DOCSLIB.ORG

Pdf 792.98 K

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pdf 792.98 K DOI:http://dx.doi.org/10.7314/APJCP.2014.15.4.1783 Expression of EMSY in Breast Carcinomas RESEARCH ARTICLE Expression of EMSY, a Novel BRCA2-link Protein, is Associated with Lymph Node Metastasis and Increased Tumor Size in Breast Carcinomas Zahra Madjd1, 2*, Mohammad Esmaeil Akbari2, Amir Hassan Zarnani3, Maryam Khayamzadeh2, Elham Kalantari1, Nazanin Mojtabavi4* Abstract Background: The EMSY gene encodes a BRCA2-binding partner protein that represses the DNA repair function of BRCA2 in non-hereditary breast cancer. Although amplification ofEMSY gene has been proposed to have prognostic value in breast cancer, no data have been available concerning EMSY tissue expression patterns and its associations with clinicopathological features. Materials and Methods: In the current study, we examined the expression and localization pattern of EMSY protein by immunohistochemistry and assessed its prognostic value in a well-characterized series of 116 unselected breast carcinomas with a mean follow up of 47 months using tissue microarray technique. Results: Immunohistochemical expression of EMSY protein was detected in 76% of primary breast tumors, localized in nuclear (18%), cytoplasmic (35%) or both cytoplasmic and nuclear sites (23%). Univariate analysis revealed a significant positive association betweenEMSY expression and lymph node metastasis (p value=0.045) and larger tumor size (p value=0.027), as well as a non-significant relation with increased risk of recurrence (p value=0.088), whereas no association with patients’ survival (log rank test, p value=0.482), tumor grade or type was observed. Conclusions: Herein, we demonstrated for the first time the immunostaining pattern of EMSY protein in breast tumors. Our data imply that EMSY protein may have impact on clinicipathological parameters and could be considered as a potential target for breast cancer treatment. Keywords: Breast cancer - EMSY - tissue microarray - immunohistochemistry - lymph node metastasis Asian Pac J Cancer Prev, 15 (4), 1783-1789 Introduction Bane et al., 2011; Mutch et al., 2013). The estimated lifetime risk of breast cancer with a BRCA1 or BRCA2 Breast cancer is the most common malignancies among mutation can be as high as 65%-74 % (Mutch et al., 2013). women worldwide, with an increase in incidence from The prevalence of BRCA mutations varies by population: 10.9 to approximately 20 million new cases per year by 0.2 to 0.3 percent in general populations, 3 percent in the year 2020 (Parkin et al., 2001; Lehmann et al., 2011). women with breast cancer, 6 percent in women with breast Breast cancer also ranks first among cancers diagnosed cancer onset before age 40 years, 10 percent in women in Iranian women (Mousavi et al., 2009; Kolahdoozan et with ovarian cancer, and 20 percent in high-risk families al., 2010; Movahedi et al., 2012). (Nelson et al., 2013). Positive family history is a confirmed risk factor for BRCA genes are implicated in RAD 51 and mediate breast cancer, as the risk to first-degree relatives of a case recombinational repair of double stranded DNA breaks, is almost 2 times the population risk (Collaborative group, chromatin remodeling and regulation of transcription 2001). Majority of the familial risk associated with breast (Venkitaraman, 2002; Hughes-Davies et al., 2003). cancer have a genetic origin (Ponder, 2001; Benusiglio et Whereas, familiar breast cancer is the cause of 5% of all al., 2005). breast cancers, sporadic breast cancers account for more Highly penetrate germline mutations in BRCA1 and than 95% of all breast cancer types. Mutations of BRCA1/2 BRCA2 account for the large majority of autosomal genes are frequently observed in hereditary breast and dominant familial breast-ovarian cancer (Bennett, 1999; ovarian cancers, additionally altered expressions of 1Oncopathology Research Center and Dep pathology, Faculty of medicine, 4Department of Immunology, faculty of medicine, Iran University of Medical Sciences, 2Cancer Research Center, Shahid Beheshti University of Medical Sciences, 3Nanobiotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran *For correspondence: [email protected], mojtabavi.n@ iums.ac.ir Asian Pacific Journal of Cancer Prevention, Vol 15, 2014 1783 Zahra Madjd et al BRCA1/2 proteins potentiate sporadic forms of breast (either familial or sporadic) of female patients with cancer (Paul and Paul, 2014). primary breast cancer diagnosed between 1996 and 2010 Nevertheless, the role of BRCA1 and BRCA2 genes were included in tissue microarrays. Of this, 10 specimens in sporadic breast cancer remains unexplained, since were excluded from the study due to technical problems somatic mutations in both genes are uncommon (Gayther in tissue processing or lack of possible tumor cells within et al., 1998). Silencing of BRCA1 allele through promoter the core, leaving a total of 116 cases for final evaluation. methylation occurs in somatic breast cancer (Dobrovic This collection comprises female patients ranging and Simpfendorfer, 1997), whereas this mechanism of from 30 to 79 years of age (mean=52 years) with a long- transcriptional suppression could not explain the absence term follow-up of 2-180 months (mean=47 months). The of somatic BRCA2 mutations in sporadic cancers (Collins samples were obtained from Cancer Research Centre; et al., 1997). Shohada Hospital affiliated to Shahid Beheshti University The discovery of EMSY in 2003 by Hughes-Davies of Medical Sciences, Tehran, Iran. et al, links the important role of BRCA2 to sporadic The study of prognostic markers in breast tumors was breast-ovarian cancer. EMSY, binds to exon 3 of BRCA2 evaluated based on the REMARK criteria (McShane et and suppresses the transactivity of BRCA2. EMSY is al., 2005). over expressed in sporadic breast and ovarian cancers, Patient characteristics including age, menopausal suggesting that its overexpression may mimic the effects status and family history of breast cancer were procured of BRCA2 inactivation, functionally equivalent to loss and information on absence or presence of recurrence, and of BRCA genes in familial cases (Hughes-Davies et al., survival was also retrieved from a retrospective database. 2003). In addition, since EMSY is a BRCA-2 partner Tumor characteristics, including histological grade, which modulates BRCA-2 function, it can be concluded tumor type (Bloom and Richardson, 1957), tumor size, that EMSY participates in breast cancer development lymph node involvement were collected and recorded in (Livingston, 2004; Yao and Polyak, 2004). a database (Table 1). EMSY localizes to the sites of DNA repair following The tumor grading of all breast cancers were assessed DNA damage and maps to chromosome 11q13.5, 100 kb based on Bloom Richardsons system (Bloom and centromeric to the GARP gene, a locus that is known to be Richardson, 1957) by a team of pathologists including involved in a number of cancers including breast, ovarian two fixed pathologists over these years. and prostate cancers (Nurminen et al., 2011). Recently Information on laboratory tests including Her2, Nurminen et al showed that 11q13.5 contributes to prostate Estrogen Receptor (ER), and Progesterone Receptor cancer predisposition with complex genetic structure and (PR) were also assessed routinely and included in is associated with prostate cancer death (Nurminen et al., database (Table 2). ER and PR status was assessed by 2013). immunohistochemistry (IHC) technique and a cut-off of Amplification of EMSY has been reported in 13% 10% for nuclear staining was used to determine positivity. of sporadic breast cancer, 17% of high grade ovarian The assessment of the HER2 status was done by IHC cancer and 13 % of sporadic pancreatic adenocarcinomas and the results interpreted as positive (3+), negative (0- (Schuuring, 1995; Hughes-Davies et al., 2003; Rodriguez 1+), or equivocal (2+). Only cases with a diffuse intense et al., 2004; Brown et al., 2006; van Hattem et al., 2008). membrane staining pattern in the tumor (scored as 3+) In a recent study conducted by Wilkerson et al, were considered HER2 positive by IHC. amplification of EMSY was found in 10 cancer cell lines All patients received surgery (either modified radical from different anatomical origins including breast, ovary, mastectomy or breast-conserving surgery) which followed pancreas, oesophagus, lung and the oral cavity (Wilkerson by radiotherapy (90%). Patients with lymph node et al., 2011). metastasis even <3 had radiation therapy with at least 2 EMSY amplification has been associated with worse specific fields and patients with 4 or >4 involved lymph survival, particularly in node-negative breast cancers, nodes received at least 3 specific fields radiation therapy suggesting that EMSY may be an indicative of poor plus systemic therapy. outcome of the disease (Hughes-Davies et al., 2003). One hundred and seven (93%) cases received Therefore, EMSY could be a strong candidate oncogene chemotherapy, at least 5 cases received neoadjuvant within 11q13.5 region (Rodriguez et al., 2004). chemotherapy (that for these cases tumor size was not a Based on the absence of any data in the literature significant data due to chemotherapy efficacy), and fewer concerning immunohistochemical analysis of EMSY patients were given hormone therapy (either tamoxifen protein expression in tumor tissues, in this study we aimed or aromatase inhibitors) if ER were positive (Table 2). for the first time to investigate the expression of this This study was approved by Iran University of Medical protein
Load more

Recommended publications
  • Responses of Bats to White-Nose Syndrome and Implications for Conservation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 2Fmm Lichtarge Lab 2006
    Pages 1–13 2fmm Evolutionary trace report by report maker June 27, 2010 4 Notes on using trace results 11 4.1 Coverage 11 4.2 Known substitutions 11 4.3 Surface 11 4.4 Number of contacts 11 4.5 Annotation 11 4.6 Mutation suggestions 11 5 Appendix 11 5.1 File formats 11 5.2 Color schemes used 12 5.3 Credits 12 5.3.1 Alistat 12 5.3.2 CE 12 5.3.3 DSSP 12 5.3.4 HSSP 12 5.3.5 LaTex 12 5.3.6 Muscle 12 5.3.7 Pymol 12 5.4 Note about ET Viewer 12 5.5 Citing this work 12 CONTENTS 5.6 About report maker 13 5.7 Attachments 13 1 Introduction 1 2 Chain 2fmmA 1 1 INTRODUCTION 2.1 Q6E6J7 overview 1 From the original Protein Data Bank entry (PDB id 2fmm): 2.2 Multiple sequence alignment for 2fmmA 1 Title: Crystal structure of emsy-hp1 complex 2.3 Residue ranking in 2fmmA 1 Compound: Mol id: 1; molecule: protein emsy; chain: e; frag- 2.4 Top ranking residues in 2fmmA and their position ment: n-terminal domain; engineered: yes; mol id: 2; molecule: on the structure 1 chromobox protein homolog 1; chain: a, b, c, d; fragment: chromo 2.4.1 Clustering of residues at 25% coverage. 1 shadow domain; synonym: heterochromatin protein 1 homolog beta, 2.4.2 Overlap with known functional surfaces at hp1 beta, modifier 1 protein, m31, heterochromatin protein p25, 25% coverage. 2 hp1hsbeta, p25beta; engineered: yes 2.4.3 Possible novel functional surfaces at 25% Organism, scientific name: Homo Sapiens; coverage.
    [Show full text]
  • Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome
    Vol. 10, 5785–5791, September 1, 2004 Clinical Cancer Research 5785 Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome Carmen Rodriguez,1 Luke Hughes-Davies,2 INTRODUCTION He´le`ne Valle`s,1 Be´atrice Orsetti,1 DNA amplification is a common mechanism of oncogenic Marguerite Cuny,1 Lisa Ursule,1 activation in human tumors, and band q13 of chromosome 11 is a frequent site of genetic aberration in a number of human Tony Kouzarides,2 and Charles Theillet1 malignancies, particularly breast and head and neck cancers (1). 1 Ge´notype et Phe´notypes Tumoraux E 229 INSERM, Centre Val Several candidate oncogenes have been proposed, among which d’Aurelle, Montpellier, France; 2Cancer Research UK/Wellcome Institute, Cambridge, United Kingdom only CCND1 and EMS1 meet the criteria for genes activated by DNA amplification (2). Both genes map to chromosome 11q13.3, 0.8 Mb apart, with CCND1 occupying a more centro- ABSTRACT meric position than EMS1 (3). Because CCND1 is frequently DNA amplification at band q13 of chromosome 11 is rearranged by chromosomal translocations in hematologic ma- common in breast cancer, and CCND1 and EMS1 remain lignancies and overexpressed in several human tumors, this gene the strongest candidate genes. However, amplification pat- has been considered the principal target for DNA amplification terns are consistent with the existence of four cores of am- at 11q13 (4). However, some findings suggested that 11q13 plification, suggesting the involvement of additional genes. amplification could be more complex. On the basis of the Here we present evidence strongly suggesting the involve- recently completed genome map, the 11q13 amplification do- ment of the recently characterized EMSY gene in the for- main spans up to 7 Mb and the existence of four distinct cores mation of the telomeric amplicon.
    [Show full text]
  • The Cbio Cancer Genomics Portal: an Open Platform for Exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E
    views In Focus The cBio Cancer Genomics Portal: An Open Platform for exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E. Gross1, Selcuk Onur Sumer3, Bülent Arman Aksoy1,2, Anders Jacobsen1, Caitlin J. Byrne1, Michael L. Heuer, Erik Larsson1, Yevgeniy Antipin1, Boris Reva1, Arthur P. Goldberg1, Chris Sander1, and Nikolaus Schultz1 summary: The cBio Cancer Genomics Portal (http://cbioportal.org) is an open-access resource for interactive exploration of multidimensional cancer genomics data sets, currently providing access to data from more than 5,000 tumor samples from 20 cancer studies. The cBio Cancer Genomics Portal significantly lowers the barriers between complex genomic data and cancer researchers who want rapid, intuitive, and high-quality access to molecular profiles and clinical attributes from large-scale cancer genomics projects and empowers researchers to translate these rich data sets into biologic insights and clinical applications. Cancer Discov; 2(5); 401–4. ©2012 AACR. With the rapidly declining cost of next-generation sequenc- survival and disease-free survival intervals. The data are then ing, and major national and international efforts, including The organized as a function of patient and gene, and the portal’s Cancer Genome Atlas (TCGA) and the International Cancer fundamental abstraction is the concept of altered genes; spe- Genome Consortium (ICGC) (1), the field of cancer genom- cifically, we classify a gene as altered in a specific patient if it ics continues to advance at an extraordinarily rapid pace. Data is mutated, homozygously deleted, amplified, or its relative generated by these projects are, however, not easily or directly mRNA expression is less than or greater than a user-defined available to the cancer research community, hindering the threshold.
    [Show full text]
  • Triangulating Molecular Evidence to Prioritise Candidate Causal Genes at Established Atopic Dermatitis Loci
    medRxiv preprint doi: https://doi.org/10.1101/2020.11.30.20240838; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-ND 4.0 International license . Triangulating molecular evidence to prioritise candidate causal genes at established atopic dermatitis loci Maria K Sobczyk1, Tom G Richardson1, Verena Zuber2,3, Josine L Min1, eQTLGen Consortium4, BIOS Consortium5, GoDMC, Tom R Gaunt1, Lavinia Paternoster1* 1) MRC Integrative Epidemiology Unit, Bristol Medical School, University of Bristol, Bristol, UK 2) Department of Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, UK 3) MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK 4) Members of the eQTLGen Consortium are listed in: Supplementary_Consortium_members.docx 5) Members of the BIOS Consortium are listed in: Supplementary_Consortium_members.docx Abstract Background: Genome-wide association studies for atopic dermatitis (AD, eczema) have identified 25 reproducible loci associated in populations of European descent. We attempt to prioritise candidate causal genes at these loci using a multifaceted bioinformatic approach and extensive molecular resources compiled into a novel pipeline: ADGAPP (Atopic Dermatitis GWAS Annotation & Prioritisation Pipeline). Methods: We identified a comprehensive list of 103 accessible
    [Show full text]
  • Regulatory Switch Enforced by Basic Helix-Loop-Helix and ACT-Domain
    Regulatory switch enforced by basic helix-loop-helix PNAS PLUS and ACT-domain mediated dimerizations of the maize transcription factor R Que Konga,1, Sitakanta Pattanaika,b,1, Antje Fellerc,1, Joshua R. Werkmana, Chenglin Chaid, Yongqin Wangd, Erich Grotewoldc,d,2, and Ling Yuana,b,2 aDepartment of Plant and Soil Sciences and bKentucky Tobacco Research and Development Center, University of Kentucky, Lexington, KY 40546; and cMolecular, Cellular and Developmental Biology Program and dDepartment of Molecular Genetics and Center for Applied Plant Sciences, Ohio State University, Columbus, OH 43210 Edited by Peter H. Quail, University of California, Berkeley, CA, and approved May 21, 2012 (received for review April 10, 2012) The maize R2R3-MYB regulator C1 cooperates with the basic helix– the formation of MAX–MAD and MAX–MNT heterodimers loop–helix (bHLH) factor R to activate the expression of anthocya- results in transcriptional repression through the recruitment of nin biosynthetic genes coordinately. As is the case for other bHLH histone deacetylase complexes (5). factors, R harbors several protein–protein interaction domains. In plants, bHLH factors constitute one of the largest families Here we show that not the classical but rather a briefly extended of regulatory proteins (1). The Arabidopsis genome encodes for R bHLH region forms homodimers that bind canonical G-box DNA ∼162 bHLH proteins, about 10% of all of the known transcrip- motifs. This bHLH DNA-binding activity is abolished if the C-termi- tion factors in this plant (6–8). Maize R was the first plant bHLH nal ACT (aspartokinase, chorismate, and TyrA) domain is licensed to transcription factor described (9).
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • BRCA2 Abrogation Triggers Innate Immune Responses Potentiated by Treatment with PARP Inhibitors
    bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. BRCA2 abrogation triggers innate immune responses potentiated by treatment with PARP inhibitors Timo Reisländer1, Emilia Puig Lombardi2,3,*, Florian J. Groelly1,*, Ana Miar4, Manuela Porru5, Benjamin Wright6, Helen Lockstone6, Annamaria Biroccio5, Adrian Harris4, Arturo Londono2,3 and Madalena Tarsounas1 1Genome Stability and Tumourigenesis Group, The CR-UK/MRC Oxford Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Oxford OX3 7DQ, U.K. 2Institut Curie, PSL Research University, CNRS, UMR3244, F-75005, Paris, France. 3Sorbonne Universités, UPMC Univ Paris 06, CNRS, UMR3244, F-75005, Paris, France. 4Hypoxia and Angiogenesis Group, Weatherall Institute of Molecular Medicine, Department of Oncology, University of Oxford, Oxford OX3 9DS, U.K. 5Area of Translational Research, IRCCS Regina Elena National Cancer Institute, 00144 Rome, Italy 6Bioinformatics and Statistical Genetics Core, Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford OX3 7BN, U.K. *These authors contributed equally to this study. *Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Heterozygous germline mutations in BRCA2 predispose to breast and ovarian cancer. Contrary to non-cancerous cells, where BRCA2 deletion causes cell cycle arrest or cell death, BRCA2 inactivation in tumors is associated with uncontrolled cell proliferation.
    [Show full text]
  • Amplification of a Chromatin Remodeling Gene, Rsf-1 HBXAP, In
    Amplification of a chromatin remodeling gene, Rsf-1͞HBXAP, in ovarian carcinoma Ie-Ming Shih*†, Jim Jinn-Chyuan Sheu*, Antonio Santillan*, Kentaro Nakayama*, M. Jim Yen*, Robert E. Bristow*, Russell Vang*, Giovanni Parmigiani*‡, Robert J. Kurman*, Claes G. Trope§, Ben Davidson§, and Tian-Li Wang*† *Departments of Pathology, Gynecology, and Oncology, ‡Department of Biostatistics, The Johns Hopkins University School of Medicine, Baltimore, MD 21231; and §Departments of Pathology and Gynecologic Oncology, Norwegian Radium Hospital, University of Oslo, Montebello, N-0310 Oslo, Norway Edited by Bert Vogelstein, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD, and approved August 15, 2005 (received for review May 20, 2005) A genomewide technology, digital karyotyping, was used to iden- Digital Karyotyping. Carcinoma cells were affinity purified by using tify subchromosomal alterations in ovarian cancer. Amplification magnetic beads conjugated with the Epi-CAM antibody (Dynal, at 11q13.5 was found in three of seven ovarian carcinomas, and Oslo). The purity of tumor cells was confirmed by immunostaining amplicon mapping delineated a 1.8-Mb core of amplification with an anti-cytokeratin antibody, CAM 5.2 (Becton Dickinson, that contained 13 genes. FISH analysis demonstrated amplification San Jose, CA) and samples with greater than 95% epithelial cells of this region in 13.2% of high-grade ovarian carcinomas but not were used in this study. Digital karyotyping library construction and in any of low-grade carcinomas or benign ovarian tumors. Com- data analysis were performed by following the protocol in refs. 2 bined genetic and transcriptome analyses showed that Rsf-1 and 3. Approximately 120,000 genomic tags were obtained for each (HBXAPalpha) was the only gene that demonstrated consistent digital karyotyping library.
    [Show full text]
  • Supplemental Material For: Screen Identifies Bromodomain Protein
    Supplemental Material for: Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination Fade Gong1,2,6, Li-Ya Chiu1,2,6, Ben Cox1,2, François Aymard3,4, Thomas Clouaire3,4, Justin W. Leung1,2, Michael Cammarata5, Mercedes Perez1,2, Poonam Agarwal1,2, Jennifer S. Brodbelt5, Gaëlle Legube3,4 & Kyle. M. Miller1,2,* 1. Supplemental Materials and Methods 2. Supplemental References 3. Supplemental Figure S1-S10 with legends 4. Supplemental Table S1-S3 with legends 1 Supplemental Materials and Methods Plasmid and siRNA transfections Mammalian expression vectors were transfected into U2OS cells by Hilymax (Dojindo) or Fugene HD (Promega) according to manufacturer’s instructions. The I-SceI expressing vector (pCAG-I-SceI) or control vector (pCAG) were transfected into the U2OS DR-GFP cells by Fugene HD (Promega). For HEK293T cells, transient transfections were carried out with pEI (Polyethylenimine, Sigma). Analyses for transient plasmid transfection were performed 24-48 h after transfection. Transfections for siRNA were carried out with lipofectamine RNAiMax (Invitrogen) following the manufacturer’s instructions. Analyses from siRNA treated cells were performed 48-72 h after transfection. The siRNAs used in this study were: siControl: non-targeting pool (Dharmacon); siZMYND8 #1: SMARTpool (Dharmacon); siZMYND8 #2: GGACUUUCCCCUUUUUAUA (targeting the 3’-UTR region of ZMYND8) (Sigma); siZMYND8 #3: GAACAUAGAUGAAUGAAA (Sigma); siCHD4: CCCAGAAGAGGAUUUGUCA (Sigma), siLSD1: GCCUAGACAUUAAACUGAAUA (Sigma); siTIP60 SMARTpool (Dharmacon); siMOF: GCAAAGACCAUAAGAUUUA (Sigma); siCtIP: GGUAAAACAGGAACGAAUC (Sigma); siLigaseIV: AGGAAGUAUUCUCAGGAAUUA (Sigma). Cloning and plasmids 2 cDNAs of human BRD-containing proteins were cloned into the Gateway entry vector pENTR11 by restriction sites, or pDONR201 by attB recombinant sites.
    [Show full text]
  • Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Structure 14, 703–712, April 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.str.2006.01.007 Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding Ying Huang,1 Michael P. Myers,1 and Rui-Ming Xu1,* main (CSD) at the C terminus (Aasland and Stewart, 1 Cold Spring Harbor Laboratory 1995; Eissenberg, 2001; Paro and Hogness, 1991). The Cold Spring Harbor, New York 11724 chromo domain of HP1 specifically recognizes the N-ter- minal tail of histone H3 methylated at lysine-9, which pro- vides a structural basis in support of the ‘‘histone code’’ Summary hypothesis (Bannister et al., 2001; Jacobs and Khorasa- nizadeh, 2002; Jenuwein and Allis, 2001; Lachner et al., Heterochromatin protein-1 (HP1) plays an essential 2001; Nielsen et al., 2002). The CSD is responsible for role in both the assembly of higher-order chromatin HP1 homodimerization and interaction with a number structure and epigenetic inheritance. The C-terminal of nonhistone nuclear proteins (Brasher et al., 2000; chromo shadow domain (CSD) of HP1 is responsible Cowieson et al., 2000; Li et al., 2002; Ye et al., 1997). It for homodimerization and interaction with a number has been demonstrated that the HP1 CSD and the hinge of chromatin-associated nonhistone proteins, includ- region are important for targeting HP1 proteins to spe- ing EMSY, which is a BRCA2-interacting protein that cific genomic loci (Smothers and Henikoff, 2001). has been implicated in the development of breast Various proteins important for chromatin structure and ovarian cancer.
    [Show full text]