DOCSLIB.ORG

The Gene Wiki: Community Intelligence Applied to Human Gene Annotation Jon W

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Gene Wiki: Community Intelligence Applied to Human Gene Annotation Jon W Published online 15 September 2009 Nucleic Acids Research, 2010, Vol. 38, Database issue D633–D639 doi:10.1093/nar/gkp760 The Gene Wiki: community intelligence applied to human gene annotation Jon W. Huss III1, Pierre Lindenbaum2, Michael Martone3, Donabel Roberts4, Angel Pizarro5, Faramarz Valafar4, John B. Hogenesch5 and Andrew I. Su1,* 1Genomics Institute of the Novartis Research Foundation, San Diego, CA 92121, USA, 2Department of Bioinformatics, CEPH/Fondation Jean-Dausset, Paris, France, 3Rush University Medical College, Chicago, IL 60612, 4San Diego State University, Bioinformatics and Medical Informatics Graduate Program, San Diego, CA 92182 and 5Department of Pharmacology, Institute for Translational Medicine and Therapeutics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA Received August 14, 2009; Revised August 26, 2009; Accepted August 29, 2009 ABSTRACT illustrated by two simple analyses of links between PubMed and the Entrez Gene database. Annotating the function of all human genes is a The first analysis showed that while there are several critical, yet formidable, challenge. Current gene well-studied genes that have thousands of indexed annotation efforts focus on centralized curation citations in the literature, that degree of functional anno- resources, but it is increasingly clear that this tation falls off steeply (1). Almost 80% of Entrez Gene approach does not scale with the rapid growth of entries had five or fewer linked references in PubMed; the biomedical literature. The Gene Wiki utilizes an almost 50% had zero linked references (Figure 1A). alternative and complementary model based on the This pattern was even more pronounced when examining principle of community intelligence. Directly integra- links to the Gene Ontology (also shown in Figure 1A). ted within the online encyclopedia, Wikipedia, the Clearly, there remains much work to be done to func- goal of this effort is to build a gene-specific review tionally annotate the human genome and to com- prehensively catalog these findings in gene annotation article for every gene in the human genome, where databases. each article is collaboratively written, continuously A second analysis examined the rate at which PubMed updated and community reviewed. Previously, entries were being linked to Entrez Gene (Figure 1B). we described the creation of Gene Wiki ‘stubs’ Between 1970 and 2008, the number of publications for approximately 9000 human genes. Here, we added to PubMed grew at an annualized rate of 3.4%. describe ongoing systematic improvements to On examining that same time period, it was found that the these articles to increase their utility. Moreover, number of articles that are currently linked to at least one we retrospectively examine the community usage Entrez Gene entry ‘grew’ by 18% per year, but still <4% and improvement of the Gene Wiki, providing of all PubMed entries in recent years (and <1.5% overall) evidence of a critical mass of users and editors. are linked to Entrez Gene. Assuming that >4% of Gene Wiki articles are freely accessible within the PubMed-indexed articles have relevance to human gene function, this finding suggests that the rate limiting step Wikipedia web site, and additional links and infor- is not generating the data, but capturing the derived mation are available at http://en.wikipedia knowledge in gene annotation databases. .org/wiki/Portal:Gene_Wiki. Currently, the process of annotating gene function typ- ically entails large-scale efforts by the model organism community (2–4) and genome annotation centers (5). INTRODUCTION Formal annotation of gene function often utilizes con- The sequencing and analysis of the human genome have trolled vocabularies like Gene Ontology (6). While the largely elucidated the ‘parts list’ of the cellular machinery annotation process can be aided by the use of in the form of approximately 25 000 genes. However, computational tools, ultimately the assignment of gene the comprehensive annotation of gene function remains function is a manual process requiring the attention of a formidable challenge. The scale of the task ahead is one or more domain experts (7). This centralized model *To whom correspondence should be addressed. Tel: 858-812-1500; Fax: 858-812-1570; Email: [email protected] ß The Author(s) 2009. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.5/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. D634 Nucleic Acids Research, 2010, Vol. 38, Database issue A 10000 TP53 TNF PubMed links APOE GO Annotaons MTHFR 1000 HLA-DRB1 31672 genes (78%) have five or fewer IL6 ACE linked PubMed references TGFB1 100 EGFR Counts VEGFA 19709 genes (49%) have zero linked 10 PubMed references 40234 entries in Entrez Gene 1 0 10000 20000 30000 40000 Genes, sorted by decreasing counts B Figure 1. Analysis of links between the Entrez Gene and PubMed databases. (A) Examining the degree of gene annotation from the perspective of Entrez Gene, we found that while a few genes are very well annotated with links to PubMed references, the vast majority of genes have few or no linked references. (B) Examining links from the perspective of PubMed, we found that only a small fraction of published articles are linked to human genes. Taken together, these findings suggest that the traditional model of centralized curation is not scaling well with the rate of scientific research, and that complementary approaches based on community intelligence may be worth exploring. has been very successful in its goal to systematically involved in the annotation effort to scale up to the rate of advance gene annotation, creating essential tools and data generation’ (8). ontologies in the process. Thus, although leaders in the curation community have However, this model alone may not be sufficient to effi- successfully set up a robust pipeline and infrastructure, ciently and systematically annotate gene function. Many and although the individuals in the curation community leading voices in the gene annotation and model are clearly skilled in the annotation process, the amount of organism communities recently wrote a feature article in resources devoted to this important task may be simply Nature describing the current state and future of insufficient relative to the volume of biomedical data being biocuration (8). They noted the immense challenge to the generated. curator community (typically numbering in tens to Recently, several efforts have been published, which hundreds of people) to keep pace with the biomedical lit- attempt to harness the principle of ‘community intelli- erature (currently 18 million articles in PubMed, roughly gence’ (9–15). In particular, we introduced the Gene 750 000 new articles per year). Specifically, these curation Wiki (11), an effort to systematically annotate articles in experts suggest that merely preserving the existing the online encyclopedia, Wikipedia, for approximately models of gene annotation will lead to an increasing lag 9000 human genes. Articles were created or amended between curated data and biological knowledge, and that with content mined from structured gene annotation ‘sooner or later, the research community will need to be databases, including Entrez Gene, Ensembl, UniProt and Nucleic Acids Research, 2010, Vol. 38, Database issue D635 the Protein Data Bank (PDB). Although the emphasis of the Wikimedia Commons. To aid in browsing and the Gene Wiki is on describing human gene function, data searching, PDB images were also categorized according from model organisms is often contributed as appropriate. to their assignments in the Structural Classification of Here, we present an update describing the recent sys- Proteins (SCOP) database (19). The set of PDB structures tematic improvements to the Gene Wiki. Moreover, we can be browsed at http://commons.wikimedia.org/wiki report on a retrospective analysis of Gene Wiki usage /SCOP. and editing. Finally, we offer some concluding remarks The easy availability of thumbnail images for almost all on general progress and challenges facing efforts to PDB structures will encourage their incorporation into collaboratively engage the entire community of scientists. relevant Gene Wiki and Wikipedia articles. To begin this process, we added an image gallery of PDB thumbnails to every Gene Wiki page with solved structures. To maintain DATABASE CONTENT balance with the rest of the pages’ content, the image As described earlier (11), the initial Gene Wiki effort galleries were shown in an expandable window at the focused on creating or amending gene pages to include a bottom of each Gene Wiki page. In total, PDB image free-text summary, an ‘infobox’ with links to public galleries were added to 2852 Gene Wiki pages with databases, Gene Ontology annotations and when avail- a total of 16 018 links to PDB structures. For example, able, protein structure identifiers. These data were primar- the PDB gallery for MDM2 (http://en.wikipedia ily harvested from the Entrez Gene database (16). Since .org/wiki/Mdm2) shows PDB structures corresponding that publication, we have introduced several other system- to the unbound protein, as well as structures in complex atic improvements to the Gene Wiki. with its p53 peptide ligand and two small molecule inhibitors. Protein interactions On-demand web service Our previously
Load more

Recommended publications
  • Responses of Bats to White-Nose Syndrome and Implications for Conservation
    University of New Hampshire University of New Hampshire Scholars' Repository Doctoral Dissertations Student Scholarship Spring 2020 Responses of Bats to White-Nose Syndrome and Implications for Conservation Meghan Stark University of New Hampshire, Durham Follow this and additional works at: https://scholars.unh.edu/dissertation Recommended Citation Stark, Meghan, "Responses of Bats to White-Nose Syndrome and Implications for Conservation" (2020). Doctoral Dissertations. 2518. https://scholars.unh.edu/dissertation/2518 This Dissertation is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. RESPONSES OF BATS TO WHITE-NOSE SYNDROME AND IMPLICATIONS FOR CONSERVATION BY MEGHAN A. STARK B.S., University of Alabama at Birmingham, 2013 DISSERTATION Submitted to the University of New Hampshire in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy In Genetics May 2020 i This dissertation was examined and approved in partial fulfillment of the requirements for the degree of Ph.D. in Genetics by: Dissertation Director, Matthew MacManes, Assoc. Prof. UNH MCBS Jeffrey T. Foster, Associate Professor, NAU PMI W. Kelley Thomas, Professor, UNH MCBS Rebecca Rowe, Associate Professor, UNH NREN Thomas Lee, Associate Professor Emeritus, UNH NREN On April 6, 2020 Approval signatures are on file with the University of New Hampshire Graduate School. ii DEDICATION I dedicate this work to all of the strong women in my life: Myra Michele Ange Heather Michelle Coons Kaitlyn Danielle Cagle Brindlee Michelle Coons Patricia Gail Miller Sarah Jean Lane “Here’s to strong women.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 2Fmm Lichtarge Lab 2006
    Pages 1–13 2fmm Evolutionary trace report by report maker June 27, 2010 4 Notes on using trace results 11 4.1 Coverage 11 4.2 Known substitutions 11 4.3 Surface 11 4.4 Number of contacts 11 4.5 Annotation 11 4.6 Mutation suggestions 11 5 Appendix 11 5.1 File formats 11 5.2 Color schemes used 12 5.3 Credits 12 5.3.1 Alistat 12 5.3.2 CE 12 5.3.3 DSSP 12 5.3.4 HSSP 12 5.3.5 LaTex 12 5.3.6 Muscle 12 5.3.7 Pymol 12 5.4 Note about ET Viewer 12 5.5 Citing this work 12 CONTENTS 5.6 About report maker 13 5.7 Attachments 13 1 Introduction 1 2 Chain 2fmmA 1 1 INTRODUCTION 2.1 Q6E6J7 overview 1 From the original Protein Data Bank entry (PDB id 2fmm): 2.2 Multiple sequence alignment for 2fmmA 1 Title: Crystal structure of emsy-hp1 complex 2.3 Residue ranking in 2fmmA 1 Compound: Mol id: 1; molecule: protein emsy; chain: e; frag- 2.4 Top ranking residues in 2fmmA and their position ment: n-terminal domain; engineered: yes; mol id: 2; molecule: on the structure 1 chromobox protein homolog 1; chain: a, b, c, d; fragment: chromo 2.4.1 Clustering of residues at 25% coverage. 1 shadow domain; synonym: heterochromatin protein 1 homolog beta, 2.4.2 Overlap with known functional surfaces at hp1 beta, modifier 1 protein, m31, heterochromatin protein p25, 25% coverage. 2 hp1hsbeta, p25beta; engineered: yes 2.4.3 Possible novel functional surfaces at 25% Organism, scientific name: Homo Sapiens; coverage.
    [Show full text]
  • Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome
    Vol. 10, 5785–5791, September 1, 2004 Clinical Cancer Research 5785 Amplification of the BRCA2 Pathway Gene EMSY in Sporadic Breast Cancer Is Related to Negative Outcome Carmen Rodriguez,1 Luke Hughes-Davies,2 INTRODUCTION He´le`ne Valle`s,1 Be´atrice Orsetti,1 DNA amplification is a common mechanism of oncogenic Marguerite Cuny,1 Lisa Ursule,1 activation in human tumors, and band q13 of chromosome 11 is a frequent site of genetic aberration in a number of human Tony Kouzarides,2 and Charles Theillet1 malignancies, particularly breast and head and neck cancers (1). 1 Ge´notype et Phe´notypes Tumoraux E 229 INSERM, Centre Val Several candidate oncogenes have been proposed, among which d’Aurelle, Montpellier, France; 2Cancer Research UK/Wellcome Institute, Cambridge, United Kingdom only CCND1 and EMS1 meet the criteria for genes activated by DNA amplification (2). Both genes map to chromosome 11q13.3, 0.8 Mb apart, with CCND1 occupying a more centro- ABSTRACT meric position than EMS1 (3). Because CCND1 is frequently DNA amplification at band q13 of chromosome 11 is rearranged by chromosomal translocations in hematologic ma- common in breast cancer, and CCND1 and EMS1 remain lignancies and overexpressed in several human tumors, this gene the strongest candidate genes. However, amplification pat- has been considered the principal target for DNA amplification terns are consistent with the existence of four cores of am- at 11q13 (4). However, some findings suggested that 11q13 plification, suggesting the involvement of additional genes. amplification could be more complex. On the basis of the Here we present evidence strongly suggesting the involve- recently completed genome map, the 11q13 amplification do- ment of the recently characterized EMSY gene in the for- main spans up to 7 Mb and the existence of four distinct cores mation of the telomeric amplicon.
    [Show full text]
  • The Cbio Cancer Genomics Portal: an Open Platform for Exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E
    views In Focus The cBio Cancer Genomics Portal: An Open Platform for exploring Multidimensional Cancer Genomics Data Ethan Cerami1, Jianjiong Gao1, Ugur Dogrusoz3, Benjamin E. Gross1, Selcuk Onur Sumer3, Bülent Arman Aksoy1,2, Anders Jacobsen1, Caitlin J. Byrne1, Michael L. Heuer, Erik Larsson1, Yevgeniy Antipin1, Boris Reva1, Arthur P. Goldberg1, Chris Sander1, and Nikolaus Schultz1 summary: The cBio Cancer Genomics Portal (http://cbioportal.org) is an open-access resource for interactive exploration of multidimensional cancer genomics data sets, currently providing access to data from more than 5,000 tumor samples from 20 cancer studies. The cBio Cancer Genomics Portal significantly lowers the barriers between complex genomic data and cancer researchers who want rapid, intuitive, and high-quality access to molecular profiles and clinical attributes from large-scale cancer genomics projects and empowers researchers to translate these rich data sets into biologic insights and clinical applications. Cancer Discov; 2(5); 401–4. ©2012 AACR. With the rapidly declining cost of next-generation sequenc- survival and disease-free survival intervals. The data are then ing, and major national and international efforts, including The organized as a function of patient and gene, and the portal’s Cancer Genome Atlas (TCGA) and the International Cancer fundamental abstraction is the concept of altered genes; spe- Genome Consortium (ICGC) (1), the field of cancer genom- cifically, we classify a gene as altered in a specific patient if it ics continues to advance at an extraordinarily rapid pace. Data is mutated, homozygously deleted, amplified, or its relative generated by these projects are, however, not easily or directly mRNA expression is less than or greater than a user-defined available to the cancer research community, hindering the threshold.
    [Show full text]
  • Triangulating Molecular Evidence to Prioritise Candidate Causal Genes at Established Atopic Dermatitis Loci
    medRxiv preprint doi: https://doi.org/10.1101/2020.11.30.20240838; this version posted November 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-ND 4.0 International license . Triangulating molecular evidence to prioritise candidate causal genes at established atopic dermatitis loci Maria K Sobczyk1, Tom G Richardson1, Verena Zuber2,3, Josine L Min1, eQTLGen Consortium4, BIOS Consortium5, GoDMC, Tom R Gaunt1, Lavinia Paternoster1* 1) MRC Integrative Epidemiology Unit, Bristol Medical School, University of Bristol, Bristol, UK 2) Department of Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, UK 3) MRC Biostatistics Unit, School of Clinical Medicine, University of Cambridge, Cambridge, UK 4) Members of the eQTLGen Consortium are listed in: Supplementary_Consortium_members.docx 5) Members of the BIOS Consortium are listed in: Supplementary_Consortium_members.docx Abstract Background: Genome-wide association studies for atopic dermatitis (AD, eczema) have identified 25 reproducible loci associated in populations of European descent. We attempt to prioritise candidate causal genes at these loci using a multifaceted bioinformatic approach and extensive molecular resources compiled into a novel pipeline: ADGAPP (Atopic Dermatitis GWAS Annotation & Prioritisation Pipeline). Methods: We identified a comprehensive list of 103 accessible
    [Show full text]
  • Regulatory Switch Enforced by Basic Helix-Loop-Helix and ACT-Domain
    Regulatory switch enforced by basic helix-loop-helix PNAS PLUS and ACT-domain mediated dimerizations of the maize transcription factor R Que Konga,1, Sitakanta Pattanaika,b,1, Antje Fellerc,1, Joshua R. Werkmana, Chenglin Chaid, Yongqin Wangd, Erich Grotewoldc,d,2, and Ling Yuana,b,2 aDepartment of Plant and Soil Sciences and bKentucky Tobacco Research and Development Center, University of Kentucky, Lexington, KY 40546; and cMolecular, Cellular and Developmental Biology Program and dDepartment of Molecular Genetics and Center for Applied Plant Sciences, Ohio State University, Columbus, OH 43210 Edited by Peter H. Quail, University of California, Berkeley, CA, and approved May 21, 2012 (received for review April 10, 2012) The maize R2R3-MYB regulator C1 cooperates with the basic helix– the formation of MAX–MAD and MAX–MNT heterodimers loop–helix (bHLH) factor R to activate the expression of anthocya- results in transcriptional repression through the recruitment of nin biosynthetic genes coordinately. As is the case for other bHLH histone deacetylase complexes (5). factors, R harbors several protein–protein interaction domains. In plants, bHLH factors constitute one of the largest families Here we show that not the classical but rather a briefly extended of regulatory proteins (1). The Arabidopsis genome encodes for R bHLH region forms homodimers that bind canonical G-box DNA ∼162 bHLH proteins, about 10% of all of the known transcrip- motifs. This bHLH DNA-binding activity is abolished if the C-termi- tion factors in this plant (6–8). Maize R was the first plant bHLH nal ACT (aspartokinase, chorismate, and TyrA) domain is licensed to transcription factor described (9).
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • BRCA2 Abrogation Triggers Innate Immune Responses Potentiated by Treatment with PARP Inhibitors
    bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. BRCA2 abrogation triggers innate immune responses potentiated by treatment with PARP inhibitors Timo Reisländer1, Emilia Puig Lombardi2,3,*, Florian J. Groelly1,*, Ana Miar4, Manuela Porru5, Benjamin Wright6, Helen Lockstone6, Annamaria Biroccio5, Adrian Harris4, Arturo Londono2,3 and Madalena Tarsounas1 1Genome Stability and Tumourigenesis Group, The CR-UK/MRC Oxford Institute for Radiation Oncology, Department of Oncology, University of Oxford, Old Road Campus Research Building, Oxford OX3 7DQ, U.K. 2Institut Curie, PSL Research University, CNRS, UMR3244, F-75005, Paris, France. 3Sorbonne Universités, UPMC Univ Paris 06, CNRS, UMR3244, F-75005, Paris, France. 4Hypoxia and Angiogenesis Group, Weatherall Institute of Molecular Medicine, Department of Oncology, University of Oxford, Oxford OX3 9DS, U.K. 5Area of Translational Research, IRCCS Regina Elena National Cancer Institute, 00144 Rome, Italy 6Bioinformatics and Statistical Genetics Core, Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford OX3 7BN, U.K. *These authors contributed equally to this study. *Correspondence: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/490268; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Heterozygous germline mutations in BRCA2 predispose to breast and ovarian cancer. Contrary to non-cancerous cells, where BRCA2 deletion causes cell cycle arrest or cell death, BRCA2 inactivation in tumors is associated with uncontrolled cell proliferation.
    [Show full text]
  • Amplification of a Chromatin Remodeling Gene, Rsf-1 HBXAP, In
    Amplification of a chromatin remodeling gene, Rsf-1͞HBXAP, in ovarian carcinoma Ie-Ming Shih*†, Jim Jinn-Chyuan Sheu*, Antonio Santillan*, Kentaro Nakayama*, M. Jim Yen*, Robert E. Bristow*, Russell Vang*, Giovanni Parmigiani*‡, Robert J. Kurman*, Claes G. Trope§, Ben Davidson§, and Tian-Li Wang*† *Departments of Pathology, Gynecology, and Oncology, ‡Department of Biostatistics, The Johns Hopkins University School of Medicine, Baltimore, MD 21231; and §Departments of Pathology and Gynecologic Oncology, Norwegian Radium Hospital, University of Oslo, Montebello, N-0310 Oslo, Norway Edited by Bert Vogelstein, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD, and approved August 15, 2005 (received for review May 20, 2005) A genomewide technology, digital karyotyping, was used to iden- Digital Karyotyping. Carcinoma cells were affinity purified by using tify subchromosomal alterations in ovarian cancer. Amplification magnetic beads conjugated with the Epi-CAM antibody (Dynal, at 11q13.5 was found in three of seven ovarian carcinomas, and Oslo). The purity of tumor cells was confirmed by immunostaining amplicon mapping delineated a 1.8-Mb core of amplification with an anti-cytokeratin antibody, CAM 5.2 (Becton Dickinson, that contained 13 genes. FISH analysis demonstrated amplification San Jose, CA) and samples with greater than 95% epithelial cells of this region in 13.2% of high-grade ovarian carcinomas but not were used in this study. Digital karyotyping library construction and in any of low-grade carcinomas or benign ovarian tumors. Com- data analysis were performed by following the protocol in refs. 2 bined genetic and transcriptome analyses showed that Rsf-1 and 3. Approximately 120,000 genomic tags were obtained for each (HBXAPalpha) was the only gene that demonstrated consistent digital karyotyping library.
    [Show full text]
  • Supplemental Material For: Screen Identifies Bromodomain Protein
    Supplemental Material for: Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination Fade Gong1,2,6, Li-Ya Chiu1,2,6, Ben Cox1,2, François Aymard3,4, Thomas Clouaire3,4, Justin W. Leung1,2, Michael Cammarata5, Mercedes Perez1,2, Poonam Agarwal1,2, Jennifer S. Brodbelt5, Gaëlle Legube3,4 & Kyle. M. Miller1,2,* 1. Supplemental Materials and Methods 2. Supplemental References 3. Supplemental Figure S1-S10 with legends 4. Supplemental Table S1-S3 with legends 1 Supplemental Materials and Methods Plasmid and siRNA transfections Mammalian expression vectors were transfected into U2OS cells by Hilymax (Dojindo) or Fugene HD (Promega) according to manufacturer’s instructions. The I-SceI expressing vector (pCAG-I-SceI) or control vector (pCAG) were transfected into the U2OS DR-GFP cells by Fugene HD (Promega). For HEK293T cells, transient transfections were carried out with pEI (Polyethylenimine, Sigma). Analyses for transient plasmid transfection were performed 24-48 h after transfection. Transfections for siRNA were carried out with lipofectamine RNAiMax (Invitrogen) following the manufacturer’s instructions. Analyses from siRNA treated cells were performed 48-72 h after transfection. The siRNAs used in this study were: siControl: non-targeting pool (Dharmacon); siZMYND8 #1: SMARTpool (Dharmacon); siZMYND8 #2: GGACUUUCCCCUUUUUAUA (targeting the 3’-UTR region of ZMYND8) (Sigma); siZMYND8 #3: GAACAUAGAUGAAUGAAA (Sigma); siCHD4: CCCAGAAGAGGAUUUGUCA (Sigma), siLSD1: GCCUAGACAUUAAACUGAAUA (Sigma); siTIP60 SMARTpool (Dharmacon); siMOF: GCAAAGACCAUAAGAUUUA (Sigma); siCtIP: GGUAAAACAGGAACGAAUC (Sigma); siLigaseIV: AGGAAGUAUUCUCAGGAAUUA (Sigma). Cloning and plasmids 2 cDNAs of human BRD-containing proteins were cloned into the Gateway entry vector pENTR11 by restriction sites, or pDONR201 by attB recombinant sites.
    [Show full text]
  • Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Structure 14, 703–712, April 2006 ª2006 Elsevier Ltd All rights reserved DOI 10.1016/j.str.2006.01.007 Crystal Structure of the HP1-EMSY Complex Reveals an Unusual Mode of HP1 Binding Ying Huang,1 Michael P. Myers,1 and Rui-Ming Xu1,* main (CSD) at the C terminus (Aasland and Stewart, 1 Cold Spring Harbor Laboratory 1995; Eissenberg, 2001; Paro and Hogness, 1991). The Cold Spring Harbor, New York 11724 chromo domain of HP1 specifically recognizes the N-ter- minal tail of histone H3 methylated at lysine-9, which pro- vides a structural basis in support of the ‘‘histone code’’ Summary hypothesis (Bannister et al., 2001; Jacobs and Khorasa- nizadeh, 2002; Jenuwein and Allis, 2001; Lachner et al., Heterochromatin protein-1 (HP1) plays an essential 2001; Nielsen et al., 2002). The CSD is responsible for role in both the assembly of higher-order chromatin HP1 homodimerization and interaction with a number structure and epigenetic inheritance. The C-terminal of nonhistone nuclear proteins (Brasher et al., 2000; chromo shadow domain (CSD) of HP1 is responsible Cowieson et al., 2000; Li et al., 2002; Ye et al., 1997). It for homodimerization and interaction with a number has been demonstrated that the HP1 CSD and the hinge of chromatin-associated nonhistone proteins, includ- region are important for targeting HP1 proteins to spe- ing EMSY, which is a BRCA2-interacting protein that cific genomic loci (Smothers and Henikoff, 2001). has been implicated in the development of breast Various proteins important for chromatin structure and ovarian cancer.
    [Show full text]