A Country in Central Europe Molecular Phylogeny of Insects, Mainly

A Country in Central Europe Molecular Phylogeny of Insects, Mainly

Poland - a country in central Europe Molecular phylogeny of insects, mainly Orthoptera Beata Grzywacz JSPS Postdoctoral Fellow University of the Ryukyus, Okinawa 2016 Poland – general information • Located in central Europe • Area: 312 685 km2 • Capital: Warsaw • Population: 38 495 659 (2014) • Official language: Polish • Currency: Polish Złoty PLN • Major religion: Christianity Poland – general information • Vistula (651mi; 1,047 kilometres long) and Oder (480 mi; 772 kilometres long) – the longest rivers • Lake Śniardwy and Lake Mamry in Masuria, Lake Łebsko and Lake Drawsko in Pomerania – the largest lakes • Polish Tatras – the highest mountain group of Poland • Beskids - the second highest mountain group in Poland • Bieszczady mountains Poland - Phylogeography Wisent in the ancient woodland of the Białowieża Forest and in Podlaskie Brown bear in Białowieża, in the Tatras, and in the Beskids The gray wolf and the Eurasian lynx in various forests The moose in northern Poland The beaver in Masuria, Pomerania and Podlaskie Red deer, roe deer and wild boars Migratory birds Famous Polish People Fryderyk Chopin Marie Skłodowska-Curie Nicolaus Copernicus pianist, composer physicist (1867-1934) astronomer, scientist, (1810-1849) mathematician (1473-1543) John Paul II Lech Wałęsa pope (1920-2005) president, activist (1943 -) Polish inventions Hand-held mine detector Cloth armor Colorful photo Mine detector Helicopter Car wiper Grafen Kerosene lamp Melex Walkie-talkie Polish Nobel Prize Lauerates 1903 Maria Skłodowska-Curie - Physics 1905 Henryk Sienkiewicz - Literature 1911 Maria Skłodowska-Curie - Chemistry 1924 Władysław Reymont - Literature 1980 Czesław Miłosz - Literature 1983 Lech Wałęsa - Peace 1996 Wisława Szymborska - Literature Polish Architecture Wawel Royal Castle and The Manggha Centre Catedral in Krakow The Palace of Culture of Japanese Art and and Science in Warsaw Technology in Krakow Wieliczka Royal Salt Centennial Hall in Wrocław Great Armory building Mine in Gdańsk The Polish national dishes Bigos Sausage Broth (variety of meat broth) Gołąbki (type of cabbage roll) Dumplings Tomato soup Pork chop (type of breaded cutlet) Żurek (sour rye soup) Cucumber soup Polish products White cheese Marshmallow Oscypek Prince Polo Fudges Krosno Stylish glass Bagels My Institute Name: Institute of Systematics and Evolution of Animals Polish Academy of Sciences, Krakow Funded: 1989 Department: Experimental Zoology Why I choose to be a scientist? I really enjoyed science at school. I am interested in the world we live in. The opportunity to discover something new is also really exciting. I’d definitely recommend it. Studies insects ? Orthoptera • Grasshoppers, locusts, crickets, katydids • Long bodies • Rear legs modified for jumping • Females with egg laying tube (ovipositor on end of abdomen) • Often communicate with chirping sounds Orthoptera Introduction ? Peculiarities of the group • morphologic simplicity in genitalia, tegminal venation and cercus shape • often high number of sibling taxa with restricted ranges • recent origin Lepthophyes sp., fot Oldbilluk Methodological problems arise • insufficient knowledge on the taxonomically important characters • uninformative descriptions based on subtle differences • overstating the isolation significance M. ornatus, fot. V. Hanzlík • working into national borders Theoretical problems arise • taxa with doubtful status described • unclear phylogenetic relationships between the taxa B. constrictus, fot. P. Schlemmer Why is phylogeny important? Understanding and classifying the diversity of life on Earth. Testing evolutionary hypotheses: - trait evolution - coevolution - mode and pattern of speciation - correlated trait evolution - biogeography - geographic origins - age of different taxa - nature of molecular evolution - disease epidemiology …and many more applications! Molecular methods AAGCTTCATAGGAGCAACCATTCTAATAATAAGCCTCATAAAGCC 3. Align AAGCTTCACCGGCGCAGTTATCCTCATAATATGCCTCATAATGCC 1. Extract 2. Sequence (e.g. 18S and internal transcribed spacer 2 - ITS2) DNA What is DNA? DNA (dexyribonucleic acid) contains the biological instructions that make each species unique. What is DNA made? DNA is made of three parts: a phosphate group, a sugar group and one of four types of nitrogen bases). What does DNA do? DNA contains instructions needed for an organism to develop, survive and reproduce. How to extract DNA from animal tissue in laboratory? PCR and sequencing Molecular data vs Morphology Strictly heritable entities Can be influenced by environmental factors Data is unambiguous Ambiguous modifiers: “reduced”, “slightly elongated”, “somewhat flattened” Regular & predictable evolution Unpredictable evolution Ease of homology assesment Homology difficult to assess Relationship of distantly related Only close relationships organisms can be inffered can be confidently inffered Why such studies are important? preparing key to help recognize insects and distribution maps taxa have been synonimized a revision of the orthoptran taxonomy new taxa have been investigated Let’s do the experiment! Add of DNA extracting solution Strawberry DNA Place one starwberry extraction in a plastic zipper-lock bag DNA Place a piece of gauze over the opening. Of the Add a dropper full of the cup, securing with a rubber band. Carefully pour alcohol to the test tube. the starwberry mixture into the cup. Do not mix the liquids. Appreciation to JSPS for giving me this great opportunity to my supervisor, Haruki Tatsuta for his continued assistance, cooperation and support to the Science Dialogue Coordinator for making all necessary arrangement to make this day reality to my wonderful audience – The Students! Arigato gozaimasu!!! .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    26 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us