Silencing of Pantothenate Kinase 2 Reduces Endothelial Cell Angiogenesis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
An Overview of Biosynthesis Pathways – Inspiration for Pharmaceutical and Agrochemical Discovery
An Overview of Biosynthesis Pathways – Inspiration for Pharmaceutical and Agrochemical Discovery Alan C. Spivey [email protected] 19th Oct 2019 Lessons in Synthesis - Azadirachtin • Azadirachtin is a potent insect anti-feedant from the Indian neem tree: – exact biogenesis unknown but certainly via steroid modification: O MeO C OAc O 2 H O OH O H O OH 12 O O C 11 O 14 OH oxidative 8 O H 7 cleavage highly hindered C-C bond HO OH AcO OH AcO OH for synthesis! H H of C ring H MeO2C O AcO H tirucallol azadirachtanin A azadirachtin (cf. lanosterol) (a limanoid = tetra-nor-triterpenoid) – Intense synhtetic efforts by the groups of Nicolaou, Watanabe, Ley and others since structural elucidation in 1987. –1st total synthesis achieved in 2007 by Ley following 22 yrs of effort – ~40 researchers and over 100 person-years of research! – 64-step synthesis – Veitch Angew. Chem. Int. Ed. 2007, 46, 7629 (DOI) & Veitch Angew. Chem. Int. Ed. 2007, 46, 7633 (DOI) – Review ‘The azadirachtin story’ see: Veitch Angew. Chem. Int. Ed. 2008, 47, 9402 (DOI) Format & Scope of Presentation • Metabolism & Biosynthesis – some definitions, 1° & 2° metabolites • Shikimate Metabolites – photosynthesis & glycolysis → shikimate formation → shikimate metabolites – Glyphosate – a non-selective herbicide • Alkaloids – acetylCoA & the citric acid cycle → -amino acids → alkaloids – Opioids – powerful pain killers • Fatty Acids and Polyketides –acetylCoA → malonylCoA → fatty acids, prostaglandins, polyketides, macrolide antibiotics – NSAIDs – anti-inflammatory’s • Isoprenoids/terpenes -
Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence After Radical Prostatectomy
Int. J. Mol. Sci. 2015, 16, 3856-3869; doi:10.3390/ijms16023856 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Exploring Prostate Cancer Genome Reveals Simultaneous Losses of PTEN, FAS and PAPSS2 in Patients with PSA Recurrence after Radical Prostatectomy Chinyere Ibeawuchi 1, Hartmut Schmidt 2, Reinhard Voss 3, Ulf Titze 4, Mahmoud Abbas 5, Joerg Neumann 6, Elke Eltze 7, Agnes Marije Hoogland 8, Guido Jenster 9, Burkhard Brandt 10 and Axel Semjonow 1,* 1 Prostate Center, Department of Urology, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 2 Center for Laboratory Medicine, University Hospital Muenster, Albert-Schweitzer-Campus 1, Gebaeude 1A, Muenster D-48149, Germany; E-Mail: [email protected] 3 Interdisciplinary Center for Clinical Research, University of Muenster, Albert-Schweitzer-Campus 1, Gebaeude D3, Domagkstrasse 3, Muenster D-48149, Germany; E-Mail: [email protected] 4 Pathology, Lippe Hospital Detmold, Röntgenstrasse 18, Detmold D-32756, Germany; E-Mail: [email protected] 5 Institute of Pathology, Mathias-Spital-Rheine, Frankenburg Street 31, Rheine D-48431, Germany; E-Mail: [email protected] 6 Institute of Pathology, Klinikum Osnabrueck, Am Finkenhuegel 1, Osnabrueck D-49076, Germany; E-Mail: [email protected] 7 Institute of Pathology, Saarbrücken-Rastpfuhl, Rheinstrasse 2, Saarbrücken D-66113, Germany; E-Mail: [email protected] 8 Department -
The Effect of Vitamin Supplementation on Subclinical
molecules Review The Effect of Vitamin Supplementation on Subclinical Atherosclerosis in Patients without Manifest Cardiovascular Diseases: Never-ending Hope or Underestimated Effect? Ovidiu Mitu 1,2,* , Ioana Alexandra Cirneala 1,*, Andrada Ioana Lupsan 3, Mircea Iurciuc 4 , 5 5 2, Ivona Mitu , Daniela Cristina Dimitriu , Alexandru Dan Costache y , Antoniu Octavian Petris 1,2 and Irina Iuliana Costache 1,2 1 Department of Cardiology, Clinical Emergency Hospital “Sf. Spiridon”, 700111 Iasi, Romania 2 1st Medical Department, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania 3 Department of Cardiology, University of Medicine, Pharmacy, Science and Technology, 540139 Targu Mures, Romania 4 Department of Cardiology, University of Medicine and Pharmacy “Victor Babes”, 300041 Timisoara, Romania 5 2nd Morpho-Functional Department, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania * Correspondence: [email protected] (O.M.); [email protected] (I.A.C.); Tel.: +40-745-279-714 (O.M.) Medical Student, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania. y Academic Editors: Raluca Maria Pop, Ada Popolo and Stefan Cristian Vesa Received: 25 March 2020; Accepted: 7 April 2020; Published: 9 April 2020 Abstract: Micronutrients, especially vitamins, play an important role in the evolution of cardiovascular diseases (CVD). It has been speculated that additional intake of vitamins may reduce the CVD burden by acting on the inflammatory and oxidative response starting from early stages of atherosclerosis, when the vascular impairment might still be reversible or, at least, slowed down. The current review assesses the role of major vitamins on subclinical atherosclerosis process and the potential clinical implications in patients without CVD. -
Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation. -
Transcriptomic Signature and Metabolic Programming of Bovine Classical and Nonclassical Monocytes Indicate Distinct Functional Specializations
bioRxiv preprint doi: https://doi.org/10.1101/2020.10.30.362731; this version posted November 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Transcriptomic signature and metabolic programming of bovine classical and nonclassical monocytes indicate distinct functional specializations Stephanie C. Talker1,2, G. Tuba Barut1,2, Reto Rufener3, Lilly von Münchow4, Artur Summerfield1,2 1Institute of Virology and Immunology, Bern and Mittelhäusern, Switzerland 2Department of Infectious Diseases and Pathobiology, Vetsuisse Faculty, University of Bern, Bern, Switzerland 3Institute of Parasitology, Vetsuisse Faculty, University of Bern, Bern, Switzerland 4 Bucher Biotec AG, Basel, Switzerland *Correspondence: Corresponding Author [email protected] Keywords: monocyte subsets, transcriptome, metabolism, cattle Abstract Similar to human monocytes, bovine monocytes can be split into CD14+CD16- classical and CD14-CD16+ nonclassical monocytes (cM and ncM, respectively). Here, we present an in-depth analysis of their steady-state transcriptomes, highlighting pronounced functional specializations. Gene transcription indicates that pro-inflammatory and antibacterial processes are associated with cM, while ncM appear to be specialized in regulatory/anti-inflammatory functions and tissue repair, as well as antiviral responses and T-cell immunomodulation. In support of these functional differences, we found that oxidative phosphorylation prevails in ncM, whereas cM are clearly biased towards aerobic glycolysis. Furthermore, bovine monocyte subsets differed in their responsiveness to TLR ligands, supporting an antiviral role of ncM. Taken together, these data clearly indicate a variety of subset-specific functions in cM and ncM that are likely to be transferable to monocyte subsets of other species, including humans. -
PANK2 Gene Pantothenate Kinase 2
PANK2 gene pantothenate kinase 2 Normal Function The PANK2 gene provides instructions for making an enzyme called pantothenate kinase 2. This enzyme is active in specialized cellular structures called mitochondria, which are the cell's energy-producing centers. Within mitochondria, pantothenate kinase 2 regulates the formation of a molecule called coenzyme A. Coenzyme A is found in all living cells, where it is essential for the body's production of energy from carbohydrates, fats, and some protein building blocks (amino acids). PANK2 is one of four human genes that provide instructions for making versions of pantothenate kinase. The functions of these different versions probably vary among tissue types and parts of the cell. The version produced by the PANK2 gene is active in cells throughout the body, including nerve cells in the brain. Health Conditions Related to Genetic Changes Pantothenate kinase-associated neurodegeneration About 100 mutations in the PANK2 gene have been identified in people with pantothenate kinase-associated neurodegeneration. Typically, people with the more severe, early-onset form of the disorder have PANK2 mutations that prevent cells from producing any functional pantothenate kinase 2. People affected by the atypical, later- onset form usually have mutations that change single amino acids in the enzyme, which makes the enzyme unstable or disrupts its activity. In some cases, single amino acid changes allow the enzyme to retain some function. The most common PANK2 mutation replaces the amino acid glycine with the amino acid arginine at position 411 of the enzyme (written as Gly411Arg or G411R). When pantothenate kinase 2 is altered or missing, the normal production of coenzyme A is disrupted and potentially harmful compounds can build up in the brain. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Pantothenate Kinase-Associated Neurodegeneration
Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration. -
A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2). -
High Throughput Computational Mouse Genetic Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. High Throughput Computational Mouse Genetic Analysis Ahmed Arslan1+, Yuan Guan1+, Zhuoqing Fang1, Xinyu Chen1, Robin Donaldson2&, Wan Zhu, Madeline Ford1, Manhong Wu, Ming Zheng1, David L. Dill2* and Gary Peltz1* 1Department of Anesthesia, Stanford University School of Medicine, Stanford, CA; and 2Department of Computer Science, Stanford University, Stanford, CA +These authors contributed equally to this paper & Current Address: Ecree Durham, NC 27701 *Address correspondence to: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Background: Genetic factors affecting multiple biomedical traits in mice have been identified when GWAS data that measured responses in panels of inbred mouse strains was analyzed using haplotype-based computational genetic mapping (HBCGM). Although this method was previously used to analyze one dataset at a time; but now, a vast amount of mouse phenotypic data is now publicly available, which could lead to many more genetic discoveries. Results: HBCGM and a whole genome SNP map covering 53 inbred strains was used to analyze 8462 publicly available datasets of biomedical responses (1.52M individual datapoints) measured in panels of inbred mouse strains. As proof of concept, causative genetic factors affecting susceptibility for eye, metabolic and infectious diseases were identified when structured automated methods were used to analyze the output. -
Dissecting the Non-Canonical Functions of P53 Through Novel Target Identification and P53 Acetylation
Dissecting the non-canonical functions of p53 through novel target identification and p53 acetylation Shang-Jui Wang Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Shang-Jui Wang All rights reserved ABSTRACT Dissecting the non-canonical functions of p53 through novel target identification and p53 acetylation Shang-Jui Wang It is well established that the p53 tumor suppressor plays a crucial role in controlling cell proliferation and apoptosis upon various types of stress. There is increasing evidence showing that p53 is also critically involved in various non-canonical pathways, including metabolism, autophagy, senescence and aging. Through a ChIP-on-chip screen, we identified a novel p53 metabolic target, pantothenate kinase-1 (PANK1). PanK1 catalyzes the rate-limiting step for CoA synthesis, and therefore, controls intracellular CoA content; Pank1 knockout mice exhibit defect in -oxidation and gluconeogenesis in the liver after starvation due to insufficient CoA levels. We demonstrated that PANK1 gene is a direct transcriptional target of p53. Although DNA damage-induced p53 upregulates PanK1 expression, depletion of PanK1 expression does not affect p53-dependent growth arrest or apoptosis. Interestingly, upon glucose starvation, PanK1 expression is significantly reduced in HCT116 p53 (-/-) but not in HCT116 p53 (+/+) cells, suggesting that p53 is required to maintain PanK1 expression under metabolic stress conditions. Moreover, by using p53-mutant mice, we observed that PanK activity and CoA levels are lower in livers of p53-null mice than that of wild-type mice upon starvation.