METAGENOMICS AND METATRANSCRIPTOMICS OF LAKE ERIE ICE

Opeoluwa F. Iwaloye

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE

August 2021

Committee:

Scott Rogers, Advisor

Paul Morris

Vipaporn Phuntumart

© 2021

Opeoluwa Iwaloye

All Rights Reserved iii

ABSTRACT

Scott Rogers,

Lake Erie is one of the five Laurentian Great Lakes, that includes three basins. The central basin is the largest, with a mean volume of 305 km2, covering an area of 16,138 km2. The ice used for this research was collected from the central basin in the winter of 2010. DNA and

RNA were extracted from this ice. cDNA was synthesized from the extracted RNA, followed by the ligation of EcoRI (NotI) adapters onto the ends of the nucleic acids. These were subjected to fractionation, and the resulting nucleic acids were amplified by PCR with EcoRI (NotI) primers.

The resulting amplified nucleic acids were subject to PCR amplification using 454 primers, and then were sequenced. The sequences were analyzed using BLAST, and taxonomic affiliations were determined. Information about the taxonomic affiliations, important metabolic capabilities, habitat, and special functions were compiled.

With a watershed of 78,000 km2, Lake Erie is used for agricultural, forest, recreational, transportation, and industrial purposes. Among the five great lakes, it has the largest input from human activities, has a long history of eutrophication, and serves as a water source for millions of people. These anthropogenic activities have significant influences on the biological community. Multiple studies have found diverse microbial communities in Lake Erie water and sediments, including large numbers of species from the Verrucomicrobia, Proteobacteria,

Bacteroidetes, and Cyanobacteria, as well as a diverse set of eukaryotic taxa. Sequences obtained from the metagenomic, and transcriptomic analyses match diverse organisms from thirty-two bacterial, two archaeal, and eight eukaryotic phyla. Some of the organisms found were capable of nitrogen, carbon, iron, sulfur, and hydrocarbon metabolism. Sequences from pathogenic and toxin-producing organisms were found. Organisms associated with several iv human activities, including pollution, agriculture, cultivation, manufacturing, shipping, and other activities were found. These results suggest that the ice contains a large diversity of organisms that are indicative of the diverse biological and anthropogenic influences in and around Lake

Erie. The results also showed that the lake ice contains a considerable number of cyanobacterial sequences, which often are in low concentrations in the lake water during winter.

v

ACKNOWLEDGMENTS

I would like to express my heartfelt gratitude to my advisor, Dr. Scott Rogers, for his support, mentorship, and guidance through the course of this research. Also, I am grateful for his consistent input, suggestions, time, and responsiveness to my questions while writing this thesis.

I am thankful to my thesis committee members, Dr. Paul Morris and Dr. Vipaporn

Phuntumart for their time and advise that greatly contributed to the success of my thesis project.

I thank the previous members of the Rogers lab who have worked assiduously on this project.

Their contribution to this project is greatly appreciated, they include Dr. Zeynep Kocer, Dr. Yury

Shtarkman and Brenna Michaud. I would like to the current members of the Rogers lab, they include Tessa Alloy and Sri Devan Appasamy who have contributed to this project in multiple ways. I am grateful to Dr. George Bullerjahn, Dr. Nigel D’Souza and Dr. Robert McKay for their help in the collection of the sample used in this project.

Finally, I am grateful to the Department of Biological Sciences, Bowling Green State

University for their support throughout my graduate education.

vi

TABLE OF CONTENTS Page

CHAPTER I. INTRODUCTORY REVIEW ...... 1

Lake Erie ...... 1

Life in Lake Erie under ice ...... 2

Microbial metabolism under ice conditions ...... 2

Human activities around Lake Erie ...... 5

Ice drilling/sample collection ...... 6

Ultracentrifugation ...... 6

RNA and DNA extraction ...... 7

cDNA synthesis ...... 7

Polymerase chain reaction ...... 9

454 pyrosequencing ...... 10

Basic local alignment search tool ...... 12

Curation of data (Python and Biopython) ...... 13

Chapter i references ...... 14

CHAPTER II. ORGANISMS DIVERSITY IN LAKE ERIE ...... 24

Lake Erie ...... 24

Metabolic activities in lake ice ...... 24

Previous research ...... 25

Purpose of research ...... 26

Materials and methods ...... 27

Sample preparation ...... 27

DNA/RNA extraction ...... 28 vii

cDNA synthesis ...... 28

Sequence analysis ...... 29

Taxonomic proportions ...... 29

Metabolic classifications ...... 29

Comparison with previous Lake Erie water study ...... 30

Results and discussion ...... 30

Result summary ...... 30

Summary of organisms ...... 39

Archaea ...... 39

Bacteria ...... 39

Extremophiles ...... 41

Cyanobacteria ...... 43

Cellulolytic bacteria ...... 44

Oil/hydrocarbon degrader ...... 45

Pathogens ...... 45

Human pathogens...... 46

Pathogenic in animals ...... 46

Pathogenic in plants ...... 47

Comparison of the bacterial community with Lake Erie water study ...... 48

Eukaryotes...... 48

SAR (stramenopiles, alveolates and rhizaria) ...... 49

Fungi ...... 54

viii

Arthropods ...... 56

Chordata ...... 57

Human activities associated with organisms found in Lake Erie ...... 58

Metabolic analysis ...... 58

Methanogenesis...... 59

Methylotrophy...... 60

Nitrogen fixation ...... 62

Anaerobic ammonium oxidation...... 64

Ammonia oxidation ...... 65

Nitrite oxidizing bacteria ...... 66

Denitrifying bacteria ...... 67

Sulfur metabolism ...... 68

Other notable metabolic capabilities ...... 71

Degradation of organic compounds ...... 72

Conclusion of findings ...... 73

Chapter ii references ...... 74

APPENDIX A. SPECIES (BASED ON SEQUENCES) FROM LAKE ERIE ICE SAMPLE,

ORGANIZED TAXONOMICALLY ...... 96

APPENDIX B. BACTERIAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99%

AND 100%...... 236

APPENDIX C. EUKARYAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99%

AND 100%...... 263

ix

LIST OF FIGURES Figure Page

1 Illustration of the process of pyrosequencing ...... 12

2 Location of sample. Station 84 of the central basin of Lake Erie ...... 27

3 Proportions of unique sequences in different environmental conditions ...... 41

4 Potential methane metabolic abilities represented in the 454 sequences

from Lake Erie ice ...... 60

5 Potential nitrogen metabolic abilities represented in the 454 sequences from

Lake Erie ice ...... 64

6 Potential sulfur metabolic abilities represented in the 454 sequences from

Lake Erie ice ...... 69

7 Potential iron metabolic abilities represented in the 454 sequences from

Lake Erie ice ...... 72 x

LIST OF TABLES Table Page

1 Summary of organisms from Lake Erie ice samples with information on

physiology, ecology, and other important characteristics ...... 32

2 Number of unique sequences and their habitat information ...... 40

1

CHAPTER I. INTRODUCTORY REVIEW

Lake Erie

The Laurentian Great Lakes are freshwater lakes located in North America, including

Lake Erie, Lake Superior, Lake Huron, Lake Michigan, and Lake Ontario. Among these five great lakes, Erie is the shallowest and smallest by volume. Lake Erie has a history of anthropogenic influences that have changed the lake ecosystem over time (Beeton 1965, 1969;

Kemp et al., 1977). The watershed that feeds the lake covers an area of about 78,000 km2. This area is 59% agricultural, 17% forested, 15% industrial/urban, and the remaining 9%, is used for other purposes (Ranking, 2002). The watershed is home to about 12 million people, including seventeen metropolitan areas with more than 50,000 residents, and provides drinking water to about 11 million people (Bolsega & Herdendorf, 1993; USEPA, 2011). About one-third of the total population of the Great Lakes basin is in the Lake Erie watershed. Despite governmental efforts, Lake Erie has been significantly impacted by agricultural, industrial, and urban runoff, and it continues to receive extensive inputs from these sources (Baker et al., 2002; Waples et al.,

2008). Because the area surrounding Lake Erie is used extensively for agricultural and industrial purposes, anthropogenic activities significantly influence the lake water and ice microbial community.

Life in Lake Erie under ice

The lake is seasonally frozen. Its surface is partially or completely covered with ice during the winter and loses the ice cover as it warms up gradually during the spring and summer.

Diverse microbial communities, including Verrucomicrobia, Proteobacteria, Bacteroidetes, and others, have been found in Lake Erie water beneath the ice cover (Beall et al., 2016). They reported a variation in the bacterial community and a shift in the diatom community of Lake Erie 2 under high and low ice conditions. They reported significant changes in the numbers of

Actinobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes, Proteobacteria,

Planctomycetes, Verrucomicrobia between high and low ice conditions. Archaeal organisms have been reported in Lake Erie and other freshwater lakes water and sediment belonging to the

Euryarchaeota, Thaumarchaeota and Crenarchaeota, but they comprise a small percentage of the total numbers of organisms in the lake (Bollmann et al., 2014; Yang et al., 2016). Members of

Archaea have been found in extreme marine environments and sometimes in halophilic environments. Some can reduce sulfate and produce methane via methanogenesis (Balch et al.,

1979; Delong, 1992). While it was once thought that the Archaea were all extremophiles, it is now known that various species of Archaea grow in moderate environments, as well as hot, cold, salty, acidic, alkaline, and others. The eukaryotic community found in freshwater lakes includes metazoans, protists, chlorophytes, and fungi (Banerji et al., 2018). Twiss et al., 2012 reported an abundance of diatoms in Lake Erie under the ice. Multiple studies have indicated that the flora of seasonally ice-covered lakes differs from the ice-free period (Shade et al., 2008; Rogozin et al.,

2009; Rosel et al., 2012). This is because of lower temperatures, reduced nutrient inputs, stratification, limited solar irradiation, and decreased quality of organic substrates (Tulonen,

1993; Tulonen et al., 1994; Bergström & Jansson, 2000).

Microbial metabolism under ice conditions

While it was once assumed that all organisms exposed to temperatures below freezing were metabolically inactive, it is now clear that this is not true for all organisms. Several researchers have reported microbial metabolism in extreme environments with temperature ranging from -5oC to -32oC (Junge et al., 2004; Panikov & Sizova 2006; Rivkina et al., 2007;

Bakermans & Skidmore 2011; Doyle et al., 2013). Microorganisms in such environments 3 maintain metabolic processes necessary for repair and assembly of vital cellular structures to preserve the integrity of the organism. However, reproduction at such temperatures has not been demonstrated (Bakermans & Skidmore 2011). The metabolic activity below freezing is not well understood as it differs between conditions and among organisms (Price & Sowers, 2004).

Sometimes when microorganisms have slowed their metabolic activities, they can remain viable in a dormant state over extended periods, if damage to their cells does not exceed the capabilities of their repair systems (Amato et al., 2010). They do this by initiating dormant states, such as spore formation, with low metabolism levels for the repair of accumulated damage (Bakermans

& Skidmore 2011). However, many organisms that endure these extreme conditions do not form spores. Conditions that limit microbial activity at cold temperatures include limited availability of liquid water, decreased molecular motion and energetics, and a loss in osmotolerance

(Mykytczuk et al., 2013). Bacteria capable of nitrogen, carbon, sulfur, and methane metabolism, have been reported in extreme environments, including lake ice (Koo et al., 2016). Some organisms surround themselves in compounds that either prevent water from freezing or allow only small crystals to form, thus limiting damage to the cells. The organisms that are entrapped in the ice and are eventually released during thawing begin full metabolic activity almost immediately.

Previous studies have shown the metabolic activities of these organisms in ice conditions.

Organisms including archaea, eukarya, and bacteria exhibit different metabolic activities such as carbohydrate metabolism, methanogenesis, iron reduction, iron oxidizing, nitrification, ammonia oxidation, sulfur oxidizing and methane oxidation. Archaea exhibit metabolic activities such as methanogenesis, nitrifier and methane oxidation. Excess methane production in Vostok ice has been reported in glacial ice attributed to the presence of methanogenic archaea (Tung et al., 4

2005). Skidmore et al., 2000 reported metabolically active organisms in high arctic glaciers, which included aerobic chemoheterotrophs, anaerobic nitrate reducers, sulfate reducers, and methanogens. Also, Sower (2001), found an excess N2O in glacial ice suggesting the presence of nitrifying bacteria. Massé et al., 2019, reported increasing nitrification activity under winter ice and found ammonia oxidizing bacteria to be present irrespective of the season while ammonia oxidizing bacteria were in abundance during the winter. Similarly, Mukherjee et al., 2016 reported more abundant ammonia oxidizing bacteria (mostly Nitrospira) than ammonia oxidizing archaea in Lake Erie water. Ammonia oxidizing bacteria and archaea have been reported in Lake

Erie and Lake Superior (Bollmann et al., 2014). Bacteria and archaea are more metabolically diverse than Eukarya, with Bacteria being the most diverse in this regard. Outside the basic metabolic activities (carbon and energy metabolism), eukaryotes are often not involved in alternative metabolic activities. This may be the reason why they are often not as heavily studied in ice. Some members of the Rhizaria (foraminifera and gromidia) have been reported to be involved in denitrification (Piña-Ochoa et al., 2010; Risgaard-Petersen et al., 2016). Fusarium oxysporum, Cylindrocarpon tonkinense (both fungi), Loxodes spp (protozoan) and some diatoms have been reported to be capable of dissimilatory nitrate reduction (Finlay et al., 1983; Shoun and Tanimoto, 1991; Usuda et al., 1995; Kamp et al., 2011). About 60% of the carbon dioxide originates from anaerobic microbial processes in lakes (Jones and Simon 1980). However, the

CO2 that is entrapped in the ice is only released into the atmosphere during melting (Bertilsson et al., 2013). Methane is produced anaerobically by some types of Archaea through methanogenesis, and microbial methanotrophs utilize it. This can lead to CH4 emissions into the air upon thawing, contributing up to 40% of the CH4 released annually (Michmerhuizen et al.,

1996; Phelps et al., 1998). CO2 and CH4 are both greenhouse gases with greenhouse warming 5

potentials of 1 and 20, respectively (Bertilsson et al., 2013). However, CO2 has a longer half-life in the atmosphere that is approximately 70 years, while CH4 resides in the atmosphere only a few years. However, if the methane reacts with hydroxyls, CO2 is produced, increasing the atmospheric CO2 levels, making it a double threat to global climate changes.

Human activities around Lake Erie

Anthropogenic activities such as agriculture, cultivation of ornamental plants, recreational activities, industrial activities, soil erosion, waste, and sewage disposal severely affect the quality of freshwater lakes (Hall & Smol, 1999). The most discussed issue about these human activities is eutrophication, which is nutrient enrichment that leads to increases in microbial populations and elevated particulate organic matter levels. In some cases, it leads to hypoxia due to high microbial respiration rates (Gray et al., 2002). Nitrogen and phosphorus are two of the main nutrients that limit primary productivity in aquatic systems (Townsend et. al,

2007). Increased levels of these nutrients result in a community shift from diatoms and small algae to cyanobacteria (Tilman et al., 1986). Newton & McMahon (2011) found that bacterial community composition changes were inconsistent across seasons following the addition of carbon, nitrogen, and phosphorus. Members of the Alphaproteobacteria, Betaproteobacteria, and

Bacteroidetes increased with nutrient addition, while nutrient addition failed to affect members of Actinobacteria. Anthropogenic activities also affect the biogeochemical cycling of carbon and other nutrients (Griggs et al., 2013). How these activities affect microorganisms is less obvious.

Still, the emerging concern is that the diversity and microbial functions may cause important changes in ecosystems (Maloy et al., 2017). Considering the established fact that microorganisms are actively involved in these cycles, there is an interconnected relationship 6 between human activities, biogeochemical cycles, and microbial activity that is not yet fully understood.

Ice drilling/sample collection

Ice samples for scientific analyses, including those for metagenomic and metatranscriptomic analyses, are collected in different ways. According to the National Science

Foundation, ice samples are collected using a mechanical or thermal method. The mechanical process can be done using physical force to turn a hand auger or coupling an electromechanical rotor to the cutter (National Science Foundation, https://icecores.org/about-ice-cores). However, this can cause fracturing of the ice core sections, especially those that are under high stress, including deep ice cores. In those cases, drilling fluids are used in the boreholes that dampen the frictional forces and stabilize the pressure in the ice.

Ice drilling is a process that provides scientists with the opportunity to explore what is beneath the ice to explain the past, present and future. Since 1840, different methods have been explored. Major methods include the percussion, hot water, and rotary drilling methods. The first attempt at ice drilling was in 1840 in Unteraargletscher in the Alps, and by 1966 a US team drilled into the Greenland ice sheets. Now, several groups have successfully collected ice samples from different locations, including Greenland, Antarctica, and elsewhere with standard methods, including percussion, rotary, and thermal (hot water) drilling.

Ultracentrifugation

Ultracentrifugation is commonly used to concentrate virus and subcellular particles and molecules in fluid samples. In studies that involve environmental water samples, the method can 7 be employed to concentrate the cells, viruses, cell components, and macromolecules prior to nucleic acid extraction. Typically, the samples are centrifuged at 100,000 xg for 12-14 hours.

RNA and DNA Extraction

RNA was extracted using a MinElute Virus Spin Kit (QIAGEN, Valencia, CA), according to the manufacturer’s instructions. This kit is designed to extract both RNA and DNA using a fast spin-column procedure. The four steps include lysing organisms, binding the nucleic acids to the column, washing away debris, and eluting the nucleic acids off the column. Lysis is carried out using the QIAGEN Protease and Buffer AL, which also inactivates RNases. Optimal binding conditions are assured through the addition of ethanol prior to addition of the sample materials. In the binding step, nucleic acids adsorb onto the silica-gel membrane as the lysate is drawn through by centrifugation. During the wash step, the nucleic acids are bound to the membrane and contaminants are removed. In the final step, RNA and DNA are eluted from the column with Buffer AVE. cDNA Synthesis

Complementary DNA (cDNA) synthesis is the technique used to make double-stranded

DNA from RNA, and this process is called reverse transcription (Croy, 1998). This method has been used since 1970 and improved in 1975; it is based on the enzymatic conversion of RNA into double-stranded cDNA using a reverse transcriptase and then a DNA polymerase

(Efstratiadis et al., 1975). Reverse transcriptases are used in the first strand synthesis, they are

RNA dependent DNA polymerases to carry out DNA synthesis (Harbers, 2008). This is followed by polymerization of the complementary DNA strand using DNA polymerase.

The extracted RNA is converted to cDNA in three steps using a cDNA superscript kit

(Invitrogen SuperScript® Choice System, Invitrogen, Grand Island, NY, USA). The first step is 8 to attach random DNA primers to the RNA. This allows reverse transcriptase to bind to the template RNA during the synthesis. For metatranscriptomic research aimed at determining the sequences of all forms of RNA (e.g., rRNA, tRNA, sRNA, and mRNA) random primers are used for this step, and it also is useful when attempting to obtain regions of very long mRNA transcripts (Noonan and Roninson 1988). It can be helpful for analytical purposes. However, the resultant cDNA might be too long for some next-generation sequencing techniques, which are capable of determining only short pieces of DNA. In the second step reverse transcriptase is added, which allows the reverse transcription of the RNA to DNA to begin. Reverse transcriptase was first isolated from Rous Sarcoma virus by Howard Temin (Temin and Mizutani 1970) and later by David Baltimore from Rous sarcoma virus and murine leukemia virus (Baltimore 1970).

The first cDNA strand synthesis takes place in this step. Some reverse transcriptases like other polymerases catalyze more than one reaction. In this case, the polymerase also has associated ribonuclease H (RNAase H) activity. High RNAse H activity degrades RNA and may reduce cDNA yield under non-optimal synthesis conditions (Kohler et al., 1995). However, most commercially available reverse transcriptases have removed this activity. Instead, the RNA template is partially removed by the addition of purified RNaseH after the reverse transcriptase reaction has been completed.

In the third step, the second strand of cDNA is made using DNA polymerase I. The first strand serves as the template for a nick translation reaction. Ribonuclease (RNase) H produces nicks and gaps, resulting in a series of RNA primers used by DNA polymerase I during the synthesis (Nature methods, 2005). In addition, the random DNA primers that remain after the initial steps also function in this process. Under optimal conditions, this resulting DNA is a double-stranded cDNA. 9

Polymerase chain reaction

The polymerase chain reaction (PCR) is a popular technique widely used in molecular biology for various applications. It was developed by Kary Mullis in 1983 to increase the copies of targeted DNA regions using a programmable heating block, called a thermal cycler (Mullis,

1990). The idea and principle of DNA amplification were first put forward by Kjell Kleppe and

H. Gobind Khorana (Kleppe et al., 1971). They called the process repair replication.

The process requires four major components: the template DNA, primers that border the region of interest, a thermostable DNA polymerase, and deoxynucleotide triphosphates

(Garibyan and Avashia 2013). The template DNA is the original DNA to be copied. Primers are short DNA fragments which specify what part of the template DNA is amplified during the amplification process. It has a defined known sequence complementary to the target DNA that is amplified and thus serves as an extension point for the DNA polymerase to build on and carry out the polymerization reaction (Garibyan and Avashia 2013). The DNA polymerase is the key enzyme in a PCR reaction. It is thermostable at the temperature (95°C) in which DNA is denatured during the first step of PCR. The enzyme most often used is Taq DNA polymerase, from the bacterium Thermus aquaticus that was isolated from hot springs, where it existed in an extremely hot environment. It functions to link several nucleotides together during the reaction

(Bartlet and Stirling, 2003). The deoxynucleotide triphosphates (dNTPs) consist of the four bases

– adenine, thymine, cytosine, and guanine (A, T, C, G) – that are present in DNA, which are attached to 2'-deoxyribose rings that have a triphosphate group attached to their 5' carbon atoms.

These serve as the building blocks used by the DNA polymerase that result in an amplified

DNA. 10

Amplification occurs in repeated cycles (30-40 cycles) in three major steps: denaturation, annealing, and extension. It starts with an initial denaturation at 95°C for up to 3 minutes; this allows the separation of the double-stranded DNA into single strands. This is followed by repeated denaturation at 95°C for 30 seconds in each cycle. Then, in the annealing step, the temperature is lowered to 55°C (or other appropriate temperature, based on the primers) for 2 minutes to allow the primer to anneal the template DNA based on complementary sequences.

Determining the optimal annealing temperature is a major factor in the success of the PCR reaction (Sambrook et al., 2001). In the third step, extension from the primers results in the synthesis of the second complementary strand of the DNA at a temperature of 72°C (optimal temperature for Taq DNA polymerase) for 2 minutes. These three steps are repeated, starting from the denaturing step to separate the newly synthesized DNA again until the cycles are completed. Following the completion of all the cycles, the DNA goes through a final extension step of 72°C for 10 minutes. This allows the polymerase to complete extension to the ends of all the synthesized DNAs (Sambrook et al., 2001).

454 pyrosequencing

The 454-pyrosequencing method originated in 2005 by Margulies et al., 2005. It was a major milestone in the next-generation sequencing technology with the advantage of a massively parallel sequencing that yielded millions of base pairs to be determined in a single sequencing procedure. The 454-pyrosequencing technology is based on the sequencing-by-synthesis principle, which involves detecting the nucleotide incorporated, combining emulsion PCR and pyrosequencing. It relies on light detection based on a chain reaction once pyrophosphate is released, and nucleotides are incorporated in the DNA (Siqueira et al., 2012). The sequencing instrument consists of four major subsystems. This includes a fluidic assembly, a flow chamber 11 with a well-containing fiber-optic slide, a CCD camera-based imaging assembly, and a computer

(Margulies et al., 2005).

In this sequencing method, DNA is isolated, fragmented, ligated to special adapters, and separated into single strands. This is followed by Emulsion PCR in which an oil-water emulsion is formed; the aqueous phase contains the PCR components and the template DNA to be sequenced. Also, capture beads with an attached oligonucleotide that is complementary to one of the adapter sequences are included in the reaction. The adapter on the opposite end of the DNA is used with a primer to initiate the polymerization reaction. Thorough mixing of the solution results in emulsification and millions of aqueous droplets are formed. These droplets are called a microreactor, each droplet contains a bead that is bound to a single DNA template. This is followed by PCR which generates millions of copies of the template DNA on each bead in a clonal PCR amplification. After the emulsion is broken, the DNA is denatured, and beads carrying single-stranded DNA are transferred to wells in a picotiter plate with a single bead in each well. Subsequently, other pyrosequencing reagents are added to each well; this includes the sequencing primer, and the enzymes DNA polymerase, ATP sulfurylase, luciferase, and apyrase.

As the complementary strand is synthesized by nucleotide incorporation, the pyrophosphate that is liberated causes the luciferase to produce a flash of light (using ATP hydrolysis) that is recorded by a CCD (charge-coupled device) camera for base calling. Because only a single dNTP is present for the addition of each nucleotide, the computer records the appropriate base for each position in the picotiter plate, building the DNA sequence with each cycle. This allows sequences to be recorded at each bead location on the picotiter plate (Siqueira et al., 2012).

12

Figure 1. Illustration of the process of pyrosequencing (Siqueira et al., 2012).

Basic local alignment search tool

Basic local alignment search tool (BLAST) (Altschul et al., 1990) is a sequence similarity search program that can be used via the NCBI (National Center for Biotechnology Information) web interface or as a separate application on a computer. It is the most widely used and reliable 13 strategy for searching sequence similarity (Pearson, 2013). The BLAST command-line applications (blastall and blastpgp) were first available in 1997, and they are supported on platforms such as Linux, UNIX, Mac, and Microsoft Windows (Camacho et al., 2009, NCBI toolkit).

There are three important aspects of the BLAST output, they include the bit score, the identity score (%), and the expected value (e-value). Expected value is defined as E(b) ≤p(b)D, where D represents the number of sequences in the database, and p(b) is the probability of finding the sequence b (Pearson, 2013). Expected value is the number of expected hits of similar sequences that could be found just by chance, which depends on the size of the database.

Acceptable expected value ranges between 0.01 to 0.1, the actual value is set by the scientist, as a general rule the lower the expected value the better (Pearson, 2013).

Curation of data (Python and Biopython)

Python, a programming language, was created by Guido van Rossum in the late 1980s, and first released in 1991. It is an interpreted, high-level, and general-purpose programming language widely used in a variety of fields. Its wide usage in science including Biology can be attributed to the simplicity of the language, its powerful and versatile combination of features including external features, and the wide base of scientific libraries and users (Ekmekci et al.,

2016, Hinsen, 2002). The Biopython project began in August 1999 as a collaboration to collect and produce open-source bioinformatics tools in Python (Chapman and Chang, 2000). The Seq object is Biopython's core sequence representation. Some features of Biopython include

SeqRecord, Bio.SeqIO, Bio.AlignIO, Bio.Nexus which are used for joining a sequence with its properties, for reading and writing biological sequence files in various formats, sequence alignment, and phylogenetic analysis respectively (Cock et al., 2009). 14

Chapter i references

Altschul, S.F, Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic local

alignment search tool. J Mol Biol. 5;215(3):403-10.doi: 10.1016/S0022-2836(05)80360-2

Amato, P., Doyle, S.M., Battista, J.R., and Christner, B.C. (2010). Implications of subzero

metabolic activity on long-term microbial survival in terrestrial and extraterrestrial

permafrost. Astrobiology 10, 789-798. doi: 10.1089/ast.2010.0477.

Baker, D.B.D., and Richards, R.P.R. (2002). Phosphorus budgets and riverine phosphorus export

in northeastern Ohio watersheds. J. Environ. Qual. 31(1), 96–108

doi:10.2134/jeq2002.9600.

Bakermans, C., and Skidmore, M.L. (2011). Microbial metabolism in ice and brine at -5oC.

Environ. Microbiol. 13(8), 2269-2278. doi:10.1111/j.1462-2920.2011.02485.x.

Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., and Wolfe, R.S. (1979). Methanogens:

reevaluation of a unique biological group. Microbiol. Rev 43, 260–296.

Baltimore, D. (1970). Viral RNA-dependent DNA Polymerase: RNA-dependent DNA

Polymerase in Virions of RNA Tumour Viruses. Nature 226, 1209–121.

https://doi.org/10.1038/2261209a0.

Banerji, A., Bagley, M., Elk, M., Pilgrim, E., Marinson, J., and Santo Domingo, J. (2018).

Spatial and temporal dynamics of a freshwater eukaryotic plankton community revealed

via 18S rRNA gene metabarcoding. Hydrobiologia, 818(1), 71–86.

https://doi.org/10.1007/s10750-018-3593-0.

Beall, B. F. N. Twiss M. R., Smith, E., Oyserman, B. O., Rozmarynowycz, M. J., Binding, C. E.,

Bourbonniere, R. A., Bullerjahn, G.S., Palmer, M.E., Reavie, E.D., Waters, M.K.,

Woityra, W.C., and McKay, R.M.L. (2016). Ice cover extent drives phytoplankton and 15

bacterial community structure in a large north-temperate lake: implications for a warming

climate. Environ. Microbiol. 18(6), 1704–1719. doi:10.1111/1462-2920.12819.

Beeton, A.M. (1965). Eutrophication of the St. Lawrence Great Lakes. Limnol. Oceanogr. 10,

240-254 https://doi.org/10.4319/lo.1965.10.2.0240.

Bergström, A., and Jansson, M. (2000). Bacterioplankton production in humic Lake Ortrasket in

relation to input of bacterial cells and input of allochthonous organic carbon. Microb.

Ecol. 39, 101–115. doi:0.1007/s002480000007.

Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,

G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of

seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.

doi:10.4319/lo.2013.58.6.1998.

Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,

G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of

seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.

Bollmann, A., Bullerjahn, G. S., and McKay, R. M. (2014). Abundance and diversity of

ammonia-oxidizing archaea and bacteria in sediments of trophic end members of the

Laurentian Great Lakes, Erie and Superior. PloS one, 9(5), e97068.

https://doi.org/10.1371/journal.pone.0097068.

Bolsega, S.J., and Herdendorf, C.E. (1993). Lake Erie and Lake St. Clair Handbook. Wayne

State University Press, Detroit.

Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., and Madden,

T.L. (2009). BLAST+: architecture and applications. BMC Bioinformatics 10, 421.

https://doi.org/10.1186/1471-2105-10-421. 16

Chapman, B., and Chang, J. (2000). Biopython: Python tools for computational biology ACM

SIGBIO Newslett. 20(2); 15 –19,https://doi.org/10.1145/360262.360268.

Cock, P.J.A., Antao, T., Chang, J.T., Chapman, B.A., Cox, C.J., Dalke, A., Friedberg, I.,

Hamelryck, T., Kauff, F., Wilczynski, B., and de Hoon, M.J.L. (2009). Biopython:

freely available Python tools for computational molecular biology and

bioinformatics, Bioinformatics, Volume 25, Issue 11, 1422–

1423, https://doi.org/10.1093/bioinformatics/btp163.

Croy, Ron. (1998). "Molecular Genetics II - Genetic Engineering Course (Supplementary

notes)". Retrieved 11 January 2021.

DeLong, E.F.1. (1992). Archaea in coastal marine environments. PNAS 89(12), 5685-5689.

https://doi.org/10.1073/pnas.89.12.5685.

Doyle, S.M., Montross, S.N., Skidmore, S.L., and Christner, B.C. (2013). Characterizing

microbial diversity and the potential for metabolic function at −15 °C in the basal ice of

Taylor Glacier, Antarctica. Biology 2(3), 1034–1053. doi: 10.3390/biology2031034.

Efstratiadis, A., Maniatis, Kafatos, T.F.C., Jeffrey, A., and Vournakis, J.N. (1975). Full length

and discrete partial reverse transcripts of globin and chorion mRNAs. Cell, 4, 367-378.

Ekmekci, B., McAnany, C.E., and Mura, C. (2016). An Introduction to Programming for

Bioscientists: A Python-Based Primer. PLoS Comput Biol 12(6): e1004867.

https://doi.org/10.1371/journal.pcbi.1004867.

Finlay, B. J., Span, A. S. W., and Harman, J. M. P. (1983). Nitrate respiration in primitive

eukaryotes. Nature, 303(5915), 333-336.

Garibyan, L., and Avashia, N. (2013). Polymerase chain reaction. The Journal of investigative

dermatology, 133(3), 1–4. https://doi.org/10.1038/jid.2013.1. 17

Gray, J. S., Wu, R. S. S., and Or, Y. Y. (2002). Effects of hypoxia and organic enrichment on the

coastal marine environment. Mar. Ecol. Prog. Ser. 238, 249–279.

Griggs, D., Stafford-Smith, M., Gaffney, O., Rockström J., Öhman M. C., Shyamsundar P.,

Steffen, W., Glaser, G., Kanie, N., and Noble, I. (2013). Sustainable development goals

for people and planet. Nature 495, 305–307. doi:10.1038/495305.

Hall, R. I., and Smol, J. P. (1999). Diatoms as indicators of lake eutrophication, in: The Diatoms:

Applications for the Environmental and Earth Sciences, edited by: Stoermer, E. F. and

Smol, J. P., Cambridge University Press, Cambridge, UK, 128-168.

https://doi.org/10.1111/j.1462-2920.2011.02485.x.

Harbers, M. (2008). The current status of cDNA cloning. Genomics, 91 pp. 232-242

Hinsen, K. (2002). High-Level Scientific Programming with Python. In: Proceedings of the

International Conference on Computational Science-Part III. ICCS’02. London, UK, UK:

Springer-Verlag; 2002. p. 691–700.

Jones, J. G., and Simon, B.M. (1980). Decomposition processes in the profundal region of

Blelham Tarn and the Lund Tubes. J. Ecology. 68, 493–512. doi:10.2307/2259418.

Junge, K., Eicken, H., and Deming, J.W. (2004). Bacterial activity at −2 to −20°C in Arctic

wintertime sea ice. Appl. Environ. Microbiol. 70 (1), 550-557 doi:

10.1128/AEM.70.1.550-557.

Kamp, A., de Beer, D., Nitsch, J.L., Lavik, G., and Stief, P. (2011). Diatoms respire nitrate to

survive dark and anoxic conditions. Proc Natl Acad Sci U S A 5;108(14):5649-54. doi:

10.1073/pnas.1015744108.

Kemp, A.L.W., MacInnis, G.A., and Harper, N.S. (1977). Sedimentation rates and a revised

sediment budget for Lake Erie. J Great Lakes Res 3, 221-233. 18

Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H.G. (1971). Studies on

polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by

DNA polymerases. J Mol Biol. 56(2):341-361. doi: 10.1016/0022-2836(71)90469-4.

Kohler, T., Labner, D., Thamm, B. and Pustowoit, B. (1995). Quantitation of mRNA by

polymerase chain reaction. Nonradioactive PCR methods. pp. 66–70. Springer-Verlag,

Berlin, Germany.

Koo, H., Mojib, N., Hakim, J.A., Hawes, I., Tanabe, Y., Andersen, D.T., and Bej, A.K. (2017).

Microbial Communities and Their Predicted Metabolic Functions in Growth Laminae of

a Unique Large Conical Mat from Lake Untersee, East Antarctica. Front. Microbiol.

8:1347. doi: 10.3389/fmicb.2017.01347.

Maloy, S., Moran, M. A., Mulholland, M. R., Sosik, H. M., and Spear, J. R. (2017). Microbes

and Climate Change: Report on an American Academy of Microbiology and American

Geophysical Union Colloquium held in Washington, DC, in March 2016 (American

Society for Microbiology, 2017).

Margulies, M., Egholm, M., and Altman, W. (2005). Genome sequencing in microfabricated

high-density picolitre reactors. Nature 437, 376–380.

https://doi.org/10.1038/nature03959.

Massé, S., Botrel, M., Walsh, D. A., and Maranger, R. (2019). Annual nitrification dynamics

in a seasonally ice-covered lake. PloS one, 14(3), e0213748.

https://doi.org/10.1371/journal.pone.0213748.

Michmerhuizen, C. M., Striegl, R.G., and Mcdonald, M.E. (1996). Potential methane emission

from north-temperate lakes following ice melt. Limnol. Oceanogr. 41, 985–991.

doi:10.4319/lo.1996.41.5.0985. 19

Mukherjee, M., Ray, A., Post, A.F., McKay, R.M., and Bullerjahn, G.S. (2016).

Identification, enumeration and diversity of nitrifying planktonic archaea and bacteria

in trophic end members of the Laurentian Great Lakes. J Great Lakes Res 2016;

42:39– 49 https://doi.org/10.1016/j.jglr.2015.11.007.

Mullis, K. (1990). The Unusual Origin of the Polymerase Chain Reaction. Scientific American,

262(4), 56-65. Retrieved January 13, 2021, from http://www.jstor.org/stable/24996713.

Mykytczuk, N.C.S., Foote, S.J., Omelon, C.R., Southam, G., Greer, C.W., and Whyte, L.G.

(2013). Bacterial growth at -15oC; molecular insights from the permafrost bacterium

Planococcus halocryophilus Or1. ISME J. 7, 1211-1226. doi: 10.1038/ismej.2013.8.

Newton, R.J., and McMahon, K.D. (2011). Seasonal differences in bacterial community

composition following nutrient additions in a eutrophic lake. Environ. Microbiol.

13(4):887–899. https://doi.org/10.1111/j.1462-2920.2010.02387.x.

Noonan, K.E., and Roninson, I.B. (1988). mRNA phenotyping by enzymatic amplification of

randomly primed cDNA. Nuc. Acids Res. 16(21): 10366.

Panikov, N.S., and Sizova, M.V. (2006). Growth kinetics of microorganisms isolated from

Alaskan soil and permafrost in solid media frozen down to −35°C. FEMS Microbiol.

Ecol. 59(2), 500-512. doi:10.1111/j.1574-6941.2006.00210.x.

Pearson, W. R. (2013). An introduction to sequence similarity ("homology") searching Current

protocols in bioinformatics, Chapter 3, Unit 3.1.

https://doi.org/10.1002/0471250953.bi0301s42.

Phelps, A. R., Peterson, K. M., and Jeffries, M. O. (1998). Methane efflux from high latitude

lakes during spring ice melt. J. Geophys. Res. 103, 29029–29036

doi:10.1029/98JD00044. 20

Piña-Ochoa, E., Høgslund, S., Geslin, E., Cedhagen, T., Revsbech, N. P., Nielsen, L. P.,

Schweizer, M., Jorissen, F., Rysgaard, S., and Risgaard-Petersen, N. (2010). Widespread

occurrence of nitrate storage and denitrification among Foraminifera and Gromiida.

Proceedings of the National Academy of Sciences, 107(3), 1148-1153.

pp. 213-251.

Price, P.B., and Sowers, T. (2004). Temperature dependence of metabolic rates for microbial

growth, maintenance, and survival. Proc Natl Acad Sci U S A. 101(13):4631-6. doi:

10.1073/pnas.0400522101

Rankin, D. (2002). Freshwater Ecosystems and Human Populations: Great Lakes Case Study.

Risgaard-Petersen, N., Langezaal, A.M., Ingvardsen, S., Schmid, M.C., Jetten, M.S., Op den

Camp, H.J., Derksen, J.W., Piña-Ochoa, E., Eriksson, S.P., Nielsen, L.P., Revsbech, N.P.,

Cedhagen, T. and van der Zwaan, G.J. (2006). Evidence for complete denitrification in a

benthic foraminifer. Nature. 7;443(7107):93-6. doi: 10.1038/nature05070.

Rivkina, E., Shcherbakova, V., Laurinavichius, K., Petrovskaya, L., Krivushin, K., Kraev, G.,

Pecheritsina, S., and Gilichinsky, D. (2007). Biogeochemistry of methane and

methanogenic archaea in permafrost. FEMS Microbiol. Ecol. 61, 1–15.

Rogozin, D. Y., Zykov, V. V., Chernetsky, M. Y., Degermendzhy, A.G., and Gulati, R.D.

(2009). Effect of winter conditions on distributions of anoxic phototrophic bacteria in two

meromictic lakes in Siberia, Russia. Aquat. Ecol. 43, 661–672. doi:10.1007/s10452-009-

9270-7.

Rosel, S., Allgaier, M., and Grossart, H.P. (2012). Long-term characterization of free-living and

particle-associated bacterial communities in Lake Tiefwaren reveals distinct seasonal

patterns. Microb. Ecol. 3, 571–583. doi:10.1007/s00248-012-0049-3. 21

Sambrook, J., Russell, D. W., and Russell, D. W. (2001). Molecular Cloning: A Laboratory

Manual (Vol. 999). New York: Cold spring harbor laboratory press.

Shade, A., Jones, S. E., and Mcmahon, K. D. (2008). The influence of habitat heterogeneity on

freshwater bacterial community composition and dynamics. Environ. Microbiol. 10,

1057–1067. doi:10.1111/j.1462-2920.2007.01527.x.

Shoun, H., and Tanimoto, T. (1991). Denitrification by the fungus Fusarium oxysporum and

involvement of cytochrome P-450 in the respiratory nitrite reduction. Journal of

Biological Chemistry, 266(17), 11078-11082.

Siqueira, J. F., Fouad, A. F., and Rôças, I. N. (2012). Pyrosequencing as a tool for better

understanding of human microbiomes. Journal of oral microbiology, 4,

10.3402/jom.v4i0.10743. https://doi.org/10.3402/jom.v4i0.10743.

Skidmore, M. L., Foght, J. M., and Sharp, M. J. (2000). Microbial life beneath a high arctic

glacier. Applied and environmental microbiology, 66(8), 3214–3220.

https://doi.org/10.1128/aem.66.8.3214-3220.2000.

Synthesis of complementary DNA. Nat Methods 2, 151–152 (2005).

https://doi.org/10.1038/nmeth0205-151.

Temin, H., and Mizutani, S. (1970). Viral RNA-dependent DNA Polymerase: RNA-dependent

DNA Polymerase in Virions of Rous Sarcoma Virus. Nature 226, 1211–1213

https://doi.org/10.1038/2261211a0.

Tilman, D., Kiesling, R. L., Sterner, R., Kilham, S. S., and Johnson, F. A. (1986). Green,

bluegreen and diatom algae: taxonomic differences in competitive ability for phosphorus,

silicon, and nitrogen. Arch. Hydrobiol. 106, 473–485. 22

Townsend, A.R., Cleveland, C.C., Asner, G.P., and Bustamante, M.M.C. (2007). Controls over

foliar N:P ratios in tropical rain forests. Ecology 88, 107–118.

Tulonen, T. (1993). Bacterial production in a mesohumic lake estimated from [14C] leucine

incorporation rate. Microb. Ecol. 26, 201–217. doi:10.1007/BF00176953.

Tulonen, T., Kankaala, P., Ojala A., and Arvola, L. (1994). Factors controlling production of

phytoplankton and bacteria under ice in a humic, boreal lake. J. Plankton Res. 16, 1411–

1432. doi:10.1093/plankt/16.10.1411.

Tung, H.C., Bramall, N. E., and Price, P. B. (2005). Microbial origin of excess methane in

glacial ice and implications for life on Mars. Proceedings of the National Academy of

Sciences Dec 2005, 102 (51) 18292-18296. DOI:10.1073/pnas.0507601102.

Twiss, M.R., McKay, R.M.L., Bourbonniere, R.A., Bullerjahn, G.S., Carrick, H., Smith, R.E.H.,

Winter, J.G., D'souza, N.A., Furey, P.C., Lashaway, A.R., and Saxton, M.A. (2012).

Diatoms abound in ice-covered Lake Erie: An investigation of offshore winter limnology

in Lake Erie over the period 2007 to 2010. J. Great Lakes Res. 38, 18-30.

doi:10.1016/j.jglr.2011.12.008.

United states environmental protection agency. (2011).

https://www.epa.gov/sites/production/files/201509/documents/binational_nutrient_manag

ement.pdf

Usuda, K., Toritsuka, N., Matsuo, Y., Kim, D. H., and Shoun, H. (1995). Denitrification by the

fungus Cylindrocarpon tonkinense: anaerobic cell growth and two isozyme forms of

cytochrome P-450nor. Applied and Environmental Microbiology, 61(3), 883-889.

Waples, J.T., Eadie, B., Klump, J.V., Squires, M., Cotner, J., and McKinley, G. (2008). The

Laurentian Great Lakes. North American continental margins: a synthesis and planning 23

workshop. U.S. Carbon Cycle Science Program B. Hales, W. Cai, G. Mitchell, C.L.

Sabine, O. Schofield (Eds.). p. 110.

Whittaker, R.H. (1972). Evolution and Measurement of Species Diversity. Taxon 21,

Yale School of Forestry and Environmental Studies. Bulletin Series 107. Accessed: 10-31-2019.

http://environment.yale.edu/topics/788.

Yang, Y., Dai, Y., Wu, Z., Xie, S., and Liu, Y. (2016). Temporal and Spatial Dynamics of

Archaeal Communities in Two Freshwater Lakes at Different Trophic Status. Front.

Microbiol. 7:451. doi: 10.3389/fmicb.2016.00451.

24

CHAPTER II. ORGANISM DIVERSITY IN LAKE ERIE

Lake Erie

Amongst the five great lakes, Lake Erie experiences the highest number of human activities. The lake is used for recreational, agricultural, transport, and industrial purposes, thus exposing it to many forms of contamination. The hypoxia problem in the central basin of Lake

Erie has been attributed to harmful algal blooms, which are followed by bacterial decomposition

(Scavia et al., 2014). In addressing this problem, cyanobacteria species are the primary concerns as some are known to produce toxins with public health effects. They have been found in many freshwater ecosystems, including Lake Erie (Rinta-Kanto et al., 2005; Rinta-Kanto and Wilhelm,

2006; Graham et al., 2010; Foss and Aubel, 2015; Loftin et al., 2016). Another significant microbial community found in Lake Erie consists of phytoplankton, dominated by diatoms such as Fragilaria and Aulacoseira (Scavia et al., 2014, Beall et al., 2016). Studies of the lake community have focused on cyanobacteria and diatoms.

Metabolic activities in lake ice

Many of the organisms found in the Lake Vostok ice were deduced to be capable of nitrogen fixation, including, Geobacillus kaustophilus, Halomonas sp., Herbaspirillum sp.,

Nostoc punctiforme, and Synechococcus sp. (Shtarkman et al., 2013). Chemolithotrophic bacteria and archaea possess the ability to fix carbon under dark conditions (Pachiadaki et al., 2017).

Bacteria identified from the Lake Vostok sequences may be capable of nitrogen fixation, denitrification, nitrate reduction, sulfur reduction, and many other metabolic pathways (Gura and

Rogers 2020; Rogers et al., 2013; Shtarkman et al., 2013). Understanding the ecology of microbial communities relies on comprehensive and integrated information about the identities of the microbes, as well as their potential metabolic capabilities (Sherr et al., 1999). Members of 25

Archaea have been found in extreme marine environments and sometimes in halophilic environments. While it was once thought that the Archaea were all extremophiles, it is now known that various species of Archaea grow in moderate environments, as well as hot, cold, salty, acidic, alkaline, and other environments (DeLong, 1998). The specific metabolic roles of the species present in Lake Erie ice has not been investigated in detail, which was one of the major focuses that this research addressed.

Previous research

Previous studies have shown that microbial communities can actively grow and survive in extreme environments such as ice (Bertilsson et al., 2013). Diverse microbial communities, including Verrucomicrobia, Proteobacteria, Bacteroidetes, and others have been found in Lake

Erie beneath the ice (Beall et al., 2015). Similarly, a diverse community consisting of

Proteobacteria, Actinobacteria, Bacteroidetes, and Planctomycetes was described in permanently frozen lakes in Antarctica (Glatz et al., 2006; Priscu et al., 1999). Major bacterial taxa found in subglacial Lake Vostok ice included Firmicutes, Proteobacteria, Cyanobacteria, Actinobacteria, and Bacteroides (Rogers et al., 2013; Shtarkman et al., 2013; Gura and Rogers 2020). Ice cover drives critical biological changes for the lake ecosystem (Moore et al. 2009; Benson et al. 2012).

Microbial community changes in freshwater lakes covered with ice are dynamic, which may depend on several factors such as light, temperature, nutrient cycling, and snow characteristics.

During the ice cover period, Lake Erie water was reported to be dominated by large diatoms

(Beall et al., 2016). In contrast, Twiss et al., 2012 reported no difference in the ice-free and ice- covered periods. During the ice-covered period, some lakes are dominated by smaller diato species (Wetzel, 2001). These studies confirmed that there is an association between ice-covered conditions and the presence of diatoms in the lake that is not yet fully understood. Beal et al., 26

2016 showed that bacterial abundance during the ice-covered period was four times lower than in summer. They reported that the populations of Actinobacteria, Acidobacteria, Bacteroidetes,

Gemmatimonadetes, Planctomycetes, Proteobacteria and Verrucomicrobia differed between the high-ice and low-ice periods. In addition, they reported low cyanobacterial levels, a major bacterial taxon during the summer. A study on Lake Erie sediment showed that the occurrence of

Microcystis species (a major cyanobacteria group) decreases over the winter (Kitchens et al.,

2018). Presently, the complete inventory of microbial species in Lake Erie is unknown. It is important to determine the functional profiles and interactions that exist between these communities that may enhance or degrade the lake ecosystem, which is the focus of this study.

Purpose of research

The main aim of this study was to determine the species and physiological characteristics represented by the metagenomic and metatranscriptomic sequences from an ice sample collected from the central basin of Lake Erie and to relate these to the lake ecosystem, as well as the inputs from various sources within and surrounding the Lake Erie.

The specific aims included:

Enumerate species from the metagenomic and metatranscriptomic sequences obtained from a

Lake Erie ice sample.

● Determine the physiological characteristics of the species.

● Provide a compilation of the metabolic characteristics of the species.

● Produce a model of the microbial community in the ice and compare this to other studies

of Lake Erie water samples.

27

Materials and methods

Sample preparation

The sample used in this study was collected from Station 84 (41°56.08 N, 80°52.18 W) in the central basin of Lake Erie in January 2010 (Figure 2). The ice was cut from the surface ice with chainsaws. In the lab, the surfaces of the ice sample were decontaminated with cold (4°C) sodium hypochlorite, followed by rinsing with cold sterile RO water (18 mΩ, <1 ppm total organic carbon), and then melting at room temperature in a sterile hood. Cells and nucleic acids were concentrated by ultracentrifugation at 100,000 xg for 16 hours using the Beckman L8-M ultracentrifuge (described in Rogers et al., 2013 & Shtarkman et al., 2013).

Figure 2. Location of sample. Station 84 of the central basin of Lake Erie. 28

DNA/RNA extraction

Pellets from ultracentrifugation were rehydrated in 50 μl of sterile 0.1X TE (1 mM Tris

[pH 7.5], 0.1 mM EDTA). DNA and RNA were extracted using a MinElute Virus Spin Kit

(QIAGEN, Valencia, CA), according to the manufacturer's instructions. About 1100 μl CSF

NPS-lysis buffer mixture was mixed with 75 μl of protease, and then 550 μl of a Buffer

AL/Carrier RNA mixture was added. After incubating at 56 °C for 15 min, 600 μl of ethanol was added, and the mixture was incubated for five more minutes. The entire volume of the sample was then added to a spin column. The sample was then drawn through the column to allow the nucleic acids to bind to the silica membrane. A series of washes with ethanol were performed, and nucleic acids were eluted into 55 μl of Buffer AVE. cDNA synthesis

Complementary DNA copies (cDNA) were made from the RNA using a cDNA kit

(Invitrogen SuperScript II Choice System, Invitrogen, Grand Island, NY, USA), with random hexamer primers, following the manufacturer's instructions (described in Rogers et al. 2013,

Shtarkman et al., 2013), including ligation of EcoRI (NotI) adapters onto the ends of the cDNAs.

The resulting cDNAs were fractionated (single drops) on Sephacryl S-500 HR columns.

Fractions 6-25 were chosen for PCR reactions to ensure that the cDNAs’ size meet the sequencing criteria. Following PCR amplification conditions, using EcoRI (NotI) primers

(AATTCGCGGCCGCGTCGA), all were assayed by agarose gel electrophoresis. Each fraction was precipitated with ethanol, dried, and rehydrated in 0.1X TE. Next, 454 primers A

(CGTATCGCCTCCCTCGCGCCATCAGAATTCGCGGCCGCGTCGAC) and B

(CTATGCGCCTTGCCAGCCCGCTCAGAATTCGCGGCCGCGTCGAC) were added in a

PCR amplification reaction (described in Rogers et al. 2013, Shtarkman et al. 2013). Following 29 quantification by agarose gel electrophoresis, the samples were sent to Roche Life Sciences 454

Technologies (Roche Life Sciences, Branford, CT, USA) for 454 pyrosequencing using a 454

GS Junior System Sequencer.

Sequence analysis

The high-quality sequences were extracted from the file determined by the sequencing facility in a FASTQ format. They were subjected to MegaBLAST analysis, using a cut-off e- value of 10-10. Taxonomic assignments were made based on the top BLAST matches. Duplicate accession numbers were removed. The top 10 similar sequences that could be aligned over at least 100 nucleotides were retrieved. Then, the top BLASTN matches that specified a genus, species, and/or strain/isolate from the top 10 similar sequences were retrieved and determined and one consensus was used for taxonomic classification.

Taxonomic proportions

Detailed analyses of taxonomic proportions were determined at the Domain, Kingdom, and Phylum levels using MG-RAST (The Metagenomics RAST server, BMC Bioinformatics

2008; www.mg-rast.org) and Galaxy (The Galaxy platform; www.usegalaxy.org).

Metabolic classifications

After the duplicate sequences were removed, 68,422 unique sequences remained. Of these, approximately 80% sequences were bacterial sequences. Excluding the uncultured bacterial sequences, the sequences were analyzed and sorted into tables showing their taxonomic affiliations, important metabolic capabilities, habitat, and any special functions for each organism. This information was retrieved through internet searches, online publications, uniport database (available at https://www.uniprot.org/), and the Bacdive database (available at 30 https://bacdive.dsmz.de/). Finally, the information retrieved about these organisms was used to compile their potential metabolic activities, such as carbon fixation and nitrogen fixation.

Comparison with previous Lake Erie water study

Previous information from Lake Erie water and sediment studies were considered for comparison. The taxonomic taxa represented in a study conducted by Beall et al., 2016 with and without ice cover (using 16S rRNA sequences) was compared with the results of this research.

Results and discussion

Result summary

An ice sample collected from Lake Erie's central basin was analyzed in this research, and

68,422 unique sequences were recovered belonging to Bacteria, Archaea, and Eukarya. The results presented in this study show that Lake Erie ice consists of a broad diversity of organisms, some of which have not been reported in the lake water itself. A total of 42,967 (67%) of the sequences could not be determined to species, but 40,010 were classified as bacteria, 70 were archaea, and 1,549 sequences were eukaryotes. After the removal of unknown sequences, a total number of known sequences was 25,450 sequences with 57, 19,716, and 5,677 belonging to

Archaea, Bacteria, and Eukarya, respectively. The sequences identified as bacteria belonged to numerous phyla, including Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,

Bacteroides, Chloroflexi, Chlorobi, Firmicutes, Tenericutes, Thermotogae, Deinococcus-

Thermus, and Verrucomicrobia, with more than half of the sequences in the Proteobacteria.

Amongst the bacteria, the sequences matched 386 species with 100% percentage identity, and

845 species with at least 97% percentage identity (percentage identities are presented in

Appendix B). The 57 archaeal sequences found were within the Euryarchaeota and

Thaumarcheota. Among the Eukarya, the largest representation was from the Opisthokonta 31

(primarily Arthropoda), Stramenopiles (primarily Bacilliarophyta), and Archaeplastida

(primarily Chlorophyta and Streptophyta). (Table 1). The eukarya sequences matched 284 species with 100% percentage identity, and 569 species with at least 97% percentage identity

(Appendix B) (Table 1). The species identified in this research live in habitats such as lakes, lake sediments, rivers, and oceans. Some are associated with animals and plants. A detailed compilation of all the species based on the sequences derived in this study is presented in

Appendix A.

In this study, the organisms found are potentially capable of several metabolic functions, such as nitrogen fixation, carbon fixation, iron reduction, sulfur oxidation, and hydrocarbon degradation (Table 1). Pathogen and toxin-producing organisms also were found in the sequences. These results suggest that the ice contains a large diversity of organisms with a broad range of metabolic activities. Microbial diversity in Lake Erie water has been reported to vary between the summer and winter seasons. Diverse bacterial communities, including

Verrucomicrobia, Proteobacteria, Bacteroidetes, and others have been found in Lake Erie under ice cover. The research described here indicates that a large diversity of organisms also exists in the winter ice, which differs from the collection of microbes in the underlying water. The presence of a microbial community associated with human activity such as industrial effluents, discharges from boats and ships, agricultural activity, and domestic and hospital waste indicates significant anthropogenic influences on the lake (Table 1). 32

Table 1: Summary of organisms from Lake Erie ice samples with information on physiology, ecology, and other important characteristics

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences EUKARYOTA 7266 1231 Amoebozoa 101 26 Aquatic, intracellular Heterotrophs parasite Apusozoa 38 5 Soil, aquatic Heterotroph, feed on bacteria Archaeplastida 598 186 Freshwater, marine, Autotrophs, photoautotrophic Glaucocystophyta 8 ND cold Rhodophyta 25 14 water environment, soil Viridplantae 485 172 Chlorophyta ND 109 Streptophyta ND 63

Protista 2016 387 Excavata 88 ND Freshwater, soil, marine Heterotrophic, autotrophic, parasitic

Hacrobia 101 21 Freshwater, marine, Mixotrophy, phototroph, Cryptophyta 74 21 brackish heterotroph

Haptophyta 8 ND SAR 1827 366 Stramenopiles 959 188 Soil, aquatic Photosynthetic Alveolata 538 120 Aquatic Heterotrophs, feeds on bacteria Rhizaria 330 28 Aquatic Heterotroph Opisthokonta 3006 638 Aquatic Heterotroph Fungi 1192 161 33

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Ascomycota 425 90 Freshwater, saltwater, Heterotroph decaying matters, extreme environment, terrestrial Basidiomycota 142 43 Terrestrial, freshwater, Heterotroph marine Blastocladiomycota 6 1 Freshwater, mud, soil, Heterotroph, feed on decomposing parasitize arthropods matter (saprotroph) Chytridiomycota 159 10 Aquatic, terrestrial, Heterotroph ponds, springs, arctic and Antarctic soil, peats, bogs, rivers, acidic soil Entorrhizomycota 2 ND Glomeromycota 37 4 Terrestrial, wetlands, Heterotroph salt marshes, associated with epiphytic plants Zygomycota 64 13 Soil, decaying plant Heterotroph material Unknown/unclassified fungi 356 ND Unknown Unknown Metazoan/Animalia 1799 464 Bilateria 1379 343 Acanthocephala 5 ND Parasitic, intestinal tract Heterotoph of fishes Annelida 60 13 Ocean, freshwater, damp Heterotroph, filter feeder, parasitic soil Arthropoda 575 151 Marine, fresh water, Heterotrophic, parasitic, filter terrestrial feeders Brachiopoda 2 1 Sea water Heterotrophic, filter feeder 34

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Bryozoa 9 2 Freshwater, lakes, Heterotrophic ponds Chordata 219 43 Marine, freshwater, Heterotrophic terrestrial Cephaloryncha 2 2 Marine sand, mud, Heterotrophic gravel Echinodermata 11 1 Marine Heterotrophic, filter feeder Gastrotricha 16 3 Freshwater, marine Heterotrophic

Kinorhyncha 3 ND Marine mud Heterotrophic Mollusca 132 45 Aquatic, marine, mud, Heterotroph, parasitic, free-living sand Nematoda 74 17 Soil Heterotrophic, parasitic Nematomorpha 3 2 Marine, freshwater Heterotrophic Nemertea 4 3 Marine, freshwater, Heterotrophic terrestrial Platyhelminthes 43 24 Freshwater, marine Free-living, parasitic, heterotrophic

Priapulida 2 2 Ocean sand, mud Heterotrophic Phoronida 1 1 - - Rotifera 121 24 Freshwater, moist land, Heterotrophic, parasitic marine, brackish water Sipuncula 2 1 Marine, benthic Heterotrophic Tardigrada 30 4 Aquatic, lake sediment, Heterotrophic freshwater Xenacoelomorpha 4 4 Marine Heterotrophic

Unclassified Bilateria 61 ND Unknown Unknown 35

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Cnidaria 335 118 Aquatic, marine Heterotroph Ctenophora 2 2 Marine Heterotroph Placozoa 7 ND Aquatic Heterotroph Porifera 48 11 Marine, freshwater Heterotroph lake/streams Unknown/unclassified 31 ND Unknown Unknown metazoan Unknown/unclassified 60 12 Marine Heterotroph Opisthokontha Uncultured/unclassified eukaryotes 1656 ND Unknown Unknown ARCHAEA 137 24

Euryarchaeota 44 18 Aquatic, marine, Methanogen, methanotroph Antarctica thermophilic, halophilic, extremophilic Thaumarchaeota 13 6 Aquatic, marine Methanogen halophilic, extremophilic Uncultured Archaea 70 ND Unknown Unknown BACTERIA 59726 2120 Acidobacteria 815 16 Soil, aquatic, mud, Heterotroph, chemoorganotroph tundra soil, thermophilic, acidophilic, psychrophilic 36

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Actinobacteria 1169 228 Soil, aquatic, sediment, Heterotroph, fixes nitrogen, nitrite thermophilic oxidation, ammonia oxidation, organic decomposition Aquificae 13 6 Marine, sediment, Autotroph, oxidizes hydrogen, thermophilic, reduces sulfate Armatimonadetes 15 3 Aquatic, soil Chemoheterotrophic Bacteroidetes/chlorobi group 1623 159 Aquatic, sediments, soil Fixes carbon thermophilic, psychrophilic, alkaliphilic Caldisericia 3 1 Thermophilic Sulfur reduction, chemoheterotroph Chlorochromatium 1 1 Freshwater Photoautotroph Chloroflexi 393 16 Thermophilic Phototroph Chlamydiae 60 16 Marine sediment - Chrysiogenetes 2 1 Aquatic Utilizes arsenic, reduces selenate

Cloacimonetes 2 1 Waste water - Cyanobacteria 1430 169 Aquatic, damp soil, Fixes nitrogen, carbon fixation Deferribacteres 9 3 Mesophilic, Chemoorganotroph, heterotroph thermophilic Deinococcus-Thermus 42 14 Radiation resistant, Chemoorganotroph, heterotroph aquatic, thermophilic, extremophilic Elusimicrobia 11 2 Marine, soils, sewage Cellulolytic sludge Fibrobacteres 20 1 Rumen Cellulolytic Firmicutes 861 270 Rumen, extremophilic, Heterotroph, cellulolytic thermophilic, 37

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences mesophilic, psychrophilic, psychroto lerant, halophilic, hot springs, deep sea thermophilic, anaerobic, aerobic Fusobacter 24 9 Anaerobic, parasitic Chemoorganotroph, heterotroph Gemmatimonadetes 120 1 Soil Aerobic heterotrophs Lentisphaerae 25 2 Marine Chemoheterotrophic Nitrospira 204 6 Marine Nitrite oxidation, hydrogen oxidation Planctomycetes 537 23 Fresh, brackish and Chemoautolithotrophic anammox, saline lakes/ponds, nitrite reduction using ammonium as anaerobic electron donor Proteobacteria 10189 1079 Alphaproteobacteria 1848 283 Glacial ice, soil, aquatic Nitrite reduction, nitrifying bacteria, denitrification, methylotrophic, uses inorganic sulfur, oxidizes sulfate and thiosulfate, carbon fixation Betaproteobacteria 3771 270 Thermophilic, Nitrogen fixation, nitrate reduction, mesophilic, methylotrophic, ammonia oxidation, psychrophilic, aquatic, carbon fixation, manganese- aerobic oxidation, iron oxidation, inorganic sulfur oxidation, arsenic oxidation Gammaproteobacteria 2691 427 Marine, soil, nitrogen fixation, nitrate reduction, thermophilic, halophilic, nitrite respiration psychrophilic, Delta/Epsilon 1314 98 Aquatic, halophilic, soil Sulfate reduction, carbon fixation, proteobacteria sulfur reduction, iron reduction 38

Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Zetaproteobacteria 2 1 Marine - Uncultured/unclassified 563 ND Unknown Unknown Proteobacteria Spirochaetia 82 25 Associated with animals Heterotroph Synergistia 9 5 Anaerobic, associated Heterotroph with human GIT, thermophilic Tenericutes 45 24 Associated with animals Heterotroph

Thermodesulfobacteria 5 3 Thermophilic, aquatic Sulfate reduction

Thermotogae 32 18 Thermophilic, aquatic Sulfur oxidation, sulfate reduction, degrades methanol Verrucomicrobia 660 18 Aquatic, soil, Antarctic Degrades mucin sea ice, acidophilic Uncultured bacterium 30384 ND Unknown Unknown 39

Summary of organisms

Archaea

A total of 24 unique archaeal organisms belonged to the Euryarchaeota (17) and

Thaumarchaeota (7). Most of them were closest to species that were thermophilic, halophilic, alkaliphilic, methanogenic, and methanotrophic (Table 2).

Bacteria

A total of 59,726 sequences that represented bacteria, with 2,120 unique sequences belonging totaxa, including Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,

Armatimonadetes, Aquficae, Bacteroidetes, Chloroflexi, Firmicutes, Tenericutes, Caldisericia,

Chlorobi, Chlorochromatium, Chlymadia, Chrysiogenetes, Cloacimonates, Cyanobacteria,

Defferibacteres, Elusmicrobia, Endomicrobia, Fibrobacteres, Fusobacteria, Gemmatimonadetes,

Lentisphareae, Nitrospira, Planctomycetes, Proteobacteria (Alphaproteobacteria,

Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria, Epsilonproteobacteria, and

Zetaproteobacteria), Spirochaetia, Synergista, and others (Table 1). Most of the bacterial sequences belonged to the Proteobacteria, with 11,503 sequences. Out of these only 563 sequences were unknown and not classified into the six subclasses. The majority of the organisms (3,771) were within the Betaproteobacteria. Some notable examples are Aquinicola tertiaricarbonis (97% identity to A. tertiaricarbonis strain L10), Cupraividus metallidurans

(98% identity to C. metallidurans CH34 megaplasmid), and Methylibium petroleiphilum (97% to

M. petroleiphilum strain X3b). They have been previously isolated from contaminated water sources (industrial wastewater and groundwater). This is followed by Gammaproteobacteria,

Alphaproteobacteria, Deltaproteobacteria, Epsilonbacteria, and Zetaproteobacteria, in order of prevalence. The organisms in Bacteria live in different environments, including marine, 40 freshwater, soil/sediments, ice, plants, and animals (Table 2). According to the environmental condition where the organisms can live and survive, the lake has a mix of mesophilic, thermophilic, thermotolerant, psychrophilic, psychrololerant, alkaliphilic, halophilic, and halotolerant bacteria (Figure 3).

Table 2: Number of unique sequences and their habitat information

Habitat Number of unique sequences

Soil/sediment 611

Plants associated 175

Fish associated 45

Ice/glaciers 57

Marine 183

Associated with clinical specimens 17

41

Figure 3. Proportions of unique sequences in different environmental conditions

Halo denotes halophilic and halotolerant organisms. Thermo denotes thermophilic, hyperthermophilic, and thermotolerant organisms. Psychro denotes psychrophilic or psychrotolerant organisms. RadioA denotes radiation-resistant organisms. Acid denotes acidophilic and acidotolerant organisms. Alkali denotes alkaliphilic and alkalitolerant organisms.

Extremophiles

In this study, we found 153 sequences close to organisms that were thermophilic or thermotolerant, and 27 organisms found in the sequences were previously isolated from hydrothermal vents. This suggests that the organisms might be entering the lake from industrial cooling wastewater from the industries and electrical power generation plants around, or from other warm water sources. There also were 92 sequences close to organisms known to be psychrophilic or psychrotolerant. This is understandable given that parts of Lake Erie are cold or frozen during parts of the year. We found 11 sequences in this study that are close to radiophilic 42 and radiotolerant organisms. They are found within the Deinococcus-Thermus (7), Bacteroidetes

(1), Actinobacteria (2) and Alphaproteobacteria (1). Generally, Deinoccoccus-Thermus consists of extremophiles. A notable organism is Deinococcus radiotolerans. It is a polyextremophile referred to as one of the world's toughest organisms. It can survive extreme conditions from cold to dehydration, extreme low pressures, low pH, and high doses of ionizing radiation. It was first isolated from canned food that had been exposed to high doses of gamma radiation, and recently it was found to have survived three years in outer space (Kawaguchi et al., 2020). In our study, there were 133 organisms similar to halophilic organisms belonging to Archaea and Bacteria.

The presence of halophilic organisms is attributed to the dumping of ballast water from ships, run-offs from road salt, as well as from industrial waste. A notable example is Halomonas salaria, a halophilic, piezophilic organism that has been previously isolated from saline water

(Kim et al., 2007). In this study, we also found two other notable halophilic organisms –

Alcanivorax diesellolei and Salinicola socius, which are capable of degrading alkanes and naphthalene, respectively. Again, this hints at an anthropogenic source for these organisms. We found three extreme halophilic archaea, including Halorubrum lacusprofundi, Halorubrum lacusprofundi, Halopiger xanaduensis and Natronobacterium gregoryi. The presence of extremely halophilic organisms is attributed to the dumping of ballast water from ships, from road salt, as well as from industrial waste. In this study, there were 35 sequences close to alkaliphilic organisms in the Bacteria and Archaea group. This also points to a possible anthropogenic source for these organisms. The ballast water tanks of ships can be filled with freshwater, saltwater, or brackish water, and subsequently dump them in Lake Erie (and other lakes) thereby introducing organisms that are not native to the lake. These ships introduce water 43 from the ocean and marine environments. Alternatively, it could also be that the sequences found in this study are similar to closely related freshwater species.

Cyanobacteria

A total of 1,430 unique cyanobacterial sequences were found. This represents the third largest phylum after Proteobacteria and Bacteroidetes/Chlorobi. There were 169 unique sequences that were similar to different cyanobacterial taxa. Some are known to be toxic and known to cause the seasonal algal blooms experienced in Lake Erie in the summer months. They can produce neurotoxins and hepatotoxins, which are toxic to humans and other animals. We found four of the most common five species of cyanobacteria commonly found in the great lakes

- Microcystis aeruginosa, Anabaena circinalis, Anabaena flos-aquae, and Aphanizomenon flos- aquae. In Lake Erie, the most common harmful species associated with blooms include species of Anabaena, Aphanizomenon, and Microcystis (Rinta-kanto et al. 2005). In the western basin of

Lake Erie, the Microcystis sp. are the most dominant taxa during the summer. The Microcystis found include M. aeruginosa, M. ichthyoblabe, M. flos-aquae, M. viridis, M. wessenbergi, M. botrys, and M. panniformis. The majority of the Microcystis species were M. aeruginosa. They are known to be the primary producers of microcystin in Lake Erie. (Rinta-kanto and Wilhelm,

2006). Many species, in addition to Microcystis species, can produce microcystins, including

Planktothrix (Ernst et al., 2001) Oscillatoria (Luukkainen et al., 1993), Nostoc (Beattie et al.,

1998), Anabaena (Halinen et al., 2007; Chorus & Welker, 2021) and Gloeotrichia (Carey et al.,

2007). We found 26 different species of Anabaena. Notables commonly implicated in algal bloom formation include Anabaena flos-aquae, A, circinalis, and A. spiroides. They are known for their ability to produce microcystins (Sivonen et al., 1992). Notable species found in

Aphanizomenon were Aphanizomenon flos-aquae. It has been previously isolated from 44 freshwater lakes and found to produce microcystin and cylindrospermopsin (Saker et al., 2005).

Others include A. ovalisporum and A. issatschenkoi that are producers of cylindrospermopsin and anatoxin, respectively (Quesada et al. 2006; Wood et al., 2007).

Our findings in this study differs from the work of Beall et al., 2016, where they reported low occurrences of cyanobacteria in lake water samples under the ice. This suggests that the cyanobacteria occurrence may be low in the lake water, but are present in higher numbers in the ice and then are seeded back into the water as the ice melts in the spring. Another study by

Kitchen et al. 2018 found that Microcystis species could survive in the lake sediments through the winter and that the Lake Erie sediments might be seeding the Microcystin species into the lake water during summer. This may be the same case with Lake Erie ice, such that the organisms are preserved until spring when the ice melts, thus releasing them back to the water.

This may suggest that the low abundance of cyanobacteria in the water during winter may be due to its greater survival in the lake sediment and ice.

Cellulolytic bacteria

Cellulolytic bacteria found were within the following taxa – Actinobacteria,

Bacteroidetes, Firmicutes, Fibrobacteres, Proteobacteria, Spirochaetes, and Thermotogae

(Intriago, 2012). The majority were within the Firmicutes (mainly Clostridium sp.) and

Actinobacteria (Carere et al. 2008). In this study we found 31 bacteria that can degrade cellulose, within the Actinobacteria (6), Bacteroidetes (3), Firmicutes (15), Proteobacteria,

Alphaproteobacteria (5) and Deltaproteobacteria (1)) and Fibrobacteres (1). Notable examples include Fibrobacter succinogenes and Clostridium cellulovorans. They are usually found in soil, human and animal gut, they aid in digesting cellulose and other complex carbohydrates. It is 45 likely that some of these originated in parts of animal fees that traveled to the lake in streams and rivers.

Oil/hydrocarbon degraders

In this study, 37 sequences were found that were closest to hydrocarbonoclastic bacteria within the Alphaproteobacteria (15), Betaproteobacteria (4), Gammaproteobacteria (13) and

Actinobacteria (4). These organisms are associated with the metabolism of benzene, squalene, toluene, ethylene, nitrobenzene, and polyaromatic hydrocarbons. Previously, the lake has been found to contain moderate concentrations of hydrocarbons (Eadie and Robbins 1987). This may be attributed to proximity of Lake Erie to oil refineries, oil storage facilities, coal-powered generating plants, leaking ships and boats, and transportation of crude oil across the lake by ships and pipelines. Two notable hydrocarbon degrading bacteria found in this study were

Pseudoxanthomonas spadix and Oleispira antarctica. The latter species is a psychrophilic bacterium previously isolated from the coast of Antarctica. It is a potential biodegradation candidate for remediation of oily water (Yakimov et al. 2003). Pseudoxanthomonas spadix was earlier isolated from gasoline contaminated water and can degrade all the six BTEX compounds - benzene, toluene, ethylbenzene, and o-, m-, and p-xylene (Kim et al., 2008). Alcanivorax borkumensis, Alcanivorax dieselolei, Alcanivorax sp. can degrade alkanes, while

Desulfatibacillum alkenivorans can degrade alkenes (Cravo-Laureau 004; Yakimov et al., 2007).

Their exact function in the lake is not clear, but may be able to degrade oil released into the lake.

Pathogens

In this study, we found sequences similar to organisms associated with diseases in plants, animals, and humans. Some pathogens (e.g Escherichia coli) may be able to persist for a long time in natural environment and cause disease once host contact is established. It has been shown 46 that as the population of E. coli O157:H7 reduced, some cells could survive for up to 234 days

(Duffitt et al., 2011). River inflow is a major source of transportation of pathogens into the lake

(Brookes et al., 2004), Lake Erie has about 90% of its inflow from Detroit River, and other inflows from surrounding rivers. These inflows may be the source of supply of pathogens into the lake.

Human pathogens

We found 163 species associated with a variety of diseases, and in humans some of them cause infections that are difficult to treat. In this study, we found species of organisms transmitted through vertebrates and invertebrates, including the 13 rickettsia species. They are tick-borne and are associated with cats, dogs, and humans. Others include Anaplasma phagocytophilum, Bartonella quintana, Kingella potus, Neisseria weaveri and Francisella tularensis transmitted through ticks, lice, and animal contacts. Some can cause diseases in humans and other animals. A notable example includes Waddlia chondrophila, which has been implicated in bovine (Rurangirwa et al., 1999) and human spontaneous abortions (Baud et al.,

2014). Also, Clostridium chauvoei is known for being pathogenic in cattle, but is now known to also be pathogenic in humans. Other important species include Streptococcus dysgalactiae,

Burkholderia mallei, and B. pseudomallei. Some of these organisms are emerging pathogens whose role in human disease is still unclear and can be difficult to treat. Examples include

Nocardia cyriacigeorgica, Klebsiella michiganensis, and Mycobacterium goodii. Some are pathogenic and are foodborne. This includes Cronobacter sakazakii and Cronobacter turicensis.

Pathogenic in animals

In our study, we found organisms that are associated with livestock animals, insects, fishes, and nematodes. We found 52 unique sequences similar to organisms that have been 47 previously found to be associated with insects. At least 34 of them form symbiotic relationships with insects such as rice weevils, beetles, ticks, ants, and aphids. However, we found five organisms that are pathogenic in insects. They include Photorhabdus asymbiotica, Photorhabdus luminescens, Pseudomonas entomophila, Bacillus thuringiensis, and Brevibacillus laterosporus.

We found 132 unique sequences similar to organisms associated with animals, including sheep, goats, cattle, cats, dogs, pigs, horses, and poultry (and other avians). Of these, 42 were similar to organisms that cause infections in animals. Notable examples include Bacillus anthracis,

Bartonella grahamii, Mycoplasma agalactiae, and Ornithobacterium rhinotracheale. Some cause infections of the gastrointestinal tracts of livestock. We found 44 unique sequences similar to organisms associated with fishes, 25 of which were pathogenic. It is interesting to find that in our sequences there are three species pathogenic in salmonid fish Renibacterium salmoninarum,

Piscirickettsia salmonis --- Flavobacterium psychrophilum. Flexibacter roseolus is another notorious fish pathogen.

Pathogenic in plants

Organisms associated with plants were found, including legumes, grasses, tomatoes, potatoes, and others. Some of them are beneficial such that they contribute significantly to the growth of the plants. This includes those that form an association with the plant root nodules to fix nitrogen. Some notable examples found in this study include Frankia sp., Mesorhizobium australicum, Mesorhizobium cicero, Methylobacterium nodulans, Rhizobium etli, Sinorhizobium americanum, Sinorhizobium arboris, Sinorhizobium morelense, Burkholderia nodosa,

Burkholderia diazotrophica, and Herbaspirillum lusitanum. However, 39 unique sequences similar to pathogenic organisms in plants also were found. Some notable examples include

Xanthomonas sacchari, a pathogenic bacterium that has been previously isolated from diseased 48 sugarcane. Also present were sequences of Xanthomonas oryzae and Dickeya zeae, which are both pathogenic in rice. Dickeya dadantii is a pathogen spread through water from infected plants or recycled irrigation water. It is also an insect pathogen in aphids. Agrobacterium tumefaciens and Spiroplasma kunkelii infect maize.

Comparison of the bacterial community with Lake Erie water study

A major finding is that the winter lake water sample with and without ice cover contained low numbers of cyanobacterial sequences. However, in this study there were relatively high numbers of cyanobacteria in the ice, which could then “seed” the water with cyanobacteria as the ice melts. In both the water and ice, proteobacterial (Alphaproteobacteria, Betaproteobacteria,

Gammaproteobacteria and Deltaproteobacteria) sequences occurred in high abundance in the lake. In the water and ice sample, the most and least abundant Classes were Betaproteobacteria and Deltaproteobacteria, respectively. This suggests that in Lake Erie the diversities of organisms in the water and in ice differ. In sea ice, there are many species that naturally live within the ice, as well as in pockets of air and water enveloped by ice (Boetius et al., 2015). It would be interesting to study the water ice interfaces, as well as areas of cracks, crevices, and air pockets in Lake Erie.

Eukaryotes

In this study, there were 7,226 sequences within Eukarya, with about 1,656 unclassified sequences. They belonged to 13 major taxonomic groups, including Alveolata, Amoebozoa,

Apusozoa, Euglenozoa, Cryptophyta, Glaucophyta, Haptophyta, Katablepharidophyta,

Opisthokonta, Rhizaria, Rhodophyta, Stramenopiles, and Viridiplantae. These eukaryotes are commonly found in terrestrial, marine, brackish water, and freshwater environments. 49

The highest proportion of sequences were within the Opisthokonta, which is divided into

Fungi and Animalia, including humans. Within the fungi, there were species within nine subdivisions, including Ascomycota, Basidiomycota, Enthomophthoromycota,

Blastocladiomycetes, Chytridiomycota, Glomeromycota, Kickxellomycota, Mucoromycota, and

Entorrhizomycota. Under the Animalia, sequences within the Bilateria, Cnidaria, Ctenophora,

Phoronida, and Porifera were present. The Opisthokonta (3,006) are the most abundant, followed by the Stramenopiles (959), Alveolata (538), Viridiplantae (485), and Amoebozoa (101).

SAR (stramenopiles, alveolates, rhizaria)

The SAR clade includes Stramenopiles, Alveolata, and Rhizaria. It contains a large diversity of organisms, with at least 60,944 described species (Grattepanche et al., 2018). They represent a large part (50%) of the eukaryotic diversity (del Campo et al., 2014) and are found in diverse environments, including marine, freshwater, soil, and many are involved in symbiotic and endosymbiotic relationships. Stramenopiles include the diatoms, brown algae and oomycetes. The Alveolata consists of dinoflagellates, apicomplexa, and ciliates. The Rhizaria contains the Cercozoa, Foraminifera, and the Polycystinea. Overall, in this study, Stramenopiles comprised 72% of the unique species (sequences) within the SAR group. Diatoms predominated among the Stramenopiles (91 of the 182 unique sequences). The majority of diatoms are photoautotrophs, which partly explains their presence at the lake surface (within the ice). Small numbers are either animal pathogens (16) or plant pathogens (14). The alveolates are the next most numerous (43, in terms of unique species/sequences), comprising 17% of the total. Of these, most are dinoflagellates (42%; 18 total). One-third of the alveolate species are animal pathogens. Only a few representatives of Rhizarians were found (28 total). 50

The Stramenopiles consist of heterokonts and oomycetes. The group consists of a large diversity of organisms such as free-living flagellates, parasites, single-cell diatoms, multicellular brown algae, and water molds (Derelle et al., 2016). In this study we found 959 sequences representing Stramenopiles, with 182 unique organisms. Oomycetes (or water molds) are protists with a mycelial growth that used to be classified as fungi, but now as Stramenopiles, which has been confirmed by a great deal of genomic data. They are mostly found in freshwater environments, but some are found in soils and in marine environments, where they are either free-living or parasitic.

Notable organisms found in this study in the oomycetes group include Achlya sparrowii, Achlya colorata, Amphanomyces, astaci, and Aphanomyces helicoides. Albugo laibachii is an oomycete that is a plant pathogen of Arabidopsis thaliana making the plant vulnerable to other diseases

(Kemen et al., 2011). Aphanomyces astaci is listed among the 100 World´s Worst Invasive Alien

Species (Lowe et al., 2000), and it infects crayfish to cause the cray plaque which is devastating in the European and North American populations (Martín-Torrijos et al., 2017). Another notable

Aphanomyces species is A. helicoides that is pathogenic in plants.

Diatoms are found in freshwater, marine environments, soils, and damp surfaces. They are a major part of the phytoplankton community and play a significant role in the carbon cycle, carbon sequestration, recycling nitrogen, and silica deposition. Through photosynthesis, they can supply enormous amounts of organic material that supports ecosystems and at the same time are involved in biogeochemical cycling of other nutrients such as nitrogen (Armbrust, 2009; Bowler et al., 2010). Microscopic photosynthetic plankton (phytoplankton) provide the organic biomass on which most ocean life depends and fuel a range of essential biogeochemical processes, ranging from the generation of oxygen, the recycling of elemental nutrients, and the removal of carbon dioxide from the atmosphere. They handle around 45% of global primary production and 51 represent just 1% of Earth’s photosynthetic biomass (Field et al., 1998). This is attributed to their rapid multiplication and the photosynthetically active nature of the cells (Benoiston et al., 2017).

In this study, notable members of the diatom group were species of Aulacoseira and

Pseudo-nitzschia calliantha. Aulacoseira species found include A. islandica, A. ambigua, A. baicalensis, A. distans, A. granulata, and A. skvortzowii. These species have previously been found in the Great Lakes water environment including Lake Erie (Lashaway and Carrick 2010;

Twiss et al., 2012; Reavie and Kireta 2015 al. 2012). They are used as environmental bioindicators for phosphorous inflow in lakes. Aulacoseira islandica has been associated with winter blooms in Lake Erie (Twiss et al., 2012). Pseudo-nitzschia species found include P. calliantha, P. galaxiae, P. multiseries, and P. pseudodelicatissima. They are known to produce a neurotoxin called domoic acid (Besiktepe et al., 2008), which is responsible for the neurological disorder in humans (and other animals) known as amnesic shellfish poisoning (ASP) (Bates et al., 1989). Neurological symptoms (including fatalities) occur at levels between 0.3 and 1.3 mg/kg.

Alveolates are mostly unicellular organisms, although some species form filaments or chains, while others have large and complex cells that can extend to millimeters in length

(Grattepanche et al., 2018). They can be parasitic (e.g., apicomplexans), heterotrophic (e.g., ciliates, some dinoflagellates), autotrophic (e.g., some dinoflagellates), and mixotrophic (with true plastids or kleptoplastid; e.g., dinotoms and ciliates; Grattepanche et al., 2018). In this study

538 sequences were found representing organisms in the Alveolata with 140 unique organisms.

The Apicomplexa are single-celled, obligate intracellular protozoan organisms that all have a parasitic lifestyle. However, it is now clear that some species contain non-photosynthetic plastids, and others have been found living freely in the oceans and in the soils of Neotropical 52 forests (De Vargas et al., 2015). A notable member of the Apicomplexa group is Plasmodium, a parasitic organism that causes malaria. Perkinsus atlanticus belongs to the apicomplexan group, which lives on and is pathogenic in bivalve mollusks (e.g clams and oysters). It has become a major concern among marine researchers and food producers since its identification in 1950

(Mackin et al., 1950). Sarcocystis are members of apicomplexan that are parasitic in animals, A notable member of this group found in our study is Sarcocystis rileyi, that causes rice breast diseases in waterfowl. Others that are pathogenic in different animals include Sarcocystis fayeri

(horse pathogen), Sarcocystis moulei (Sheep and goat pathogen), and Sarcocystis muris (cat and mouse pathogen). Also, in this group, organisms were found that are pathogenic in humans and animals, a notable example being the protozoan parasite Toxoplasma gondii that infects warm- blooded animals including humans. Others include Babesia gibsoni (blood parasite in dogs),

Besnoitia darling (infects skin, eyes, mucous membranes of cats, wild animals, and domestic livestock) and Eimeria tenella (pathogenic in chickens and livestock). Neospora caninum is a member of Apicomplexa that is a major pathogen in dogs and also causes diseases in horses, goats, sheep, and deer. Plasmodium cynomolgi is an apicomplexan that is widely spread in south

Asia. It infects macaque monkeys, but rarely infects humans (Martinelli and Culleton, 2018).

Most dinoflagellate species are photosynthetic, and others are predatory and parasitic.

They can be found in both marine and freshwater environments (Hinchliff et al., 2015). Some dinoflagellates cause red tides and can produce toxins. It has become a major concern because of their harmful effects on public health, the environment, fisheries, and other organisms

(Shumway, 1990, Van Dolah, 2000). In this study, some dinoflagellates were found that are associated with red tides, including Tovellia paldangensis, Esoptrodinium sp, Peridiniopsis pernardii, Peridimium aciculiferum, Peridinium baicalense, Peridinium euryceps, Karenia 53 umbella, Karenia mikimoto. The Karenia species are found in marine environments and are known to cause dense algae blooms that are very toxic in fishes and marine animals. Pfiesteria piscicida is a dinoflagellate associated with harmful algal blooms, responsible for killing fishes due to its toxicity and its toxins may have adverse effects in humans (Grattan et al., 2001). Some cold-water dinoflagellates were also found in this research, including Scrippsiella hangoei,

Polarella glacialsis, and Prorocentrum micans. Dinoflagellates can provide ecological benefits by forming associations with Cnidaria (e.g Montastraea cavernova), which creates coral reefs that support some remarkably diverse and productive marine ecosystems (Coffroth et al., 2006).

Because the dinoflagellate sequences found in this research are marine organisms, the origins of the sequences are likely being transported on ships that have recently been travelling in the

Atlantic Ocean.

Ciliates are unicellular, heterokaryotic organisms with a macronucleus and micronucleus that are different in size and function (Raikov 1972). Ciliates are found in a variety of habitats including on or inside various animals as commensals or parasites. Some species can colonize the surface of crustaceans and water beetles, while others can infect fishes (Ichtyophthirius) and humans (Balantidium) (Foissner et al., 2007). In this study, Cryptocaryon irritans, a marine fish pathogen, was found. Kuklikophrya ougandae also was found. It has been previously isolated from soil (Foissner et al., 2008), and feeds on cyanobacteria. Also found was Notohymena apoaustralis, a freshwater ciliate that has been previously isolated from sewage sludge (Naqvi et al., 2016). Stentor muelleri and S. roeselii were found in this study and are usually found in freshwater feeding on bacteria and algae, often on filamentous algae. Another notable organism found was Tokophrya quadripartita, which infects copepods and has been previously found in lake Michigan (Evans et al., 1979). 54

Rhizarians are eukaryotic, single-celled, and free-living organisms with few parasitic members commonly found in freshwater and soil habitats (Grattepanche et al., 2018). While most are non-photosynthetic, members of one group, the chlorarachniophytes are photosynthetic.

In this study sequences were found from rhizarians belonging to chloroarachiphytes, cercozoans, foraminifera, and radiolarians. Two notable organisms found were Plasmodiophora brassicae, which infects plants causing the disease known as clubroot disease; and Rhogostoma minus that are pathogens of trout.

While the majority of species indicated by the sequence comparisons were freshwater species, over 40% were from marine sources, and 4% were brackish water species. There are at least two possible explanations for the large number of marine taxa. The first is that the sequence searches resulted in listing species that were closely related to the sequence in the Lake Erie ice sample, thus indicating a marine species that was closely allied taxonomically to the species that was in the ice sample. The second possibility is that ships transiting through the lake are depositing marine organisms and their nucleic acids into the lake as they pass or discharge ballast or cooling water.

Fungi

In this study, we found 162 unique sequences from fungi that belong to the Ascomycota,

Basidiomycota, Blastocladiomycota, Chytridiomycota, Kickxellomycota, Microsporidia

Chytridiomycota, Kickxellomycota, Microsporidia, Mucoromycota, Zygomycota, and

Glomeromycota. They are mostly Ascomycota (90) and Basidiomycota (43) with few species in the other groups. Fungi have been previously found in freshwater lake and terrestrial environments, with most of them belong to the Ascomycota, Basidiomycota, Chytridiomycota, and Glomeromycota (Shearer et al., 2007). Fungi play a key role in the degradation and recycling 55 of organic materials (e.g., plant leaves, wood, decaying materials) in terrestrial and aquatic environments including freshwater lakes. These species include pathogenic and non-pathogenic species found in a wide variety of environmental conditions (hot and cold, including in ice).

In this study, the members of the Ascomycota were mostly pathogenic species, causing disease in plants and allergenic to humans and animals. Notable examples that are pathogenic in plants include Alternaria alternata, Alternaria tomato, Eremothecium gossypii, Fumiglobus pieridicola, Leptosphaeria biglobosa, Neofusicoccum parvum, Neofusicoccum parvum,

Phaeosphaeriopsis glaucopunctata, and several others. Members of Ascomycota that are pathogenic or allergenic in humans include Pseudogymnoascus destructans, Rasamsonia emersonii, Rhinocladiella mackenziei, Millerozyma farinosa, Pseudogymnoascus destructans,

Cladophialophora yegresii, and Alternaria longipes. Three members of the Ascomycota found in this study are associated with insects, including Metarhizium anisopliae (pathogenic in insects), and Metschnikowia agaves and M. similis (infect daphnia and beetles). Amongst the

Basidiomycota group, several species are indicated, including Armillaria mellea, Coltriciella globosa, Heterobasidion irregulare, Coniophora puteana, Melanopsichium pennsylvanicum,

Phanerochaete carnosa, Phlebiopsis crassa, Pseudozyma hubeiensis, Sporisorium scitamineum,

Stereum gausapatum, Tilletiopsis cremea, T. lilacina, T. washingtonensis, and Trametes versicolor, Punctularia strigosozonata. Amongst the 43 species found in the Basidiomycota, only three are pathogenic in humans and they include Blastomyces gilchristii, Cryptococcus sp., and Trichosporon asahii. Most of the fungus species that were found are non-pathogenic except

56 for a member of Blastocladiomycota, Paraphysoderma sedebokerense (pathogenic in microalgae), and Microspridia sp. (pathogenic in honeybee).

Arthropods

In this study, 151 unique sequences are present that represent different kinds of arthropods. They were mostly crustaceans which include copepods, cladocerans, and parasitoids.

Copepods are small crustaceans that feed on phytoplankton, bacteria, and protists. They are found in either marine or freshwater environments. They are one of the most important marine animals as they form a major part of the food web that links benthic and pelagic organisms, fish and birds (Szaniawska, 2018). Crustaceans are a major carbon sink, because when they die their shells sink to the bottom of the lakes and oceans, thus taking the carbon out of the carbon cycle for some time. Also, they are an important part of the food web because they feed on small insects and other larger insects feed on them.

Daphnia species are small planktonic crustaceans (water fleas) commonly found in freshwater environments including large lakes, temporary pools, and vernal pools (Ebert, 2005). They are the most dominant zooplankton in water environments and are seasonally found in abundance during the spring and summer months (Kasprzak et al., 1999). They serve as food for larger aquatic organisms, feed on smaller organisms (e.g diatoms) and thus they are essential parts of food webs (Ebert, 2005). In this study we found nine Daphnia species including D. ambigua, D. dentifera, D. Dubia, D. laevis, D. longicephala, D. magna, D. occidentalis, D. pulex, and D. pulicaria. Also, two species related to the Daphnia species were found, Daphniopsis ephemeralis and Daphniopsis truncate. Daphnia species are of interest in lake ecology dynamics as they are associated with high transparency of lake environments during summer because they easily feed on smaller flagellates and diatoms from early spring (Kasprzak et al., 1999). Like 57 other crustaceans, cladocerans (including Daphnia sp.) are found in freshwater and feed on smaller organisms such as bacteria and algae through filter feeding. In this study, we found sequences that represent Simocephalus species, including S. beianensis, S. heilongjiangensis, S. serrulatus, and S. vetuloides. They are zooplankton commonly found in lakes and ponds. Some species are parasitoids (infects and kill the host). Notable examples among our sequences were

Copidosoma floridanum, Diaeretus leucopterus, and Fopius arisanus, which infect moths, aphids and tephritid fruit flies, respectively. Other important species found in this study include those that spread human diseases such as Aedes aegypti, Anopheles albimanus, and Cimex lectularius. Aedes aegypti spreads diseases such as yellow fever, Zika, dengue fever, and chikungunya. It has been previously found from the southern US through parts of the Midwest.

Cimex lectularius, commonly known as the bed bugs, infest warm blooded animals including humans and feed off their blood. They are also associated with the infestation of bedding, a major environmental problem in the US. human host and feed off of blood. Because of the wide distributions of arthropods in and around Lake Erie it is not surprising to find their nucleic acids in the lake ice.

Chordata

Chordates are found in marine, freshwater, and terrestrial environments. In this study 219 sequences were found representing the Chordata, with 42 unique species. These sequences indicate the presence of mammals (42.9%); fish (38.1%); reptiles (9.5%); and amphibians, birds, mollusks, and lancelets (collectively 2.4%). These species are found include terrestrial (40.5%); marine/brackish water/estuary (38.1%); freshwater (21.4%) environments.

58

Human activities associated with organisms found in Lake Erie

Our findings showed that organisms found in Lake Erie ice have been influenced by the human activities surrounding the lake. These include agricultural activities such as pig farming, crop farming, and poultry farming. Bovine sequences indicative of agricultural activities were found, as well as sequences from other domestic and native animal species. In addition, sequences from both native, agricultural, and cultivated plants were found. As with other parts of this study, Lake Erie exhibits a mixture of species that are native to the lake, as well as introduced species, some of which can be considered contaminants or pollution, and others that are invasive. There are organisms in the lake that indicate that they are foreign and may have been introduced by ships that dump their ballast water in the lake, including the well-studied zebra mussels (Dreissena polymorpha) and quagga mussels (D. rostiformis). We found thermophilic organisms indicative of dumping industrial water from manufacturing and electrical generation plants, as well as dumping from ships. We also found hydrocarbon-degrading organisms that may be attributed to sunken or leaking ships, recreational boating, and/or the presence of oil/power industries surrounding the lake. We found organisms that may indicate dumping of human, animal, and hospital waste. Many of the organisms were associated with gastrointestinal tracts, including pathogenic species. We found sequences close to Escherichia coli 0157, a serious human pathogen, likely being from human or other animal intestinal tracts.

Metabolic analysis

Organisms present in a specific environment are able to live together and benefit from each other as a result of diverse metabolic capabilities in a way that each organism depends on other metabolic products produced by other organisms and vice versa. The organisms found in

Lake Erie demonstrated notable metabolic activities such as carbon fixation, ammonium 59 oxidizer, iron oxidation, methanogenic, methylotrophic, methanotrophic, and nitrogen fixing ability. Major metabolic potentials demonstrated by organisms represented by the mRNA sequences derived from this study are shown in Figure 4-7.

Methanogenesis

Many species of Archaea are generally classified as methanogenic organisms based on phylogenetic analysis (Boone et al. 1993), however, most of the methanogens are within the

Euryarchaeota. The product of this process is methane, which other organisms are able to utilize

(discussed below). They are able to produce methane from different sources such as hydrogen and CO2, acetate, formate, hydrogen and methanol (Wagner et al., 2018). Amongst the archaeal sequences, we found 13 organisms that are capable of methanogenesis. An important example is Methanocella arvoryzae, which is a hydrogenotrophic methanogen that is capable of producing methane by utilizing hydrogen and CO2, and was previously isolated from a rice field

(Sakai et al., 2010). This is not surprising considering the high agricultural activity occurring around Lake Erie. Methanogenic archaea are frequently found in rice fields. These fields have been previously implicated in an increase of methane emission (Chen and Prinn, 2006). This suggests that the agricultural activity around Lake Erie is influencing the types of organisms found in the area. Another example of hydrogenotrophic methanogen found in this study is Methanoregula boonei which was previously isolated from a peat bog (Brauer et al., 2011).

Methanogenic archaea play a top role in the global carbon cycle and function in the processing of about 1- 2% of the carbon fixed each year (Reeburgh et al. 1993). These organisms can be of benefit in biotechnology, and in the treatment of sewage plants. However, the major implication of methanogenesis is that the methane produced is a major greenhouse gas that contributes 60 significantly to global climate change (Wagner et al., 2018). Taxa found in this study that are capable of methanogenesis are shown in Figure 4.

Figure 4. Potential methane metabolic abilities represented in the 454 sequences from Lake Erie ice

Methylotrophy

Methylotrophic organisms are capable of using one-carbon compounds such as methane and methanol, as their source of carbon and energy (Chistoserdova and Lidstrom, 2013).

Methane is produced biotically by methanogenic archaea and through human and industrial activities such as burning, coal mining and oil industrial activities, and agricultural activities

(plants emit methane, and agricultural practices can cause increases in methanogen populations)

(Iguchi et al., 2015). These organisms are found in both aquatic and terrestrial environments such as water, soil, lakes, wetlands, plants (Trotsenko and Murrell 2008), and extreme environments 61

(Antony et al. 2010). There are non-methane utilizing and methane utilizing methylotrophs. The latter are usually found within the Proteobacteria, (Alphaproteobacteria, Betaproteobacteria,

Gammaproteobacteria) and in the bacteria families Bacillaceae, Pseudonocardiaceae, and

Micrococcaceae (Chistoserdova and Lidstrom, 2013). In this study, we found 26 non-methane utilizing organisms, nine of which were in the Alphaproteobacteria and Betaproteobacteria, five were in the Family Piscirickettsiaceae of the Gammaproteobacteria, and one each was found in the Families Pseudonocardiaceae (Actinobacteria) and Bacillaceae (Firmicutes) (figure 4). A notable organism found among the sequences was Methanosalsum zhilinae. It is an archaeon in the Euryarchaeota that has been previously isolated from a haloalkaliphilic lake. There are areas around and under Lake Erie that are mined for salt and other minerals, which could be the source of this species.

Another notable methylotrophic organism found in the sequence that is able to utilize methanol is Bacillus methylotrophicus. It has been previously isolated from plants and has the ability to promote plant growth. The methane-utilizing methylotrophs are called methanotrophs.

They are able to utilize methane exclusively as a source of carbon and energy and play an important role in the carbon cycle. They are able to reduce methane emitted in the environment and thus might prove useful in reducing methane emissions as one method to reduce the effects of this greenhouse gas (Kumar et al., 2018). As expected, they are found in environments where methane is produced and present, such as wetlands, soils, marshes, rice paddies, landfills, lakes, oceans, and streams (Dalal and Allen, 2008). Many of the methanotrophs are within the

Proteobacteria (Alphaproteobacteria and Gammaproteobacteria) and Verrucomicrobia (Ho et al.,

2012). 62

In this study, 21 sequences were found from organisms that have the ability to utilize methane. Most were within the Proteobacteria (Alphaproteobacteria), while two in the

Verrucomicrobia (figure 4). Previous studies have identified three Verrucomicrobia species in acidophilic environments that are able to utilize methane (Dunfiel et al., 2007, Pol et al., 2007,

Islam et al., 2008). The two organisms are thermoacidophilic Methylacidiphilum fumariolicum and M. infernorum. Methylacidiphilum fumariolicum was isolated from a volcanic region (Pol et al., 2007) and M. infernorum was first isolated from a soil sample collected from a methane-emitting geothermal field (Hou et al., 2008). It is also important to note that we found one sequence that is close to an unculturable organism called Methylomirabilis oxyfera, found in the candidate NC10 phylum, a unique organism that is widely distributed in agricultural soils

(Shen et al., 2016). It is capable of utilizing methane and reducing nitrite (Ettwig et al., 2010).

This is interesting because of its ability to carry out both processes linking the carbon and nitrogen cycles in one organism, and thus plays an important role in biogeochemical processes and in the reduction of methane emitted into the environment (He et al., 2016).

Nitrogen fixation

Some bacteria are able to fix atmospheric N2 into NH3 (Lam et al., 1996). These bacteria are called diazotrophs and they are usually found in soil, water, and associated with plants such as some legumes and grasses. The free-living diazotrophs are found within the

Alphaproteobacteria (Rhizobium, Bradyrhizobium, Rhodobacterium), Betaproteobacteria

(Burkholderia, Nitrosospira), Deltaproteobacteria, Gammaproteobacteria (Pseudomonas,

Xanthomonas), Firmicutes, and Cyanobacteria (Rosenblueth et al., 2018). Some diazotrophs form symbiotic relationships with plants (some legumes) to fix nitrogen. They are found within genera Rhizobium, Bradyrhizobium, Mesorhizobium, and Sinorhizobium within 63

Alphaproteobacteria (Graham and Vance 2003). Nitrogen is a vital nutrient required for plant growth (Santi et al., 2013). However, plants are unable to directly use N2, but it is available to them in the form of ammonium and nitrates (Santi et al., 2013). Often, the amount of available nitrogen in soils is insufficient for crop plants. More than half of the quantity of nitrogen fertilizer amended into agricultural soil is used by the plants, while the remainder leaches into the environment resulting in nitrate contamination of the surrounding environment (Mahmud et al.,

2020) and subsequent eutrophication of streams, rivers, and lakes. This contamination is a source of concern as a result of issues related to health and environmental sustainability. It is worth noting that diazotrophs play major roles in contributing great amounts to the total nitrogen of the biosphere, contributing about 30 – 50% of the total nitrogen in crop fields (Ormeño-Orrillo et al.,

2013), thus reducing the need to use nitrogen fertilizer on the fields. In our study, 97 organisms were found that have the ability to fix nitrogen. Due to the high agricultural activity around Lake

Erie, it attracts substantial numbers of nitrogen-utilizing organisms because of the regular use of nitrate fertilizers, with a smaller proportion of organisms fixing unutilized nitrogen. As shown in figure 5, the majority of nitrogen fixers found in this study belong to the Proteobacteria (69 total;

42 Alphaproteobacteria, 19 Betaproteobacteria, 6 Gammaproteobacteria, and 2

Deltaproteobacteria), while others were within Cyanobacteria (14), Firmicutes (9), Bacteroidetes

(1), and Endomicrobia (1). A notable nitrogen fixer found in this study was Azoarcus tolulyticus, a bacterium that is capable of degrading toluene. It has been previously isolated from petroleum contaminated freshwater sediment (Zhou et al., 1995). It is not surprising to find such organisms in the ice sample because toluenes naturally occur in crude oil, and there are many petroleum- based and petroleum-dependent industries around Lake Erie. In our study, diatoms were found that are capable of forming associations with nitrogen fixing cyanobacteria. This association is 64 called diatom-diazotroph associations (DDA). Diatoms that are able to form this relationship are species within Hemiaulus, Rhizosolenia, Chaetoceros Guinardia, and Bacteriastrum (Caputo et al., 2018). In this study we found eight sequences in the genus Chaetoceros: C. compressus, C. contortus, C. decipiens, C. hirtisetus, C. laciniosus, C. rotosporus, C. simplex, and C. socialis.

The presence of DDAs have been associated with algal blooms that appear regularly during the summer, but their role is often ignored (Caputo et al., 2018, Follet et al., 2018). However, these blooms are a major concern in Lake Erie, as they are indicators of the conditions in the lake.

Figure 5. Potential nitrogen metabolic abilities represented in the 454 sequences from Lake Erie ice

Anaerobic ammonium oxidation

Anaerobic ammonia oxidizing bacteria are able to oxidize ammonia and reduce nitrite to produce nitrogen gas. The process is called anammox reaction. It was originally found in wastewater, however it has now been found in a variety of environments including marine, estuary, freshwater, and terrestrial habitats (Sonthiphand et al., 2014). Anammox bacteria are 65 also found in extreme environments such as extremely saline, cold, and hot environments

(Byrne et al., 2009; Russ et al., 2013). In this study we found seven sequences that were the closest to Anammoximicrobium moscowi, Brocadia annamoxidans, Brocadia sinica, Caldilinea aerophila, Isosphaera pallida, Jettenia asiatica, and Kuenenia stuttgartiensis, they belong to the planctomycetes group (Figure 5). They are of high interest amongst microbial ecologists and biotechnologists because of their unusual and unique metabolic capabilities. Anammox bacteria are responsible for up to 50% and 40% of the nitrogen loss from ocean and freshwater lakes, respectively (Dalsgaard et al., 2005; Yoshinaga et al., 2011). The presence of the unique group in

Lake Erie is not surprising, because low temperature favors the presence anammox bacteria

(Russ et al., 2013). Their presence in this lake also confirms the fact that anammox bacteria thrive in low oxygen environments such as those found in some regions of Lake Erie.

Ammonia oxidation

The process of nitrification includes two steps where ammonia oxidizing microorganisms

(bacteria and archaea) and nitrite oxidizing bacteria are involved in each step, respectively. Ammonia oxidizing microorganisms, including some bacteria and archaea, play important roles in nitrogen recycling. Although it was first thought that only bacteria are capable of ammonium oxidation, we now know that archaea too are capable of doing this (Treusch et al.,

2005). In this study sequences from both bacteria and archaea were found that indicate the presence of species that are able to oxidize ammonia to nitrite. In this study, signatures of 12 organisms were found that are capable of ammonia oxidizing within the Thaumarchaeota (3) and

Proteobacteria (Betaproteobacteria (6) and Gammaproteobacteria (3). The archaeal sequences include those from Nitrosoarchaeum limnia, Nitrosopumilus koreensis, and Nitrosopumilus maritimus. The organisms within the Betaproteobacteria include species of Nitrosomonas 66 communis, Nitrosomonas europaea, Nitrosomonas eutropha, Nitrosomonas oligotropha, Nitrosomonas sp., and Nitrosospira briensis. Organisms within the

Gammaproteobacteria include Nitrococcus oceani, Nitrosococcus halophilus, and Nitrosococcus watsoni. All the taxa represented are shown in figure 5. Ammonia oxidizers have been reported to occur in greater numbers during the summer than in the winter (Beman et al., 2012). This might explain the reason why low numbers of ammonia oxidizing archaea and bacteria were found in the ice.

Nitrite oxidizing bacteria

Nitrite oxidizing bacteria are involved in the second step of nitrification, converting nitrite to nitrate (Prosser, 1989). These organisms are found within the Proteobacteria

(Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria),

Chloroflexi, Nitrospirae, and the newly proposed Nitrospinae (Watson et al., 1986, Alawi et al.,

2007, Starkenburg et al., 2008, Spieck et al., 2014). In this study sequences close to

Magnetobacterium bavaricum, Nitrospira moscoviensis, and Nitrospira sp. were found within the Nitrospira, and Nitrotoga arctica, within the Betaproteobacteria. These organisms play a significant role in the nitrogen cycle, collaborating with ammonia-oxidizing bacteria to ensure a nitrification step in the nitrogen cycle. If nitrite oxidation does not occur, nitrates will be unavailable for plants and microbes that are vital to them (Daims et al., 2016). Additionally, the presence of nitrite prevents the growth of some microbes (Castellani and Niven 1954), and the increase in nitrite is harmful to fishes and other aquatic organisms as it converts hemoglobin to methemoglobin, causing severe oxygen deprivation (Lewis and Morris 1986). This further emphasizes the importance of nitrite oxidizers in aquatic ecosystems.

67

Denitrifying bacteria

Denitrifying bacteria can convert nitrate or nitrite to di-nitrogen or nitrogen in the absence of oxygen. Most are within the Proteobacteria (Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria) (Ji et al., 2015). In this study, we found 33 sequences close to bacteria capable of denitrification within the Alphaproteobacteria (4), Betaproteobacteria (8),

Gammaproteobacteria (14), Deltaproteobacteria (1), Actinomycetes (1), Aquificae (1),

Deferribacteres (3), and one Methylomirabilis oxyfera within the candidate phylum NC10. This suggests that denitrification ability is widespread in bacteria and not limited to certain phyla or genera as earlier suggested. Denitrifiers are involved in the nitrogen cycle to produce nitrogen ultimately. However, not all of them can carry out complete denitrification to nitrogen, resulting in nitrite formation, and the release of nitric oxide and nitrous oxide (greenhouse gases) that contribute to global climate change (Ravishankara et al., 2009, Erisman et al., 2011). The process of denitrification in the absence of oxygen also contributes to methane oxidation, which is a potent greenhouse gas. This is further driven by human activities such as pollution and agricultural activities (Raghoebarsing et al., 2006; Erisman et al., 2011). Denitrifying bacteria are responsible for removing nitrogen from the environment and may help control the degree of eutrophication (Seitzinger, 1986). Some are useful in bioremediation and can be used in waste treatment as they convert large amounts of nitrogen. Therefore, the denitrifying bacterial population in this lake is a very crucial component of the lake ecology. However, it can be inferred from our results and from the nitrogen cycle, the problems that are the result of human activities are complex and will be difficult to rectify. The fact that these organisms exist in the ice during the winter when microbial populations are lower in the water, indicates that a large reservoir of microbes is being released into the water as the ice melts during the spring. 68

Sulfur metabolism

Organisms capable of sulfur metabolism are found in sulfur rich environments and are often reported amongst bacteria (Chlorobi and Proteobacteria) and Archaea. They are commonly found within the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. In this study, 21 unique organisms were found that belongs to the 5 taxa, including Actinobacteria,

Nitrospira, Proteobacteria (Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria),

Thermotogae, and Deinococcus-Thermus (figure 6). One unique organism each was found in the

Actinobacteria, Nitrospira, Deinococcus-Thermus and Thermotogae, including

Acidithiomicrobium sp., Magnetobacterium bavaricum, Sulfurihydrogenibium sp., and Thermus scotoductus, respectively. Three organisms were found in the Betaproteobacteria, including

Sulfurisoma sediminicola, Sulfuritalea hydrogenivorans and Thiobacillus thioparus. Ten organisms were found in the Gammaproteobacteria, including Halothiobacillus neapolitanus,

Sulfuricaulis limicola, Thioalkalimicrobium aerophilum, Thioalkalimucrobium cyclicum,

Thioalkivibrio sp., Thioalkalivibrio sulfidophilus, Thioalkalivibrio versutus, Beggiatoa leptomitiformis, Ruthia magnifica, and Thiovicoccus mobilis. Four organisms were found in the

Deltaproteobacteria, including Sulfuricurvum kujiense, Sulfurimonas autotrophica, Sulfurimonas denitrificans and Sulfurivicum sp. 69

Figure 6. Potential sulfur metabolic abilities represented in the 454 sequences from Lake Erie ice

Sequences that represent organisms that can reduce sulphate were found, belonging to eight phyla, including Proteobacteria (Deltaproteobacteria and Gammaproteobacteria),

Thermodesulfobacteria, Firmicutes, Defferibacteres, Aquificae, Bacteroidetes, Thermotogae and

Defferibacteres (figure 6). The following sulphate reducing organisms found in the

Deltaproteobacteria include Desulfobacca acetoxidans, Desulfobacterium autotrophicum,

Desulfarculus baarsii, Desulfatibacillum alkenivorans, Desulfobacca acetoxidans,

Desulfobacterium autotrophicum, Desulfobacula toluolica, Desulfococcus oleovorans,

Desulfohalobium retbaense, Desulfomicrobium baculatum, Desulfomonile tiedjei,

Desulfonatronum lacustre, Desulfovibrio aespoeensis, Desulfovibrio africanus, Desulfovibrio alaskensis, Desulfovibrio gigas, Desulfovibrio desulfuricans, Desulfovibrio hydrothermalis,

Desulfovibrio magneticus, Desulfovibrio psychrotolerans, Desulfovibrio salexigens,

Desulfovibrio vulgaris, Desulfotalea psychrophila, Desulfovibrio piezophilus, and

Syntrophobacter fumaroxidans. Two were found in the Gammaproteobacteria, Thiocystis 70 violascens and Vesicomyosocius okutanii. All the three organisms found in the

Thermodesulfobacteria that can reduce sulphate are also mostly thermophilic or thermotolerant, including Thermodesulfobacterium commune, Thermodesulfobacterium geofontis, and

Thermodesulfatator indicus. One sequence each was found in the Aquificae, Bacteroidetes,

Thermotogae and Defferibacteres that are able reduce sulfate, including Desulfurobacterium thermolithotrophum, Desulfosporosinus meridiei, Thermotoga elfii, and Deferribacter desulfuricans, respectively. Sequences that represent members of the Firmicutes that can reduce sulfate were found, including Desulfotomaculum gibsoniae, Desulforudis audaxviator,

Desulfosporosinus acidiphilus, Desulfosporosinus orientis, Desulfosporosinus meridiei,

Desulfotomaculum acetoxidans, Desulfotomaculum carboxydivorans, Desulfotomaculum kuznetsovii, Desulfotomaculum reducens, Desulfotomaculum ruminis, Thermodesulfobium narugense, and Thermodesulfovibrio yellowstonii. Other unique organisms were found that can reduce sulfur and they were found in the Deltaproteobacteria and Firmicutes, including

Desulfurella acetivorans, Desulfuromonas acetoxidans, Sulfurospirillum deleyianum,

Shewanella amazonensis (all Deltaproteobacteria), and Clostridium sulfidigenes (Firmicutes).

Organisms involved in sulfur metabolism are important in the cycling of sulfur and protection of organisms in aquatic environment. For example, dissimilatory sulfur oxidation, a process carried out by sulfur oxidizing bacteria, can protect marine organisms from sulfide toxicity (Lavik et al.,

2009). In a hypoxic lake like Lake Erie, the presence of these organisms may be beneficial to mitigate consequences that arises from the lack of oxygen (e.g., loss of marine life, disruption of food webs).

71

Other notable metabolic capabilities

Other metabolic activities represented by the species identified in this study include degradation of iron, manganese, chlorate, and metals, such as uranium. Iron oxidizing bacteria are taxonomically found in the following taxa Proteobacteria (Alphaproteobacteria,

Betaproteobacteria, Gammaproteobacteria, and Zetaproteobacteria), Actinobacteria, Firmicutes,

Chlorobi and Nitrosospirae, and among the Archaea - Euryarchaeota and Chrenarcaeota (Hedrich et al., 2011; Emerson et al., 2013). In this study, sequences representing organisms were found that were capable of iron oxidation in the following taxa – Firmicutes (Desulfosporosinus orientis, Sulfobacillus acidophilus), Nitrospira (Leptospirillum ferriphilum and Leptospirillum ferrooxidans), Betaproteobacteria (Acidovorax ebereus, and Gallionella capsiferriformans), and

Gammaproteobacteria (Marinobacter aquaeolei) (figure 7). Those that have the potential to reduce iron were found in Gammaproteobacteria (Ferrimonas balearica, Shewanella amazonensis, Shewanella oneidensis, Shewanella putrfaciens) and Delatproteobacteria

(Anaeromyxobacter sp., Geobacter daltonii, Geobacter pickeringii, Geoalkalibacter subterraneus).

72

Figure 7. Potential iron metabolic abilities represented in the 454 sequences from Lake Erie ice

The following organisms that were found among the sequences are able oxidize acetate -

Firmicutes (Thermacetogenium phaeum, Tepidanaerobacter acetatoxydans), Deltaproteobacteria

(Desulfurella acetivorans, Desulfuromonas acetoxidans, Geobacter uraniireducens). The following organisms, Desulfovibrio alaskensis , Geobacter daltonii, Geobacter uraniireducens, within the Deltaproteobacteria, can reduce heavy metals such as uranium. Sequences were found representing Dechloromonas hortensis, and Deefgea rivuli which can reduce chlorate and perchlorate, respectively. Organisms represented by the sequences found in this study are capable of alternative metabolic functions outside the common basic metabolic capabilities. This suggests that Lake Erie organisms exhibit a wide range of metabolic capabilities, including some that appear to have been influenced by human activities.

Degradation of organic compounds

Four organisms were found that are capable of degrading polychlorinated biphenyls

(PCBs), including Caldimonas hydrothermale, Rhodococcus jostii, Burkholderia xenovorans and

Variovorax paradoxus. Delftia sp. and Stenotrophomonas acidaminiphila degrade polycyclic 73 aromatic hydrocarbons (PAH). While this is an encouraging finding in that useful bacteria exist in the lake ice, it also indicates that aromatic hydrocarbon pollution has likely led to the presence of these organisms in the lake.

Conclusions of findings

Metagenomic and metatranscriptomic sequences derived from this study showed that the

Lake Erie Ice contains organisms that are alive and functioning. Major microbial community found in the ice include Bacteria (Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,

Bacteroides, Chloroflexi, Chlorobi, Firmicutes, Tenericutes, Thermotogae, Deinococcus-

Thermus, and Verrucomicrobia), Eukarya (diatoms, red algae, green algae, higher plants, fungi, insects, mollusks, nematodes, platyhelminths and chordates) and archaea (Euryarchaeota and

Thaumarcheota). The majority of organisms are characteristic of those in large lakes. However, a substantial proportion indicates an input of organisms from anthropogenic sources. These include human associated organisms, species from industrial activities, those from ships, and additional organisms from recreational and agricultural sources. Many metabolic pathways and cycles are well-represented among the sequences. These include major metabolic pathways that involve nitrogen, carbon, methane, iron, and sulfur. During winter, the Lake Erie ice has a larger diversity of bacteria than the water. This may indicate that the lake ice serves as storage for many organisms that are released into the lake upon melting of the ice. Organisms pathogenic in humans, animals and plants were found in the ice, this may indicate that the lake harbors pathogens that are able to persist for a long time in the environment.

74

Chapter ii references

Alawi, M., Lipski, A., Sanders, T., Pfeiffer, E.M., and Spieck, E. (2007). Cultivation of a novel

cold-adapted nitrite oxidizing betaproteobacterium from the Siberian Arctic. ISME J.

1(3):256-64 doi: 10.1038/ismej.2007.34.

Antony, C., Kumaresan, D., Ferrando, L. Boden, R., Mousers, H., Scavino, A., Shouche,

Y.S., and Murrell, J.C. (2010). Active methylotrophs in the sediments of Lonar Lake,

a saline and alkaline ecosystem formed by meteor impact. ISME J 4, 1470-

1480 https://doi.org/10.1038/ismej.2010.70.

Armbrust, E.V. (2009). The life of diatoms in the world's oceans. Nature. May

14;459(7244):185-92 doi: 10.1038/nature08057.

Bates, S. S., Bird, C. J., Freitas, A. D., Foxall, R., Gilgan, M., Hanic, L. A., Johnson, G. R.,

McCulloch, W., Odense, P. Pocklington, R., Quilliam, M. A., Sim, P. G., Smith, J. C.,

Subba Rao, D. V., Todd, E. C. D., Walter, J. A. and Wright, J. L. C. (1989). Pennate

diatom Nitzschia pungens as the primary source of domoic acid, a toxin in shellfish from

eastern Prince Edward Island, Canada. Canadian Journal of Fisheries and Aquatic

Sciences, 46(7), 1203-1215.

Baud, D., Goy, G., Osterheld, M. C., Croxatto, A., Borel, N., Vial, Y., Pospischil, A., and Greub,

G. (2014). Role of Waddlia chondrophila placental infection in miscarriage. Emerging

infectious diseases, 20(3), 460–464. https://doi.org/10.3201/eid2003.131019.

Beall, B. F. N. Twiss M. R., Smith, E., Oyserman, B. O., Rozmarynowycz, M. J., Binding, C. E.,

Bourbonniere, R. A., Bullerjahn, G.S., Palmer, M.E., Reavie, E.D., Waters, M.K.,

Woityra, W.C., and McKay, R.M.L. (2016). Ice cover extent drives phytoplankton and 75

bacterial community structure in a large north-temperate lake: implications for a warming

climate. Environ. Microbiol. 18(6), 1704–1719. doi:10.1111/1462-2920.12819.

Beattie, K.A., Kaya, K., Sano, T., and Codd, G.A. (1998). Three dehydrobutyrine-containing

microcystins from Nostoc, Phytochemistry, 47(7): 1289 – 1292.

Beman, J.M., Bertics, V.J., Braunschweiler, T., and Wilson, J.M. (2012) Quantification of

ammonia oxidation rates and the distribution of ammonia-oxidizing archaea and

bacteria in marine sediment depth profiles from Catalina Island, California. Front.

Microbio. 3:263 doi: 10.3389/fmicb.2012.00263.

Benoiston, A. S., Ibarbalz, F. M., Bittner, L., Guidi, L., Jahn, O., Dutkiewicz, S., and Bowler, C.

(2017). The evolution of diatoms and their biogeochemical functions. Philosophical

transactions of the Royal Society of London. Series B, Biological sciences, 372(1728),

20160397. https://doi.org/10.1098/rstb.2016.0397.

Benson, B.J., Magnuson, J.J., Jensen, O.P., Card, V.M., Hodgkins, G., Korhonen, J.

Livingstone, D.M., Stewart, K.M., Weyhenmeyer, G.A., and Granin, N.G. (2012).

Extreme events, trends, and variability in Northern Hemisphere lake-ice

phenology (1855–2005). Clim. Change., 112, 299–323 10.1007/s10584-011-0212-8.

Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,

G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of

seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.

doi:10.4319/lo.2013.58.6.1998.

Besiktepe, S., Ryabushko, L., Ediger, D., Yilmaz, D., Zenginer, A., Ryabushko, V., and Lee, R.

(2008). Domoic acid production by Pseudo-nitzschia calliantha Lundholm, Moestrup et 76

Hasle (bacillariophyta) isolated from the Black Sea. Harmful Algae, 7(4), 438-442.

https://doi.org/10.1016/j.hal.2007.09.004.

Boetius, A., Anesio, A. M., Deming, J. W., Mikucki, J. A., and Rapp, J. Z. (2015). Microbial

ecology of the cryosphere: sea ice and glacial habitats. Nature reviews. Microbiology,

13(11), 677–690. https://doi.org/10.1038/nrmicro3522

Boone, D.R., Whitman, W.B., and Rouvière, P. (1993). Diversity and Taxonomy of

Methanogens. In: Ferry J.G. (eds) Methanogenesis. Chapman & Hall Microbiology

Series (Physiology / Ecology / Molecular Biology / Biotechnology). Springer, Boston,

MA. https://doi.org/10.1007/978-1-4615-2391-8_2.

Bowler, C., Vardi, A., and Allen, A.E. (2010). Oceanographic and biogeochemical insights from

diatom genomes. Ann Rev Mar Sci. 2:333-365 doi: 10.1146/annurev-marine-120308-

081051.

Bräuer, S.L., Cadillo‐Quiroz, H., Ward, R.J., Yavitt, J.B., and Zinder, S.H. (2011).

Methanoregula boonei gen. nov., sp. nov., an acidiphilic methanogen isolated from an

acidic peat bog. Int J Syst Evol Microbiol 61: 45–52 https://doi.org/10.1099/ijs.0.021782-

0.

Brookes, J. D., Antenucci, J., Hipsey, M., Burch, M. D., Ashbolt, N. J., and Ferguson, C. (2004).

Fate and transport of pathogens in lakes and reservoirs. Environment international, 30(5),

741–759. https://doi.org/10.1016/j.envint.2003.11.006

Byrne, N., Strous, M., Crépeau, V., Kartal, B., Birrien, JL., Schmid, M., Lesongeur, F.,

Schouten, S., Jaeschke, A., Jetten, M., Prieur, D., and Godfroy, A. (2009). 77

Presence and activity of anaerobic ammonium-oxidizing bacteria at deep-sea

hydrothermal vents. ISME J 3, 117-123 https://doi.org/10.1038/ismej.2008.72.

Caputo, A., Stenegren, M., Pernice, M.C., and Foster, R.A. (2018). A Short Comparison of Two

Marine Planktonic Diazotrophic Symbioses Highlights an Un-quantified Disparity.

Front. Mar. Sci. 5:2. doi: 10.3389/fmars.2018.00002.

Carere, C., Sparling, R., Cicek, N., and Levin, D. (2008). Third Generation Biofuels via Direct

Cellulose Fermentation. International Journal of Molecular Sciences, 9(7), 1342–1360.

http://dx.doi.org/10.3390/ijms9071342.

Carey, C.C., Haney, J.F., and Cottingham, K.L. (2007). First Report of microcystin-LR in the

cyanobaterium Gloeotrichia echinulata Environ. Toxicol., 22; 337-339,

https://doi.org/10.1002/tox.20245.

Castellani, A.G., and Niven, C.F. (1955). Factors affecting the bacteriostatic action of sodium

nitrite. Appl Microbiol 3(3):154-9.

Chen, Y.H., and Prinn, R. G. (2006). Estimation of atmospheric methane emissions between

1996 and 2001 using a three-dimensional global chemical transport model, J. Geophys.

Res., 111, doi:10.1029/2005JD006058.

Chistoserdova, L., and Lidstrom, M.E. (2013). Aerobic methylotrophic prokaryotes. In:

Rosenberg E, DeLong EF, Thompson F, Lory S, Stackebrandt E, editors. The

prokaryotes. Fourth edition. Berlin, Heidelberg: Springer-Verlag, pp. 267–285.

Chorus, I., and Welker, M. (2021). Toxic cyanobacteria in water: a guide to their public health

consequences, monitoring and management (p. 858). Taylor & Francis. 78

Coffroth, M.A., Lewis, C.F., Santos, S.R., and Weaver, J.L. (2006). Environmental

populations of symbiotic dinoflagellates in the genus Symbiodinium can initiate

symbioses with reef cnidarians. Curr Biol. 6(23): R985-7. doi:

10.1016/j.cub.2006.10.049.

Cravo-Laureau, C., Matheron, R., Joulian, C., Cayol, J.L., and Hirschler-Réa, A. (2004).

Desulfatibacillum alkenivorans sp. nov., a novel n-alkene-degrading, sulfate-reducing

bacterium, and emended description of the genus Desulfatibacillum. Int J Syst Evol

Microbiol. 54(Pt 5):1639-1642. doi: 10.1099/ijs.0.63104-0

Daims, H., Lücker, S., and Wagner, M. (2016). A New Perspective on Microbes Formerly

Known as Nitrite-Oxidizing Bacteria. Trends in microbiology, 24(9), 699–712.

https://doi.org/10.1016/j.tim.2016.05.004.

Dalal, R. C., and Allen, D. E. (2008). Greenhouse gas fluxes from natural ecosystems.

Australian Journal of Botany, 56(5), 369-407 https://doi.org/10.1071/BT07128

Dalsgaard, T., Thamdrup, B., and Canfield, D. E. (2005). Anaerobic ammonium oxidation

(anammox) in the marine environment. Res. Microbiol. 156, 457–464

https://doi.org/10.1016/j.resmic.2005.01.011.

De Vargas, C., Audic, S., Henry, N., Decelle, J., Mahé, F., Logares, R., Lara, E., Berney, C.,

Le Bescot, N., Probert, I., Carmichael, M., Poulain, J., Romac, S., Colin, S., Aury,

J.M., Bittner, L., Chaffron, S., Dunthorn, M., Engelen, S., Flegontova, O., Guidi, L.,

Horák, A., Jaillon, O., Lima-Mendez, G., Lukeš, J., Malviya, S., Morard, R., Mulot,

M., Scalco, E., Siano, R., Vincent, F., Zingone, A., Dimier, C., Picheral, M.,

Searson, S., Kandels- Lewis, S., Acinas, S.G., Bork, P., Bowler, C., Gorsky, 79

G., Grimsley, N., Hingamp, P., Iudicone, D., Not, F., Ogata, H., Pesant, S., Raes, J.,

Sieracki, M.E., Speich, S., Stemmann, L., Sunagawa, S., Weissenbach, J., Wincker,

P., and Karsenti, E. (2015). Ocean plankton. Eukaryotic plankton diversity in the

sunlit ocean. Science. 22;348(6237):1261605. doi: 10.1126/science.1261605.

Del Campo, J., Sieracki, M.E., Molestina, R., Keeling, P., Massana, R., and Ruiz‐Trillo, I.

(2014). Trends Ecol. Evol 29(5):252-9. doi: 10.1016/j.tree.2014.03.006.

DeLong, E.F. (1998). Everything in moderation: archaea as 'non-extremophiles'. Curr Opin

Genet Dev. 8(6):649-54. doi: 10.1016/s0959-437x(98)80032-4.

Derelle, R., López-García, P., Timpano, H., and Moreira, D. (2016). A Phylogenomic

Framework to Study the Diversity and Evolution of Stramenopiles

(=Heterokonts). Molecular biology and evolution, 33(11), 2890–2898.

https://doi.org/10.1093/molbev/msw168.

Duffitt, A. D., Reber, R. T., Whipple, A., and Chauret, C. (2011). Gene Expression during

Survival of Escherichia coli O157:H7 in Soil and Water. International journal of

microbiology, 2011, 340506. https://doi.org/10.1155/2011/340506

Dunfield, P., Yuryev, A., Senin, P., Smirnova, A.V., Stott, M.B., Hou, S., Ly, B., Saw,

J.H., Zhou, Z., Ren, Y., Wang, J., Mountain, B.W., Crowe, M.A, Weatherby,

T.M., Bodelier, P.L.E., Liesack, W., Feng, L., Wang, L., and Alam, M. (2007).

Methane oxidation by an extremely acidophilic bacterium of the phylum

Verrucomicrobia. Nature 450, 879–882. https://doi.org/10.1038/nature06411.

Eadie, B.J. and Robbins, J.A. (1987). The role of particulate matter in the movement of

contaminants in the Great Lakes. In Advances in Chemistry Series No. 216, Sources and 80

Fates of Aquatic Pollutants, R.A. Hites, and S. J. Eisenreich (eds.). American Chemical

Society, 319-364.

Ebert, D. (2005). Ecology, Epidemiology, and Evolution of Parasitism in Daphnia [Internet].

Bethesda (MD): National Center for Biotechnology Information (US); 2005.

Chapter 2, Introduction to Daphnia Biology. Available from:

https://www.ncbi.nlm.nih.gov/books/NBK2042/.

Emerson, D., Fleming, E.J., and McBeth, J. M. (2010). "Iron-Oxidizing Bacteria: An

Environmental and Genomic Perspective". Annual Review of Microbiology. 64 (1):

561–583. doi:10.1146/annurev.micro.

Erisman, J.W., van Grinsven, H., Grizzetti, B., Bouraoui, F., Powlson, D., Sutton, M.A., Bleeker,

A., and Reis, S. (2011). The European nitrogen assessment, ch. 2: the European nitrogen

problem in a global perspective, pp. 9–31 Cambridge, UK: Cambridge University Press.

Ernst, B., Hitzfeld, B., and Dietrich, D. (2001). Presence of Planktothrix sp. and cyanobacterial

toxins in Lake Ammersee, Germany and their impact on whitefish (Coregonus lavaretus

L.). Environ. Toxicol., 16 (2001), pp. 483-488, https://doi.org/10.1002/tox.10006.

Ettwig, K., Butler, M., Le Paslier, D., Pelletier, E., Mangenot, S., Kuypers, M.M.M., Schreiber,

F., Dutilh, B.E., Zedelius, J., De Beer, D., Gloerich, J., Wessels, H.J.C.T., Van Alen, T.,

Luesken, F., Wu, M.L., Van de Pas-Schoonen, K.T., Op den Camp, H.J.M., Janssen-

Megens, E.M., Francoijs, K., Stunnenberg, H., Weissenbach, J., Jetten, M.S.M., and

Strous, M. (2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria.

Nature 464, 543–548. https://doi.org/10.1038/nature08883. 81

Evans, M., Sicko-Goad, L., and Omair, M. (1979). Seasonal Occurrence of Tokophrya

quadripartita (Suctoria) as Epibionts on Adult Limnocalanus macrurus (Copepoda:

Calanoida) in Southeastern Lake Michigan. Transactions of the American

Microscopical Society, 98(1), 102-109. doi:10.2307/3225944.

Field, C.B., Behrenfeld, M.J., Randerson, J.T. and Falkowski, P.G. (1998). Primary production

of the biosphere: integrating terrestrial and oceanic components. Science 281, 237–240

DOI: 10.1126/science.281.5374.237.

Foissner, W., Chao, A., and Katz, L.A. (2007). Diversity and geographic distribution of

ciliates (Protista: Ciliophora). Journal of Biodiversity and Conservation, 17(2), 345–

363. DOI:10.1007/s10531-007-9254-7.

Foissner, W., Quintela-Alonso, P., and Al-Rasheid, K. (2008). Soil Ciliates from Saudi

Arabia, Including Descriptions of Two New Genera and Six New Species. Acta

protozoologica, 47(4), 317–352.

Follett, C., Dutkiewicz, S., Karl, D.M., Inomura, K., and Follows, M.J. (2018). Seasonal resource

conditions favor a summertime increase in North Pacific diatom–diazotroph associations.

ISME J 12, 1543–1557 https://doi.org/10.1038/s41396-017-0012-x.

Foss, A.J., and Aubel, M.T. (2015). Using the MMPB technique to confirm microcystin

concentrations in water measured by ELISA and HPLC (UV, MS, MS/MS). Toxicon.

15;104:91-101 doi: 10.1016/j.toxicon.2015.07.332.

Glatz, R., Lepp, W., Ward, B., and Francis, C. (2006). Planktonic microbial community

composition across steep physical/chemical gradients in permanently ice-covered Lake

Bonney, Antarctica. Geobiology 4, 53–67. doi:10.1111/j.1472-4669.2006.00057.x. 82

Graham, J.L., Loftin, K.A., Meyer, M.T., and Ziegler, A.C. (2010). Cyanotoxin mixtures and

taste-and-odor compounds in cyanobacterial blooms from the Midwestern United States.

Environ Sci Technol 44(19):7361-8. doi: 10.1021/es1008938.

Graham, P.H., and Vance, C.P. (2003). Legumes: importance and constraints to greater use.

Plant Physiol. 131(3):872-7. doi: 10.1104/pp.017004.

Grattan, L.M., Oldach, D., and Morris, J.G. (2001). Human Health Risks of Exposure

to Pfiesteria piscicida: Environmental exposure to toxic Pfiesteria piscicida produces

a distinct clinical syndrome in some persons; efforts to identify the toxin(s)

responsible for the syndrome and to increase understanding of how it disrupts the

central nervous system have important implications for public health, BioScience, 51,

10, 853–857.https://doi.org/10.2307/3454928.

Grattepanche, J.D., Walker, L.M., Ott, B.M., Paim Pinto, D.L., Delwiche, C.F., Lane, C.E.,

and Katz, L.A. (2018). Microbial Diversity in the Eukaryotic SAR Clade:

Illuminating the Darkness Between Morphology and Molecular Data. Bioessays.

40(4):e1700198. doi:10.1002/bies.201700198.

Gura, C., and Rogers, S.O. (2020). Metatranscriptomic and metagenomic analysis of

biological diversity in Subglacial Lake Vostok (Antarctica). Biology 9, 55

https://doi.org/10.3390/biology9030055.

Halinen, K., Jokela, J., Fewer, D. P., Wahlsten, M., and Sivonen, K. (2007). Direct evidence

for production of microcystins by Anabaena strains from the Baltic Sea. Applied and

environmental microbiology, 73(20), 6543–6550https://doi.org/10.1128/AEM.01377-

07. 83

He, Z., Cai, C., Wang, J., Xu, X., Zheng, P., Jetten, M. S., and Hu, B. (2016). A novel

denitrifying methanotroph of the NC10 phylum and its microcolony. Scientific

reports, 6, 32241. https://doi.org/10.1038/srep32241.

Hedrich, S., Schlomann, M., and Johnson, D. B. (2011). "The iron-oxidizing

proteobacteria". Microbiology. 157 (6): 1551–1564. doi:10.1099/mic.0.045344-0.

Hinchliff, C.E., Smith, S.A., Allman, J.F., Burleigh, J.G., Chaudhary, R., Coghill, L.M.,

Crandall, K.A., Deng, J., Drew, B.T., Gazis, R., Gude, K., Hibbett, D.S., Katz, L.A.,

Laughinghouse, H.D., McTavish, E.J., Midford, P.E., Owen, C.L., Ree, R.H., Rees,

J.A., Soltis, D.E., Williams, T., and Cranston, K.A. (2015). Synthesis of phylogeny

and taxonomy into a comprehensive tree of life. Proc Natl Acad Sci U S A.

112(41):12764-9. doi: 10.1073/pnas.1423041112.

Ho, A., Kerckhof, F., Luke, C., Reim, A., Krause, S., Boon, N., Bodelier, P. L. E.

(2012). Conceptualizing functional traits and ecological characteristics of methane-

oxidizing bacteria as life strategies. Environ. Microbiol. Rep. 5, 335–345

https://doi.org/10.1111/j.1758-2229.2012.00370.x.

Hou, S., Makarova, K. S., Saw, J. H., Senin, P., Ly, B. V., Zhou, Z., Ren, Y., Wang, J.,

Galperin, M. Y., Omelchenko, M. V., Wolf, Y. I., Yutin, N., Koonin, E. V., Stott, M.

B., Mountain, B. W., Crowe, M. A., Smirnova, A. V., Dunfield, P. F., Feng, L.,

Wang, L., and Alam, M. (2008). Complete genome sequence of the extremely

acidophilic methanotroph isolate V4, Methylacidiphilum infernorum, a

representative of the bacterial phylum Verrucomicrobia. Biology direct, 3, 26.

https://doi.org/10.1186/1745-6150-3-26. 84

Iguchi, H., Yurimoto, H., and Sakai, Y. (2015). Interactions of Methylotrophs with Plants and

Other Heterotrophic Bacteria. Microorganisms, 3(2), 137-151.

https://doi.org/10.3390/microorganisms3020137.

Intriago, P. (2012). Marine Microorganisms: perspectives for getting involved in cellulosic

ethanol. AMB Express, 2(1), 46. https://doi.org/10.1186/2191-0855-2-46.

Islam, T., Jensen, S., Reigstad, L. J., Larsen, O., and Birkeland, N. K. (2008). Methane

oxidation at 55 degrees C and pH 2 by a thermoacidophilic bacterium belonging to

the Verrucomicrobia phylum. Proceedings of the National Academy of Sciences of

the United States of America, 105(1), 300-304.

https://doi.org/10.1073/pnas.0704162105.

Ji, B., Yang, K., Zhu, L., Yu Jiang, Wang, H., Zhou, J., and Zhang, H. (2015). Aerobic

denitrification: A review of important advances of the last 30 years. Biotechnol

Bioproc E 20, 643–651 https://doi.org/10.1007/s12257-015-0009-0.

Kasprzak, P., Lathrop, R.C., and Carpenter, S.R. (1999). Influence of different

sized Daphnia species on chlorophyll concentration and summer phytoplankton

community structure in eutrophic Wisconsin lakes, Journal of Plankton Research,

21(1), 2161 – 2174 https://doi.org/10.1093/plankt/21.11.2161.

Kawaguchi, Y., Shibuya, M., Kinoshita, I., Yatabe, J., Narumi, I., Shibata, H., Hayashi, R.,

Fujiwara, D., Murano, Y., Hashimoto, H., Imai, E., Kodaira, S., Uchihori, Y., Nakagawa,

K., Mita, H., Yokobori, S., and Yamagishi, A. (2020). DNA Damage and Survival Time

Course of Deinococcal Cell Pellets During 3 Years of Exposure to Outer Space. Front.

Microbiol. 11:2050. doi: 10.3389/fmicb.2020.02050. 85

Kemen, E., Gardiner, A., Schultz-Larsen, T., Kemen, A. C., Balmuth, A. L., Robert-

Seilaniantz, A., Bailey, K., Holub, E., Studholme, D. J., Maclean, D., and Jones, J. D.

(2011). Gene gain and loss during evolution of obligate parasitism in the white rust

pathogen of Arabidopsis thaliana. PLoS biology, 9(7), e1001094.

https://doi.org/10.1371/journal.pbio.1001094.

Kim, J. M., Le, N. T., Chung, B. S., Park, J. H., Bae, J. W., Madsen, E. L., and Jeon, C. O.

(2008). Influence of soil components on the biodegradation of benzene, toluene,

ethylbenzene, and o-, m-, and p-xylenes by the newly isolated bacterium

Pseudoxanthomonas spadix BD-a59. Applied and environmental microbiology, 74(23),

7313–7320. https://doi.org/10.1128/AEM.01695-08.

Kim, K.K., Jin, L., and Yang, H.C. (2007). Halomonas gomseomensis sp. Nov., Halomonas

janggokensis sp nov, and Halomonas denitrificans sp. moderately halophilic bacteria

isolated from saline water. Int J Syst Evol Microbiol. 57(4): 675-681. doi:

10.1099/ijs.0.64767-0.

Kitchens, C.M., Johengen, T.H., and Davis, T.W (2018). Establishing spatial and temporal

patterns in Microcystis sediment seed stock viability and their relationship to

subsequent bloom development in Western Lake Erie. PLoS ONE 13(11): e0206821.

https://doi.org/10.1371/journal.pone.0206821.

Kumar, M., Saxena, R., Tomar, R. S., Rai, P. K., and Paul, D. (2018). Role of methylotrophic

bacteria in climate change mitigation. Microbes for Climate Resilient Agriculture, 149-

164. 86

Lam, H.M., Coshigano, K., Oliveira, I., Melo‐Oliveira, R., and Coruzzi, G (1996). The molecular

genetics of nitrogen assimilation into amino acids in higher plants. Annual Review of

Plant Physiology and Plant Molecular Biology 47, 569-

593.10.1146/annurev.arplant.47.1.569.

Lashaway, A.R., and Carrick, H.J. (2010) Effects of light, temperature and habitat quality on

meroplanktonic diatom rejuvenation in Lake Erie: implications for seasonal hypoxia.

Journal of Plankton Research, 32: 479-490.

Lavik, G., Stührmann, T., Brüchert, V., Van der Plas, A., Mohrholz, V., Lam, P., Mussmann, M.,

Fuchs, B.M., Amann, R., Lass, U., and Kuypers, M.M.M. (2009). Detoxification of

sulphidic African shelf waters by blooming chemo-lithotrophs. Nature, 457: 581–584

Lewis, W.M., and Morris, D.P. (1986). Toxicity of nitrite to fish: a review. Trans Am Fish Soc,

115, 183-195. https://doi.org/10.1577/1548-8659.

Loftin, K.A., Graham, J.L., Hilborn, E.D., Lehmann, S.C., Meyer, M.T., Dietze, J.E., and

Griffith, C.B. (2016). Cyanotoxins in inland lakes of the United States: Occurrence and

potential recreational health risks in the EPA National Lakes Assessment 2007. Harmful

Algae. 56:77-90. doi: 10.1016/j.hal.2016.04.001.

Lowe, S., Browne, M., Boudjelas, S., and De Poorter, M. (2000). 100 of the World’s Worst

Invasive Alien Species A selection from the Global Invasive Species Database.: The

Invasive Species Specialist Group (ISSG) a specialist group of the Species Survival

Commission (SSC) of the World Conservation Union (IUCN). p. 12

Luukkainen, R., Sivonen, K., Namikoshi, M., Färdig, M., Rinehart, K.L. and Niemelä, S.I.

(1993). Isolation and identification of eight microcystins from thirteen Oscillatoria 87

agardhii strains and structure of a new microcystin. Applied and Environmental

Microbiology 59 (7) 2204-2209.

Mackin, J.G., Owen, H.M., and Collier, A. (1950). Preliminary Note on the Occurrence of a

New Protistan Parasite, Dermocystidium marinum n. sp. in Crassostrea virginica

(Gmelin). Science. 31;111(2883):328-9. doi: 10.1126/science.111.2883.328.

Mahmud, K., Makaju, S., Ibrahim, R., and Missaoui, A. (2020). Current Progress in Nitrogen

Fixing Plants and Microbiome Research. Plants (Basel, Switzerland), 9(1), 97.

https://doi.org/10.3390/plants9010097.

Martinelli, A., and Culleton, R. (2016). Non-human primate malaria parasites: out of the

forest and into the laboratory. Parasitology 145(1):41-54. doi:

10.1017/S0031182016001335.

Martín-Torrijos, L., Campos Llach, M., Pou-Rovira, Q., and Diéguez-Uribeondo, J. (2017).

Resistance to the crayfish plague, Aphanomyces astaci (Oomycota) in the endangered

freshwater crayfish species, Austropotamobius pallipes. PloS one, 12(7), e0181226.

https://doi.org/10.1371/journal.pone.0181226.

Moore, M.V., Hampton, S.E., Izmest’eva, L.R., Silow, E.A., Peshkova, E.V., and Pavlov,

B.K. (2009). Climate change and the world’s “Sacred Sea”—lake baikal, siberia.

Bioscience, 59, 405–417 https://doi.org/10.1525/bio.2009.59.5.8.

Naqvi, I., Gupta, R., Makhija, S., Toteja, R., Abraham, J. S., Sripoorna, S., El-Serehy, H. A.,

and Al-Misned, F. A. (2016). Morphology and morphogenesis of a new oxytrichid

ciliate, Notohymena limus n. sp. (Ciliophora, Oxytrichidae) from Delhi, India. Saudi

journal of biological sciences, 23(6), 789–794. https://doi.org/10.1016/j.sjbs.2016.10.008 88

Ormeño-Orrillo, E., Hungria, M., and Martínez-Romero E. (2013). “Dinitrogen-fixing

prokaryotes,” in The Prokaryotes: Prokaryotic Physiology and Biochemistry, eds

Rosenberg E., Long E. F. de, Lory S., Stackebrandt E., Thompson F. (Berlin:

Springer-Verlag), 427–451. 10.1007/978-3-642-30141-4_72.

Pachiadaki, M.G., Sintes, E., Bergauer, K., Brown, J.M., Record, N.R., Swan,

B.K., Mathyer, E., Hallam, S.J., Lopez-Garcia, P., Takaki, Y., Nunoura, T., Woyke,

T., Herndl, G.J., and Stepanauskas, R. (2017). Major role of nitrite-oxidizing bacteria in

dark ocean carbon fixation. Science. 24;358(6366):1046-1051.

doi:10.1126/science.aan8260.

Pol, A., Heijmans, K., Harhangi, H., Tedesco, D., Jetten, M.S.M., and Huub J. M.

(2007). Methanotrophy below pH 1 by a new Verrucomicrobia species. Nature

450,874–878. https://doi.org/10.1038/nature06222.

Priscu, J.C., Adams, E.E., Lyons, W.B., Voytek, M.A., Mogk, D.W., Brown, R.L., McKay, C.P.,

Takacs, C.D., Welch, K.A., Wolf, C.F., Kirshtein, J.D., and Avci, R. (1999).

Geomicrobiology of Subglacial Ice Above Lake Vostok, Antarctica. Science 286 (5447),

2141-2144 doi: 10.1126/science.286.5447.2141.

Prosser, J.I. (1989). Autotrophic nitrification in bacteria. Adv. Microb. Physiol. 30:125–

81 https://doi.org/10.1016/S0065-2911(08)60112-5.

Quesada, A., Moreno, E., Carrasco, D., Paniagua, T., Wormer, L., De Hoyos, C., and Sukenik.

A. (2006). Toxicity of Aphanizomenon ovalisporum (Cyanobacteria) in a Spanish water

reservoir, European Journal of Phycology, 41:1, 39-45, DOI:

10.1080/09670260500480926. 89

Raghoebarsing, A.A., Pol, A., van de Pas-Schoonen, K.T., Smolders, A.J., Ettwig, K.F.,

Rijpstra, W.I., Schouten, S., Damsté, J.S., Op den Camp, H.J., Jetten, M.S., and

Strous, M.A, (2006). Microbial consortium couples anaerobic methane oxidation to

denitrification. Nature. 13;440(7086):918-21 doi: 10.1038/nature04617.

Raikov, I.B. (1972). Nuclear phenomena during conjugation and autogamy in ciliates. In:

Chen T-T (ed) Research in protozoology vol 4. Pergamon Press, New York, pp 146–

289

Ravishankara, A.R., Daniel, J.S., and Portmann, R.W. (2009). Nitrous oxide (N2O): the

dominant ozone-depleting substance emitted in the 21st century. Science

326(5949): 123–5 DOI: 10.1126/science.1176985.

Reavie, E.D., and Kireta, A.R. (2015). Centric, Araphid and Eunotioid Diatoms of the

Coastal Laurentian Great Lakes Bibliotheca Diatomologica 62:1-184.

Reeburgh, W. S., Whalen S. C., and Alperin M. J. (1993). The role of methylotrophy in the

global methane budget Microbial growth on C1 compounds. Proceedings of the 7th

International Symposium. Murrell J. C., Kelly D. P. 1 14 American Society for

Microbiology Washington, D.C.

Rinta-Kanto, J. M., Ouellette, A. J. A., Boyer, G. L., Twiss, M. R., Bridgeman, T. B.,

and Wilhelm S. W. (2005). Quantification of Toxic Microcystis spp. during the 2003

and 2004 Blooms in Western Lake Erie using Quantitative Real-Time PCR.

Environmental Science & Technology 39 (11), 4198-4205 doi: 10.1021/es048249u. 90

Rinta-Kanto, J.M., and Wilhelm S.W. (2006). Diversity of Microcystin-Producing

Cyanobacteria in Spatially Isolated Regions of Lake Erie. Applied and Environmental

Microbiology 72 (7) 5083-5085. doi: 10.1128/AEM.00312-06.

Rogers, S.O., Rehner, S., Bledsoe, C., Mueller, G.J., and Ammirati, J.F. (1989). Extraction of

DNA from Basidiomycetes for ribosomal DNA hybridizations. Can J Bot. 67, 1235–

1243.

Rogers, S.O., Shtarkman, Y.M., Koçer, Z.M., Edgar, R., Veerapaneni, R., and D’Elia, T. (2013).

Ecology of subglacial Lake Vostok (Antarctica) based on

metagenomic/metatranscriptomic analyses of accretion ice. Biology 2(2), 629–650. doi:

10.3390/biology2020629.

Rosenblueth, M., Ormeño-Orrillo, E., López-López, A., Rogel, M. A., Reyes-Hernández, B.

J., Martínez-Romero, J. C., Reddy, P. M., and Martínez-Romero, E. (2018). Nitrogen

Fixation in Cereals. Frontiers in microbiology, 9, 1794.

https://doi.org/10.3389/fmicb.2018.01794

Rurangirwa, F.R., Dilbeck, P.M., Crawford, T.B., McGuire, T.C. and McElwain, T.F. (1999).

Analysis of the 16S rRNA gene of micro-organism WSU 86-1044 from an aborted

bovine foetus reveals that it is a member of the order Chlamydiales: proposal of

Waddliaceae fam. nov., Waddlia chondrophila gen. nov., sp. nov. Int J Syst Bacteriol. 49

(2):577-581 doi: 10.1099/00207713-49-2-577.

Russ, L., Kartal, B., op den Camp, H.J.M., Sollai, M., Le Bruchec, J., Caprais, J-C., Godfroy,

A., Damsté, S.J.S., and Jetten, M.S.M. (2013). Presence and diversity of anammox 91

bacteria in cold hydrocarbon-rich seeps and hydrothermal vent sediments of the

Guaymas Basin. Front. Microbiol. 4:219 doi: 10.3389/fmicb.2013.00219.

Sakai, S., Conrad, R., Liesack, W., and Imachi, H. (2010). Methanocella arvoryzae sp. nov., a

hydrogenotrophic methanogen isolated from rice field soil. Int J Syst Evol Microbiol.

60(12):2918-2923 doi: 10.1099/ijs.0.020883-0.

Saker, M.L., Jungblut, A. D., Neilan, B.A., Rawn, D.F.K., and Vasconcelos, V.M.

(2005). Detection of microcystin synthetase genes in health food supplements

containing the freshwater cyanobacterium Aphanizomenon flos-aquae, Toxicon,

(46)5, 555-562, https://doi.org/10.1016/j.toxicon.2005.06.021.

Santi, C., Bogusz, D., and Franche, C. (2013). Biological nitrogen fixation in non-legume

plants. Annals of botany, 111(5), 743–767. https://doi.org/10.1093/aob/mct048.

Scavia, D., Allan, J.D., Arend, K.K., Bartell, S., Beletsky, D., Bosch, N.S., Brandt,

S.B., Briland, R.D., Daloglu, I., De Pinto, J.V., Dolan, D.M., Evans, M.A., Farmer,

T.M., Goto, D., Han, H., Hook, T., Knight, R., Ludsin, S.A., Mason, D., Michalak,

A.M., Richards, R.P., Roberts, J.J., Rucinski, D.K., Rutherford, E., Schwab,

D.J., Sesterhenn, T.M., Zhang, H., and Zhou, Y. (2014). Assessing and addressing the

Re-eutrophication of Lake Erie: Central Basin Hypoxia. J Great Lakes Res. 40(2):

226–246. https://doi.org/10.1016/j.jglr.2014.02.004.

Seitzinger, S.P. (1988). Denitrification in freshwater and coastal marine ecosystems:

ecological and geochemical importance. Limnol. Oceanogr. 33: 702–

724. https://doi.org/10.4319/lo.1988.33.4part2.0702. 92

Shearer, C. A., Descals, E., Kohlmeyer, B., Kohlmeyer, J., Marvanová, L., Padgett,

D., Porter, D., Raja, H.A., Schmit, J.P., Thorton, H.A., and Voglymayr, H. (2007).

Fungal biodiversity in aquatic habitats. Biodiversity and Conservation, 16(1), 49-

67. https://doi.org/10.1007/s10531-006-9120-z.

Shen, L.D., Wu, H.S., Gao, Z.Q., Liu, X., and Li, J. (2016). Comparison of community

structures of Candidatus Methylomirabilis oxyfera-like bacteria of NC10 phylum in

different freshwater habitats. Sci Rep 6: 25647 10.1111/jam.13119.

Sherr, B.F., del Giorgio, P., and Sherr, E.B. (1999). Estimating abundance and single-cell

characteristics of respiring bacteria via the redox dye CTC. Aquat Microb Ecol. 18, 117–

131.

Shtarkman, Y., Koçer, Z., Edgar, R., Veerapaneni, R., D'Elia, T., Morris, P., and Rogers, S.

(2013). Subglacial Lake Vostok (Antarctica) accretion ice contains a diverse set of

sequences from aquatic, marine and sediment-inhabiting Bacteria and Eukarya. Plos One,

8(7), e67221. doi:10.1371/journal.pone.0067221.

Shumway, S. E. (1990). A review of the effects of algal blooms on shellfish and

aquaculture. Journal of the world aquaculture society, 21(2), 65-104.

Sivonen, K., Namikoshi, M., Evans, W.R., Carmichael, W.W., Sun, F., Rouhiainen, L.,

Luukkainen, R., and Rinehart, K.L. (1992). Isolation and characterization of a variety

of microcystins from seven strains of the cyanobacterial genus Anabaena. Applied

and Environmental Microbiology, 58 (8) 2495-2500. 93

Sonthiphand, P., Hall, M. W., and Neufeld, J. D. (2014). Biogeography of anaerobic

ammonia-oxidizing (anammox) bacteria. Frontiers in microbiology, 5, 399.

https://doi.org/10.3389/fmicb.2014.00399.

Spieck, E., Keuter, S., Wenzel, T., Bock, E., and Ludwig, W. (2014). Characterization of a

new marine nitrite oxidizing bacterium, Nitrospina watsonii sp. nov., a member of the

newly proposed phylum "Nitrospinae". Syst Appl Microbiol. May;37(3):170-6 doi:

10.1016/j.syapm.2013.12.005.

Starkenburg, S.R., Arp, D.J., and Bottomley, P.J. (2008). Expression of a putative nitrite

reductase and the reversible inhibition of nitrite-dependent respiration by nitric oxide

in Nitrobacter winogradskyi Nb-255. Environmental Microbiology. 10(11):3036-

3042. DOI: 10.1111/j.1462-2920.2008.01763.x.

Szaniawska, A. (2018). Function and Importance of Crustaceans. In: Baltic Crustaceans.

Springer, Cham. https://doi.org/10.1007/978-3-319-56354-1_11.

Treusch, A.H., Leininger, S., Kletzin, A, Schuster, S, C., Klenk, H.P, and Schleper, C.

(2005). Novel genes for nitrite reductase and Amo-related proteins indicate a role of

uncultivated mesophilic crenarchaeota in nitrogen cycling. Environ Microbiol. 2005

7(12):1985-95. j.1462-2920.2005.00906.x .

Trotsenko, Y.A., and Murrell, J.C. (2008). Metabolic Aspects of Aerobic Obligate

Methanotrophy, Advances in Applied Microbiology, 63, 183-229,

https://doi.org/10.1016/S0065-2164(07)00005-6. 94

Twiss, M.R., McKay, R.M.L., Bourbonniere, R.A., Bullerjahn, G.S., Carrick, H., Smith, R.E.H.,

Winter, J.G., D'souza, N.A., Furey, P.C., Lashaway, A.R., and Saxton, M.A. (2012).

Diatoms abound in ice-covered Lake Erie: An investigation of offshore winter limnology

in Lake Erie over the period 2007 to 2010. J. Great Lakes Res. 38, 18-30.

doi:10.1016/j.jglr.2011.12.008.

Van Dolah, F. M. (2000). Marine algal toxins: origins, health effects, and their increased

occurrence. Environmental health perspectives, 108 Suppl 1(Suppl 1), 133–141.

https://doi.org/10.1289/ehp.00108s1133

Wagner, T., Watanabe, T., and Shima S. (2018). Hydrogenotrophic Methanogenesis. In: Stams

A., Sousa D. (eds) Biogenesis of Hydrocarbons. Handbook of Hydrocarbon and Lipid

Microbiology. Springer, Cham. https://doi.org/10.1007/978-3-319-53114-4_3-1.

Watson, S.W., Bock, E., Valois, F.W., Waterbury, J.B., and Schlosser, U. (1986). Nitrospira

marina gen. nov. sp. nov.: a chemolithotrophic nitrite-oxidizing bacterium. Arch.

Microbiol. 144, 1–7 https://doi.org/10.1007/BF00454947.

Wetzel, R.G. (2001). Limnology: Lake and River Ecosystems. Gulf Professional

Publishing, Academic Press, San Diego.

Wood, S. A., Rasmussen, J. P., Holland. P. T., Campbell, R., and Crowe, A. L. M. (2007). First

report of cyanotoxin anatoxin-a from Aphanizomenon issatschenkoi (cyanobacteria).

Journal of Phycology 43:356-365. https://doi.org/10.1111/j.1529-8817.2007.00318.x.

Yakimov, M.M., Giuliano, L., Gentile, G., Crisafi, E., Chernikova, T.N., Abraham, W.R.,

Lunsdorf, H., Timmis, K.N., and Golyshin, P.N. (2003) Oleispira antarctica gen. nov., 95

sp. nov., a novel hydrocarbonoclastic marine bacterium isolated from Antarctic coastal

sea water. Int J Syst Evol Microbiol 53: 779 785 https://doi.org/10.1099/ijs.0.02366-0.

Yakimov, M.M., Timmis, K.N., and Golyshin, P.N. (2007). Obligate oil-degrading marine

Bacteria. Curr Opin Biotechnol. 18(3):257-66. doi: 10.1016/j.copbio.2007.04.006

Yoshinaga, I., Amano, T., Yamagishi, T., Okada, K., Ueda, S., Sako, Y., and Suwa, Y.

(2011) Distribution and diversity of anaerobic ammonium oxidation (anammox)

bacteria in the sediment of a eutrophic freshwater lake, Lake Kitaura, Japan.

Microbes Environ. 26(3):189-97 doi: 10.1264/jsme2.me10184.

Zhou, J., Fries, M.R., Chee-Sanford, J.C., and Tiedje, J.M. (1995). Phylogenetic analyses of

a new group of denitrifiers capable of anaerobic growth of toluene and description of

Azoarcus tolulyticus sp. nov. Int J Syst Bacteriol. 45(3):500-6 doi:

10.1099/00207713-45-3-500.

96

APPENDIX A. SPECIES (BASED ON SEQUENCES) FROM LAKE ERIE ICE SAMPLE,

ORGANIZED TAXONOMICALLY

Domain BACTERIA

MONODERMS

Actinobacteria

Acidimicrobium ferrooxidans - oxidizes ferrous iron, thermophilic, acidophilic

Acidithiomicrobium sp. - oxidizes sulfur, geothermal environment

Acidothermus cellulolyticus - acidophilic, thermophilic, cellulolytic, thermal spring

Actinoallomurus spadix - soil, dung samples

Actinobaculum schaalii - pathogen of urinary tract

Actinomadura cremea - human pathogen, sputum, bronchoalveolar lavage fluid,

honeybee hive

Actinomadura umbrina - soil

Actinomyces bovis - pathogenic in cattle and humans

Actinomyces graevenitzii - pathogenic in human

Actinomyces weissii - oral cavity of dogs

Actinoplanes friuliensis - soil

Actinoplanes missouriensis - soil

Actinoplanes sp. - soil

Actinosynnema pretiosum - plant leaves

Adlercreutzia equolifaciens - human feces, metabolizes daidzeins (from soybeans) to

equol (an estrogen)

Alloscardovia omnicolens - soil 97

Amycolatopsis mediterranei - methylotrophic

Amycolatopsis methanolica - pathogenic in human and goats

Amycolatopsis orientalis - oil polluted saline soil, moderately halophilic

Amycolicicoccus subflavus - aquatic, freshwater

Aquihabitans daechungensis - human and animal intestinal tract

Arcanobacterium canis - associated with dogs

Arcanobacterium hippocoleae - associated with horses

Arcanobacterium pluranimalium - associated with animals

Arcanobacterium pyogenes - associated with pigs, pathogenic in livestock

Arthrobacter agilis - psychrophilic, lake water, Antarctic sea ice

Arthrobacter aurescens - soil, metabolizes striazine, utilizes anethole

Arthrobacter flavus - psychrophilic, aquatic

Arthrobacter tumbae - associated with biofilm

Atopobium vaginae - pathogenic in humans

Bifidobacterium actinocoloniiforme - associated with bumblebee digestive tract

Bifidobacterium angulatum - human gastrointestinal tract

Bifidobacterium asteroides - associated with honeybees

Bifidobacterium bifidum - associated with mammals (including humans)

Bifidobacterium breve - human gastrointestinal tract

Bifidobacterium longum - human gastrointestinal tract

Bifidobacterium scardovii - associated with clinical samples

Bifidobacterium thermacidophilum - thermophilic, anaerobic digester, feces of pigs

Bifidobacterium thermophilum - bovine rumen, feces 98

Blastococcus saxobsidens - rock, alcarenite (limestone)

Catenulispora acidiphila - freshwater, acidophilic

Cellulomonas fimi - cellulolytic

Cellulomonas flavigena - soil, degrades cellulose

Cellvibrio gilvus - cellulolytic

Coriobacterium glomerans - gastrointestinal tract of fireflies

Corynebacterium camporealensis - associated with sheep milk, pathogenic

Corynebacterium casei - grows on surface of cheeses

Corynebacterium diphtheriae - pathogenic in humans

Corynebacterium glycinophilum - decaying banana

Corynebacterium halotolerans - halotolerant, saline soil

Corynebacterium lactis - associated with cow milk

Corynebacterium pseudotuberculosis - pathogenic in horses and cattle

Corynebacterium resistens - pathogenic in human

Corynebacterium riegelii - pathogenic in humans

Corynebacterium sp. - pathogenic, associated with clinical samples

Corynebacterium terpenotabidum - degrades squalene, soil

Corynebacterium uterequi - associated with horses

Crossiella equi - associated with horses

Dermacoccus nishinomiyaensis - pathogenic in humans

Cryobacterium sp. - psychrotolerant

Eggerthella lenta - human gastrointestinal tract, pathogenic

Eggerthella sp. - associated with human colon 99

Frankia alni - root nodule, nitrogen fixing

Frankia sp. - nitrogen fixer, root nodules

Gaiella occulta - deep mineral water

Gordonia bronchialis - pathogenic in human

Gordonia polyisoprenivorans - degrades rubber, pathogenic

Gordonibacter pamelaeae - associated with human gastrointestinal tract

Gordonia sp. - soil, water

Ilumatobacter fluminis - sediment

Intrasporangium calvum - air, reduces nitrate

Isoptericola variabilis - associated with termite guy, hydrolyzes nitrile

Jonesia denitrificans - pathogenic

Kibdelosporangium phytohabitans - associated with plants

Kitasatospora cineracea - soil

Kitasatospora griseola - soil

Kitasatospora niigatensis - soil

Kitasatospora phosalacinea - soil

Kitasatospora setae -soil

Kocuria rhizophila - soil

Kutzneria albida - soil

Kytococcus sedentarius - marine

Lentzea violacea - gold mine

Leucobacter sp. - aquatic areas, sludge, and soil samples

Luteipulveratus mongoliensis - soil 100

Marmoricola bigeumensis - soil

Microbacterium sp. - associated with clinical specimen

Microbacterium testaceum - associated with plant tissue e.g corn, sorghum

Microlunatus phosphovorus - activated sludge, accumulates polyphosphate

Micromonospora aurantiaca - soil, freshwater, marine, fixes nitrogen

Micromonospora chersina - aquatic, soil

Micromonospora echinospora - soil, produces antibiotics

Micromonospora inyonensis - soil

Mobiluncus curtisii - pathogenic in human

Modestobacter marinus - psychrotolerant, deep sea sediment

Modestobacter versicolor - soil

Mycobacterium abscessus - water, soil, pathogenic

Mycobacterium asiaticum - sputum, monkeys

Mycobacterium bovis - pathogenic in cattle

Mycobacterium canettii - pathogenic in humans

Mycobacterium chubuense - soil

Mycobacterium confluentis - human oral cavity and airways

Mycobacterium fallax - aquatic, river

Mycobacterium fortuitum - pathogenic in humans

Mycobacterium goodii - pathogenic, associated with clinical samples

Mycobacterium hodleri - degrades polycyclic aromatic hydrocarbon

Mycobacterium indicus - soil

Mycobacterium intracellulare - pathogenic in frogs 101

Mycobacterium liflandii - pathogenic

Mycobacterium kansasii - pathogenic in humans

Mycobacterium marinum - aquatic, associated with fish

Mycobacterium neoaurum - pathogenic in human

Mycobacterium obuense - soil, aquatic, degrades organic compounds

Mycobacterium phlei - soil, dust and plants. Associated with an immunocompetent

pediatric patient

Mycobacterium rhodesiae - soil, pathogenic, degrades PAH

Mycobacterium smegmatis - skin lesion, marine

Mycobacterium vanbaalenii - petroleum-contaminated estuarine sediments,

aquatic, contaminated soils, can utilize polycyclic aromatic hydrocarbons

Nocardia brasiliensis - soil, pathogenic in human

Nocardia cyriacigeorgica - pathogenic

Nocardia farcinica - soil, plant, animal tissue

Nocardia nova - soil, plant materials

Nocardia seriolae - associated with fishes, pathogenic in fish, man, cats

Olsenella uli - pathogenic in humans

Patulibacter medicamentivorans - activated sludge, degrades ibuprofen

Propionibacterium acidipropionici - propionic acid-tolerant, soil, rumen

Propionibacterium avidum - human normal oral flora

Propionibacterium propionicum - human normal skin flora

Pseudonocardia dioxanivorans - industrial sludge

Rathayibacter toxicus - pathogenic in rye grass (kills livestock that consumes it) 102

Renibacterium salmoninarum - pathogenic in salmonoid fishes

Rhodococcus equi - soil, pathogenic in foal (horse < 1 year old) and humans

Rhodococcus fascians - associated with leafy gall disease, soil, activated sludge,

water treatment plant

Rhodococcus jostii - soil, degrades PCB

Rhodococcus pyridinivorans - industrial wastewater, degrades pyridine

Rhodococcus sp. IGTS8 - Soil, compost

Rothia dentocariosa - associated with human teeth

Rubrobacter radiotolerans - aquatic, hot-springs, extremely resistant to UV

Rubrobacter xylanophilus - thermophile, extreme gamma radiation resistant, hot

springs, can degrade xylan and hemicellulose

Saccharomonospora viridis - soil, hot compost

Saccharothrix espanaensis - soil, produces saccharomicins (an antibiotic)

Salinispora arenicola - marine

Salinispora tropica - marine, sediment, psychrophilic

Sanguibacter keddieii - associated with cattle

Segniliparus rotundus - pathogenic in humans

Slackia heliotrinireducens - associated with ruminal flora of sheep

Spirillospora rubra - soil

Sporichthya brevicatena - soil

Stackebrandtia nassauensis - soil

Streptacidiphilus jiangxiensis - soil

Streptacidiphilus oryzae - ricefield soil 103

Streptomyces abikoensis - soil

Streptomyces acrimycini - soil

Streptomyces albireticuli - soil

Streptomyces albulus - soil

Streptomyces albus - soil

Streptomyces ambofaciens - soil

Streptomyces aomiensis - soil

Streptomyces bingchenggensis - soil, produces milbemycin (an insecticidal macrolide

compound)

Streptomyces caviscabies - soil, pathogenic in potatoes

Streptomyces catbensis - soil

Streptomyces collinus - soil

Streptomyces cyaneogriseus - soil, thermotolerant

Streptomyces davawensis - soil

Streptomyces finlayi - soil

Streptomyces flavofuscus - soil

Streptomyces flavoviridis - soil

Streptomyces fulvissimus - soil

Streptomyces glaucescens - soil

Streptomyces griseobrunneus - soil

Streptomyces griseolus - soil, antifungal

Streptomyces griseoplanus - soil

Streptomyces hygroscopicus - soil 104

Streptomyces hypolithicus - soil

Streptomyces incarnatus - soil

Streptomyces iranensis - soil

Streptomyces leeuwenhoekii - soil

Streptomyces netropsis - soil, antifungal

Streptomyces nitrosporeus - soil

Streptomyces olivaceiscleroticus - soil

Streptomyces purpeofuscus - soil

Streptomyces scabiei - soil, pathogenic in plants

Streptomyces speibonae - soil

Streptomyces tanashiensis - soil

Streptomyces venezuelae - soil

Streptomyces vietnamensis - soil

Streptomyces violaceusniger - soil

Streptomyces viridiflavus - soil

Streptomyces xiamenensis - soil

Tepidimonas arfidensis - thermophilic, pathogenic

Terracoccus luteus - soil

Thermobifida fusca - thermophilic, compost heaps, rotting hay, manure piles

Thermobispora bispora - thermophilic

Thermomonospora chromogena - thermophilic, soil, composted garbage

Tropheryma whipplei - associated with the Whipple disease, sewage water, fecal

material, sewage plant workers 105

Tsukamurella paurometabola - soil, sludge

Verrucosispora maris - marine sediment

Chloroflexi

Anaeolinea thermophila - thermophilic, activated sludge

Chloroflexus aggregans - thermophilic

Chloroflexus aurantiacus - thermophilic, hot springs, utilizes sulfur, fixes carbon

through the Calvin cycle and 3-hydroxy-propionate pathway

Dehalococcoides ethenogenes - contaminated groundwater, dechlorinate

perichloroethylene

Dehalococcoides mccartyi - contaminated soil/groundwater

Dehalococcoides sp. - contaminated environment, reduce contaminants such as

perichloroethylene and thrichloroethylene

Dehalogenimonas lykanthroporepellens - groundwater

Herpetosiphon aurantiacus - aquatic

Litorilinea aerophila - qquatic, thermophilic

Roseiflexus castenholzii - thermophilic, hot springs

Roseiflexus sp. - thermophilic, microbial mats of hot springs

Sphaerobacter thermophilus - thermophilic, sewage sludge

Thermobaculum terrenum - hyperthermophilic, thermal soil

Thermomicrobium roseum - thermophilic

Thermosporothrix hazakensis - thermophilic, compost

Firmicutes

Acidaminococcus intestini - human pathogens 106

Alicyclobacillus acidocaldarius - thermophilic, acidophilic

Alkaliphilus metalliredigens - akaliphilic, moderately halophilic, metal-reducing

bacterium

Alkaliphilus oremlandii - river sediments

Ammonifex degensii - thermophilic, volcanic hot spring

Amphibacillus xylanus - degrades xylan, compost manure

Aneurinibacillus thermoaerophilus - decomposes thiamine, human feces

Anoxybacillus gonensis - aquatic, thermophilic, utilizes xylan

Bacillus amyloliquefaciens - soil

Bacillus anthracis - soil, animal pathogen

Bacillus atrophaeus - soil

Bacillus bombysepticus - silkworm (insect) pathogen

Bacillus cellulosilyticus - soil, alkaliphilic

Bacillus cereus - soil, raw food, pathogenic in human

Bacillus circulans - soil, pathogenic

Bacillus clausii - soil

Bacillus coagulans - milk, pathogenic

Bacillus infantis - marine, pathogenic in infants

Bacillus halodurans - dried sewage sludge, soil, gastrointestinal tract, stool

Bacillus lehensis - soil, alkalitolerant

Bacillus licheniformis - soil, plants

Bacillus megaterium - saprophytic, soil (agricultural)

Bacillus methylotrophicus - methylotrophic, soil 107

Bacillus pseudofirmus - alkaliphilic, alkalotolerant, soil

Bacillus pumilus - fixes nitrogen, soil, aquatic

Bacillus selenitireducens - lake, haloalkaliphilic

Bacillus sp. PS3 - thermophilic

Bacillus smithii - thermophilic

Bacillus subtilis - Soil, gastrointestinal tract of animals (incl. humans)

Bacillus thuringiensis - soil, entomopathogenic

Brevibacillus brevis - air, water, decaying matter

Brevibacillus laterosporus - Entomopathogenic

Caldicellulosiruptor hydrothermalis - hyperthermophilic, thermal spring, degrades

cellulose

Caldicellulosiruptor kristjanssonii - thermophilic, cellulolytic

Caldicellulosiruptor kronotskyensis - thermophilic, cellulolytic, hot springs

Caldicellulosiruptor lactoaceticus - thermophilic, aquatic, thermal spring

Caldicellulosiruptor owensensis - extremely thermophilic, xylanolytic, marine

sediment

Caldicellulosiruptor saccharolyticus - thermophilic, cellulolytic, freshwater, thermal

spring

Carboxydothermus hydrogenoformans - thermophilic, hot springs

Carnobacterium maltaromaticum - psychrotrophic, associated with spoilage of meat

products

Carnobacterium sp. - aquatic, psychrotrophic, ice

Cellulosilyticum lentocellum - river estuarine sediment, degrades cellulose 108

Clostridiales sp. - Soil, human and animal gastrointestinal tracts

Clostridium aceticum - soil, acetogenic

Clostridium acetobutylicum - digests sugar, starch, and cellulose

Clostridium autoethanogenum - autotrophic, acetogenic

Clostridium beijerinckii - soil

Clostridium bifermentans - toxic to mosquito larvae, soil, marine sediment

Clostridium baratii - human (animal) pathogen

Clostridium botulinum - pathogenic, soil, marine sediment

Clostridium butyricum - human and animal gastrointestinal tracts

Clostridium carboxidivorans - sediment, acetogenic

Clostridium carnis - soil

Clostridium cavendishii - contaminated groundwater

Clostridium cellulolyticum - cellulolytic

Clostridium cellulosi - cellulolytic

Clostridium cellulovorans - cellulolytic

Clostridium chauvoei - human and animal pathogen

Clostridium clariflavum - thermophilic, sludge, cellulolytic

Clostridium disporicum - associated with rat caecum, human pathogen

Clostridium haemolyticum - soil, pathogenic in cattle

Clostridium lentocellum - cellulolytic, aquatic

Clostridium ljungdahlii - homoacetogenic

Clostridium pasteurianum - fixes nitrogen

Clostridium perfringens - soil, marine, animal gastrointestinal tracts, human 109

pathogen, raw meat/poultry

Clostridium phytofermentans - forest soil, ferments plant polysaccharides

Clostridium saccharobutylicum - indole, acetone, butanol, and ethanol-producing

Clostridium saccharolyticum - sewage sludge

Clostridium saccharoperbutylacetonicum - butanol-producing

Clostridium scatologenes - acetogenic, sediment

Clostridium septicum - gastrointestinal tracts, human pathogen

Clostridium sordellii - human pathogen

Clostridium sp. - soil, gastrointestinal tracts

Clostridium sporogenes - Soil, human pathogen

Clostridium stercorarium - cellulolytic, thermophilic

Clostridium sticklandii - metabolizes amino acids, black mud

Clostridium sulfidigenes - pond sediment, reduces sulfur and thiosulfate

Clostridium tetani - human clinical samples, soil, intestinal tract of human,

associated with tetanus

Clostridium thermocellum - thermophilic, cellulolytic, ethanologenic, soil, water

sediment, intestinal tract of mammals

Clostridium tyrobutyricum - dairy products (cheese and milk)

Coprococcus catus - associated with human fecal flora

Dehalobacter restrictus - soil, dechlorinates Tetra- and Trichloroethene

Dehalobacter sp. - deep soils, groundwater aquifers, and river sediments

Desulfitobacterium dehalogenans - freshwater pond sediment, reductive

dechlorination of chloroaromatic compounds 110

Desulfitobacterium dichloroeliminans - contaminated ground water

Desulfotomaculum gibsoniae - freshwater, heterotrophic, reduces sulfate

Desulfitobacterium hafniense - capable of reductive dechlorination of organohalides,

sewage sludge, freshwater sediment, soil

Desulfitobacterium metallireducens - reduce metal, aquifer sediment (uranium

contaminated)

Desulforudis audaxviator - aquatic, fixes nitrogen, reduces sulfate

Desulfosporosinus acidiphilus - acidophilic, reduces sulfate, acid mining drainage

sediments

Desulfosporosinus orientis - reduce sulfate, terrestrial, reduces iron

Desulfosporosinus meridiei - reduce sulfate, groundwater, aquatic

Desulfotomaculum acetoxidans - reduces sulfate, animal waste, contaminated

freshwater

Desulfotomaculum carboxydivorans - moderately thermophilic, sludge, aquatic,

reduces sulfate

Desulfotomaculum kuznetsovii - thermophilic, soil, reduces sulfate, aquatic

Desulfotomaculum reducens - aquatic, sediment contaminated with heavy metals,

sulfate reducing, uranium and chromium reducing

Desulfotomaculum ruminis - reduces sulfate, associated with animal rumen

Dictyoglomus thermophilum - thermophilic

Enterococcus avium - birds, human feces

Enterococcus casseliflavus - Pathogenic

Enterococcus cecorum - poultry birds, , blood, feces 111

Enterococcus columbae - pigeon intestine, blood, gastrointestinal tracts

Enterococcus durans - associated with human intestine

Enterococcus faecalis - associated with animal and human gastrointestinal tracts

Enterococcus faecium - gastrointestinal tracts of human and animal

Enterococcus hirae - pathogenic

Enterococcus malodoratus - cheese, oral cavity and airways, gastrointestinal tracts,

human liver abscess biopsy, blood

Enterococcus mundtii - Soil, plant, gastrointestinal tracts

Enterococcus saccharolyticus - herbaceous plants, fresh broccoli

Enterococcus sulfureus - plants

Eubacterium acidaminophilum - wastewater, degrades amino acids

Eubacterium limosum - anaerobic digester, acetogenic

Eubacterium rectale - human gastrointestinal tract

Exiguobacterium acetylicum - rhizospheric soil

Exiguobacterium antarcticum - psychrophilic, microbial mats

Exiguobacterium sibiricum - psychrophilic, aquatic

Exiguobacterium sp. - hyperarsenic lake, extremophile, halotolerant

Filifactor alocis - associated with periodontitis

Geobacillus thermoglucosidasius - thermophilic, soil, aquatic

Geobacillus thermoleovorans - thermophilic, hotsprings

Halanaerobium hydrogeniformans - alkaliphilic, haloalkaline lake

Halanaerobium praevalens - halophilic, surface sediments of hypersaline lakes,

hydrolytic bacterium 112

Halobacillus halophilus - halophilic, salt marsh soil, aquatic

Halothermothrix orenii - halophilic, thermophilic

Hathewaya histolytica - Soil, oral cavity and airways (gingiva and plaque),

gastrointestinal tract

Hazenella coriacea - human blood

Heliobacterium modesticaldum - cellulolytic, soil

Kyrpidia tusciae - thermophilic, hot-springs, aquatic, soil

Lachnoclostridium phytofermentans - thermophilic, acidophilic

Lactobacillus acidophilus - gastrointestinal tracts

Lactobacillus amylovorus - associated with human gastrointestinal tracts

Lactobacillus animalis - dental plaque, gastrointestinal tracts

Lactobacillus bifermentans - degrades lactate

Lactobacillus brevis - normal human microbiota, heterofermentation of lactic acid

Lactobacillus casei - associated with human urinary tract and mouth

Lactobacillus coryniformis - grass silage, antifungal, plants, cow manure

Lactobacillus delbrueckii - milk, fermented products, gastrointestinal tracts, used in

the production of yoghurt

Lactobacillus fermentum - probiotic bacterium

Lactobacillus gasseri - probiotic, found in fermented foods, human breast milk

Lactobacillus ginsenosidimutans - associated with fermented food

Lactobacillus heilongjiangensis - fermentation of lactic acid

Lactobacillus johnsonii - associated with human and animal gastrointestinal tracts

Lactobacillus lactis - plants, animal gastrointestinal tracts 113

Lactobacillus murinus - gastrointestinal tracts

Lactobacillus paracasei - human gastrointestinal tracts

Lactobacillus pentosus - associated with olives, pickles

Lactobacillus pontis - associated with sourdough

Lactobacillus ruminis - bovine rumen

Lactobacillus reuteri - probiotic bacterium, gastrointestinal tracts

Lactobacillus rhamnosus - gastrointestinal tracts

Lactobacillus sakei - dry sausage, meat, pork, stool, fermented cabbage

Lactobacillus sanfranciscensis - sourdough, fermentation of lactic acid

Lactobacillus salivarius - saliva, probiotic, gastrointestinal tracts

Lactobacillus sp. wkB8 - associated with honey bee gastrointestinal tracts

Lactobacillus zymae - associated with sourdough

Lactococcus garvieae - fish pathogen, associated with aquatic animals

Lactococcus lactis - Cheese, plant surfaces, digestive tracts of cattle

Limnochorda pilosa - thermophilic, aquatic

Listeria grayi - gastrointestinal tracts, stool, plant leaf/stem, agricultural watershed

oil, soil

Listeria monocytogenes - associated with food, pathogenic

Macrococcus caseolyticus - associated with meat, sheep, goat, and milk

Mahella australiensis - thermophilic, oil reservoir

Megamonas hypermegale - Human gastrointestinal tracts

Melissococcus plutonius - assocaited with honey bees

Methylotenera mobilis - utilizes methylamine, denitrifying bacterium 114

Mucinivorans hirudinis - degrades mucin, digestive tract of medicinal leeches

Natranaerobius thermophilus - aquatic, sediments, halophilic, thermophilic

Oceanobacillus iheyensis - halophilic, alkaliphilic, deep sea sediment

Oenococcus kitaharae - fermentation of lactic acid

Oscillibacter valericigenes - produces valerate, sea coast, gastrointestinal tracts of

mollusks

Paenibacillus beijingensis - soil, fixes nitrogen

Paenibacillus durus - plant roots, fixes nitrogen

Paenibacillus graminis - soil, plant root, food

Paenibacillus mucilaginosus - silicate bacterium, soil, fixes nitrogen

Paenibacillus odorifer - associated with milk, wheat roots

Paenibacillus peoriae - soil

Paenibacillus polymyxa - soil, marine sediment, fixes nitrogen

Paenibacillus popilliae - soil, associated with milky spore (a disease in Japanese

beetles)

Paenibacillus riograndensis - fixes nitrogen, wheat rhizosphere

Paenibacillus sabinae - rhizospheric soil, fixes nitrogen

Paenibacillus stellifer - food packaging board, produces cyclodextrin

Paenibacillus terrae - mesophilic, earthworm gut

Pectinatus frisingensis - fermented beverages, beer, spoilt beer

Pediococcus acidilactici - plants

Pediococcus inapinatus - fermented beverages

Pediococcus claussenii - fermented beverages 115

Pediococcus damnosus - fermented beverages

Pediococcus pentosaceus - Lactic acid bacteria, plant materials, ripened cheese,

vegetables, produces a bacteriocin called pediocin

Pediococcus stilesii - maize

Pelotomaculum thermopropionicum - thermophilic, propionate-oxidizing bacterium

Pelosinus fermentans - aquatic, ground water, reduces metal

Pelosinus sp. - aquifier sediment

Peptoclostridium difficile - human pathogen

Peptococcus niger - human umbilical and human flora, ovine foot rot disease of

hooved animals

Peptostreptococcus anaerobius - associated with human oral cavity

Roseburia hominis - human gut/ feces

Ruminiclostridium thermocellum - amylolytic bacterium, associated with human

colon, degrades resistant starch in the colon

Psychrobacillus insolitus - soil, psychrophilic

Ruminococcus albus - thermophilic, cellulolytic

Ruminococcus bicirculans - human gastrointestinal tract

Ruminococcus bromi - human gastrointestinal tract, degrades cellulose

Ruminococcus chamanellensis - human gastrointestinal tract, degrades cellulose

Ruminococcus obeum - associated with human gut

Savagea faecisuis - associated with swine manure

Selenomonas ruminantium - animal rumen

Selenomonas sputigena - human pathogen 116

Solibacillus silvestris - forest soil

Sporosarcina aquimarina - aquatic, halophilic

Sporosarcina contaminans - industrial clean-room floor

Sporosarcina globispora - soil, human associated (blood)

Sporosarcina koreensis - soil

Sporosarcina newyorkensis - human blood, raw cow milk

Sporosarcina soli - soil

Sporosarcina thermotolerans - thermotolerant, human blood

Sporosarcina ureae - soil

Staphylococcus haemolyticus - normal human skin flora

Staphylococcus lugdunensis - human pathogen

Staphylococcus pasteuri - human pathogen

Staphylococcus piscifermentans - fermented fish/seafood (shrimp), dog feces

Staphylococcus pseudintermedius - associated with dog’s skin, human and dog

pathogen

Staphylococcus saprophyticus - Normal flora in female genital tracts, associated with

urinary tract infections, aquatic

Staphylococcus schleiferi - dog pathogen

Staphylococcus warneri - human pathogen

Staphylococcus xylosus - soil, human skin, food

Streptococcus agalactiae - pathogenic in humans

Streptococcus dysgalactiae - human and animal pathogen

Streptococcus equi - horse pathogen 117

Streptococcus iniae - fish pathogen

Streptococcus pneumoniae - human pathogen

Streptococcus pseudopneumoniae - pathogenic in humans

Streptococcus pyogenes - pathogenic, skin microbiota

Sulfobacillus acidophilus - oxidizes mineral sulfides and ferrous iron, acidophilic,

thermophilic

Symbiobacterium thermophilum - compost, soil, feces, thermophilic

Syntrophomonas wolfei - anaerobic digestor, sewage sludge

Syntrophothermus lipocalidus - thermophilic, sludge, oxidizes fatty acids

Tepidanaerobacter acetatoxydans - silage, oxidizes acetate

Tetragenococcus halophilus - halophilic, lactic acids bacteria

Thermacetogenium phaeum - aquatic, wastewater, thermophilic, oxidizes acetate

Thermaerobacter marianensis - extremely thermophilic, marine, deep sea floor

Thermincola potens - thermophilic, reduces metal

Thermincola sp. - thermophilic

Thermoanaerobacter brockii - thermophilic, aquatic, sediment

Thermoanaerobacter italicus - thermophilic, hot springs

Thermoanaerobacter kivui - thermophilic, freshwater lake sediment, reduces CO2

Thermoanaerobacter mathranii - hot spring, extremely thermophilic, produces

ethanol

Thermoanaerobacter sp. - extremely thermophilic

Thermoanaerobacterium thermosaccharolyticum - thermophilic, degrades cellulose,

starch 118

Thermoanaerobacter pseudethanolicus - thermophiic

Thermobacillus composti - thermophilic

Thermodesulfobium narugense - reduce sulfate, thermophilic, aquatic

Thermodesulfovibrio yellowstonii - thermophilic, reduces sulfate

Thermosediminibacter oceani - thermophilic, deep sea sediment

Veillonella parvula - aquatic, pathogenic in some fishes (trout)

Weissella ceti - gut and oral cavity of human

Weissella cibaria - lactic acid bacteria

Weissella hellenica - fermented sausage, flounder intestine

Weissella thailandensis - associated with fermented food and fish

Weissella viridescens - meat, pasteurized milk

DIDERMS

Acidobacteria

Alicyclobacillus acidocaldarius - thermophilic, acidophilic

Alicyclobacillus contaminans - acidophilic, moderately thermophilic

Alicyclobacillus cycloheptanicus - soil, acidophilic

Alicyclobacillus pomorum - acidophilic, thermophilic

Alicyclobacillus sp. - acidophilic, thermophilic

Alicyclobacillus vulcanalis - acidophilic, thermophilic, hot spring

Bryobacter aggregatus - peat moss, acidotolerant, chemoorganotrophic

Cellulosimicrobium cellulans - soil, pathogenic in human

Chloracidobacterium thermophilum - acidophilic, hot spring, thermophilic

Geothrix fermentans - aquatic, petroleum contaminated aquifer sediments, reduces 119

iron

Granulicella mallensis - acidophilic, psychrophilic, soil

Granulicella tundricola - psychrophilic, soil, tundra

Holophaga foetida - freshwater mud, can degrade aromatic compounds

Koribacter versatilis Ellin345 - soil, carbon oxidizing

Sphaerochaeta globose - freshwater sediment

Terriglobus roseus - agricultural soil

Terriglobus saanensis - tundra, psychrophilic, soil

Aquifacae

Aquifex pyrophilis - hot marine sediment (Iceland), underwater volcanoes,

thermophilic

Desulfurobacterium thermolithotrophum - reduces sulfate, thermophilic, marine,

deep-sea hydrothermal vent

Persphonella marina - chemolithotrophic, thermophilic hydrogen-oxidizing, deep sea

hydrothermal vent, fixes CO2

Thermocrinis albus - hyperthermophilic

Thermocrinis ruber - hyperthermophilic

Thermovibrio ammonificans - thermophilic, nitrate ammonifying, deep sea

hydrothermal vent

Armatimonadetes

Chthonomonas calidirosea - thermophilic, soil, carbohydrate scavenging bacterium

Armatimonas rosea - freshwater

Fimbriimonas ginsengisoli - soil 120

Bacteria Candidate Phylum

Acetothermus autotrophicum - thermophilic

Methylomirabilis oxyfera - denitrifying, methanotroph

Bacteroidetes

Aequorivita sublithincola - quartz stone from the Antarctic

Alistipes shahii - associated with human appendix tissue

Alistipes finegoldii - associated with human appendix tissue

Algoriphagus sp. - marine

Amoebophilus asiaticus - Intracellular symbiont of amoeba

Azobacteroides pseudotrichonymphae - Endosymbiont of termites

Bacteroides cellulosilyticus - human and animal gastrointestinal tract, degrades

cellulose

Bacteroides dorei - human and animal gastrointestinal tract

Bacteroides helcogenes - Associated with pigs

Bacteroides ovatus - human gastrointestinal tract

Bacteroides salanitronis - Associated with chicken caecum

Bacteroides stercoris - Normal flora of gastrointestinal tract

Bacteroides thetaiotaomicron - gastrointestinal tract flora

Bacteroides ureolyticus - gastrointestinal tract flora

Bacteroides vulgatus - gastrointestinal tract flora

Bacteroides xylanisolvens - associated with human intestine

Barnesiella viscericola - chicken caecum microbiota 121

Belliella baltica - aquatic

Blattabacterium punctulatus - associated with cockroaches (Crytocercus darwini),

nitrogen recycler

Blattabacterium sp. - associated with cockroaches

Butyrivibrio proteoclasticus - produces butyrate, associated with the rumen

Capnocytophaga canimorsus - normal flora of canine and feline species, pathogenic

in human

Capnocytophaga cynodegmi - associated with dogs

Cardinium endosymbiont - nematode symbiont

Cellulophaga algicola - psychrophilic, sea ice, marine

Cellulophaga baltica - psychrophilic, halophilic, marine, associated with marine alga

Cellulophaga lytica - aquatic, mud

Chryseobacterium gallinarum - associated with chicken, degrades keratin

Chryseobacterium sp. - associated with potato root, degrades lactone

Croceibacter atlanticus - marine

Cyclobacterium amurskyense - marine

Cyclobacterium marinum - marine

Cytopaga sp. - sand, aquatic

Cytophaga aurantiaca - soil

Desulfosporosinus meridiei - reduces sulfate, aquatic, contaminated groundwater

Dokdonia sp. - marine, phototrophic

Draconibacterium orientale - marine, chemoorganotrophic

Dyadobacter fermentans - associated with Zea mays 122

Echinicola vietnamensis - halotolerant, sea water

Elizabethkingia anophelis - pathogenic in humans, associated with mosquitoes

Elizabethkingia meningoseptica - freshwater and salt water, soil, associated with fish

and frogs

Elizabethkingia sp. - soil, river water and reservoirs

Emticicia oligotrophica - aquatic

Fibrella aestuarina - coastal mud, aquatic

Flavimarina pacifica - marine

Flavobacterium antarcticum - psychrotolerant, soil (Antarctica)

Flavobacterium aquatile - aquatic

Flavobacterium aquidurense - aquatic

Flavobacterium branchiophilum - freshwater, pathogenic in fishes

Flavobacterium cheniae - sediment

Flavobacterium chilense - associated with salmonid fishes

Flavobacterium columnare - aquatic, fish pathogen

Flavobacterium degerlachei - microbial mats in Antarctic lake, psychrophilic

Flavobacterium frigidarium - aquatic, psychrophilic, xylanolytic

Flavobacterium frigoris - psychrophilic, microbial mat

Flavobacterium glaciei - psychrophilic, glacier

Flavobacterium granuli - living on granules used in wastewater treatment plant

Flavobacterium hercynium - freshwater

Flavobacterium hibernum - freshwater, psychrotrophic

Flavobacterium hydatis - fish pathogen 123

Flavobacterium indicum - aquatic, warm spring water

Flavobacterium johnsoniae - muddy soil, freshwater, degrades chitin

Flavobacterium limicola - river sediment, psychrophilic, freshwater

Flavobacterium pectinovorum - soil

Flavobacterium psychrolimnae - psychrophilic, microbial mats of Antarctic ice

Flavobacterium psychrophilum - fish pathogen, psychrophilic

Flavobacterium saccharophilum - aquatic

Flavobacterium segetis - psychrophilic, soil

Flavobacterium sinopsychrotolerans - psychrophilic, frozen soil

Flavobacterium sp. - soil, hypersaline Antarctic lake, pathogenic in freshwater fish

Flavobacterium succinicans - aquatic, associated with diseased fish

Flavobacterium tiangeerense - psychrophilic

Flavobacterium xinjiangense - psychrophilic

Flexibacter flexilis - aquatic, pond

Flexibacter litoralis - aquatic

Flexibacter roseolus - marine, thermal springs, pathogenic in fish

Fluviicola taffensis - freshwater

Formosa agariphila - marine, agarolytic

Formosa sp. - marine

Geojedonia litorea - marine

Gramella forsetii - marine, surface waters, organic matters, involved in carbon cycle

Haliscomenobacter hydrossis - activated sludge

Hymenobacter gelipurpurascens - soil 124

Hymenobacter perfusus - uranium mine waste-water system

Hymenobacter sp. - Antarctic lichen, soil

Hymenobacter swuensis - mountain soil, gamma-radiation resistant

Ignavibacterium album - thermophilic, hot springs, aquatic

Indibacter alkaliphilus - haloalkaline lake, alkaliphilic

Krokinobacter sp. - marine

Lacibacter cauensis - eutrophic lake

Lacinutrix sp. - psychrophilic, subsea floor sediment

Leadbetterella byssophila - associated with cotton waste compost

Litoribacter alkaliphilus - haloalkaliphile, soil

Maribacter sp. - marine

Marivirga tractuosa - beach sand, freshwater, terrestrial wet environments

Melioribacter roseus - thermophilic, aquatic, cellulolytic

Muricauda lutaonensis - aquatic, thermophilic

Muricauda ruestringensis - marine

Myroides odoratus - chronic wounds, human ulcer swabs, urine

Myroides profundi - deep sea sediment, psychrophilic

Niabella soli - soil

Niastella koreensis - soil

Nonlabens dokdonensis - marine, mesophilic

Nonlabens marinus - Marine

Odoribacter splanchnicus - human blood, gastrointestinal tract, and gums of dogs

Ornithobacterium rhinotracheale - pathogenic in poultry birds 125

Owenweeksia hongkongensis - marine

Paludibacter propionicigenes - soil, rice plant residue, propionate-producing

bacterium

Parabacteroides distasonis - gastrointestinal tract

Parapedobacter composti - cotton waste compost

Pedobacter aquatilis - aquatic, freshwater

Pedobacter jejuensis - soil

Pedobacter heparinus - soil

Pedobacter saltans - soil

Pedobacter sp. - soil

Pontibacter korlensis - desert soil

Porphyromonas gingivalis - human pathogen

Porphyromonas asaccharolytica - associated with human teeth, pathogenic

Prevotella denticola - associated with human oral flora

Prevotella dentalis - associated with human oral flora

Prevotella melaninogenica - associated with the upper respiratory tract, human

pathogen

Prevotella fusca - associated with oral microbiome

Prevotella ruminicola - degrades hemicellulose and pectin, human rumen

Psychroflexus torquis - psychrophilic, Antarctic sea ice

Rhodothermus marinus - geothermal environment, thermophilic, halophilic

Riemerella anatipestifer - associated with disease in ducks and geese

Robiginitalea biformata - marine 126

Rudanella sp. - air, activated sludge

Rufibacter tibetensis - marine

Runella slithyformis - freshwater lake, aquatic

Salinirepens amamiensis - marine

Saprospira grandis - marine littoral sand, coastal regions

Sediminibacter furfurosus- marine sediment

Sediminibacter sp. - marine

Siansivirga zeaxanthinifaciens - marine

Solitalea canadensis - soil

Spirosoma linguale - freshwater

Sphingobacterium sp. - Antarctic soil

Sulcia muelleri - associated with sap-feeding insects (endosymbiont)

Tannerella forsythia - associated with subgingival cavity, pathogenic

Uzinura diaspidicola - insect endosymbiont

Weeksella virosa - associated with human urinary tract

Winogradskyella sp. - marine

Zobellia galactanivorans - marine, associated with red algae

Zunongwangia profunda - deep sea sediment, halophilic

Caldisericia

Caldisericum exile - Thermophilic, aquatic, thiosulfate-reducing bacterium, hotspring

Chlamydiae

Chlamydia avium - feral pigeon droppings

Chlamydia pecorum - pathogenic in animals 127

Chlamydia trachomatis - pathogenic

Chlymadia pneumoniae - cause respiratory tract infections, human serum

Chlamydophila psittaci - pathogenic in birds and humans

Criblamydia sequanensis - aquatic, amoeba resisting bacterium

Estrella lausannensis - amoeba-resisting bacterium

Metachlamydia lacustris - endosymbiont of amoeba

Neochlamydia hartmannellae - endosymbiont of Hartmannellae vermiformis

Parachlamydia acanthamoebae - activated sludge, wastewater, wastewater

treatment plant, associated with amoebae

Protochlamydia amoebophila - Soil, endosymbiont of acanthamoeba

Protochlamydia naegleriophila - Associated with pneumonia

Simkania negevensis - human pathogen

Waddlia chondrophila - cattle, bovine abortion tissue, causative agent of human and

bovine abortion

Chrysiogenetes

Desulfurispirillum indicum - aquatic, river sediment, reduces selenate

Cloacimonetes

Cloacamonas acidaminovorans - anaerobic digester of wastewater

Chlorobi

Chlorobi sp. - aquatic, hot springs (>45°C), thermophilic

Chlorobium limicola - aquatic

Chlorobaculum tepidum - thermophilic, acidic high sulfide hot-springs

Chlorobium luteolum - aquatic 128

Chlorochromatium aggregatum - aquatic, epibiont

Chlorobium chlorochromatii - freshwater, stratified lakes, ice-covered lakes in

Antarctica

Chlorobium phaeobacteroides - aquatic, hot springs

Chlorobium phaeovibrioides - utilizes thiosulfate, fixes nitrogen

Chlorobaculum parvum - chlorophototrophic, utilizes thiosulfate

Chloroherpeton thalassium - marine

Pelodictyon phaeoclathratiforme - freshwater lakes

Prosthecochloris aestuarii - aquatic

Cyanobacteria

Acaryochloris marina -marine

Acaryochloris sp. - freshwater

Anabaena affinis - freshwater

Anabaena bergii - brackish water

Anabaena catenula - freshwater

Anabaena circinalis - freshwater

Anabaena compacta - freshwater

Anabaena crassa - freshwater

Anabaena cylindrica - aquatic, nitrogen fixer

Anabaena eucompacta - freshwater

Anabaena flos-aquae - freshwater

Anabaena gelatinicola - freshwater

Anabaena lemmermannii - freshwater, produces cyanotoxins 129

Anabaena mendotae - freshwater

Anabaena minispora - freshwater

Anabaena oryzae - freshwater

Anabaena oumiana - freshwater

Anabaena planctonia - aquatic, sediment, fixes nitrogen

Anabaena pseudocompacta - freshwater, eutrophic lakes

Anabaena sedovii - freshwater

Anabaena smithii - freshwater

Anabaena solitaria - aquatic

Anabaena sp. - moist soil, rocks, aquatic

Anabaena sphaerica - aquatic, hypersaline estuary, natronophilic

Anabaena spiroides - aquatic

Anabaena tenericaulis - freshwater

Anabaena torulosa - freshwater

Anabaena ucrainica - freshwater

Anabaena variabilis - aquatic, nitrogen fixer

Anacystis nidulans - freshwater and marine environments, photosynthetic

Aphanizomenon flos-aquae - brackish water, freshwater, fixes nitrogen

Aphanizomenon gracile - freshwater

Aphanizomenon issatschenkoi - freshwater, fixes nitrogen

Aphanizomenon ovalisporum - lakes, water reservoir

Aphanizomenon sp. - aquatic, psychrophilic

Aphanothece clathrata - freshwater 130

Arthrospira erdosensis - freshwater

Arthrospira platensis - freshwater lake, alkaliphilic

Atelocyanobacterium thalassa - marine, fixes nitrogen

Calothrix brevissima - hot springs, thermophilic

Calothrix sp. - freshwater

Chamaesiphon minutus - freshwater

Chroococcales cyanobacterium - freshwater

Chroococcidiopsis thermalis - freshwater

Coleofasciculus chthonoplastes - marine

Coelomoron pusillum - freshwater

Crinalium epipsammum - terrestrial

Cuspidothrix issatschenkoi freshwater

Cyanobacterium aponinum - freshwater

Cyanobacterium stanieri - freshwater

Cyanobium gracile - freshwater

Cyanobium sp. - freshwater lakes

Cyanothece sp. - freshwater, nitrogen fixer

Cylindrospermum catenatum - freshwater, terrestrial

Cylindrospermum siamensis - freshwater

Cylindrospermum stagnale - freshwater, terrestrial

Cylindrospermum muscicola - terrestrial

Dolichospermum affine - freshwater

Dolichospermum circinale - aquatic, associated with blooms 131

Dolichospermum crassum - freshwater

Dolichospermum compactum - freshwater

Dolichospermum ellipsoides - nitrogen fixer

Dolichospermum flos-aquae - freshwater, causes blooms

Dolichospermum lemmermannii - large lakes, associated with surface bloom

formation

Dolichospermum macrosporum - aquatic, forms bloom

Dolichospermum mendotae - freshwater

Dolichospermum mucosum - freshwater

Dolichospermum planctonicum - freshwater

Dolichospermum sigmoideum - freshwater

Dolichospermum smithii - freshwater

Dolichospermum viguieri - freshwater

Euhalothece sp. - Antarctic lake

Fischerella muscicola - aquatic, psychrophilic

Geitlerinema sp. - aquatic

Gloeobacter kilaueensis - surface of rocks

Gloeobacter violaceus - surface of rocks in Switzerland

Gloeocapsa sp. - halophiles, hypersaline lakes

Gloeocapsa sp. - hypersaline lakes, fixes nitrogen

Gloeotrichia sp. - freshwater, sediments

Halothece sp. - fixes nitrogen, halotolerant, lake

Halotia longispora - terrestrial 132

Hassallia andreassenii - terrestrial

Hassallia antarctica - marine, deglaciated lake

Hydrocoleum majus - marine

Hydrocoryne spongiosa - freshwater, marine

Leptolyngbya mycoidea - marine

Leptolyngbya sp. - terrestrial, freshwater

Limnococcus limneticus - freshwater

Limnoraphis robusta - freshwater

Lyngbya aestuarii - marine

Lyngbya hieronymusii - freshwater

Lyngbya majuscula - warm/temperate waters, freshwater

Lyngbya robusta - freshwater

Microcoleus chthonoplastes - sediments, psychrophilic, freshwater

Microcoleus paludosus - freshwater

Microcoleus sp. - freshwater

Microcystis aeruginosa - brackish water, psychrophilic

Microcystis botrys - freshwater

Microcystis flos-aquae - freshwater

Microcystis ichthyoblabe - freshwater

Microcystis panniformis - freshwater

Microcystis sp. - river, associated with large surface blooms

Microcystis viridis - freshwater

Microcystis wesenbergii - aquatic 133

Nodosilinea epilithica - sediment, psychrophilic

Nodularia sphaerocarpa - freshwater

Nodularia spumigena - nitrogen fixer, hypersaline lakes

Nostoc azollae - sediments

Nostoc calcicola - associated with water fern, fixes nitrogen

Nostoc commune - terrestrial

Nostoc ellipsosporum - marine

Nostoc insulare - terrestrial

Nostoc piscinale - terrestrial

Nostoc punctiforme - freshwater

Nostoc sp. - freshwater, sediment

Okeania sp. - moist rock, soil, bottom of deep lakes and springs (freshwater and salt

water), psychrophilic

Oscillatoria geminata - marine

Oscillatoria nigroviridis - freshwater

Planktothrix agardhii - aquatic

Planktothrix cryptovaginata - freshwater

Planktothrix sp. - freshwater

Planktothrix suspensa - freshwater

Planktothrix rubescens - freshwater

Plectolyngbya hodgsonii - freshwater, turbid lakes

Plectonema terebrans - freshwater

Pleurocapsa sp. - freshwater 134

Prochlorococcus marinus - forest soil, grows in association with mosses, moist

meadow

Prochlorococcus sp. - aquatic

Prochlorothrix hollandica - freshwater, saline environment

Pseudanabaena catenata - aquatic, psychrophilic

Pseudanabaena frigida - freshwater

Pseudanabaena sp. - freshwater

Radiocystis sp. - aquatic, fixes nitrogen, can utilize organic phosphonoate

Raphidiopsis curvata - freshwater

Rivularia sp. - marine

Scytonema cf. fritschii - freshwater

Scytonema stuposum - moist rock, damp soil

Snowella litoralis - soil

Snowella rosea - marine

Sphaerospermopsis aphanizomenoides - freshwater

Sphaerospermopsis kisseleviana - freshwater

Sphaerospermopsis torques-reginae - freshwater

Spirulina major - aquatic

Spirulina maxima - marine and freshwater, hot springs

Spirulina sp. - marine

Spirulina subsalsa - marine

Stanieria cyanosphaera - freshwater

Stigonema ocellatum - freshwater, water reservoirs 135

Symploca sp. - marine, may possess anti-cancer compounds

Synechococcus elongatus - freshwater

Synechococcus rubescens - aquatic

Synechococcus sp. - freshwater

Synechocystis minuscula - marine

Synechococcus spongiarum - freshwater

Synechocystis salina - brackish water

Synechocystis sp. - freshwater, psychrophilic, sediments

Thermosynechococcus elongatus - marine

Thermosynechococcus sp. - thermophilic, hot spring

Tolypothrix sp. - psychrophilic, sediments

Trichodesmium erythraeum IMS101 - freshwater

Trichormus variabilis - fixes nitrogen, freshwater, terrestrial

Wilmottia murrayi - freshwater

Woronichinia naegeliana - freshwater

Woronichinia sp. - freshwater

Deferribacteres

Calditerrivibrio nitroreducens - thermophilic, aquatic, thermal spring, reduces nitrate

Deferribacter desulfuricans - thermophilic, hydrothermal vent, reduces sulfate,

arsenate, and nitrate

Denitrovibrio acetiphilus - reduces nitrate, oil reservoir

Deinococcus-Thermus-Fusobacteria

Deinococcus deserti - radiotolerant, desert soil 136

Deinococcus geothermalis - thermophilic, radiophilic, hot springs

Deinococcus gobiensis - radiation resistant

Deinococcus maricopensis - radiation resistant, desert soil

Deinococcus peraridilitoris - radiation resistant, desert soil

Deinococcus radiodurans - radiation resistant, extremophilic (polyextremophile)

Fusobacterium necrophorum - bovine liver abscess, blood, alimentary canal of

humans and animals

Fusobacterium nucleatum - throat, wound, animal colon, blood, amniotic fluid

Ilyobacter insuetus - marine, anoxic sediment, fermentative

Ilyobacter polytropus - marine, mud

Ilyobacter tartaricus - mud, canal sediment

Leptotrichia buccalis -associated with human dental plaque

Marinithermus hydrothermalis - thermophilic, heterotrophic, marine

Meiothermus ruber - thermophilic, heterotrophic

Meiothermus silvanus - thermophilic

Oceanithermus profundus - thermophilic, organotrophic

Propionigenium maris - marine, intertidal mud

Propionigenium modestum - mud, human saliva

Sebaldella termitidis - associated with termite gastrointestinal tract, uricolytic

Thermus scotoductus - thermophilic, oxidizes sulfur

Thermus sp. - thermophilic, hot spring

Thermus thermophilus - thermal spring, extremely thermophilic

Truepera radiovictrix - radiation resistant, hot spring 137

Elusimicrobia

Elusimicrobium minutum - associated with termite gastrointestinal tract

Endomicrobia

Endomicrobium proavitum - symbiont of termites, fixes nitrogen

Fibrobacteres

Fibrobacter succinogenes - associated with cattle rumen, cellulolytic bacterium

Gemmatimonadetes

Gemmatimonas aurantiaca - wastewater

Lentisphaerae

Lentisphaera marina - marine

Lentisphaera profunda - marine

Nitrospirae

Leptospirillum ferriphilum - oxidizes iron, aquatic, acidophilic

Leptospirillum ferrooxidans - iron oxidizer, fresh volcanic ash, copper deposits, acid

mine drainage water

Magnetobacterium bavaricum - magnetotactic, lake sediment, oxidizes sulfur

oxidizes nitrite, wastewater

Nitrospira defluvii - chemolithoautotrophic bacteria, freshwater/saltwater, deltaic

sediments, deep-sea sediment, soil, iron pipe of a heating system

Nitrospira moscoviensis - soil, aquatic, oxidizes nitrite

Nitrospira sp. - oxidizes nitrite

Planctomyces 138

Anammoximicrobium moscowii - anaerobic ammonia oxidation, wastewater

Blastopirellula marina - freshwater, brackish water, halotolerant

Brocadia annamoxidans - aquatic, oxidizes ammonium anaerobically

Brocadia sinica - oxidizes ammonium

Caldilinea aerophila - freshwater, brackish water, ammonium oxidizer, thermophilic

Gemmata obscuriglobus - freshwater, nucleus-like organelle

Gemmata sp. - marine, coastal

Gimesia maris - hot springs, salmon colored

Isosphaera pallida - anaerobic ammonium oxidizing, sludge of an anaerobic

bioreactor

Jettenia asiatica - wastewater treatment plant, bioreactor

Kuenenia stuttgartiensis - Marine, wastewater treatment plant

Pirellula sp. - marine, anaerobic digester at wastewater treatment plant

Pirellula staleyi - aquatic

Phycisphaera mikurensis - marine

Planctomyces brasiliensis - fresh and salt water, halophilic

Planctomyces limnophilus - aquatic, surface water

Planctopirus limnophila - brackish water, sediment, algal surface

Rhodopirellula baltica - aquatic, hypersaline lake, water from salt pit

Rubinisphaera brasiliensis - aquatic

Singulisphaera acidiphila - wetlands, associated with peat plants

Syntrophobotulus glycolicus - sewage sludge, anoxic freshwater sediment

Telmatocola sphagniphila - wetland 139

Proteobacteria

Alphaproteobacteria

Acetobacter aceti - flowers, fruits, soil

Acetobacter cibinongensis - associated with fruits and flowers, acetogenic

Acetobacter indonesiensis - human pathogen (lung infections, bacteremia), fruits,

plants, vinegar production

Acetobacter oeni - acetic acid bacteria, sugary environment, associated with

wine

Acetobacter pasteurianus - produces acetic acid, associated with plants and

plant products

Acetobacter sp. - fixes nitrogen, acetic acid bacterium

Acetobacter tropicalis - associated with olive fruit fly, acetic acid bacterium

Acidiphilium multivorum - acidophilic, mine, aquatic, metal-resisting

Acidiphilium sp. - aquatic, metal-rich environment, acidophilic

Acidiphilium symbioticum - acidophilic, sulfidic mine environment,

Acidisoma sp. - acidophilic, psychrotolerant, wetland

Acidisphaera sp. - acidic hot-springs, mine drainage

Acidocella aromatica - mud, acidophilic

Acidocella facilis - aquatic, acidophilic, geothermal lake

Acidocella sp. - acidophilic, geothermal lake, mine drainage, freshwater

Afipia broomea - human sputum, industrial water for injection

Afipia felis - lake sediment, human lymph node tissue 140

Afipia sp. - atmosphere, contaminated sediment, roots

Agrobacterium fabrum - pathogenic in plants, soil

Agrobacterium sp. - pathogenic in plants

Agrobacterium vitis - pathogenic in plants, soil

Albidovulum xiamenense - thermophilic, aquatic, hot spring

Allorhizobium undicola - aquatic (waterlogged area), fixes nitrogen

Altererythrobacter atlanticus - marine

Altererythrobacter epoxidivorans - marine sediment

Altererythrobacter marensis - marine

Altererythrobacter sp. - sediment, marine, tidal flat

Anaplasma phagocytophilum - transmitted by ticks, human pathogen, blood

Ancalomicrobium adetum - freshwater creeks

Asaia bogorensis - acetic acid bacterium, flowers, fruits

Asaia krungthepensis - acetic acid bacterium, flowers, plant derived materials

Asaia lannensis - acetic acid bacterium, pathogenic

Asaia siamensis - acetic acid bacterium, flower

Asticcacaulis excentricus - aquatic, pond water

Aurantimonas manganoxydans - marine

Aurantimonas coralicida - pathogenic in corals

Aureimonas altamirensis - terrestrial

Aureimonas frigidaquae - aquatic

Azorhizobium caulinodans - stem nodule, nitrogen fixer

Azorhizophilus paspali - soil, rhizosphere, plants 141

Azospirillum sp. - fixes nitrogen

Azospirillum brasilense - fixes nitrogen, soil, rhizosphere

Azospirillum lipoferum - plant root, fixes nitrogen

Azospirillum thiophilum - aquatic, sulfur bacterial mat, fixes nitrogen

Bartonella ancashi - human pathogen

Bartonella australis - associated with kangaroo

Bartonella bacilliformis - pathogenic, associated with sandflies

Bartonella clarridgeiae - associated with cats

Bartonella grahamii - animal pathogen, ocular fluids

Bartonella henselae - associated with cat-scratch disease in humans

Bartonella quintana - human pathogen, transmitted by the human body louse

Bartonella schoenbuchensis - associated with deer fly

Bartonella vinsonii - human pathogen, associated with dogs and wild canines

Beijerinckia indica - acidophilic, fixes nitrogen, soil

Belnapia rosea - forest soil

Blastochloris viridis - aquatic

Bradyrhizobium denitrificans - aquatic, lake water

Bradyrhizobium diazofficiens - plant nodules, fixes nitrogen

Bradyrhizobium elkanii - fixes nitrogen, aquatic, soil

Bradyrhizobium jicamae - plant nodules, fixes nitrogen

Bradyrhizobium lupine - plant roots, nitrogen fixer

Bradyrhizobium oligotrophicum - fixes nitrogen, rice paddy field soil

Brevundimonas basaltis - terrestrial (black sand) 142

Brevundimonas denitrificans - aquatic sediment, denitrifying bacterium

Brevundimonas diminuta - Aaquatic, soil, cow/cattle (in their skin, nail, hair)

Brevundimonas intermedia - aquatic

Brevundimonas sp. - aquatic, it can survive simulated cosmic radiation

Brevundimonas subvibrioides - freshwater

Brevundimonas vesicularis - aquatic, associated with clinical samples

Brevundimonas viscosa - soil

Brucella abortus - pathogenic in cattle

Brucella canis - pathogenic in dogs and other canids

Brucella ceti - pathogenic in cetaceans

Brucella microti - soil, pathogenic in human

Brucella suis - pathogenic in animals

Caedibacter caryophilus - Paramecium caudatum symbiont

Caedibacter macronucleorum - obligate endosymbiont of paramecia, has R

bodies

Caedibacter acanthamoebae - endosymbiont of paramecium species

Catellibacterium nectariphilum - activated sludge

Caulobacter crescentus - freshwater

Caulobacter fusiformis - aquatic

Caulobacter leidyia - aquatic

Caulobacter vibrioides - aquatic, fresh water

Celeribacter marinus - marine

Chelativorans sp. BNC1 - polycyclic aromatic hydrocarbon degradation 143

Croceicoccus naphthovorans - marine, degrade hydrocarbon

Cytophaga hutchinsonii - soil, digest crystalline cellulose

Devosia ginsengisoli - soil

Devosia riboflavina - soil

Dinoroseobacter shibae - marine

Dongia rigui - freshwater

Endolissoclinum faulkneri - aquatic, coral reef

Ensifer adhaerens - soil, nitrogen fixer

Erythrobacter sp. - coastal sea water

Erythromicrobium sp. - resistant to heavy metal oxide, freshwater

Fulvimarina pelagi - marine

Gemmobacter tilapiae - freshwater pond

Gluconacetobacter diazotrophicus - associated with sugarcane, fixes nitrogen,

acetic acid bacteria

Gluconacetobacter xylinus - Produce cellulose, acetic acid bacteria

Gluconacetobacter takamatsuzukensis - from plaster in tomb, acetic acid

bacteria

Gluconacetobacter tumulisoli - from plaster in tomb, acetic acid bacteria

Gluconobacter oxydans - sugar-rich environment, fruits

Granulibacter bethesdensis - pathogenic

Haematobacter massiliensis - associated with clinical specimens

Hirschia baltica - marine, chemoheterotrophic

Hyphomicrobium denitrificans - marine 144

Hyphomicrobium vulgare - aquatic

Hyphomicrobium nitrativorans - biofilm, denitrifying bacterium

Jannaschia sp. CCS1 - marine

Kaistia granuli - chemoorganotroph, anaerobic sludge (granule part)

Ketogulonicigenium vulgare - soil

Komagataeibacter europaeus - cider vinegar, cellulose producer

Komagataeibacter intermedius - fermented fruit juice, cellulose producer

Komagataeibacter medillinensis - cellulolytic

Komagataeibacter xylinus - shrubs, fruit (seeds), trees, produces cellulose

Kozakia baliensis - acetic acid bacterium, plants

Leisingera methylohalidivorans - psychrophilic, marine

Liberibacter americanus - pathogenic in citrus plants

Liberibacter crescens - insect symbions, plant pathogen

Loktanella hongkongensis - marine biofilm

Magnetospirillum gryphiswaldense - freshwater, sediments

Magnetospirillum magneticum - magnetotactic, aquatic

Magnetococcus marinus - magnetotactic, marine

Maricaulis maris MCS10 - marine, forms biofilm, volatizes mercury

Martelella endophytica - associated with halophytes, antifungal

Mesorhizobium amorphae - root nodule, soil

Mesorhizobium australicum - associated with plant root nodules

Mesorhizobium ciceri - fix nitrogen, root nodules

Mesorhizobium erdmanii - soil 145

Mesorhizobium huakuii - root nodule

Mesorhizobium opportunistum - associated with root nodule, fixes nitrogen

Mesorhizobium sp. - soil

Methylarcula sp. - coastal saline habitat, facultatively methanotroph

Methylobacterium adhaesivum - aquatic, methylotrophic

Methylobacterium aquaticum - aquatic

Methylobacterium gnaphalii - associated with leaves of Gnaphalium Spicatum

Methylobacterium nodulans - methylotrophic, root nodules, nitrogen-fixing

bacteria

Methylobacterium oryzae - associated with rice stem, methylotrophic

Methyloceanibacter caenitepidi - thermophilic, marine sediment, methylotrophic

Methylocella silvestris - oxidizes methane

Methylocystis sp. - methanotrophic, aquatic

Methylosinus sp. - fixes nitrogen

Micavibrio aeruginosavorus - wastewater, epibiont

Midichloria mitochondrii - endosymbiont of ticks

Mycoplana dimorpha - soil

Neoasaia chiangmaiensis - osmotolerant acetic acid bacterium, flower

Neorhizhobium huautlense - root nodule, fixes nitrogen

Neorhizobium galegae - nitrogen fixer, root nodule

Neorickettsia helminthoeca - associated with fish, pathogenic in dogs

Neorickettsia risticii - lives in aquatic insects, associated with the Potomac horse

fever 146

Neorickettsia sennetsu - associated with fishes, human pathogen

Nitrobacter winogradskyi - soil, aquatic

Novosphingobium barchaimii - contaminated soil (with hexachlorocyclohexane)

Novosphingobium pentaromativorans - estuarine sediment, degrades

hydrocarbons

Novosphingobium sp. - soil, aquatic, degrades hydrocarbons

Nordella oligomobilis - aquatic

Nucleicultrix amoebiphila - amoeba symbiont

Ochrobactrum intermedium - associated with human, soil, polluted environment,

water, rhizosphere

Octadecabacter antarcticus - sea ice, psychrophilic, aquatic

Octadecabacter arcticus - psychrophilic, aquatic, sea ice

Oligotropha carboxidovorans - soil

Orientia tsutsugamushi - human pathogen, mite-borne bacterium

Paracaedibacter acanthamoebae - endosymbiont of Paramecium caudatum

Paracoccus aminophilus - heterotrophic, methylotroph

Paracoccus denitrificans - meadow, soil, associated with agriculture, wastewater

treatment plant

Paracoccus sp. - soil, mud volcano soil, cow dung, activated sludge

Paraherbaspirillum soli - soil

Parvibaculum lavamentivorans - degrades hydrocarbons, aquatic

Parvularcula bermudensis - marine

Pelagibacter ubique - salt and freshwater, heterotrophic 147

Pelagibacterium halotolerans - halotolerant, aquatic

Pelagibacter sp. - marine

Phaeobacter gallaeciensis - aquatic

Phenylobacterium lituiforme - freshwater, moderately thermophilic

Phenylobacterium zucineum - subsurface aquifer, alkaline groundwater, activated sludge, wastewater treatment plant, soil

Phyllobacterium myrsinacearum - sugar beet root, leaf nodule, aquatic, industrial

wastewater

Phyllobacterium sp. - associated with plant nodules, fixes nitrogen

Phycosocius bacilliformis - associated with green algae

Polymorphum gilvum - saline soil, degrades oil

Pseudorhodobacter antarcticus - Antarctic sandy sediment

Pseudorhodobacter ferrugineus - brackish water

Pseudorhodobacter sp. - aquatic

Pseudovibrio sp. - aquatic

Puniceispirillum marinum - associated with marine invertebrates

Rhizobium etli - soil, root nodules, commonly associated with beans

Rhizobium gallicum - root nodules, fixes nitrogen

Rhizobium phenanthrenilyticum - degrades phenanthrene, petroleum residue

treatment plant, fixes nitrogen

Rhizobium sp. - fixes nitrogen

Rhizobium tropici - nitrogen fixer, legume roots

Rhodobacter azotoformans - alkali-tolerant, aquatic 148

Rhodobacter blasticus - aquatic

Rhodobacter capsulatus - muddy pond rich in decomposing organic matter, soil

Rhodobacter changlensis - phototrophic, psychrotolerant

Rhodobacter johrii - semi-arid soil

Rhodobacter megalophilus - soil

Rhodobacter sp. - aquatic, psychrophilic

Rhodobacter veldkampii - freshwater pond

Rhodomicrobium vannielii - thermophilic, marine, soil, coastal sediments

Rhodospirillum centenum - thermotolerant

Rhodospirillum photometricum - freshwater

Rhodospirilum rubrum - mud (sludge), grassland

Rhodovastum atsumiense - marine, phototrophic

Rhodovulum sp. - rice paddy soil, fixes nitrogen

Rhodovulum sulfidophilum - aquatic, mud (mud sludge)

Rickettsia akari - associated with ricketssial pox, transmitted by rodent mites

Rickettsia amblyommii - associated with ticks, pathogenic

Rickettsia bellii - tick-borne, pathogenic

Rickettsia felis - associated with dogs and cats, human pathogen

Rickettsia heilongjiangensis - associated with ticks, human pathogen

Rickettsia japonica - pathogenic

Rickettsia limoniae - transmitted by ticks

Rickettsia monacensis - tick borne, human pathogen

Rickettsia prowazekii - pathogenic 149

Rickettsia rhipicephali - pathogenic, associated with ticks

Rickettsia rickettsii - associated with ticks, pathogenic

Rickettsia slovaca - associated with ticks, pathogenic

Rickettsia typhi - associated with murine typhus, use tick as carrier

Roseibacterium elongatum - marine, sand

Roseobacter denitrificans - marine sediment, phototroph

Roseobacter litoralis - marine, psychrophilic

Roseobacter sp. - sediments, sea ice

Roseococcus thiosulfatophilus - freshwater, thermal springs, bacteriochlorophyll

a-containing bacteria

Roseomonas lacus - aquatic, freshwater lake sediment

Roseomonas riguiloci - freshwater

Roseospira sp. Ber2104 - marine

Ruegeria pomeroyi - aquatic, coastal lagoon sediments, saline sulfur springs,

microbial mats

Sandarakinorhabdus limnophila - freshwater lake, psychrophilic

Silicibacter sp. TM1040 - marine, involved global sulfur cycle

Sinorhizobium americanum - fixes nitrogen, root nodules

Sinorhizobium arboris2 - leguminous trees, root nodules, fixes nitrogen

Sinorhizobium fredii - fixes nitrogen, plants, root nodule

Sinorhizobium kostiense - leguminous trees, nitrogen fixer

Sinorhizobium medicae - fixes nitrogen, root of leguminous plants, acid tolerant

Sinorhizobium meliloti - fixes nitrogen, soil 150

Sinorhizobium morelense - root nodules, nitrogen fixer

Sinorhizobium saheli - fixes nitrogen, roots, rhizosphere

Sinorhizobium terangae - nitrogen fixer, plants

Sinorhizobium xinjiangense - soybean nodules

Skermanella aerolata - air

Sphingobium chlorophenolicum- soil contaminated with pentachlorophenol,

mineralizes pentachlorophenol

Sphingobium chungbukense - soil, metabolizes polycyclic hydrocarbons,

extracellular polysaccharides and antibiotics

Sphingobium sp. SYK-6 - soil, degrades lignin-derived compounds

Sphingomonas sanxanigenens - soil

Sphingomonas sp. - oil and uranium contaminated soil, marine, can break down

polycyclic hydrocarbons, water from ricefields, volcano

Sphingomonas taxi - associated with a plant root (Cucurbita pepo), degrades DDE

(Dichlorodiphenyldichloroethylene)

Sphingopyxis alaskensis - marine

Sphingopyxis fribergensis - meadow soil, degrades styrene and phenylacetic acid

Sphingopyxis macrogoltabida - soil

Sphingopyxis sp. - freshwater lake, psychrophilic

Sphingorhabdus planktonica - degrades crude oil, marine

Sphingosinicella soli - alkaline soil

Starkeya novella - soil, methylotrophic

Swaminathania salitolerans - Plants associated, nitrogen fixing bacteria, 151

phosphate solubilizing, rhizosphere, roots and stems of salt-tolerant,

mangrove-associated wild rice

Sulfitobacter sp. - marine

Thalassobius aestuarii - tidal flat sediment, reduces nitrite

Thalassospira xiamenensis - aquatic, surface water oof an oil pool

Tistrella mobilis - wastewater, polyhydroxyalkanoate-producing bacterium

Woodsholea maritima - marine

Xanthobacter autotrophicus - fixes nitrogen, methylotroph, activated sludge,

oxidizes propene, degrades trichloroethylene

Zymomonas mobilis - aquatic, associated with beer spoilage and alcoholic

beverages

Betaproteobacteria

Accumulibacter phosphatis - sewage and wastewater treatment plant

Bacillus endophyticus - pathogenic, associated with otitis media and cystic

fibrosis

Acidovorax avenae - plant pathogen

Acidovorax citrulli - plant pathogen

Acidovorax delafieldii - soil

Acidovorax ebreus - oxidizes iron and uranium

Acidovorax facilis - soil

Acidovorax sp. JS42 - aquatic, nitrobenzene contaminated sediment,

contaminated soil

Acidovorax temperans - soil, water 152

Acidovorax valerianellae - Pathogenic in lamb’s lettuce (plant)

Advenella kashmirensis - oxidizes etrathionate, soil

Advenella mimigardefordensis - compost, utilizes organic disulfide 3,39-

dithiodipropionic acid.

Albidiferax ferrireducens - aquatic sediment

Alcaligenes faecalis - aquatic, brackish water, feces

Algoriphagus machipongonensis - mud

Alicycliphilus denitrificans - reduces nitrate, wastewater and sewage treatment

plant

Aquabacterium limnoticum - freshwater spring

Aquabacterium sp. - aquatic, soil

Aquaspirillum arcticum - aquatic

Aquaspirillum serpens - aquatic, psychrophilic, Arctic sediment

Aquincola tertiaricarbonis - pond water

Aquitalea denitrificans - contaminated groundwater, wastewater

Aromatoleum aromaticum EbN1 - soil, denitrifying bacterium

Azoarcus sp. - freshwater, soil

Azoarcus toluclasticus - nitrogen fixer, wastewater, activated sludge

Azoarcus tolulyticus - soil, water, fixes nitrogen

Azoarcus toluvorans - contaminated soil, sediments, aquifer, degrades toluene,

fixes nitrogen

Azospira restricta - contaminated soil and water

Azospira oryzae - fixes nitrogen, groundwater 153

Azospira sp. - swine waste, reduces selenite and selenate

Azovibrio restrictus - fixes nitrogen

Basilea psittacipulmonis - grass, roots (surface sterilized) Pakistan

Bordetella avium - lungs of a parakeet

Bordetella bronchiseptica - avian oral cavity and airway

Bordetella hinzii - animal pathogen

Bordetella holmesii - associated with poultry with respiratory disease, chicken

trachea

Bordetella parapertussis - associated with whooping cough in humans

Bordetella pertussis - associated with whooping cough in humans

Burkholderia caribensis - associated with whooping cough in humans

Burkholderia cepacia - soil, degrades haloacids

Burkholderia contaminans - aquatic, soil

Burkholderia diazotrophica - marine

Burkholderia dolosa - root nodules, fixes nitrogen

Burkholderia fungorum - associated with cystic fibrosis

Burkholderia gladioli - associated with fungus, plant and animals clinical samples

Burkholderia lata - soil, water, rhizosphere, isolated from an insect,

plants and animal pathogen, decomposing plants, fruits (seed)

Burkholderia mallei - soil, aquatic

Burkholderia mimosarum - humans and animal pathogen

Burkholderia nodosa - soil, root nodule

Burkholderia oklahomensis - root nodules, fix nitrogen 154

Burkholderia phenoliruptrix - mine waste, chlorate reducing

Burkholderia phytofirmans - heat-tolerant, nitrogen-fixing symbiont of Mimosa

flocculosa

Burkholderia plantarii - associated with plants

Burkholderia pseudomallei 688 - rice pathogen

Burkholderia pyrrocinia - soil, water, pathogenic

Burkholderia rhizoxinica - coil, sputum of cycstic fibrosis patients

Burkholderia thailandensis - associated with a plant pathogenic fungus (Rhizopus

microspores)

Burkholderia ubonensis - soil, water, human pathogen

Burkholderia xenovorans - soil, catabolizes aromatic compounds, aerobic

Caldimonas hydrothermale - thermophilic, thermal spring

Caldimonas manganoxidans - aquatic, thermophilic, hot spring, degrades

manganese

Caldimonas taiwanensis - hot-spring, amylase-producing bacterium

Castellaniella defragrans - Soil, reduces nitrate

Chitinibacter sp. - soil, chitin-degrading

Chitinibacter suncheonensis - soil, chitin-degrading

Chitinibacter tainanensis - degrades chitin, mud

Chitinivorax tropicus - soil, degrades chitin

Chromobacterium violaceum - freshwater lake, chitinlolytic

Chromobacterium sp. - soil, stagnant water

Collimonas arenae - wastewater, effluent from a fiber glass industry 155

Collimonas fungivorans - soi

Collimonas sp. - soil, antifungal

Comamonas koreensis - soil

Comamonas sp. - wetlands

Cupriavidus basilensis - halotolerant

Cupriavidus gilardii - soil

Cupriavidus necator - human pathogen

Cupriavidus oxalaticus - soil, mud (sludge), small ponds, hydrogen oxidizer

Cupriavidus pinatubonensis - soil

Cupriavidus taiwanensis - volcanic ash deposits, mud sludge

Cupriavidus wautersia - fixes nitrogen, plant roots

Curvibacter delicatus - soil

Curvibacter fontanus - aquatic, well water

Dechloromonas aromatica - aquatic, well water, industrial wastewater

Dechloromonas hortensis - aquatic sediment

Dechloromonas sp. - Psychrophilic

Dechlorosoma suillum - mine waste, chlorate reducing

Deefgea chitinilytica - aquatic

Deefgea rivuli - aquatic

Deefgea sp. - freshwater, reduces perchlorate

Delftia acidovorans - aquatic

Delftia sp. - soil, sewage

Denitratisoma oestradiolicum - degrades polyaromatic hydrocarbons, 156

polyaromatic hydrocarbon contaminated soil

Derxia gummosa - denitrifying bacterium, wastewater, sludge

Duganella sp. - soil, fixes nitrogen

Flexibacter ruber - water, soil

Gallionella capsiferriformans - marine

Glomeribacter gigasporarum - oxidizes iron, iron contaminated groundwater

Herbaspirillum autotrophicum - endosymbiont of arbuscular mycorrhizal fungi

(Gigaspora margarita)

Herbaspirillum chlorophenolicum - aquatic, paddy soil

Herbaspirillum frisingense - soil, degrades chloropheno

Herbaspirillum hiltneri - nitrogen fixer, soil, associated with C4-fibre plants

Herbaspirillum huttiense - plant roots, soil

Herbaspirillum lusitanum - nitrogen fixer, plant roots

Herbaspirillum rubrisubalbicans - root nodules, nitrogen fixer, soil

Herbaspirillum seropedicae - nitrogen fixer, roots and stems of sugarcane,

sorghum, and rice

Herbaspirillum sp. - aquatic, mud (sludge), freshwater, leaf (phyllosphere)

Herminiimonas arsenicoxydans - Metal resistant, industrial sludge contaminated

with arsenic, can oxidize arsenic

Herminiimonas sp. - aquatic

Hydrogenophaga sp. - oxidizes hydrogen, autotroph

Hydrogenophaga palleronii - aquatic, degrades aminobenzenesulfonate, oxidizes

hydrogen 157

Hylemonella gracilis - aquatic, pond water

Hylemonella sp. - aquatic

Inhella inkyongensis - freshwater, activated sludge

Ideonella dechloratans - aquatic, uses chlorate as an electron acceptor

Iodobacter arcticus - psychrotolerant, stream sediment

Iodobacter fluviatilis - aquatic, river

Iodobacter glacier - psychrophilic

Iodobacter limonosediminis - lake sediment

Iodobacter sp. - Freshwater, psychrophilic

Janthinobacterium agaricidamnosum - pathogenic in Agaricus bisporus

mushrooms

Janthinobacterium lividum - soil

Janthinobacterium sp. -soil, lake sediment, aquatic, psychrotolerant

Kerstersia gyiorum - associated with human clinical samples

Kinetoplastibacterium crithidii - endosymbiont of trypanosome

Kinetoplastibacterium desouzaii - endosymbiont of trypanosome

Kingella kingae - pathogenic in human

Kingella potus - associated with wounds caused by animal bites

Lampropedia hyalina - liquid manure (from livestock)

Leptothrix mobilis - freshwater sediment

Leptothrix sp. - soil, plants

Limnohabitans parvus - freshwater

Limnohabitans planktonicus - Aquatic, chemoorganotroph 158

Limnohabitans sp. - soil (heavy metal contaminated soil)

Massilia aurea - aquatic

Massilia lutea - freshwater lake, streams

Massilia sp. - soil, fixes nitrogen

Massilia varians - associated with clinical samples

Methylibium fulvum - soil of a ginseng field

Methylibium sp. - soil, groundwater

Methylobacillus flagellatus - marine, methylotrophic

Methylotenera mobilis - utilizes methylamine, lake sediment

Methylotenera versatilis - methylotrophic, lake sediment, freshwater, acid mine

drainage

Methyloversatilis universalis - methylotrophic, contaminated soil

Methylovorus glucosetrophus - methylotroph, lake

Methylovorus glucosotrophus - utilizes fructose, methylotroph

Methylopumilus planktonicus - freshwater, methylotrophic

Methylovorus sp. - methylotrophic

Methylopumilus turicensis - freshwater, methylotrophic

Mitsuaria chitosanitabida - produces chitosanase, soil

Neisseria animaloris - associated with human wound infection

Neisseria canis - oral cavity of dog and cat

Neisseria cinerea - human commensal

Neisseria dentiae - associated with dental plaque of cows

Neisseria elongata - oral floral, pathogenic 159

Neisseria gonorrhea - urogenital tract, urine

Neisseria lactamica - harmless resident of infant respiratory tract

Neisseria macacae - oropharynx flora of healthy Rhesus Monkeys

Neisseria meningitidis - pathogenic

Neisseria oralis - mesophilic, gingival plaque

Neisseria shayeganii - associated with clinical specimen

Neisseria sicca - human oropharynx flora

Neisseria wadsworthii - associated with clinical specimen

Neisseria weaveri - associated with dog bites, pathogenic in human

Neisseria zoodegmatis - associated with human wound infection

Nitrosomonas communis - oxidizes ammonium, wastewater

Nitrosomonas europaea - soil, sewage, fresh water, surfaces of building

Nitrosomonas eutropha - ammonium-oxidizing, dirt and untreated water,

sewage

Nitrosomonas oligotropha - ammonia oxidizer, water systems,

Nitrosomonas sp. - freshwater, soil, building surfaces, ammonium oxidizer

Nitrosospira briensis - acidic agricultural soil, chemolithotrophic ammonium

oxidizer

Nitrosospira sp. - soil, freshwater sediments

Nitrotoga arctica - permafrost soil, oxidizes nitrite

Noviherbaspirillum canariense - mountain volcanic soil

Pandoraea apista - associated with clinical samples (sputum of CF patients)

Pandoraea oxalativorans - soil, degrades oxalate 160

Pandoraea pnomenusa - soil, aquatic, associated with clinical samples (sputum

of cystic fibrosis patients)

Pandoraea pulmonicola - lake sediment

Pandoraea sputorum - soil, aquatic, associated with CF patients

Pelomonas puraquae - aquatic, industrial wastewater

Pandoraea thiooxydans - rhizospheric soil, oxidizes thiosulfate

Pandoraea vervacti - human pathogen

Paucibacter toxinivorans - soil

Pelodictyon luteolum - aquatic

Pelomonas soli - soil

Pigmentiphaga daeguensis - sewage plant, dye wastewater

Piscinibacter aquaticus - freshwater

Polaromonas hydrogenivorans - psychrotolerant, oxidizes hydrogen, soil

Polaromonas naphthalenivorans - freshwater, coal tar contaminated sediment,

can degrade naphthalene

Polaromonas sp. - psychrophiles, Antarctic sea water, aquatic, can degrade

ground water contaminants

Polynucleobacter acidiphobus - freshwater, chemoorganotroph

Polynucleobacter difficilis - freshwater, chemoorganotroph

Polynucleobacter necessarius - aquatic, freshwater, endosymbiont of ciliates

Pseudogulbenkiania sp. - denitrifying bacteria, rice-soybean field

Procabacter acanthamoebae - obligate endosymbiont of Acanthamoeba

Profftella armatura - symbiont of psyllids 161

Providencia stuartii - pathogenic

Pusillimonas sp. - degrades oil, cold tolerant

Ralstonia mannitolilytica - human pathogens

Ralstonia solanacearum - grass, banana plant, associated with bacterial wilt in

host plants

Ralstonia syzygii - sub-desert soil

Ramlibacter tataouinensis - soil

Rhizobacter dauci - associated with plants

Rhodoferax antarcticus - psychrophilic, Antarctic microbial mat

Rhodoferax ferrireducens - aquatic, sediment, psychrotolerant

Rhodoferax saidenbachensis - freshwater, psychrotolerant

Rhodoferax sp. - aquatic

Roseateles depolymerans - aquatic

Roseateles terrae - aquatic, greenhouse basin, freshwater ponds, sewage

ditches, activated sludge, and food processing wastewater

Rubrivivax gelatinosus - soil

Rubrivivax benzoatilyticus - degrades hydrocarbon

Silvimonas amylolytica - degrades starch, soil

Silvimonas sp. - degrades chitin

Silvimonas terrae - degrades chitin

Simplicispira metamorpha - putrid infusion of freshwater shellfish, decomposing

animals, aquatic, activated sludge, wastewater, container (reservoir)

Snodgrassella alvi - gut symbiont of honey and bumble bees 162

Sphaerotilus montanus - freshwater sediment (containing iron oxides), sludge

Sphaerotilus natans - sewage, wastewater, activated sludge

Sterolibacterium denitrificans - denitrifying bacterium, oxidizes cholesterol

Sulfuricella dentrificans - oxidizes sulfur, autotrophic, freshwater lake

Sulfurisoma sediminicola - oxidizes sulfur, autotrophic, freshwater lake sediment

Sulfuritalea hydrogenivorans - autotroph, freshwater lake

Taylorella equigenitalis - pathogenic in horse

Taylorella asinigenitalis - Associated with donkeys

Telluria sp. - soil

Tepidimonas sp. - slightly thermophilic, hot water tanks, thermal springs

Thauera sp. - wastewater

Thiobacillus denitrificans - nitrate rich habitat, soil, water, sewage, mines

Thiobacillus sp. - oxidizes sulfur

Thiobacillus thioparus - soil

Thiomonas delicate - aquatic, mine water

Thiomonas sp. - thermal spring, aquatic, creek sediment, thermophilic, degrades

urea

Tremblaya phenacola - endosymbiont of Phenacoccus peruvianus (mealybug)

Undibacterium oligocarboniphilum - aquatic

Undibacterium parvum - aquatic

Undibacterium pigrum - aquatic

Undibacterium seohonense - freshwater

Undibacterium sp. - freshwater 163

Undibacterium terreum - permafrost soil

Variovorax boronicumulans - soil, accumulates boron

Variovorax ginsengisoli - denitrifying bacterium, soil

Variovorax paradoxus - degraded PCBs, heavy-metal tolerant, deep marine

sediments

Variovorax soli - greenhouse soil

Verminephrobacter eiseniae - nephridia symbiont of earthworms

Vogesella indigofera - freshwater, soil

Vogesella perlucida - aquatic, spring water

Xenophilus aerolatus - air

Xenophilus azovorans - soil, can degrade azo dyes

Xylophilus ampelinus - pathogenic in grapes

Zoogloea sp. - aquatic, pond

Deltaproteobacteria

Anaeromyxobacter dehalogenans - aquatic, sediments, soil

Anaeromyxobacter sp. - reduces iron, sediments, aquatic

Babela massiliensis - parasite of Acanthamoeba castellanii

Bacteriovorax marinus - marine

Bacteriovorax sp. - halophilic, aquatic

Bdellovibrio bacteriovorus - soil, human gut, rhizosphere, aquatic, sewage, feces, oyster shells, gills of crabs

Bdellovibrio exovorus - rivers, soil, compost, raw sewage, and wastewater

Bdellovibrio sp. - freshwater, rhizosphere, soil, animal gastrointestinal tracts 164

Corallococcus coralloides - soil

Corallococcus macrosporus - soil

Chondromyces apiculatus - soil with plant residues, decayed wood

Chondromyces crocatus - soil

Chondromyces pediculatus - soil with decaying plant material, has antifungal

activity

Cystobacter gracilis - tree bark, soil with rotten plant material, rotting wood

Deferrisoma camini - aquatic, thermophilic

Desulfarculus baarsii - freshwater sediment, reduces sulfate

Desulfatibacillum alkenivorans - degrades alkenes, reduces sulfates

Desulfobacca acetoxidans - deduces sulfates, sludge

Desulfobacterium autotrophicum - marine, reduces sulfate

Desulfobacula toluolica - aquatic, marine mud, reduces sulfates, reduces

aromatic compounds

Desulfobulbus propionicus - aquatic, freshwater mud

Desulfocapsa sulfexigens - marine sediment, fixes nitrogen

Desulfococcus oleovorans - oil fields, utilizes C12-C20 alkanes, reduces sulfates

Desulfoglaeba sp. - aquatic, oily wastewater

Desulfohalobium retbaense - reduces sulfates, halophilic, hypersaline lake

Desulfomicrobium baculatum - reduces sulfates, freshwater

Desulfomonile tiedjei - reduce sulfates, sewage sludge

Desulfonatronum lacustre - lake sediment, mud, alkaliphilic, reduces sulfates

Desulfotalea psychrophila - psychrophilic, muds 165

Desulfovibrio aespoeensis - groundwater, reduces sulfates, aquatic

Desulfovibrio africanus - reduces sulfates, aquatic sediment

Desulfovibrio alaskensis - sulfate reducing, can reduce heavy metals like uranium

and chromium, aquatic

Desulfovibrio gigas - reduces sulfates

Desulfovibrio desulfuricans - reduces sulfates, soil, water

Desulfovibrio hydrothermalis - aquatic, hydrothermal vent, reduces sulfatea

Desulfovibrio magneticus - reduces sulfates, magnetotactic

Desulfovibrio psychrotolerans - salt water lake, alkaliphilic, psychrotolerant,

reduces sulfates

Desulfovibrio salexigens - marine, reduces sulfates

Desulfovibrio vulgaris - sulfate-reducing, soil, termite gut, rice paddy field, animal

intestines and feces, and fresh and salt water

Desulfurella acetivorans - thermophilic, oxidizes acetate, reduces sulfur

Desulfurivibrio alkaliphilus - sulfidogenic, haloalkaliphilic

Desulfotalea psychrophila - marine, psychrophilic, reduces sulfates

Desulfovibrio piezophilus - piezophilic, reduces sulfates

Desulfuromonas acetoxidans - marine sediment, reduces sulfur, oxidizes acetate

Desulfuromonas chloroethenica - aquatic, freshwater contaminated with

chlorinated ethylenes, metal-reducing

Enhygromyxa salina - aquatic, coastal mud, halophilic

Geobacter bemidjiensis - reduces metal, petroleum contaminated aquifer 166

sediment

Geobacter daltonii - reduces iron and uranium, sediment

Geobacter pickeringii - Freshwater, reduces iron

Geobacter sp. - industrial wastewater, paddy soil, sludge

Geoalkalibacter subterraneus - aquatic, reduces iron

Geobacter sulfurreducens - reduces sulfur and metal, aquatic, soil

Geobacter uraniireducens - sediment undergoing uranium bioremediation,

oxidizes acetates, reduces metals

Haliangium ochraceum - halophilic, marine

Helicobacter cinaedi - human pathogen

Helicobacter heilmanii - gastrointestinal tract biota of animals

Helicobacter pylori - Human gastrointestinal tracts, human pathogens

Hippea maritima - thermophilic, sediment, hydrothermal vent

Jahnella thaxteri - soil

Labilithrix luteola - soil

Myxococcus fulvus - halotolerant, soil, aquatic

Myxococcus sp. - soil

Myxococcus stipitatus - soil

Myxococcus virescens - soil

Nannocystis exeden - plants, soil

Pelobacter carbinolicus - aquatic, ferments 2,3-butanediol and acetoin

Pelobacter propionicus - aquatic, mud sludge, ferments 2,3-butanediol and

acetoin 167

Pelobacter sp. - canned food, industrial wastewater, sediments (fresh and

saltwater), anaerobic digester

Phaselicystis flava - forest soil, mesophilic

Polyangium sorediatum - soil, decomposing plants

Polyangium spumosum - decomposing plants, soil

Pseudenhygromyxa salsuginis - mud

Stigmatella aurantiaca - tree bark (Canada), decaying wood (USA), soil from a

brookside (Germany)

Sulfuricurvum sp. - oxidizes sulfur

Syntrophobacter fumaroxidans - synotrophic propionate degrading, sulfate-

reducing, sugar waste, anaerobic digestor

Syntrophus aciditrophicus - sewage sludge

Vulgatibacter incomptus - soil

Epsilonproteobacteria

Arcobacter cryaerophilus - water, food, farm animals, pathogenic in humans

Arcobacter nitrofigilis - marine, fixes nitrogen

Campylobacter ureolyticus - animal gastrointestinal tracts, pathogenic

Helicobacter marmotae - liver, intestine

Helicobacter mustelae - associated with ferret gastrointestinal tracts

Nautilia profundicola - hydrothermal vent, ocean

Nitratifractor salsuginis - reduces nitrate, thermophilic, aquatic

Sulfurimonas denitrificans - hydrothermal habitats, oxidizes sulfur, denitrifying

bacterium 168

Sulfurimonas autotrophica - oxidizes sulfur and thiosulfate, deep sea sediment

Sulfurimonas gotlandica - aquatic, psychrophilic

Sulfurospirillum barnesii - selenium-contaminated freshwater marsh

Sulfurospirillum deleyianum - reduces sulphur, freshwater ponds

Sulfurospirillum multivorans - polluted soil, reduces perchloroethylene

Sulfuricurvum kujiense - oxidizes sulfur, oil reservoir

Sulfurovum sp. - aquatic, deep sea vent, can utilize hydrogen, sulfur compounds

and nitrate, thermophilic

Wolinella succinogenes - cattle rumen, metabolizes cellulose, soil, tree bark

Gammaproteobacteria

Achromatium minus - freshwater sediments, acidic lake (Germany)

Achromatium sp. - sulfur bacteria, lake sediments, hydrothermal vents

Acinetobacter calcoaceticus - associated with human intestinal floral

Acinetobacter guillouiae - aquatic, soil, sewage

Acinetobacter lwoffii - normal flora of skin and human oropharynx

Acinetobacter oleivorans - rice paddy soil

Aeromonas bestiarum - aquatic, fish pathogen (carp)

Aeromonas caviae - freshwater, associated with pigs, pathogenic in humans

Aeromonas diversa - wound

Aeromonas encheleia - aquatic, European eels, soil

Aeromonas jandaei - freshwater, feces, gastrointestinal tracts, fish

Aeromonas media - aquatic, soil

Aeromonas popoffii - freshwater, drinking water production plant, water 169

reservoirs

Aeromonas salmonicida - aquatic, pathogenic in fish

Aeromonas schubertii - freshwater, forehead abscess, aquarium water, human

wound

Aeromonas sobria - fish, activated sludge, human urine and stool, freshwater

Aeromonas sp. - aquatic, soil

Aeromonas veronii - freshwater, symbiont in leeches

Actinobacillus suis - human pathogen, associated with swine

Agarivorans gilvus - produces agarose, associated with plants (seaweed)

Aggregatibacter actinomycetemcomitans - capnophilic, human oral flora,

reduces nitrate

Aggregatibacter aphrophilus - capnophilic, human oral flora

Alcanivorax borkumensis - aquatic, seawater containing crude oil, can degrade

alkanes

Alcanivorax dieselolei - degrades alkanes, aquatic, halophilic

Alcanivorax sp. - marine, degrades alkanes

Algoriphagus aquatilis - freshwater

Aliivibrio salmonicida - associated with fishes, marine

Aliivibrio wodanis - aquatic, pathogenic in fishes, psychrophilic

Alkalilimnicola ehrlichii - aquatic, haloalkaliphilic, arsenite-oxidizing

Allochromatium vinosum - ponds, marine, stagnate freshwater, oxidizes sulfide

and thiosulfate

Alteromonas australica - marine, halophilic, degrades starch 170

Alteromonas macleodii - marine

Anaerobiospirillum succiniciproducens - associated with dogs

Aquicella siphonis - aquatic, infects arthropods and protozoans

Arenimonas aquatica - freshwater

Arenimonas daejeonensis - compost manure

Arenimonas donghaensis - seashore sand

Arsenophonus endosymbiont - symbionts of insects

Arsenophonus nasoniae - associated with insects

Azorhizophilus paspali - rhizosphere soil

Azotobacter chroococcum - fixes nitrogen

Azotobacter vinelandii - soil, fixes nitrogen, aquatic

Basfia succiniciproducens - bovine rumen

Baumannia cicadellinicola - obligate endosymbiont parasite of leafhopper insect

Beggiatoa leptomitiformis - aquatic, oxidizes sulfur

Beggiatoa sp. - hydrothermal vents, mud, sulfur spring, sewage contaminated

water, high concentration of hydrogen sulfide

Berkiella cookevillensis - obligate intranuclear endosymbionts of freshwater

amoebae

Bibersteinia trehalos - pathogenic in ruminant animals

Blochmannia pennsylvanicus - ant endosymbiont

Buchnera aphidicola - endosymbiont of aphids

Cardiobacterium hominis - associated with human nose, throat, and mouth

Carnimonas nigrificans - associated with meats 171

Cedecea neteri - aquatic, human pathogen

Cellvibrio japonicus - soil, degrades plant cell wall and storage polysaccharides

Chromohalobacter beijerinckii - halophilic, soil

Chromohalobacter canadensis - halophilic, hypersaline environment

Chromohalobacter nigrandesensis - halophilic, lake sediment

Chromohalobacter salaries - halophilic

Chromohalobacter sarecensis - halophilic, psychrotolerant

Chromatocurvus halotolerans - halophilic, aquatic, brine spring

Citrobacter freundii - wound swab, infections of the respiratory tract, urinary

tract and blood, aquatic, mud (sludge), anaerobic digester, sewage

Citrobacter rodentium - associated with mouse gastrointestinal tracts

Clonothrix fusca - freshwater

Cobetia sp. - marine, degrades hydrocarbon

Colwellia psychrerythraea - eggs, psychrophilic, marine environment

Competibacter phosphatis - denitrifying bacteria, can be used for phosphate

removal

Congregibacter litoralis - aquatic, pleomorphic

Coxiella burnetii - associated with tick, pathogenic

Cronobacter condimenti - associated with food

Cronobacter dublinensis - associated with milk

Cronobacter malonaticus - associated with food

Cronobacter sakazakii - pathogenic, associated with low moisture food

Cronobacter turicensis - food borne pathogen 172

Cycloclasticus sp. - marine sediment

Cycloclasticus zancles - marine, degrades hydrocarbon

Dasania marina - psychrophilic, marine sediment

Dichelobacter nodosus - associated with foot rot in sheep

Dickeya dadantii - plant pathogen

Dickeya zeae - plant pathogen

Dyella japonica - soil

Dyella jiangningensis - potassium bearing rock

Edwardsiella ictaluri - aquatic, pathogenic in fishes

Edwardsiella piscicida - aquatic, pathogenic in fishes

Edwardsiella tarda - freshwater, gut of fishes, birds, and mammals, fish pathogen

Enterobacter aerogenes - gastrointestinal tracts, soil, waste

Enterobacter asburiae - human pathogen

Enterobacter lignolyticus - degrades lignin, soil

Enterobacter sacchari - fixes nitrogen, associated with sugarcane

Erwinia amylovora - plant pathogen

Erwinia billingiae - associated with plants

Erwinia tasmaniensis - associated with apple and pear trees

Erwinia toletana - plants, trees, olive knots

Escherichia coli O157:H7 - soil, feces, water, human pathogen

Escherichia coli UTI89 - gastrointestinal tracts, urinary tracts, uropathogenic

Escherichia fergusonii - associated with infections in human

Ferrimonas balearica - sediment, marine, reduces iron(iii) 173

Francisella cf. novicida - aquatic, arthropod-borne, pathogenic in human

Francisella noatunensis - pathogenic in fishes, aquatic

Francisella sp. - human pathogen

Francisella philomiragia - aquatic, human pathogen

Frateuria aurantia - solubilizes potassium, associated with lily and fruits of

raspberry

Francisella tularensis - pathogenic, soil, aquatic

Frischella perrara - Bee gut microbiota

Gilliamella apicola - gut symbionts of honey and bumble bees

Glaciecola nitratireducens - psychrophilic, halophilic, aquatic

Glaciecola psychrophila - psychrophilic

Gynuella sunshinyii - halophilic, antifungal

Haemophilus ducreyi - human pathogen

Haemophilus influenzae - human pathogen

Haemophilus paracuniculus - gastrointestinal tracts of rabbits

Haemophilus parainfluenzae - human pathogen

Haemophilus parasuis - associated with pigs

Haemophilus somnus - pathogenic in cattle, parasitic, upper respiratory tract of

cattle

Hafnia alvei - human pathogen

Hahella chejuensis - marine, halophilic

Haliea rubra - marine

Haliea sp. - marine 174

Halomonas alimentaria - halophilic

Halomonas alkaliantarctica - halophilic, alkaliphilic

Halomonas almeriensis - halophilic

Halomonas anticariensis - halophilic

Halomonas aquamarina - halophilic, marine

Halomonas axialensis - halophilic, deep sea hydrothermal vent

Halomonas boliviensis - soil, halophilic, alkalitolerant

Halomonas campaniensis - aquatic, haloalkaliphilic

Halomonas campisalis - aquatic, halophilic, soil

Halomonas cupida - halophilic, aquatic

Halomonas desiderata - sewage treatment plant, halophilic, denitrifying

bacterium

Halomonas elongata - estuaries, marine, saline lakes, halophilic

Halomonas halmophila - aquatic, halophilic

Halomonas halocynthiae - marine, associated with fish gill, halophilic

Halomonas halophila - halophilic, soil

Halomonas koreensis - halophilic

Halomonas magadiensis - halophilic, extremophilic, alkaliphilic

Halomonas muralis - halophilic

Halomonas neptunia - halophilic, deep sea hydrothermal vent

Halomonas olivaria - halophilic

Halomonas organivorans - halophilic, soil

Halomonas pantelleriensis - aquatic, sandy soil from lake, halophilic 175

Halomonas phosphatis - accumulates polyphosphate

Halomonas salaria - halophilic, piezophilic, salt water

Halomonas salina - aquatic, halophilic

Halomonas sp. - aquatic, halophilic

Halomonas subglaciescola - Antarctic, hypersaline, meromictic lake, fermenting

seafood

Halomonas sulfidaeris - halophilic, hydrothermal vent

Halomonas taeanensis - aquatic, halophilic

Halomonas titanicae - marine, heterotrophic, halophilic

Halomonas variabilis - halophilic, leaf surface, aquatic

Halomonas ventosae - halophilic, soil, denitrifying bacterium

Halomonas zhanjiangensis - halophilic

Halorhodospira halochloris - halophilic, lake

Halorhodospira halophila SL1 - hypersaline lake, halophilic, metabolizes sulfur

Halotalea alkalilenta - osmotolerant, alkalitolerant, sludge like waste

Halothiobacillus neapolitanus - halotolerant, oxidizes sulfur

Halyomorpha halys - endosymbiont of stink bug

Histophilus somni - pathogenic in cattle

Idiomarina loihiensis - hydrothermal vents, aquatic

Ignatzschineria indica - associated with the larvae of flesh flies and human

wounds infested with maggots

Ignatzschineria larvae - associated with larvae of fresh flies

Kangiella koreensis - aquatic, tidal flat 176

Kangiella geojedonensis - marine

Klebsiella michiganensis - human gastrointestinal tract, pathogenic

Klebsiella oxytoca - associated with clinical samples, pathogenic

Kushneria aurantia - leaves, aquatic, halophilic

Kushneria avicenniae - leaves, halophilic

Kushneria indalinina - halophilic, aquatic

Kushneria marisflavi - halophilic

Legionella anisa - aquatic

Legionella cardiaca - human pathogen

Legionella hackeliae - associated with clinical samples (lung biopsy)

Legionella jeonii - associated symbiotically with Amoeba proteus

Legionella jordanis - aquatic, sewage, human pathogens, air conditioners, spa

equipment, fountains, humidifiers, or showers, water distribution

systems

Legionella longbeachae - soil, compost, pathogenic in humans

Legionella oakridgensis - aquatic, industrial tower cooling water

Legionella pneumophila - freshwater, soil, pathogenic in human, Amoeba

pathogen

Legionella sp. - Associated with free-living amoebae, water, soil and aquatic

system

Leucothrix mucor - epibiont, Aquatic plants

Listonella anguillarum - marine, pathogenic in fishes

Luteimonas sp. - greenhouse soil 177

Lysobacter brunescens - aquatic, lake water

Lysobacter daecheongensis - stream sediment

Lysobacter niabensis - marine

Lysobacter oligotrophicus - soil

Lysobacter sp. - marine, beach sludge

Marichromatium purpuratum - freshwater

Mannheimia succiniciproducens - capnophilic, produces succinic acid

Mannheimia varigena - pathogenic in ruminant animals

Marinobacter adhaerens - marine, from thermophilic to psychrophilic

Marinobacter aquaeolei - aquatic, polluted sea water, sediment, halophilic,

psychrophilic, can degrade n-hexadecane, pristane and some crude oil

components, oxidizes iron

Marinobacter salarius - marine

Marinobacter similis - marine

Marinobacter hydrocarbonoclasticus - marine, degrades hydrocarbon,

halotolerant

Marinobacter sp. - marine, can degrade hydrocarbons, sediments

Marinomonas mediterranea - marine

Marinomonas posidonica - seagrass

Marinobacter psychrophilus - marine, psychrophilic, aquatic

Marinomonas sp. - psychrophilic, aquatic

Methylobacter luteus - methane oxidizer, oxic soil, freshwater wetland

Methylobacter psychrophilus - oxidizes methane, psychrophilic 178

Methylocaldum caldum - marine, thermotolerant, oxidizes methane

Methylocaldum sp. - methanotrophic, metabolizes sulfur

Methylocaldum szegediense - marine, thermotolerant, methanotroph

Methylococcus capsulatus - methylotrophic, thermotolerant, oil processing

plants

Methylococcus mobilis - utilizes methane

Methylococcus sp. - methanotroph, thermotolerant

Methylohalomonas lacus - halophilic, methylotrophic, hypersaline lake

Methylomicrobium album - methanotrophic, soil

Methylomicrobium alcaliphilum - methanotrophic, alkaliphilic, halotolerant

Methylomonas methanica - methanotrophic, lakes, ponds, freshwater sediment,

marshy ground

Methylomonas sp. - methanotrophs, floodwater of a rice paddy field

Methylophaga frappieri - marine, brackish water, reduces nitrate

Methylophaga sp. - halophilic, methylotrophic

Methylophaga nitratireducenticrescens - marine, reduces nitrate

Methylosarcina fibrate - oxidizes methane, soil

Methylosarcina lacus - freshwater sediment, methanotroph

Methylosoma difficile - methanotroph, lake sediment

Microbulbifer sp. - halophilic, estuarine sediment

Modicisalibacter tunisiensis - halophilic

Moranella endobia - endosymbiont of mealy bugs

Moraxella bovoculi - eye fluid of a calf, pathogenic in calves 179

Moraxella catarrhalis - human pathogen

Moraxella ovis - eye of sheep, pathogenic in sheep

Morganella morganii - Intestinal flora of human, animal, and reptiles

Nitrococcus oceani - marine, ammonia-oxidizing

Nitrosococcus halophilus - salt-adapted, oxidizes ammonia, saline pond

Nitrosococcus oceani - marine

Nitrosococcus watsoni - marine, oxidizes ammonia

Oceanicoccus sagamiensis - marine

Oceanimonas sp. - marine

Oleispira antarctica - hydrocarbonoclastic, marine, psychroplilic

Pantoea carbekii - endosymbiont of stink bug

Pantoea rwandensis - plant pathogen

Pasteurella multocida - plant pathogen

Pectobacterium atrosepticum - human pathogen

Pectobacterium carotovorum - plant pathogen

Pectobacterium wasabiae - plant pathogen

Perlucidibaca piscinae - symbiont of stink bug

Plautia stali - marine, pathogenic in marine animals

Photobacterium damselae - freshwater

Photobacterium profundum - psychrophilic, sediments

Photorhabdus asymbiotica - pathogenic in insects and human

Photorhabdus luminescens - pathogen of insects, gut of nematodes

Piscirickettsia salmonis - pathogenic in salmonid fishes 180

Plesiomonas shigelloides - freshwater, Estuarine or brackish water,

gastrointestinal tracts, feces (dog and human)

Portiera aleyrodidarum - endosymbiont of whiteflies

Pragia fontium - aquatic

Proteus mirabilis - soil, water

Proteus vulgaris - soil, water, human gastrointestinal tracts, reduces nitrate

Pseudoalteromonas atlantica - marine, primarily produces biofilms, pathogenic

in crabs (Cancer pagurus)

Pseudoalteromonas haloplanktis - marine, psychrophilic, Antarctica coastal sea

water

Pseudoalteromonas sp. - deep sea marine, psychrophilic

Pseudomonas alkylphenolia - soil, metabolizes alkylphenol

Pseudomonas balearica - denitrifying bacterium, aquatic, wastewater treatment

plant, degrades napthalene

Pseudomonas brassicacearum - soil, pathogenic in plants

Pseudomonas cichorii - soil, pathogenic in plants

Pseudomonas chlororaphis - soil, denitrifying bacterium

Pseudomonas cremoricolorata - plant pathogens

Pseudomonas deceptionensis - psychrotolerant

Pseudomonas denitrificans - denitrifying bacterium, soil

Pseudomonas fragi - psychrophilic, associated with dairy food spoilage

Pseudomonas fulva - associated with rice plants, grains, rice paddy fields, human

pathogen 181

Pseudomonas knackmussi - sewage plant, degrades chloroaromatic compounds

Pseudomonas kuykendallii - soil, bioreactor (built to degrade hexazinone)

Pseudomonas koreensis - soil

Pseudomonas mandelii - aquatic, mineral water

Pseudomonas marina - marine

Pseudomonas monteilii - human pathogen

Pseudomonas mosselii - associated with clinical samples

Pseudomonas nitroreducens - soil, synthesize polyhydroxybutyrate

Pseudomonas perfectomarina - cerebrospinal fluid, rhizosphere of Sorghum

mutans

Pseudomonas pseudoalcaligenes - soil, aquatic (swimming pool)

Pseudomonas psychrophila - psychrophilic, aquatic

Pseudomonas oryzihabitans - pathogenic in humans

Pseudomonas plecoglossicida - associated with fishes

Pseudomonas poae - associated with grass phyllosphere

Pseudomonas protegens - soil, plant roots

Pseudomonas resinovorans - soil, degrades carbazole, commonly found in lubricating oils of wood mills

Pseudomonas rhizosphaerae - rhizospheric soil

Pseudomonas savastanoi - plant leaves, plant pathogen (olive plants)

Pseudoxanthomonas icgebensis - associated with mosquitoes (Anopheles

stephensi)

Pseudomonas taeanensis - aquatic, oil contaminated sea water 182

Pseudomonas trivialis - grass phyllosphere

Pseudoxanthomonas sp. - waste, biofilter

Pseudoxanthomonas spadix - contaminated soil, degrades all six BTEX (benzene,

toluene, ethylbenzene, and o-, m-, and p-xylene)

Pseudoxanthomonas suwonensis - cotton waste compost, soil

Psychrobacter aquaticus - psychrophilic, halotolerant, aquatic, microbial mat

Psychrobacter arcticus - psychrophilic, aquatic, permafrost sediment core

Psychrobacter arenosus - psychrotolerant, sea ice, pathogenic in human

Psychrobacter cryohalolentis - permafrost, psychrophilic, aquatic, saline water

Psychrobacter faecalis - air, associated with pigeon feces

Psychrobacter frigidicola - psychrophilic, halotolerant, soil

Psychrobacter glacincola - aquatic, ice, psychrophilic, halotolerant

Psychrobacter luti - psychrophilic, aquatic, mud

Psychrobacter lutiphocae - associated with the feces of seals

Psychrobacter pulmonis - associated with a lamb lung sample

Psychrobacter sanguinis - marine

Psychrobacter sp. - Psychrophilic, soil, sediment, ice

Psychrobacter urativorans - psychrophilic

Psychromonas ingrahamii - aquatic, ice water, psychrophilic

Rahnella aquatilis - freshwater, soil, human pathogen

Rahnella sp. - contaminated subsurface soil

Raoultella ornithinolytica - aquatic, associated with fish, human pathogen

Rhodanobacter denitrificans - denitrifying bacterium, associated with nuclear 183

sites contaminated with heavy metals, nitrates, acids

Rickettsiella melolonthae - associated with ticks, pathogenic

Rickettsiella tipulae - pathogenic in crane fly

Ruthia magnifica - symbiont of Calyptogena magnifica (giant white clam),

oxidizes sulfur

Saccharophagus degradans - wetland, salt mash, decomposing plants

Salinicola socius - halophilic, utilize naphthalene

Salinicola peritrichatus - associated with frogs

Salmonella bongori - deep sea sediment

Salmonella enterica - pathogenic

Serratia fonticola - human pathogen

Serratia liquefaciens - human pathogen

Serratia marcescens - Soil, water, associated with hospital acquired infections

Serratia plymuthica - pathogenic

Serratia symbiotica - symbionts of aphids

Shewanella amazonensis - aquatic, coastal muds, intertidal sediments, reduces

iron and manganese oxides, thiosulfate, and elemental sulfur, denitrifies

nitrate to nitrite and nitrite to N2

Shewanella baltica OS155 - aquatic, oil reservoir, can utilize acetate and lactate

Shewanella denitrificans - aquatic, denitrifying bacterium

Shewanella halifaxensis - psychrophilic, marine sediment

Shewanella loihica - aquatic, iron-rich microbial mat, hydrothermal vent,

Shewanella oneidensis - soil, sediment, lake, reduces iron 184

Shewanella pealeana - marine, psychrotolerant

Shewanella piezotolerans - deep sea sediment, piezotolerant, psychrotolerant

Shewanella putrefaciens - reduces uranium, iron and magnesium, marine,

associated with fish

Shewanella sediminis - psychrophilic, aquatic, sediment

Shewanella sp. - aquatic, surface flora in fishes, associated with fish spoilage

Shewanella violacea - psychrophilic, marine sediment, high-pressure

environment

Shewanella woodyi - marine, deep seas, barophilic

Shigella boydii - pathogenic

Shigella flexneri - human pathogen, gastrointestinal tracts

Shigella sonnei - human pathogen, human gastrointestinal tract, water

Shimwellia blattae - hindgut of cockcroach, synthesize vitamin B12 de novo

Simiduia agarivorans - heterotrophic, marine

Sodalis glossinidius - endosymbiont of tsetse fly

Sodalis pierantonius - endosymbiont of rice weevil

Sodalis praecaptivus - insect endosymbiont (weevil)

Spiribacter salinus - halophilic

Spongiibacter marinus - halophilic, marine

Spongiibacter tropicus - Associated with Synechococcus (cyanobacterium) culture

Stenotrophomonas acidaminiphila - aquatic, industrial wastewater, degrades

polyaromatic hydrocarbons 185

Stenotrophomonas nitritireducens - soil

Stenotrophomonas rhizophila - associated with plants

Stenotrophomonas sp. - aquatic

Sulfuricaulis limicola - lake sediment, oxidizes sulfur

Teredinibacter turnerae - freshwater

Thalassolituus oleivorans - marine, degrades hydrocarbon

Thioalkalimicrobium aerophilum - oxidizes sulfur, alkaline lake,

chemolithoautotroph

Thioalkalimicrobium cyclicum - haloalkaliphilic, aquatic, oxidizes sulfur

Thioalkalivibrio nitratireducens - lake sediment, halophilic, alkaliphilic

Thioalkalivibrio paradoxus - alkaliphilic, autotrophic, oxidizes sulfur, lakes

Thioalkalivibrio sp. - lake sediment, natronophilic, oxidizes sulfur

Thioalkalivibrio sulfidophilus - oxidizes sulfur, haloalkaliphilic

Thioalkalivibrio versutus - oxidizes sulfur, alkaliphilic, soda lake

Thiocystis violascens - aquatic, brackish pond, reduces sulfate

Thioflavicoccus mobilis - microbial mat of a salt marsh, oxidizes sulfur

Thiomargarita sp. - oxidizes sulfur

Thiomicrospira crunogena - sulfur-oxidizing, aquatic, hydrothermal vents

Thioploca ingrica - freshwater lake (Japan), sulfur oxidizer

Thioploca sp. - sulfur bacteria, freshwater and marine sediments

Tolumonas auensis - produces toluene, freshwater lake

Variovorax sp. - soil

Vesicomyosocius okutanii - endosymbiont of Calyptogena okutanii (deep-sea 186

clam), reduces sulfate

Vibrio agarivorans - halophilic, aquatic, agarolytic

Vibrio alginolyticus - marine, pathogenic in humans

Vibrio anguillarum - marine, pathogenic in fishes

Vibrio campbellii - human pathogen

Vibrio cholerae - aquatic, pathogenic in aquatic organisms, human pathogen

Vibrio coralliilyticus - aquatic, pathogenic in coral

Vibrio fischeri - marine

Vibrio furnissii - halophilic, marine, human pathogens

Vibrio harveyi - halophilic, marine, pathogenic in marine organisms

Vibrio lentus - marine, associated with oysters

Vibrio mediterranei - aquatic, coastal sediment

Vibrio nigripulchritudo - associated with shrimp

Vibrio parahaemolyticus - brackish water, salt water, human pathogen

Vibrio splendidus - marine

Vibrio tubiashii - marine, pathogenic in corals

Vibrio vulnificus - Marine, human pathogen

Wenzhouxiangella marina - marine

Westeberhardia cardiocondylae - endosymbiont of ants

Wigglesworthia glossinidia - endosymbiont of tsetse fly

Wohlfahrtiimonas chitiniclastica - associated with open wound infections, found

in the larva of Wohlfahrtia magnifica (spotted flesh fly)

Xanthomonas albilineans - plant pathogen 187

Xanthomonas arboricola - plant pathogen

Xanthomonas citri - pathogenic in citrus plants

Xanthomonas euvesicatoria - plants, pathogenic in tomatoes

Xanthomonas fuscans - pathogenic in bean plants

Xanthomonas oryzae - pathogenic in rice

Xanthomonas sacchari - pathogenic, associated with sugarcane

Xanthomonas sp. - plant pathogen

Xanthomonas translucens - plant pathogen

Xenorhabdus bovienii - associated with nematodes

Xenorhabdus doucetiae - associated with nematodes

Xenorhabdus ehlersii - soil, associated with nematodes

Xenorhabdus hominickii - associated with nematodes

Xenorhabdus poinarii - associated with nematodes

Xylella fastidiosa - plant pathogen

Yersinia aldovae - soil, aquatic

Yersinia aleksiciae - associated with animal feces

Yersinia enterocolitica - human pathogen

Yersinia kristenseni - pathogenic in mice

Yersinia pestis - human pathogen, plague

Yersinia pseudotuberculosis - associated with a scarlet-like fever in human, food-

borne pathogen

Yersinia ruckeri - marine, pathogenic in marine organisms

Zymobacter palmae - plant sap, ferments ethano 188

Zetaproteobacteria

Mariprofundus sp. - marine, Fe (II)-rich deep-sea hydrothermal vents

Spirochaetes

Borrelia burgdorferi - tick-borne, human pathogen (Lyme disease)

Borrelia coriaceae - associated with soft ticks

Borrelia crocidurae - tick borne, human pathogen

Brachyspira alvinipulli - intestinal pathogen of chickens

Brachyspira intermedia - pathogenic in pigs, intestines of mammals and avians

Brachyspira sp. - pathogenic in pigs, birds, dogs and humans

Brachyspira pilosicoli - gastrointestinal tracts of pigs and chicken, human pathogen

Leptospira biflexa - stagnant water sources (bogs, shallow lakes, ponds, puddles),

pathogenic

Leptospira borgpetersenii serovar - causes bovine leptospirosis, found in cattle

Hardjo bovis - pathogenic in human, infection with this bacterium is zoonotic, found

in food, soil and water containing urine of infected animals

Leptospira interrogans - marine, hotspring

Salinispira pacifica - hypersaline microbial mat

Sphaerochaeta coccoides - associated with termites

Sphaerochaeta globose - freshwater, pond

Spirochaeta africana - Lake, alkaliphilic, halophilic

Spirochaeta aurantia - freshwater mud, pond, swamp water 189

Spirochaeta smaragdinae - Oil

Spirochaeta sp. - lakes (hypersaline), microbial mat, aquatic sediment, sulfuric

spring, anaerobic bioreactor (USA)

Spirochaeta thermophila - thermophilic, aquatic, sediment

Treponema azotonutricium - associated with termite gut

Treponema brennaborense - associated with a diseased cow

Treponema caldaria - aquatic, thermophilic, freshwater hotspring

Treponema primitia - associated with termite gut

Treponema succinifaciens - associated with colon of swine

Turneriella parva - aquatic

Synergistetes

Anaerobaculum mobile - thermophilic, aquatic, wastewater treatment plant

Aminobacterium colombiense - anaerobic lagoon, dairy waste treatment plant

Synergistes sp. - animal gastrointestinal tracts, soil, oil wells, wastewater treatment

plants

Thermanaerovibrio acidaminovorans - thermophilic, methanogenic sludge

Thermovirga lienii - moderately thermophilic, degrades amino acids, oil well

Tenericutes

Acholeplasma equifetale - associated with lung tissue of horse

Acholeplasma laidlawii - sewage, wastewater

Hepatoplasma crinochetorum - midgut of isopods

Mesoplasma florum - flower of a lemon tree, associated with environment rich in

sugar and cholesterol 190

Mycoplasma agalactiae - milk of sheep and goat, pathogenic in animals

Mycoplasma bovoculi - pathogenic in cattle

Mycoplasma conjunctivae - pathogenic in goat and sheep

Mycoplasma hominis - urinary tract, pathogenic

Mycoplasma hyorhinis - respiratory tract and tonsils of pigs

Mycoplasma microti - lung tissue

Mycoplasma mobile - gills of freshwater fish

Mycoplasma mycoides - associated with ruminants, pathogenic in cattle and goats

Mycoplasma penetrans - associated with human urogenital and respiratory system,

pathogenic in human

Mycoplasma putrefaciens - pathogenic in goats

Mycoplasma salivarium - human oral cavity

Mycoplasma yeatsii - associated with goats

Spiroplasma cantharicola - associated with soldier beetle

Spiroplasma diabroticae - associated with the rootworm beetle

Spiroplasma kunkelii - infects maize, resides in insect

Spiroplasma litorale - associated with tabanid flies

Spiroplasma sabaudiense - associated with mosquitoes

Spiroplasma sp. - associated with ticks

Spiroplasma taiwanense - associated with Culex mosquitoes

Ureaplasma sp. - associated with human urinary and genital tract

Thermodesulfobacteria

Thermodesulfobacterium commune - thermophilic, reduces sulfate, aquatic 191

Thermodesulfobacterium geofontis - hyperthermophilic, reduces sulfate, aquatic

Thermodesulfatator indicus - thermophilic, reduces sulfate, aquatic, hydrothermal

vent

Thermotogae

Defluviitoga tunisiensis - thermophilic, anaerobic digester

Fervidobacterium islandicum - icelandic hot spring, aquatic, extremely thermophilic

Fervidobacterium nodosum - thermophilic, thermal springs

Fervidobacterium pennivorans - thermophilic

Kosmotoga olearia - thermophilic

Mesotoga prima - sediment, mesophilic

Sulfurihydrogenibium sp. - thermophilic, sulfur oxidizing

Thermosipho africanus - thermophilic, marine hydrothermal area

Thermosipho melanesiensis -thermophilic, deep sea hydrothermal vents

Thermotoga caldifontis - thermophilic, terrestrial hot springs

Thermotoga elfii - thermophilic, reduces sulfate

Thermotoga hypogea - xylanolytic, thermophilic

Thermotoga lettingae - thermophilic, degrades methanol

Thermotoga maritima - hyperthermophilic

Thermotoga neapolitana - thermophilic, capnophilic

Thermotoga profunda - thermophilic, terrestrial hot spring

Thermotoga thermarum - hyperthermophilic, solfataric spring

Verrumicrobia

Akkermansia muciniphila - human intestine, degrades mucin 192

Bacterium Ellin - soil

Brevifollis gellanilyticus - gellan-gum degrading bacterium

Chthoniobacter flavus - soil, plants

Coraliomargarita akajimensis - aquatic

Criblamydia sequanensis - aquatic, amoeba resisting bacterium

Luteolibacter algae - marine

Luteolibacter luojiensis - psychrophilic, tundra soil

Methylacidiphilum fumariolicum - autotrophic, fixes CO2 , thermoacidophilic,

methanotrophic

Methylacidiphilum infernorum - soil, extremely acidophilic, methanotrophic

Pedosphaera parvula - soil

Prosthecobacter debontii - freshwater, Antarctic sea ice

Prosthecobacter dejongeii - freshwater

Prosthecobacter fusiformis - freshwater, Antarctic sea ice

Prosthecobacter vanneervenii - aquatic, activated sludge

Protochlamydia amoebophila - soil, endosymbiont of acanthamoeba

Verrucomicrobium spinosum - freshwater, karst cave, ancient man-made soil

(biochar), bog lake

Domain ARCHAEA

Euryarchaeota

Halopiger xanaduensis - extremely halophilic, aquatic, saline lake

Halorubrum lacusprofundi - extreme halophile, psychrophilic, deep lake Antarctica

Methanocella arvoryzae - hydrogenotrophic, methanogen, soil 193

Methanoculleus marisnigri - autotroph, methanogenic

Methanoplanus petrolearius - methanogenic, oil field

Methanoregula boonei - acidophilic, hydrogenotrophic, methanogen

Methanoregula formicica - methanogen, sludge

Methanosaeta concilii - methanogenic

Methanosaeta harundinacea - methanogenic, industrial waste water

Methanosaeta thermophila - methanogen, metabolizes acetate, aquatic, thermophilic

Methanosalsum zhilinae - halophilic, alkaliphilic, methylotrophic, aquatic

Methanosarcina acetivorans - methanotroph, aquatic

Methanosarcina barkeri - methanotrophic, sewage, aquatic

Methanosarcina horonobensis - methanogenic, aquatic, groundwater

Methanosarcina lacustris - psychrotolerant, anoxic lake sediment, methanogenic

Methanosarcina mazei - methanogen, halophilic, fixes nitrogen

Methanosphaerula palustris - methanogen, minetrophic fern

Natrialba magadii - extremophile, alkaline and hypersaline environment, thermotolerant

Thaumarchaeota

Natronobacterium gregoryi - extreme halophile and alkaliphile

Methanoregula formicicum - methanogen, activated sludge

Pyrococcus sp. - marine, hyperthermophilic, deep sea hydrothermal vent

Nitrosoarchaeum limnia - oxidizes ammonium, estuary, low salinity environment

Nitrosopumilus koreensis - marine sediment, oxidizes ammonia

Nitrosopumilus maritimus - marine, ammonium oxidizer, moderately halophilic

194

Domain EUKARYOTA

SAR

Rhizaria

Cercozoa

Plasmodiophora brassicae - plant pathogen (clubroot disease), including

cultivated plants

Rhogostoma minus - infects trout, freshwater, soils

Alveolata

Apicomplexa

Babesia gibsoni - blood parasite in dogs

Besnoitia darling - species infect skin, eyes, mucous membranes of cats, wild

animals, domestic livestock

Eimeria tenella - pathogen of chickens and livestock

Neospora caninum - pathogen of deer, livestock, dogs, rhinos, foxes, camels,

felids, buffalo, etc.

Plasmodium cynomolgi - causes malaria, mosquito vector

Sarcocystis rileyi, S. fayeri, S. moulei, S. muris - animal (mammals, reptiles,

birds) pathogens (ducks, skunks, etc.)

Theileria orientalis - pathogen of cattle

Toxoplasma gondii - parasitic in warm-blooded animals, infects most birds and

mammals (cats primarily)

Ciliophora 195

Cryptocaryon irritans - marine fish pathogen

Kuklikophrya ougandae - feeds on cyanobacteria

Notohymena apoaustralis - sewage sludge

Spathidium amphoriforme, S. rectitoratum - soil and in filamentous algae,

pathogen of birds of prey and rodents

Stentor muelleri, S. roeselii -ciliate feeds on algae, found on filamentous algae

Sterkiella sp. Aspen - from forest soil

Tokophrya quadripartita - Lake Michigan, marsh areas - infect copepods

Vorticella aequilata - associated with mosquitoes, crustaceans, amphibians,

nematodes

Dinoflagellata

Karenia umbella - toxic marine dinoflagellate

Karenia mikimotoi - toxic marine dinoflagellate

Tovellia paldangensis - dinoflagellate, marine, encysts, related species cause red

tides in freshwater lakes

Esoptrodinium sp. - freshwater dinoflagellate (mixotrophic)

Peridiniopsis niei - red tide dinoflagellate

Peridiniopsis pernardii, P. aciculiferum, P. baicalense, P. euryceps - red tide

dinoflagellate, forms on lower surfaces of ice in lakes, blooms are in

winter (marine, brackish, fresh water), encysts in ice

Pfiesteria piscicida - dinoflagellate, toxic blooms responsible for major fish kills,

toxin dangerous to humans

Polarella glacialsis - dinoflagellate, cold-water adapted 196

Prorocentrum micans - cold water

Protocruzia sp. - dinoflagellate, found in shellfish

Scrippsiella hangoei - dinoflagellate, red tide, cold water

Tovellia paldangensis - lake sediments

Perkinsozoa

Perkinsus atlanticus - lives on bivalves

Stramenopiles

Heterokonta

Ochrophyta

Bacilliarophyta (diatoms)

Amphora affinis - freshwater, diatom

Attheya septentrionalis - marine, diatom

Aulacoseira islandica, A. ambigua, A. baicalensis, A. distans, A. granulata,

A. islandica, A. skvortzowii.- Diatoms, common in lake

environments, including Lake Erie

Navicula minima - freshwater, diatom

Chysophyta (golden algae)

Chroomonas mesostigmatica - marine

Cryptomonas marssonii, C. obovata, C. paramecium, C. curvata, C.

gyropyrenoidosa, C. marssonii, C. obovoidea, C. ovata, C.

parapyrenoidifera, C. phaseolus, C. pyrenoidifera, C.

tetrapyrenoidosa - freshwater, brackish water, photolithotrophs,

food for zooplankton and fish 197

Goniomonas avonlea, G. truncata - freshwater, no plastids

Guillardia theta - marine

Hanusia phi - marine

Plagioselmis nannoplanctica - freshwater

Rhodomonas minuta - freshwater

Storeatula sp. - freshwater

Teleaulax amphioxeia - marine, important food source for marine organisms

Phaeophyta (brown algae)

Syringoderma phinneyi - marine, brown alga

Oomycota (water molds)

Achlya colorata, A. sparrowii - plant pathogens

Alaria esculenta - Atlantic seaweed (edible) - probably on ships

Albugo laibachii - plant pathogen

Aphanomyces astaci - crustacean pathogen

Aphanomyces helicoides - plant pathogen

Aphanomyces laevis - fish pathogen

Hacrobia

Haptophyta

Chlamydaster sterni - brackish cold water

Plantae (Archaeplastida)

Rhodophyta (red algae)

Antithamnion erucacladellum - marine, multicelular

Bangia fuscopurpurea - marine, on rock, wood, fleecy mat, widespread 198

Cyanidium caldarium - unicellular, microscopic, acidic hot springs, bogs, moist acidic

soils, worldwide

Glaucosphaera vacuolata - freshwater, soil

Gracilariopsis lemaneiformis - marine, freshwater, soil

Gymnogongrus griffithsiae - marine, widespread

Kumanoa intorta - freshwater, widespread

Porphyra purpurea - marine, on rocks, pebbles, and mollusks

Porphyridium purpureum - marine

Pyropia fucicola, P. haitanensis, P. kanakaensis, P. nítida, P. yezoensis - marine,

intertidal, shallow water, attaches to stones and shells, edible Nori

Viriplantae

Chlorophyta (green algae)

Acetabularia acetabulum - marine, unicellular, shallow water

Acrosiphonia spinescens - marine, multicellular, intertidal

Actinastrum sp. - freshwater, unicellular, colonial

Acutodesmus obliquus - freshwater, unicellular

Ankistrodesmus bibraianu, A. gracilis - freshwater, unicellular, colonial

Ankistrodesmus falcatus, A. stipitatus - freshwater, terrestrial, unicellular, colonial

Asterarcys quadricellulare - freshwater, unicellular

Asteromonas gracillis - freshwater to high salinity, unicellular

Auxenochlorella protothecoides - facultative heterotroph, freshwater, acidic

volcanic soil, tree sap, used in biofuel production and wastewater

treatment 199

Bathycoccus prasinos - marine, unicellular, picoplankton

Bracteacoccus aerius, B. minor - terrestrial, unicellular

Chaetosphaeridium globosum - freshwater, unicellular

Characiochloris acuminata - freshwater, unicellular

Chlamydomonas agloeformis - unicellular, freshwater, stagnant water

Chlamydomonas geitleri - unicellular, freshwater

Chlamydomonas mexicana - unicellular, terrestrial

Chlamydomonas mutabilis - unicellular, freshwater

Chlamydomonas peterfii - unicellular, freshwater, terrestrial

Chlamydomonas reinhardtii - unicellular, freshwater, soil, model organism

Chlamydomonas zebra -unicellular, freshwater, marine

Chlorella emersonii, C. mirabilis, C. sorokiniana, Chlorella sp., C. variabilis, C.

vulgaris - unicellular, freshwater, terrestrial, widespread

Chlorogonium elongatum - unicellular, freshwater, soil, eutrophic lakes, ponds,

mutualistic relationship with toads (tadpoles), widespread

Chlorokybus atmophyticus - multicellular (simple - few cells), soil

Chlorosarcinopsis arenicola - unicellular, terrestrial

Choricystis parasitica - unicellular, freshwater

Chromochloris zofingiensis - unicellular, terrestrial

Closterium baillyanum, C. calosporum, C. spinosporum - unicellular, freshwater

Coccomyxa simplex - unicellular, freshwater, terrestrial

Coccomyxa subellipsoidea - unicellular, freshwater

Coelastrum astroideum, C. microporum - freshwater unicellular, colonial 200

Desmochloris halophila - marine, unicellular

Follicularia botryoides - freshwater, unicellular

Fusochloris perforata - terrestrial, unicellular

Geminella minor - freshwater, terrestrial, filamentous, multicellular

Gloeotilopsis sterilis - marine, terrestrial, filamentous, multicellular

Interfilum terricola - terrestrial, unicellular

Kirchneriella aperta - freshwater, unicellular, colonial

Koliella longiseta - freshwater, unicellular

Lacunastrum gracillimum - freshwater, multicellular

Lobocharacium coloradoense - freshwater, unicellular, colonial

Lobosphaera incisa - freshwater, unicellular

Marsupiomonas pelliculata - brackish water, unicellular

Marvania geminata - freshwater, terrestrial, unicellular

Mesostigma viride - freshwater, unicellular, early diverging species

Mesotaenium caldariorum - freshwater, unicellular

Micractinium reisseri - freshwater, unicellular

Microglena monadina - freshwater, unicellular

Micromonas sp. RCC299 - marine, picophytoplankton

Microthamnion kuetzingianum - freshwater, terrestrial, multicellular

Monactinus sturmii - freshwater, multicellular

Monoraphidium minutum, M. neglectum - freshwater, unicellular

Mychonastes homosphaera - terrestrial, unicellular

Mychonastes huancayensis, M. jurisii - freshwater, unicellular 201

Mychonastes sp. - brackish water, unicellular

Myrmecia israelensis - terrestrial, unicellular

Nannochloris sp. - freshwater, brackish water, unicellular

Neochloris aquatica - terrestrial, freshwater, unicellular

Neocystis brevis - terrestrial, unicellular

Nephroselmis olivacea - freshwater, unicellular

Nephroselmis pyriformis - marine, unicellular

Oltmannsiellopsis sp. - marine, brackish water, unicellular

Oocystis solitaria - freshwater, unicellular

Oophila amblystomatis - salamander algae, freshwater, woodland ponds,

unicellular, symbiotic with salamanders

Ourococcus multisporus - terrestrial, unicellular

Parachlorella kessleri - freshwater, terrestrial, unicellular

Paradoxia multiseta - freshwater, unicellular

Pediastrum biradiatum, P. duplex - freshwater, multicellular

Planctonema lauterbornii - marine, freshwater, multicellular, filamentous

Planktosphaeria gelatinosa - freshwater, unicellular, colonial

Prasiola crispa - marine or terrestrial, moist shady areas, multicellular

Pseudochloris wilhelmii - freshwater, marine, unicellular

Pseudoschroederia antillarum - freshwater, unicellular

Pyramimonas gelidicola, P. parkeae - marine, unicellular

Radiococcus polycoccus - freshwater, unicellular, colonial

Resultomonas moestrupii - marine, unicellular 202

Rotundella rotunda - terrestrial, unicellular

Roya obtusa - freshwater, unicellular

Scenedesmus oblique, S. rotundus - freshwater, unicellular, colonial

Spermatozopsis exsultans - freshwater, unicellular

Spirogyra maxima - freshwater, multicellular

Stigeoclonium subsecundum - freshwater, multicellular

Tetraselmis carteriiformis - saline soil, unicellular

Tetraselmis subcordiformis - marine, unicellular

Trebouxia arboricola - aeophytic, unicellular, clonal, lichen alga

Trebouxia asymmetrica, T. impressa, T. usneae - terrestrial, unicellular, clonal,

lichen alga

Trichosarcina mucosa - terrestrial, unicellular, colonal

Tumidella tumida - terrestrial, unicellular, clonal

Ulothrix zonata - terrestrial, multicellular

Uronema sp. - freshwater, stagnant water, unicellular to filamentous

Volvox carteri - freshwater, clonal

Streptophyta

Charophyta

Embryophyta

Non-vascular plants

Anthocerotophyta

Phaeocerosv laevis - smooth hornwort, terrestrial, moist soil, banks of

streams and rivers 203

Bryophyta

Buxbaumia punctata - bug moss, terrestrial

Entosthodon obtusus - blunt cord-moss, terrestrial

Funaria hygrometrica - bonfire moss, terrestrial, moist walls and

crevices

Lyellia platycarpa - moss, terrestrial

Nyholmiella obtusifolia - blunt-leaved bristle moss, grow on trees and

shrubs

Oedipodium griffithianum - gouty-moss, moist soil, humus, rock

crevices

Polytrichum commune - common haircap moss, moist soils, high

humidity/rainfall

Tetraplodon mnioides - moss, bogs, open forest, trail margins,

terrestrial

Lycophyta

Selaginella moellendorffii - lycophyte, terrestrial, cultivated

Marchantiophyta

Marchantia paleacea - liverwort, terrestrial

Marchantia polymorpha - liverwort, terrestrial

Vascular Plants

Gnetophyta

Ephedra distachya - shrub, widespread, terrestrial

204

Magnoliophyta (flowering plants)

Aegilops tauschii - monocot, Poaceae, Tausch’s goat grass, related to

wheat (the D diploid genome of hexaploid wheat)

Alloteropsis semialata - monocot, Poaceae, black seed grass, C3 and

C4 photosynthesis systems, studied for photosynthetic

pathways

Amborella trichopoda - primitive angiosperm, shrub, small trees

Atropa belladonna - eudicot, deadly mightshade, perennial,

herbaceous, widespread

Brachypodium distachyon - monocot, Poaceae, related to agricultural

cereal grasses

Brassica rapa - eudicot, cultivated turnip, bok choi, cabbage,

mustard

Corallorhiza trifida - monocot, coralroot orchid, terrestrial

Corylopsis sinensis - eudicot, witch-hazel, terrestrial

Cucumis melo - eudicot, melon, terrestrial, agricultural crop

Eutrema salsugineum - eudicot, terrestrial, salt tolerant, drought

tolerant, heat/cold tolerant, low nitrogen tolerant

Gossypium herbaceum - eudicot, Levant cotton, perennial shrub,

terrestrial

Gossypium hirsutum - eudcot, upland cotton, perennial shrub,

agricultural, terrestrial

Heliamphora minor - marsh pitcher plant, widely cultivated, bogs 205

Hordeum jubatum - monocot, Poaceae, foxtail barley, worldwide,

terrestrial

Hydnocarpus heterophyllus - eudicot, large tree, terrestrial

Itea virginica - eudicot, Virginia sweetspire, small shrub

Lilium tsingtauense - monocot, lily, cultivated, terrestrial

Liquidambar styraciflua - eudicot, American sweetgum, tree,

terrestrial, cultivated

Lotus japonicus - eudicot, legume, terrestrial, agricultural

Lycopersicon esculentum - eudicot, tomato, terrestrial, cultivated

Medicago truncatula - eudicot, barrelclover, legume, terrestrial,

small annual

Momordica charantia - eudicot, bitter melon, terrestrial, cultivated

Nelumbo lutea - eudicot, lotus, aquatic

Oryza sativa - monocot, Poaceae, rice, cultivated

Paspalum vaginatum - monocot, Poaceae, silt grass, invasive,

cultivated as turfgrass

Phaseolus vulgaris - eudicot, cultivated bean, terrestrial, herbaceous

Phelipanche ramosa - eudicot, broomrape, terrestrial, invasive

Physalis virginiana - eudicot, Virginia groundcherry, terrestrial,

invasive

Populus trichocarpa - eudicot, black cottonwood, terrestrial, native

to North America

Roupala macrophylla - eudicot, shrub, tree, terrestrial 206

Sarracenia purpurea - eudicot, purple pitcher plant, bogs, damp soil,

carnivorous

Silene antirrhina - eudicot, sleepy silane, terrestrial, coarse soil, sand

Solanum lycopersicum - eudicot, tomato, terrestrial, cultivated

Solanum pennellii - eudicot, drought-tolerant wild tomato, terrestrial

Sorghum bicolor - monocot, Poaceae, sorghum, terrestrial, cultivated

Staphylea trifolia - eudicot, American bladdernut,shrub, native to

eastern North America, ornamental plant

Stellaria media - eudicot, chickweed, terrestrial, cultivated

Triticum aestivum - monocot, Poaceae, wheat, cultivated

Pinophyta (conifers)

Picea glauca - gymnosperm, white spruce, native to N.A., widely

cultivated, terrestrial

Picea asperata - gymnosperm, dragon spruce, terrestrial, cultivated

Pinus mugo - gymnosperm, mugo pine, terrestrial, widely cultivated

Pinus peuce - gymnosperm, Macedonian pine, terrestrial, cultivated

as an ornamental tree

Pinus strobus - gymnosperm, eastern white pine, terrestrial, native

to North America

Polypodiophyta (ferns)

Lygodium japonicum - Japanese climing fern, terrestrial, cultivated

Osmunda javanica - American royal fern, widespread from Canada to 207

Argentina, wet soils, bogs, along streams and lakes

Amoebozoa

Lobosa

Discosea

Acanthamoeba polyphaga - widespread, soil, aquatic, marine, can cause disease,

harbor large viruses (e.g., Mimivirus, Megavirus, Pandoravirus), some

harbor bacterial pathogens

Balamuthia mandrillaris - Free living amoeba, soil, causes a deadly neurological

condition known as granulomatous amoebic encephalitis, can be treated

early in infection

Neoparamoeba pemaquidensis - marine, causes amoebic gill diesease in fishes,

harbor kinetoplastid protists

Pseudoparamoeba pagei - marine

Vannella sp. - freshwater, can cause ocular keratitis in humans

Tubulinea

Difflugia garmen - freshwater, feed on algae

Hartmannellidae sp. - soil, freshwater, marine

Nolandella hibernica - marine

Paraflabellula hoguae - marine

Physochila griseola - swamps, peat, mineral soils

Quadrulella symmetrica - in wet mosses, freshwater, forest litter, soils, worldwide

Rhizamoeba sp. - freshwater, sediments

Saccamoeba limax - soil, freshwater, marine 208

Vermamoeba vermiformis - common, terrestrial, aquatic, swimmning pools, tap

water, hospital water systems, can cause severe infections in humans,

severe keratitis, can harbor giant viruses

Evosida

Conosa

Archamoeba

Mastigella eilhardi, M. erinacea - freshwater and marine sediments

Rhizomastix libera - intestinal commensals of insects, amphibians, reptiles;

inhabit freshwater sediments

Semiconosa

Dictyostelea

Acytostelium subglobosum - Inhabit surface humus and leaf mold of forest

soils, widely distributed in different forests of the world

Dictyostelium fasciculatum, D. discoideum - soil, slime mold

Apusozoa

Amastigomonas mutabilis - marine, feed on bacteria

Apusomonas proboscidea - freshwater, estuaries, feed on bacteria

Fabomonas tropica - marine sediments

Nutomonas howeae - freshwater, sediment, sand

Planomonas brevis - marine, freshwater, feed on bacteria

Opisthokonta

Animalia

Annelida 209

Aporrectodea trapezoids- common earthworm, important in soil formation,

agriculturally useful, fishing bait

Chtonobdella meyeri - jawed land leech

Dendrobaena pygmaea- rare earthworm, damp soil, mossy soil, stream banks

Eisenia fetida- feeds on decaying organic material, found on top of soil (epigean)

Eiseniona gerardoi - soil, sandy loam, earthworm

Helobdella robusta - leech, feshwater

Leodamas dubia - marine, polychaete

Ophelia bicornis - marine, polychaete

Osedax frankpressi, Osedax sp.- marine, feed on bones on seabeds

Pectinaria regalis - marine, polychaete

Platynereis dumerilii - marine, polychaete

Urechis unicinctus - marine, spoon worm, feeds on detritus

Arthropoda

Arachnida (spiders)

Ananteris franckei - scorpion

Brotheas amazonicus - scorpion

Crustacea

Aetideopsis carinata - marine, calanoid copepod

Anomalocera patersoni - copepod

Arctodiaptomus sp. - freshwater copepod

Boeckella sp. - freshwater, copepod

Caenestheriella setosa - brittletail clam shrimp, freshwater 210

Calamoecia sp. - marine, saline lakes, copepod native to Australia and Asia

Calanus finmarchicus - sea water, species of copepods, zooplankton, subarctic

waters

Calanus hyperboreus - copepod, Arctic to North Atlantic

Caligus rogercresseyi- sea louse, parasite, causative agent of caligidosis,

infects salmon

Candacia curta - marine, copepod, subtropical, pelagic

Chiridius obtusifrons - marine, copepod, pelagic, Arctic

Cyclops insignis - common freshwater copepod

Diacyclops bicuspidatus - marine, copepod native to lagoons

Diacyclops scanloni - planktonic copepod common in Great Lakes, benthic

Echinolaophonte armiger - marine, copepod, found on Gulf of Mexico

Eodiaptomus wolterecki - copepods, calanoid, also found in ancient tropical

lake in Indonesia

Eucalanus bungii - copepod found in North Pacific waters, phytoplanktivore

Euchaeta Antarctica - calanoid copepod, most common copepod in Antarctic

Eudactylopus robustus - copepod, sublittoral

Eudiaptomus graciloides - most common calanoid copepod in North-Norway

Eurytemora affinis - copepod, epibenthic

Evadne nordmanni - copepod, prefers coastal waters

Gomphiocephalus hodgsoni- Antarctic springtail

Labidocera aestiva - copepod, pelagic calanoid

Labidocera pectinata - pontellid copepod, tropical 211

Labidocera scotti - copepod, on Atlantic Coast

Laophontella armata - copepod species

Longipedia gonzalezi - marine, freshwater, copepod

Lucayostratiotes cornuta - water sprite species, harpacticoid copepod

Lucicutia flavicornis - marine, copepod, pelagic,

Macrocyclops albidus - larvivorous copepod

Macrocyclops distinctus - cyclopoid copepod

Mesocyclops leuckarti - common freshwater copepod

Neocalanus cristatus - northern Pacific copepod species, marine

Neocalanus plumchrus - large copepod found in Pacific and Arctic Oceans

Parabroteas sarsi - marine, calanoid copepod found in lakes

Paracalanus sp. - marine, copepod found worldwide

Paraeuchaeta sp. - marine, bathypelagic copepod

Parvocalanus crassirostris - marine, small pelagic calanoid copepod

Phyllodiaptomus sp. - freshwater, copepod

Pseudocalanus sp. - copepod found in Artic and northern Pacific waters

Pseudodiaptomus annandalei - marine, brackish, calanoid copepod

Pseudodiaptomus coronatus - calanoid copepod, temperate, coastal waters

Scolecithricellas sp. - calanoid copepod

Temora longicornis - marine copepod found in Atlantic.

Tigriopus californicus - intertidal copepod found on Pacific

Undeuchaeta plumosa - marine, aetideid calanoid copepod

212

Branchiopoda

Acantholeberis curvirostris - acidic peaty pools, humic lakes

Bosmina coregoni - water flea, freshwater

Bythotrephes cederstroemi, B. longimanus - water flea, freshwater,

invasive in North America, common in Great Lakes

Bythotrephes longimanus - spiny water flea, invasive, freshwater

Daphnia ambigua - marine, small planktonic, water flea, smallest of the

Daphnia species

Daphnia dentifera - water flea, freshwater lakes and ponds, small

Daphnia dubia - freshwater, water flea, benthic, arctic

Daphnia laevis - water flea species, freshwater

Daphnia longicephala - freshwater, water flea

Daphnia magna - planktonic, freshwater, water flea

Daphnia occidentalis - endemic to Australia

Daphnia pulex - most common species of water flea

Daphnia pulicaria - water flea, freshwater, model organism for scientific

research

Holopedium amazonicum - water flea, found in warm regions in North

America

Ilyocryptus sp. - species of water flea

Leptodora kindtii - transparent predatory water flea

Moina affinis - small water flea 213

Simocephalus beianensis, S. heilongjiangensis, S. serrulatus, S.

vetuloides - cladocerans, zooplankton common in lakes and ponds

Entognatha (springtails)

Anurida maritima - marine springtail, scavangers, feed on dead animals

Bilobella aurantiaca - springtail

Insecta

Aedes aegypti- yellow fever mosquito, spreads many diseases, has been found

in Ohio

Anopheles albimanus- mosquito, spreads malaria, common in the Americas

Argia oculata - damselfly, predatory

Athalia rosae - sawfly, larvae feed on brassica species, adults feed on nectar

Attelabus analis - weevil, feeds on oak

Bactrocera cucurbitae - melon fly, feed on cucurbits, agricultural pest, p

olinators of some plants

Bactrocera dorsalis - oriental fruit fly, agricultural pest, pollinators of some

plants

Bactrocera oleae - olive fruit fly, agricultural pest

Bombus impatiens - common eastern bumble bee, pollinator

Cimex lectularius- bed bugs, Human hosts, common in the US

Copidosoma floridanum- insect, wasp, parasitoid of moths

Diaeretus leucopterus - wasp, aphid parasitoid

Fopius arisanus - wasp, egg-pupal parasitoid of tephritid fruit flies, used for

biological control of fruit flies 214

Sergentomyia minuta - sand fly, parasitic, feed on blood of cold-blooded and

warm-blooded animals, associated with leishmaniasis

Brachiopoda

Lingula rostrum - marine, brachiopod, shallow, intertidal, filter-feeder, free-

swimming larva

Bryozoa

Flustrellidra hispida - marine, mud, intertidal zone, colonizes protist algae

Hornera robusta - marine, shallow, suspension feeder

Choanaflagellates

Didymoeca costata - marine, brackish water, saltmarshes

Ichthyophonus hoferi - marine, freshwater, parasite of fish (marine, freshwater, and

anadromous fishes)

Monosiga brevicollis - marine and freshwater, feed on bacteria and detritus

Salpingoeca euryoecia - marine, brackish water, freshwater

Salpingoeca fusiformis - freshwater, living on algae

Salpingoeca infusionum - marine, live on sponges

Chordata

Cephalochordata

Branchiostoma floridae - lancelet, marine

Olfactores

Tunicata

Vertebrata

Balaenoptera acutorostrata - minke whale, marine, mammal 215

Callorhinchus milii - chimaera, related to sharks, marine fish

(Chondrichthyes)

Chelonia mydas - green sea turtle, Coastal US Atlantic as far north as

Canada, marine reptile

Chinchilla lanigera - domesticated rodent, terrestrial mammal

Chrysemys picta - common painted turtle, freshwater North America reptile

Danio rerio - zebrafish, freshwater, research organism, popular aquarium

fish

Dicentrarchus labrax - European bass, marine and freshwater, fish

Epinephelus coioides - orange-spotted grouper, estuary cod, marine and

brackish water fish

Eptesicus fuscus - big bown bat, terrestrial mammal

Gorilla gorilla - gorilla (from human or zoo?) terrestrial mammal

Homo sapiens - human, terrestrial mammal

Ictidomys tridecemlineatus - three-lined ground squirrel, North America,

terrestrial mammal

Jaculus jaculus - lesser jerboa, small terrestrial rodent (mammal)

Lampadena urophaos - lanternfish, maine fish

Lepisosteus oculatus - spotted gar, North America, freshwater fish

Lipotes vexillifer - freshwater mammal (dolphin)

Macaca mulatta - Rhesus macaque, terrestrial mammal (from human)

Monodelphis domestica - gray short-tailed opossum, terrestrial mammal

(marsupial) 216

Mus musculus - common mouse, terrestrial mammal

Myotis lucifugus - little brown bat, terrestrial mammal

Ornithorhynchus anatinus - platypus, semiaquatic mammal (monotreme)

Oryzias latipes - ricefish, freshwater, brackish water fish

Otolemur garnettii - northern greater galago, terrestrial mammal

Pantholops hodgsonii -Tibetan antelope (zoo?), terrestrial mammal

Pelodiscus sinensis - softshell turtle, freshwater, brackish water reptile,

widespread

Phodopus sungorus - winter white dwarf hamster, terrestrial mammal

Poecilia formosa, P. reticulata - Amazon molly, guppy, freshwater fish

Pongo abelii - oragutan, (human?), terrestrial mammal

Protomyctophum gemmatum - lanternfish, circumglobal, marine fish

Pseudopodoces humilis - ground tit, ground jay, terrestrial avian

Pteropus alecto - flying fox, terrestrial mammal

Raja schmidti - ray (Chondrichthyes), marine fish

Rhinobatos productos - shovelnose guitarfish (Chondrichthyes), marine fish

Salmo salar - Atlantic salmon, marine fish

Sciaenops ocellatus - Atlantic red drum, marine fish

Scyliorhinus torazame - cloudy catshark (Chondrichthyes), marine fish

Taaningichthys minimus - lanternfish, widespread, marine fish

Takifugu rubripes - pufferfish, marine, brackish water, fish

Thamnophis sirtalis - common garter snake, terrestrial reptile

Xenopus tropicalis - western clawed frog, freshwater amphibian 217

Cnidaria

Actinernus elongatus - marine, sea anemone, benthic

Adamsia palliata - marine, sea anemone found on hermit crab shells, shallow

water

Antennella ansini - marine, coral, benthic

Antipathes atlántica - marine, black coral, benthic

Asyncoryne ryniensi s- marine, hydroid, sub-littoral

Aulactinia stella- Silver spotted sea anemone subtropical

Boloceroides mcmurrichi - sea anemone, benthic, tropical

Bunodactis reynaudi - marine, sandy sea anemone, shallow water, southern Africa

Calycella syringa - marine, sessile hydroid, subtropical

Carybdea xaymacana - marine, box jellyfish, tropical

Chironex fleckeri - marine venomous box jellyfish, shallow water

Corynactis viridis - marine, jewel sea anemone, brightly colored, sublittoral zone

Dendrobathypathes boutillieri - marine, coral, benthic

Diadumene cincta - marine, small, orange sea anemone, intertidal to sublittoral

Diadumene leucolena - marine, white sea anemone, intertidal to sublittoral

Drymonema larsoni - marine, jellyfish, tropical

Ectopleura crocea - marine, tubular hydroid, temperate coastal waters

Edwardsia timida - marine, sea anemone, sublittoral zones

Edwardsia elegans - marine, burrowing sea anemone, benthic

Epiactis handi - marine, sea anemone, benthic 218

Eutima curva - marine, hydrozoa, pelagic, tropical waters

Favites abdita - marine, stony coral native, Indo-Pacific region, littoral zone

Gonothyraea loveni - marine, hydroid, subtidal zones

Halecium labrosum - marine, hydroid, benthic

Halopteris schucherti - marine, hydrozoa, benthic, subtropical

Hebella venusta - marine, hydroid, shallow water

Hydra circumcincta - marine, hydra, common in tropical regions

Hydra littoralis - small, freshwater, subtropical, demersal

Hydra sinesis - freshwater, small

Hydrissa sodalis - marine, benthic

Kirchenpaueria halecioides - marine, hydroid, benthic

Laodicea undulata - marine, hydroid, subtropical, pelagic

Leiopathes cf. expansa - marine, sea pen, benthic

Leioptilus fimbriatus - marine, sea pen, sublittoral

Mitrocomella fulva - marine, hydroid, coastal waters

Modeeria rotunda - marine, hydroid, subtropical, benthopelagic

Moerisia inkermanica- invasive hydrozoan, demersal, subtropical

Nausithoe punctata - marine, crown jellyfish, pelagic, tropical

Nematostella vectensis- marine, starlet sea anemone, coastal

Obelia bidentate - aquatic, brackish water, coastal

Odessia maeotica - marine, brackish water, hydrozoa, pelagic, subtropical

Paranthus niveus - sea anemone, benthic, subtropical

Parantipathes cf. hirondelle - marine, benthic, black coral 219

Parazoanthus axinellae - marine, yellow cluster anemone, benthic

Parvicapsula petuniae - marine, fish parasite

Pavona cactus - cactus coral, found in tropical shallow waters or lagoons

Phialella quadrata - marine, hydrozoan, shallow water

Polyorchis haplus - marine, hydrozoan, coastal

Ricordea florida- coral, glows under UV light, shallow water

Sagarita ornata - marine, sea anemone, shallow water

Sagartia troglodytes - marine, cave-dwelling sea anemone, shallow water

Sarsia apicula - marine, hydrozoan, pelagic, subtropical

Sertularella gayi, S. mediterránea - marine, hydrozoan, sublittoral

Schuchertinia sp. - marine, hydrozoan, shallow water

Sphaerocoryne agassizii - marine, hydrozoan, pelagic, subtropical

Stauropathes cf. punctata - marine, coral species, cold water

Staurocladia wellingtoni - marine, hydrozoan, subtropical, demersal

Stegopoma plicatile - marine, hydrozoan, sessile, cold water

Stichopathes dissimilis - marine, coral, sessile, tropical

Thyroscyphus marginatus - marine, small, immortal jellyfish, temperate to tropics

worldwide, benthic

Tiaricodon coeruleus - marine, hydrozoan, pelagic, subtropical

Tiaropsis multicirrata - marine, hydrozoan, shallow waters

Triactis producto - marine, sea anemone, shallow reefs, tropical

Trissopathes pseudotristicha - marine, benthic, tropical

Tubastraea coccinea - marine, stony coral, sun coral, heterotrophic, shallow water 220

Turritopsis lata - marine, hydrozoan, subtropical, benthopelagic

Viatrix globulifera - turtle grass anemone, poisonous, sessile, subtropical

Ctenophora

Mnemiopsis leidyi - marine, comb jelly, Western Atlantic, tolerates a wide range

in salinity

Pleurobrachia bachei - marine, com jelly, feed on copepods and plankton

Echinodermata

Florometra serratissima - crinoid, marine, plankton feeder

Gastrotrichia

Chaetonotus sp. - Freshwater, gastrotrichs

Halichaetonotus sp. - freshwater, estuary, and marine sediments, gastrotrichs

Heterolepidoderma sp. - freshwater, gastrotrichs

Hemichordata

Holomycota

Nuclearia moebiusi, N. simplex - freshwater, brackish water

Holozoa

Capsaspora owczarzaki - freshwater, sister group to choanoflagellates and fungi,

endosymbiont of snails

Kinorhyncha

Echinoderes dujardinii, E. sensibilis - Small marine mud dragon, intertidal to deep

sea, worldwide

Mollusca

Abra alba - marine bivalve, shallow water, soft sediments 221

Acila castrensis - marine bivalve, shallow water, soft sediment and sand

Amblychilepas nigrita - marine limpet, shallow water under stones

Aplysia californica - marine sea slug, research lab animal

Arctica islandica - marine bivalve, edible

Asaphis deflorata - marine bivalve, shallow water, mud and/or sand

Barnea candida - marine bivalve, shallow water, sublittoral, burrows into wood,

peat, and soft rock

Calyptogena magnifica - large white clam, deep ocean, around hydrothermal vents

Chama macerophylla - marine bivalve, attaches to ship hulls and floating debris,

invaisve

Chione elevata - marine bivalve, shallow water, sand

Congeria jalzici - subterranean bivalve, cave-dwelling

Corbicula fluminea - freshwater bivalve, invasive

Corbula tunicata - small marine clam

Cyrenoida floridana - freshwater (marsh) bivlave

Diaulula sandiegensis - marine sea slug, nudibranch, rocky areas

Dimya japónica - marine bivalve, subtidal, sand, gravel, shells

Donax trunculus - marine bivalve, edible, shallow water in sand

Dreissena bugensis - freshwater mussel (quagga mussel), invasive

Dreissena polymorpha - freshwater mussel (zebra mussel), invasive

Episiphon yamakawai - marine tusk shell

Glauconome rugosa - freshwater mussel

Glossus humanus - marine bivalve, deep water, mud, sand 222

Hiatella arctica - marine bivalve, rock-borer, arctic, tidal to deep water

Leiopyrga octona -marine, eight-ringed weed shell, shallow water

Leptochiton vietnamensis - marine chiton, deep water

Lima fujitai - marine bivalve, moderate depth

Lithophaga nigra - marine mussel, shallow water, coral rock borer

Modiolus nipponicus - marine bivalve, shallow to deep water

Mya arenaria - marine bivalve, soft-shell, edible, sandy and muddy tidal flats

Mysella charcoti - marine bivlave, burrow into soft sediment

Mytilopsis leucophaeata - small marine bivalve, estuaries, brackish water, common

in ship ballast water, invasive

Nierstraszella andamanica - marine chiton, deep sea

Paphia undulata - marine bivalve, shallow water, sand, edible

Petricola lapicida - marine bivalve, shallow water, coral rock borer

Pinna muricate, P. saccate - marine bivalve, pen shell, shallow water, widespread,

soft sediments

Saccostrea kegaki - marine bivalve, rock oyster, estuaries, common

Septifer excisus, S. virgatus - marine mussels, on exposed rocks, corals, and oyster

shells

Sphaerium nucleus - freshwater bivalve, swamps

Tagelus plebeius - bivalve, brackish water, sandy beaches, razor clam

Teredo clappi - marine bivalve, wood borers

Turbo marmoratus - marine gastropod, spiral shell, feed on algae, nocturnal

Velesunio ambiguus - freshwater mussel, static water 223

Venus verrucosa - marine bivalve, shallow to moderate depths, mud or sand,

edible

Varicorbula dissimilis - marine bivalve, ocean and estuaries, mud or sand

Nematomorpha

Chordodes morgana - horsehair worm, parasite of arthropods (praying mantis), lay

eggs in freshwater

Gordius aquaticus - horsehair worm, parasites of arthropods (beetles and

mantids), lay eggs in freshwater

Nematoda

Angiostrongylus cantonensis- infects rats

Anisakis simplex - infects humans

Brugia pahangi - parasitic roundworm infecting cats and wild animals

Brugia timori - parasitic roundworm, infects humans

Cyclopidae sp. - plant pathogenic nematode, freshwater

Cylicostephanus goldi - parasite in horses

Haemonchus placei - cattle parasite

Nematodirus helvetianus - cattle parasite

Parascaris equorum - horse parasite

Strongyloides venezuelensis - Mouse parasite

Strongylus vulgaris - horse parasite

Toxocara canis - canine parasite

Trichodorus arasbaranensis - plant pathogen

Trichodorus orientalis - plant pathogen 224

Wuchereria bancrofti - human parasite

Xiphinema rivesi - plant pathogen

Nemertea

Amphiporus sp. - ribbon worm, freshwater, eat amphipods (small crustaceans)

Baseodiscus unicolor - ribbon worm, proposcis worm, marine, brackish water,

sand, under rocks

Drepanophorus spectabilis - ribbon worm, predatory, marine, estuary, coastal,

sand, beneath boulders

Platyhelminthes

Acholades asteris - turbellarian flatworm, marine, no mouth, pharynx, or

intestines, parasite of sea-stars (encysts in tube feet)

Diphyllobothrium latum - tapeworm, infects fish, crustaceans, and mammals

(including humans), marine or aquatic

Dollfustrema hefeiensis - marine worms, infect bivalves and fish

Geocentrophora applanate, G. baltica, G. marcusi, G. sphyrocephala - turbellarian

flatworms, freshwater

Kronborgia isopodicola - turbellarian flatworm, parasite of isopods, marine

intertidal reefs

Mesocestoides corti - tapeworm, common in carnivores (canines, felines, racoons,

mice; rarely humans)

Notocaryoplana arctica - turbellarian flatworm, marine, widespread

Orectolobicestus randyi - tapeworm, parasite of sharks

Polystyliphora karlingi - turbellarian flatworm, marine, subtidal sand 225

Polystomoides malayi - trematode, fluke, freshwater, parasites of mollusks and

vertebrates

Protopolystoma xenopodis - flatworm, infects amphibians, freshwater

Prorhynchus fontinalis - flatworm, freshwater, groundwater

Pseudofabriciola quasiincisura - polychaete, marine, shallow water

Schistocephalus solidus - tape worm of fish, fish-eating birds,and rodents,

intermediate hosts are copepods

Schistosoma rodhaini - schistosomes (trematode), freshwater, infect rodents

Schistosomatium douthitti - schistosomes (trematode), freshwater, infects birds

and small mammals, mild infections in humans

Spirometra erinaceieuropaei - tapeworm, freshwater, infects animals (including

humans), worldwide

Stylochus zebra - flatworms, live in rocks and pilings, infests hermit crabs

Taenia asiatica - tapeworm, infests humans and porcines

Toia ycia - turbellarian flatworm, marine

Trichobilharzia regenti - neuropathogenic parasitic flatworm of birds, causes

cercarial dermatitis (swimmers itch) in humans, mollusk intermediate,

freshwater

Porifera

Clathrina blanca, C. clathrus, C. rubra - calcareous sponge, marine, shallow water

and in ocean caverns

Dysidea arenaria - marine, sponge, invasive

Halichondria panicea - breadcrumb sponge, marine, shallow to deep water, 226

common, wide range of habitats

Hyrtios erectus - marine, attach to corals, shallow water

Leucetta chagosensis - marine, outer reef slope, on hard substrates

Leucosolenia sp. - marine, calcareous sponge, in tide pools, clustered around

seaweed or on rocks

Monanchora arbuscula - marine, wave-exposed areas, veticle or overhanging

encrustations

Plectroninia neocaledoniense - marine, calcareous sponge, deep water

Ute ampullaceal - marine, calcareous sponge, on reefs

Priapulida

Halicryptus spinulosus - marine worm, soft sediment (mud),shallow to moderate

depth water

Priapulus caudatus - marine worm, soft sediment (mud), subtidal zone, shallow to

moderate depth water, widespread

Rotifera

Adineta vaga - bdelloid rotifer, freshwater, exclusively parthenogenic

Beauchampia crucigera - freshwater, near outflow of cooling water from power

plant

Brachionus calyciflorus, B. patulus - freshwater, planktonic

Brachionus plicatilis - salt lakes, tolerates a wide range of salinity, planktonic

Conochilus coenobasis, C. unicornis - freshwater, planktonic

Floscularia armata, F. bífida - freshwater, sessile on awuatic plants

Keratella cochlearis - marine, brackish water, freshwater, worldwide, planktonic 227

Lacinularia flosculosa - freshwater, sessile on aquatic plants

Lacinularoides coloniensis - freshwater, sessile on aquatic plants

Lecane ungulata - freshwater, in bogs and among mosses

Limnias ceratophylli, L. melicerta - freshwater, sessile on aquatic plants and

sediment

Octotrocha speciosa - freshwater, sessile on aquatic plants

Ptygura beauchampi, P. longicornis - acid bog, freshwater, sessile on aquatic plants

(bladderwort)

Sinantherina semibullata, S. sociales, S. pectinata - freshwater, sessile on aquatic

plants, colonial

Testudinella clypeata - marine, brackish water, among aquatic plants

Testudinella patina - marine, brackish water, freshwater, tolerant of changing

salinity, among mosses

Trichotria tetractis - marine, brackish water, freshwater, among sphagnum

Spinicula

Phascolopsis gouldii - marine non-segmented worm, shallow water, burrows in

sandy mud, filter feeder

Tarigrada

Dactylobiotus ambiguus- forest soil, bogs, lake sediment, freshwater, polar

Dactylobiotus parthenogeneticus - freshwater, from freshwater alga

Milnesium sp. - common tardigrade, worldwide, marine, in lichens and moss

(freshwater habitats), humid forests 228

Murrayon pullari - terrestrial, freshwater, from peat bog, on moss, on aquatic

plants

Xenacoelomorpha

Ascoparia sp. - marine, flatworm, sediment

Childia groenlandica - marine, flatworm, sediment, shallow water

Hallangia proporoides - marine, flatworm, sediment, shallow water, epizoic on

hydroids

Isodiametra pulchra - marine, flatworm, widespread, sediment, shallow water

Fungi

Eumycota

Chytridiomyceta

Chytridiomycota

Batrachochytrium dendrobatidis- causes chytridiomycosis in amphibians

Boothiomyces macroporosum - grows on pollen, forest soils

Gonapodya polymorpha, G. prolifera - aquatic, grow on decaying plant

tissues

Gromochytrium mamkaevae- parasite of yellow-green algae (SAR, protists)

Monoblepharis hypogyna - aquatic

Nowakowskiella hemisphaerospora - grows on decaying plant tissues

Rhizophydium patellarium - forest soils, plant and fungus parasite

Neocallimastigomycota

Piromyces sp - grow in the gut of herbivores, have hydrogenosomes (no

mitochondria) 229

Blastocladiomyceta

Blastoclasiomycota

Paraphysoderma sedebokerense- Facultative pathogenic chytrid, causes

irreversible damage to green algae

Mucormyceta

Calcarisporiellomycota

Mucoromycota

Calcarisporiella sp. - endophyte of moss

Circinella simplex, C. umbellata - soil, leaf, freshwater

Endogone flammicorona, E. lactiflua - ectomycorrhizal on conifer, truffles

Mortierella sp. - soil, widespread

Mucor racemosus - common, worldwide, soil, houses

Thermomucor indicae-seudaticae - thermophilic, soil

Umbelopsis autotrophica - soil, dung, dead plant material, rhizospheric

soil/roots

Symbiomycota

Dikarya

Ascomycota

Alternaria alternata - plant pathogen, animal (human) allergen

Alternaria longipes - animal (human) pathogen, allergen

Alternaria tomato - plant pathogen

Arthrinium arundinis - soils 230

Articulospora atra - aquatic (freshwater)

Ascoidea rubescens- associated with bark beetles, dead wood

Aspergillus nidulans - commonly used in genetic research

Aureobasidium pullulans, A. pullulans - epiphyte, endophyte on many

plants, human allergen

Bacidia rosella - lichenized fungus, grows on deciduous trees

Bipolaris maydis, B. microstegii, B. sorokiniana - plant pathogens

Botrytis cinerea - necrotrophic on plants, including grapes

Candida glabrata, C. glucosophila - commensal on humans (and other

animals)

Capronia coronata - soil, plant pathogen, wood

Cladophialophora yegresii - cactus spines, human pathogen

Cladosporium bruhnei, C. delicatulum, C. sphaerospermum - plant

pathogens, human allergen, air, soil, indoors, common

Colletotrichum graminícola - plant pathogen (including on wheat and

maize)

Curvularia fallax, C. spicifera - plant pathogen

Darkera picea - endophyte of Picea needles

Eiglera flavida - lichenized fungus (crustose)

Endocarpon pusillum - lichenized fungus

Epicoccum nigrum - plant pathogen, endophyte

Eremothecium gossypii - plant pathogen

Exophiala xenobiotica - human pathogen (cutaneous - opportunistic) 231

Fumiglobus pieridicola - plant pathogen

Fusarium fujikuroi, F. graminearum - plant pathogen

Gaeumannomyces graminis - plant pathogen

Geoglossum nigritum - saprobic, non-pathogenic

Haplographium delicatum - grows on deteriorating wood of

angiosperms

Hyphopichia heimii - associated with rotting wood, transmitted by

insects

Hypocrea jecorina - cellulose degrading fungus

Kluyveromyces lactis, K. marxianus - ubiquitous - on corn, in milk, soil

Knufia petricola - rock-inhabiting, limestone

Lasallia sp. - lichenized fungi

Leptosphaeria biglobosa, L. doliolum, L. maculans - plant pathogen

(stem cankers in crucifers)

Lichenothelia arida - rock-inhabiting fungus

Marssonina brunnea - pathogenic to poplars

Metarhizium anisopliae - insect pathogen, parasitoid

Metschnikowia agaves, M. similis - infect Daphnia and beetles

Millerozyma farinosa - ubiquitous, salt-tolerant, infects

immunocompromised humans

Myceliophthora thermophila - lignocellulose (wood) degradation

Mycofalcella calcarata - aquatic, root endophytes

Nadsonia fulvescens - no details 232

Neofusicoccum parvum - plant pathogen

Neosetophoma clematidis - plant pathogen (grasses), soils

Pachysolen tannophilus - pentose-fermeting fungus

Paraconiothyrium lycopodinum, P. polonense - endophyte

Peltula obscurans - lichenized fungi, grows on rocks and soils

Penicillium rubens - common in environment

Pertusaria trachythallina - lichenized fungus

Pestalotiopsis fici - plant pathogen and endophyte

Peterozyma toletana - methanol-assimilation

Phaeosphaeriopsis glaucopunctata - plant pathogen

Phaeosphaeria juncicola - saprotrophs on plants

Phaffomyces opuntiae - grows on cactus and other plants

Phomopsis sp. - plant pathogen

Pseudocercospora angolensis - plant pathogen

Pseudogymnoascus destructans - psychrotrophic, pathogenic on

mammals, including bats (white, nose disease)

Rasamsonia emersonii - themotolerant, animal pathogen

Rhinocladiella mackenziei - human pathogen (cerebral

phaeohyphomycosis)

Saccharomyces cerevisiae - bread, wine, beer yeast

Saitoella complicate - saprobic

Setosphaeria turcica - plant pathogic on grasses (including maize) 233

Stenocarpella maydis - plant pathogic on grasses (including maize and

sugar cane)

Sydowia polyspora - plant pathogen and endophyte of gymnosperms

Talaromyces stipitatus - non-pathogenic, decays oplant matter

Tetrapisispora phaffii - toxic to other fungi

Thielavia terrestris - thermophilic, marine, terrestrial, plant pathogen

Trichoderma atroviride - common soil fungus

Tuber aestivum, T. borchii - edible truffles

Umbilicaria sp. - lichenized fungus on rock

Wickerhamia fluorescens - no information

Zygotorulaspora mrakii - on tree bark and wood

Basidiomycota

Anthracocystis flocculosa - used as a biocontrol agent

Athelia arachnoidea - pathogen of lichens

Armillaria mellea - common plant pathogen

Auricularia subglabra - jelly fungus

Basidioascus magus, B. undulates - soil, saprobe

Blastomyces gilchristii - human pathogen

Candelabrochaete africana - crust fungus, decompose dead plant

material and wood

Clavaria fumosa - coral fungus, saprobe

Coltricia crassa - tiger's eye fungus, saprobe

Coltriciella globosa - wood-inhabiting (rotting) 234

Coniophora puteana - wood-rotting, brown-rot

Cryptococcus sp. - human pathogen, meningocephalitis

Dichomitus kirkii, D. squalens - white rot fungus

Filobasidiella neoformans - parasitic on other fungi

Heterobasidion irregulare - tree root rot

Hypsizygus marmoreus - white beech mushroom, edible

Inocybe maculate - toxic (muscarine)

Lignosus rhinocerotis - saprobe

Macrocybe titans - saprobe

Melanopsichium pennsylvanicum - parasitic on plants

Peniophora nuda - grows on bark and wood

Phanerochaete carnosa - crust fungus, plant pathogen

Phlebiopsis crassa - crust fungus, saprobic, possible plant parasite

Pichia fermentans - live on decaying plants

Pseudozyma hubeiensis - plant pathogen, decaying material, possible

animal pathogen

Punctularia strigosozonata - white-rot fungus, plant pathogen

Scytinopogon havencampii - saprobe

Sporisorium scitamineum - sugar cane smit, plant pathogen (grasses)

Tilletiopsis cremea, T. lilacina, T. washingtonensis - plant pathogen

Trametes versicolor - plant pathogen

Tremella mesenterica - parasite of other fungi

Tremiscus helvelloides - jelly fungus, saprobe 235

Tricholoma sp. - tree synbiont, ectomycorrhizal

Trichosporon asahii - human pathogen (sometimes fatal in

immunocompromised patients)

Xanthophyllomyces dendrorhous - grows in plants

Glomeromycota

Acaulospora laevis - arbuscular mycorrhiza and vesicles in roots

Diversispora celata - arbuscular mycorrhiza

Rhizophagus intraradices - arbuscular mycorrhizal fungus

Sacculospora báltica - maritime sand dunes, fungi, arbuscular mycorrhiza

Zoopagomyceta

Entomorphthoromycota

Basidiobolus ranarum- decaying fruit, filamentous, worldwide

Kickxellomycota

Barbatospora ambicaudata - aquatic arthropod symbiont

Zoopagomycota

Kuzuhaea moniliformis - soil, dung, parasitic on fungi and animals

Rozellomyceta

Microsporidia

Nosema sp. - pathogenic in honeybee, parasite, affects flight behavior

Rozellomycota

Amoeboaphelidium protococcarum - freshwater, unicellular, parasite of

algae

Rozella allomycis- variety of hosts, parasite of water molds (oomycetes) 236

APPENDIX B. BACTERIAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99% AND 100%

≥97% ≥99% =100% Bryobacter aggregatus Cellulosimicrobium cellulans Holophaga foetida Cellulosimicrobium cellulans Geothrix fermentans Actinobaculum schaalii Geothrix fermentans Holophaga foetida Actinoplanes missouriensis Holophaga foetida Actinobaculum schaalii Actinoplanes sp Acidothermus cellulolyticus Actinoplanes missouriensis Corynebacterium pseudotuberculosis Actinobaculum schaalii Actinoplanes sp Frankia sp. Actinoplanes missouriensis Aquihabitans daechungensis Intrasporangium calvum Isoptericola variabilis Actinoplanes sp Corynebacterium Kutzneria albida Aquihabitans daechungensis pseudotuberculosis Microbacterium sp Catenulispora acidiphila Frankia sp. Mycobacterium bovis Corynebacterium pseudotuberculosis Intrasporangium calvum Nocardia farcinica Frankia sp. Isoptericola variabilis Streptomyces collinus Intrasporangium calvum Kutzneria albida Streptomyces leeuwenhoekii Isoptericola variabilis Leucobacter sp. Algoriphagus sp Kutzneria albida Microbacterium sp Bacteroides ovatus Kytococcus sedentarius Modestobacter versicolor Bacteroides xylanisolvens Luteipulveratus mongoliensis Mycobacterium abscessus Blattabacterium sp Marmoricola bigeumensis Mycobacterium bovis Cytophaga sp Microbacterium sp Mycobacterium confluentis Dyadobacter fermentans Flavobacterium Microlunatus phosphovorus Mycobacterium hodleri aquidurense Modestobacter marinus Mycobacterium intracellulare Flavobacterium branchiophilum Modestobacter versicolor Mycobacterium smegmatis Flavobacterium columnare Mycobacterium abscessus Nocardia farcinica Flavobacterium degerlachei Mycobacterium asiaticum Sporichthya brevicatena Flavobacterium frigidarium Mycobacterium bovis Streptomyces collinus Flavobacterium granuli Mycobacterium chubuense Streptomyces leeuwenhoekii Flavobacterium hercynium Mycobacterium confluentis Aequorivita sublithincola Flavobacterium hydatis Mycobacterium goodii Algoriphagus sp Flavobacterium indicum Mycobacterium intracellulare Bacteroides helcogenes Flavobacterium johnsoniae 237

≥97% ≥99% =100% Mycobacterium kansasii Bacteroides ovatus Flavobacterium limicola Flavobacterium Mycobacterium neoaurum Bacteroides vulgatus psychrophilum Mycobacterium obuense Bacteroides xylanisolvens Flavobacterium sp. Mycobacterium rhodesiae Barnesiella viscericola Flavobacterium succinicans Mycobacterium smegmatis Blattabacterium sp Flavobacterium tiangeerense Mycobacterium vanbaalenii Cytophaga sp Flavobacterium xinjiangense Nocardia farcinica Dyadobacter fermentans Formosa sp Rhodococcus jostii Flavobacterium antarcticum Haliscomenobacter hydrossis Sanguibacter keddieii Flavobacterium aquatile Hymenobacter perfusus Sporichthya brevicatena Flavobacterium aquidurense Hymenobacter sp Streptomyces albireticuli Flavobacterium branchiophilum Marivirga tractuosa Streptomyces collinus Flavobacterium chilense Niabella soli Streptomyces hygroscopicus Flavobacterium columnare Niastella koreensis Streptomyces leeuwenhoekii Flavobacterium degerlachei Odoribacter splanchnicus Streptomyces netropsis Flavobacterium frigidarium Pedobacter saltans Terracoccus luteus Flavobacterium glaciei Chlorochromatium aggregatum Armatimonas rosea Flavobacterium granuli Herpetosiphon aurantiacus Persephonella marina Flavobacterium hercynium Anabaena bergii Aequorivita sublithincola Flavobacterium hydatis Anabaena circinalis Alistipes shahii Flavobacterium indicum Anabaena cylindrica Alistipes finegoldii Flavobacterium johnsoniae Anabaena ellipsoides Algoriphagus sp Flavobacterium limicola Anabaena flos-aquae Bacteroides helcogenes Flavobacterium psychrolimnae Anabaena lemmermannii Bacteroides ovatus Flavobacterium psychrophilum Anabaena oumiana Bacteroides vulgatus Flavobacterium segetis Anabaena solitaria Bacteroides xylanisolvens Flavobacterium sp. Anabaena sp Barnesiella viscericola Flavobacterium succinicans Anabaena variabilis Blattabacterium sp Flavobacterium tiangeerense Aphanizomenon flos-aquae Cellulophaga algicola Flavobacterium xinjiangense Aphanizomenon gracile Cyclobacterium amurskyense Fluviicola taffensis Aphanizomenon issatschenkoi Cyclobacterium marinum Formosa sp Aphanizomenon ovalisporum Cytophaga sp Haliscomenobacter hydrossis Aphanizomenon sp. 238

≥97% ≥99% =100% Draconibacterium orientale Hymenobacter gelipurpurascens Aphanothece clathrata Dyadobacter fermentans Hymenobacter perfusus Calothrix sp Echinicola vietnamensis Hymenobacter sp Coelomoron pusillum Emticicia oligotrophica Leadbetterella byssophila Cyanobium gracile Fibrella aestuarina Marivirga tractuosa Cyanobium sp Flavimarina pacifica Niabella soli Cyanothece sp Flavobacterium antarcticum Niastella koreensis Cylindrospermum stagnale Flavobacterium aquatile Odoribacter splanchnicus Dolichospermum affine Flavobacterium aquidurense Parabacteroides distasonis Dolichospermum circinale Flavobacterium branchiophilum Pedobacter saltans Dolichospermum flos-aquae Flavobacterium columnare Porphyromonas gingivalis Dolichospermum lemmermannii Flavobacterium degerlachei Salinirepens amamiensis Dolichospermum mendotae Flavobacterium frigidarium Sediminibacter furfurosus Dolichospermum planctonicum Flavobacterium frigoris Winogradskyella sp Dolichospermum smithii Flavobacterium glaciei Chlorochromatium aggregatum Limnococcus limneticus Flavobacterium granuli Herpetosiphon aurantiacus Microcystis aeruginosa Flavobacterium hercynium Anabaena affinis Microcystis botrys Flavobacterium hibernum Anabaena bergii Microcystis panniformis Flavobacterium hydatis Anabaena circinalis Microcystis sp. Flavobacterium indicum Anabaena cylindrica Microcystis viridis Flavobacterium johnsoniae Anabaena ellipsoides Nodularia sphaerocarpa Flavobacterium limicola Anabaena flos-aquae Nodularia spumigena Flavobacterium psychrolimnae Anabaena lemmermannii Nostoc azollae Flavobacterium psychrophilum Anabaena mendotae Nostoc piscinale Flavobacterium saccharophilum Anabaena minispora Nostoc punctiforme Flavobacterium segetis Anabaena oumiana Nostoc sp. Flavobacterium sinopsychrotolerans Anabaena smithii Planktothrix agardhii Flavobacterium sp. Anabaena solitaria Planktothrix cryptovaginata Flavobacterium succinicans Anabaena sp Planktothrix sp Flavobacterium tiangeerense Anabaena sphaerica Planktothrix suspensa Flavobacterium xinjiangense Anabaena variabilis Prochlorococcus marinus Fluviicola taffensis Aphanizomenon flos-aquae Radiocystis sp 239

≥97% ≥99% =100% Formosa agariphila Aphanizomenon gracile Raphidiopsis curvata Formosa sp Aphanizomenon issatschenkoi Snowella litoralis Geojedonia litorea Aphanizomenon ovalisporum Sphaerospermopsis aphanizomenoides Haliscomenobacter hydrossis Aphanizomenon sp. Stanieria cyanosphaera Hymenobacter gelipurpurascens Aphanothece clathrata Synechococcus rubescens Hymenobacter perfusus Calothrix sp Synechococcus sp Hymenobacter sp Coelomoron pusillum Synechococcus spongiarum Hymenobacter swuensis Cyanobium gracile Synechocystis sp Lacinutrix sp Cyanobium sp Tolypothrix sp. Leadbetterella byssophila Cyanothece sp Trichodesmium erythraeum IMS101 Marivirga tractuosa Cylindrospermum stagnale Woronichinia naegeliana Myroides odoratus Dolichospermum affine Woronichinia sp. Niabella soli Dolichospermum circinale Deinococcus gobiensis Niastella koreensis Dolichospermum crassum Meiothermus ruber Nonlabens marinus Dolichospermum flos-aquae Meiothermus silvanus Odoribacter splanchnicus Dolichospermum lemmermannii Clostridium pasteurianum Owenweeksia hongkongensis Dolichospermum mendotae Clostridium saccharoperbutylacetonicum Parabacteroides distasonis Dolichospermum mucosum Clostridium sulfidigenes Pedobacter heparinus Dolichospermum planctonicum Clostridium tetani Pedobacter saltans Dolichospermum sigmoideum Dehalobacter restrictus Pedobacter sp Dolichospermum smithii Dehalobacter sp. Porphyromonas gingivalis Hydrocoryne spongiosa Desulforudis audaxviator Salinirepens amamiensis Limnococcus limneticus Lactobacillus fermentum Saprospira grandis Limnoraphis robusta Lactobacillus pentosus Sediminibacter furfurosus Lyngbya hieronymusii Methylotenera mobilis Sulcia muelleri Microcystis aeruginosa Paenibacillus polymyxa Winogradskyella sp Microcystis botrys Paenibacillus sabinae Zunongwangia profunda Microcystis panniformis Ruminococcus obeum Chlorochromatium aggregatum Microcystis sp. Staphylococcus haemolyticus Anaerolinea thermophila Microcystis viridis Staphylococcus lugdunensis Chloroflexus aggregans Nodularia sphaerocarpa Staphylococcus pasteuri Herpetosiphon aurantiacus Nodularia spumigena Staphylococcus pseudintermedius 240

≥97% ≥99% =100% Litorilinea aerophila Nostoc azollae Streptococcus pyogenes Desulfurispirillum indicum Nostoc piscinale Veillonella parvula Anabaena affinis Nostoc punctiforme Weissella cibaria Anabaena bergii Nostoc sp. Gemmatimonas aurantiaca Anabaena catenula Planktothrix agardhii Nitrospira defluvii Anabaena circinalis Planktothrix cryptovaginata Nitrospira moscoviensis Anabaena crassa Planktothrix sp Nitrospira sp. Anabaena cylindrica Planktothrix suspensa Caldilinea aerophila Anabaena eucompacta Prochlorococcus marinus Gemmata obscuriglobus Anabaena ellipsoides Pseudanabaena catenata Gimesia maris Anabaena flos-aquae Radiocystis sp Pirellula staleyi Anabaena lemmermannii Raphidiopsis curvata Planctomyces brasiliensis Anabaena mendotae Scytonema stuposum Rhodopirellula baltica Anabaena minispora Snowella litoralis Acetobacter tropicalis Anabaena oumiana Snowella rosea Acidisoma sp Anabaena pseudocompacta Sphaerospermopsis Afipia sp Anabaena smithii aphanizomenoides Agrobacterium tumefaciens Anabaena solitaria Sphaerospermopsis kisseleviana Agrobacterium vitis Anabaena sp Stanieria cyanosphaera Azospirillum brasilense Anabaena sphaerica Synechococcus elongatus Bartonella schoenbuchensis Anabaena spiroides Synechococcus rubescens Bradyrhizobium denitrificans Anabaena torulosa Synechococcus sp Bradyrhizobium japonicum Anabaena variabilis Synechocystis minuscula Bradyrhizobium jicamae Aphanizomenon flos-aquae Synechococcus spongiarum Brevundimonas basaltis Aphanizomenon gracile Synechocystis sp Brevundimonas denitrificans Aphanizomenon issatschenkoi Tolypothrix sp. Brevundimonas sp. Aphanizomenon ovalisporum Trichodesmium erythraeum Brevundimonas subvibrioides Aphanizomenon sp. IMS101 Caedibacter caryophilus Aphanothece clathrata Woronichinia naegeliana Caedibacter macronucleorum Calothrix sp Woronichinia sp. Caulobacter fusiformis Coelomoron pusillum Deinococcus gobiensis Caulobacter sp. Cuspidothrix issatschenkoi Meiothermus ruber Chelativorans sp. BNC1 241

≥97% ≥99% =100% Cyanobacterium stanieri Meiothermus silvanus Devosia ginsengisoli Cyanobium gracile Clostridium pasteurianum Haematobacter massiliensis Cyanobium sp Clostridium saccharobutylicum Mesorhizobium sp. Cyanothece sp Clostridium Methylobacterium sp Cylindrospermum catenatum saccharoperbutylacetonicum Methylocystis sp Cylindrospermum siamensis Clostridium sulfidigenes Methylosinus sp Cylindrospermum stagnale Clostridium tetani Novosphingobium barchaimii Cylindrospermum muscicola Dehalobacter restrictus Paracoccus aminophilus Dolichospermum affine Dehalobacter sp. Phenylobacterium zucineum Dolichospermum circinale Desulforudis audaxviator Polymorphum gilvum Dolichospermum crassum Enterococcus durans Pseudorhodobacter sp Dolichospermum flos-aquae Enterococcus faecalis Rhizobium etli Dolichospermum lemmermannii Enterococcus faecium Rhizobium leguminosarum Dolichospermum mendotae Lactobacillus casei Rhodobacter blasticus Dolichospermum mucosum Lactobacillus fermentum Rhodobacter capsulatus Dolichospermum planctonicum Lactobacillus pentosus Rhodobacter changlensis Dolichospermum Methylotenera mobilis Rhodobacter sp. sigmoideumDolichospermum smithii Paenibacillus polymyxa Rhodobacter sphaeroides Dolichospermum viguieri Paenibacillus sabinae Rhodovulum sp. Gloeocapsa sp Ruminococcus obeum Rhodovulum sulfidophilum Halotia longispora Staphylococcus haemolyticus Silicibacter sp. TM1040 Hydrocoryne spongiosa Staphylococcus lugdunensis Sinorhizobium meliloti Limnococcus limneticus Staphylococcus pasteuri Sphingobium sp. SYK-6 Limnoraphis robusta Staphylococcus pseudintermedius Sphingomonas sp. Lyngbya aestuarii Streptococcus pyogenes Sphingomonas wittichii Lyngbya hieronymusii Veillonella parvula Sphingopyxis alaskensis Lyngbya majuscula Weissella cibaria Sphingopyxis fribergensis Microcystis aeruginosa Gemmatimonas aurantiaca Sphingopyxis macrogoltabida Microcystis botrys Nitrospira defluvii Sphingopyxis sp Microcystis ichthyoblabe Nitrospira moscoviensis Sulfitobacter sp Microcystis panniformis Nitrospira sp. Thalassobius aestuarii Microcystis sp. Caldilinea aerophila Thalassospira xiamenensis 242

≥97% ≥99% =100% Microcystis viridis Gemmata obscuriglobus Tistrella mobilis Nodularia sphaerocarpa Gemmata sp Xanthobacter autotrophicus Nodularia spumigena Gimesia maris Accumulibacter phosphatis Nostoc azollae Pirellula staleyi Acidovorax avenae Nostoc calcicola Planctomyces brasiliensis Acidovorax citrulli Nostoc calcicola Rhodopirellula baltica Acidovorax ebreus Nostoc commune Acetobacter aceti Acidovorax facilis Nostoc ellipsosporum Acetobacter cibinongensis Acidovorax sp. JS42 Nostoc insulare Acetobacter sp Acidovorax temperans Nostoc piscinale Acetobacter tropicalis Acidovorax valerianellae Albidiferax Nostoc punctiforme Acidiphilium cryptum ferrireducensAlicycliphilus denitrificans Nostoc sp. Acidiphilium multivorum Aquabacterium sp Planktothrix agardhii Acidisoma sp Aromatoleum aromaticum EbN1 Planktothrix cryptovaginata Acidisphaera sp Azoarcus sp. Planktothrix sp Afipia sp Azospira oryzae Planktothrix suspensa Agrobacterium tumefaciens Bordetella bronchiseptica Plectolyngbya hodgsonii Agrobacterium vitis Bordetella holmesii Pleurocapsa sp Altererythrobacter epoxidivorans Burkholderia caribensis Prochlorococcus marinus Altererythrobacter marensis Burkholderia cenocepacia Pseudanabaena catenata Altererythrobacter sp Burkholderia cepacia Pseudanabaena frigida Azospirillum brasilense Burkholderia diazotrophica Pseudanabaena sp Bartonella schoenbuchensis Burkholderia pseudomallei 688 Radiocystis sp Bradyrhizobium denitrificans Burkholderia pyrrocinia Raphidiopsis curvata Bradyrhizobium japonicum Burkholderia rhizoxinica Scytonema stuposum Bradyrhizobium jicamae Burkholderia sp. Snowella litoralis Brevundimonas basaltis Burkholderia thailandensis Snowella rosea Brevundimonas denitrificans Castellaniella defragransChitinibacter sp Sphaerospermopsis aphanizomenoides Brevundimonas diminuta Chromobacterium violaceum Sphaerospermopsis kisseleviana Brevundimonas sp. Chromobacterium sp Stanieria cyanosphaera Brevundimonas subvibrioides Collimonas arenae Synechococcus elongatus Caedibacter caryophilus Collimonas fungivorans Synechococcus rubescens Caedibacter macronucleorum Comamonas koreensis 243

≥97% ≥99% =100% Synechococcus sp Caulobacter fusiformis Comamonas sp Synechocystis minuscula Caulobacter sp. Comamonas testosteroniCupriavidus basilensis Synechococcus spongiarum Chelativorans sp. BNC1 Cupriavidus necator Synechocystis sp Croceicoccus naphthovorans Cupriavidus taiwanensis Tolypothrix sp. Devosia ginsengisoli Curvibacter delicatus Trichodesmium erythraeum IMS101 Dongia rigui Dechloromonas aromatica Trichormus variabilis Gemmobacter tilapiae Dechloromonas hortensis Woronichinia naegeliana Gluconacetobacter diazotrophicus Dechlorosoma suillum Woronichinia sp. Gluconacetobacter Deefgea chitinilytica Denitrovibrio acetiphilus takamatsuzukensis Deefgea rivuli Deinococcus gobiensis Gluconacetobacter tumulisoli Delftia acidovorans Deinococcus maricopensis Granulibacter bethesdensis Delftia sp Deinococcus radiodurans Haematobacter massiliensis Duganella sp Meiothermus ruber Komagataeibacter xylinus Gallionella capsiferriformans Meiothermus silvanus Mesorhizobium sp. Herbaspirillum autotrophicum Oceanithermus profundus Methylobacterium adhaesivum Herbaspirillum hiltneri Bacillus circulans Methylobacterium sp Herbaspirillum lusitanum Clostridium cavendishii Methylocystis sp Herbaspirillum seropedicae Clostridium disporicum Methylosinus sp Herminiimonas arsenicoxydans Clostridium pasteurianum Novosphingobium aromaticivorans Herminiimonas sp Clostridium saccharobutylicum Novosphingobium barchaimii Iodobacter fluviatilis Clostridium Paracoccus aminophilus Iodobacter sp. saccharoperbutylacetonicum Paraherbaspirillum soli Janthinobacterium agaricidamnosum Clostridium sulfidigenes Phenylobacterium zucineum Janthinobacterium lividum Clostridium tetani Polymorphum gilvum Janthinobacterium sp Dehalobacter restrictus Pseudorhodobacter sp Leptothrix cholodnii Dehalobacter sp. Rhizobium etli Leptothrix sp. Desulfitobacterium dichloroeliminans Rhizobium leguminosarum Limnohabitans sp Desulfitobacterium hafniense Rhodobacter blasticus Massilia aurea Desulforudis audaxviator Rhodobacter capsulatus Massilia sp Desulfotomaculum ruminis Rhodobacter changlensis Methylibium petroleiphilum Enterococcus durans Rhodobacter megalophilus Methylibium sp 244

≥97% ≥99% =100% Enterococcus faecalis Rhodobacter sp. Methylobacillus flagellatus Enterococcus faecium Rhodobacter sphaeroides Methylotenera mobilis Lactobacillus casei Rhodopseudomonas palustris Methylotenera versatilis Lactobacillus fermentum Rhodovulum sp. Methyloversatilis universalis Lactobacillus pentosus Rhodovulum sulfidophilum Methylovorus glucosetrophus Methylotenera mobilis Roseomonas lacus Methylopumilus planktonicus Paenibacillus polymyxa Silicibacter sp. TM1040 Methylovorus sp Paenibacillus sabinae Sinorhizobium meliloti Methylopumilus turicensis Ruminococcus obeum Sphingobium sp. SYK-6 Mitsuaria chitosanitabida Sporosarcina aquimarina Sphingomonas sp. Neisseria gonorrheae Sporosarcina newyorkensis Sphingomonas taxi Neisseria lactamica Staphylococcus haemolyticus Sphingomonas wittichii Neisseria meningitidis Staphylococcus lugdunensis Sphingopyxis alaskensis Nitrosomonas communis Staphylococcus pasteuri Sphingopyxis fribergensis Nitrosomonas eutropha Staphylococcus pseudintermedius Sphingopyxis macrogoltabida Nitrosomonas sp. Streptococcus pyogenes Sphingopyxis sp Nitrosospira briensis Veillonella parvula Sphingorhabdus planktonica Nitrosospira multiformis Weissella cibaria Sulfitobacter sp Noviherbaspirillum canariense Gemmatimonas aurantiaca Thalassobius aestuarii Pandoraea pnomenusa Nitrospira defluvii Thalassospira xiamenensis Pandoraea pulmonicola Nitrospira moscoviensis Tistrella mobilis Pelomonas puraquae Nitrospira sp. Xanthobacter autotrophicus Paucibacter toxinivorans Polaromonas Anammoximicrobium moscowii Zymomonas mobilis hydrogenivorans Caldilinea aerophila Accumulibacter phosphatis Polaromonas naphthalenivorans Gemmata obscuriglobus Acidovorax avenae Polaromonas sp Gemmata sp Acidovorax citrulli Polynucleobacter necessarius Gimesia maris Acidovorax delafieldii Pseudogulbenkiania sp Isosphaera pallida Acidovorax ebreus Profftella armatura Pirellula staleyi Acidovorax facilis Pusillimonas sp Planctomyces brasiliensis Acidovorax sp. JS42 Ralstonia eutropha H16 Planctomyces limnophilus Acidovorax temperans Ralstonia mannitolilyticaRalstonia pickettii Rhodopirellula baltica Acidovorax valerianellae Rhodoferax ferrireducens 245

≥97% ≥99% =100% Singulisphaera acidiphila Albidiferax ferrireducens Rhodoferax sp. Acetobacter aceti Alicycliphilus denitrificans Roseateles terrae Acetobacter cibinongensis Aquabacterium sp Rubrivivax gelatinosus Acetobacter europaeus Aquincola tertiaricarbonis Rubrivivax benzoatilyticus Acetobacter pasteurianus Aromatoleum aromaticum EbN1 Sideroxydans lithotrophicus Acetobacter sp Azoarcus sp. Sulfuricella denitrificans Acetobacter tropicalis Azospira oryzae Sulfurisoma sediminicolaSulfuritalea Acidiphilium cryptum Azospira sp hydrogenivorans Acidiphilium multivorum Basilea psittacipulmonis Thiobacillus denitrificans Thiomonas intermedia Acidisoma sp Bordetella bronchiseptica Thiomonas sp. Acidisphaera sp Bordetella hinzii Undibacterium oligocarboniphilum Afipia sp Bordetella holmesii Undibacterium seohonense Agrobacterium tumefaciens Bordetella pertussis Undibacterium sp Agrobacterium vitis Bordetella petrii Variovorax boronicumulans Altererythrobacter epoxidivorans Burkholderia caribensis Variovorax ginsengisoli Altererythrobacter marensis Burkholderia cenocepacia Variovorax paradoxus Altererythrobacter sp Burkholderia cepacia Variovorax soli Asaia lannensis Burkholderia diazotrophica Verminephrobacter eiseniae Asaia siamensis Burkholderia multivorans Aeromonas veronii Asticcacaulis excentricus Burkholderia pseudomallei 688 Agarivorans gilvus Aureimonas altamirensis Burkholderia pyrrocinia Allochromatium vinosum Aureimonas frigidaquae Burkholderia rhizoxinica Alteromonas macleodii Azospirillum brasilense Burkholderia sp. Citrobacter freundii Bartonella quintana Burkholderia thailandensis Competibacter phosphatis Bartonella schoenbuchensis Castellaniella defragrans Congregibacter litoralis Beijerinckia indica Chitinibacter sp Cronobacter malonaticus Bradyrhizobium denitrificans Chromobacterium violaceum Cronobacter sakazakii Bradyrhizobium elkanii Chromobacterium sp Dickeya dadantii Bradyrhizobium japonicum Collimonas arenae Dyella japonica Bradyrhizobium jicamae Collimonas fungivorans Dyella jiangningensis Brevundimonas basaltis Collimonas sp. Enterobacter asburiae Brevundimonas denitrificans Comamonas koreensis Frateuria aurantia 246

≥97% ≥99% =100% Brevundimonas diminuta Comamonas sp Gynuella sunshinyii Brevundimonas intermedia Comamonas testosteroni Haemophilus ducreyi Brevundimonas sp. Cupriavidus basilensis Haemophilus parasuis Brevundimonas subvibrioides Cupriavidus metallidurans Halomonas sp Brevundimonas vesicularis Cupriavidus necator Halomonas variabilis Brevundimonas viscosa Cupriavidus taiwanensis Halorhodospira halochloris Caedibacter caryophilus Curvibacter delicatus Kushneria indalinina Caedibacter macronucleorum Dechloromonas aromatica Legionella jeonii Caedibacter acanthamoebae Dechloromonas hortensis Legionella oakridgensis Caulobacter crescentus Dechloromonas sp. Marichromatium purpuratum Caulobacter fusiformis Dechlorosoma suillum Marinobacter sp. Caulobacter segnis Deefgea chitinilytica Marinobacter psychrophilus Caulobacter sp. Deefgea rivuli Methylomicrobium alcaliphilum Caulobacter vibrioides Deefgea sp Methylomonas methanica Chelativorans sp. BNC1 Delftia acidovorans Modicisalibacter tunisiensis Croceicoccus naphthovorans Delftia sp Nitrosococcus oceani Devosia ginsengisoli Duganella sp Nitrosococcus watsoni Dongia rigui Gallionella capsiferriformans Pasteurella multocida Ensifer adhaerens Herbaspirillum autotrophicum Pseudoalteromonas haloplanktis Erythrobacter sp. Herbaspirillum chlorophenolicum Pseudoalteromonas sp Gemmobacter tilapiae Herbaspirillum hiltneri Pseudomonas alkylphenolia Gluconacetobacter diazotrophicus Herbaspirillum huttiense Pseudomonas brassicacearum Gluconacetobacter xylinus Herbaspirillum lusitanum Pseudomonas cichorii Gluconacetobacter takamatsuzukensis Herbaspirillum rubrisubalbicans Pseudomonas deceptionensis Gluconacetobacter tumulisoli Herbaspirillum seropedicae Pseudomonas fulva Granulibacter bethesdensis Herminiimonas arsenicoxydans Pseudomonas knackmussi Haematobacter massiliensis Herminiimonas sp Pseudomonas mandelii Hyphomicrobium denitrificans Hydrogenophaga sp Pseudomonas protegensPseudomonas Hyphomicrobium vulgare Hylemonella gracilis resinovorans Hyphomicrobium nitrativorans Hylemonella sp. Pseudomonas trivialis Ketogulonicigenium vulgare Ideonella dechloratans Pseudoxanthomonas spadix Komagataeibacter medellinensis Iodobacter fluviatilis Pseudoxanthomonas suwonensis 247

≥97% ≥99% =100% Komagataeibacter xylinus Iodobacter sp. Psychrobacter sp Magnetospirillum gryphiswaldense Janthinobacterium Rhodanobacter denitrificans Magnetospirillum magneticum agaricidamnosum Saccharophagus degradans Magnetococcus marinus Janthinobacterium lividum Salmonella enterica Mesorhizobium australicum Janthinobacterium sp Shewanella sp. Mesorhizobium ciceri Kinetoplastibacterium desouzaii Shigella boydii Mesorhizobium huakuii Leptothrix cholodnii Shigella sonnei Mesorhizobium opportunistum Leptothrix sp. Stenotrophomonas acidaminiphila Mesorhizobium sp. Limnohabitans sp Stenotrophomonas rhizophila Methylobacterium adhaesivum Massilia aurea Teredinibacter turnerae Methylobacterium extorquens Massilia sp Thioalkalivibrio nitratireducens Methylobacterium gnaphalii Methylibium petroleiphilum Thioalkalivibrio paradoxus Methylobacterium oryzae Methylibium sp Thioalkalivibrio versutus Methylobacterium populi Methylobacillus flagellatus Thiocystis violascens Methylobacterium radiotolerans Methylotenera mobilis Thioploca ingrica Methylobacterium sp Methylotenera versatilis Thioploca sp. Methyloceanibacter caenitepidi Methyloversatilis universalis Variovorax sp Methylocystis sp Methylovorus glucosetrophus Vibrio cholerae Methylosinus sp Methylopumilus planktonicus Vibrio parahaemolyticus Nitrobacter hamburgensis Methylovorus sp Yersinia pestis Nitrobacter winogradskyi Methylopumilus turicensis Zymobacter palmae Novosphingobium aromaticivorans Mitsuaria chitosanitabida Anaeromyxobacter dehalogenans Novosphingobium barchaimii Neisseria gonorrheae Chondromyces crocatus Novosphingobium pentaromativorans Neisseria lactamica Desulfatibacillum alkenivorans Nordella oligomobilis Neisseria meningitidis Desulfobacca acetoxidans Nucleicultrix amoebiphila Nitrosomonas communis Desulfobacula toluolica Oligotropha carboxidovorans Nitrosomonas europaea Geobacter bemidjiensis Paracoccus aminophilus Nitrosomonas eutropha Geobacter pickeringii Paraherbaspirillum soli Nitrosomonas sp. Geobacter sp. Parvibaculum lavamentivorans Nitrosospira briensis Geoalkalibacter subterraneus Pelagibacterium halotolerans Nitrosospira multiformis Geobacter sulfurreducens Phenylobacterium lituiforme Noviherbaspirillum canariense Haliangium ochraceum 248

≥97% ≥99% =100% Phenylobacterium zucineum Pandoraea apista Labilithrix luteola Phycosocius bacilliformis Pandoraea oxalativorans Pelobacter carbinolicus Polymorphum gilvum Pandoraea pnomenusa Pelobacter propionicus Pseudorhodobacter antarcticus Pandoraea pulmonicola Aminobacterium colombiense Pseudorhodobacter ferrugineus Pelomonas puraquae Mycoplasma putrefaciens Pseudorhodobacter sp Paucibacter toxinivorans Bacterium Ellin Pseudovibrio sp Piscinibacter aquaticus Chthoniobacter flavus Rhizobium etli Polaromonas hydrogenivorans Prosthecobacter debontii Rhizobium leguminosarum Polaromonas naphthalenivorans Prosthecobacter dejongeii Rhizobium phenanthrenilyticum Polaromonas sp Prosthecobacter fusiformis Rhodobacter azotoformans Polynucleobacter difficilis Prosthecobacter vanneerveni Rhodobacter blasticus Polynucleobacter necessarius Rhodobacter capsulatus Pseudogulbenkiania sp Rhodobacter changlensis Profftella armatura Rhodobacter megalophilus Pusillimonas sp Rhodobacter sp. Ralstonia eutropha H16 Rhodobacter sphaeroides Ralstonia mannitolilytica Rhodopseudomonas palustris Ralstonia pickettii Rhodospirillum centenum Ralstonia solanacearum Rhodospirillum photometricum Ralstonia syzygii Rhodovulum sp. Ramlibacter tataouinensis Rhodovulum sulfidophilum Rhizobacter dauci Rickettsia limoniae Rhodocyclus purpureus Roseibacterium elongatum Rhodoferax ferrireducens Roseobacter sp. Rhodoferax sp. Roseomonas lacus Roseateles terrae Roseomonas riguiloci Rubrivivax gelatinosus Roseospira sp. Ber2104 Rubrivivax benzoatilyticus Sandarakinorhabdus limnophila Sideroxydans lithotrophicus Silicibacter sp. TM1040 Simplicispira metamorpha Sinorhizobium meliloti Sphaerotilus montanus Sphingobium chlorophenolicum Sulfuricella denitrificans 249

≥97% ≥99% =100% Sphingobium chungbukense Sulfurisoma sediminicola Sphingobium sp. SYK-6 Sulfuritalea hydrogenivorans Sphingomonas sanxanigenens Tepidimonas sp. Sphingomonas sp. Thauera sp. Sphingomonas taxi Thiobacillus denitrificans Sphingomonas wittichii Thiomonas intermedia Sphingopyxis alaskensis Thiomonas sp. Sphingopyxis fribergensis Undibacterium oligocarboniphilum Sphingopyxis macrogoltabida Undibacterium parvum Sphingopyxis sp Undibacterium pigrum Sphingorhabdus planktonica Undibacterium seohonense Starkeya novella Undibacterium sp Sulfitobacter sp Variovorax boronicumulans Thalassobius aestuarii Variovorax ginsengisoli Thalassospira xiamenensis Variovorax paradoxus Tistrella mobilis Variovorax soli Woodsholea maritima Verminephrobacter eiseniae Xanthobacter autotrophicus Xylophilus ampelinus Zymomonas mobilis Zoogloea sp. Accumulibacter phosphatis Acinetobacter guillouiae Acidovorax avenae Aeromonas veronii Acidovorax citrulli Agarivorans gilvus Acidovorax delafieldii Aggregatibacter aphrophilus Acidovorax ebreus Alcanivorax dieselolei Acidovorax facilis Alcanivorax sp Acidovorax sp. JS42 Allochromatium vinosum Acidovorax temperans Alteromonas macleodii Acidovorax valerianellae Beggiatoa leptomitiformis Advenella kashmirensis Chromatocurvus halotolerans Advenella mimigardefordensis Citrobacter freundii Albidiferax ferrireducens Competibacter phosphatis Alcaligenes faecalis Congregibacter litoralis 250

≥97% ≥99% =100% Alicycliphilus denitrificans Cronobacter malonaticus Aquabacterium sp Cronobacter sakazakii Aquincola tertiaricarbonis Cycloclasticus sp Aquitalea denitrificans Cycloclasticus zancles Aromatoleum aromaticum EbN1 Dickeya dadantii Azoarcus sp. Dyella japonica Azospira oryzae Dyella jiangningensis Azospira sp Enterobacter asburiae Basilea psittacipulmonis Frateuria aurantia Bordetella avium Gynuella sunshinyii Bordetella bronchiseptica Haemophilus ducreyi Bordetella hinzii Haemophilus parainfluenzae Bordetella holmesii Haemophilus parasuis Bordetella pertussis Haliea sp Bordetella petrii Halomonas halocynthiae Burkholderia caribensis Halomonas sp Burkholderia cenocepacia Halomonas variabilis Burkholderia cepacia Halorhodospira halochloris Burkholderia diazotrophica Kushneria indalinina Burkholderia fungorum Legionella jeonii Burkholderia multivorans Legionella longbeachae Burkholderia phymatum Legionella oakridgensis Burkholderia phytofirmans Legionella pneumophila Burkholderia pseudomallei 688 Legionella sp. (Amoebal pathogen) Burkholderia pyrrocinia Leucothrix mucor Marinobacter Burkholderia rhizoxinica Lysobacter brunescens Burkholderia sp. Lysobacter sp Burkholderia thailandensis Marichromatium purpuratum Burkholderia xenovorans Marinobacter sp. Castellaniella defragrans Marinobacter psychrophilus Chitinibacter sp Methylobacter psychrophilus Chitinibacter suncheonensis Methylococcus capsulatus 251

≥97% ≥99% =100% Chitinibacter tainanensis Methylomicrobium alcaliphilum Chromobacterium violaceum Methylomonas methanica Chromobacterium sp Methylophaga sp Collimonas arenae Methylosarcina lacus Collimonas fungivorans Modicisalibacter tunisiensis Collimonas sp. Nitrosococcus oceani Comamonas koreensis Nitrosococcus watsoni Comamonas sp Oceanimonas sp Comamonas testosteroni Pasteurella multocida Cupriavidus basilensis Plesiomonas shigelloides Cupriavidus metallidurans Pseudoalteromonas haloplanktis Cupriavidus necator Pseudoalteromonas sp Cupriavidus taiwanensis Pseudomonas alkylphenolia Curvibacter delicatus Pseudomonas brassicacearum Dechloromonas aromatica Pseudomonas cichorii Dechloromonas hortensis Pseudomonas deceptionensis Dechloromonas sp. Pseudomonas denitrificans Dechlorosoma suillum Pseudomonas fulva Deefgea chitinilytica Pseudomonas knackmussi Deefgea rivuli Pseudomonas mandelii Deefgea sp Pseudomonas pseudoalcaligenes Delftia acidovorans Pseudomonas psychrophila Delftia sp Pseudomonas poae Denitratisoma oestradiolicum Pseudomonas protegens Duganella sp Pseudomonas resinovorans Gallionella capsiferriformans Pseudoxanthomonas icgebensis Herbaspirillum autotrophicum Pseudomonas trivialis Herbaspirillum chlorophenolicum Pseudoxanthomonas spadix Herbaspirillum frisingense Pseudoxanthomonas suwonensis Herbaspirillum hiltneri Psychrobacter sanguinis Herbaspirillum huttiense Psychrobacter sp Herbaspirillum lusitanum Rhodanobacter denitrificans 252

≥97% ≥99% =100% Herbaspirillum rubrisubalbicans Saccharophagus degradans Herbaspirillum seropedicae Salmonella enterica Herbaspirillum sp Shewanella halifaxensis Herminiimonas arsenicoxydans Shewanella pealeana Herminiimonas sp Shewanella sp. Hydrogenophaga sp Shigella boydii Hylemonella gracilis Shigella sonnei Hylemonella sp. Sodalis pierantonius Inhella inkyongensis Stenotrophomonas acidaminiphila Ideonella dechloratans Stenotrophomonas rhizophila Iodobacter arcticus Sulfuricaulis limicola Iodobacter fluviatilis Teredinibacter turnerae Iodobacter sp. Thalassolituus oleivorans Janthinobacterium agaricidamnosum Thioalkalivibrio nitratireducens Janthinobacterium lividum Thioalkalivibrio paradoxus Janthinobacterium sp Thioalkalivibrio sp Kerstersia gyiorum Thioalkalivibrio sulfidophilus Kinetoplastibacterium desouzaii Thioalkalivibrio versutus Kingella potus Thiocystis violascens Laribacter hongkongensis Thioploca ingrica Leptothrix cholodnii Thioploca sp. Leptothrix sp. Variovorax sp Limnohabitans planktonicus Vibrio cholerae Limnohabitans sp Vibrio parahaemolyticus Massilia aurea Wenzhouxiangella marina Massilia sp Westeberhardia cardiocondylae Massilia varians Xanthomonas albilineans Methylibium petroleiphilum Xanthomonas arboricola Methylibium sp Xanthomonas citri Methylobacillus flagellatus Xanthomonas fuscans Methylotenera mobilis Xanthomonas oryzae Methylotenera versatilis Xylella fastidiosa 253

≥97% ≥99% =100% Methyloversatilis universalis Yersinia pestis Methylovorus glucosetrophus Zymobacter palmae Methylopumilus planktonicus Anaeromyxobacter dehalogenans Methylovorus sp Chondromyces crocatus Methylopumilus turicensis Desulfobacca acetoxidans Mitsuaria chitosanitabida Desulfobacula toluolica Neisseria gonorrheae Desulfomonile tiedjei Neisseria lactamica Geobacter bemidjiensis Neisseria meningitidis Geobacter pickeringii Nitrosomonas communis Geobacter sp. Nitrosomonas europaea Geoalkalibacter subterraneus Nitrosomonas eutropha Geobacter sulfurreducens Nitrosomonas sp. Haliangium ochraceum Nitrosospira briensis Labilithrix luteola Nitrosospira multiformis Pelobacter carbinolicus Nitrotoga arctica Pelobacter propionicus Noviherbaspirillum canariense Aminobacterium colombiense Pandoraea apista Mycoplasma putrefaciens Pandoraea oxalativorans Bacterium Ellin Pandoraea pnomenusa Chthoniobacter flavus Pandoraea pulmonicola Prosthecobacter debontii Pandoraea sputorum Prosthecobacter dejongeii Pelomonas puraquae Prosthecobacter fusiformis Pandoraea thiooxydans Prosthecobacter vanneervenii Paucibacter toxinivorans Verrucomicrobium spinosum Piscinibacter aquaticus Polaromonas hydrogenivorans Polaromonas naphthalenivorans Polaromonas sp Polynucleobacter difficilis Polynucleobacter necessarius Pseudogulbenkiania sp 254

≥97% ≥99% =100% Profftella armatura Pusillimonas sp Ralstonia eutropha H16 Ralstonia mannitolilytica Ralstonia pickettii Ralstonia solanacearum Ralstonia syzygii Ramlibacter tataouinensis Rhizobacter dauci Rhodocyclus purpureus Rhodoferax ferrireducens Rhodoferax sp. Roseateles depolymerans Roseateles terrae Rubrivivax gelatinosus Rubrivivax benzoatilyticus Sideroxydans lithotrophicus Silvimonas sp Simplicispira metamorpha Snodgrassella alvi Sphaerotilus montanus Sphaerotilus natans Sulfuricella denitrificans Sulfurisoma sediminicola Sulfuritalea hydrogenivorans Taylorella equigenitalis Taylorella asinigenitalis Tepidimonas sp. Thauera sp. Thiobacillus denitrificans Thiobacillus thioparus Thiomonas delicata 255

≥97% ≥99% =100% Thiomonas intermedia Thiomonas sp. Undibacterium oligocarboniphilum Undibacterium parvum Undibacterium pigrum Undibacterium seohonense Undibacterium sp Undibacterium terreum Variovorax boronicumulans Variovorax ginsengisoli Variovorax paradoxus Variovorax soli Verminephrobacter eiseniae Vogesella perlucida Xenophilus azovorans Xylophilus ampelinus Zoogloea sp. Achromatium minus Acinetobacter guillouiae Aeromonas veronii Agarivorans gilvus Aggregatibacter aphrophilus Alcanivorax dieselolei Alcanivorax sp Algoriphagus aquatilis Allochromatium vinosum Alteromonas australica Alteromonas macleodii Aquicella siphonis Arsenophonus endosymbiont Beggiatoa leptomitiformis Beggiatoa sp. 256

≥97% ≥99% =100% Cardiobacterium hominis Cellvibrio japonicus Chromatocurvus halotolerans Citrobacter freundii Competibacter phosphatis Congregibacter litoralis Coxiella burnetii Cronobacter malonaticus Cronobacter sakazakii Cycloclasticus sp Cycloclasticus zancles Dichelobacter nodosus Dickeya dadantii Dickeya zeae Dyella japonica Dyella jiangningensis Enterobacter aerogenes Enterobacter asburiae Francisella cf. novicida Francisella noatunensis Frateuria aurantia Francisella tularensis Gynuella sunshinyii Haemophilus ducreyi Haemophilus parainfluenzae Haemophilus parasuis Hahella chejuensis Haliea sp Halomonas alimentaria Halomonas halocynthiae Halomonas halophila Halomonas organivorans 257

≥97% ≥99% =100% Halomonas phosphatis Halomonas salina Halomonas sp Halomonas variabilis Halorhodospira halochloris Halorhodospira halophila SL1 Halothiobacillus neapolitanus Idiomarina loihiensis Klebsiella michiganensis Kushneria indalinina Legionella anisa Legionella hackeliae Legionella jeonii Legionella longbeachae Legionella oakridgensis Legionella pneumophila Legionella sp. (Amoebal pathogen) Leucothrix mucor Marinobacter Listonella anguillarum Lysobacter brunescens Lysobacter daecheongensis Lysobacter sp Marichromatium purpuratum Marinobacter aquaeolei Marinobacter salarius Marinobacter hydrocarbonoclasticus Marinobacter sp. Marinobacter psychrophilus Methylobacter psychrophilus Methylocaldum marinum Methylocaldum sp Methylococcus capsulatus 258

≥97% ≥99% =100% Methylomicrobium alcaliphilum Methylomonas methanica Methylomonas sp. Methylophaga sp Methylophaga nitratireducenticrescens Methylosarcina lacus Modicisalibacter tunisiensis Nitrosococcus oceani Nitrosococcus watsoni Oceanimonas sp Pasteurella multocida Photobacterium damselae Photobacterium profundum Plesiomonas shigelloides Proteus mirabilis Proteus vulgaris Pseudoalteromonas haloplanktis Pseudoalteromonas sp Pseudomonas alkylphenolia Pseudomonas balearica Pseudomonas brassicacearum Pseudomonas cichorii Pseudomonas deceptionensis Pseudomonas denitrificans Pseudomonas fulva Pseudomonas knackmussi Pseudomonas koreensis Pseudomonas mandelii Pseudomonas pseudoalcaligenes Pseudomonas psychrophila Pseudomonas poae Pseudomonas protegens 259

≥97% ≥99% =100% Pseudomonas resinovorans Pseudomonas rhizosphaerae Pseudomonas savastanoi Pseudoxanthomonas icgebensis Pseudomonas trivialis Pseudoxanthomonas sp Pseudoxanthomonas spadix Pseudoxanthomonas suwonensis Psychrobacter aquaticus Psychrobacter faecalis Psychrobacter frigidicola Psychrobacter glacincola Psychrobacter luti Psychrobacter pulmonis Psychrobacter sanguinis Psychrobacter sp Rahnella aquatilis Rahnella sp Rhodanobacter denitrificans Saccharophagus degradans Salinicola peritrichatus Salmonella enterica Serratia fonticola Serratia liquefaciens Serratia marcescens Serratia symbiotica Shewanella halifaxensis Shewanella pealeana Shewanella sp. Shigella boydii Shigella sonnei Shimwellia blattae 260

≥97% ≥99% =100% Simiduia agarivorans Sodalis pierantonius Spiribacter salinus Stenotrophomonas acidaminiphila Stenotrophomonas rhizophila Sulfuricaulis limicola Teredinibacter turnerae Thalassolituus oleivorans Thioalkalivibrio nitratireducens Thioalkalivibrio paradoxus Thioalkalivibrio sp Thioalkalivibrio sulfidophilus Thioalkalivibrio versutus Thiocystis violascens Thioflavicoccus mobilis Thiomargarita sp Thioploca ingrica Thioploca sp. Tolumonas auensis Variovorax sp Vibrio alginolyticus Vibrio anguillarum Vibrio cholerae Vibrio nigripulchritudo Vibrio parahaemolyticus Wenzhouxiangella marina Westeberhardia cardiocondylae Xanthomonas albilineans Xanthomonas arboricola Xanthomonas citri Xanthomonas fuscans Xanthomonas oryzae 261

≥97% ≥99% =100% Xanthomonas sacchari Xanthomonas translucens Xylella fastidiosa Yersinia enterocolitica Yersinia pestis Zymobacter palmae Anaeromyxobacter dehalogenans Bdellovibrio bacteriovorus Bdellovibrio exovorus Bdellovibrio sp. Corallococcus coralloides Chondromyces apiculatus Chondromyces crocatus Chondromyces pediculatus Deferrisoma camini Desulfatibacillum alkenivorans Desulfobacca acetoxidans Desulfobacula toluolica Desulfobulbus propionicus Desulfocapsa sulfexigens Desulfohalobium retbaense Desulfomonile tiedjei Desulfotalea psychrophila Enhygromyxa salina Geobacter bemidjiensis Geobacter daltonii Geobacter pickeringii Geobacter sp. Geoalkalibacter subterraneus Geobacter sulfurreducens Haliangium ochraceum Jahnella thaxteri 262

≥97% ≥99% =100% Labilithrix luteola Nannocystis exeden Pelobacter carbinolicus Pelobacter propionicus Sulfuricurvum sp Syntrophus aciditrophicus Sulfurimonas denitrificans Sulfuricurvum kujiense Spirochaeta sp. Aminobacterium colombiense Mycoplasma putrefaciens Spiroplasma kunkelii Mesotoga prima Sulfurihydrogenibium sp Akkermansia muciniphila Bacterium Ellin Chthoniobacter flavus Methylacidiphilum fumariolicum Methylacidiphilum infernorum Prosthecobacter debontii Prosthecobacter dejongeii Prosthecobacter fusiformis Prosthecobacter vanneervenii Protochlamydia amoebophila Verrucomicrobium spinos

263

APPENDIX C. EUKARYAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99% AND 100%

≥97% ≥99% =100

Acavomonas peruviana Acineta flava Acineta flava Acineta flava Amphisiella pulchra Antiokeronopsis flava Amphisiella pulchra Antiokeronopsis flava Campanella umbellaria Anteholosticha monilata Arcuospathidium namibiense Durinskia baltica Antiokeronopsis flava Campanella umbellaria Gymnodinium catenatum Arcuospathidium namibiense Diophrys japonica Hypotrichida sp Campanella umbellaria Durinskia baltica Oxytricha granulifera Carchesium polypinum Gymnodinium catenatum Paraurostyla viridis Cryptocaryon irritans Hypotrichida sp Peridiniopsis niei Diophrys japonica Oxytricha granulifera Peridiniopsis penardii Diophrys oligothrix Paraurostyla viridis Stentor muelleri Durinskia baltica Peridiniopsis niei Stentor roeselii Gymnodinium aureolum Peridiniopsis penardii Stylonychia Mytilus Gymnodinium catenatum Peridinium aciculiferum Acanthamoeba polyphaga Hypotrichida sp Peridinium baicalense Acanthamoeba sp Lagynophrya acuminata Peridinium euryceps Dictyostelium fasciculatum Oxytricha granulifera Perisincirra paucicirrata Vermamoeba vermiformis Paramecium tetraurelia Pfiesteria piscicida Nutomonas howeae Paraurostyla viridis Plasmodium cynomolgi Chlamydaster sterni Peridiniopsis niei Scrippsiella hangoei Cryptomonas tetrapyrenoidosa Peridiniopsis penardii Spathidium amphoriforme Goniomonas avonlea Peridinium aciculiferum Spathidium rectitoratum Goniomonas truncata Peridinium baicalense Stentor muelleri Storeatula sp Peridinium euryceps Stentor roeselii Alternaria alternata Perisincirra paucicirrata Stylonychia Mytilus Bacidia rosella Pfiesteria piscicida Acanthamoeba polyphaga Bipolaris maydis Phialina salinarum Acanthamoeba sp Bipolaris microstegii Philaster apodigitiformis Dictyostelium fasciculatum Bipolaris sorokiniana Plasmodium cynomolgi Vermamoeba vermiformis Botrytis cinerea 264

≥97% ≥99% =100

Prorocentrum micans Nutomonas howeae Cladophialophora carrionii Scrippsiella hangoei Chlamydaster sterni Cladophialophora yegresii Spathidium amphoriforme Cryptomonas marssonii Cladosporium bruhnei Spathidium rectitoratum Cryptomonas obovata Cladosporium sphaerospermum Stentor muelleri Cryptomonas curvata Colletotrichum graminícola Stentor roeselii Cryptomonas marssonii Curvularia fallax Sterkiella histriomuscorum Cryptomonas parapyrenoidifera Endocarpon pusillum Stylonychia Mytilus Cryptomonas tetrapyrenoidosa Fumiglobus pieridicola Uronemella parafilificum Goniomonas avonlea Gaeumannomyces graminis Vorticella microstoma Goniomonas truncata Kluyveromyces marxianus Acanthamoeba polyphaga Plagioselmis nannoplanctica Leptosphaeria maculans Acanthamoeba sp Rhodomonas minuta Leptosphaeria doliolum Dictyostelium fasciculatum Storeatula sp Marssonina brunnea Dictyostelium discoideum Teleaulax amphioxeia Millerozyma farinosa Mastigella erinacea Alternaria alternata Neofusicoccum parvum Paraflabellula hoguae Aureobasidium pullulans Neosetophoma clematidis Pseudoparamoeba pagei Bacidia rosella Pseudogymnoascus destructans Rhizamoeba sp Bipolaris maydis Rasamsonia emersonii Vermamoeba vermiformis Bipolaris microstegii Rhinocladiella mackenziei Apusomonas proboscidea Bipolaris sorokiniana Thielavia terrestris Nutomonas howeae Botrytis cinerea Anthracocystis flocculosa Chlamydaster sterni Cladophialophora carrionii Auricularia subglabra Cryptomonas marssonii Cladophialophora yegresii Candelabrochaete africana Cryptomonas obovata Cladosporium bruhnei Coltricia crassa Cryptomonas curvata Cladosporium sphaerospermum Coltriciella globosa Cryptomonas marssonii Colletotrichum graminícola Coniophora puteana Cryptomonas parapyrenoidifera Curvularia fallax Heterobasidion irregulare Cryptomonas tetrapyrenoidosa Endocarpon pusillum Inocybe maculata Goniomonas avonlea Epicoccum nigrum Punctularia strigosozonata Goniomonas truncata Fumiglobus pieridicola Scytinopogon havencampii Guillardia theta Gaeumannomyces graminis Sporisorium scitamineum 265

≥97% ≥99% =100

Plagioselmis nannoplanctica Kluyveromyces marxianus Tilletiopsis cremea Rhodomonas minuta Leptosphaeria maculans Tilletiopsis lilacina Storeatula sp Leptosphaeria doliolum Tilletiopsis washingtonensis Teleaulax amphioxeia Marssonina brunnea Tremella mesenterica Alternaria alternata Millerozyma farinosa Paraphysoderma sedebokerense Ascoidea rubescens Neofusicoccum parvum Gromochytrium mamkaevae Aureobasidium namibiae Neosetophoma clematidis Circinella simplex Aureobasidium pullulans Pseudocercospora angolensis Circinella umbellata Bacidia rosella Pseudogymnoascus destructans Kuzuhaea moniliformis Bipolaris maydis Rasamsonia emersonii Eiseniona gerardoi Bipolaris microstegii Rhinocladiella mackenziei Arctodiaptomus sp Bipolaris sorokiniana Thielavia terrestris Bombus impatiens Botrytis cinerea Anthracocystis flocculosa Calanus hyperboreus Candida glucosophila Auricularia subglabra Cimex lectularius Capronia coronata Candelabrochaete africana Copidosoma floridanum Cladophialophora carrionii Coltricia crassa Cyclops insignis Cladophialophora yegresii Coltriciella globosa Daphnia dentifera Cladosporium bruhnei Coniophora puteana Daphnia dubia Cladosporium delicatulum Heterobasidion irregulare Daphnia magna Cladosporium sphaerospermum Hypsizygus marmoreus Daphnia pulex Colletotrichum graminícola Inocybe maculata Daphnia pulicaria Curvularia fallax Punctularia strigosozonata Daphniopsis ephemeralis Dermatocarpon miniatum Scytinopogon havencampii Darcythompsonia fairliensis Endocarpon pusillum Sporisorium scitamineum Drosophila busckii Epicoccum nigrum Tilletiopsis cremea Eodiaptomus wolterecki Fumiglobus pieridicola Tilletiopsis lilacina Eudiaptomus graciloides Gaeumannomyces graminis Tilletiopsis washingtonensis Hemidiaptomus sp Kluyveromyces marxianus Tremella mesenterica Pseudothericles compressifrons Leptosphaeria biglobosa Paraphysoderma sedebokerense Solenopsis invicta Leptosphaeria maculans Gromochytrium mamkaevae Systolederus spicupennis Leptosphaeria doliolum Sacculospora baltica Tigriopus californicus 266

≥97% ≥99% =100

Marssonina brunnea Barbatospora ambicaudata Lingula rostrum Millerozyma farinosa Circinella simplex Balaenoptera acutorostrata Neofusicoccum parvum Circinella umbellata Callorhinchus milii Neosetophoma clematidis Kuzuhaea moniliformis Chelonia mydas Paraconiothyrium lycopodinum Eiseniona gerardoi Chinchilla lanigera Paraconiothyrium polonense Helobdella robusta Corbula tunicata Peltula obscurans Leodamas dubia Danio rerio Pseudocercospora angolensis Anomalocera patersoni Dicentrarchus labrax Pseudogymnoascus destructans Arctodiaptomus sp Ictidomys tridecemlineatus Rasamsonia emersonii Boeckella sp Jaculus jaculus Rhinocladiella mackenziei Bombus impatiens Lepisosteus oculatus Stenocarpella maydis Calanus finmarchicus Macaca mulatta Thielavia terrestris Calanus hyperboreus Monodelphis domestica Tuber aestivum Candona candida Ornithorhynchus anatinus Anthracocystis flocculosa Cimex lectularius Oryzias latipes Auricularia subglabra Copidosoma floridanum Otolemur garnettii Candelabrochaete africana Cyclopidae sp Phodopus sungorus Coltricia crassa Cyclops insignis Poecilia formosa Coltriciella globosa Diaphanosoma sp Poecilia reticulata Coniophora puteana Daphnia dentifera Takifugu rubripes Filobasidiella neoformans Daphnia dubia Thamnophis sirtalis Heterobasidion irregulare Daphnia magna Xenopus tropicalis Hypsizygus marmoreus Daphnia pulex Heterolepidoderma sp Inocybe maculata Daphnia pulicaria Abra alba Melanopsichium pennsylvanicum Daphniopsis ephemeralis Aplysia californica Phomopsis sp Darcythompsonia fairliensis Asaphis deflorata Punctularia strigosozonata Diaphanosoma sp Congeria jalzici Scytinopogon havencampii Drosophila busckii Dreissena bugensis Sporisorium scitamineum Eodiaptomus wolterecki Dreissena polymorpha Tilletiopsis cremea Eucalanus bungii Mya arenaria Tilletiopsis lilacina Eudiaptomus graciloides Mysella charcoti 267

≥97% ≥99% =100

Tilletiopsis washingtonensis Fabaeformiscandona sp Mytilopsis leucophaeata Tremella mesenterica Hemidiaptomus sp Brugia pahangi Paraphysoderma sedebokerense Parabroteas sarsi Brugia timori Boothiomyces macroporosum Phyllodiaptomus sp Parastrongyloides trichosuri Gromochytrium mamkaevae Pontomalota opaca Diphyllobothrium latum Rhizophydium patellarium Pseudothericles compressifrons Geocentrophora applanate Sacculospora baltica Rhinocyllus conicus Geocentrophora baltica Circinella simplex Scapholeberis rammneri Geocentrophora marcusi Circinella umbellata Simocephalus beianensis Geocentrophora sphyrocephala Kuzuhaea moniliformis Simocephalus heilongjiangensis Mesocestoides corti Thermomucor indicae-seudaticae Simocephalus vetuloides Protopolystoma xenopodis Eiseniona gerardoi Solenopsis invicta Prorhynchus fontinalis Helobdella robusta Systolederus spicupennis Spirometra erinaceieuropaei Leodamas dubia Temora longicornis Taenia asiatica Ophelia bicornis Tigriopus californicus Trichobilharzia regenti Anomalocera patersoni Lingula rostrum Brachionus calyciflorus Anurida maritima Flustrellidra hispida Brachionus patulus Arctodiaptomus sp Balaenoptera acutorostrata Brachionus plicatilis Athalia rosae Callorhinchus milii Conochilus coenobasis Bilobella aurantiaca Chelonia mydas Conochilus unicornis Boeckella sp Chinchilla lanigera Floscularia armata Bombus impatiens Corbula tunicata Floscularia bífida Brotheas amazonicus Danio rerio Octotrocha speciosa Bythotrephes cederstroemi Dicentrarchus labrax Ptygura longicornis Calamoecia sp Gorilla gorilla Sinantherina semibullata Calanus finmarchicus Ictidomys tridecemlineatus Sinantherina socialis Calanus hyperboreus Jaculus jaculus Synchaeta pectinata Candona candida Lepisosteus oculatus Testudinella patina Ceriodaphnia rotunda Macaca mulatta Trichotria tetractis Chironomus tentans Monodelphis domestica Dactylobiotus ambiguus Cimex lectularius Ornithorhynchus anatinus Dactylobiotus parthenogeneticus 268

≥97% ≥99% =100

Copidosoma floridanum Oryzias latipes Murrayon pullari Cormocephalus hartmeyeri Otolemur garnettii Aulactinia stella Cyclaspis caprella Pantholops hodgsonii Bouillonactinia sp Cyclopidae sp Phodopus sungorus Coniothyrium cereale Cyclops insignis Poecilia formosa Drymonema larsoni Diaphanosoma sp Poecilia reticulata Ectopleura crocea Daphnia dentifera Takifugu rubripes Ectopleura wright Daphnia dubia Thamnophis sirtalis Edwardsia timida Daphnia magna Xenopus tropicalis Epiactis handi Daphnia pulex Heterolepidoderma sp Halopteris schucherti Daphnia pulicaria Abra alba Hebella venusta Daphniopsis ephemeralis Aplysia californica Hydra circumcincta Daphniopsis truncata Asaphis deflorata Hydra hymanae Darcythompsonia fairliensis Chione elevata Hydra oligactis Diacyclops bicuspidatus Congeria jalzici Hydra sinensis Diacyclops scanloni Dreissena bugensis Hydra utahensis Diaeretus leucopterus Dreissena polymorpha Hydra vulgaris Diaphanosoma sp Mya arenaria Hydra zhujiangensis Drosophila busckii Mysella charcoti Moerisia inkermanica Eodiaptomus wolterecki Mytilopsis leucophaeata Nematostella vectensis Eucalanus bungii Velesunio ambiguus Sertularella africana Eudiaptomus graciloides Venus verrucosa Tiaricodon coeruleus Eurytemora affinis Anisakis simplex Turritopsis lata Evadne nordmanni Brugia pahangi Halichondria panicea Fabaeformiscandona sp Brugia timori Didymoeca costata Gomphiocephalus hodgsoni Parastrongyloides trichosuri Monosiga brevicollis Hemidiaptomus sp Amphiporus sp Nuclearia simplex Lernaea cyprinacea Diphyllobothrium latum Parvicapsula petuniae Limnocalanus macrurus Geocentrophora applanate Bodomorpha minima Megacyllene robiniae Geocentrophora baltica Elphidium williamsoni Neocalanus cristatus Geocentrophora marcusi Elphidium sp 269

≥97% ≥99% =100

Neocalanus plumchrus Geocentrophora sphyrocephala Paulinella chromatophora Oligotoma sp Mesocestoides corti Plasmodiophora brassicae Opisthacanthus cayaporum Protopolystoma xenopodis Pseudodifflugia gracilis Palophagoides vargasorum Prorhynchus fontinalis Spongotrochus glacialis Parabroteas sarsi Spirometra erinaceieuropaei Pyropia nítida Phyllodiaptomus sp Taenia asiatica Pyropia yezoensis Plagiostira albonotata Podura aquatica Trichobilharzia regenti Albugo laibachii Pontomalota opaca Beauchampia crucigera Ankylochrysis lutea Pseudothericles compressifrons Brachionus calyciflorus Aphanomyces astaci Rhinocyllus conicus Brachionus patulus Aphanomyces laevis Scapholeberis rammneri Brachionus plicatilis Asterionellopsis glacialis Simocephalus beianensis Conochilus coenobasis Aulacoseira ambigua Simocephalus heilongjiangensis Conochilus unicornis Aulacoseira granulata Simocephalus vetuloides Floscularia armata Aulacoseira islandica Solenopsis invicta Floscularia bífida Aulacoseira skvortzowii Systolederus spicupennis Keratella cochlearis Aureococcus anophagefferens Temora longicornis Lacinularoides coloniensis Cerataulina daemon Tetrodontophora bielanensis Lecane ungulata Chaetoceros simplex Tigriopus californicus Limnias ceratophylli Coscinodiscus radiatus Lingula rostrum Limnias melicerta Cyclostephanos dubius. Flustrellidra hispida Octotrocha speciosa Cylindrotheca closterium Balaenoptera acutorostrata Ptygura beauchampi Discostella sp Branchiostoma floridae Ptygura longicornis Eunotia naegelii Callorhinchus milii Sinantherina semibullata Fistulifera solaris Chelonia mydas Sinantherina socialis Fragilaria capucina Chinchilla lanigera Synchaeta pectinata Fragilaria crotonensis Corbula tunicata Testudinella clypeata Grammonema striatula Danio rerio Testudinella patina Halamphora coffeaeformis Dicentrarchus labrax Trichotria tetractis Halamphora coloradiana Eptesicus fuscus Dactylobiotus ambiguus Halamphora oligotraphenta Gorilla gorilla Dactylobiotus parthenogeneticus Halamphora veneta 270

≥97% ≥99% =100

Ictidomys tridecemlineatus Murrayon pullari Hyphochytrium catenoides Jaculus jaculus Aulactinia stella Lampriscus kittonii Lepisosteus oculatus Bouillonactinia sp Lithodesmium undulatum Macaca mulatta Coniothyrium cereale Melosira arctica Monodelphis domestica Drymonema larsoni Melosira dubia Myotis lucifugus Ornithorhynchus Ectopleura crocea Nannochloropsis gaditana anatinus Ectopleura wright Nannochloropsis granulata Oryzias latipes Edwardsia timida Nannochloropsis limnetica Otolemur garnettii Epiactis handi Nannochloropsis oceanica Pantholops hodgsonii Halopteris schucherti Nannochloropsis oculata Phodopus sungorus Hebella venusta Nannochloropsis salina Poecilia formosa Hydra circumcincta Navicula sp Poecilia reticulata Hydra hymanae Nitzschia longissima Pteropus alecto Hydra oligactis Odontella aurita Takifugu rubripes Hydra sinensis Odontella sinensis Thamnophis sirtalis Hydra utahensis Phytophthora megasperma Xenopus tropicalis Hydra vulgaris Phytophthora sojae Heterolepidoderma sp Hydra zhujiangensis Pseudo-nitzschia calliantha Abra alba Moerisia inkermanica Pseudo-nitzschia galaxiae Acila castrensis Nematostella vectensis Pseudo-nitzschia pseudodelicatissima Aplysia californica Sagartia ornata Pythium anandrum Arctica islandica Sertularella africana Pythium senticosum Asaphis deflorata Tiaricodon coeruleus Pythium takayamanum Calyptogena magnifica Turritopsis lata Pythium viniferum Chione elevata Halichondria panicea Rhizosolenia imbricata Congeria jalzici Didymoeca costata Rhizosolenia setigera Cyrenoida floridana Monosiga brevicollis Saccharina japonica Dreissena bugensis Nuclearia simplex Saprolegnia parasítica Dreissena polymorpha Parvicapsula petuniae Skeletonema costatum Mya arenaria Syringoderma phinneyi Skeletonema potamos Mysella charcoti Bodomorpha minima Skeletonema pseudocostatum 271

≥97% ≥99% =100

Mytilopsis leucophaeata Bodomorpha sp Thalassiosira eccentric Petricola lapicida Elphidium williamsoni Thalassiosira fallax Teredo clappi Elphidium sp Thalassiosira minima Velesunio ambiguus Esquamula lacrimiformis Thalassiosira nordenskioeldii Venus verrucosa Gymnophrys sp Thalassiosira profunda Angiostrongylus cantonensis Paulinella chromatophora Thalassiosira pseudonana Anisakis simplex Plasmodiophora brassicae Thalassiosira rotula Brugia pahangi Pseudodifflugia gracilis Thalassiosira weissflogii Brugia timori Spongotrochus glacialis Triparma laevis Parastrongyloides trichosuri Bangia fuscopurpurea Ulnaria acus Xiphinema rivesi Gracilariopsis lemaneiformis Actinastrum sp Amphiporus sp Pyropia haitanensis Amborella trichopoda Diphyllobothrium latum Pyropia nítida Bathycoccus prasinos Geocentrophora applanate Pyropia yezoensis Brachypodium distachyon Geocentrophora baltica Achlya sparrowii Brassica rapa Geocentrophora marcusi Albugo laibachii Chlorella emersonii Geocentrophora sphyrocephala Amphora affinis Chlorella sorokiniana Mesocestoides corti Ankylochrysis lutea Chlorella sp Protopolystoma xenopodis Aphanomyces astaci Chlorella variabilis Prorhynchus fontinalis Aphanomyces laevis Chlorella vulgaris Schistosoma rodhaini Asterionella formosa Coccomyxa simplex Spirometra erinaceieuropaei Asterionellopsis glacialis Cucumis melo Taenia asiatica Aulacoseira ambigua Gossypium herbaceum Trichobilharzia regenti Aulacoseira distans Gossypium hirsutum Halicryptus spinulosus Aulacoseira granulata Hordeum jubatum Priapulus caudatus Aulacoseira islandica Lycopersicon esculentum Beauchampia crucigera Aulacoseira skvortzowii Medicago truncatula Brachionus calyciflorus Aureococcus anophagefferens Microglena monadina Brachionus patulus Bicosoeca sp Momordica charantia Brachionus plicatilis Cerataulina daemon Monoraphidium neglectum Conochilus coenobasis Chaetoceros simplex Mychonastes sp 272

≥97% ≥99% =100

Conochilus unicornis Chrysosphaerella rotundata Oltmannsiellopsis sp Floscularia armata Coscinodiscus radiatus Paradoxia multiseta Floscularia bífida Cyclostephanos dubius. Phaeocerosv laevis Keratella cochlearis Cyclotella meneghiniana Populus trichocarpa Lacinularoides coloniensis Cylindrotheca closterium Solanum lycopersicum Lecane ungulata Cymatopleura elliptica Sorghum bicolor Limnias ceratophylli Discostella sp Watanabea reniformis Limnias melicerta Eunotia naegelii Octotrocha speciosa Fistulifera solaris Ptygura beauchampi Fragilaria capucina Ptygura longicornis Fragilaria crotonensis Sinantherina semibullata Fragilaria perminuta Sinantherina socialis Grammonema striatula Synchaeta pectinata Halamphora coffeaeformis Testudinella clypeata Halamphora coloradiana Testudinella patina Halamphora oligotraphenta Trichotria tetractis Halamphora veneta Dactylobiotus ambiguus Hyphochytrium catenoides Dactylobiotus parthenogeneticus Lampriscus kittonii Milnesium sp Lithodesmium undulatum Murrayon pullari Mallomonas asmundae Anthopleura elegantissima Melosira arctica Aulactinia stella Melosira dubia Aulactinia verrucosa Microzonia velutina Boloceroides mcmurrichi Nannochloropsis sp Bougainvillia muscus Nannochloropsis gaditana Bouillonactinia sp Nannochloropsis granulata Bunodactis reynaudi Nannochloropsis limnetica Carybdea xaymacana Nannochloropsis oceanica Chironex fleckeri Nannochloropsis oculata Chironex yamaguchii Nannochloropsis salina 273

≥97% ≥99% =100

Clytia xiamenensis Navicula sp Coniothyrium cereale Nitzschia laevis Diadumene cincta Nitzschia longissima Drymonema larsoni Odontella aurita Ectopleura crocea Odontella sinensis Ectopleura wright Phytophthora megasperma Edwardsia elegans Phytophthora sojae Edwardsia timida Pseudo-nitzschia calliantha Eirene brevistylus Pseudo-nitzschia galaxiae Epiactis handi Pseudo-nitzschia multiseries Haloclava producta Pseudo-nitzschia pseudodelicatissima Halopteris schucherti Pythiopsis terrestris Hebella venusta Pythium anandrum Henneguya salminicola Pythium senticosum Hydra circumcincta Pythium takayamanum Hydra hymanae Pythium viniferum Hydra oligactis Rhizosolenia imbricata Hydra sinensis Rhizosolenia setigera Hydra utahensis Roundia cardiophora Hydra vulgaris Saccharina japonica Hydra zhujiangensis Saprolegnia parasítica Janaria mirabilis Skeletonema costatum Leiopathes expansa Skeletonema marinoi Melicertum octocostatum Skeletonema potamos Mitrocomella niwai Skeletonema pseudocostatum Modeeria rotunda Syringoderma phinneyi Moerisia inkermanica Thalassiosira angulata Nectopyramis sp Thalassiosira eccentric Nematostella vectensis Thalassiosira fallax Parantipathes hirondelle Thalassiosira minima Sagartia ornata 274

≥97% ≥99% =100

Sertularella africana Thalassiosira nordenskioeldii Tiaricodon coeruleus Thalassiosira profunda Tiaropsis multicirrata Thalassiosira pseudonana Turritopsis lata Thalassiosira rotula Clathrina blanca Thalassiosira weissflogii Clathrina clathrus Triceratium dubium Clathrina rubra Triparma laevis Halichondria panicea Ulnaria acus Didymoeca costata Ulnaria ulna Ichthyophonus hoferi Actinastrum sp Monosiga brevicollis Alloteropsis semialata Nuclearia moebiusi Amborella trichopoda Nuclearia simplex Atropa belladonna Parvicapsula petuniae Bathycoccus prasinos Salpingoeca fusiformis Brachypodium distachyon Syringoderma phinneyi Brassica rapa Bodomorpha minima Chlorella emersonii Bodomorpha sp Chlorella sorokiniana Collozoum inerme Chlorella sp Elphidium williamsoni Chlorella variabilis Elphidium sp Chlorella vulgaris Esquamula lacrimiformis Coccomyxa simplex Gymnophrys sp Coelastrum astroideum Haynesina germanica Coelastrum microporum Paulinella chromatophora Cucumis melo Plasmodiophora brassicae Gossypium herbaceum Pseudodifflugia gracilis Gossypium hirsutum Rhogostoma minus Hordeum jubatum Sphaerozoum ovodimare Lycopersicon esculentum Spongotrochus glacialis Medicago truncatula Bangia fuscopurpurea Microglena monadina 275

≥97% ≥99% =100

Glaucosphaera vacuolata Momordica charantia Gracilariopsis lemaneiformis Monoraphidium minutum Gymnogongrus griffithsiae Monoraphidium neglectum Pyropia haitanensis Mychonastes homosphaera Pyropia nítida Mychonastes sp Pyropia yezoensis Oltmannsiellopsis sp Achlya sparrowii Parachlorella kessleri Albugo laibachii Paradoxia multiseta Amphora affinis Phaeocerosv laevis Ankylochrysis lutea Pinus peuce Aphanomyces astaci Pinus strobus Aphanomyces laevis Populus trichocarpa Asterionella formosa Solanum lycopersicum Asterionellopsis glacialis Sorghum bicolor Aulacoseira ambigua Syringoderma phinneyi Aulacoseira distans Triticum aestivum Aulacoseira granulata Watanabea reniformis Aulacoseira islandica Aulacoseira skvortzowii Aureococcus anophagefferens Bicosoeca sp Blastocystis hominis Cerataulina daemon Chaetoceros simplex Chaetoceros socialis Chattonella subsalsa Chrysolepidomonas dendrolepidota Chrysosphaerella rotundata Coscinodiscus radiatus Cyclostephanos dubius. Cyclotella meneghiniana 276

≥97% ≥99% =100

Cylindrotheca closterium Cymatopleura elliptica Dictyocha speculum Dictyota dichotoma Discostella sp Eunotia naegelii Fistulifera solaris Fragilaria capucina Fragilaria crotonensis Fragilaria perminuta Frustulia aotearoa Glossomastix chrysoplastos Grammonema striatula Guinardia striata Halamphora coffeaeformis Halamphora coloradiana Halamphora oligotraphenta Halamphora veneta Hantzschia sp Heterosigma akashiwo Hyphochytrium catenoides Laminaria digitata Lampriscus kittonii Lithodesmium undulatum Mallomonas asmundae Mallomonas elongata Mallomonas kalinae Mallomonas morrisonensis Mallomonas muskokana Mallomonas papillosa Mallomonas tonsurata 277

≥97% ≥99% =100

Mallomonas torquata Melosira arctica Melosira dubia Microzonia velutina Monodus guttula Nannochloropsis sp Nannochloropsis gaditana Nannochloropsis granulata Nannochloropsis limnetica Nannochloropsis oceanica Nannochloropsis oculata Nannochloropsis salina Navicula sp Nitzschia laevis Nitzschia longissima Ochromonas Danica Odontella aurita Odontella sinensis Phytophthora megasperma Phytophthora sojae Phytopythium vexans Pseudo-nitzschia calliantha Pseudo-nitzschia galaxiae Pseudo-nitzschia multiseries Pseudo-nitzschia pseudodelicatissima Pteridomonas Danica Pylaiella littoralis Pythiopsis terrestris Pythium anandrum Pythium flevoense Pythium glomeratum 278

≥97% ≥99% =100

Pythium scleroteichum Pythium senticosum Pythium takayamanum Pythium viniferum Rhizochromulina cf. Marina Rhizosolenia imbricata Rhizosolenia setigera Roundia cardiophora Saccharina japonica Saprolegnia parasítica Skeletonema costatum Skeletonema marinoi Skeletonema potamos Skeletonema pseudocostatum Sphacelaria sp Spumella vulgaris Stephanopyxis nipponica Streblonema maculans Syringoderma phinneyi Tessellaria lapponica Thalassiosira angulata Thalassiosira eccentric Thalassiosira fallax Thalassiosira minima Thalassiosira nordenskioeldii Thalassiosira pacifica Thalassiosira profunda Thalassiosira pseudonana Thalassiosira rotula Thalassiosira weissflogii Tribonema aequale 279

≥97% ≥99% =100

Triceratium dubium Triparma laevis Ulnaria acus Ulnaria ulna Vacuolaria virescens Actinastrum sp Acutodesmus obliquus Alloteropsis semialata Amborella trichopoda Ankistrodesmus falcatus Atropa belladonna Bathycoccus prasinos Brachypodium distachyon Brassica rapa Chlamydomonas reinhardtii Chlorella emersonii Chlorella sorokiniana Chlorella sp Chlorella variabilis Chlorella vulgaris Chromochloris zofingiensis Closterium baillyanum Coccomyxa simplex Coelastrum astroideum Coelastrum microporum Corylopsis sinensis Cucumis melo Gossypium herbaceum Gossypium hirsutum Hordeum jubatum Itea virginica 280

≥97% ≥99% =100

Lilium tsingtauense Lycopersicon esculentum Lyellia platycarpa Marsupiomonas pelliculata Medicago truncatula Micractinium reisseri Microglena monadina Momordica charantia Monactinus sturmii Monoraphidium minutum Monoraphidium neglectum Mychonastes homosphaera Mychonastes huancayensis Mychonastes jurisii Mychonastes sp Nelumbo lutea Oltmannsiellopsis sp Ourococcus multisporus Parachlorella kessleri Paradoxia multiseta Paspalum vaginatum Phaeocerosv laevis Phaseolus vulgaris Picea asperata Pinus mugo Pinus peuce Pinus strobus Populus trichocarpa Pyramimonas gelidicola Rotundella rotunda Roupala macrophylla 281

≥97% ≥99% =100

Scenedesmus obliquus Scenedesmus rotundus Selaginella moellendorffii Solanum lycopersicum Solanum pennellii Sorghum bicolor Staphylea trifolia Stigeoclonium subsecundum Syringoderma phinneyi Triticum aestivum Tumidella tumida Watanabea reniformis