A Country in Central Europe Molecular Phylogeny of Insects, Mainly

Total Page:16

File Type:pdf, Size:1020Kb

A Country in Central Europe Molecular Phylogeny of Insects, Mainly Poland - a country in central Europe Molecular phylogeny of insects, mainly Orthoptera Beata Grzywacz JSPS Postdoctoral Fellow University of the Ryukyus, Okinawa 2016 Poland – general information • Located in central Europe • Area: 312 685 km2 • Capital: Warsaw • Population: 38 495 659 (2014) • Official language: Polish • Currency: Polish Złoty PLN • Major religion: Christianity Poland – general information • Vistula (651mi; 1,047 kilometres long) and Oder (480 mi; 772 kilometres long) – the longest rivers • Lake Śniardwy and Lake Mamry in Masuria, Lake Łebsko and Lake Drawsko in Pomerania – the largest lakes • Polish Tatras – the highest mountain group of Poland • Beskids - the second highest mountain group in Poland • Bieszczady mountains Poland - Phylogeography Wisent in the ancient woodland of the Białowieża Forest and in Podlaskie Brown bear in Białowieża, in the Tatras, and in the Beskids The gray wolf and the Eurasian lynx in various forests The moose in northern Poland The beaver in Masuria, Pomerania and Podlaskie Red deer, roe deer and wild boars Migratory birds Famous Polish People Fryderyk Chopin Marie Skłodowska-Curie Nicolaus Copernicus pianist, composer physicist (1867-1934) astronomer, scientist, (1810-1849) mathematician (1473-1543) John Paul II Lech Wałęsa pope (1920-2005) president, activist (1943 -) Polish inventions Hand-held mine detector Cloth armor Colorful photo Mine detector Helicopter Car wiper Grafen Kerosene lamp Melex Walkie-talkie Polish Nobel Prize Lauerates 1903 Maria Skłodowska-Curie - Physics 1905 Henryk Sienkiewicz - Literature 1911 Maria Skłodowska-Curie - Chemistry 1924 Władysław Reymont - Literature 1980 Czesław Miłosz - Literature 1983 Lech Wałęsa - Peace 1996 Wisława Szymborska - Literature Polish Architecture Wawel Royal Castle and The Manggha Centre Catedral in Krakow The Palace of Culture of Japanese Art and and Science in Warsaw Technology in Krakow Wieliczka Royal Salt Centennial Hall in Wrocław Great Armory building Mine in Gdańsk The Polish national dishes Bigos Sausage Broth (variety of meat broth) Gołąbki (type of cabbage roll) Dumplings Tomato soup Pork chop (type of breaded cutlet) Żurek (sour rye soup) Cucumber soup Polish products White cheese Marshmallow Oscypek Prince Polo Fudges Krosno Stylish glass Bagels My Institute Name: Institute of Systematics and Evolution of Animals Polish Academy of Sciences, Krakow Funded: 1989 Department: Experimental Zoology Why I choose to be a scientist? I really enjoyed science at school. I am interested in the world we live in. The opportunity to discover something new is also really exciting. I’d definitely recommend it. Studies insects ? Orthoptera • Grasshoppers, locusts, crickets, katydids • Long bodies • Rear legs modified for jumping • Females with egg laying tube (ovipositor on end of abdomen) • Often communicate with chirping sounds Orthoptera Introduction ? Peculiarities of the group • morphologic simplicity in genitalia, tegminal venation and cercus shape • often high number of sibling taxa with restricted ranges • recent origin Lepthophyes sp., fot Oldbilluk Methodological problems arise • insufficient knowledge on the taxonomically important characters • uninformative descriptions based on subtle differences • overstating the isolation significance M. ornatus, fot. V. Hanzlík • working into national borders Theoretical problems arise • taxa with doubtful status described • unclear phylogenetic relationships between the taxa B. constrictus, fot. P. Schlemmer Why is phylogeny important? Understanding and classifying the diversity of life on Earth. Testing evolutionary hypotheses: - trait evolution - coevolution - mode and pattern of speciation - correlated trait evolution - biogeography - geographic origins - age of different taxa - nature of molecular evolution - disease epidemiology …and many more applications! Molecular methods AAGCTTCATAGGAGCAACCATTCTAATAATAAGCCTCATAAAGCC 3. Align AAGCTTCACCGGCGCAGTTATCCTCATAATATGCCTCATAATGCC 1. Extract 2. Sequence (e.g. 18S and internal transcribed spacer 2 - ITS2) DNA What is DNA? DNA (dexyribonucleic acid) contains the biological instructions that make each species unique. What is DNA made? DNA is made of three parts: a phosphate group, a sugar group and one of four types of nitrogen bases). What does DNA do? DNA contains instructions needed for an organism to develop, survive and reproduce. How to extract DNA from animal tissue in laboratory? PCR and sequencing Molecular data vs Morphology Strictly heritable entities Can be influenced by environmental factors Data is unambiguous Ambiguous modifiers: “reduced”, “slightly elongated”, “somewhat flattened” Regular & predictable evolution Unpredictable evolution Ease of homology assesment Homology difficult to assess Relationship of distantly related Only close relationships organisms can be inffered can be confidently inffered Why such studies are important? preparing key to help recognize insects and distribution maps taxa have been synonimized a revision of the orthoptran taxonomy new taxa have been investigated Let’s do the experiment! Add of DNA extracting solution Strawberry DNA Place one starwberry extraction in a plastic zipper-lock bag DNA Place a piece of gauze over the opening. Of the Add a dropper full of the cup, securing with a rubber band. Carefully pour alcohol to the test tube. the starwberry mixture into the cup. Do not mix the liquids. Appreciation to JSPS for giving me this great opportunity to my supervisor, Haruki Tatsuta for his continued assistance, cooperation and support to the Science Dialogue Coordinator for making all necessary arrangement to make this day reality to my wonderful audience – The Students! Arigato gozaimasu!!! .
Recommended publications
  • Miłosz - Gombrowicz - Brzozowski
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE Title: Wobec Sienkiewicza : Miłosz - Gombrowicz - Brzozowski Author: Anna Szawerna-Dyrszka Szawerna-Dyrszka Anna. (2013). Wobec Sienkiewicza : Citation style: Miłosz - Gombrowicz - Brzozowski. W: E. Bartos, M. Tomczok (red.), "Literatura popularna. T. 1, Dyskursy wielorakie" (S. 137-148). Katowice : Wydawnictwo Uniwersytetu Śląskiego Anna Szawerna-Dyrszka Uniwersytet Śląski Wobec Sienkiewicza Miłosz – Gombrowicz – Brzozowski Bardzo proszę pamiętać, że ja byłem przeciw A. Słonimski Chronologicznie rzecz ujmując, zaczynam od końca, czyli od roku 1969, w którym Czesław Miłosz publikuje w paryskiej „Kulturze” szkic poświęcony Henrykowi Sienkiewiczowi1. Szkic miał być recenzją wy- danej w 1967 roku w Londynie książki zbiorowej Sienkiewicz żywy2. Okazał się jednak czymś więcej: Proszono mnie już dawno, żebym napisał recenzję z tej książki – pisze Miłosz. – Wzbraniałem się, bo kiedy zaczyna się mówić o Sien- kiewiczu, nie sposób nie poruszyć pewnych spraw zasadniczych. Natomiast sprawy zasadnicze warto poruszać, tylko jeżeli ma się nadzieję kogoś przekonać, co, zważywszy na obecny stan polskich 1 Cz. Miłosz: Sienkiewicz, Homer i Gnębon Puczymorda. „Kultura” 1969, nr 1–2. Przedruk w książce Prywatne obowiązki. Paryż 1972. Cytuję za wydaniem: Cz. Miłosz: Sienkiewicz, Homer i Gnębon Puczymorda. W: Idem: Prywatne obowiązki. Kraków 2001, s. 136–149. Dalej tytuł tego szkicu oznaczam skrótem SH. Po cytatach w nawiasach po- daję numery stron. Refleksję nad tym, „po co wielkim Sienkiewicz”, zawdzięczam Józefowi Olejnicza- kowi, który po wysłuchaniu mego referatu Sienkiewicz Miłosza, wygłoszonego w Wilnie podczas konferencji w stulecie urodzin poety, zauważył, że Sienkiewicz pojawia się jako istotny punkt odniesienia u wielu wybitnych twórców. Fragment artykułu do- tyczący Miłosza odsyła do tekstu Sienkiewicz Miłosza opublikowanego w mej książce Bliższe i dalsze okolice Miłosza.
    [Show full text]
  • Numbers and Distribution
    Numbers and distribution The brown bear used to occur throughout the whole Europe. In the beginning of XIX century its range in Poland had already contracted and was limited to the Carpathians, the Białowieża Forest, the currently non-existent Łódzka Forest and to Kielce region (Jakubiec and Buchalczyk 1987). After World War I bears occurred only in the Eastern Carpathians. In the 1950’ the brown bears was found only in the Tatra Mountains and the Bieszczady Mountains and its population size was estimated at 10-14 individuals only (Buchalczyk 1980). In the following years a slow population increase was observed in the Polish Carpathians. Currently the brown bear’s range in Poland is limited to the Carpathians and stretches along the Polish-Slovak border. Occasional observations are made in the Sudetes where one migrating individual was recorded in the 1990’ (Jakubiec 1995). The total range of the brown bear in Poland is estimated at 5400-6500 km2. The area available for bears based on the predicative model for the habitat is much larger and may reach 68 700km2 (within which approx. 29000 km2 offers suitable breeding sites) (Fernández et al. 2012). Currently experts estimate the numbers of bears in Poland at merely 95 individuals. There are 3 main area of bear occurrence: 1. the Bieszczady Mountains, the Low Beskids, The Sącz Beskids and the Gorce Mountains, 2. the Tatra Mountains, 3. the Silesian Beskids and the Żywiec Beskids. It must be noted, however, that bears only breed in the Bieszczady Mountains, the Tatra Mountains and in the Żywiec Beskids. Poland is the north limit range of the Carpathian population (Swenson et al.
    [Show full text]
  • Settlement History and Sustainability in the Carpathians in the Eighteenth and Nineteenth Centuries
    Munich Personal RePEc Archive Settlement history and sustainability in the Carpathians in the eighteenth and nineteenth centuries Turnock, David Geography Department, The University, Leicester 21 June 2005 Online at https://mpra.ub.uni-muenchen.de/26955/ MPRA Paper No. 26955, posted 24 Nov 2010 20:24 UTC Review of Historical Geography and Toponomastics, vol. I, no.1, 2006, pp 31-60 SETTLEMENT HISTORY AND SUSTAINABILITY IN THE CARPATHIANS IN THE EIGHTEENTH AND NINETEENTH CENTURIES David TURNOCK* ∗ Geography Department, The University Leicester LE1 7RH, U.K. Abstract: As part of a historical study of the Carpathian ecoregion, to identify salient features of the changing human geography, this paper deals with the 18th and 19th centuries when there was a large measure political unity arising from the expansion of the Habsburg Empire. In addition to a growth of population, economic expansion - particularly in the railway age - greatly increased pressure on resources: evident through peasant colonisation of high mountain surfaces (as in the Apuseni Mountains) as well as industrial growth most evident in a number of metallurgical centres and the logging activity following the railway alignments through spruce-fir forests. Spa tourism is examined and particular reference is made to the pastoral economy of the Sibiu area nourished by long-wave transhumance until more stringent frontier controls gave rise to a measure of diversification and resettlement. It is evident that ecological risk increased, with some awareness of the need for conservation, although substantial innovations did not occur until after the First World War Rezumat: Ca parte componentă a unui studiu asupra ecoregiunii carpatice, pentru a identifica unele caracteristici privitoare la transformările din domeniul geografiei umane, acest articol se referă la secolele XVIII şi XIX când au existat măsuri politice unitare ale unui Imperiu Habsburgic aflat în expansiune.
    [Show full text]
  • Teaching the Short Story: a Guide to Using Stories from Around the World. INSTITUTION National Council of Teachers of English, Urbana
    DOCUMENT RESUME ED 397 453 CS 215 435 AUTHOR Neumann, Bonnie H., Ed.; McDonnell, Helen M., Ed. TITLE Teaching the Short Story: A Guide to Using Stories from around the World. INSTITUTION National Council of Teachers of English, Urbana, REPORT NO ISBN-0-8141-1947-6 PUB DATE 96 NOTE 311p. AVAILABLE FROM National Council of Teachers of English, 1111 W. Kenyon Road, Urbana, IL 61801-1096 (Stock No. 19476: $15.95 members, $21.95 nonmembers). PUB 'TYPE Guides Classroom Use Teaching Guides (For Teacher) (052) Collected Works General (020) Books (010) EDRS PRICE MF01/PC13 Plus Postage. DESCRIPTORS Authors; Higher Education; High Schools; *Literary Criticism; Literary Devices; *Literature Appreciation; Multicultural Education; *Short Stories; *World Literature IDENTIFIERS *Comparative Literature; *Literature in Translation; Response to Literature ABSTRACT An innovative and practical resource for teachers looking to move beyond English and American works, this book explores 175 highly teachable short stories from nearly 50 countries, highlighting the work of recognized authors from practically every continent, authors such as Chinua Achebe, Anita Desai, Nadine Gordimer, Milan Kundera, Isak Dinesen, Octavio Paz, Jorge Amado, and Yukio Mishima. The stories in the book were selected and annotated by experienced teachers, and include information about the author, a synopsis of the story, and comparisons to frequently anthologized stories and readily available literary and artistic works. Also provided are six practical indexes, including those'that help teachers select short stories by title, country of origin, English-languag- source, comparison by themes, or comparison by literary devices. The final index, the cross-reference index, summarizes all the comparative material cited within the book,with the titles of annotated books appearing in capital letters.
    [Show full text]
  • The Species Composition on Agricultural Terraces in Nw Part of Slovakia
    Ekológia (Bratislava) Vol. 33, No. 4, p. 307–320, 2014 doi:10.2478/eko-2014-0029 THE SPECIES COMPOSITION ON AGRICULTURAL TERRACES IN NW PART OF SLOVAKIA IVA MACHOVÁ, KAREL KUBÁT Jan Evangelista Purkyně University in Ústí nad Labem, Faculty of Environment, Králova výšina 7, 400 96 Ústí nad Labem, Czech Republic; e-mail: [email protected] Jan Evangelista Purkyně University in Ústí nad Labem, Faculty of Science, Za Válcovnou 8, 400 96 Ústí nad Labem, Czech Republic; e-mail: [email protected] Abstract Machová I., Kubát K.: The species composition on agricultural terraces in NW part of Slovakia. Ekológia (Bratislava), Vol. 33, No. 4, p. 307–320, 2014. The article contributes to a deeper understanding of agricultural terraces in NW Slovakia. The agri- cultural terraces found in 12 mountain ranges were characterised in detail on 32 localities. The slope parts of the studied terraces are on average only 2.3 m wide and current and former agricultural areas between them are on average 11 m wide. Furthermore, seventy phytosociological relevés were made on the terraces. Overall, 360 species of vascular plants were found in the relevés, 66 of which appeared regularly. The localities were evaluated by DCA analysis. The main factor influencing the species com- position appears to be the geological composition of the bedrock and, probably, the altitude as well. High coverage of the herb layer (median value 95%), low coverage of the shrub layer (median value 5%) and the absence or a very low coverage of the tree layer is typical for these terraces. Key words: NW Slovakia, agricultural terraces, vascular plants species, properties of the terraces.
    [Show full text]
  • Volume XVII, No. 12 31 December 2016
    Volume XVII, No. 12 31 December 2016 ISSN 1555-774X. Copyright © 2016, PolishRoots®, Inc. Editor: William F. “Fred” Hoffman, e-mail: [email protected]< > CONTENTS A Bio of Władysław Reymont (1867–1925) Letters to the Editor Supplementary Information to “Online Research in the Austro-Hungarian Empire and Nearby” Stanley Diamond Has Been Awarded the Meritorious Service Medal of Canada Contribute to a Polish Genealogical Society! An Overview of Recent Periodicals Upcoming Events More Useful Web Addresses You May Reprint Articles... *************************************** *** WELCOME! *** to the latest issue of Gen Dobry!, the e-zine of PolishRoots®. If you missed previous issues, you can find them here: <http://polishroots.org/GenDobry/tabid/60/Default.aspx> *************************************** Gen Dobry!, Vol. XVII, No. 12, December 2016 — 1 *** A BIO OF WŁADYSŁAW REYMONT (1867–1925) *** by Oliver W. Clemons, Jr. Editor—Oliver very kindly sent me two items for publication, one of which appeared in the November 2016 issue of Gen Dobry! It was a reprint of a 1923 article “The Polish Peasant” from the American Catholic Quarterly Review. This article was written by Mr. Clemons himself, and provides a brief biography of the great Polish writer, Władysław Stanisław Reymont. One might ask how this relates to Polish genealogy; but over the years, I have often seen researchers of Polish genealogy praise Reymont’s best-known work, Chłopi or The Peasants, as a wonderful story that gave them valuable insights into the lives of their ancestors. So I think many of our readers may find this information interesting. I should mention that different years of publication are often cited for Reymont’s works.
    [Show full text]
  • Premio Nobel Per La Letteratura
    Premio Nobel per la letteratura Bibliografia A cura della Biblioteca Cantonale di Bellinzona Novembre 2017 Il 5 ottobre 2017 Kazuo Ishiguro ha vinto il Premio Nobel per la letteratura. E’ stata l’occasione per scoprire o ri-scoprire questo importante scrittore inglese di origine giapponese. Ma quali sono gli scrittori premiati in questi anni? Dal 1901 ogni anno un autore viene onorato con questo significativo premio. Proponiamo con questa bibliografia le opere di scrittori vincitori del Premio Nobel, presenti nel fondo della Biblioteca cantonale di Bellinzona, e nel caso in cui la biblioteca non possedesse alcun titolo di un autore, le opere presenti nel catalogo del Sistema bibliotecario ticinese. Gli autori sono elencati cronologicamente decrescente a partire dall’anno in cui hanno vinto il premio. Per ogni autore è indicato il link che rinvia al catalogo del Sistema bibliotecario ticinese. 2017 Kazuo Ishiguro 2016 Bob Dylan 2015 Svjatlana Aleksievič 2014 Patrick Modiano 2013 Alice Munro 2012 Mo Yan 2011 Tomas Tranströmer 2010 Mario Vargas Llosa 2009 Herta Müller 2008 Jean-Marie Gustave Le Clézio 2007 Doris Lessing 2006 Orhan Pamuk 2005 Harold Pinter 2004 Elfriede Jelinek 2003 John Maxwell Coetzee 2002 Imre Kertész 2001 Vidiadhar Surajprasad Naipaul 2000 Gao Xingjian 1999 Günter Grass 1998 José Saramago 1997 Dario Fo 1996 Wisława Szymborska 1995 Séamus Heaney 1994 Kenzaburō Ōe 1993 Toni Morrison 1992 Derek Walcott 1991 Nadine Gordimer 1990 Octavio Paz 1989 Camilo José Cela 1988 Naguib Mahfouz 1987 Iosif Aleksandrovič Brodskij 1986 Wole
    [Show full text]
  • (HRS4R) at the University of Warsaw – Positive Developments and Impact
    Implementation of Human Resources Strategy for Researchers (HRS4R) at the University of Warsaw – positive developments and impact Diana Pustuła Head Office for International Research & Liaison UNICA EURLO GROUP HRS4R Seminar 6.05.2021 WARSAW – AN ACADEMIC CITY . 1.7 million inhabitants . 15 public Higher Education Institutions (HEIs) . 240 000 students per year . Warsaw and the region of Mazovia are most often chosen by international students coming to Poland: 30% of all foreigners coming to Polish academies study here. UW– FACTS AND FIGURES - HRS4R put into scale . The University of Warsaw was founded in 1816. 43 thousand students and PhD candidates . 7.5 thousand employees of which over 3.8 thousand academic staff . 24 departments, 30 extra-departmental academic and research units . 800 international partners . 1600 running research projects a year . University graduates have won 6 Nobel Prize awards: . Nobel Prize in Literature: Henryk Sienkiewicz, Czesław Miłosz, Olga Tokarczuk . Nobel Peace Prize: Menachem Begin, Joseph Rotblat . Nobel Prize in Economic Sciences: Leonid Hurwicz Towards the HR Excellence in Research award Our motivation and first actions taken: • The University C&C Committee • 14.07.2014 - Rector appointed the is headed by the Vice-Rector for members of the special Univerity Human Resources Committee for the implementation of the principles of the European Charter& • The C&C Committee: Code ; • Representatives of the researchers and PhD students GOAL: Continuous progress on the • The representatives of the central development of the revised HRS4R and administration: the implementation of the principles of the Vice –Chancellors for Finance/IT, C&C translating into providing friendly • Deputy Head of the Human Resources working conditions and environment to Office , all researchers for the benefit of the • Deputy Head of the Research Services whole University community.
    [Show full text]
  • Contemporary Geomorphic Processes in the Polish Carpathians Under Changing Human Impact
    21 by Adam Lajczak1, Wlodzimierz Margielewski2, Zofia Raczkowska3 Jolanta Swiechowicz4 Contemporary geomorphic processes in the Polish Carpathians under changing human impact 1 Pedagogical University, Institute of Geography, 2 Podchorazych Str., 30-084 Cracow, Poland. E-mail: [email protected] 2 Polish Academy of Sciences, Institute of Nature Conservation, 33 A. Mickiewicza Ave., 31-120 Cracow, Poland 3 Polish Academy of Sciences, Institute of Geography and Spatial Organization, 22 Sw. Jana Str., Cracow, Poland 4 Jagiellonian University in Krakow, Institute of Geography and Spatial Management, 7 Gronostajowa Str., 30-387 Cracow, Poland The paper presents activity of contemporary The Polish Carpathians are relatively densely populated (127 2 geomorphic processes in the Polish Carpathians, taking persons/km ), and more than 65% of the population live in rural areas (Dlugosz and Soja, 1995). For this reason man exerts a strong into account human impact on relief transformation in influence on the course of geomorphic processes, but recent processes the past several centuries. and their effects also pose a threat to man. According to Slaymaker Landsliding in the flysch Carpathians is a principal (2010), human activity is a key driver in present-day landscape process in slope transformation, posing the most serious evolution in mountain areas. threat to man, both in the mountains and the foothills. The aim of this paper is to present such mutual relationships within areas showing four types of relief, indicating the most important On the other hand, unsuitable housing on slopes initiates process, type of geomorphic hazard and type and effect of human mass movements, frequently with catastrophic influence on relief transformation, as well as tendencies in these consequences.
    [Show full text]
  • Czesław Miłosz (1980), Wisława Szymborska (1996)
    Reference 1: The four Polish Nobel Awarded writers: Henryk Sienkiewicz (1905), Władysław Reymont (1924), Czesław Miłosz (1980), Wisława Szymborska (1996). Reference 2: Czesław Miłosz, “Polish literature focused more on drama and the poetic expression of the self than on fiction (which dominated the English-speaking world). The reasons find their roots on the historical circumstances of the nation.” Reference 3: - Rational periods (knowledge): Antiquity, Renaissance (1500-1620), Age of Enlightenment (1770-1822), Positivism (1864- 1900), Inter-war period (1918-1939) - Irrational periods (beliefs and feelings): Middle-Ages (966- 1499), Baroque (1620-1764), Romanticism (1822-1864), Young Poland (1900-1914). Reference 4: Gallus Anonymus, Cronica et gesta ducum sive principum Polonorum (The Acts of the Princes of the Polish people) Reference 5: Bogurodzica (God’s mother), a hymn to the glory of Virgin Mary, written down in the 15th century. Reference 6: Mikołaj Rej or Mikołaj Rey of Nagłowice (February 4, 1505–between September 8 and October 5, 1569) was a leading Polish poet and prose writer of the Renaissance, as well as a politician and musician. He was the first Polish author to write exclusively in the Polish language, and is considered (with Biernat of Lublin and Jan Kochanowski), to be one of the founders of Polish literary language and literature Reference 6: The Polish Baroque’s literature began in 1620 and ended in 1764. Reference 7: The Polish Age of Enlightenment began around 1770 and reached its apotheosis during the second half of the 18th century under the reign of the last king of Poland, Stanisław August Poniatowski. It ended in 1822.
    [Show full text]
  • Nobel Prize in Literature Winning Authors 2020
    NOBEL PRIZE IN LITERATURE WINNING AUTHORS 2020 – Louise Gluck Title: MEADOWLANDS Original Date: 1996 DB 43058 Title: POEMS 1962-2012 Original Date: 2012 DB 79850 Title: TRIUMPH OF ACHILLES Original Date: 1985 BR 06473 Title: WILD IRIS Original Date: 1992 DB 37600 2019 – Olga Tokarczuk Title: DRIVE YOUR PLOW OVER THE BONES OF THE DEAD Original Date: 2009 DB 96156 Title: FLIGHTS Original Date: 2017 DB 92242 2019 – Peter Handke English Titles Title: A sorrow beyond dreams: a life story Original Date: 1975 BRJ 00848 (Request via ILL) German Titles Title: Der kurze Brief zum langen Abschied 10/2017 NOBEL PRIZE IN LITERATURE WINNING AUTHORS Original Date: 1972 BRF 00716 (Request from foreign language collection) 2018 – No prize awarded 2017 – Kazuo Ishiguro Title: BURIED GIANT Original Date: 2015 BR 20746 /DB 80886 Title: NEVER LET ME GO Original Date: 2005 BR 21107 / DB 59667 Title: NOCTURNES: FIVE STORIES OF MUSIC AND NIGHTFALL Original Date: 2009 DB 71863 Title: REMAINS OF THE DAY Original Date: 1989 BR 20842 / DB 30751 Title: UNCONSOLED Original Date: 1995 DB 41420 BARD Title: WHEN WE WERE ORPHANS Original Date: 2000 DB 50876 2016 – Bob Dylan Title: CHRONICLES, VOLUME 1 Original Date: 2004 BR 15792 / DB 59429 BARD 10/2017 NOBEL PRIZE IN LITERATURE WINNING AUTHORS Title: LYRICS, 1962-2001 Original Date: 2004 BR 15916 /DB 60150 BARD 2015 – Svetlana Alexievich (no books in the collection by this author) 2014 – Patrick Modiano Title: DORA BRUDER Original Date: 1999 DB 80920 Title: SUSPENDED SENTENCES: THREE NOVELLAS Original Date: 2014 BR 20705
    [Show full text]
  • Gustav Von Aschenbach╎s Journey Towards The
    Czytanie Literatury https://doi.org/10.18778/2299-7458.09.06 Łódzkie Studia Literaturoznawcze 9/2020 ISSN 2299–7458 ANNA SIERADZAN e-ISSN 2449–8386 University of Warsaw 0000-0001-7615-2447 139 Co N te M po rar Contemporary Icarus: I y Gustav von Aschenbach’s Journey carus … towards the Sun SUMMARY The point of departure for the reflections contained in this article is the motif of the sun in Tomasz Mann’s Death in Venice. Analysing the presence of the sun in the work turns out to be fruitful for distinguishing and connecting several symbolic planes, on which the issues of Death in Venice and the drama of the main character are depicted: the relationship between contemporary times and antiquity, the cultu- ral North-South axis, the destructive power of beauty as well as the individual fate of the artist marked by decadence. The figure of the sun seems to provide material for the interpretation of the figure of Gustav von Aschenbach as an incarnation of contemporary Icarus and allows the reader to see the path which the protagonist of Death in Venice follows in a new light. Keywords Venice, Mann, sun, mythology, love, decadence, novella Death in Venice by Thomas Mann belongs among the masterpieces of Euro- pean literature and as such has been the subject of a considerable number of analyses, studies and interpretations. The work itself encourages such ac- tions: it contains many symbols, metaphors and allusions, which sometimes allow researchers to obtain coherent findings and sometimes make them arrive at contradictory conclusions. Moreover, due to these voices, which enrich the discourse on the reception of the work, the discussion around the novella written in 1911 remains vivid to this day, and the reading of the work may still bring interesting reflections.
    [Show full text]