DOCSLIB.ORG

Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Structure 14, 703–712, April 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.str.2006.01.007 Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding Ying Huang,1 Michael P. Myers,1 and Rui-Ming Xu1,* main (CSD) at the C terminus (Aasland and Stewart, 1 Cold Spring Harbor Laboratory 1995; Eissenberg, 2001; Paro and Hogness, 1991). The Cold Spring Harbor, New York 11724 chromo domain of HP1 specifically recognizes the N-ter- minal tail of histone H3 methylated at lysine-9, which pro- vides a structural basis in support of the ‘‘histone code’’ Summary hypothesis (Bannister et al., 2001; Jacobs and Khorasa- nizadeh, 2002; Jenuwein and Allis, 2001; Lachner et al., Heterochromatin protein-1 (HP1) plays an essential 2001; Nielsen et al., 2002). The CSD is responsible for role in both the assembly of higher-order chromatin HP1 homodimerization and interaction with a number structure and epigenetic inheritance. The C-terminal of nonhistone nuclear proteins (Brasher et al., 2000; chromo shadow domain (CSD) of HP1 is responsible Cowieson et al., 2000; Li et al., 2002; Ye et al., 1997). It for homodimerization and interaction with a number has been demonstrated that the HP1 CSD and the hinge of chromatin-associated nonhistone proteins, includ- region are important for targeting HP1 proteins to spe- ing EMSY, which is a BRCA2-interacting protein that cific genomic loci (Smothers and Henikoff, 2001). has been implicated in the development of breast Various proteins important for chromatin structure and ovarian cancer. We have determined the crystal and gene transcription have been found to interact structure of the HP1b CSD in complex with the N-termi- with the HP1 CSD (Lechner et al., 2005; Li et al., 2002). nal domain of EMSY at 1.8 A˚ resolution. Surprisingly, They include the large subunit of chromatin assembly the structure reveals that EMSY is bound by two HP1 factor-1 (CAF-1) (Brasher et al., 2000; Lechner et al., CSD homodimers, and the binding sequences differ 2000; Murzina et al., 1999) and components of the cellu- from the consensus HP1 binding motif PXVXL. This lar transcriptional machinery (Vassallo and Tanese, structural information expands our understanding of 2002). In addition, the largest subunit of the origin recog- HP1 binding specificity and provides insights into in- nition complex (Orc1) interacts with full-length HP1 teractions between HP1 homodimers that are likely rather than with individual domains (Lidonnici et al., to be important for heterochromatin formation. 2004; Pak et al., 1997). In the budding yeast Saccharo- myces cerevisiae, the interaction between the silencer Introduction bound Orc1 with silencing information regulator-1 (Sir1) is important for the establishment of the silenced chro- Heterochromatin protein-1 (HP1) is a conserved chro- matin domain at the cryptic mating-type loci (Gardner matin-associated protein important for both the assem- et al., 1999; Triolo and Sternglanz, 1996; Zhang et al., bly of higher-order chromatin structure and regulation of 2002). In higher eukaryotes, the interaction between gene transcription (Eissenberg and Elgin, 2000; Maison Orc1 and HP1 is likely to play an analogous role in the and Almouzni, 2004). HP1 was first discovered in Dro- formation of heterochromatin (Shareef et al., 2003). sophila, and it plays essential roles in position effect var- A recent addition to the list of HP1-interacting pro- iegation, which is a phenomenon of epigenetic gene si- teins is EMSY, which was identified as a protein that in- lencing through heterochromatin formation (Eissenberg teracts with the exon 3-encoded transcriptional activa- et al., 1990; James et al., 1989; Wustmann et al., 1989). tion domain of breast cancer susceptibility gene 2 HP1 achieves its silencing function by directly binding (BRCA2) (Hughes-Davies et al., 2003). EMSY has been to chromatin and spreading across the entire silenced implicated in BRCA2-associated sporadic breast and chromosomal region (Maison and Almouzni, 2004). ovarian cancer, but an understanding of its cellular func- Similar mechanisms of epigenetic control of gene ex- tions is lacking. EMSY is a large protein containing an pression are employed in organisms from yeasts to hu- N-terminal domain (ENT) found in many plant proteins, mans and in diverse biological processes ranging from and the ENT domain is followed by an amino acid se- mating-type switching to X chromosome inactivation quence involved in binding HP1 and BS69, the latter of (Grewal and Elgin, 2002; Jaenisch and Bird, 2003; Nusi- which was initially isolated as an adenoviral E1A binding now and Panning, 2005; Rusche et al., 2003). HP1 and protein that recognizes the PXLXP sequence motif (An- localized heterochromatic foci have also been impli- sieau and Leutz, 2002; Hateboer et al., 1995; Hughes- cated in cellular senescence and cancer development Davies et al., 2003). (Narita et al., 2003; Nielsen et al., 2001). The EMSY sequence implicated in HP1 binding, In Drosophila and mammals, there are three HP1 ho- RLVPL, deviates from the consensus HP1 binding se- mologs: HP1a, HP1b, and HP1g. The three proteins are quence PXVXL (positions 22 to +2) at the 22 position highly related, yet they are distributed in distinct chro- (Smothers and Henikoff, 2000; Thiru et al., 2004). In the mosomal regions. HP1a and HP1b are predominantly structure of the HP1 CSD-CAF-1 peptide complex, the associated with heterochromatin, while HP1g is mostly proline at position 22 occupies a shallow hydrophobic euchromatic (Maison and Almouzni, 2004). All HP1 pro- pocket (Thiru et al., 2004) that an arginine would not be teins have a highly conserved chromo domain at the able to bind. To determine the exact mode of interaction ˚ N terminus and a well-conserved chromo shadow do- between the HP1 CSD and EMSY, we solved a 1.8 A res- olution cocrystal structure of the HP1b CSD in complex with an N-terminal EMSY fragment encompassing the *Correspondence: [email protected] ENT domain and the HP1/BS69 binding sites (EMSY-N, Structure 704 Figure 1. Structure Determination (A) A section of the MAD-phased electron density map surrounding the ENT-proximal HP1 binding site. The 2.3 A˚ map is shown in a filled chicken- wire representation and is contoured at the 1.0s level. The refined model of the EMSY-HP1 CSD complex (stick model) is superimposed onto the map. EMSY, HP1 CSD-A1, and HP1 CSD-A2 molecules are shown with carbon bonds colored yellow, magenta, and red, respectively. (B) The overall structure of the EMSY-HP1 CSD complex shown in a ribbon representation. One asymmetric unit contains half of the EMSY ho- modimer, and the other half (shaded) is related by a 2-fold symmetry. EMSY is colored yellow, the ENT-proximal CSD dimer (CSD-A) is shown in magenta (CSD-A1) and red (CSD-A2), and the ENT-distal dimer (CSD-B) is shown in green (CSD-B1) and cyan (CSD-B2). (C) Superposition of the backbones of CSD-A (red), CSD-B (green), and the HP1 CSD dimer of the HP1-CAF-1 complex (white). aa 9–139). The structure reveals an unexpected binding the HP1 binding sites (aa 98–124). The structure of the mode for HP1 CSD to EMSY, which broadens our under- ENT domain has been previously described (Chavali standing of HP1 binding specificity, and the structural et al., 2005). It consists mainly of five a helices: a1 and information should be useful for identifying new HP1 a2 are antiparallel to each other, a3 and a5 are packed binding proteins. on the same side of a1 and a2, and a4 contacts the C-terminal end of a1(Figure 1B). As noted in the work Results of Chavali et al. (2005), the ENT domain forms a homo- dimer, and the two ENT monomers are related by a Overall Structure 2-fold crystallographic symmetry in our structure (Fig- The structure was solved by the method of multiwave- ure 1B). Helices a1, a2, and a4 are engaged in extensive length anomalous dispersion (MAD) by using data col- dimeric interactions. The dimeric interface buries a total lected from a crystal with seleno-methionine (SeMet)- of w2976 A˚ 2 of pairwise solvent-accessible area, calcu- substituted HP1 CSD. The high-quality MAD-phased lated with a probe radius of 1.4 A˚ . The C-terminal exten- electron density allows for unambiguous tracing of sion of EMSY-N, which harbors the HP1 binding sites, main chains and assignment of amino acids side chains projects away from the dimeric interface (Figure 1B). (Figure 1A). The modeled EMSY-N and the HP1 CSD The HP1 CSD has a mixed a/b structure (Brasher et al., complex contains two HP1 CSD homodimers (aa 109– 2000; Cowieson et al., 2000): three b strands (b1–b3) at 175) bound to one EMSY-N (aa 9–124) in the asymmetric the N-terminal end form an antiparallel sheet, which is unit (Figure 1B). The 1.8 A˚ refined model has excellent stabilized by the packing of two approximately perpen- stereochemical quality: 90.3% of the residues are in dicularly oriented a helices (aA and aB) on one side of the most-favored region of the Ramachandran plot, the b sheet. The two helices are responsible for homo- and none are in the disallowed region, assessed by the dimer formation, and they interact with the same helices PROCHECK program (Laskowski et al., 1993). Detailed of another CSD monomer (Figure 1B). The two HP1 CSD statistics of structure determination and refinement are homodimers in the structure, denoted CSD-A and CSD- shown in Table 1. B, have very similar monomeric structures.
Load more

Recommended publications
  • Responses of Bats to White-Nose Syndrome and Implications for Conservation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 2Fmm Lichtarge Lab 2006
    Pages 1–13 2fmm Evolutionary trace report by report maker June 27, 2010 4 Notes on using trace results 11 4.1 Coverage 11 4.2 Known substitutions 11 4.3 Surface 11 4.4 Number of contacts 11 4.5 Annotation 11 4.6 Mutation suggestions 11 5 Appendix 11 5.1 File formats 11 5.2 Color schemes used 12 5.3 Credits 12 5.3.1 Alistat 12 5.3.2 CE 12 5.3.3 DSSP 12 5.3.4 HSSP 12 5.3.5 LaTex 12 5.3.6 Muscle 12 5.3.7 Pymol 12 5.4 Note about ET Viewer 12 5.5 Citing this work 12 CONTENTS 5.6 About report maker 13 5.7 Attachments 13 1 Introduction 1 2 Chain 2fmmA 1 1 INTRODUCTION 2.1 Q6E6J7 overview 1 From the original Protein Data Bank entry (PDB id 2fmm): 2.2 Multiple sequence alignment for 2fmmA 1 Title: Crystal structure of emsy-hp1 complex 2.3 Residue ranking in 2fmmA 1 Compound: Mol id: 1; molecule: protein emsy; chain: e; frag- 2.4 Top ranking residues in 2fmmA and their position ment: n-terminal domain; engineered: yes; mol id: 2; molecule: on the structure 1 chromobox protein homolog 1; chain: a, b, c, d; fragment: chromo 2.4.1 Clustering of residues at 25% coverage. 1 shadow domain; synonym: heterochromatin protein 1 homolog beta, 2.4.2 Overlap with known functional surfaces at hp1 beta, modifier 1 protein, m31, heterochromatin protein p25, 25% coverage. 2 hp1hsbeta, p25beta; engineered: yes 2.4.3 Possible novel functional surfaces at 25% Organism, scientific name: Homo Sapiens; coverage.
    [Show full text]
  • Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome
    Vol. 10, 5785–5791, September 1, 2004 Clinical Cancer Research 5785 Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome Carmen Rodriguez,1 Luke Hughes-Davies,2 INTRODUCTION He´le`ne Valle`s,1 Be´atrice Orsetti,1 DNA amplification is a common mechanism of oncogenic Marguerite Cuny,1 Lisa Ursule,1 activation in human tumors, and band q13 of chromosome 11 is a frequent site of genetic aberration in a number of human Tony Kouzarides,2 and Charles Theillet1 malignancies, particularly breast and head and neck cancers (1). 1 Ge´notype et Phe´notypes Tumoraux E 229 INSERM, Centre Val Several candidate oncogenes have been proposed, among which d’Aurelle, Montpellier, France; 2Cancer Research UK/Wellcome Institute, Cambridge, United Kingdom only CCND1 and EMS1 meet the criteria for genes activated by DNA amplification (2). Both genes map to chromosome 11q13.3, 0.8 Mb apart, with CCND1 occupying a more centro- ABSTRACT meric position than EMS1 (3). Because CCND1 is frequently DNA amplification at band q13 of chromosome 11 is rearranged by chromosomal translocations in hematologic ma- common in breast cancer, and CCND1 and EMS1 remain lignancies and overexpressed in several human tumors, this gene the strongest candidate genes. However, amplification pat- has been considered the principal target for DNA amplification terns are consistent with the existence of four cores of am- at 11q13 (4). However, some findings suggested that 11q13 plification, suggesting the involvement of additional genes. amplification could be more complex. On the basis of the Here we present evidence strongly suggesting the involve- recently completed genome map, the 11q13 amplification do- ment of the recently characterized EMSY gene in the for- main spans up to 7 Mb and the existence of four distinct cores mation of the telomeric amplicon.
    [Show full text]
  • The Cbio Cancer Genomics Portal: an Open Platform for Exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E
    views In Focus The cBio Cancer Genomics Portal: An Open Platform for exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E. Gross1, Selcuk Onur Sumer3, Bülent Arman Aksoy1,2, Anders Jacobsen1, Caitlin J. Byrne1, Michael L. Heuer, Erik Larsson1, Yevgeniy Antipin1, Boris Reva1, Arthur P. Goldberg1, Chris Sander1, and Nikolaus Schultz1 summary: The cBio Cancer Genomics Portal (http://cbioportal.org) is an open-access resource for interactive exploration of multidimensional cancer genomics data sets, currently providing access to data from more than 5,000 tumor samples from 20 cancer studies. The cBio Cancer Genomics Portal significantly lowers the barriers between complex genomic data and cancer researchers who want rapid, intuitive, and high-quality access to molecular profiles and clinical attributes from large-scale cancer genomics projects and empowers researchers to translate these rich data sets into biologic insights and clinical applications. Cancer Discov; 2(5); 401–4. ©2012 AACR. With the rapidly declining cost of next-generation sequenc- survival and disease-free survival intervals. The data are then ing, and major national and international efforts, including The organized as a function of patient and gene, and the portal’s Cancer Genome Atlas (TCGA) and the International Cancer fundamental abstraction is the concept of altered genes; spe- Genome Consortium (ICGC) (1), the field of cancer genom- cifically, we classify a gene as altered in a specific patient if it ics continues to advance at an extraordinarily rapid pace. Data is mutated, homozygously deleted, amplified, or its relative generated by these projects are, however, not easily or directly mRNA expression is less than or greater than a user-defined available to the cancer research community, hindering the threshold.
    [Show full text]
  • Triangulating Molecular Evidence to Prioritise Candidate Causal Genes at Established Atopic Dermatitis Loci
    medRxiv preprint doi: https://doi.org/10.1101/2020.11.30.20240838; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-ND 4.0 International license . Triangulating molecular evidence to prioritise candidate causal genes at established atopic dermatitis loci Maria K Sobczyk1, Tom G Richardson1, Verena Zuber2,3, Josine L Min1, eQTLGen Consortium4, BIOS Consortium5, GoDMC, Tom R Gaunt1, Lavinia Paternoster1* 1) MRC Integrative Epidemiology Unit, Bristol Medical School, University of Bristol, Bristol, UK 2) Department of Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, UK 3) MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK 4) Members of the eQTLGen Consortium are listed in: Supplementary_Consortium_members.docx 5) Members of the BIOS Consortium are listed in: Supplementary_Consortium_members.docx Abstract Background: Genome-wide association studies for atopic dermatitis (AD, eczema) have identified 25 reproducible loci associated in populations of European descent. We attempt to prioritise candidate causal genes at these loci using a multifaceted bioinformatic approach and extensive molecular resources compiled into a novel pipeline: ADGAPP (Atopic Dermatitis GWAS Annotation & Prioritisation Pipeline). Methods: We identified a comprehensive list of 103 accessible
    [Show full text]
  • Regulatory Switch Enforced by Basic Helix-Loop-Helix and ACT-Domain
    Regulatory switch enforced by basic helix-loop-helix PNAS PLUS and ACT-domain mediated dimerizations of the maize transcription factor R Que Konga,1, Sitakanta Pattanaika,b,1, Antje Fellerc,1, Joshua R. Werkmana, Chenglin Chaid, Yongqin Wangd, Erich Grotewoldc,d,2, and Ling Yuana,b,2 aDepartment of Plant and Soil Sciences and bKentucky Tobacco Research and Development Center, University of Kentucky, Lexington, KY 40546; and cMolecular, Cellular and Developmental Biology Program and dDepartment of Molecular Genetics and Center for Applied Plant Sciences, Ohio State University, Columbus, OH 43210 Edited by Peter H. Quail, University of California, Berkeley, CA, and approved May 21, 2012 (received for review April 10, 2012) The maize R2R3-MYB regulator C1 cooperates with the basic helix– the formation of MAX–MAD and MAX–MNT heterodimers loop–helix (bHLH) factor R to activate the expression of anthocya- results in transcriptional repression through the recruitment of nin biosynthetic genes coordinately. As is the case for other bHLH histone deacetylase complexes (5). factors, R harbors several protein–protein interaction domains. In plants, bHLH factors constitute one of the largest families Here we show that not the classical but rather a briefly extended of regulatory proteins (1). The Arabidopsis genome encodes for R bHLH region forms homodimers that bind canonical G-box DNA ∼162 bHLH proteins, about 10% of all of the known transcrip- motifs. This bHLH DNA-binding activity is abolished if the C-termi- tion factors in this plant (6–8). Maize R was the first plant bHLH nal ACT (aspartokinase, chorismate, and TyrA) domain is licensed to transcription factor described (9).
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • BRCA2 Abrogation Triggers Innate Immune Responses Potentiated by Treatment with PARP Inhibitors
    bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. BRCA2 abrogation triggers innate immune responses potentiated by treatment with PARP inhibitors Timo Reisländer1, Emilia Puig Lombardi2,3,*, Florian J. Groelly1,*, Ana Miar4, Manuela Porru5, Benjamin Wright6, Helen Lockstone6, Annamaria Biroccio5, Adrian Harris4, Arturo Londono2,3 and Madalena Tarsounas1 1Genome Stability and Tumourigenesis Group, The CR-UK/MRC Oxford Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Oxford OX3 7DQ, U.K. 2Institut Curie, PSL Research University, CNRS, UMR3244, F-75005, Paris, France. 3Sorbonne Universités, UPMC Univ Paris 06, CNRS, UMR3244, F-75005, Paris, France. 4Hypoxia and Angiogenesis Group, Weatherall Institute of Molecular Medicine, Department of Oncology, University of Oxford, Oxford OX3 9DS, U.K. 5Area of Translational Research, IRCCS Regina Elena National Cancer Institute, 00144 Rome, Italy 6Bioinformatics and Statistical Genetics Core, Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford OX3 7BN, U.K. *These authors contributed equally to this study. *Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Heterozygous germline mutations in BRCA2 predispose to breast and ovarian cancer. Contrary to non-cancerous cells, where BRCA2 deletion causes cell cycle arrest or cell death, BRCA2 inactivation in tumors is associated with uncontrolled cell proliferation.
    [Show full text]
  • Amplification of a Chromatin Remodeling Gene, Rsf-1 HBXAP, In
    Amplification of a chromatin remodeling gene, Rsf-1͞HBXAP, in ovarian carcinoma Ie-Ming Shih*†, Jim Jinn-Chyuan Sheu*, Antonio Santillan*, Kentaro Nakayama*, M. Jim Yen*, Robert E. Bristow*, Russell Vang*, Giovanni Parmigiani*‡, Robert J. Kurman*, Claes G. Trope§, Ben Davidson§, and Tian-Li Wang*† *Departments of Pathology, Gynecology, and Oncology, ‡Department of Biostatistics, The Johns Hopkins University School of Medicine, Baltimore, MD 21231; and §Departments of Pathology and Gynecologic Oncology, Norwegian Radium Hospital, University of Oslo, Montebello, N-0310 Oslo, Norway Edited by Bert Vogelstein, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD, and approved August 15, 2005 (received for review May 20, 2005) A genomewide technology, digital karyotyping, was used to iden- Digital Karyotyping. Carcinoma cells were affinity purified by using tify subchromosomal alterations in ovarian cancer. Amplification magnetic beads conjugated with the Epi-CAM antibody (Dynal, at 11q13.5 was found in three of seven ovarian carcinomas, and Oslo). The purity of tumor cells was confirmed by immunostaining amplicon mapping delineated a 1.8-Mb core of amplification with an anti-cytokeratin antibody, CAM 5.2 (Becton Dickinson, that contained 13 genes. FISH analysis demonstrated amplification San Jose, CA) and samples with greater than 95% epithelial cells of this region in 13.2% of high-grade ovarian carcinomas but not were used in this study. Digital karyotyping library construction and in any of low-grade carcinomas or benign ovarian tumors. Com- data analysis were performed by following the protocol in refs. 2 bined genetic and transcriptome analyses showed that Rsf-1 and 3. Approximately 120,000 genomic tags were obtained for each (HBXAPalpha) was the only gene that demonstrated consistent digital karyotyping library.
    [Show full text]
  • Supplemental Material For: Screen Identifies Bromodomain Protein
    Supplemental Material for: Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination Fade Gong1,2,6, Li-Ya Chiu1,2,6, Ben Cox1,2, François Aymard3,4, Thomas Clouaire3,4, Justin W. Leung1,2, Michael Cammarata5, Mercedes Perez1,2, Poonam Agarwal1,2, Jennifer S. Brodbelt5, Gaëlle Legube3,4 & Kyle. M. Miller1,2,* 1. Supplemental Materials and Methods 2. Supplemental References 3. Supplemental Figure S1-S10 with legends 4. Supplemental Table S1-S3 with legends 1 Supplemental Materials and Methods Plasmid and siRNA transfections Mammalian expression vectors were transfected into U2OS cells by Hilymax (Dojindo) or Fugene HD (Promega) according to manufacturer’s instructions. The I-SceI expressing vector (pCAG-I-SceI) or control vector (pCAG) were transfected into the U2OS DR-GFP cells by Fugene HD (Promega). For HEK293T cells, transient transfections were carried out with pEI (Polyethylenimine, Sigma). Analyses for transient plasmid transfection were performed 24-48 h after transfection. Transfections for siRNA were carried out with lipofectamine RNAiMax (Invitrogen) following the manufacturer’s instructions. Analyses from siRNA treated cells were performed 48-72 h after transfection. The siRNAs used in this study were: siControl: non-targeting pool (Dharmacon); siZMYND8 #1: SMARTpool (Dharmacon); siZMYND8 #2: GGACUUUCCCCUUUUUAUA (targeting the 3’-UTR region of ZMYND8) (Sigma); siZMYND8 #3: GAACAUAGAUGAAUGAAA (Sigma); siCHD4: CCCAGAAGAGGAUUUGUCA (Sigma), siLSD1: GCCUAGACAUUAAACUGAAUA (Sigma); siTIP60 SMARTpool (Dharmacon); siMOF: GCAAAGACCAUAAGAUUUA (Sigma); siCtIP: GGUAAAACAGGAACGAAUC (Sigma); siLigaseIV: AGGAAGUAUUCUCAGGAAUUA (Sigma). Cloning and plasmids 2 cDNAs of human BRD-containing proteins were cloned into the Gateway entry vector pENTR11 by restriction sites, or pDONR201 by attB recombinant sites.
    [Show full text]
  • EMSY Expression Affects Multiple Components of the Skin Barrier with Relevance to Atopic Dermatitis
    Elias, M. S., Wright, S. C., Remenyi, J., Abbott, J. C., Bray, S. E., Cole, C., Edwards, S., Gierlinski, M., Glok, M., McGrath, J. A., Nicholson, W. V., Paternoster, L., Prescott, A. R., Have, S. T., Whitfield, P. D., Lamond, A. I., & Brown, S. J. (2019). EMSY expression affects multiple components of the skin barrier with relevance to atopic dermatitis. Journal of Allergy and Clinical Immunology, 144(2), 470-481. https://doi.org/10.1016/j.jaci.2019.05.024 Publisher's PDF, also known as Version of record License (if available): CC BY Link to published version (if available): 10.1016/j.jaci.2019.05.024 Link to publication record in Explore Bristol Research PDF-document This is the final published version of the article (version of record). It first appeared online via Elsevier at https://doi.org/10.1016/j.jaci.2019.05.024 . Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ Atopic dermatitis and inflammatory skin disease EMSY expression affects multiple components of the skin barrier with relevance to atopic dermatitis Martina S. Elias, PhD,a Sheila C. Wright, HNC,a Judit Remenyi, PhD,a James C. Abbott, PhD,b Susan E. Bray, PhD,c Christian Cole, PhD,b Sharon Edwards, MBChB,d Marek Gierlinski, PhD,b Mateusz Glok,a John A.
    [Show full text]