and renewal of ectodermal organs (Gat et al., 1998; Alonso and Fuchs, 2003; Järvinen et al., 2006; Blanpain et al., 2007). The function of AXIN2 as a negative feedback regulator suggests that it is needed at defined stages of tooth development to downregulate E-catenin activity. However, no data exist on the consequences of overactivation of E- catenin activity in the dermis or dental mesenchyme. Furthermore, it has been shown that the Axin2 null mutant mice develop a craniosynostosis phenotype as a result of increased proliferation and differentiation potential of calvarial osteogenic cells (Yu et al., 2005). AXIN2 haploinsufficiency may affect the regulation of the relationship between the tooth germs and the bone which may be critical for the long development of the teeth that were affected in association with the AXIN2 gene defects.

Tooth agenesis and cancer

The connection between tooth agenesis and cancer predisposition as a consequence of AXIN2 defects is explained by the critical role of Wnt signaling in tooth development (Andl et al., 2002; van Genderen et al., 1994; Järvinen et al., 2006) and the major contribution of the deregulation of intracellular E-catenin levels to carcinogenesis (reviewed by Segditsas and Tomlinson, 2006; Giles et al., 2003). It is intriguing to consider a more general connection between tooth agenesis and cancer predisposition and that tooth agenesis could in some cases be an indication of the latter.

Importance of epigenetic events for the outcome of tooth agenesis suggests that agenesis may in some cases reflect inherited developmental instability. Increased cancer risk has been associated with developmental instability, developmental anomalies and evolutionary change (Narod et al., 1997; Galis, 1999; Galis and Metz, 2003). On the other hand, it has been suggested that major hereditary contribution to cancer is given by largely unknown alleles of low penetrance (Amundadottir et al., 2004; de la Chapelle, 2004), and some of these alleles may also contribute to the background of tooth agenesis. It is conceivable that defects in other genes, in addition to AXIN2, involved in Wnt signaling and regulation of E-catenin level may also link tooth agenesis and cancer predisposition. Interestingly, it has been shown that expression of MSX1 is reduced in cervical cancer cells and that MSX1 stabilizes p53, a well known tumor suppressor protein (Park et al., 2005).

56 HUMAN GENETICS AND GENE DEFECTS

The human genome

During the last hundred years, significant understanding of the basis and mechanisms of heredity has accumulated. Major steps in this process include recognition of the significance of Mendel’s laws, understanding that chromosomes carry the heritable determinants, discovery of the structure of DNA and deciphering of the genetic code, development of the recombination DNA technology, and, finally, ability to catalogue whole genomes at the DNA sequence level (reviewed by Dunwell, 2007). Application of increasingly powerful genetic mapping and positional cloning methodology has led to the identification of thousands of disease causing loci, and tens of thousands of individual gene defects. The international efforts to catalogue the DNA sequence of the whole human genome, first drafts of which were published in 2001, made identification of disease causing gene defects even more straightforward, and have made it possible to understand genotype-phenotype relationships at a higher, whole genome level. This is facilitated by technological as well as conceptual advances re- garding the genome structure and abilities to consider, in addition to single genes, whole gene networks, and to extract information based on conservation of sequences in the genomes of different species (reviewed by Kidd et al., 2004; Boffelli et al., 2004).

Human genome consists of 22 pairs of autosomes, two sex-determining chromosomes, and the mitochondrial DNA. One of the sex-chromosomes with one from each autosome pair constitute a haploid genome, which is inherited from each parent and after random segregation and crossover events transferred to a child. MtDNA is inherited in the ovum from the mother to the child. In a process of producing gametes, meiosis, approximately 35 crossover events reshuffle parts of the parental chromosome pairs, and the resulting jigsaws become transmitted to the progeny, thus determining the so-called genetic length of the genome as 35 Morgans. A haploid genome of a gamete contains approximately 3.1 * 109 basepairs. Ac- cording to current statistics, the human genome contains approximately 20000-25000 protein-coding genes (Little, 2005; see also http://www.ensembl.org). In addition, the gene maps in public access internet databases contain a lot of potential predicted genes. The usage of alternative transcription start sites and an alternative mRNA-processing (“splicing”) makes it possible to produce a much larger amount of different proteins than is the amount of genes in the genome. The gene content is also complemented by an increasing amount of non-protein-coding RNA genes including the micro-RNAs (Cobb and Duboule, 2004; Hobert, 2007). The genomic length covered by the genes accounts only for one fourth of the whole genome length, and the actual protein coding sequence has been estimated as only two % of the genome length. However, the non-coding sequence contains important regulatory and structural elements affecting gene expression and genome maintenance, and also a lot of conserved elements of as yet unknown significance. Remarkable part of the genome is covered by different types of repeat elements (Levy et al., 2007). Several gene families exist where extensive gene duplications create variation between individuals (Freeman et al., 2006). Finally, whole genome sequencing has revealed the extent of genetic variation, ranging from large sequence blocks to single nucleotide changes (reviewed by Kidd et al., 2004; Feuk et al., 2006).

57 Figure 6. Common types of sequence changes in an idealized “gene” (exons and introns are usually significantly longer!). Exonic sequences are written with capital letters and promoter and introns with lowercase. Examples of sequence changes are shaded. Codons and a CA- repeat in the intron are underlined. Sequence changes that do NOT change an amino acid, affect the reading frame or create a stop codon, may affect regulation of the gene activity or mRNA processing (splicing). Appearance of a termination (“stop”) codon as a result of a mutation often leads to degradation of the mRNA instead of translation to a truncated protein.

Variation

Chromosomal aneuploidies and major chromosomal abnormalities account for the most gross, usually rare forms of genetic variation. While aneuploidies and most abnormalities (large deletions, partial trisomies and most translocations) are not inheritable, some of the less deleterious deletions and translocations may be transmitted to progeny. The genetic variation transmitted from a generation to another includes duplications and deletions of large sequence segments as well as repeat elements (Kidd et al., 2004; reviewed by Feuk et al., 2006; Levy et al., 2007). The repetitive sequences are common in the centromeric regions of chromosomes (satellite DNA) but they may also exist in regions of euchromatic DNA, and involve functional genes. Repetitive sequences of short fragments from two to a few basepairs (short tandem repeat polymorphisms, STRPs, also called microsatellites) have been extensively used as genomic markers in construction of genetic maps and in localization (mapping) of disease genes (Weissenbach et al., 1992; Dib et al., 1996). Most abundant variation, however, consists of single nucleotide polymorphisms (SNPs), insertions and deletions (Kidd et al., 2004) (Fig. 6). The human genome contains over 10 million SNPs (Feuk et al., 2006; Estivill and Armengol, 2007). On the average a polymorphic SNP occurs once in 300 basepairs (Feuk et al., 2006). In the genome of one individual more than two million sites may be heterozygous (Levy et al., 2007). Different genomic variants and alternative

58 sequences of the polymorphisms are called alleles. While only a small fraction of the variation affects protein structure (variation in exons affecting codons), silent changes and variation outside the coding regions are regarded potentially important for gene regulation and evolutionary change.

Sequencing of whole human genomes has also revealed a substructure of chromosomes, called haplotype blocks (reviewed by Wall and Pritchard, 2003). These blocks reflect different magnitudes of linkage disequilibrium between SNPs made possible by uneven distribution of meiotic crossing-over events during generations.

Already before the whole genome sequencing, the observed sequence variation made it possible to construct high density genetic maps of the human genome to serve as frameworks in the disease gene mapping (Donis-Keller et al., 1987; Weissenbach et al., 1992; Dib et al., 1996). The first maps were based largely on restriction length polymorphisms, usually caused by SNPs (Donis-Keller et al., 1987), followed by microsatellite maps (Weissenbach et al., 1992; Dib et al., 1996). These were followed by the physical maps and subsequent whole genome sequencing (Cohen et al., 1993). Along with the whole genome sequencing, SNP-based mapping methodology has become reasonable (Kruglyak et al., 1997).

From genotypes to phenotypes

Malformations and other genetic diseases may be caused by a defect (“mutation”1) in a single gene and usually then follow Mendelian inheritance (OMIM, http: //www.ncbi.nlm.nih. gov/OMIM; Fig. 6). Gene defect may cause a disorder either when present as one copy, i.e. in a heterozygous state (dominant diseases) or only when both gene copies are defective (ho- mozygotes or compound heterozygotes in recessive disorders). The consequence of a gene defect may be loss of function, gain of a new function or it may also prevent the function of the unaffected allele (dominant negative). The genetic factors present in an individual constitute the individual’s genotype. The phenotype (the appearance, fitness and health of an individual) is a result of an interplay of the genotype and postgenetic factors, i.e. epigenetic, maternal, and environmental factors.

Similar phenotypes may be caused by defects in different genes (genetic heterogeneity) as seen in many malformation syndromes such as craniosynostosis syndromes or anhidrotic ectodermal dysplasias (reviewed by Wilkie, 1997; Mikkola and Thesleff, 2003). Allelic het-

1 Sequence variants that cause a phenotype and are rare (e.g. gene frequency less than 0.01) have traditionally been called mutations, whereas more common variants have been classified as polymorphisms. This relates to the thinking that rare causative sequence variants are considered results of recent mutation events because due to harmfulness they tend to vanish from the population gene pool. However, recessive gene defects can be very old because of no selection against them. Furthermore, all sequence variants are results of mutations. A frequency criterium does neither reflect the real contribution of a sequence variant to the pathogenesis. For this reason, it could be more appropriate e.g. to use terms gene defect for variants that have high penetrance and risk allele for variants that have low penetrance (and may be common in the population). Still, there remains the problem of determining the limit between high and low penetrance. One criterium could be whether the disease phenotype caused by the variant can or can not be shown, respectively, to follow Mendelian inheritance.

59 erogeneity, a form of genetic heterogeneity in which a disease may be caused by different gene defects in a single gene, is according to current view rather a rule than exception when malformations or single gene diseases are considered (Weiss, 1996; Wilkie, 1997). In some cases, allelic – or even identical - gene defects may also cause phenotypes or diseases that are or have been considered separate entities as in the case of gene defects in p63, IRF6 and the genes for the FGF receptors (reviewed by van Bokhoven and McKeon, 2002; Kurotaki et al., 2002; reviewed by Wilkie, 1997). For example, defects in the FGFR2 have been found in several craniosynostosis syndromes, and in some cases identical amino acid changes have been identified in patients with diagnoses of different syndromes (Wilkie, 1997).

In many diseases, the correlation between the genotype and phenotype is strong and they follow Mendelian inheritance. In these cases, such as many diseases of the so-called Finnish disease inheritage, it has been relatively straigthforward to localize the disease-causing gene. However, the relationship between a genotype and a phenotype may also be rather complex. The dependence of the phenotype on other genetic factors (“modifier” genes or “genetic background”), epigenetic and external factors is reflected as different degrees of variable expressivity (different phenotypes among individuals) and often as reduced penetrance (some individuals with no disease even though the individual carries the gene defect or genotype associated with the disease). Redundancy between genes and genetic pathways may mask the effects of loss of function mutations. Diseases, in which a single gene has a major effect, usually follow Mendelian inheritance patterns (exceptions are diseases with genomic imprinting, i.e. effect of a parent's sex, and diseases caused by repeat expansion), albeit often with reduced penetrance and variable expressivity. These may include hypomorphic defects that by definition cause only a partial loss of function of the affected allele (Strachan and Read, 1999). It is thought that non-Mendelian or "complex" diseases are caused by defects (or rather risk variants or risk alleles1) that have low penetrance which may be considered as having only a predisposing effect and usually require contribution of other genetic factors (polygenic diseases) or extrinsic factors (multifactorial diseases) to cause the disease (Strachan and Read, 1999; Reich and Lander, 2001; Peltonen et al., 2006). The borderline between "Mendelian diseases" and "complex diseases" may often be, however, rather arbitrary, as are borderlines between alleles of "high" and "low" penetrance. It is assumed that defects in single gene diseases usually reside in the protein coding region, affecting the reading frame or the protein sequence, while risk variants rather affect the sequences important for the regulation of gene expression (Reich and Lander, 2001; Peltonen et al., 2006) (Fig. 6). Genes, in which coding region defects have been identified, are often first candidates also in search of the risk variants.

Gene identification

To identify gene defects that cause a genetic disease, two approaches exist. It is possible either to study candidate genes or perform a genome-wide search. Candidate genes can be subjected to sequence analysis, either by sequencing or indirect methods, or, if possible, the expression levels in the patients can be compared to those of healthy controls. Candidate genes can also be studied by genetic analysis based on linkage or association. Genetic analysis is usually able to detect also the involvement of sequence variants that reside outside the cod-

60 ing region and may affect the regulation of gene expression. However, genetic analysis is possible only if a reasonable amount of patients is available. If the candidate gene approach has not provided positive results or is not feasible and a suitable sample of patients is available, a genome-wide search, also called positional cloning, can be performed.

Figure 7. Recombinants and non-recombinants. During meiosis, parental chromosomes are randomly segregated to the gametes. An individual is a recombinant with respect to two genes or polymorphisms (A and B) if he or she inherits alleles (A/a and B/b) originating in different grandparents. Expected proportion of recombinant progeny decreases from 50 % if the loci are located so near each other that the expected amount of crossovers of the parental chromosomes between the loci during meiosis decreases.

Two properties (diseases, phenotypes, sequence variation) are segregated randomly if their genotypic determinants reside in different chromosomes or in the same chromosome but reasonably far from each other, allowing a good chance for crossover events between them (Terwilliger and Ott, 1994; Strachan and Read, 1999). In this case, recombinant and non- recombinant progeny are observed with similar frequency (individual who inherits alleles of two genes from one parent that originated in different grandparents is called a recombinant, see Fig. 7). If they are located relatively near each other in a chromosome, crossovers between them are rare. As a result, they will segregate nonindependently, i.e. be in linkage, and a fraction of recombinants will be less than one half. Thus, the estimate of the recombination fraction can be used to estimate the genetic distance of two genotypic determinants, forming the basis of linkage analysis (Terwilliger and Ott, 1994).

With experimental or domestic animals, the recombination fraction can be estimated simply by counting the progeny with different phenotypes and evaluating the statistical significance of the observations. In human genetics, for diseases following (reasonably closely) Mende- lian inheritance, a mathematical method based on evaluating observations from pedigrees may be used. In this method, a total likelihood is calculated for the observations assuming different hypotheses, these in this case being different recombination fractions, i.e. distance of the disease locus and the analysed DNA marker. A 10-based logarithm of a likelihood ratio assuming linkage (recombination fraction less than 0.5) and non-linkage (recombination fraction 0.5), usually called the lod (logarithm of odds) score is used as an indicator of significance of results (Terwilliger and Ott, 1994). A lod score > 3 was initially considered significant, this score meaning that, with a given recombination fraction, a linkage is 1000

61 times more probable than the null hypothesis of non-linkage. A more stringent limit than e.g. the commonly used limit of p-value of 0.05 is necessary because of the inherent multiple testing. Even more stringent limits for significance have been suggested, based on experi- ence and theoretical considerations, especially in complex diseases (Strachan and Read, 1999).

In practice, the lod score method of gene mapping can be utilized if a reasonably large single family or many separate families are available (the lod scores are additive if the families share a common genetic background). For traits following dominant inheritance, it may be possible to obtain significant evidence for linkage with a single pedigree of 10-15 affected individuals, or alternatively, with several pedigrees. Recessive traits require several families with at least two affected children. Increasing the sample size provides better possibilities for limiting the locus size in terms of a recombinant free region. The locus identification becomes less cumbersome, if a founder effect can be assumed in the history of the population or as a verified consanquinity loop (Terwilliger and Ott, 1994; Kere, 2001). In these cases linkage disequilibrium may be utilized. In recessive traits with a founder effect, regions of homozygosity have been searched utilizing samples of just a few affecteds (Nikali et al., 1995; Pekkarinen et al., 1998). Etiologic or genetic heterogeneity and high disease gene frequency, on the other hand, tend to make the analysis less straightforward. The same follows from reduced penetrance. The stringency of a genotype to a phenotype relation becomes weaker, decreasing the power of the statistical analysis.

Several computer programs have been developed for the estimation of the recombination fraction. The popular programs were based on the algorithm by Elston and Stewart (Lathrop et al., 1984). However, more effective algorithms have been developed for purposes of multipoint analysis that evaluate linkage along a haplotype rather than with a single polymorphic marker. These are implemented e.g. in GeneHunter and Simwalk (Kruglyak et al., 1996; So- bel and Lange, 1996).

In the case of the so-called complex diseases, the penetrance is so low that an inheritance pattern can not be determined (Strachan and Read, 1999; Freimer and Sabatti, 2004). In these situations the so-called non-parametric methods of analysis can be applied. These are based on estimations of allele sharing among affecteds, either as identical-by-state (ibs) or as identical-by-descent (ibd). Software packages such as Mendel, GeneHunter and Simwalk implement these algorithms to offer elaborate statistical indicators for linkage (Kruglyak et al., 1996; Sobel and Lange, 1996).

Within complex phenotypes or diseases, because of a low occurrence of affecteds in one family, a different kind of strategy based on analysis of allelic association may be used (Strachan and Read, 1999; Freimer and Sabatti, 2004). A presumption for this analysis is that the affected individuals to a large extent share same predisposing genetic factors, i.e. ancestral sequence variants. Instead of collecting large families, allele and genotype frequencies may be measured in a large sample of unrelated affected individuals and compared to frequencies among an equivalent sample of unaffected controls (case-control-design). Devia- tions from expected frequencies may be taken as proof of a causative role of the studied variant itself or of a linkage disequilibrium with a causative genetic factor. An inherent problem

62 of the selection of an adequate control group can be avoided if instead of allele frequencies, frequencies of transmission of alleles from parents to offspring is estimated (e.g. transmission disequilibrium test, TDT). The results of association analyses should be regarded critically, and for reliable results, large samples shall often be studied, or positive results repli- cated in other studies.

A further methodology in genetic reseach involves mapping of quantitative traits. The sam- pling strategies are similar as in association analysis but instead of discrete phenotypes, correlations of quantitative measures to the observed allele frequencies are estimated (Mackay 2001).

Technological development has greatly increased the possibilities for genome-wide studies. Instead of microsatellites, SNP genotyping using DNA-arrays is becoming a method of choice (Carlson et al., 2004). The final step of the process, sequence analysis, has also become fast and economical and new technologies are emerging. Thus the greatest limitation, in addition to funding, most probably is the identification and recruiting of a reasonable large sample of patients.

63 AIMS

The aim of the present study was to identify genes and gene networks that participate in the development of teeth and dentition. For this purpose, the study into the congenital defects of human dentition was undertaken. More specifically, the aim was to study x the inheritance of the incisor and premolar hypodontia, one of the most common congenital malformations in humans, and identify causative genes x the involvement of candidate genes into the etiology of the incisor and premolar hypodontia x the involvement of the candidate genes into the severe tooth agenesis in humans x the co-expression of genes during tooth development by developing a bioinformatic tool for this purpose.

64 MATERIALS AND METHODS

Subjects

The criterion (I, IV) for selecting persons with hypodontia (probands) was the congenital absence of one to six permanent teeth or the presence of peg-shaped permanent upper lateral incisors. The probands were non-syndromic patients at the Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki. The probands and/or their parents were interviewed of the occurrence of hypodontia in their families. The study population comprised nine probands with hypodontia and their family members, totaling 149 individuals in nine Finnish families (Fig. 8; Table 4). From these, five families with 42 family members participated in the study on involvement of MSX1 and MSX2 to tooth agenesis (I). Seven families were selected for the genome wide search (IV).

Information concerning general health was obtained by interview. A clinical dental examination of the probands and their family members was performed by three experienced ortho- dontists (S.A., S.P., I.T.). In addition to hypodontia, other visible dental abnormalities were recorded. Panoramic radiographs were taken, if this was necessary for the diagnosis. In some cases, information on hypodontia was confirmed from documents and radiographs in dental files. In addition, retrospective dental data were collected by questionnaires and from dental files. Agenesis of the third molars was excluded because reliable retrospective data on them were incomplete. Children under six years of age were excluded from the study.

The proband of family 1 in (II) was originally referred for treatment to the Pediatric Dental Department of the Hospital for Children and Adolescents, Helsinki University Central Hos- pital. The proband of family 2 was referred for consultation and treatment to the Department of Pedodontics and Orthodontics. The diagnosis of missing teeth was based on clinical and radiographic examinations. Retrospective dental information was collected from dental files. Agenesis of third molars was not possible to diagnose in the proband and in two brothers of the proband in family 1 because of their young ages.

We studied eight individuals with a deletion in the short arm of chromosome 4 (III). Seven of them had been diagnosed as Wolf-Hirschhorn syndrome patients while one was included in the study because of the presence of a 4p deletion. Their ages ranged from 5.8 to 21.7 yrs. Initial diagnoses had been made in the University Hospitals of Helsinki, Turku, or Tampere and been confirmed in early childhood with cytogenetics or fluorescence in situ hybridization (FISH). Congenitally missing teeth were assessed from panoramic radiographs. Of two patients from Rinnekoti Central Institute, two panoramic radiographs with several years' in- terval were available. In case of obscure regions in radiographs, the number of erupted teeth was confirmed in clinical examination. Signs of enamel hypoplasia and severely worn dentition were also recorded. The anatomy of the palate and structure of hair and nails were recorded in a clinical examination or obtained from patient records.

The studies were approved by the Ethics Committee of the Institute of Dentistry, University of Helsinki. The study was conducted with the consent of the parents and the Rinnekoti Cen- tral Institute.

65 Table 4. Agenesis phenotypes in the incisor and premolar hypodontia families

family gen:id*) agenesis**) family gen:id*) agenesis 1 II:1 15 9 IV:6 peg 12 1 II:4 35 9 IV:8 35 1 II:6 35 9 IV:10 35 1 III:1 25, 35, 45 9 IV:11 15 1 III:2 35 9 IV:13 35 1 III:4 45 9 IV:17 35, 45 1 IV:1 35, 45 11 II:2 25 2 II:3 31, 41 11 II:4 35, 45 2 III:3 peg 12, peg 22 11 III:2 12, 22, 15, 25, 35, 45 2 IV:2 12, 22 11 III:3 35, 45 2 IV:3 12, 22 11 III:5 45 3 II:2 31 12 II:4 35, 45, peg 12, 22 3 III:1 peg 12 12 II:6 premolars 6 I:1 12, 25, peg 22 12 II:8 13, premolars 6 II:2 12, peg 22 12 II:10 15, 25, 35, 45 6 II:4 15, 35 12 II:12 14, 15, 25, 31, 35, 41, 45 6 II:5 peg 12, 22 12 III:4 35, peg 15 6 III:3 15, 35, 45 12 III:8 12, 22, 53, 63 7 I:1 peg 22 12 III:10 35, 45 7 II:1 15, 25 12 III:11 12, 22, 41, peg 31 7 III:1 15, 25 12 III:12 31, 41, 35 7 III:2 25 12 IV:1 15, 25, 35, 45, 27, 34 9 II:2 35 20 I:2 15, 25 9 III:4 peg 12 20 II:5 15, 25, 35 9 III:9 35, 45 20 II:7 15, 25 9 III:13 15, 25, 35 20 III:2 12, 35, 45 9 III:15 35 20 III:3 15, 25 9 III:18 14, 15, 24, 25, 35, 45 20 III:7 35 9 III:19 15, 25 20 IV:1 35, 45 9 III:22 35 20 IV:2 35, 45, cleft soft palate 9 IV:1 25 20 IV:3 peg 22 9 IV:3 31, peg 12 20 IV:4 15, 35, 45

*) generation:subject in order from the left (compare to Fig. 8) **) missing teeth expressed as the FDI notation; peg, peg shaped incisor

DNA isolation

Venous blood samples, 10 to 20 ml, were taken for DNA analyses from all available family members. DNA was extracted from leukocytes according to standard procedures (Vanden- plas et al., 1984). DNA-samples of family 12 were isolated from venous blood samples by the DNA isolation service of the National Public Health Institute of Finland, Biomedicum, Helsinki, using a Autopure TM DNA purification system (Gentra, Minneapolis, MN, USA).

66 Figure 8. Pedigrees of families with autosomal dominant inheritance of incisor and premolar hypodontia. Squares, males; circles, females, black, affected; open, unaffected; ?, possibly affected; dot, carrier. For description of phenotypes, see table 4. Please note that different numbers for families were used in Arte, 2001, and Arte et al., 2001.

Genotyping

The polymerase chain reaction (PCR) with amplifiable microsatellite markers was used for assessing the genotypes of the individuals (I, IV). PCR primers were obtained from Ge- nethon, France, or from the Department of Clinical Genetics, University Hospital of Upp- sala, Sweden, or they were synthesized in the Laboratory of Human molecular genetics of the National Public Health Institute, Finland, or bought from TAGC, Copenhagen, Denmark or Oligomer Oy, Helsinki, Finland. When radioactive detection of PCR products was used, one of the primers was 5‘- end–labeled with 32P-phosphate with T4 kinase (Amersham, UK; Pharmacia, Sweden). PCR reactions were done in a Perkin-Elmer Cetus Thermal Cycler 480 (Norwalk, CT, USA) or DNA Engine (MJ Research, MA, USA) in a total volume of 15 µl containing 4 ng/ul chromosomal DNA, 0.4 uM of each of the primers, 0.2 mM of each of the deoxynucleotides, 0.25 U of enzyme, and 1.5 mM MgCl2 in a standard PCR buffer. Either Taq-polymerase (Amplitaq, Perkin Elmer Cetus, Ca), Dynazyme II or Dynazyme Ext (Finn- zymes, Finland) were used. 32P-labeled PCR products were made 50% of formamide and 10 mM of EDTA, pH 8.0, and separated in a 5% sequencing gel with 7.5 M urea in an IBI gel apparatus. Alleles were detected by autoradiography with Kodak films exposed for 15 to 48 hours and analyzed manually. Fluorescently labeled PCR products were analyzed in an ABI 377 sequencer (Applied Biosystems, Foster City, CA). Fluorescent alleles were detected

67 with ABI Genescan software and identified with ABI Genotyper software. For families 11, 12, and 20 genome-wide genotyping of 365 microsatellites was provided by the Finnish Ge- nome Center, Biomedicum, University of Helsinki, Finland. The genotype data were stored and organized with dBase IV 5.0 for Windows software (Borland International, USA).

Linkage analysis (I, IV)

In the linkage studies (I, IV), the lod score method served for evaluation of the existence of linkage (Ott, 1974). The hypodontia locus was modeled as an autosomal dominant, two- allele system with a gene frequency of the hypodontia allele of 8%. A penetrance of hypodontia of 86% was used (Burzynski and Escobar, 1983). The informativeness of the family material was evaluated with the Slink software package, assuming an autosomal dominant model and gene homogeneity (Ott, 1989). Allele frequencies for marker alleles were calculated from observed genotypes if data from a reasonable amount of founders was available, otherwise equal allele frequencies were used. The pairwise lod scores for different recombination fractions were estimated by the Mlink and Ilink options of the Linkage package, ver- sion 5.1 7 (Lathrop et al., 1984). The multipoint location scores (corresponding to lod scores) were estimated with Simwalk software (Sobel and Lange, 1996) which was also used for testing of genetic heterogeneity. In affecteds-only analyses, the phenotypes of the unaffected individuals were coded as unknowns.

Sequencing (II, IV)

For the sequencing analysis, exons of MSX1, PAX9, AXIN2 and TGFA were amplified in PCR by Dynazyme Ext polymerase (Finnzymes, Espoo, Finland). For analysis of exons of PAX9 in II, PCR products were purified from agarose gels by Qiaquick gel extraction kit (Qiagen, Bothell, Wa). Both strands of the PCR products were sequenced in both directions with ABI BigDye terminator chemistry (Applied Biosystems, Foster City, CA) and analyzed on an ABI 377XXL DNA sequencer. For other sequencings, PCR products were purified with ExoSAP-it reagent (USB, Cleveland, Ohio) and sequenced in both directions with ABI BigDye v.3.1 sequencing reagents. Sequencing products were analysed in the ABI 3730 cap- illary instrument in Molecular Medicine Sequencing laboratory, Biomedicum Helsinki. Primers as well as PCR and sequencing conditions were as described earlier (Nieminen et al., 2001; Lammi et al., 2003; Lammi et al., 2004) or as summarized in Table 7. Sequencing results were compared by BLAST2 (http://ncbi.nlm.nih.com/gorf/ bl2.html) with EMBL entries M76731, M76732 (MSX1), AJ238381, AJ238382, and AJ238383 (PAX9) as well as genomic sequence entries from NCBI NT_010783.13 (AXIN2) and NT_022184.14 (TGFA).

FISH Analysis (III)

Chromosome preparations for FISH were made from cultures of blood lymphocytes. DNA samples from cosmid clones 2A1 and 15A2, spanning a region of 40 kb and containing the entire MSX1 coding region (gift from Dr. Jane E. Hewitt), were labeled with biotin 14-dATP by means of a BRL-nick translation kit (Bethesda Research Laboratories, Gaithersburg, MD, USA). Denaturation of the target cells, hybridization, and detection were carried out as described elsewhere (el-Rifai et al., 1995).

68 Table 7. Conditions and primers for the sequence analysis of MSX1 and TGFA

PCR sequencing ann. T, add ann. exon primer sequence*) add cycles**) DMSO T***)

MSX1 1 F CCCGGAGCCCATGCCCGGCGGCTG hot 64 32x 5 % 60 1 M R CTCCCTCTGCGCCTGGGTTCTGGCT Betaine 2 F ACTTGGCGGCACTCAATATC hot 59 32x 2 % 59 R AGAGGCACCGTAGAGCGAG

TGFA 1 F GGTAGCCGCCTTCCTATTTC hot 58 32x 58 R GCAGCCAGGTAAGCAGGTAG 2 F GTGCTTTTCATGGGCATTTT hot 58 32x 58 R GAGCTCTTGAGGAGCCACAC 3 F TGGAAAGCACGCTATACAGG hot 58 32x 58 R CCATGAGTGACCTGAGATGC 4 F CTCCAGGATTTGGCACAGTC hot 58 32x 58 R ATACTGCGGATGTCCCTGGT 5 F GGGTAGCCAACAGATGCTTT hot 58 32x 58 R TTCCTTTTCTCCTCTCTTCCTG 6 F CCACCCCTTACAGGATCTGA hot 58 32x 58 R CCGTCTCTTTGCAGTTCTTTT

*) all primers were used in the final concentration of 1 uM **) hot start, annealing temperature, number of cycles ***) annealing T, 25 cycles

Gene expression data collection (V)

The data on expression of genes were collected mostly from published literature and to a smaller extent from direct submissions from the researchers. The data was first collected to a form on paper and subsequently stored to tables designed in dBase 5.0 for Windows software. Standardized schematic drawings were used to indicate subtissue-level resolution and gradients of expression when unambiguous illustrations were available. The drawings were made in CorelDraw v. 5 to 8 (Corel Corporation, Ottawa, Canada) and exported in JPEG format.

WWW implementation (V) dBase 5.0 for Windows scripts were written to produce WWW-pages in HTML format for gene lists, pages for individual genes and notes. The pages were stored in the WWW-server of the Institute of Biotechnology, University of Helsinki, Finland, and updated with regular basis.

69 RESULTS AND DISCUSSION

MSX1 and PAX9 in dominantly inherited severe tooth agenesis (publications II and III)

During the studies described in this thesis, researchers elsewhere made important contributions to clarify the genetic basis of human tooth agenesis. It was shown that the mouse null mutants of Msx1 and Pax9 did not develop any teeth, but development was arrested at an early stage (Satokata and Maas, 1994; Peters et al., 1998). Vastardis and collaegues in the Harvard university (1996) identified a missense mutation in the MSX1 homeobox that was associated with dominantly inherited severe tooth agenesis (oligodontia) in a family of Afri- can origin. Later this mutation was shown to disturb the three-dimensional folding of the MSX1 protein and its ability to bind to its cognate DNA sequences (Hu et al., 1998). A few years later, Stockton and collaegues (2000) identified a frameshift mutation within the DNA- binding paired domain of the human PAX9 gene in an American family segregating severe agenesis. These first findings suggested that defects in these two genes were associated with somewhat different types of agenesis. In the family segregating the MSX1 mutation, the agenesis rather uniformly affected second premolars and third molars, in addition to variable agenesis of some other teeth. On the other hand, the PAX9 mutation was strikingly associated with agenesis of permanent molars, however, with variable agenesis of other teeth in this case, too.

These findings inspired the studies of dominant severe tooth agenesis in Finnish families. First families to be studied were two small nuclear families with one of the parents and one or two of the children affected (Table 1 and Fig.1 in II). In a family with predominantly permanent molar agenesis, resembling the phenotypes in the family described by Stockton et al (2000), a c. 1143A>T mutation creating a nonsense change Lys144Stop was identified in the paired box domain (Fig.2 in II). The same mutation was later identified in another Finnish oligodontia patient with no known relationship to the original family (unpublished). As the stop codon appeared in the middle of the DNA binding paired box, it was reasoned that it would cause loss of function. In another family no defects in MSX1 or PAX9 were identified. However, further family members were later recruited and a genome-wide scan with samples from this family was conducted in collaboration with the Finnish Genome Center. This work led to the identification of a nonsense mutation in the AXIN2 gene (Lammi et al., 2004).

In another line of investigation of the genetic basis of tooth agenesis, the involvement of MSX1 to the tooth agenesis phenotype in association with the Wolf-Hirschhorn syndrome was investigated (III). This syndrome is caused by deletions in the short arm of chromosome 4, and involves craniofacial abnormalities and mental retardation as the most prominent features. In some patients, tooth agenesis had also been reported, while on the other hand dental features may in many cases have become overlooked (Burgersdijk and Tan, 1978). The strong candidate for causation of tooth agenesis in Wolf-Hirschhorn syndrome patients was MSX1 in 4q32 (Ivens et al., 1990). A group of Finnish patients with Wolf-Hirschhorn syndrome was studied and tooth agenesis recorded (Table 1 and Fig. in III). In a subsequent FISH analysis with a genomic MSX1 probe, it was shown that in all five patients affected by severe agenesis, the observed deletion spanned the MSX1 locus, presumably causing MSX1

70 haploinsufficiency (Table 1 in III). In one patient with a less severe agenesis, both copies of the MSX1 gene were found to be present. The severe agenesis phenotypes of the five patients roughly correlated with previous findings from families with defects in MSX1. This study offered direct evidence that the tooth agenesis associated with MSX1 defects was a result of reduced amounts of the MSX1 protein, i.e. haploinsufficiency, thus corroborating the results from functional studies of the MSX1 protein with a missense mutation R196P in the homeobox (Hu et al., 1998).

Table 6. Gene defects in MSX1 , PAX9 and AXIN2 that cause tooth agenesis gene exon type DNA (coding region) protein

Nieminen et al., 2004 gene deletions 1 Kim et al., 2006 insertion 62-63insG G22RfsX168 1 Lidral et al., 2002 missense 182T>A M61K 1 van den Boogaard et al., 2000 nonsense 314C>A S105X MSX1 2 de Muynck et al., 2004 nonsense 559C>T Q187X 2 Vastardis et al., 1996 missense 587G>C R196P 2 Jumlongras et al., 2001 nonsense 605C>A S202X 2 Arte et al. (unpublished) deletion 690delG K231SfsX232 2 Chishti et al., 2006 missense 655G>A A219T

Das et al., 2002 gene deletion Devos et al., 2006 gene deletion 1 Klein et al., 2005 nonsense 1A>G M1V 2 Das et al., 2003 missense 62T>C L21P 2 Lammi et al., 2003 missense 76C>T R26W 2 Jumlongras et al., 2004 missense 83G>C R28P 2 Zhao et al., 2005 insertion 109-110insG I37SfsX41 2 Zhao et al., 2005 missense 139C>T R47W PAX9 2 Mostowska et al., 2003 missense 151G>A G51S 2 Tallon Walton et al. (in press) nonsense 175C>T R59X 2 Das et al., 2003 insertion 175-176ins288bp R59QfsX177 2 Stockton et al., 2000 insertion 218-219insG S74QfsX317 2 Kapadia et al., 2006 missense 259A>T I87F 2 Das et al., 2003 missense 271A>G K91E 2 Nieminen et al., 2001 nonsense 340A>T K114X 2 Mostowska et al., 2005 delins 619_621delATCins24bp I207Y_X211 4 Frazier-Bowers et al., 2002 insertion 792-793insC V265RfsX315

7 Lammi et al., 2004 nonsense 1966C>T R656X AXIN2 7 Lammi et al., 2004 insertion 1994-1995insG N666QfsX706

71 Figure 9. Genomic structures and known gene defects in MSX1, PAX9, and AXIN2. Num- bers below the schemes indicate amino acid positions. Standard amino acid codes are used in the description of mutations. X, appearance of a stop codon (nonsense or frameshift mutations); fs, a frameshift as a result of an insertion or a deletion; light grey, exons; medium grey, coding region; dark grey, code for the DNA binding domain; hb, code for the homeobox.

Until today, altogether 24 different sequence defects in addition to whole gene deletions in PAX9 and MSX1 have been published in association with dominant severe tooth agenesis (Fig. 9; Table 6). Our laboratory has been involved in identification of five mutations in PAX9, (II , Lammi et al., 2003; Klein et al., 2005; Tallon-Walton et al, in press; unpublished) and two in MSX1 (unpublished), in addition to the syndromic deletions described above. The defects have included nonsense and frameshift as well as missense mutations. In PAX9, whole gene deletions in two families and a mutation destroying the start codon in one family have been described (Das et al., 2002; Klein et al., 2005; Devos et al., 2006). For the first described defect, a frameshift in the paired box (Stockton et al., 2000), the mutated protein was shown to be unable to bind to known PAX target DNA sequences and to activate transcription (Mensah et al., 2004). Inability to bind to target DNA was also shown for two missense defects (Jumlongras et al., 2004; Kapadia et al., 2006). For the mutation affecting the exon 2 – intron 3 junction, no mRNA carrying the mutated sequence was found in patient lymphocytes, presumably because of the degradation of the abnormal RNA by the nonsense mediated decay (NMD) mechanism (Mostowska et al., 2005). Although not studied, all missense defects in exon 2 of PAX9 are susceptible to NMD (Wilusz et al., 2001). These results strongly suggest that, analogous to the defects in MSX1, the principal effect of known PAX9 mutations is to reduce the amount of functional PAX9 protein, i.e. haploinsufficiency. This is also supported by the essential similarity of the associated phenotypes. Recognizing hap-

72 loinsufficiency as the cause of severe tooth agenesis implicates a dose effect of MSX1 and PAX9 protein in the pathogenetic mechanism.

The summary that can be built from the phenotypes associated with these mutations supports the conclusion drawn from the families first described: defects in MSX1 are characteristically associated with agenesis of second premolars and third molars (frequencies of agenesis over 80 %) whereas defects in PAX9 affect most strongly all the permanent molars (except for mandibular first molar, frequencies of agenesis are over 80 %)(Fig. 10; Table 7). It is also probable that even though tooth size within the affecteds has been commented in only a few reports (Nieminen et al., 2001; Jumlongras et al., 2001; Lammi et al., 2003; Jumlongras et al., 2004; Klein et al., 2005; Chishti et al., 2006), reduced dimensions, shortened roots and simplified forms are common in association with the defects in MSX1 and PAX9.

The increased amount of agenesis phenotypes associated with different mutations provides a possibility to attempt statistical analysis. Such an attempt is presented in Table 7, consisting of 39 patients with 7 defects in MSX1 and 63 patients with 13 defects in PAX9. As no significant differences between the frequency of agenesis in the left and right sides were observed, the frequencies from both sides were combined. Significant differences (p<0.001) were found between the maxilla and the mandible. For phenotypes associated with defects in MSX1, the first premolars in the maxilla were missing significantly more often than in the mandible, whereas in association with defects in PAX9, the second premolars and the first molars were missing significantly more often in the maxilla than in the mandible. In the incisor region, the central incisors were much more often affected in the mandible and the lateral incisors in the maxilla in association with the defects of both genes, a difference observed also in the general population. In association with the defects in MSX1, agenesis of the lateral incisors in the manbible was almost as frequent as that of the central incisors, but this may reflect difficulties in identifying the missing tooth in the mandible.

When the phenotypes associated with the defects in different genes were compared, a significantly higher frequency of agenesis was found for the maxillary first and second premolars and the mandibular second premolars in association with defects in MSX1 than with defects in PAX9, whereas agenesis of the maxillary first and second molars and the mandibular second molars was significantly more common in association with defects in PAX9. In addition, the mandibular central incisors were significantly more frequently affected in association with defects in PAX9 than in MSX1, but as the relationship was the opposite in the case of the mandibular lateral incisors, these differences may again be explained by difficulties to distinguish agenesis of mandibular central and lateral incisors.

Results of this part of the analysis are similar to those presented by Kim et al (2006). In addition to the results provided by Kim et al (2006), a significantly (p<0.001) higher frequency of agenesis of maxillary first molars in association of defects in PAX9 was observed. Thus, the most salient differences between the phenotypes are observed in the agenesis of premolars, especially the maxillary first premolars (higher frequency in association with defects in MSX1), and the second molars in both jaws as well as the maxillary first molars (higher frequency in association with defects in PAX9). These differences may be useful when differen- tiating severe agenesis caused by defects in PAX9 and MSX1. However, a further comment

73 concerning the agenesis of the third molars is warranted. Kim and collaegues (2006) did not take the agenesis of the third molars into account on the basis that because of the high frequency of the third molar agenesis in the population, it would be redundant for the purposes of the analysis. However, in view of the reported phenotypes in the literature (Table 7), agenesis of third molars is clearly an essential feature of phenotypes in association with defects in MSX1 or PAX9. While some patients who have defects, especially in MSX1, have developed at least some of the third molars, it is also possible that published reports may un- derestimate the third molar agenesis because of problems in diagnosis. This probably also explains the observed significant difference for agenesis of mandibular third molars in association with defects in MSX1 (Table 7). It appears that the agenesis of third molars is strongly associated with defects in both genes, and presence of third molars should cause doubt whether these genes are involved in etiology.

It is also relevant to compare phenotypes in association with different defects in MSX1 and PAX9, i.e. to look for genotype-phenotype correlations. In the case of PAX9, the whole gene deletions and the start codon mutation appear to cause the most severe defects extending to the premolars and primary molars (Das et al., 2002; Klein et al., 2005). It has also been presented earlier that missense defects in PAX9 are associated with slightly different phenotypes than other defects in this gene (Lammi et al., 2003). The analysis of figures in Table 7 (see also Fig. 10) shows that agenesis of the first and second molars is significantly less common in association with missense defects in PAX9 than in association with other kinds of defects (p<0.05 for the mandibular second molars, p<0.001 for the other molars). Interestingly, agenesis of the maxillary canines appears to be more common in association with missense defects. Thus, the missense defects more often leave the first permanent molars unaffected (Lammi et al., 2003). The differences may be explained by the assumption that in the case of nonsense, frameshift and especially missense defects, some functional activity of the protein is retained, possibly through a residual DNA-binding ability and especially through protein- protein interactions. For different mutations in MSX1, the genotype-phenotype correlations are less straightforward although also in this case it appears that deletion and nonsense mutations are associated with more severe phenotypes than missense mutations (Table 7).

Attempts to unravel the genetic basis of common tooth agenesis (incisor and premolar hypodontia) (publications I, IV)

The research summarized in this thesis was started with an effort to identify the genetic factors, i.e. causative genes, that cause dominantly inherited common tooth agenesis, incisor and premolar hypodontia. Originally five Finnish families (1 ,2, 3, 6 and 7 in Fig. 8) were recruited into the study (I). In these families agenesis of one or a few second premolars, mandibular central incisors or upper lateral incisors, or in some cases, peg-shaped upper lateral incisors, had been observed to follow an apparently dominant inheritance. In one of these original families, only second premolars, and in two only incisors were affected, while in the remaining families both classes of teeth could be affected (Table 4). One obligatory carrier was observed in these initial families, reflecting the reduced penetrance.

74 Table 7. Summary of tooth agenesis phenotypes associated with defects in MSX1 and PAX9

n / n / 3rd agenesis % *) teeth molars maxilla 1 2 3 4 5 6 7 8 MSX1 all 78 72 0 27 5.1 72 94 18 12 85 MSX1 missense 28 24 0 18 0 68 93 00100 PAX9 all 126 122 1.6 22 9.5 21 70 81 91 98 PAX9 missense 50 48 0 36 24 26 60 62 80 96 mandible MSX1 all 78 72 21 19 3.8 14 90 40 22 92 MSX1 missense 28 26 7.1 21 0 14 93 32 7.1 96 PAX9 all 126 122 47 7.1 1.6 6.3 45 40 88 97 PAX9 missense 50 48 62 448542278 92 p values from chi2 tests 12345678 MSX1, maxilla v. mandible <0.001 ns ns <0.001 ns <0.05 ns ns PAX9, maxilla v. mandible <0.001 <0.001 <0.05 <0.001 <0.001 <0.001 ns ns max ns ns ns <0.001 <0.001 <0.001 <0.001 <0.001 MSX1 v. PAX9 mand <0.001 <0.05 ns ns <0.001 ns <0.001 ns max ns ns ns ns ns <0.05 <0.05 <0.05 MSX1 missense v. non-missense**) mand <0.05 ns ns ns ns ns <0.05 ns max ns <0.05 <0.001 ns ns <0.001 <0.001 ns PAX9 missense v. non-missense**) mand <0.05 ns ns ns ns <0.001 <0.05 <0.05 *) bold, frequency of agenesis > 60 % **) non-missense: deletions, frameshifts, nonsense, splicing mutations

As the first step, involvement of the most promising candidate genes was studied. In the initial analysis, microsatellite markers in the MSX1 and MSX2 genes were genotyped in all available DNA samples (I). These paralogous genes were obvious candidate genes because of the known expression patterns of them during the mouse tooth development, also suggesting functional redundance (MacKenzie et al., 1991; MacKenzie et al., 1992). Further support for the role of these genes was provided by the findings that a mutation in MSX2 was responsible for the Boston-type craniosynostosis in man (Jabs et al., 1993). After the completion of our analysis, it also became known that inactivation of Msx1 in mouse leads to an arrest of tooth development at an early stage (Satokata and Maas, 1994).

Using the five families and intragenic microsatellite polymorphisms in the MSX1 and MSX2 genes, exclusively negative total lod scores were obtained for the total family material, and no significant support for linkage was either observed in the individual families (Table 2 in I). When the segregation of the microsatellite alleles in the pedigrees was inspected, it was observed that in most families the affected family members had inherited different alleles for these markers (Fig. 1 in I).

Subsequently, we presented a similar study on the involvement of other candidate genes, EGF, EGFR, FGF3 and FGF4. In this study, a few additional families (including family 9 in Fig.8) with comparable phenotypes were included. Also in this study the principal conclusion was that these genes did not explain tooth agenesis in the families studied (Arte et al., 1996).

75 Figure 10. Comparison of phenotypes associated with gene defects in MSX1 and PAX9. Only permanent teeth are shown. Darkness of the color expresses the frequency of agenesis. “PAX9 missense” includes only missense defects, i.e. single amino acid changes. Compare to table 7.

The investigation was expanded to other known candidate genes and finally to genome-wide efforts to identify causative loci (IV). For a genome-wide genotyping, only samples from the most informative families (1, 2, 6 and 9 in Fig. 8) and even a reduced set of samples from these families were used. After recruiting a further set of families (11, 12 and 20), samples from these families were subjected to total genome wide genotyping in the Finnish Genome Center. In addition to markers included in the genome-wide searches with intervals from 10 to 20 cM, results from candidate gene loci as well as from fine mapping of the most promising regions were used in calculation of the results described below. For these reasons, marker maps and densities for individual families are not identical. Samples of family 12 were analysed for 418 microsatellite markers, those from family 9 with 552 markers and those of the other families with 450-520 markers. However, multipoint analysis offers linkage estimates also from the marker intervals and makes it possible to compare and summate results from different families.

The location score charts from the multipoint analysis by Simwalk showed that only relatively low scores were obtained when all the families were considered together, i.e. a genetic homogeneity was assumed (Fig. 2a,b in IV). The highest scores from the analyses of individual families are given in Table 8 and the genome-wide location score charts in Figs. 2c-l in IV. The highest scores obtained for family 9, the largest family, were also relatively low as compared to the expectations of the informativeness (Fig. 2i in IV). Indeed, no recombinant-free locus in the genome was found in this family, i.e. an area where all affected family members would have inherited a shared allele or haplotype. This probably reflected the presence of multiple causative factors in this family, and accordingly the analyses were also conducted for subfamilies "91", "93" and “9p” (Fig. 8).

In most families (1, 2, 6, 11, 91, 93, and 9p) multiple positive but insignificant scores in the range of 0.7-2 were obtained (Figs. 2a,b,c,d,j,k,l in IV; Table 8) both in the normal and in the affecteds-only analyses, reflecting the fact that because of the moderate size of the families several recombinant-free areas existed in the genome.

76 Table 8. Highest location scores from multipoint analysis by Simwalk all family members affecteds-only chromo- chromo- family cM score cM score some some

1 2 87 1.801 2 87 1.801 2 5 28 1.606 5 23 0.781 6 7 98 1.691 several 0.778 11 7 44 1.567 several 1.045 12 12 56 2.431*) 2 59 1.336 12 13 30 1.459 20 18 39 3.059**) 18 39 2.009**) 20 6 5 1.621 9 12 88 1.263 21 10 1.609 91 5 108 1.710 several 1.237 93 1 225 1.576 several 0.797 9pm 8 138 1.804 several 1.168

*) affecteds-only analysis: location score for this locus 0,946; **) see text

In family 12, the highest peaks in chromosomes 2, 12, and 13 were all obtained in areas, where also at least some recombinant affected family members were observed (Fig. 2g in IV). In family 20, the most promising locus was initially identified in chromosome 6 (Fig. 2h in IV) but after the fine mapping an affected recombinant family member (IV:4) was observed in this locus. Subsequent fine mapping of other promising regions led to an identification of a locus in chromosome 18, in which all the affected family members except IV:3 had inherited the same haplotype (location score 1.970). As IV:3 presented with a different phenotype (one peg-shaped lateral incisor) than other affected family members and especially his sibs (one or multiple missing second premolars), his phenotype was marked as unknown and a significant location score 3.059 was obtained (Figs. 2h and 3 in IV).

When the results from all the families were compared, there were some overlap of the suggested loci. The chromosome 2 locus where the highest score in family 1 was obtained overlapped peaks from families 11 and 91. The locus in chromosome 18, that was identified in family 20, was recombinant-free for the affecteds also in family 11, and the analyses of families 12 and 9p also gave positive scores in this region. Overlap of positive peaks were also observed in 8qtel, 10p and 17q. When gene heterogeneity was allowed in the analysis of all the families in these regions, support for linkage was obtained in chromosome 18 from the analysis that included family 9p (Fig. 3 in IV). In the other regions, allowing gene heterogeneity gave suggestive but not significant scores (data not shown).

Results from the genome-wide search were also studied in relation to the known candidate genes, implicated either by known gene defects in man or by mouse mutants. While identified defects in several of these genes show a strong dominant effect, it has been suggested that common types of tooth agenesis, such as incisor and premolar hypodontia in the families described in this study, could result e.g. from hypomorphic alleles, and perhaps from alleles considered only as risk alleles (Vieira, 2003). For 6 cM wide regions around the most obvious candidate genes, only negative or non-supporting scores were usually obtained (Table 4

77 in IV). The results excluded MSX1 and several other genes. AXIN2 could not be excluded in families 2 and 11, and MSX2 and PAX9 in family 6. For families 1, 2, 6, 11, 91 and 93, regions of at least one studied candidate gene gave suggestive scores. The highest peak from family 1 overlapped the TGFA locus, and the highest peak from family 11 with the AXIN2 locus. However, as described above, in both families several other regions were identified in which affected family members had inherited a shared haplotype.

Sequence variants that have a strong dominant effect usually severely affect the coding sequence whereas sequence variants for risk alleles affect the gene regulation and tend to reside outside the coding region. Linkage analysis reveals also the involvement of sequence variants in non-coding regions. To complement the results from the linkage analysis, we also performed sequence analyses of exons and flanking sequences of MSX1, PAX9, AXIN2 and TGFA in the samples of the probands and some other affected family members. No sequence alterations besides common SNPs were identified in this analysis. This is in line with some previous studies, in which no sequence alterations were found in the coding regions of MSX1 and PAX9 in association with common types of tooth agenesis (Scarel et al., 2000; Frazier- Bowers et al., 2003).

In conclusion, the results from the genome-wide search do not support the existence of a single or a major locus for incisor and premolar hypodontia or involvement of several candidate genes, especially MSX1. On the other hand, the results are most compatible with existence of several loci, some of which may contain a previously known candidate gene. However, most candidate genes could be excluded in our families. The strongest support was provided to a novel locus in chromosome 18. While it was initially presumed that incisor and premolar hypodontia would be caused by one or only a few causative genes, the results imply a remarkable genetic heterogeneity of incisor and premolar hypodontia, a fact that also significantly reduced the possibilities for identification of the loci.

Construction of the gene expression database (V)

The amount of data on gene expression in the developing tooth has increased rapidly since in situ hybridization methodology began to be applied in several laboratories. This created a need to collect existing data into a database which would help researchers to easily find data on gene expression, often published in papers not necessarily concentrating on tooth development, and to enable detection of co-expression of genes. As an additional benefit, collecting the data according to common principles and storing it in a common, formalized structure, would also help to assess the quality of the data. To make it possible for everyone to browse the collected data, a WWW-based solution was the natural choice.

We fitted the data into six developmental stages: initiation, bud, cap, bell, differentiation and secretory stages. Later a specific stage covering root development was added. In the tables of the database, the expression data was coded for each tissue present during different stages of tooth development. However, when unambiguous visual view of the expression was available, e.g. as illustrations of the publications, additional standardized schematic drawings were used to indicate subtissue-level resolution and gradients of expression. The data was

78 presented as lists selected from different viewpoints (tissue, stage, species, molecule class, methodology) and as separate pages for each gene containing the schematic illustrations and notes. In addition to minimum information, we included data on the methodology, properties of genes and literature references as well as on functional and experimental data, if available. Several links to other internet databases were added later.

The data was stored as tables in Borland dBase 5.0 for Windows software, and the WWW- pages in HTML format were produced by dBase-scripts. The schematic drawings were included to the WWW pages in the JPG format. Thus the WWW-site presented static, but regularly updated and intuitively organized pages.

The Gene expression in tooth (http://bite-it.helsinki.fi) site was first published on the eve of the 6th Tooth morphogenesis and differentiation meeting in Gothenburg 1998, and was posi- tively received by the researchers in the field. Currently the database contains altogether 435 gene expression records, but because of separate pages for different species and for expression on the mRNA and protein levels, the amount of different gene homologs is smaller, currently 330. 267 of them describe expression in mouse, while other species included are rat, human, sibling vole, cow, hamster and pig, listed in the order of the amount of the genes from each species. 323 pages describe expression on the mRNA level and 118 on the protein level. Half of the genes are signaling genes and one fourth transcription factors, reflecting the interests of the researchers in the field.

During recent years, biological data in the internet accessible databases have remarkably increased, especially accelerated by the genome projects. Most of the data concern DNA and protein sequences and derived information, but also an increasing amount of expression data that have been produced by DNA-microarray methodology is available. So far, microarray expression data from developing teeth has not been made available in public databases. Re- cently a database offering in situ expression data has been launched by researchers in the Max-Planck-Institute (http://Genepaint.org). This database offers primary in situ hybridization views into gene expression in whole embryos with spatial resolution high enough to reveal details in the the craniofacial region. Expression in teeth has been annotated. While offering data of a large amount of genes, ultimately covering all mouse genes, the database is so far limited to only certain stages of development. Thus, in terms of coverage of different stages and annotations, Gene expression in tooth has still retained an important function.

79 GENERAL DISCUSSION

Uncovering the genetic background of tooth agenesis

In the work presented in this thesis, we have clarified the genetic basis of dominantly inherited severe tooth agenesis (oligodontia). We have identified a nonsense loss of function mutation in PAX9 that segregated with agenesis in a Finnish family and shown that deletions of MSX1 are associated with severe agenesis. These findings contribute to the understanding that reduced amount of functional PAX9 or MSX1 protein, haploinsufficiency, is able to cause the severe, partial agenesis. On the other hand, we have studied the genetic background of the common type of tooth agenesis, incisor and premolar hypodontia, in a set of Finnish families where hypodontia phenotype follows autosomal dominant inheritance. As conclusions of this study, we found no support for the remarkable role of the most important candidate genes but found strong support for existence of at least one novel locus involved in the etiology of this phenotype.

The results confirm the heterogeneous genetic etiology of tooth agenesis. Together with other results from our and other laboratories, they help to clarify the genetic background of tooth agenesis in general.

So far, gene defects have been identified in association of either well-defined multiorgan syndromes or non-syndromic severe agenesis, oligodontia. For the latter, gene defects have been identified from families with fully penetrant oligodontia, that follows either dominant inheritance or results from de novo, dominantly acting, mutations. Gene defects associated with syndromes usually also have a strong effect on the molecular level, i.e. result in loss of function, dominant negative effect or possibly gain of function, but in different syndromes the effect on tooth development may be strong or less penetrant and variable (Table 1). Re- gardless of the incomplete penetrance of tooth agenesis, diagnosis of a syndrome has been possible because of other salient features. Thus, it is common for the identified gene defects that they generally have a strong effect on the molecular function and have been identified from patients with relatively unequivocal diagnosis and mode of inheritance.

In our laboratory we have identified the causative gene defect in seven Finnish families with severe agenesis, oligodontia (II; Lammi et al., 2003;.Lammi et al., 2004; unpublished). In addition, mutational analysis of MSX1, PAX9 and AXIN2 as well as of some other genes has been conducted with negative results in several other families with dominantly inherited severe agenesis. As our mutational screening covers only the exons, the immediate flanking sequences and immediate promoter regions, mutations in the important regulatory regions may have been left undetected. However, the sequence variation in the non-coding region has rather been associated with risk alleles (Reich and Lander, 2001), and it may be considered unlikely that non-coding regulatory region sequence variants would remarkably contribute to this phenotype. Thus, it is premature to evaluate the relative contribution of MSX1, PAX9, or AXIN2 to the dominantly inherited non-syndromic severe tooth agenesis (see also Kapadia et al., 2007). It seems likely that as yet unrecognized genes defective in this kind of families will be identified in the future. EDA and its downstream partners may belong to these as shown by the recent reports (Tao et al., 2006; Tarpey et al., 2007).

80 In an ongoing study (unpublished), we have also studied a large group of patients whose parents or other family members did not present with severe agenesis. In fact, these constitute a bigger group than the probands of families with dominant inheritance. So far we have been able to identify three gene defects in these probands. However, these represent either uncer- tainties of the parenthood or de novo mutations, which most probably are dominant by nature.

The majority of genetic causes of tooth agenesis remain largely unidentified. These include a remarkable fraction of severe agenesis, and especially those with no apparent dominant inheritance, as well as all cases of common, less severe types of agenesis, including incisor and premolar hypodontia. Apparently, in the latter cases, defects and variants in genes in which strong defects already have been identified are most tempting candidates for causative factors (Vieira, 2003). These could be hypomorphic defects (reduced activity instead of complete loss of function), or variants considered to represent "risk alleles". Studies exploring the polymorphisms in MSX1, TGFD PAX9, AXIN2, IRF6 and FGFR1 in association with tooth agenesis have reported associations with variable significance to specific alleles and haplotypes (Vieira et al., 2004; Peres et al., 2005; Mostowska et al., 2006; Vieira et al., 2007). So far, it is reasonable to wait whether these results can be confirmed by further studies. However, especially the associations of third molar agenesis to SNPs in the PAX9 promoter and tooth agenesis to SNPs in the exon 7 and intron 2 of AXIN2 seem promising (Peres et al., 2005; Mostowska et al., 2006). It is possible that these SNPs exert their effect either by affecting the binding of transcription factors or splicing efficiency, and would con- form to the idea that common phenotypes are caused by changes that affect the regulation of gene expression rather than the structure of the protein. Interestingly, the 169 bp allele of the intragenic microsatellite in the MSX1 gene appears to be associated with both tooth agenesis and oral clefting (Vieira et al., 2004; Suzuki et al., 2004), although the functional explanation remains obscure.

Our results from the families with apparent autosomal dominant inheritance of incisor and premolar hypodontia do not lend strong support for the involvement of the MSX1, TGFD PAX9, AXIN2, IRF6 and FGFR1 or several other loci. Rather, our results suggest the existence of previously unidentified loci for tooth agenesis. The strongest evidence is shown for such a locus in chromosome 18, but further studies are needed to confirm and map this locus more precisely as well as to confirm the involvement with tooth agenesis of the other genomic regions indicated in this study.

The molecular nature of the genetic factors residing in the loci we identified remains unknown. They may represent hypomorphic defects (or “high risk alleles”) that however by themselves have a major effect. They may also represent stronger defects, e.g. with loss of function and haploinsufficiency, as shown by the identification of such defects in the association with syndromic phenotypes that resemble common types of tooth agenesis (e.g. van der Woude and Kallmann syndromes, see table 1). Functional redundancy between different genes and genetic pathways may limit the consequences of a haploinsufficient defect, thus allowing the effect to become visible only as a relatively mild form of tooth agenesis. Con- sidering the phenotypes in syndromes as well as in the families studied by us and in other

81 family studies (Grahnen, 1956; Chosack et al., 1975), it is also probable that the effects of many of such genetic factors would be selective, i.e. primarily affect only one class of teeth.

Evidence of tooth agenesis as a result of a combination of genetic factors has been provided by cases of severe agenesis where both parents have presented with less severe tooth anomalies ("non-dominant severe agenesis") or from reports of recessive inheritance (Schalk-van der Weide, 1992; Lyngstadaas et al., 1996; Ahmad et al., 1998; Pirinen et al., 2001; Chishti et al., 2006). Taking the already verified genetic heterogeneity into account, it appears that it is much more frequent to find cases with defects or risk alleles of two or more genes than to find recessive inheritance, even as compound heterozygotes of allelic defects. Recessive inheritance is most probable in consanguinous situations (Ahmad et al., 1998; Chishti et al., 2006) or in populations with a strong possibility of a founder effect (Pirinen et al., 2001). Depending on the effect on the regulatory pathways, all combinations of alleles of different genes may not necessarily be additive as may be expected for the recessive inheritance, and one allele may have a major contribution while the other has a modifying function. Combi- nations of different kind of alleles may largely satisfy the premises on which the quasicontinuous quantitative trait models of polygenic/multifactorial etiology were based (Bailit 1975; Brook, 1984).

In summary, non-syndromic tooth agenesis may follow from different genotypes. Strong defects in critical genes, often loss of function defects that cause haploinsufficiency, cause dominantly inherited severe agenesis. Similar defects, either present in less critical genes or masked by redundancy, may also underlie more common types of dominantly inherited tooth agenesis such as incisor and premolar hypodontia. The latter kind of phenotypes may also be caused by hypomorphic defects or high risk alleles. Tooth agenesis without dominant inheritance may follow from combinations of haploinsufficient, hypomorphic or risk alleles, including recessive inheritance.

Implications for the pathogenetic mechanisms of tooth agenesis

One of the main conclusions from the results presented in this thesis is that defects in PAX9 and MSX1 exert their effect through haploinsufficiency. Reduced amount of functional MSX1 or PAX9 protein in the tooth forming cells is able to cause severe and selective tooth agenesis. Another conclusion, based on the analysis of the phenotypes associated with the known defects in these genes, is that the phenotypes associated with the defects in MSX1 and those associated with the defects in PAX9 are different. Despite the similarities, there are clearcut differences in the frequency of agenesis of specific teeth.

As described in the Review of the literature, most types of tooth agenesis can be considered to be caused by quantitative mechanisms affecting especially those teeth that are initiated and develop latest in their respective tooth class. In terms of the morphogenetic field and clone theories this can be regarded as exhaustion or change of the field strength or odontogenic potential. Historically, critically reduced size of the dental lamina or tooth germs have been considered as causes of agenesis (Grüneberg, 1951; Bailit, 1975; Brook, 1984). How- ever, in modern thinking based on the molecular and genetic studies of tooth development,

82 tooth agenesis is a consequence of a qualitatively or quantitatively impaired function of genetic networks, which regulate tooth development (Thesleff, 2006). Understanding a regulatory failure as a cause of agenesis is in line with the concepts implying morphogenetic fields and self-organizing cell populations.

As shown by studies in mouse, impaired functions of the genetic networks are reflected as reduced signaling or impaired signal regulation, cell proliferation, migration, commitment and differentiation. The most critical are the stages of formation of the signaling centers that have an organizing role for the future development. It is conceivable that these and other critical stages of tooth development may work as thresholds at which a somehow reduced “tooth forming potential” of the regulatory networks is converted to partial tooth agenesis. The other stages may include e.g. differentiation and activation of a program for secondary tooth formation. Overcoming the thresholds appears more critical in the late developing teeth. The reduction of the “tooth forming potential” may follow from a reduced functional activity of a single gene as in the case of the heterozygous defects in MSX1 and PAX9. It may also result from complete inactivation of a single signaling pathway the function of which is partially redundant as in the case of impaired EDA signaling. Thus, reduced size and function of the dental signaling centers as a result of impaired EDA signaling has been suggested as a major cause of tooth defects in anhidrotic ectodermal dysplasias (Mustonen et al., 2004). AXIN2 haploinsufficiency may specifically affect the onset of the program needed for secondary tooth development (Lammi et al., 2004).

In the case of MSX1 and PAX9, tooth agenesis has been related to the critical function of the mouse homologues of these genes in the formation of the enamel knot and the subsequent transition from bud to cap stage (e.g. Thesleff, 2006). The MSX1 haploinsufficiency, however, appears to affect only the secondary teeth and permanent molars, and it is not obvious how a weakened enamel knot function, which presumably follows from a reduced amount of functional MSX1 protein, is linked to impaired secondary tooth development. It is possible that the late developing teeth are more sensitive to impaired enamel knot function. The development of these teeth normally is a long lasting process and happens surrounded by the alveolar bone. It can also be speculated that enamel knots may somehow regulate the program leading to the secondary tooth formation.

Both Msx1 and Pax9 are also needed for the mesenchymal cell condensation around the growing epithelial bud (Satokata and Maas, 1994; Peters et al., 1998). The reduced condensation which is also seen in the Pax9 hypomorphic mutants, perhaps indicating a decreased amount of committed dental mesenchymal cells, may be related to tooth agenesis (Kist et al., 2005). As Msx1 is known to be important for the commitment of the neural crest, an early defect in the commitment or migration of the neural crest cells could also be responsible for the tooth agenesis, if it caused a reduction in the amount of competent ectomesenchymal cells.

The analysis presented in this thesis shows that MSX1 and PAX9 haploinsufficiency and different types of PAX9 defects are associated with slightly but distinctly different agenesis phenotypes. While third molars are affected in the association with defects in both genes, the most essential differences between the phenotypes are that premolars are more often affected

83 in association with defects in MSX1 and first and second molars in association with defects in PAX9. As PAX9 apparently is upstream of MSX1 and acts synergistically with it (Peters et al., 1998; Ogawa et al., 2006), it is conceivable that the effect of PAX9 haploinsufficiency is mediated by reduced MSX1 activity. However, the differences in phenotypes suggest that PAX9 also has functions not mediated by MSX1.

In patients with defects that reduce the amount of PAX9 mRNA and protein, the agenesis appears to “grow” in a posterior-to-anterior direction in a way that agenesis of a tooth is associated with the agenesis of all the more posterior teeth. The whole gene deletions and the start codon mutation affected all the postcanine teeth, including the primary molars showing that the whole postcanine dentition is sensitive to the PAX9 dose, and that a posterior-to- anterior sensitivity gradient (Kist et al., 2006) may extend to the anterior-most of these teeth, the primary first molar which is regarded as the “key” or “stem” tooth of the human postcanine dentition. The less severe agenesis phenotypes observed in association with the missense defects in PAX9 may relate to the fact that while these defects reduce or impair the DNA binding ability of the PAX9 protein, the protein still is capable to protein-protein interactions. As shown by Ogawa and colleagues (2006), such mutated PAX9 protein was able to bind MSX1, but its capacity to transcriptional activation alone or in synergism with MSX1 was remarkably reduced. It is possible that the observed residual transcriptional activation capacity accounts for the less severe phenotypes. Alternatively, these may be explained by interactions of PAX9 with other protein partners.

The pathogenetic mechanisms that mediate the effect of reduced amounts of functional MSX1 and PAX9 protein may serve as models for pathogenesis of tooth agenesis caused by other gene defects. These may exert their effect by affecting MSX1 or PAX9 function or the same genetic networks. Further research of genetic and pathogenetic mechanisms of MSX1 and PAX9 is warranted to shed light into the pathogenesis of tooth agenesis in general. This is especially true for MSX1 because defects in this gene affect the teeth that are most often affected in the population.

84 CONCLUDING REMARKS

The studies summarized in this thesis were started with an aim to identify genes that affect human tooth development and are involved in inherited tooth anomalies. More specifically, we wanted to identify the gene defect that caused a common type of tooth agenesis, dominantly inherited incisor and premolar hypodontia, in a group of Finnish families. Originally, it was presumed that agenesis in these families would share a common genetic background, i.e. to be caused by defects in one or a few genes. During the work it became obvious that this was not the case, but instead, the genetic background of this phenotype was rather heterogeneous, which was one of the main conclusions of these studies. The heterogeneity hampered the possibilities to identify causative loci and to pinpoint the defective genes. The observed heterogeneity is in line with the increasing understanding of the complex genetic networks regulating the development of dentition. This understanding, however, also supports the idea that gene defects with dominant effects may be responsible for the incisor and premolar hypodontia.

In this work evidence was presented for novel causative loci, especially in chromosome 18. Further studies will be required to confirm and refine these results and eventually to identify the causative sequence variants. Basic approaches for this end would be to recruit additional patients and families as well as to take advantage of an eventual common ancestral etiology, which would allow the utilization of single nucleotide polymorphisms to fine-map the disease loci. The causative defects may rather affect the expression than the protein structure and reside outside the coding regions. Therefore, mutational analysis could be complemented by analysis of RNA expression.

In an other line of investigation into the genetics of tooth agenesis presented in this thesis, causes of dominantly inherited severe tooth agenesis, oligodontia, were identified. It was shown that haploinsufficient defects of PAX9 and MSX1 cause tooth agenesis with specific patterns. Thus, the pathogenesis of specific types of tooth agenesis involves reduced activity of these important regulatory genes, which presumably affects the essential genetic networks necessary for normal development of dentition. During the work it has also become obvious that defects in the so far identified three genes MSX1, PAX9 and AXIN2 may not explain all cases of non-syndromic oligodontia with dominant inheritance. Furthermore, mutational analysis of these genes in other patients with severe tooth agenesis, i.e. patients without familial background of this phenotype, has been successful in only a few cases. Etiology of this kind of severe tooth agenesis may largely be explained by combinations of genetic factors, i.e. polygenic inheritance. One way to clarify the etiology in these cases is to identify factors that cause common familial incisor and premolar hypodontia.

The results presented in this thesis, especially those on severe tooth agenesis, provide tools for diagnosis, genetic counseling and planning of treatment. However, the main impact of the results is to provide insights into the biological mechanisms that underlie normal and abnormal development of teeth and development in general. Thus, the results contribute to the biological basis of dental science, and eventually to development of diagnosis and therapy.

85 ACKNOWLEDGEMENTS

My part in the work presented in this thesis was started in 1993 at the sixth floor laboratory of the Institute of Dentistry in Ruskeasuo. I also visited the Department of Pedodontics and Orthodontics at the third floor as well as the Laboratory of Human molecular genetics at the nearby building of the National Public Health Institute. From 1996, I mostly worked in the Institute of Biotechnology at the new Biocenter in Viikki. In 2001, I set up a corner of a laboratory in Biomedicum, brand new, under the auspices of the Institute of Dentistry.

I am greatly indebted to professor Sinikka Pirinen whose scientific work, aspirations and vi- sions at the Department of Pedodontics and Orthodontics were the foundations to start the molecular genetic studies of human tooth agenesis. During these years she has been not only the Professor but also a friend, whose ability to encourage and take you over the critical moments has been invaluable.

I entered the laboratory of professor Irma Thesleff even some years before the start of the work with tooth agenesis. During the completion of my studies in biochemistry, I greated an interest in developmental biology. I have retained this interest, even though I became routed to the world of human molecular genetics. Irma has been the most essential person for the work I have done: she inspired and guided the work with her scientific knowledge and vision and provided the bulk of the basic support. She has shown an encouraging trust without which my work, including this thesis, wouldn’t have been possible.

At the very beginning of the project, I became to know Sirpa Arte, then a dentist finishing her specialization in orthodontics. Sirpa recruited and examined most of the patients and has thus been elementary for the investigation. During the years we have spent a lot of time with pipetting, scoring alleles, and discussing. Although Sirpa now has a busy position as a senior orthodontist, she still finds time to participate in the research and share her specialist knowledge. I’m especially grateful to Sirpa for the friendship and support.

In the beginning of these studies, I had the pleasure to get acquainted with Leena Peltonen- Palotie, then a professor of human molecular genetics in the National Public Health Institute. She took a personal and warm interest in our efforts, gave me wonderful supervision, allowed the use of many of her facilities and introduced me to a lot of helpful people in her laboratory.

I’m grateful to professor Satu Alaluusua for all the support, scientific, economical and social, during my years in Biomedicum as well as for her scientific alertness which opened new avenues for my research.

I warmly thank Johanna Kotilainen whose work offered us the possibility to study an interesting group of patients with Wolf-Hirschhorn syndrome. I want also express my gratitude to professor Sakari Knuutila and to Yan Aalto in his laboratory for the FISH analysis of samples from these patients.

86 I thank all the people in the tooth development group for their help and companionship. I want especially to thank Johanna Pispa for discussions and help, Thomas Åberg for joint activities and friendship, David Rice for the excursions to sporting events, Maija Kaski for her friendship and the contribution to the Gene expression database, and Merja Mäkinen and Riikka Santalahti for all the help I have received during these years. I’m grateful to Jukka Jernvall for discussions and his readiness to share his scientific knowledge. I greatly appreci- ate the help of Lars Paulin in the sequencing laboratory of the Institute of Biotechnology. I thank professor, director Mart Saarma for the support and all encouraging words.

My warm thanks go to Carin Sahlberg for her company at the laboratory and during travels, and also for her advice how to care Tommi, my cat. I wish to thank Janna Waltimo-Siren, Pirjo-Liisa Lukinmaa and Anna-Maija Partanen for all the discussions and support. I’m grateful to Laura Lammi, Elina Luonsi and other young dentists for their contributions in many projects as well as for refreshing the life in the laboratory. My warmest thanks go to Annikki Siren and Anneli Sinkkonen for their help in the laboratory and especially to Mar- jatta Kivekäs and Maarit Hakkarainen for their invaluable help in many respects. I’m grateful to Kirsti Kari for her help and support in the laboratory. I thank professor Jarkko Hieta- nen for support and appreciation of my work.

I’m grateful to Raila Salminen and Elina Waris for their help and friendliness. I also thank all the people in the computer support at the Institutes of Dentistry and Biotechnology.

Numerous people in the laboratory of the National Public Health Institute and in the Molecu- lar Medicine Sequencing Laboratory have helped me during these years: Johanna Aaltonen, Anne Vikman, Iiris Hovatta, Petra Pekkarinen, Joe Terwilliger, Teppo Varilo, Maija Parkki- nen, Mari Sipilä, Pekka Ellonen, Elli Kempas, Heli Keränen and Susanna Anjala. I also thank Päivi Lahermo and Aarno Palotie at the Finnish Genome Center for the invaluable help in the genome-wide searches.

Many times during the work I have tempted to ignore my friends. The friendship of Mervi and Petra Erkkilä in all the turns of life during these years has helped me enormously. The company of Ilkka Leskinen and all the travels together have been essential for survival, and so have the activities organized by Cetin Sahin, Ilppo Kivivuori and Anne Ojanperä.

I’m fully aware of the importance of my late father in waking my interest in studies and edu- cation. I’m grateful for my mother for all the care and love.

In addition to the Institutes and the grants of the seniors, I have received financial support from the Finnish Cultural Foundation, the University of Helsinki funds and HUCH EVO.

Finally, I’m indebted to Jan Huggare and Anu Wartiovaara who as reviewers gave a remarkable contribution to this thesis.

Vantaa, November 2007

Pekka Nieminen

87 REFERENCES

Adaimy L, Chouery E, Megarbane H, Mroueh S, Delague V, Nicolas E, Belguith H, de Mazancourt P, and Megarbane A (2007). Mutation in WNT10A is associated with an autosomal recessive ectodermal dysplasia: the odonto-onycho-dermal dysplasia. Am J Hum Genet 81: 821-828.

Ahmad W, Brancolini V, ul Haque FM, Lam H, ul Hague HS, Haider M, Maimon A, Aita VM, Owen J, Brown D, Zegarelli DJ, Ahmad M, Ott J, and Christiano AM (1998). A locus for autosomal recessive hypodontia with associated dental anomalies maps to chromosome 16q12.1. Am J Hum Genet 62: 987-991.

Aioub M, Lezot F, Molla M, Castaneda B, Robert B, Goubin G, Nefussi JR, and Berdal A (2007). Msx2 -/- transgenic mice develop compound amelogenesis imperfecta, dentinogenesis imperfecta and periodental osteopetrosis. Bone 41: 851-859.

Alaluusua S, Calderara P, Gerthoux PM, Lukinmaa PL, Kovero O, Needham L, Patterson DGJ, Tuomisto J, and Mocarelli P (2004). Developmental dental aberrations after the dioxin accident in Seveso. Environ Health Perspect 112: 1313-1318.

Alaluusua S, Lukinmaa PL, Torppa J, Tuomisto J, and Vartiainen T (1999). Developing teeth as biomarker of dioxin exposure. Lancet 353: 206

Alonso L and Fuchs E (2003). Stem cells in the skin: waste not, Wnt not. Genes Dev 17: 1189-1200.

Alvesalo L and Portin P (1969). The inheritance pattern of missing, peg-shaped and strongly mesiodistally reduced upper lateral incisors. Acta Odontol Scand 27: 563-573.

Alvesalo L and Tigerstedt PM (1974). Heritabilities of human tooth dimensions. Hereditas 77: 311- 318.

Amundadottir LT, Thorvaldsson S, Gudbjartsson DF, Sulem P, Kristjansson K, Arnason S, Gulcher JR, Bjornsson J, Kong A, Thorsteinsdottir U, and Stefansson K (2004). Cancer as a Complex Phenotype: Pattern of Cancer Distribution within and beyond the Nuclear Family. PLoS Med 1 (e65): 229-236.

Andl T, Ahn K, Kairo A, Chu EY, Wine-Lee L , Reddy ST, Croft NJ, Cebra-Thomas JA, Metzger D, Chambon P, Lyons KM, Mishina Y, Seykora JT, Crenshaw EB, and Millar SE (2004). Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 131: 2257-2268.

Andl T, Reddy ST, Gaddapara T, and Millar SE (2002). WNT signals are required for the initiation of hair follicle development. Dev Cell 2: 643-653.

Apajalahti S, Arte S, and Pirinen S (1999). Short root anomaly in families and its association with other dental anomalies. Eur J Oral Sci 107: 97-101.

Arte S (2001). Phenotypic and genotypic features of familial hypodontia. Thesis. Institute of Dentistry, University of Helsinki, Finland. http://ethesis.helsinki.fi.

Arte S, Nieminen P, Apajalahti S, Haavikko K, Thesleff I, and Pirinen S (2001). Characteristics of incisor-premolar hypodontia in families. J Dent Res 80: 1445-1450. 2001.

Arte S, Nieminen P, Pirinen S, Thesleff I, and Peltonen L (1996). Gene defect in hypodontia: exclusion of EGF, EGFR, and FGF-3 as candidate genes. J Dent Res 75: 1346-1352.

88 Baccetti T (1998). A controlled study of associated dental anomalies. Angle Orthod 68: 267-274.

Baccetti T (2000). Tooth anomalies associated with failure of eruption of first and second permanent molars. Am J Orthod Dentofacial Orthop 118: 608-610.

Bailit HL (1975). Dental variation among populations. An anthropologic view. Dent Clin North Am 19: 125-139.

Baum BJ and Cohen MM (1971). Agenesis and tooth size in the permanent dentition. Angle Orthod 41: 100-102.

Becker A, Smith P, and Behar R (1981). The incidence of anomalous maxillary lateral incisors in relation to palatally-displaced cuspids. Angle Orthod 51: 24-29.

Bei M and Maas R (1998). FGFs and BMP4 induce both Msx1-independent and Msx1-dependent signaling pathways in early tooth development. Development 125: 4325-4333.

Bendall AJ and Abate-Shen C (2000). Roles for Msx and Dlx homeoproteins in vertebrate development. Gene 247: 17-31.

Bergström K (1977). An orthopantomographic study of hypodontia, supernumeraries and other anomalies in school children between the ages of 8-9 years. An epidemiological study. Swed Dent J 1: 145-157.

Bjerklin K and Kurol J (1981). Prevalence of ectopic eruption of the maxillary first permanent molar. Swed Dent J 5: 29-34.

Bjerklin K, Kurol J, and Valentin J (1992). Ectopic eruption of maxillary first permanent molars and association with other tooth and developmental disturbances. Eur J Orthod 14: 369-375.

Blanpain C, Horsley V, and Fuchs E (2007). Epithelial stem cells: turning over new leaves. Cell 128: 445-458.

Blin-Wakkach C, Lezot F, Ghoul-Mazgar S, Hotton D, Monteiro S, Teillaud C, Pibouin L, Orestes- Cardoso S, Papagerakis P, MacDougall M, Robert B, and Berdal A (2001). Endogenous Msx1 antisense transcript: in vivo and in vitro evidences, structure, and potential involvement in skeleton development in mammals. Proc Natl Acad Sci USA 98: 7336-7341.

Boffelli D, Nobrega MA, and Rubin EM (2004). Comparative genomics at the vertebrate extremes. Nat Rev Genet 5: 456-465.

Boraas JC, Messer LB, and Till MJ (1988). A genetic contribution to dental caries, occlusion, and morphology as demonstrated by twins reared apart. J Dent Res 67: 1150-1155.

Boruchov MJ and Green LJ (1971). Hypodontia in human twins and families. Am J Orthod 60: 165- 174.

Brin I, Becker A, and Shalhav M (1986). Position of the maxillary permanent canine in relation to anomalous or missing lateral incisors: a population study. Eur J Orthod 8: 12-16.

Brook AH (1974). Dental anomalies of number, form and size: their prevalence in British schoolchildren. J Int Assoc Dent Child 5: 37-53.

Brook AH (1984). A unifying aetiological explanation for anomalies of human tooth number and size. Arch Oral Biol 29: 373-378.

89 Brook AH, Elcock C, al-Sharood MH, McKeown HF, Khalaf K, and Smith RN (2002). Further studies of a model for the etiology of anomalies of tooth number and size in humans. Connect Tissue Res 43: 289-295.

Brook AH and Holt RD (1978). The relationship of crown length to root length in permanent maxillary central incisors. Proc Br Paedod Soc 8: 17-20.

Brown K (1983). Evolution of dentition. Birth Defects: Original Article Series : 29-66.

Burgersdijk R and Tan HL (1978). Oral symptoms of the Wolf syndrome: report of case. J Dent Children 45: 488-489.

Burzynski N and Escobar V (1983). Classification and genetics of numeric anomalies of dentition. Birth Defects 13: 95-106.

Butler PM (1939). Studies of the mammalian dentition. Differentiation of the postcanine dentition. Proc Zool Soc Lond 109B: 329-356.

Butler PM (1978). The ontogeny of mammalian heterodonty. J Biol Buccale 6: 217-228.

Butler PM (1995). Ontogenetic aspects of dental evolution. Int J Dev Biol 39: 25-34.

Bäckman B and Wahlin YB (2001). Variations in number and morphology of permanent teeth in 7- year-old Swedish children. Int J Paediatr Dent 11: 11-17.

Camilleri S (2005). Maxillary canine anomalies and tooth agenesis. Eur J Orthod 27: 450-456.

Carlson CS, Eberle MA, Kruglyak L, and Nickerson DA (2004). Mapping complex disease loci in whole-genome association studies. Nature 429: 446-452.

Catron KM, Zhang H, Marshall SC, Inostroza JA, Wilson JM, and Abate C (1995). Transcriptional repression by Msx-1 does not require homeodomain DNA-binding sites. Mol Cell Biol 15: 861- 871.

Celli G, Larochelle WJ, Mackem S, Sharp R, and Merlino G (1998). Soluble dominant-negative receptor uncovers essential roles for fibroblast growth factors in multi-organ induction and patterning. EMBO J 17: 1642-1655.

Celli J, Duijf P, Hamel BCJ, Bamshad M, Kramer B, Smits APT, Newbury-Ecob R, Hennekam RCM, Van Buggenhout G, van Haeringen B, Woods, CG, van Essen AJ, de Waal R, Vriend G, Haber DA, Yang A, McKeon F, Brunner HG, and van Bokhoven H (1999). Heterozygous germline mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell 99: 143-153.

Chai Y, Jiang X, Ito Y, Bringas PJ, Han J, Rowitch DH, Soriano P, McMahon AP, and Sucov HM (2000). Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development 127: 1671-1679.

Chen Y, Bei M, Woo I, Satokata I, and Maas R (1996). Msx1 controls inductive signaling in mammalian tooth morphogenesis. Development 122: 3035-3044.

Chishti MS, Muhammad D, Haider M, and Ahmad W (2006). A novel missense mutation in MSX1 underlies autosomal recessive oligodontia with associated dental anomalies in Pakistani families. J Hum Genet

Chosack A, Eidelman E, and Cohen T (1975). Hypodontia: A polygenic trait - a family study among Israeli jews. J Dent Res 54: 16-19.

90 Clayton JM (1956). Congenital dental anomalies occurring in 3557 children. ASDC J Dent Child : 206-208.

Cobb J and Duboule D (2004). Tracing microRNA patterns in mice. Nat Genet 36: 1033-1034.

Cobourne MT, Hardcastle Z, and Sharpe PT (2001). Sonic hedgehog regulates epithelial proliferation and cell survival in the developing tooth germ. J Dent Res 80: 1974-1979.

Cohen D, Chumakov I, and Weissenbach J (1993). A first-generation physical map of the human genome. Nature 366: 698-701.

Cohn SA (1957). Development of the molar teeth in the albino mouse. Am J Anat 101: 295-319.

Corruccini RS (1984). An epidemiologic transition in dental occlusion in world populations. Am J Orthod 86: 419-426.

Couly G, Grapin-Botton A, Coltey P, Ruhin B, and Le Douarin NM (1998). Determination of the identity of the derivatives of the cephalic neural crest: incompatibility between Hox gene expression and lower jaw development. Development 125: 3445-3459.

Courtois G, Smahi A, Reichenbach J, Döffinger R, Cancrini C, Bonnet M, Puel A, Chable-Bessia C, Yamaoka S, Feinberg J, Dupuis-Girod S, Bodemer C, Livadiotti S, Novelli F, Rossi P, Fischer A, Israel A, Munnich A, Le Deist F, and Casanova JL (2003). A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. J Clin Invest 112: 1108-1115. da Silva Dalben G, Costa B, and Gomide MR (2006). Prevalence of dental anomalies, ectopic eruption and associated oral malformations in subjects with Treacher Collins syndrome. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 101: 588-592.

Dahl E, Koseki H, and Balling R (1997). Pax genes and organogenesis. Bioessays 19: 755-765.

Dahlberg AA (1945). The changing dentition in man. Journal of American Dental Association : 676-690.

Dahllöf G and Huggare J (2004). Orthodontic considerations in the pediatric cancer patients: a review. Semin Orthod 10: 266-276.

Das P, Hai M, Elcock C, Leal SM, Brown DT, Brook AH, and Patel PI (2003). Novel missense mutations and a 288-bp exonic insertion in PAX9 in families with autosomal dominant hypodontia. Am J Med Genet 118A: 35-42.

Das P, Stockton DW, Bauer C, Shaffer LG, D'Souza RN, Wright T, and Patel PI (2002). Haploinsufficiency of PAX9 is associated with autosomal dominant hypodontia. Hum Genet 110: 371-376.

Dassule HR, Lewis P, Bei M, Maas R, and McMahon AP (2000). Sonic hedgehog regulates growth and morphogenesis of the tooth. Development 127: 4775-4785.

Dassule HR and McMahon AP (1998). Analysis of epithelial-mesenchymal interactions in the initial morphogenesis of the mammalian tooth. Dev Biol 202: 215-227.

Daugaard-Jensen J, Nodal M, and Kjaer I (1997a). Pattern of agenesis in the primary dentition: a radiographic study of 193 cases. Int J Paediatr Dent 7: 3-7.

91 Daugaard-Jensen J, Nodal M, Skovgaard LT, and Kjaer I (1997b). Comparison of the pattern of agenesis in the primary and permanent dentitions in a population characterized by agenesis in the primary dentition. Int J Paediatr Dent 7: 143-148.

Davies PL (1968). Relationship of cusp reduction in the permanent mandibular first molar to agenesis of teeth. J Dent Res 47: 499

Davis PJ (1987). Hypodontia and hyperdontia of permanent teeth in Hong Kong schoolchildren. Community Dent Oral Epidemiol 15: 218-220.

Davis PJ and Brook AH (1986). The presentation of talon cusp: diagnosis, clinical features, associations and possible aetiology. Br Dent J 160: 84-88. de la Chapelle A (2004). Genetic predisposition to colorectal cancer. Nat Rev Cancer 4: 769-780.

De Moerlooze L, Spencer-Dene B, Revest J, Hajihosseini M, Rosewell I, and Dickson C (2000). An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development 127: 483-492.

De Muynck S, Schollen E, Matthijs G, Verdonck A, Devriendt K, and Carels C (2004). A novel MSX1 mutation in hypodontia. Am J Med Genet 128A: 401-403.

Demirjian A (1978). [Dental development: index of physiologic maturation]. Med Hyg 36: 3154- 3159.

Dempsey PJ and Townsend GC (2001). Genetic and environmental contributions to variation in human tooth size. Heredity 86: 685-693.

Dempsey PJ, Townsend GC, Martin NG, and Neale MC (1995). Genetic covariance structure of incisor crown size in twins. J Dent Res 74: 1389-1398.

Depew MJ, Lufkin T, and Rubenstein JL (2002). Specification of jaw subdivisions by Dlx genes. Science 298: 381-385.

Depew MJ, Simpson CA, Morasso M, and Rubenstein JL (2005). Reassessing the Dlx code: the genetic regulation of branchial arch skeletal pattern and development. J Anat 207: 501-561.

Devos D, Vuillaume I, de Becdelievre A, de Martinville B, Dhaenens CM, Cuvellier JC, Cuisset JM, Vallee L, Lemaitre MP, Bourteel H, Hachulla E, Wallaert B, Destee A, Defebvre L, and Sablonniere B (2006). New syndromic form of benign hereditary chorea is associated with a deletion of TITF-1 and PAX-9 contiguous genes. Mov Disord 21: 2237-2240.

Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, and Weissenbach J (1996). A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380: 152-154.

Dode C, Levilliers J, Dupont JM, De Paepe A, Le Du N, Soussi-Yanicostas N, Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, Pecheux C, Le Tessier D, Cruaud C, Delpech M, Speleman F, Vermeulen S, Amalfitano A, Bachelot Y, Bouchard P, Cabrol S, Carel JC, Delemarre-van dW, Goulet-Salmon B, Kottler ML, Richard O, Sanchez-Franco F, Saura R, Young J, Petit C, and Hardelin JP (2003). Loss-of-function mutations in FGFR1 cause autosomal dominant Kallmann syndrome. Nat Genet 33: 463-465.

Donis-Keller H, Green P, Helms C, Cartinhour S, Weiffenbach B, Stephens K, Keith TP, Bowden DW, Smith DR , and Lander ES (1987). A genetic linkage map of the human genome. Cell 51: 319-337.

92 Duailibi MT, Duailibi SE, Young CS, Bartlett JD, Vacanti JP, and Yelick PC (2004). Bioengineered teeth from cultured rat tooth bud cells. J Dent Res 83: 523-528.

Dunwell JM (2007). 100 years on: a century of genetics. Nat Rev Genet 8: 231-235.

Dupuis-Girod S, Corradini N, Hadj-Rabia S, Fournet JC, Faivre L, Le Deist F, Durand P, Döffinger R, Smahi A, Israel A, Courtois G, Brousse N, Blanche S, Munnich A, Fischer A, Casanova JL, and Bodemer C (2002). Osteopetrosis, lymphedema, anhidrotic ectodermal dysplasia, and immunodeficiency in a boy and incontinentia pigmenti in his mother. Pediatrics 109: e97.

Döffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, Bodemer C, Kenwrick S, Dupuis-Girod S, Blanche S, Wood P, Rabia SH, Headon DJ, Overbeek PA, Le Deist F, Holland SM, Belani K, Kumararatne DS, Fischer A, Shapiro R, Conley ME, Reimund E, Kalhoff H, Abinun M, Munnich A, and Casanova JL (2001). X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappa B signaling. Nat Genet 27: 277-285. el-Rifai W, Leisti J, Kahkonen M, Pietarinen A, Altherr MR, and Knuutila S (1995). A patient with Wolf-Hirschhorn syndrome originating from translocation t(4;8) (p16.3;q24.3)pat. J Med Genet 32: 65-67.

Endo T, Ozoe R, Yoshino S, and Shimooka S (2006). Hypodontia patterns and variations in craniofacial morphology in Japanese orthodontic patients. Angle Orthod 76: 996-1003.

Ericson S and Kurol J (1986). Longitudinal study and analysis of clinical supervision of maxillary canine eruption. Community Dent Oral Epidemiol 14: 172-176.

Estivill X and Armengol L (2007). Copy Number Variants and Common Disorders: Filling the Gaps and Exploring Complexity in Genome-Wide Association Studies. PLoS Genet 19;3: e190:- 1787-1798.

Fan CM, Porter JA, Chiang C, Chang DT, Beachy PA, and Tessier-Lavigne M (1995). Long-range sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway. Cell 81: 457-465.

Fearne JM and Brook AH (1993). Small primary tooth-crown size in low birthweight children. Early Hum Dev 33: 81-90.

Ferguson CA, Tucker AS, Heikinheimo K, Nomura M, Oh P, Li E, and Sharpe PT (2001). The role of effectors of the activin signalling pathway, activin receptors IIA and IIB, and Smad2, in patterning of tooth development. Development 128: 4605-4613.

Ferguson CA, Tucker AS, and Sharpe PT (2000). Temporospatial cell interactions regulating mandibular and maxillary arch patterning. Development 127: 403-412.

Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, and Franco B (2001). Identification of the gene for oral-facial-digital type I syndrome. Am J Hum Genet 68: 569-576.

Feuk L, Carson AR, and Scherer SW (2006). Structural variation in the human genome. Nat Rev Genet 7: 85-97.

Frazier-Bowers SA, Guo DC, Cavender A, Xue L, Evans B, King T, Milewicz D, and D'Souza RN (2002). A novel mutation in human PAX9 causes molar oligodontia. J Dent Res 81: 129-133.

93 Frazier-Bowers SA, Pham KY, Le EV, Cavender AC, Kapadia H, King TM, Milewicz DM, and D'Souza RN (2003). A unique form of hypodontia seen in Vietnamese patients: cinical and molecular analysis. J Med Genet 40: E79

Freeman JL, Perry GH, Feuk L, Redon R, McCarroll SA, Altshuler DM, Aburatani H, Jones KW, Tyler-Smith C, Hurles ME, Carter NP, Scherer SW, and Lee C (2006). Copy number variation: new insights in genome diversity. Genome Res 16: 949-961.

Freimer N and Sabatti C (2004). The use of pedigree, sib-pair and association studies of common diseases for genetic mapping and epidemiology. Nat Genet 36: 1045-1051.

Friedman JR and Kaestner KH (2006). The Foxa family of transcription factors in development and metabolism. Cell Mol Life Sci 63: 2317-2328.

Fuchs E, Tumbar T, and Guasch G (2004). Socializing with the neighbors: stem cells and their niche. Cell 116: 769-778.

Galis F (1999). Why do almost all mammals have seven cervical vertebrae? Developmental constraints, Hox genes, and cancer. J Exp Zool 285: 19-26.

Galis F and Metz JA (2003). Anti-cancer selection as a source of developmental and evolutionary constraints. Bioessays 25: 1035-1039.

Garn SM, Dahlberg AA, Lewis AB, and Kerewsky RS (1966). Cusp number, occlusal groove pattern and human taxonomy. Nature 210: 224-225.

Garn SM and Lewis AB (1970). The gradient and the pattern of crown-size reduction in simple hypodontia. Angle Orthod 40: 51-58.

Garn SM, Lewis AB, and BONNE B (1961). Third molar polymorphism and the timing of tooth formation. Nature 192: 989

Garn SM, Lewis AB, and Kerewsky RS (1964). Third molar agenesis and variation in size of the remaining teeth. Nature 201: 839

Garn SM, Lewis AB, and Walenga AJ (1968). Genetic basis of the crown-size profile pattern. J Dent Res 47: 1190

Garn SM, Osborne RH, and McCabe KD (1979). The effect of prenatal factors on crown dimensions. Am J Phys Anthropol 51: 665-678.

Gat U, DasGupta R, Degenstein L, and Fuchs E (1998). De novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. Cell 95: 605-614.

Gaunt WA (1964). Changes in the form of the jaws of the albino mouse during ontogeny. Acta Anat 58: 37-61.

Gilbert, S.F. (2003). Developmental biology. 6th edition. Sinauer, Sunderland.

Giles RH, van Es JH, and Clevers H (2003). Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 1653: 1-24.

Giudicelli F and Lewis J (2004). The vertebrate segmentation clock. Curr Opin Genet Dev 14: 407- 414.

94 Glasstone S (1963). Regulative changes in tooth germs grown in tissue culture. J Dent Res 42: SUPPL 1364-1368.

Glasstone S (1967). Morphodifferentiation of teeth in embryonic mandibular segments in tissue culture. J Dent Res 46: 611-614.

Graber LW (1978). Congenital absence of teeth: a review with emphasis on inheritance patterns. J Am Dent Assoc 96: 266-275.

Grahnen H (1956). Hypodontia in the permanent dentition. Odont Revy 7: 1-100.

Gravely JF and Johnson DB (1971). Variation in the expression of hypodontia in monozygotic twins. Dent Pract Dent Rec 21: 212-220.

Grigoriou M, Tucker AS, Sharpe PT, and Pachnis V (1998). Expression and regulation of lhx6 and lhx7, a novel subfamily of lim homeodomain encoding genes, suggests a role in mammalian head development. Development 125: 2063-2074.

Gritli-Linde A, Bei M, Maas R, Zhang XM, Linde A, and McMahon AP (2002). Shh signaling within the dental epithelium is necessary for cell proliferation, growth and polarization. Development 129: 5323-5337.

Gritli-Linde, A., Lewis, P., McMahon, A.P., and Linde, A. (2001). The whereabouts of a morphogen: Direct evidence for short- and graded long-range activity of Hedgehog signaling peptides. Dev Biol 236: 364–386

Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, DenBesten P, Robey PG, and Shi S (2002). Stem cell properties of human dental pulp stem cells. J Dent Res 81: 531-535.

Grüneberg H (1951). The Genetics of Tooth Defect in the Mouse. Proc R Soc Lond B : 437-451.

Guttman, B., Griffiths, A., Suzuki, D., and Cullis, T. (2002). Genetics (Oxford: Oneworld).

Haavikko K (1970). The formation and the alveolar and clinical eruption of the permanent teeth. An orthopantomographic study. Suom Hammaslaak Toim 66: 103-170.

Haavikko K (1971). Hypodontia of permanent teeth. Proc Finn Dent Soc 67: 219-225.

Hamner JE, Witkop CJJ, and Metro PS (1964). Taurodontism; Report of a Case. Oral Surg Oral Med Oral Pathol 18:409-18.: 409-418.

Harada H, Kettunen P, Jung HS, Mustonen T, Wang YA, and Thesleff I (1999). Localization of putative stem cells in dental epithelium and their association with Notch and FGF signaling. J Cell Biol 147: 105-120.

Hardcastle Z, Mo R, Hui CC, and Sharpe PT (1998). The shh signalling pathway in tooth development - defects in gli2 and gli3 mutants. Development 125: 2803-2811.

Hardy MH (1992). The secret life of the hair follicle. Trends Genet 8: 55-61.

Harila-Kaera V, Heikkinen T, Alvesalo L, and Osborne RH (2001). Permanent tooth crown dimensions in prematurely born children. Early Hum Dev 62: 131-147.

Harris MP, Hasso SM, Ferguson MW, and Fallon JF (2006). The development of archosaurian first- generation teeth in a chicken mutant. Curr Biol 16: 371-377.

95 Haworth KE, Healy C, Morgan P, and Sharpe PT (2004). Regionalisation of early head ectoderm is regulated by endoderm and prepatterns the orofacial epithelium. Development 131: 4797-4806.

Haworth KE, Wilson JM, Grevellec A, Cobourne MT, Healy C, Helms JA, Sharpe PT, and Tucker AS (2007). Sonic hedgehog in the pharyngeal endoderm controls arch pattern via regulation of Fgf8 in head ectoderm. Dev Biol 303: 244-258.

Headon DJ, Emmal SA, Ferguson BM, Tucker AS, Justice MJ, Sharpe PT, Zonana J, and Overbeek PA (2001). Gene defect in ectodermal dysplasia implicates a death domain adapter in development. Nature 414: 913-916.

Headon DJ and Overbeek PA (1999). Involvement of a novel TNF receptor homologue in hair follicle induction. Nat Genet 22: 370-374.

Heikkinen T, Alvesalo L, Osborne RH, and Tienari J (1994). Maternal smoking and tooth formation in the foetus. II. Tooth crown size in the permanent dentition. Early Hum Dev 40: 73-86.

Hobert O (2007). miRNAs Play a Tune. Cell 131: 22-24.

Hogan BL (1999). Morphogenesis. Cell 96: 225-233.

Holloway PJ, Shaw JH, and Sweeney EA (1961). Effects of various sucrose: casein ratios in purified diets on the teeth and supporting structures of rats. Arch Oral Biol 3:185-200.: 185-200.

Hu G, Vastardis H, Bendall AJ, Wang Z, Logan M, Zhang H, Nelson C, Stein S, Greenfield N, Seidman CE, Seidman JG, and Abate-Shen C (1998). Haploinsufficiency of MSX1: a mechanism for selective tooth agenesis. Mol Cell Biol 18: 6044-6051.

Hu JC and Simmer JP (2007). Developmental biology and genetics of dental malformations. Orthod Craniofac Res 10: 45-52.

Hunstadbraten K (1964). Hypodonti i det permanente tannsett. Nor Tandlaegeforen Tid : 64-69.

Huysseune A and Thesleff I (2004). Continuous tooth replacement: the possible involvement of epithelial stem cells. Bioessays 26: 665-671.

Hölttä P (2005). Developmental aberrations of permanent teeth after high-dose anticancer therapy in childhood : A study on stem cell transplant recipients. Thesis. Institute of Dentistry, University of Helsinki, Finland. http://ethesis.helsinki.fi.

Ida M, Nakamura T, and Utsunomiya J (1981). Osteomatous changes and tooth abnormalities found in the jaw of patients with adenomatosis coli. Oral Surg Oral Med Oral Pathol 52: 2-11.

Imai H, Osumi-Yamashita N, Ninomiya Y, and Eto K (1996). Contribution of early-emigrating midbrain crest cells to the dental mesenchyme of mandibular molar teeth in rat embryos. Dev Biol 176: 151-165.

Irish JD and Guatelli-Steinberg D (2003). Ancient teeth and modern human origins: an expanded comparison of African Plio-Pleistocene and recent world dental samples. J Hum Evol 45: 113- 144.

Ivens A, Flavin N, Williamson R, Dixon M, Bates G, Buckingham M, and Robert B (1990). The human homeobox gene HOX7 maps to chromosome 4p16.1 and may be implicated in Wolf- Hirschhorn syndrome. Hum Genet 84: 473-476.

96 Jabs EW, Muller U, Li X, Ma L, Luo W, Haworth IS, Klisak I, Sparkes, Warman ML, and Mulliken JB (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell 75: 443-450.

Jaffe N, Toth BB, Hoar RE, Ried HL, Sullivan MP, and McNeese MD (1984). Dental and maxillofacial abnormalities in long-term survivors of childhood cancer: effects of treatment with chemotherapy and radiation to the head and neck. Pediatrics 73: 816-823.

Jensen BL and Kreiborg S (1990). Development of the dentition in cleidocranial dysplasia. J Oral Pathol Med 19: 89-93.

Jensen E, Kai-Jen YEN, Moorrees CF, and Thomsen SO (1957). Mesiodistal crown diameters of the deciduous and permanent teeth in individuals. J Dent Res 36: 39-47.

Jernvall J (1995). Mammalian molar cusp patterns: Developmental mechanisms of diversity. Acta Zool Fennica 198: 1-61.

Jernvall J, Keränen SV, and Thesleff I (2000). Evolutionary modification of development in mammalian teeth: quantifying gene expression patterns and topography [In Process Citation]. Proc Natl Acad Sci U S A 97: 14444-14448.

Jernvall J, Kettunen P, Karavanova I, Martin LB, and Thesleff I (1994). Evidence for the role of the enamel knot as a control center in mammalian tooth cusp formation: non-dividing cells express growth stimulating Fgf-4 gene. Int J Dev Biol 38: 463-469.

Jernvall J and Thesleff I (2000). Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 92: 19-29.

Jernvall J, Åberg T, Kettunen P, Keränen S, and Thesleff I (1998). The life history of an embryonic signaling center: BMP-4 induces p21 and is associated with apoptosis in the mouse tooth enamel knot. Development 125: 161-169.

Jezewski PA, Vieira AR, Nishimura C, Ludwig B, Johnson M, O'Brien SE, Daack-Hirsch S, Schultz RE, Weber A, Nepomucena B, Romitti PA, Christensen K, Orioli IM, Castilla EE, Machida J, Natsume N, and Murray JC (2003). Complete sequencing shows a role for MSX1 in non- syndromic cleft lip and palate. J Med Genet 40: 399-407.

Jumlongras D, Bei M, Stimson JM, Wang WF, DePalma SR, Seidman CE, Felbor U , Maas R, Seidman JG, and Olsen BR (2001). A nonsense mutation in MSX1 causes Witkop syndrome. Am J Hum Genet 69: 67-74.

Jumlongras D, Lin JY, Chapra A, Seidman CE, Seidman JG, Maas RL, and Olsen BR (2004). A novel missense mutation in the paired domain of PAX9 causes non-syndromic oligodontia. Hum Genet 114: 242-249.

Järvinen E, Salazar-Ciudad I, Birchmeier W, Taketo MM, Jernvall J, and Thesleff I (2006). Continuous tooth generation in mouse is induced by activated epithelial Wnt/beta-catenin signaling. Proc Natl Acad Sci USA 103: 18627-18632.

Järvinen HJ, Peltokallio P, Landtman M, and Wolf J (1982). Gardner's stigmas in patients with familial adenomatosis coli. Br J Surg 69: 718-721.

Järvinen HJ and Peltomäki P (2004). The complex genotype-phenotype relationship in familial adenomatous polyposis. Eur J Gastroenterol Hepatol 16: 5-8.

97 Järvinen S and Lehtinen L (1981). Supernumerary and congenitally missing primary teeth in Finnish children. An epidemiologic study. Acta Odontol Scand 39: 83-86.

Jörgensen KD (1955). The Dryopithecus pattern in recent Danes and Dutchmen. J Dent Res 34: 195-208.

Kajii TS, Sato Y, Kajii S, Sugawara Y, and Iida J (2004). Agenesis of third molar germs depends on sagittal maxillary jaw dimensions in orthodontic patients in Japan. Angle Orthod 74: 337-342.

Kangas AT, Evans AR, Thesleff I, and Jernvall J (2004). Nonindependence of mammalian dental characters. Nature 432: 211-214.

Kapadia H, Frazier-Bowers S, Ogawa T, and D'Souza RN (2006). Molecular characterization of a novel PAX9 missense mutation causing posterior tooth agenesis. Eur J Hum Genet

Kapadia H, Mues G, and D'Souza R (2007). Genes affecting tooth morphogenesis. Orthod Craniofac Res 10: 105-113.

Kardong, K. (1995). Vertebrates: Comparative Anatomy, Function, Evolution (McGraw-Hill).

Karlstedt E, Kaitila I, and Pirinen S (1996). Phenotypic features of dentition in diastrophic dysplasia. J Craniofac Genet Dev Biol 16: 164-173.

Kassai Y, Munne P, Hotta Y, Penttila E, Kavanagh K, Ohbayashi N, Takada S , Thesleff I, Jernvall J, and Itoh N (2005). Regulation of mammalian tooth cusp patterning by ectodin. Science 309: 2067-2070.

Kataja M, Nystrom M, and Aine L (1989). Dental maturity standards in southern Finland. Proc Finn Dent Soc 85: 187-197.

Kattainen H, Tuukkanen J, Simanainen U, Tuomisto JT, Kovero O, Lukinmaa PL, Alaluusua S, Tuomisto J, and Viluksela M (2001). In utero/lactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure impairs molar tooth development in rats. Toxicol Appl Pharmacol 174: 216-224.

Kaufman MH, Chang HH, and Shaw JP (1995). Craniofacial abnormalities in homozygous small eye (sey/sey) embryos and newborn mice. J Anat 186: 607-617.

Kere J (2001). Human population genetics: lessons from Finland. Annu Rev Genomics Hum Genet 2: 103-128.

Kere J, Srivastava AK, Montonen O, Zonana J, Thomas N, Ferguson B, Munoz F, Morgan D, Clarke A, Baybayan P, Chen EY, Ezer S, Saarialho-Kere U, de la Chapelle A, and Schlessinger D (1996). X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat Genet 13: 409-416.

Keränen SV, Kettunen P, Åberg T, Thesleff I, and Jernvall J (1999). Gene expression patterns associated with suppression of odontogenesis in mouse and vole diastema regions. Dev Genet Evol 209: 495-506.

Kettunen P, Karavanova I, and Thesleff I (1998). Responsiveness of developing dental tissues to fibroblast growth factors - expression of splicing alternatives of FGFR1, -2, -3, and of FGFR4 - and stimulation of cell proliferation by FGF-2, -4, -8, and -9. Dev Genet 22: 374-385.

Kettunen P, Laurikkala J, Itaranta P, Vainio S, Itoh N, and Thesleff I (2000). Associations of FGF-3 and FGF-10 with signaling networks regulating tooth morphogenesis. Dev Dyn 219 : 322-332.

98 Kettunen P, Loes S, Furmanek T, Fjeld K, Kvinnsland IH, Behar O, Yagi T, Fujisawa H, Vainio S, Taniguchi M, and Luukko K (2005). Coordination of trigeminal axon navigation and patterning with tooth organ formation: epithelial-mesenchymal interactions, and epithelial Wnt4 and Tgf{beta}1 regulate semaphorin 3a expression in the dental mesenchyme. Development 132: 323-334.

Kettunen P and Thesleff I (1998). Expression and function of FGFs-4, -8, and -9 suggest functional redundancy and repetitive use as epithelial signals during tooth morphogenesis. Dev Dyn 211: 256-268.

Khalaf K, Robinson DL, Elcock C, Smith RN, and Brook AH (2005). Tooth size in patients with supernumerary teeth and a control group measured by image analysis system. Arch Oral Biol 50: 243-248.

Kidd KK, Pakstis AJ, Speed WC, and Kidd JR (2004). Understanding human DNA sequence variation. J Hered 95: 406-420.

Kim JW and Simmer JP (2007). Hereditary dentin defects. J Dent Res 86: 392-399.

Kim JW, Simmer JP, Lin BP, and Hu JC (2006). Novel MSX1 Frameshift Causes Autosomal- dominant Oligodontia. J Dent Res 85: 267-271.

Kimmel NA, Gellin ME, Bohannan HM, and Kaplan AL (1982). Ectopic eruption of maxillary first permanent molars in different areas of the United States. ASDC J Dent Child 49: 294-299.

Kirkham J, Kaur R, Stillman EC, Blackwell PG, Elcock C, and Brook AH (2005). The patterning of hypodontia in a group of young adults in Sheffield, UK. Arch Oral Biol 50: 287-291.

Kist R, Watson M, Wang X, Cairns P, Miles C, Reid DJ, and Peters H (2005). Reduction of Pax9 gene dosage in an allelic series of mouse mutants causes hypodontia and oligodontia. Hum Mol Genet

Kitisin K, Saha T, Blake T, Golestaneh N, Deng M, Kim C, Tang Y, Shetty K, Mishra B, and Mishra L (2007). Tgf-Beta signaling in development. Sci STKE 2007 : cm1

Klein ML, Nieminen P, Lammi L, Niebuhr E, and Kreiborg S (2005). Novel Mutation of the Initiation Codon of PAX9 Causes Oligodontia. J Dent Res 84: 43-47.

Klein OD, Minowada G, Peterkova R, Kangas A, Yu BD, Lesot H, Peterka M, Jernvall J, and Martin GR (2006). Sprouty genes control diastema tooth development via bidirectional antagonism of epithelial-mesenchymal FGF signaling. Dev Cell 11: 181-190.

Kollar EJ and Baird GR (1969). The influence of the dental papilla on the development of tooth shape in embryonic mouse tooth germs. Journal of Embryology and Experimental Morphology 21: 131-148.

Kollar EJ and Baird GR (1970). Tissue interactions in embryonic mouse tooth germs. I. Reorganization of the dental epithelium during tooth-germ reconstruction. Journal of Embryology and Experimental Morphology 24: 159-171.

Kollar EJ and Mina M (1991). Role of the early epithelium in the patterning of the teeth and Meckel's cartilage. J Craniofac Genet Dev Biol 11: 223-228.

Kotilainen J (1996). Development of dentition in conditions with multiple congenital anomalies. Thesis. Institute of Dentistry, University of Helsinki, Finland.

99 Kotsomitis N, Dunne MP, and Freer TJ (1996). A genetic aetiology for some common dental anomalies: a pilot twin study. Aust Orthod J 14: 172-178.

Kratochwil K, Galceran J, Tontsch S, Roth W, and Grosschedl R (2002). FGF4, a direct target of LEF1 and Wnt signaling, can rescue the arrest of tooth organogenesis in Lef1(-/-) mice. Genes Dev 16: 3173-3185.

Kraus BS, Ames MD, and Clark GR (1969). Effects of maternal rubella on dental crown development. Clin Pediatr 8: 204-215.

Kruglyak L (1999). The use of a genetic map of biallelic markers in linkage studies. Nat Genet 17: 21-24.

Kruglyak L, Daly MJ, Reeve-Daly MP, and Lander ES (1996). Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet 58: 1347-1363.

Kurol J and Bjerklin K (1982). Ectopic eruption of maxillary first permanent molars: familial tendencies. ASDC J Dent Child 49: 35-38.

Kurotaki N, Imaizumi K, Harada N, Masuno M, Kondoh T, Nagai T, Ohashi H , Naritomi K, Tsukahara M, Makita Y, Sugimoto T, Sonoda T, Hasegawa T, Chinen Y, Tomita HH, Kinoshita A, Mizuguchi T, Yoshiura KK, Ohta T, Kishino T, Fukushima Y, Niikawa N, and Matsumoto N (2002). Haploinsufficiency of NSD1 causes Sotos syndrome. Nat Genet 30: 365-366.

Lai PY and Seow WK (1989). A controlled study of the association of various dental anomalies with hypodontia of permanent teeth. Pediatr Dent 11: 291-296.

Lammi L, Arte S, Somer M, Järvinen H, Lahermo P, Thesleff I, Pirinen S , and Nieminen P (2004). Mutations in AXIN2 Cause Familial Tooth Agenesis and Predispose to Colorectal Cancer. Am J Hum Genet 74: 1043-1050.

Lammi L, Halonen K, Pirinen S, Thesleff I, Arte S, and Nieminen P (2003). A missense mutation in PAX9 in a family with distinct phenotype of oligodontia . Eur J Hum Genet 11: 866-871.

Lathrop GM, Lalouel JM, Julier C, and Ott J (1984). Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 81: 3443-3446.

Laurikkala J, Mikkola M, Mustonen T, Åberg T, Koppinen, Pispa J, Nieminen P, Galceran J, Grosschedl R, and Thesleff I (2001). TNF signaling via the ligand-receptor pair ectodysplasin and edar controls the function of epithelial signaling centers and is regulated by Wnt and activin during tooth organogenesis. Dev Biol 229: 443-455.

Laurikkala J, Mikkola ML, James M, Tummers M, Mills AA, and Thesleff I (2006). p63 regulates multiple signalling pathways required for ectodermal organogenesis and differentiation. Development 133: 1553-1563.

Laurikkala J, Pispa J, Jung HS, Nieminen P, Mikkola M, Wang X, Saarialho-Kere U, Galceran J, Grosschedl R, and Thesleff I (2002). Regulation of hair follicle development by the TNF signal ectodysplasin and its receptor Edar. Development 129: 2541-2553.

Lavelle CL, Ashton EH, and Flinn RM (1970). Cusp pattern, tooth size and third molar agenesis in the human mandibular dentition. Arch Oral Biol 15: 227-237.

Lee SH, Fu KK, Hui JN, and Richman JM (2001). Noggin and retinoic acid transform the identity of avian facial prominences. Nature 414: 909-912.

100 Letra A, de Almeida AL, Kaizer R, Esper LA, Sgarbosa S, and Granjeiro JM (2007). Intraoral features of Apert's syndrome. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 103: e38- e41

Levy S, Sutton G, Ng PC, Feuk L, Halpern AL, Walenz BP, Axelrod N, Huang J, Kirkness EF, Denisov G, Lin Y, Macdonald JR, Pang AW, Shago M, Stockwell TB, Tsiamouri A, Bafna V, Bansal V, Kravitz SA, Busam DA, Beeson KY, McIntosh TC, Remington KA , Abril JF, Gill J, Borman J, Rogers YH, Frazier ME, Scherer SW, Strausberg RL, and Venter JC (2007). The Diploid Genome Sequence of an Individual Human. PLoS Biol 5 (e254): 21132144

Lewin DL (1997). Evolutions:mammalian tooth development. The Journal of NIH Research : 75- 80.

Lexner MO, Bardow A, Hertz JM, Nielsen LA, and Kreiborg S (2007). Anomalies of tooth formation in hypohidrotic ectodermal dysplasia. Int J Paediatr Dent 17: 10-18.

Li ZY, Chen L, Liu L, Lin YF, Li SW, and Tian WD (2007). Odontogenic potential of bone marrow mesenchymal stem cells. J Oral Maxillofac Surg 65: 494-500.

Lidral AC and Reising BC (2002). The role of MSX1 in human tooth agenesis. J Dent Res 81: 274- 278.

Lidral AC, Romitti PA, Basart AM, Doetschman T, Leysens NJ, Daack-Hirsch S, Semina EV, Johnson LR, Machida J, Burds A, Parnell, TJ, Rubenstein JL, and Murray JC (1998). Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet 63: 557-568.

Lin CR, Kioussi C, O'Connell S, Briata P, Szeto D, Liu F, Izpisua-Belmonte JC, and Rosenfeld MG (1999). Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature 401: 279-282.

Lind V (1972). Short root anomaly. Scand J Dent Res 80: 85-93.

Little PF (2005). Structure and function of the human genome. Genome Res 15: 1759-1766.

Logan CY and Nusse R (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20:781-810.: 781-810.

Lu MF, Pressman C, Dyer R, Johnson RL, and Martin JF (1999). Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature 401: 276-278.

Luckett, W.P. (1993). An Ontogenetic Assessment of Dental Homologies in Therian Mammals. In Mammal Phylogeny. F.S. Szalay, M.J. Novacek, and M.C. McKenna, eds. (New York: Springer- Verlag), pp. 182-204.

Lukinmaa PL, Ranta H, Ranta K, Kaitila I, and Hietanen J (1987). Dental findings in osteogenesis imperfecta: II. Dysplastic and other developmental defects. J Craniofac Genet Dev Biol 7: 127- 135.

Lukinmaa PL, Sahlberg C, Leppaniemi A, Partanen AM, Kovero O, Pohjanvirta R, Tuomisto J, and Alaluusua S (2001). Arrest of rat molar tooth development by lactational exposure to 2,3,7,8- tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 173: 38-47.

Lumsden AG (1979). Pattern formation in the molar dentition of the mouse. J Biol Buccale 7: 77- 103.

101 Lumsden AG (1988). Spatial organization of the epithelium and the role of neural crest cells in the initiation of the mammalian tooth germ. Development 103 Suppl: 155-169.

Luukko K (1997). Neuronal cells and neurotrophins in odontogenesis. Thesis. Institute of Dentistry and Institute of Biotechnology, University of Helsinki, Finland.

Lyngstadaas SP, Nordbo H, Gedde-Dahl TJ, and Thrane PS (1996). On the genetics of hypodontia and microdontia: synergism or allelism of major genes in a family with six affected members. J Med Genet 33: 137-142.

Lysell L (1953). [14 Selected cases of hypodontia with observations on tooth size in these cases.]. Sven Tandlak Tidskr 46: 281-302.

Lysell L and Myrberg N (1982). Mesiodistal tooth size in the deciduous and permanent dentitions. Eur J Orthod 4: 113-122.

MacDougall M, Dong J, and Acevedo AC (2006). Molecular basis of human dentin diseases. Am J Med Genet A

Mackay TFC (2001): The genetic architecture of quantitative traits. Annu Rev Genet 35: 303-339.

MacKenzie A, Ferguson MW, and Sharpe PT (1991). Hox-7 expression during murine craniofacial development. Development 113: 601-611.

MacKenzie A, Ferguson MW, and Sharpe PT (1992). Expression patterns of the homeobox gene, Hox-8, in the mouse embryo suggest a role in specifying tooth initiation and shape. Development 115: 403-420.

Magnusson TE (1984). Hypodontia, hyperodontia, and double formation of primary teeth in Iceland. An epidemiological study. Acta Odontol Scand 42: 137-139.

Mahaney MC, Fujiwara TM, and Morgan K (1990). Dental agenesis in the Dariusleut Hutterite Brethren: comparisons to selected Caucasoid population surveys. Am J Phys Anthropol 82: 165- 177.

Makris C, Godfrey VL, Krahn-Senftleben G, Takahashi T, Roberts JL, Schwarz T, Feng L, Johnson RS, and Karin M (2000). Female mice heterozygous for IKK gamma/NEMO deficiencies develop a dermatopathy similar to the human X-linked disorder incontinentia pigmenti. Molecular Cell 5: 969-979.

Mandeville L (1949). Congenital absence of permanent maxillary lateral incisor teeth; a preliminary investigation. Ann Eugen 15: 1-10.

Mandler M and Neubuser A (2001). FGF signaling is necessary for the specification of the odontogenic mesenchyme. Dev Biol 240: 548-559.

Marden PM, Smith DW, and McDonald MJ (1964). Congenital Anomalies In The Newborn Infant, Including Minor Variations. A Study Of 4,412 Babies By Surface Examination For Anomalies And Buccal Smear For Sex Chromatin. J Pediatr 64:357-71.: 357-371.

Markovic M (1982). Hypodontia in twins. Swed Dent J 15 Suppl: 153-162.

Markovic M (1992). At the crossroads of oral facial genetics. Eur J Orthod 14: 469-481.

Mattheeuws N, Dermaut L, and Martens G (2004). Has hypodontia increased in Caucasians during the 20th century? A meta-analysis. Eur J Orthod 26: 99-103.

102 Matzuk MM, Kumar TR, and Bradley A (1995a). Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374: 356-360.

Matzuk MM, Kumar TR, Vassalli A, Bickenbach JR, Roop DR, Jaenisch R, and Bradley A (1995b). Functional analysis of activins during mammalian development. Nature 374: 354-356.

McKeown HF, Robinson DL, Elcock C, al-Sharood M, and Brook AH (2002). Tooth dimensions in hypodontia patients, their unaffected relatives and a control group measured by a new image analysis system. Eur J Orthod 24: 131-141.

Mensah JK, Ogawa T, Kapadia H, Cavender AC, and D'Souza RN (2004). Functional analysis of a mutation in PAX9 associated with familial tooth agenesis in humans. J Biol Chem 279: 5924- 5933.

Mikkola ML and Millar SE (2006). The mammary bud as a skin appendage: unique and shared aspects of development. J Mammary Gland Biol Neoplasia 11: 187-203.

Mikkola ML and Thesleff I (2003). Ectodysplasin signaling in development. Cytokine Growth Factor Rev 14: 211-224.

Miles, A.E.W. and Grigson, C. (1990). Colyer's Variations and diseases of the teeth in animals. Cambridge University Press, Cambridge.

Miletich I, Buchner G, and Sharpe PT (2005). Barx1 and evolutionary changes in feeding. J Anat 207: 619-622.

Miller WA (1969). Inductive changes in early tooth development. I. A study of mouse tooth development on the chick chorioallantois. J Dent Res 48: 719-725.

Mills AA, Zheng BH, Wang XJ, Vogel H, Roop DR, Bradley A, and abradley (1999). p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 398: 708-713.

Mina M and Kollar EJ (1987). The induction of odontogenesis in non-dental mesenchyme combined with early murine mandibular arch epithelium. Arch Oral Biol 32: 123-127.

Mitsiadis TA, Angeli I, James C, Lendahl U, and Sharpe PT (2003). Role of Islet1 in the patterning of murine dentition. Development 130: 4451-4460.

Mitsiadis TA, Cheraud Y, Sharpe P, and Fontaine-Perus J (2003). Development of teeth in chick embryos after mouse neural crest transplantations. Proc Natl Acad Sci USA 100: 6541-6545.

Monreal AW, Ferguson BM, Headon DJ, Street SL, Overbeek PA, and Zonana J (1999). Mutations in the human homologue of mouse dl cause autosomal recessive and dominant hypohidrotic ectodermal dysplasia. Nat Genet 22: 366-369.

Monsoro-Burq AH, Wang E, and Harland R (2005). Msx1 and Pax3 Cooperate to Mediate FGF8 and WNT Signals during Xenopus Neural Crest Induction. Dev Cell 8: 167-178.

Moorrees CF, Fanning EA, and Hunt EEJ (1963). Age Variation of Formation Stages for Ten Permanent Teeth. J Dent Res 42:1490-502.: 1490-1502.

Mostowska A, Biedziak B, and Jagodzinski PP (2006). Axis inhibition protein 2 (AXIN2) polymorphisms may be a risk factor for selective tooth agenesis. J Hum Genet 51: 262-266.

Mostowska A, Biedziak B, and Trzeciak WH (2005). A novel mutation in PAX9 causes familial form of molar oligodontia. Eur J Hum Genet 14:173-179.

103 Mostowska A, Kobielak A, Biedziak B, and Trzeciak WH (2003). Novel mutation in the paired box sequence of PAX9 gene in a sporadic form of oligodontia. Eur J Oral Sci 111: 272-276.

Mucchielli ML, Mitsiadis TA, Raffo S, Brunet JF, Proust JP, Goridis, and C. (1997). Mouse Otlx2/RIEG expression in the odontogenic epithelium precedes tooth initiation and requires mesenchyme-derived signals for its maintenance. Dev Biol 189: 275-284.

Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole WG, Henn W, Knoll JH, Owen MJ, Mertelsmann R, Zabel, BU, and Olsen BR (1997). Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89: 773-779.

Mustonen T, Ilmonen M, Pummila M, Kangas AT, Laurikkala J, Jaatinen R, Pispa J, Gaide O, Schneider P, Thesleff I, and Mikkola ML (2004). Ectodysplasin A1 promotes placodal cell fate during early morphogenesis of ectodermal appendages. Development 131: 4907-4919.

Mustonen T, Pispa J, Mikkola ML, Pummila M, Kangas AT, Pakkasjarvi L, Jaatinen R, and Thesleff I (2003). Stimulation of ectodermal organ development by Ectodysplasin-A1. Dev Biol 259: 123-136.

Naito A, Yoshida H, Nishioka E, Satoh M, Azuma S, Yamamoto T, Nishikawa S, and Inoue J (2002). TRAF6-deficient mice display hypohidrotic ectodermal dysplasia. Proc Natl Acad Sci USA 99: 8766-8771.

Nakatomi M, Morita I, Eto K, and Ota MS (2006). Sonic hedgehog signaling is important in tooth root development. J Dent Res 85: 427-431.

Narod SA, Hawkins MM, Robertson CM, and Stiller CA (1997). Congenital anomalies and childhood cancer in Great Britain. Am J Hum Genet 60: 474-485.

Neubuser A, Peters H, Balling R, and Martin GR (1997). Antagonistic interactions between fgf and bmp signaling pathways - a mechanism for positioning the sites of tooth formation. Cell 90: 247-255.

Ng D, Thakker N, Corcoran CM, Donnai D, Perveen R, Schneider A, Hadley DW, Tifft C, Zhang L, Wilkie AO, van der Smagt JJ, Gorlin RJ, Burgess SM, Bardwell VJ, Black GC, and Biesecker LG (2004). Oculofaciocardiodental and Lenz microphthalmia syndromes result from distinct classes of mutations in BCOR. Nat Genet 36: 411-416.

Nichols DH (1986). Formation and distribution of neural crest mesenchyme to the first pharyngeal arch region of the mouse embryo. Am J Anat 176: 221-231.

Nieminen P, Arte S, Tanner D, Paulin L, Alaluusua S, Thesleff I, and Pirinen S (2001). Identification of a nonsense mutation in the PAX9 gene in molar oligodontia. Eur J Hum Genet 9: 743-746.

Nieminen P, Kotilainen J, Aalto Y, Knuutila S, Pirinen S, and Thesleff I (2003). MSX1 Gene is Deleted in Wolf-Hirschhorn Syndrome Patients with Oligodontia. J Dent Res 82: 1013-1017.

Nikali K, Suomalainen A, Terwilliger J, Koskinen T, Weissenbach J, and Peltonen L (1995). Random search for shared chromosomal regions in four affected individuals: the assignment of a new hereditary ataxia locus. Am J Hum Genet 56: 1088-1095.

Niswander JD and Sujaku C (1963). Congenital Anomalies of Teeth in Japanese Children. Am J Phys Anthropol 21: 569-574.

Nodal M, Kjaer I, and Solow B (1994). Craniofacial morphology in patients with multiple congenitally missing permanent teeth. Eur J Orthod 16: 104-109.

104 Nordgarden H, Jensen JL, and Storhaug K (2001). Oligodontia is associated with extra-oral ectodermal symptoms and low whole salivary flow rates. Oral Dis 7: 226-232.

Näsman M, Forsberg CM, and Dahllöf G (1997). Long-term dental development in children after treatment for malignant disease. Eur J Orthod 19: 151-159.

Ogawa T, Kapadia H, Feng JQ, Raghow R, Peters H, and D'Souza RN (2006). Functional Consequences of Interactions between Pax9 and Msx1 Genes in Normal and Abnormal Tooth Development. J Biol Chem 281: 18363-18369.

Ohazama A, Courtney JM, Tucker AS, Naito A, Tanaka S, Inoue J, and Sharpe PT (2004). Traf6 is essential for murine tooth cusp morphogenesis. Dev Dyn 229: 131-135.

Ohazama A, Hu Y, Schmidt-Ullrich R, Cao Y, Scheidereit C, Karin M, and Sharpe PT (2004). A dual role for Ikk alpha in tooth development. Dev Cell 6: 219-227.

Ohazama A, Modino SA, Miletich I, and Sharpe PT (2004). Stem-cell-based tissue engineering of murine teeth. J Dent Res 83: 518-522.

Ooshima T, Ishida R, Mishima K, and Sobue S (1996). The prevalence of developmental anomalies of teeth and their association with tooth size in the primary and permanent dentitions of 1650 Japanese children. Int J Paediatr Dent 6: 87-94.

Osborn JW (1973). The evolution of dentitions. The study of evolution suggests how the development of mammalian dentitions may be controlled. Am Sci 61: 548-559.

Osborn, J.W. (1978). Morphogenetic gradients: fields versus clones. In Development, Function and Evolution of Teeth. P.M. Butler and K.A. Joysey, eds. (New York: Academic Press), pp. 171- 201.

Osborne RH, Horowitz SL, and de George FV (1958). Genetic variation in tooth dimensions: a twin study of the permanent anterior teeth. AmJ Hum Genet 10: 350-356.

Ott J (1974). Estimation of the recombination fraction in human pedigrees: efficient computation of the likelihood for human linkage studies. Am J Hum Genet 26: 588-597.

Ott J (1989). Computer-simulation methods in human linkage analysis. Proc Natl Acad Sci USA 86: 4175-4178.

Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, and Owen MJ (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89: 765-771.

Packham EA and Brook JD (2003). T-box genes in human disorders. Hum Mol Genet 12: R37-R44

Park K, Kim K, Rho SB, Choi K, Kim D, Oh SH, Park J, Lee SH, and Lee JH (2005). Homeobox Msx1 interacts with p53 tumor suppressor and inhibits tumor growth by inducing apoptosis. Cancer Res 65: 749-757.

Paulsson L, Bondemark L, and Soderfeldt B (2004). A systematic review of the consequences of premature birth on palatal morphology, dental occlusion, tooth-crown dimensions, and tooth maturity and eruption. Angle Orthod 74: 269-279.

105 Paznekas WA, Boyadjiev SA, Shapiro RE, Daniels O, Wollnik B, Keegan CE, Innis JW, Dinulos MB, Christian C, Hannibal MC, and Jabs EW (2003). Connexin 43 (GJA1) mutations cause the pleiotropic phenotype of oculodentodigital dysplasia. Am J Hum Genet 72: 408-418.

Peck L, Peck S, and Attia Y (1993). Maxillary canine-first premolar transposition, associated dental anomalies and genetic basis. Angle Orthod 63: 99-109.

Pekkarinen P, Hovatta I, Hakola P, Jarvi O, Kestila M, Lenkkeri U, Adolfsson R, Holmgren G, Nylander PO, Tranebjaerg L, Terwilliger JD, Lonnqvist J, and Peltonen L (1998). Assignment of the locus for PLO-SL, a frontal-lobe dementia with bone cysts, to 19q13. Am J Hum Genet 62: 362-372.

Peltonen L, Perola M, Naukkarinen J, and Palotie A (2006). Lessons from studying monogenic disease for common disease. Hum Mol Genet 15 Spec No 1: R67-R74

Peres RC, Scarel-Caminaga RM, do ESA, and Line SR (2005). Association between PAX-9 promoter polymorphisms and hypodontia in humans. Arch Oral Biol 50: 861-871.

Peterkova R, Kristenova P, Lesot H, Lisi S, Vonesch JL, Gendrault JL, and Peterka M (2002). Different morphotypes of the tabby (EDA) dentition in the mouse mandible result from a defect in the mesio-distal segmentation of dental epithelium. Orthod Craniofac Res 5: 215-226.

Peters H and Balling R (1999). Teeth - where and how to make them. Trends Genet 15: 59-65.

Peters H, Neubuser A, Kratochwil K, and Balling R (1998). Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev 12: 2735-2747.

Pires-daSilva A and Sommer RJ (2003). The evolution of signalling pathways in animal development. Nat Rev Genet 4 : 39-49.

Pirinen S, Arte S, and Apajalahti S (1996). Palatal displacement of canine is genetic and related to congenital absence of teeth. J Dent Res 75: 1742-1746.

Pirinen S, Kentala A, Nieminen P, Varilo T, Thesleff I, and Arte S (2001). Recessively inherited lower incisor hypodontia. J Med Genet 38: 551-556.

Pirinen, S. and Thesleff, I. (1995). Development of the dentition. In Orthodontics. B. Thilander and O. Rönning, eds. pp 41-53. Gothia, Karlshamn.

Pispa J, Jung HS, Jernvall J, Kettunen P, Mustonen T, Tabata MJ, Kere J, and Thesleff I (1999). Cusp patterning defect in Tabby mouse teeth and its partial rescue by FGF. Dev Biol 216: 521- 534.

Pispa J and Thesleff I (2003). Mechanisms of ectodermal organogenesis. Dev Biol 262: 195-205.

Polder BJ, Van't Hof MA, Van der Linden FP, and Kuijpers-Jagtman AM (2004). A meta-analysis of the prevalence of dental agenesis of permanent teeth. Community Dent Oral Epidemiol 32: 217- 226.

Potter RH, Nance WE, Yu PL, and Davis WB (1976). A twin study of dental dimension. II. Independent genetic determinants. Am J Phys Anthropol 44: 397-412.

Potter RH, Rice JP, Dahlberg AA, and Dahlberg T (1983). Dental size traits within families: path analysis for first molar and lateral incisor. Am J Phys Anthropol 61: 283-289.

106 Price JA, Bowden DW, Wright JT, Pettenati MJ, and Hart TC (1998). Identification of a mutation in DLX3 associated with tricho-dento-osseous (TDO) syndrome. Hum Mol Genet 7: 563-569.

Präger TM, Finke C, and Miethke RR (2006). Dental findings in patients with ectodermal dysplasia. J Orofac Orthop 67: 347-355.

Pummila M, Fliniaux I, Jaatinen R, James MJ, Laurikkala J, Schneider P, Thesleff I, and Mikkola ML (2007). Ectodysplasin has a dual role in ectodermal organogenesis: inhibition of Bmp activity and induction of Shh expression. Development 134: 117-125.

Rajab LD and Hamdan MA (2002). Supernumerary teeth: review of the literature and a survey of 152 cases. Int J Paediatr Dent 12: 244-254.

Ranta R (1986). A review of tooth formation in children with cleft lip/palate. Am J Orthod Dentofacial Orthop 90: 11-18.

Rasmussen P (1999). Severe hypodontia: diversities in manifestations. J Clin Pediatr Dent 23: 179- 188.

Reich DE and Lander ES (2001). On the allelic spectrum of human disease. Trends Genet 17: 502- 510.

Richman JM and Lee SH (2003). About face: signals and genes controlling jaw patterning and identity in vertebrates. Bioessays 25: 554-568.

Rogan WJ, Gladen BC, Hung KL, Koong SL, Shih LY, Taylor JS, Wu YC, Yang D, Ragan NB, and Hsu CC (1988). Congenital poisoning by polychlorinated biphenyls and their contaminants in Taiwan. Science 241: 334-336.

Rudolph D, Yeh WC, Wakeham A, Rudolph B, Nallainathan D, Potter J, Elia AJ , and Mak TW (2000). Severe liver degeneration and lack of NF-kappaB activation in NEMO/IKKgamma- deficient mice. Genes Dev 14: 854-862.

Ruiz-Perez VL, Blair HJ, Rodriguez-Andres ME, Blanco MJ, Wilson A, Liu YN, Miles C, Peters H, and Goodship JA (2007). Evc is a positive mediator of Ihh-regulated bone growth that localises at the base of chondrocyte cilia. Development 134: 2903-2912.

Ruiz-Perez VL, Ide SE, Strom TM, Lorenz B, Wilson D, Woods K, King L, Francomano C, Freisinger P, Spranger S, Marino B, Dallapiccola B, Wright M, Meitinger T, Polymeropoulos MH, and Goodship J (2000a). Mutations in a new gene in Ellis-van Creveld syndrome and Weyers acrodental dysostosis. Nat Genet 24: 283-286.

Ruiz-Perez VL, Tompson SW, Blair HJ, Espinoza-Valdez C, Lapunzina P, Silva EO, Hamel B, Gibbs JL, Young ID, Wright MJ, and Goodship JA (2003b). Mutations in two nonhomologous genes in a head-to-head configuration cause Ellis-van Creveld syndrome. Am J Hum Genet 72: 728-732.

Rune B and Sarnäs KV (1974). Tooth size and tooth formation in children with advanced hypodontia. Angle Orthod 44 : 316-321.

Russell KA and Folwarczna MA (2003). Mesiodens--diagnosis and management of a common supernumerary tooth. J Can Dent Assoc 69: 362-366.

Rölling S (1980). Hypodontia of permanent teeth in Danish schoolchildren. Scand J Dent Res 88: 365-369.

107 Rölling S and Poulsen S (2001). Oligodontia in Danish schoolchildren. Acta Odontol Scand 59: 111-112.

Sadler, T.W. (1990). Langman's medical embryology. 6th edition. Williams & Wilkins, Baltimore.

Salazar-Ciudad I and Jernvall J (2002). A gene network model accounting for development and evolution of mammalian teeth. Proc Natl Acad Sci U S A 99: 8116-8120.

Sarkar L, Cobourne M, Naylor S, Smalley M, Dale T, and Sharpe PT (2000). Wnt/Shh interactions regulate ectodermal boundary formation during mammalian tooth development. Proc Natl Acad Sci U S A 97: 4520-4524.

Sarkar L and Sharpe PT (1999). Expression of Wnt signalling pathway genes during tooth development. Mech Dev 85: 197-200.

Satoda M, Zhao F, Diaz GA, Burn J, Goodship J, Davidson HR, Pierpont ME, and Gelb BD (2000). Mutations in TFAP2B cause Char syndrome, a familial form of patent ductus arteriosus. Nat Genet 25: 42-46.

Satokata I, Ma L, Ohshima H, Bei M, Woo I, Nishizawa K, Maeda T, Takano Y, Uchiyama M, Heaney S, Peters H, Tang Z, Maxson R, and Maas R (2000). Msx2 deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ formation. Nat Genet 24: 391-395.

Satokata I and Maas R (1994). Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet 6: 348-356.

Saxen L and Thesleff I (1992). Epithelial-mesenchymal interactions in murine organogenesis . Ciba Found Symp 165: 183-98.

Scarel RM, Trevilatto PC, Di HOJ, Camargo LE, and Line SR (2000). Absence of mutations in the homeodomain of the MSX1 gene in patients with hypodontia. Am J Med Genet 92: 346-349.

Schalk-van der Weide Y. Oligodontia. A clinical, radiographic and genetic evaluation. 1992. Thesis. Rijksuniversiteit Utrecht.

Schalk-van der Weide Y and Bosman F (1996). Tooth size in relatives of individuals with oligodontia. Arch Oral Biol 41: 469-472.

Schmidt-Supprian M, Bloch W, Courtois G, Addicks K, Israel A, Rajewsky K, and Pasparakis M (2000). NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Molecular Cell 5: 981-992.

Segditsas S and Tomlinson I (2006). Colorectal cancer and genetic alterations in the Wnt pathway. Oncogene 25: 7531-7537.

Semina EV, Reiter R, Leysens NJ, Alward WL, Small KW, Datson NA, Siegel-Bartelt J, Bierke- Nelson D, Bitoun P, Zabel BU, Carey JC, Murray JC, Alward WLM, Datson NAXSJ, Bierkenelson D, Murray, and JC. (1996). Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet 14: 392- 399.

Sengupta A, Whittaker DK, Barber G, Rogers J, and Musgrave JH (1999). The effects of dental wear on third molar eruption and on the curve of Spee in human archaeological dentitions. Arch Oral Biol 44: 925-934.

108 Seow WK and Lai PY (1989). Association of taurodontism with hypodontia: a controlled study . Pediatr Dent 11: 214-219.

Seow WK and Wan A (2000). A controlled study of the morphometric changes in the primary dentition of pre-term, very-low-birthweight children. J Dent Res 79: 63-69.

Seppälä M, Depew MJ, Martinelli DC, Fan CM, Sharpe PT, and Cobourne MT (2007). Gas1 is a modifier for holoprosencephaly and genetically interacts with sonic hedgehog. J Clin Invest 117: 1575-1584.

Shah RM, Boyd MA, and Vakil TF (1978). Studies of permanent tooth anomalies in 7,886 Canadian individuals. I: impacted teeth. Dent J 44: 262-264.

Sharpe PT (1995). Homeobox genes and orofacial development. Connect Tissue Res 32: 17-25.

Shifman A and Chanannel I (1978). Prevalence of taurodontism found in radiographic dental examination of 1,200 young adult Israeli patients. Community Dent Oral Epidemiol 6: 200-203.

Sick S, Reinker S, Timmer J, and Schlake T (2006). WNT and DKK determine hair follicle spacing through a reaction-diffusion mechanism. Science 314: 1447-1450.

Slavkin HC, Beierle J, and Bavetta LA (1968). Odontogenesis: cell-cell interactions in vitro. Nature 217: 269-270.

Smahi A, Courtois G, Vabres P, Yamaoka S, Heuertz S, Munnich A, Israel A, Heiss NS, Klauck SM, Kioschis P, Wiemann S, Poustka A, Esposito T, Bardaro T, Gianfrancesco F, Ciccodicola A, D'U, Woffendin H, Jakins T, Donnai D, Stewart H, Kenwrick SJ, Aradhya S, Yamagata T, Levy M, Lewis RA, and Nelson DL (2000). Genomic rearrangement in NEMO impairs NF-kappaB activation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium. Nature 405: 466-472.

Sobel E and Lange K (1996). Descent graphs in pedigree analysis: applications to haplotyping, location scores, and marker-sharing statistics. Am J Hum Genet 58: 1323-1337.

Sofaer JA, Bailit HL, and MacLean CJ (1970). A developmental basis for differential tooth reduction during hominid evolution. Evolution 25: 509-517.

Sofaer JA, MacLean CJ, and Bailit HL (1972). Heredity and morphological variation in early and late developing human teeth of the same morphological class. Arch Oral Biol 17: 811-816.

Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, Liu H, Gronthos S, Wang CY, Shi S, and Wang S (2006). Mesenchymal stem cell-mediated functional tooth regeneration in Swine. PLoS ONE 1 (e79): 1-8.

Srivastava AK, Pispa J, Hartung AJ, Du Y, Ezer S, Jenks T, Shimada, T., Pekkanen M, Mikkola ML, Ko MS, Thesleff I, Kere J, and Schlessinger D (1997). The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains. Proc Natl Acad Sci U S A 94: 13069-13074.

St.Amand TR, Zhang Y, Semina EV, Zhao X, Hu Y, Nguyen, Murray JC, and Chen Y (2000). Antagonistic signals between BMP4 and FGF8 define the expression of Pitx1 and Pitx2 in mouse tooth-forming anlage. Developmental Biology 217: 323-332.

109 Steele-Perkins G, Butz KG, Lyons GE, Zeichner-David M, Kim HJ, Cho MI, and Gronostajski RM (2003). Essential role for NFI-C/CTF transcription-replication factor in tooth root development. Mol Cell Biol 23: 1075-1084.

Steigman S, Harari D, and Kuraita-Landman S (1982). Relationship between mesiodistal crown diameter of posterior deciduous and succedaneous teeth in israeli children. Eur J Orthod 4: 219- 227.

Stockton DW, Das P, Goldenberg M, D'Souza RN, and Patel PI (2000). Mutation of PAX9 is associated with oligodontia. Nat Genet 24: 18-19.

Stottmann RW, Anderson RM, and Klingensmith J (2001). The BMP antagonists Chordin and Noggin have essential but redundant roles in mouse mandibular outgrowth. Dev Biol 240: 457- 473.

Strachan, T. and Read, A.P. (1999). Human Molecular Genetics. 2nd edition. BIOS Scientific Publishers Ltd, Oxford.

Suarez BK and Spence A (1974). The genetics of hypodontia. J Dent Res 53: 781-785.

Suzuki K, Hu D, Bustos T, Zlotogora J, Richieri-Costa A, Helms JA, and Spritz RA (2000). Mutations of PVRL1, encoding a cell-cell adhesion molecule/herpesvirus receptor, in cleft lip/palate-ectodermal dysplasia. Nat Genet 25: 427-430.

Suzuki Y, Jezewski PA, Machida J, Watanabe Y, Shi M, Cooper ME, Viet lT, Nguyen TD, Hai H, Natsume N, Shimozato K, Marazita ML, and Murray JC (2004). In a Vietnamese population, MSX1 variants contribute to cleft lip and palate. Genet Med 6: 117-125.

Svinhufvud E, Myllarniemi S, and Norio R (1988). Dominant inheritance of tooth malpositions and their association to hypodontia. Clin Genet 34: 373-381.

Sözen MA, Suzuki K, Tolarova MM, Bustos T, Fernandez IJ, and Spritz RA (2001). Mutation of PVRL1 is associated with sporadic, non-syndromic cleft lip/palate in northern Venezuela. Nat Genet 29: 141-142.

Tao R, Jin B, Guo SZ, Qing W, Feng GY, Brooks DG, Liu L, Xu J, Li T, Yan Y, and He L (2006). A novel missense mutation of the EDA gene in a Mongolian family with congenital hypodontia. J Hum Genet : 498-502.

Tarpey P, Pemberton TJ, Stockton DW, Das P, Ninis V, Edkins S, Andrew FP, Wooster R, Kamath S, Nayak R, Stratton MR, and Patel PI (2007). A novel Gln358Glu mutation in ectodysplasin A associated with X-linked dominant incisor hypodontia. Am J Med Genet A 143: 390-394.

Ten Cate, A.R. (1994). Oral Histology. Development, structure and function. 4th edition. Mosby, St Louis.

Terwilliger, J.D. and Ott, J. (1994). Handbook of Human Genetic Linkage. The Johns Hopkins University Press, Baltimore and London.

Thauvin-Robinet C, Cossee M, Cormier-Daire V, Van Maldergem L, Toutain A, Alembik Y, Bieth E, Layet V, Parent P, David A, Goldenberg A, Mortier G, Heron D, Sagot P, Bouvier AM, Huet F, Cusin V, Donzel A, Devys D, Teyssier JR, and Faivre L (2006). Clinical, molecular, and genotype-phenotype correlation studies from 25 cases of oral-facial-digital syndrome type 1: a French and Belgian collaborative study. J Med Genet 43: 54-61.

110 Thesleff I (2006). The genetic basis of tooth development and dental defects. Am J Med Genet A 140: 2530-2535.

Thesleff I, Keränen S, and Jernvall J (2001). Enamel knots as signaling centers linking tooth morphogenesis and odontoblast differentiation. Adv Dent Res 15: 14-18.

Thesleff I and Mikkola ML (2002). Death receptor signaling giving life to ectodermal organs. Sci STKE 2002: E22

Thesleff I and Nieminen P. (2005) Tooth induction. http://www.els.net. Encyclopedia of Life Sciences. Nature Publishing Group, Macmillan Publishers Ltd.

Thesleff I, Partanen AM, and Vainio S (1991). Epithelial-mesenchymal interactions in tooth morphogenesis: the roles of extracellular matrix, growth factors, and cell surface receptors. J Craniofac Genet Dev Biol 11: 229-237.

Thesleff I and Pirinen S. (2005) Genetics of Dental Anomalies. http://www.els.net. Encyclopedia of Life Sciences. Nature Publishing Group.

Thilander B and Jakobsson SO (1968). Local factors in impaction of maxillary canines. Acta Odontol Scand 26: 145-168.

Thomas BL, Tucker AS, Qiu M, Ferguson CA, Hardcastle Z, Rubenstein, JL, and Sharpe PT (1997). Role of Dlx-1 and Dlx-2 genes in patterning of the murine dentition. Development 124: 4811- 4818.

Thompson GW and Popovich F (1974). Probability of congenitally missing teeth: results in 1,191 children in the Burlington Growth centre in Toronto. Community Dent Oral Epidemiol 2: 26-32.

Tissier-Seta JP, Mucchielli ML, Mark M, Mattei MG, Goridis C, and Brunet JF (1995). Barx1, a new mouse homeodomain transcription factor expressed in cranio-facial ectomesenchyme and the stomach. Mech Dev 51: 3-15.

Tonge CH (1969). The time-structure relationship to tooth development in human embryogenesis. J Dent Res 48: 745-752.

Townsend G, Rogers J, Richards L, and Brown T (1995). Agenesis of permanent maxillary lateral incisors in South Australian twins. Aust Dent J 40: 186-192.

Townsend GC (1980). Heritability of deciduous tooth size in Australian aboriginals. Am J Phys Anthropol 53: 297-300.

Townsend GC, Aldred MJ, and Bartold PM (1998). Genetic aspects of dental disorders. Aust Dent J 43: 269-286.

Townsend GC, Richards L, Hughes T, Pinkerton S, and Schwerdt W (2005). Epigenetic influences may explain dental differences in monozygotic twin pairs. Aust Dent J 50: 95-100.

Tribulo C, Aybar MJ, Nguyen VH, Mullins MC, and Mayor R (2003). Regulation of Msx genes by a Bmp gradient is essential for neural crest specification. Development 130: 6441-6452.

Trumpp A, Depew MJ, Rubenstein JL, Bishop JM, and Martin GR (1999). Cre-mediated gene inactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch. Genes Dev 13: 3136-3148.

111 Tsai SJ and King NM (1998). A catalogue of anomalies and traits of the permanent dentition of southern Chinese. J Clin Pediatr Dent 22: 185-194.

Tucker A and Sharpe P (2004). The cutting-edge of mammalian development; how the embryo makes teeth. Nat Rev Genet 5: 499-508.

Tucker AS, Matthews KL, and Sharpe PT (1998). Transformation of tooth type induced by inhibition of BMP signaling. Science 282: 1136-1138.

Tummers M and Thesleff I (2003). Root or crown: a developmental choice orchestrated by the differential regulation of the epithelial stem cell niche in the tooth of two rodent species. Development 130: 1049-1057.

Tureckova J, Sahlberg C, Åberg T, Ruch JV, Thesleff I, and Peterkova R (1995). Comparison of expression of the msx-1, msx-2, BMP-2 and BMP-4 genes in the mouse upper diastemal and molar tooth primordia. Int J Dev Biol 39: 459-468.

Uslenghi S, Liversidge HM, and Wong FS (2006). A radiographic study of tooth development in hypodontia. Arch Oral Biol 51: 129-133.

Vaahtokari A, Åberg T, Jernvall J, Keränen S, and Thesleff I (1996). The enamel knot as a signaling center in the developing mouse tooth. Mech Dev 54: 39-43.

Vainio S, Karavanova I, Jowett A, and Thesleff I (1993). Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development . Cell 75: 45-58. van Bokhoven H and McKeon F (2002). Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans. Trends Mol Med 8: 133-139. van den Boogaard MJH, Dorland M, Beemer FA, and van Amstel HKP (2000). MSX1 mutation is associated with orofacial clefting and tooth agenesis in humans. Nat Genet 24: 342-343. van Genderen C, Okamura RM, Farinas I, Quo RG, Parslow TG, Bruhn L, and Grosschedl R (1994). Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1- deficient mice. Genes Dev 8: 2691-2703.

Vastardis H (2000). The genetics of human tooth agenesis: new discoveries for understanding dental anomalies. Am J Orthod Dentofacial Orthop 117: 650-656.

Vastardis H, Karimbux N, Guthua SW, Seidman JG, and Seidman CE (1996). A human MSX1 homeodomain missense mutation causes selective tooth agenesis. Nat Genet 13: 417-421.

Vieira AR (2003). Oral clefts and syndromic forms of tooth agenesis as models for genetics of isolated tooth agenesis. J Dent Res 82: 162-165.

Vieira AR, Meira R, Modesto A, and Murray JC (2004). MSX1, PAX9, and TGFA contribute to tooth agenesis in humans. J Dent Res 83: 723-727.

Vieira AR, Modesto A, Meira R, Barbosa AR, Lidral AC, and Murray JC (2007). Interferon regulatory factor 6 (IRF6) and fibroblast growth factor receptor 1 (FGFR1) contribute to human tooth agenesis. Am J Med Genet A 143: 538-545.

Wall JD and Pritchard JK (2003). Haplotype blocks and linkage disequilibrium in the human genome. Nat Rev Genet 4 : 587-597.

112 Wallis DE, Roessler E, Hehr U, Nanni L, Wiltshire T, Richieri-Costa A, Gillessen-Kaesbach G, Zackai EH, Rommens J, and Muenke M (1999). Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat Genet 22: 196-198.

Waltimo J. Developmental defects of human dentine matrix. 1996. Institute of Dentistry, University of Helsinki, Finland.

Wang SL, Chen TT, Hsu JF, Hsu CC, Chang LW , Ryan JJ, Guo YL, and Lambert GH (2003). Neonatal and childhood teeth in relation to perinatal exposure to polychlorinated biphenyls and dibenzofurans: observations of the Yucheng children in Taiwan. Environ Res 93: 131-137.

Wang XP, Aberg T, James MJ, Levanon D, Groner Y, and Thesleff I (2005). Runx2 (Cbfa1) Inhibits Shh Signaling in the Lower but not Upper Molars of Mouse Embryos and Prevents the Budding of Putative Successional Teeth. J Dent Res 84: 138-143.

Wang XP, Suomalainen M, Felszeghy S, Zelarayan LC, Alonso MT, Plikus MV, Maas RL, Chuong CM, Schimmang T, and Thesleff I (2007). An integrated gene regulatory network controls stem cell proliferation in teeth. PLoS Biol 5: e159

Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Wankell M, Werner S, and Thesleff I (2004a). Modulation of activin/bone morphogenetic protein signaling by follistatin is required for the morphogenesis of mouse molar teeth. Dev Dyn 231: 98-108.

Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Werner S, and Thesleff I (2004b). Follistatin regulates enamel patterning in mouse incisors by asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev Cell 7: 719-730.

Wang, X.P. and Thesleff, I. (2005). Tooth development. In Cell signaling and growth factors in development. K. Unsicker and K. Krieglstein, eds. pp. 719-754. Wiley-VCH & C0, Weinheim.

Weiss KM (1996). Is there a paradigm shift in genetics? Lessons from the study of human diseases. Mol Phylogenet Evol 5: 259-265.

Weiss KM, Stock DW, and Zhao Z (1998). Dynamic interactions and the evolutionary genetics of dental patterning. Crit Rev Oral Biol Med 9: 369-398.

Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, and Lathrop M (1992). A second-generation linkage map of the human genome. Nature 359: 794-801.

Whittington BR and Durward CS (1996). Survey of anomalies in primary teeth and their correlation with the permanent dentition. N Z Dent J 92: 4-8.

Wilkie AO (1997). Craniosynostosis: genes and mechanisms. Hum Mol Genet 6: 1647-1656.

Wilusz CJ, Wang W, and Peltz SW (2001). Curbing the nonsense: the activation and regulation of mRNA surveillance. Genes Dev 15: 2781-2785.

Wolf J, Järvinen HJ, and Hietanen J (1986). Gardner's dento-maxillary stigmas in patients with familial adenomatosis coli. Br J Oral Maxillofac Surg 24: 410-416.

Wright JT (2006). The molecular etiologies and associated phenotypes of amelogenesis imperfecta. Am J Med Genet A 140: 2547-2555.

Yang A, Schweitzer R, Sun DQ, Kaghad M, Walker N, Bronson RT, Tabin, Sharpe A, Caput D, Crum C, and McKeon F (1999). p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 398: 714-718.

113 Yasuda I, Yasuda M, Sumida H, Tsusaki H, Arima A, Ihara T, Kubota S, Asaoka K, Tsuga K, and Akagawa Y (2005). In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) affects tooth development in rhesus monkeys. Reprod Toxicol 20: 21-30.

Yonezu T, Hayashi Y, Sasaki J, and Machida Y (1997). Prevalence of congenital dental anomalies of the deciduous dentition in Japanese children. Bull Tokyo Dent Coll 38: 27-32.

Yu HM, Jerchow B, Sheu TJ, Liu B, Costantini F, Puzas JE, Birchmeier W, and Hsu W (2005). The role of Axin2 in calvarial morphogenesis and craniosynostosis. Development 132: 1995-2005.

Zhang Q, Murcia NS, Chittenden LR, Richards WG, Michaud EJ, Woychik RP, and Yoder BK (2003). Loss of the Tg737 protein results in skeletal patterning defects. Dev Dyn 227: 78-90.

Zhang Y, Zhang Z, Zhao X, Yu X, Hu Y, Geronimo B, Fromm SH, and Chen YP (2000). A new function of BMP4: dual role for BMP4 in regulation of Sonic hedgehog expression in the mouse tooth germ. Development 127 : 1431-1443.

Zhang YD, Zhao X, Hu YP, St Amand T, Zhang MF, Ramamurthy R, Qiu MS, and Chen YP (1999). Msx1 is required for the induction of Patched by Sonic hedgehog in the mammalian tooth germ. Dev Dyn 215: 45-53.

Zhao JL, Chen YX, Bao L, Xia QJ, Wu TJ, and Zhou L (2005). [Novel mutations of PAX9 gene in Chinese patients with oligodontia]. Zhonghua Kou Qiang Yi Xue Za Zhi 40: 266-270.

Zhou P, Byrne C, Jacobs J, and Fuchs E (1995). Lymphoid enhancer factor 1 directs hair follicle patterning and epithelial cell fate. Genes Dev 9: 700-713.

Zhu JF, Marcushamer M, King DL, and Henry RJ (1996). Supernumerary and congenitally absent teeth: a literature review. J Clin Pediatr Dent 20: 87-95.

Zilberman Y, Cohen B, and Becker A (1990). Familial trends in palatal canines, anomalous lateral incisors, and related phenomena. Eur J Orthod 12: 135-139.

Zonana J, Elder ME, Schneider LC, Orlow SJ, Moss C, Golabi M, Shapira SK, Farndon PA, Wara DW, Emmal SA, and Ferguson BM (2000). A novel X-linked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK-gamma (NEMO). Am J Hum Genet 67: 1555-1562.

Åberg T, Cavender A, Gaikwad JS, Bronckers AL, Wang X, Waltimo-Siren J, Thesleff I, and D'Souza RN (2004). Phenotypic Changes in Dentition of Runx2 Homozygote-null Mutant Mice. J Histochem Cytochem 52: 131-140.

Åberg T, Wang XP, Kim JH, Yamashiro T, Bei M, Rice R, Ryoo HM, and Thesleff I (2004). Runx2 mediates FGF signaling from epithelium to mesenchyme during tooth morphogenesis. Dev Biol 270: 76-93.

Åberg T, Wozney J, and Thesleff I (1997). Expression patterns of bone morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in morphogenesis and cell differentiation. Dev Dyn 210: 383-396.

114