METAGENOMICS AND METATRANSCRIPTOMICS OF LAKE ERIE ICE
Opeoluwa F. Iwaloye
A Thesis
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
August 2021
Committee:
Scott Rogers, Advisor
Paul Morris
Vipaporn Phuntumart
© 2021
Opeoluwa Iwaloye
All Rights Reserved iii
ABSTRACT
Scott Rogers,
Lake Erie is one of the five Laurentian Great Lakes, that includes three basins. The central basin is the largest, with a mean volume of 305 km2, covering an area of 16,138 km2. The ice used for this research was collected from the central basin in the winter of 2010. DNA and
RNA were extracted from this ice. cDNA was synthesized from the extracted RNA, followed by the ligation of EcoRI (NotI) adapters onto the ends of the nucleic acids. These were subjected to fractionation, and the resulting nucleic acids were amplified by PCR with EcoRI (NotI) primers.
The resulting amplified nucleic acids were subject to PCR amplification using 454 primers, and then were sequenced. The sequences were analyzed using BLAST, and taxonomic affiliations were determined. Information about the taxonomic affiliations, important metabolic capabilities, habitat, and special functions were compiled.
With a watershed of 78,000 km2, Lake Erie is used for agricultural, forest, recreational, transportation, and industrial purposes. Among the five great lakes, it has the largest input from human activities, has a long history of eutrophication, and serves as a water source for millions of people. These anthropogenic activities have significant influences on the biological community. Multiple studies have found diverse microbial communities in Lake Erie water and sediments, including large numbers of species from the Verrucomicrobia, Proteobacteria,
Bacteroidetes, and Cyanobacteria, as well as a diverse set of eukaryotic taxa. Sequences obtained from the metagenomic, and transcriptomic analyses match diverse organisms from thirty-two bacterial, two archaeal, and eight eukaryotic phyla. Some of the organisms found were capable of nitrogen, carbon, iron, sulfur, and hydrocarbon metabolism. Sequences from pathogenic and toxin-producing organisms were found. Organisms associated with several iv human activities, including pollution, agriculture, cultivation, manufacturing, shipping, and other activities were found. These results suggest that the ice contains a large diversity of organisms that are indicative of the diverse biological and anthropogenic influences in and around Lake
Erie. The results also showed that the lake ice contains a considerable number of cyanobacterial sequences, which often are in low concentrations in the lake water during winter.
v
ACKNOWLEDGMENTS
I would like to express my heartfelt gratitude to my advisor, Dr. Scott Rogers, for his support, mentorship, and guidance through the course of this research. Also, I am grateful for his consistent input, suggestions, time, and responsiveness to my questions while writing this thesis.
I am thankful to my thesis committee members, Dr. Paul Morris and Dr. Vipaporn
Phuntumart for their time and advise that greatly contributed to the success of my thesis project.
I thank the previous members of the Rogers lab who have worked assiduously on this project.
Their contribution to this project is greatly appreciated, they include Dr. Zeynep Kocer, Dr. Yury
Shtarkman and Brenna Michaud. I would like to the current members of the Rogers lab, they include Tessa Alloy and Sri Devan Appasamy who have contributed to this project in multiple ways. I am grateful to Dr. George Bullerjahn, Dr. Nigel D’Souza and Dr. Robert McKay for their help in the collection of the sample used in this project.
Finally, I am grateful to the Department of Biological Sciences, Bowling Green State
University for their support throughout my graduate education.
vi
TABLE OF CONTENTS Page
CHAPTER I. INTRODUCTORY REVIEW ...... 1
Lake Erie ...... 1
Life in Lake Erie under ice ...... 2
Microbial metabolism under ice conditions ...... 2
Human activities around Lake Erie ...... 5
Ice drilling/sample collection ...... 6
Ultracentrifugation ...... 6
RNA and DNA extraction ...... 7
cDNA synthesis ...... 7
Polymerase chain reaction ...... 9
454 pyrosequencing ...... 10
Basic local alignment search tool ...... 12
Curation of data (Python and Biopython) ...... 13
Chapter i references ...... 14
CHAPTER II. ORGANISMS DIVERSITY IN LAKE ERIE ...... 24
Lake Erie ...... 24
Metabolic activities in lake ice ...... 24
Previous research ...... 25
Purpose of research ...... 26
Materials and methods ...... 27
Sample preparation ...... 27
DNA/RNA extraction ...... 28 vii
cDNA synthesis ...... 28
Sequence analysis ...... 29
Taxonomic proportions ...... 29
Metabolic classifications ...... 29
Comparison with previous Lake Erie water study ...... 30
Results and discussion ...... 30
Result summary ...... 30
Summary of organisms ...... 39
Archaea ...... 39
Bacteria ...... 39
Extremophiles ...... 41
Cyanobacteria ...... 43
Cellulolytic bacteria ...... 44
Oil/hydrocarbon degrader ...... 45
Pathogens ...... 45
Human pathogens...... 46
Pathogenic in animals ...... 46
Pathogenic in plants ...... 47
Comparison of the bacterial community with Lake Erie water study ...... 48
Eukaryotes...... 48
SAR (stramenopiles, alveolates and rhizaria) ...... 49
Fungi ...... 54
viii
Arthropods ...... 56
Chordata ...... 57
Human activities associated with organisms found in Lake Erie ...... 58
Metabolic analysis ...... 58
Methanogenesis...... 59
Methylotrophy...... 60
Nitrogen fixation ...... 62
Anaerobic ammonium oxidation...... 64
Ammonia oxidation ...... 65
Nitrite oxidizing bacteria ...... 66
Denitrifying bacteria ...... 67
Sulfur metabolism ...... 68
Other notable metabolic capabilities ...... 71
Degradation of organic compounds ...... 72
Conclusion of findings ...... 73
Chapter ii references ...... 74
APPENDIX A. SPECIES (BASED ON SEQUENCES) FROM LAKE ERIE ICE SAMPLE,
ORGANIZED TAXONOMICALLY ...... 96
APPENDIX B. BACTERIAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99%
AND 100%...... 236
APPENDIX C. EUKARYAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99%
AND 100%...... 263
ix
LIST OF FIGURES Figure Page
1 Illustration of the process of pyrosequencing ...... 12
2 Location of sample. Station 84 of the central basin of Lake Erie ...... 27
3 Proportions of unique sequences in different environmental conditions ...... 41
4 Potential methane metabolic abilities represented in the 454 sequences
from Lake Erie ice ...... 60
5 Potential nitrogen metabolic abilities represented in the 454 sequences from
Lake Erie ice ...... 64
6 Potential sulfur metabolic abilities represented in the 454 sequences from
Lake Erie ice ...... 69
7 Potential iron metabolic abilities represented in the 454 sequences from
Lake Erie ice ...... 72 x
LIST OF TABLES Table Page
1 Summary of organisms from Lake Erie ice samples with information on
physiology, ecology, and other important characteristics ...... 32
2 Number of unique sequences and their habitat information ...... 40
1
CHAPTER I. INTRODUCTORY REVIEW
Lake Erie
The Laurentian Great Lakes are freshwater lakes located in North America, including
Lake Erie, Lake Superior, Lake Huron, Lake Michigan, and Lake Ontario. Among these five great lakes, Erie is the shallowest and smallest by volume. Lake Erie has a history of anthropogenic influences that have changed the lake ecosystem over time (Beeton 1965, 1969;
Kemp et al., 1977). The watershed that feeds the lake covers an area of about 78,000 km2. This area is 59% agricultural, 17% forested, 15% industrial/urban, and the remaining 9%, is used for other purposes (Ranking, 2002). The watershed is home to about 12 million people, including seventeen metropolitan areas with more than 50,000 residents, and provides drinking water to about 11 million people (Bolsega & Herdendorf, 1993; USEPA, 2011). About one-third of the total population of the Great Lakes basin is in the Lake Erie watershed. Despite governmental efforts, Lake Erie has been significantly impacted by agricultural, industrial, and urban runoff, and it continues to receive extensive inputs from these sources (Baker et al., 2002; Waples et al.,
2008). Because the area surrounding Lake Erie is used extensively for agricultural and industrial purposes, anthropogenic activities significantly influence the lake water and ice microbial community.
Life in Lake Erie under ice
The lake is seasonally frozen. Its surface is partially or completely covered with ice during the winter and loses the ice cover as it warms up gradually during the spring and summer.
Diverse microbial communities, including Verrucomicrobia, Proteobacteria, Bacteroidetes, and others, have been found in Lake Erie water beneath the ice cover (Beall et al., 2016). They reported a variation in the bacterial community and a shift in the diatom community of Lake Erie 2 under high and low ice conditions. They reported significant changes in the numbers of
Actinobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes, Proteobacteria,
Planctomycetes, Verrucomicrobia between high and low ice conditions. Archaeal organisms have been reported in Lake Erie and other freshwater lakes water and sediment belonging to the
Euryarchaeota, Thaumarchaeota and Crenarchaeota, but they comprise a small percentage of the total numbers of organisms in the lake (Bollmann et al., 2014; Yang et al., 2016). Members of
Archaea have been found in extreme marine environments and sometimes in halophilic environments. Some can reduce sulfate and produce methane via methanogenesis (Balch et al.,
1979; Delong, 1992). While it was once thought that the Archaea were all extremophiles, it is now known that various species of Archaea grow in moderate environments, as well as hot, cold, salty, acidic, alkaline, and others. The eukaryotic community found in freshwater lakes includes metazoans, protists, chlorophytes, and fungi (Banerji et al., 2018). Twiss et al., 2012 reported an abundance of diatoms in Lake Erie under the ice. Multiple studies have indicated that the flora of seasonally ice-covered lakes differs from the ice-free period (Shade et al., 2008; Rogozin et al.,
2009; Rosel et al., 2012). This is because of lower temperatures, reduced nutrient inputs, stratification, limited solar irradiation, and decreased quality of organic substrates (Tulonen,
1993; Tulonen et al., 1994; Bergström & Jansson, 2000).
Microbial metabolism under ice conditions
While it was once assumed that all organisms exposed to temperatures below freezing were metabolically inactive, it is now clear that this is not true for all organisms. Several researchers have reported microbial metabolism in extreme environments with temperature ranging from -5oC to -32oC (Junge et al., 2004; Panikov & Sizova 2006; Rivkina et al., 2007;
Bakermans & Skidmore 2011; Doyle et al., 2013). Microorganisms in such environments 3 maintain metabolic processes necessary for repair and assembly of vital cellular structures to preserve the integrity of the organism. However, reproduction at such temperatures has not been demonstrated (Bakermans & Skidmore 2011). The metabolic activity below freezing is not well understood as it differs between conditions and among organisms (Price & Sowers, 2004).
Sometimes when microorganisms have slowed their metabolic activities, they can remain viable in a dormant state over extended periods, if damage to their cells does not exceed the capabilities of their repair systems (Amato et al., 2010). They do this by initiating dormant states, such as spore formation, with low metabolism levels for the repair of accumulated damage (Bakermans
& Skidmore 2011). However, many organisms that endure these extreme conditions do not form spores. Conditions that limit microbial activity at cold temperatures include limited availability of liquid water, decreased molecular motion and energetics, and a loss in osmotolerance
(Mykytczuk et al., 2013). Bacteria capable of nitrogen, carbon, sulfur, and methane metabolism, have been reported in extreme environments, including lake ice (Koo et al., 2016). Some organisms surround themselves in compounds that either prevent water from freezing or allow only small crystals to form, thus limiting damage to the cells. The organisms that are entrapped in the ice and are eventually released during thawing begin full metabolic activity almost immediately.
Previous studies have shown the metabolic activities of these organisms in ice conditions.
Organisms including archaea, eukarya, and bacteria exhibit different metabolic activities such as carbohydrate metabolism, methanogenesis, iron reduction, iron oxidizing, nitrification, ammonia oxidation, sulfur oxidizing and methane oxidation. Archaea exhibit metabolic activities such as methanogenesis, nitrifier and methane oxidation. Excess methane production in Vostok ice has been reported in glacial ice attributed to the presence of methanogenic archaea (Tung et al., 4
2005). Skidmore et al., 2000 reported metabolically active organisms in high arctic glaciers, which included aerobic chemoheterotrophs, anaerobic nitrate reducers, sulfate reducers, and methanogens. Also, Sower (2001), found an excess N2O in glacial ice suggesting the presence of nitrifying bacteria. Massé et al., 2019, reported increasing nitrification activity under winter ice and found ammonia oxidizing bacteria to be present irrespective of the season while ammonia oxidizing bacteria were in abundance during the winter. Similarly, Mukherjee et al., 2016 reported more abundant ammonia oxidizing bacteria (mostly Nitrospira) than ammonia oxidizing archaea in Lake Erie water. Ammonia oxidizing bacteria and archaea have been reported in Lake
Erie and Lake Superior (Bollmann et al., 2014). Bacteria and archaea are more metabolically diverse than Eukarya, with Bacteria being the most diverse in this regard. Outside the basic metabolic activities (carbon and energy metabolism), eukaryotes are often not involved in alternative metabolic activities. This may be the reason why they are often not as heavily studied in ice. Some members of the Rhizaria (foraminifera and gromidia) have been reported to be involved in denitrification (Piña-Ochoa et al., 2010; Risgaard-Petersen et al., 2016). Fusarium oxysporum, Cylindrocarpon tonkinense (both fungi), Loxodes spp (protozoan) and some diatoms have been reported to be capable of dissimilatory nitrate reduction (Finlay et al., 1983; Shoun and Tanimoto, 1991; Usuda et al., 1995; Kamp et al., 2011). About 60% of the carbon dioxide originates from anaerobic microbial processes in lakes (Jones and Simon 1980). However, the
CO2 that is entrapped in the ice is only released into the atmosphere during melting (Bertilsson et al., 2013). Methane is produced anaerobically by some types of Archaea through methanogenesis, and microbial methanotrophs utilize it. This can lead to CH4 emissions into the air upon thawing, contributing up to 40% of the CH4 released annually (Michmerhuizen et al.,
1996; Phelps et al., 1998). CO2 and CH4 are both greenhouse gases with greenhouse warming 5
potentials of 1 and 20, respectively (Bertilsson et al., 2013). However, CO2 has a longer half-life in the atmosphere that is approximately 70 years, while CH4 resides in the atmosphere only a few years. However, if the methane reacts with hydroxyls, CO2 is produced, increasing the atmospheric CO2 levels, making it a double threat to global climate changes.
Human activities around Lake Erie
Anthropogenic activities such as agriculture, cultivation of ornamental plants, recreational activities, industrial activities, soil erosion, waste, and sewage disposal severely affect the quality of freshwater lakes (Hall & Smol, 1999). The most discussed issue about these human activities is eutrophication, which is nutrient enrichment that leads to increases in microbial populations and elevated particulate organic matter levels. In some cases, it leads to hypoxia due to high microbial respiration rates (Gray et al., 2002). Nitrogen and phosphorus are two of the main nutrients that limit primary productivity in aquatic systems (Townsend et. al,
2007). Increased levels of these nutrients result in a community shift from diatoms and small algae to cyanobacteria (Tilman et al., 1986). Newton & McMahon (2011) found that bacterial community composition changes were inconsistent across seasons following the addition of carbon, nitrogen, and phosphorus. Members of the Alphaproteobacteria, Betaproteobacteria, and
Bacteroidetes increased with nutrient addition, while nutrient addition failed to affect members of Actinobacteria. Anthropogenic activities also affect the biogeochemical cycling of carbon and other nutrients (Griggs et al., 2013). How these activities affect microorganisms is less obvious.
Still, the emerging concern is that the diversity and microbial functions may cause important changes in ecosystems (Maloy et al., 2017). Considering the established fact that microorganisms are actively involved in these cycles, there is an interconnected relationship 6 between human activities, biogeochemical cycles, and microbial activity that is not yet fully understood.
Ice drilling/sample collection
Ice samples for scientific analyses, including those for metagenomic and metatranscriptomic analyses, are collected in different ways. According to the National Science
Foundation, ice samples are collected using a mechanical or thermal method. The mechanical process can be done using physical force to turn a hand auger or coupling an electromechanical rotor to the cutter (National Science Foundation, https://icecores.org/about-ice-cores). However, this can cause fracturing of the ice core sections, especially those that are under high stress, including deep ice cores. In those cases, drilling fluids are used in the boreholes that dampen the frictional forces and stabilize the pressure in the ice.
Ice drilling is a process that provides scientists with the opportunity to explore what is beneath the ice to explain the past, present and future. Since 1840, different methods have been explored. Major methods include the percussion, hot water, and rotary drilling methods. The first attempt at ice drilling was in 1840 in Unteraargletscher in the Alps, and by 1966 a US team drilled into the Greenland ice sheets. Now, several groups have successfully collected ice samples from different locations, including Greenland, Antarctica, and elsewhere with standard methods, including percussion, rotary, and thermal (hot water) drilling.
Ultracentrifugation
Ultracentrifugation is commonly used to concentrate virus and subcellular particles and molecules in fluid samples. In studies that involve environmental water samples, the method can 7 be employed to concentrate the cells, viruses, cell components, and macromolecules prior to nucleic acid extraction. Typically, the samples are centrifuged at 100,000 xg for 12-14 hours.
RNA and DNA Extraction
RNA was extracted using a MinElute Virus Spin Kit (QIAGEN, Valencia, CA), according to the manufacturer’s instructions. This kit is designed to extract both RNA and DNA using a fast spin-column procedure. The four steps include lysing organisms, binding the nucleic acids to the column, washing away debris, and eluting the nucleic acids off the column. Lysis is carried out using the QIAGEN Protease and Buffer AL, which also inactivates RNases. Optimal binding conditions are assured through the addition of ethanol prior to addition of the sample materials. In the binding step, nucleic acids adsorb onto the silica-gel membrane as the lysate is drawn through by centrifugation. During the wash step, the nucleic acids are bound to the membrane and contaminants are removed. In the final step, RNA and DNA are eluted from the column with Buffer AVE. cDNA Synthesis
Complementary DNA (cDNA) synthesis is the technique used to make double-stranded
DNA from RNA, and this process is called reverse transcription (Croy, 1998). This method has been used since 1970 and improved in 1975; it is based on the enzymatic conversion of RNA into double-stranded cDNA using a reverse transcriptase and then a DNA polymerase
(Efstratiadis et al., 1975). Reverse transcriptases are used in the first strand synthesis, they are
RNA dependent DNA polymerases to carry out DNA synthesis (Harbers, 2008). This is followed by polymerization of the complementary DNA strand using DNA polymerase.
The extracted RNA is converted to cDNA in three steps using a cDNA superscript kit
(Invitrogen SuperScript® Choice System, Invitrogen, Grand Island, NY, USA). The first step is 8 to attach random DNA primers to the RNA. This allows reverse transcriptase to bind to the template RNA during the synthesis. For metatranscriptomic research aimed at determining the sequences of all forms of RNA (e.g., rRNA, tRNA, sRNA, and mRNA) random primers are used for this step, and it also is useful when attempting to obtain regions of very long mRNA transcripts (Noonan and Roninson 1988). It can be helpful for analytical purposes. However, the resultant cDNA might be too long for some next-generation sequencing techniques, which are capable of determining only short pieces of DNA. In the second step reverse transcriptase is added, which allows the reverse transcription of the RNA to DNA to begin. Reverse transcriptase was first isolated from Rous Sarcoma virus by Howard Temin (Temin and Mizutani 1970) and later by David Baltimore from Rous sarcoma virus and murine leukemia virus (Baltimore 1970).
The first cDNA strand synthesis takes place in this step. Some reverse transcriptases like other polymerases catalyze more than one reaction. In this case, the polymerase also has associated ribonuclease H (RNAase H) activity. High RNAse H activity degrades RNA and may reduce cDNA yield under non-optimal synthesis conditions (Kohler et al., 1995). However, most commercially available reverse transcriptases have removed this activity. Instead, the RNA template is partially removed by the addition of purified RNaseH after the reverse transcriptase reaction has been completed.
In the third step, the second strand of cDNA is made using DNA polymerase I. The first strand serves as the template for a nick translation reaction. Ribonuclease (RNase) H produces nicks and gaps, resulting in a series of RNA primers used by DNA polymerase I during the synthesis (Nature methods, 2005). In addition, the random DNA primers that remain after the initial steps also function in this process. Under optimal conditions, this resulting DNA is a double-stranded cDNA. 9
Polymerase chain reaction
The polymerase chain reaction (PCR) is a popular technique widely used in molecular biology for various applications. It was developed by Kary Mullis in 1983 to increase the copies of targeted DNA regions using a programmable heating block, called a thermal cycler (Mullis,
1990). The idea and principle of DNA amplification were first put forward by Kjell Kleppe and
H. Gobind Khorana (Kleppe et al., 1971). They called the process repair replication.
The process requires four major components: the template DNA, primers that border the region of interest, a thermostable DNA polymerase, and deoxynucleotide triphosphates
(Garibyan and Avashia 2013). The template DNA is the original DNA to be copied. Primers are short DNA fragments which specify what part of the template DNA is amplified during the amplification process. It has a defined known sequence complementary to the target DNA that is amplified and thus serves as an extension point for the DNA polymerase to build on and carry out the polymerization reaction (Garibyan and Avashia 2013). The DNA polymerase is the key enzyme in a PCR reaction. It is thermostable at the temperature (95°C) in which DNA is denatured during the first step of PCR. The enzyme most often used is Taq DNA polymerase, from the bacterium Thermus aquaticus that was isolated from hot springs, where it existed in an extremely hot environment. It functions to link several nucleotides together during the reaction
(Bartlet and Stirling, 2003). The deoxynucleotide triphosphates (dNTPs) consist of the four bases
– adenine, thymine, cytosine, and guanine (A, T, C, G) – that are present in DNA, which are attached to 2'-deoxyribose rings that have a triphosphate group attached to their 5' carbon atoms.
These serve as the building blocks used by the DNA polymerase that result in an amplified
DNA. 10
Amplification occurs in repeated cycles (30-40 cycles) in three major steps: denaturation, annealing, and extension. It starts with an initial denaturation at 95°C for up to 3 minutes; this allows the separation of the double-stranded DNA into single strands. This is followed by repeated denaturation at 95°C for 30 seconds in each cycle. Then, in the annealing step, the temperature is lowered to 55°C (or other appropriate temperature, based on the primers) for 2 minutes to allow the primer to anneal the template DNA based on complementary sequences.
Determining the optimal annealing temperature is a major factor in the success of the PCR reaction (Sambrook et al., 2001). In the third step, extension from the primers results in the synthesis of the second complementary strand of the DNA at a temperature of 72°C (optimal temperature for Taq DNA polymerase) for 2 minutes. These three steps are repeated, starting from the denaturing step to separate the newly synthesized DNA again until the cycles are completed. Following the completion of all the cycles, the DNA goes through a final extension step of 72°C for 10 minutes. This allows the polymerase to complete extension to the ends of all the synthesized DNAs (Sambrook et al., 2001).
454 pyrosequencing
The 454-pyrosequencing method originated in 2005 by Margulies et al., 2005. It was a major milestone in the next-generation sequencing technology with the advantage of a massively parallel sequencing that yielded millions of base pairs to be determined in a single sequencing procedure. The 454-pyrosequencing technology is based on the sequencing-by-synthesis principle, which involves detecting the nucleotide incorporated, combining emulsion PCR and pyrosequencing. It relies on light detection based on a chain reaction once pyrophosphate is released, and nucleotides are incorporated in the DNA (Siqueira et al., 2012). The sequencing instrument consists of four major subsystems. This includes a fluidic assembly, a flow chamber 11 with a well-containing fiber-optic slide, a CCD camera-based imaging assembly, and a computer
(Margulies et al., 2005).
In this sequencing method, DNA is isolated, fragmented, ligated to special adapters, and separated into single strands. This is followed by Emulsion PCR in which an oil-water emulsion is formed; the aqueous phase contains the PCR components and the template DNA to be sequenced. Also, capture beads with an attached oligonucleotide that is complementary to one of the adapter sequences are included in the reaction. The adapter on the opposite end of the DNA is used with a primer to initiate the polymerization reaction. Thorough mixing of the solution results in emulsification and millions of aqueous droplets are formed. These droplets are called a microreactor, each droplet contains a bead that is bound to a single DNA template. This is followed by PCR which generates millions of copies of the template DNA on each bead in a clonal PCR amplification. After the emulsion is broken, the DNA is denatured, and beads carrying single-stranded DNA are transferred to wells in a picotiter plate with a single bead in each well. Subsequently, other pyrosequencing reagents are added to each well; this includes the sequencing primer, and the enzymes DNA polymerase, ATP sulfurylase, luciferase, and apyrase.
As the complementary strand is synthesized by nucleotide incorporation, the pyrophosphate that is liberated causes the luciferase to produce a flash of light (using ATP hydrolysis) that is recorded by a CCD (charge-coupled device) camera for base calling. Because only a single dNTP is present for the addition of each nucleotide, the computer records the appropriate base for each position in the picotiter plate, building the DNA sequence with each cycle. This allows sequences to be recorded at each bead location on the picotiter plate (Siqueira et al., 2012).
12
Figure 1. Illustration of the process of pyrosequencing (Siqueira et al., 2012).
Basic local alignment search tool
Basic local alignment search tool (BLAST) (Altschul et al., 1990) is a sequence similarity search program that can be used via the NCBI (National Center for Biotechnology Information) web interface or as a separate application on a computer. It is the most widely used and reliable 13 strategy for searching sequence similarity (Pearson, 2013). The BLAST command-line applications (blastall and blastpgp) were first available in 1997, and they are supported on platforms such as Linux, UNIX, Mac, and Microsoft Windows (Camacho et al., 2009, NCBI toolkit).
There are three important aspects of the BLAST output, they include the bit score, the identity score (%), and the expected value (e-value). Expected value is defined as E(b) ≤p(b)D, where D represents the number of sequences in the database, and p(b) is the probability of finding the sequence b (Pearson, 2013). Expected value is the number of expected hits of similar sequences that could be found just by chance, which depends on the size of the database.
Acceptable expected value ranges between 0.01 to 0.1, the actual value is set by the scientist, as a general rule the lower the expected value the better (Pearson, 2013).
Curation of data (Python and Biopython)
Python, a programming language, was created by Guido van Rossum in the late 1980s, and first released in 1991. It is an interpreted, high-level, and general-purpose programming language widely used in a variety of fields. Its wide usage in science including Biology can be attributed to the simplicity of the language, its powerful and versatile combination of features including external features, and the wide base of scientific libraries and users (Ekmekci et al.,
2016, Hinsen, 2002). The Biopython project began in August 1999 as a collaboration to collect and produce open-source bioinformatics tools in Python (Chapman and Chang, 2000). The Seq object is Biopython's core sequence representation. Some features of Biopython include
SeqRecord, Bio.SeqIO, Bio.AlignIO, Bio.Nexus which are used for joining a sequence with its properties, for reading and writing biological sequence files in various formats, sequence alignment, and phylogenetic analysis respectively (Cock et al., 2009). 14
Chapter i references
Altschul, S.F, Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990). Basic local
alignment search tool. J Mol Biol. 5;215(3):403-10.doi: 10.1016/S0022-2836(05)80360-2
Amato, P., Doyle, S.M., Battista, J.R., and Christner, B.C. (2010). Implications of subzero
metabolic activity on long-term microbial survival in terrestrial and extraterrestrial
permafrost. Astrobiology 10, 789-798. doi: 10.1089/ast.2010.0477.
Baker, D.B.D., and Richards, R.P.R. (2002). Phosphorus budgets and riverine phosphorus export
in northeastern Ohio watersheds. J. Environ. Qual. 31(1), 96–108
doi:10.2134/jeq2002.9600.
Bakermans, C., and Skidmore, M.L. (2011). Microbial metabolism in ice and brine at -5oC.
Environ. Microbiol. 13(8), 2269-2278. doi:10.1111/j.1462-2920.2011.02485.x.
Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., and Wolfe, R.S. (1979). Methanogens:
reevaluation of a unique biological group. Microbiol. Rev 43, 260–296.
Baltimore, D. (1970). Viral RNA-dependent DNA Polymerase: RNA-dependent DNA
Polymerase in Virions of RNA Tumour Viruses. Nature 226, 1209–121.
https://doi.org/10.1038/2261209a0.
Banerji, A., Bagley, M., Elk, M., Pilgrim, E., Marinson, J., and Santo Domingo, J. (2018).
Spatial and temporal dynamics of a freshwater eukaryotic plankton community revealed
via 18S rRNA gene metabarcoding. Hydrobiologia, 818(1), 71–86.
https://doi.org/10.1007/s10750-018-3593-0.
Beall, B. F. N. Twiss M. R., Smith, E., Oyserman, B. O., Rozmarynowycz, M. J., Binding, C. E.,
Bourbonniere, R. A., Bullerjahn, G.S., Palmer, M.E., Reavie, E.D., Waters, M.K.,
Woityra, W.C., and McKay, R.M.L. (2016). Ice cover extent drives phytoplankton and 15
bacterial community structure in a large north-temperate lake: implications for a warming
climate. Environ. Microbiol. 18(6), 1704–1719. doi:10.1111/1462-2920.12819.
Beeton, A.M. (1965). Eutrophication of the St. Lawrence Great Lakes. Limnol. Oceanogr. 10,
240-254 https://doi.org/10.4319/lo.1965.10.2.0240.
Bergström, A., and Jansson, M. (2000). Bacterioplankton production in humic Lake Ortrasket in
relation to input of bacterial cells and input of allochthonous organic carbon. Microb.
Ecol. 39, 101–115. doi:0.1007/s002480000007.
Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,
G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of
seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.
doi:10.4319/lo.2013.58.6.1998.
Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,
G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of
seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.
Bollmann, A., Bullerjahn, G. S., and McKay, R. M. (2014). Abundance and diversity of
ammonia-oxidizing archaea and bacteria in sediments of trophic end members of the
Laurentian Great Lakes, Erie and Superior. PloS one, 9(5), e97068.
https://doi.org/10.1371/journal.pone.0097068.
Bolsega, S.J., and Herdendorf, C.E. (1993). Lake Erie and Lake St. Clair Handbook. Wayne
State University Press, Detroit.
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., and Madden,
T.L. (2009). BLAST+: architecture and applications. BMC Bioinformatics 10, 421.
https://doi.org/10.1186/1471-2105-10-421. 16
Chapman, B., and Chang, J. (2000). Biopython: Python tools for computational biology ACM
SIGBIO Newslett. 20(2); 15 –19,https://doi.org/10.1145/360262.360268.
Cock, P.J.A., Antao, T., Chang, J.T., Chapman, B.A., Cox, C.J., Dalke, A., Friedberg, I.,
Hamelryck, T., Kauff, F., Wilczynski, B., and de Hoon, M.J.L. (2009). Biopython:
freely available Python tools for computational molecular biology and
bioinformatics, Bioinformatics, Volume 25, Issue 11, 1422–
1423, https://doi.org/10.1093/bioinformatics/btp163.
Croy, Ron. (1998). "Molecular Genetics II - Genetic Engineering Course (Supplementary
notes)". Retrieved 11 January 2021.
DeLong, E.F.1. (1992). Archaea in coastal marine environments. PNAS 89(12), 5685-5689.
https://doi.org/10.1073/pnas.89.12.5685.
Doyle, S.M., Montross, S.N., Skidmore, S.L., and Christner, B.C. (2013). Characterizing
microbial diversity and the potential for metabolic function at −15 °C in the basal ice of
Taylor Glacier, Antarctica. Biology 2(3), 1034–1053. doi: 10.3390/biology2031034.
Efstratiadis, A., Maniatis, Kafatos, T.F.C., Jeffrey, A., and Vournakis, J.N. (1975). Full length
and discrete partial reverse transcripts of globin and chorion mRNAs. Cell, 4, 367-378.
Ekmekci, B., McAnany, C.E., and Mura, C. (2016). An Introduction to Programming for
Bioscientists: A Python-Based Primer. PLoS Comput Biol 12(6): e1004867.
https://doi.org/10.1371/journal.pcbi.1004867.
Finlay, B. J., Span, A. S. W., and Harman, J. M. P. (1983). Nitrate respiration in primitive
eukaryotes. Nature, 303(5915), 333-336.
Garibyan, L., and Avashia, N. (2013). Polymerase chain reaction. The Journal of investigative
dermatology, 133(3), 1–4. https://doi.org/10.1038/jid.2013.1. 17
Gray, J. S., Wu, R. S. S., and Or, Y. Y. (2002). Effects of hypoxia and organic enrichment on the
coastal marine environment. Mar. Ecol. Prog. Ser. 238, 249–279.
Griggs, D., Stafford-Smith, M., Gaffney, O., Rockström J., Öhman M. C., Shyamsundar P.,
Steffen, W., Glaser, G., Kanie, N., and Noble, I. (2013). Sustainable development goals
for people and planet. Nature 495, 305–307. doi:10.1038/495305.
Hall, R. I., and Smol, J. P. (1999). Diatoms as indicators of lake eutrophication, in: The Diatoms:
Applications for the Environmental and Earth Sciences, edited by: Stoermer, E. F. and
Smol, J. P., Cambridge University Press, Cambridge, UK, 128-168.
https://doi.org/10.1111/j.1462-2920.2011.02485.x.
Harbers, M. (2008). The current status of cDNA cloning. Genomics, 91 pp. 232-242
Hinsen, K. (2002). High-Level Scientific Programming with Python. In: Proceedings of the
International Conference on Computational Science-Part III. ICCS’02. London, UK, UK:
Springer-Verlag; 2002. p. 691–700.
Jones, J. G., and Simon, B.M. (1980). Decomposition processes in the profundal region of
Blelham Tarn and the Lund Tubes. J. Ecology. 68, 493–512. doi:10.2307/2259418.
Junge, K., Eicken, H., and Deming, J.W. (2004). Bacterial activity at −2 to −20°C in Arctic
wintertime sea ice. Appl. Environ. Microbiol. 70 (1), 550-557 doi:
10.1128/AEM.70.1.550-557.
Kamp, A., de Beer, D., Nitsch, J.L., Lavik, G., and Stief, P. (2011). Diatoms respire nitrate to
survive dark and anoxic conditions. Proc Natl Acad Sci U S A 5;108(14):5649-54. doi:
10.1073/pnas.1015744108.
Kemp, A.L.W., MacInnis, G.A., and Harper, N.S. (1977). Sedimentation rates and a revised
sediment budget for Lake Erie. J Great Lakes Res 3, 221-233. 18
Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H.G. (1971). Studies on
polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by
DNA polymerases. J Mol Biol. 56(2):341-361. doi: 10.1016/0022-2836(71)90469-4.
Kohler, T., Labner, D., Thamm, B. and Pustowoit, B. (1995). Quantitation of mRNA by
polymerase chain reaction. Nonradioactive PCR methods. pp. 66–70. Springer-Verlag,
Berlin, Germany.
Koo, H., Mojib, N., Hakim, J.A., Hawes, I., Tanabe, Y., Andersen, D.T., and Bej, A.K. (2017).
Microbial Communities and Their Predicted Metabolic Functions in Growth Laminae of
a Unique Large Conical Mat from Lake Untersee, East Antarctica. Front. Microbiol.
8:1347. doi: 10.3389/fmicb.2017.01347.
Maloy, S., Moran, M. A., Mulholland, M. R., Sosik, H. M., and Spear, J. R. (2017). Microbes
and Climate Change: Report on an American Academy of Microbiology and American
Geophysical Union Colloquium held in Washington, DC, in March 2016 (American
Society for Microbiology, 2017).
Margulies, M., Egholm, M., and Altman, W. (2005). Genome sequencing in microfabricated
high-density picolitre reactors. Nature 437, 376–380.
https://doi.org/10.1038/nature03959.
Massé, S., Botrel, M., Walsh, D. A., and Maranger, R. (2019). Annual nitrification dynamics
in a seasonally ice-covered lake. PloS one, 14(3), e0213748.
https://doi.org/10.1371/journal.pone.0213748.
Michmerhuizen, C. M., Striegl, R.G., and Mcdonald, M.E. (1996). Potential methane emission
from north-temperate lakes following ice melt. Limnol. Oceanogr. 41, 985–991.
doi:10.4319/lo.1996.41.5.0985. 19
Mukherjee, M., Ray, A., Post, A.F., McKay, R.M., and Bullerjahn, G.S. (2016).
Identification, enumeration and diversity of nitrifying planktonic archaea and bacteria
in trophic end members of the Laurentian Great Lakes. J Great Lakes Res 2016;
42:39– 49 https://doi.org/10.1016/j.jglr.2015.11.007.
Mullis, K. (1990). The Unusual Origin of the Polymerase Chain Reaction. Scientific American,
262(4), 56-65. Retrieved January 13, 2021, from http://www.jstor.org/stable/24996713.
Mykytczuk, N.C.S., Foote, S.J., Omelon, C.R., Southam, G., Greer, C.W., and Whyte, L.G.
(2013). Bacterial growth at -15oC; molecular insights from the permafrost bacterium
Planococcus halocryophilus Or1. ISME J. 7, 1211-1226. doi: 10.1038/ismej.2013.8.
Newton, R.J., and McMahon, K.D. (2011). Seasonal differences in bacterial community
composition following nutrient additions in a eutrophic lake. Environ. Microbiol.
13(4):887–899. https://doi.org/10.1111/j.1462-2920.2010.02387.x.
Noonan, K.E., and Roninson, I.B. (1988). mRNA phenotyping by enzymatic amplification of
randomly primed cDNA. Nuc. Acids Res. 16(21): 10366.
Panikov, N.S., and Sizova, M.V. (2006). Growth kinetics of microorganisms isolated from
Alaskan soil and permafrost in solid media frozen down to −35°C. FEMS Microbiol.
Ecol. 59(2), 500-512. doi:10.1111/j.1574-6941.2006.00210.x.
Pearson, W. R. (2013). An introduction to sequence similarity ("homology") searching Current
protocols in bioinformatics, Chapter 3, Unit 3.1.
https://doi.org/10.1002/0471250953.bi0301s42.
Phelps, A. R., Peterson, K. M., and Jeffries, M. O. (1998). Methane efflux from high latitude
lakes during spring ice melt. J. Geophys. Res. 103, 29029–29036
doi:10.1029/98JD00044. 20
Piña-Ochoa, E., Høgslund, S., Geslin, E., Cedhagen, T., Revsbech, N. P., Nielsen, L. P.,
Schweizer, M., Jorissen, F., Rysgaard, S., and Risgaard-Petersen, N. (2010). Widespread
occurrence of nitrate storage and denitrification among Foraminifera and Gromiida.
Proceedings of the National Academy of Sciences, 107(3), 1148-1153.
pp. 213-251.
Price, P.B., and Sowers, T. (2004). Temperature dependence of metabolic rates for microbial
growth, maintenance, and survival. Proc Natl Acad Sci U S A. 101(13):4631-6. doi:
10.1073/pnas.0400522101
Rankin, D. (2002). Freshwater Ecosystems and Human Populations: Great Lakes Case Study.
Risgaard-Petersen, N., Langezaal, A.M., Ingvardsen, S., Schmid, M.C., Jetten, M.S., Op den
Camp, H.J., Derksen, J.W., Piña-Ochoa, E., Eriksson, S.P., Nielsen, L.P., Revsbech, N.P.,
Cedhagen, T. and van der Zwaan, G.J. (2006). Evidence for complete denitrification in a
benthic foraminifer. Nature. 7;443(7107):93-6. doi: 10.1038/nature05070.
Rivkina, E., Shcherbakova, V., Laurinavichius, K., Petrovskaya, L., Krivushin, K., Kraev, G.,
Pecheritsina, S., and Gilichinsky, D. (2007). Biogeochemistry of methane and
methanogenic archaea in permafrost. FEMS Microbiol. Ecol. 61, 1–15.
Rogozin, D. Y., Zykov, V. V., Chernetsky, M. Y., Degermendzhy, A.G., and Gulati, R.D.
(2009). Effect of winter conditions on distributions of anoxic phototrophic bacteria in two
meromictic lakes in Siberia, Russia. Aquat. Ecol. 43, 661–672. doi:10.1007/s10452-009-
9270-7.
Rosel, S., Allgaier, M., and Grossart, H.P. (2012). Long-term characterization of free-living and
particle-associated bacterial communities in Lake Tiefwaren reveals distinct seasonal
patterns. Microb. Ecol. 3, 571–583. doi:10.1007/s00248-012-0049-3. 21
Sambrook, J., Russell, D. W., and Russell, D. W. (2001). Molecular Cloning: A Laboratory
Manual (Vol. 999). New York: Cold spring harbor laboratory press.
Shade, A., Jones, S. E., and Mcmahon, K. D. (2008). The influence of habitat heterogeneity on
freshwater bacterial community composition and dynamics. Environ. Microbiol. 10,
1057–1067. doi:10.1111/j.1462-2920.2007.01527.x.
Shoun, H., and Tanimoto, T. (1991). Denitrification by the fungus Fusarium oxysporum and
involvement of cytochrome P-450 in the respiratory nitrite reduction. Journal of
Biological Chemistry, 266(17), 11078-11082.
Siqueira, J. F., Fouad, A. F., and Rôças, I. N. (2012). Pyrosequencing as a tool for better
understanding of human microbiomes. Journal of oral microbiology, 4,
10.3402/jom.v4i0.10743. https://doi.org/10.3402/jom.v4i0.10743.
Skidmore, M. L., Foght, J. M., and Sharp, M. J. (2000). Microbial life beneath a high arctic
glacier. Applied and environmental microbiology, 66(8), 3214–3220.
https://doi.org/10.1128/aem.66.8.3214-3220.2000.
Synthesis of complementary DNA. Nat Methods 2, 151–152 (2005).
https://doi.org/10.1038/nmeth0205-151.
Temin, H., and Mizutani, S. (1970). Viral RNA-dependent DNA Polymerase: RNA-dependent
DNA Polymerase in Virions of Rous Sarcoma Virus. Nature 226, 1211–1213
https://doi.org/10.1038/2261211a0.
Tilman, D., Kiesling, R. L., Sterner, R., Kilham, S. S., and Johnson, F. A. (1986). Green,
bluegreen and diatom algae: taxonomic differences in competitive ability for phosphorus,
silicon, and nitrogen. Arch. Hydrobiol. 106, 473–485. 22
Townsend, A.R., Cleveland, C.C., Asner, G.P., and Bustamante, M.M.C. (2007). Controls over
foliar N:P ratios in tropical rain forests. Ecology 88, 107–118.
Tulonen, T. (1993). Bacterial production in a mesohumic lake estimated from [14C] leucine
incorporation rate. Microb. Ecol. 26, 201–217. doi:10.1007/BF00176953.
Tulonen, T., Kankaala, P., Ojala A., and Arvola, L. (1994). Factors controlling production of
phytoplankton and bacteria under ice in a humic, boreal lake. J. Plankton Res. 16, 1411–
1432. doi:10.1093/plankt/16.10.1411.
Tung, H.C., Bramall, N. E., and Price, P. B. (2005). Microbial origin of excess methane in
glacial ice and implications for life on Mars. Proceedings of the National Academy of
Sciences Dec 2005, 102 (51) 18292-18296. DOI:10.1073/pnas.0507601102.
Twiss, M.R., McKay, R.M.L., Bourbonniere, R.A., Bullerjahn, G.S., Carrick, H., Smith, R.E.H.,
Winter, J.G., D'souza, N.A., Furey, P.C., Lashaway, A.R., and Saxton, M.A. (2012).
Diatoms abound in ice-covered Lake Erie: An investigation of offshore winter limnology
in Lake Erie over the period 2007 to 2010. J. Great Lakes Res. 38, 18-30.
doi:10.1016/j.jglr.2011.12.008.
United states environmental protection agency. (2011).
https://www.epa.gov/sites/production/files/201509/documents/binational_nutrient_manag
ement.pdf
Usuda, K., Toritsuka, N., Matsuo, Y., Kim, D. H., and Shoun, H. (1995). Denitrification by the
fungus Cylindrocarpon tonkinense: anaerobic cell growth and two isozyme forms of
cytochrome P-450nor. Applied and Environmental Microbiology, 61(3), 883-889.
Waples, J.T., Eadie, B., Klump, J.V., Squires, M., Cotner, J., and McKinley, G. (2008). The
Laurentian Great Lakes. North American continental margins: a synthesis and planning 23
workshop. U.S. Carbon Cycle Science Program B. Hales, W. Cai, G. Mitchell, C.L.
Sabine, O. Schofield (Eds.). p. 110.
Whittaker, R.H. (1972). Evolution and Measurement of Species Diversity. Taxon 21,
Yale School of Forestry and Environmental Studies. Bulletin Series 107. Accessed: 10-31-2019.
http://environment.yale.edu/topics/788.
Yang, Y., Dai, Y., Wu, Z., Xie, S., and Liu, Y. (2016). Temporal and Spatial Dynamics of
Archaeal Communities in Two Freshwater Lakes at Different Trophic Status. Front.
Microbiol. 7:451. doi: 10.3389/fmicb.2016.00451.
24
CHAPTER II. ORGANISM DIVERSITY IN LAKE ERIE
Lake Erie
Amongst the five great lakes, Lake Erie experiences the highest number of human activities. The lake is used for recreational, agricultural, transport, and industrial purposes, thus exposing it to many forms of contamination. The hypoxia problem in the central basin of Lake
Erie has been attributed to harmful algal blooms, which are followed by bacterial decomposition
(Scavia et al., 2014). In addressing this problem, cyanobacteria species are the primary concerns as some are known to produce toxins with public health effects. They have been found in many freshwater ecosystems, including Lake Erie (Rinta-Kanto et al., 2005; Rinta-Kanto and Wilhelm,
2006; Graham et al., 2010; Foss and Aubel, 2015; Loftin et al., 2016). Another significant microbial community found in Lake Erie consists of phytoplankton, dominated by diatoms such as Fragilaria and Aulacoseira (Scavia et al., 2014, Beall et al., 2016). Studies of the lake community have focused on cyanobacteria and diatoms.
Metabolic activities in lake ice
Many of the organisms found in the Lake Vostok ice were deduced to be capable of nitrogen fixation, including, Geobacillus kaustophilus, Halomonas sp., Herbaspirillum sp.,
Nostoc punctiforme, and Synechococcus sp. (Shtarkman et al., 2013). Chemolithotrophic bacteria and archaea possess the ability to fix carbon under dark conditions (Pachiadaki et al., 2017).
Bacteria identified from the Lake Vostok sequences may be capable of nitrogen fixation, denitrification, nitrate reduction, sulfur reduction, and many other metabolic pathways (Gura and
Rogers 2020; Rogers et al., 2013; Shtarkman et al., 2013). Understanding the ecology of microbial communities relies on comprehensive and integrated information about the identities of the microbes, as well as their potential metabolic capabilities (Sherr et al., 1999). Members of 25
Archaea have been found in extreme marine environments and sometimes in halophilic environments. While it was once thought that the Archaea were all extremophiles, it is now known that various species of Archaea grow in moderate environments, as well as hot, cold, salty, acidic, alkaline, and other environments (DeLong, 1998). The specific metabolic roles of the species present in Lake Erie ice has not been investigated in detail, which was one of the major focuses that this research addressed.
Previous research
Previous studies have shown that microbial communities can actively grow and survive in extreme environments such as ice (Bertilsson et al., 2013). Diverse microbial communities, including Verrucomicrobia, Proteobacteria, Bacteroidetes, and others have been found in Lake
Erie beneath the ice (Beall et al., 2015). Similarly, a diverse community consisting of
Proteobacteria, Actinobacteria, Bacteroidetes, and Planctomycetes was described in permanently frozen lakes in Antarctica (Glatz et al., 2006; Priscu et al., 1999). Major bacterial taxa found in subglacial Lake Vostok ice included Firmicutes, Proteobacteria, Cyanobacteria, Actinobacteria, and Bacteroides (Rogers et al., 2013; Shtarkman et al., 2013; Gura and Rogers 2020). Ice cover drives critical biological changes for the lake ecosystem (Moore et al. 2009; Benson et al. 2012).
Microbial community changes in freshwater lakes covered with ice are dynamic, which may depend on several factors such as light, temperature, nutrient cycling, and snow characteristics.
During the ice cover period, Lake Erie water was reported to be dominated by large diatoms
(Beall et al., 2016). In contrast, Twiss et al., 2012 reported no difference in the ice-free and ice- covered periods. During the ice-covered period, some lakes are dominated by smaller diato species (Wetzel, 2001). These studies confirmed that there is an association between ice-covered conditions and the presence of diatoms in the lake that is not yet fully understood. Beal et al., 26
2016 showed that bacterial abundance during the ice-covered period was four times lower than in summer. They reported that the populations of Actinobacteria, Acidobacteria, Bacteroidetes,
Gemmatimonadetes, Planctomycetes, Proteobacteria and Verrucomicrobia differed between the high-ice and low-ice periods. In addition, they reported low cyanobacterial levels, a major bacterial taxon during the summer. A study on Lake Erie sediment showed that the occurrence of
Microcystis species (a major cyanobacteria group) decreases over the winter (Kitchens et al.,
2018). Presently, the complete inventory of microbial species in Lake Erie is unknown. It is important to determine the functional profiles and interactions that exist between these communities that may enhance or degrade the lake ecosystem, which is the focus of this study.
Purpose of research
The main aim of this study was to determine the species and physiological characteristics represented by the metagenomic and metatranscriptomic sequences from an ice sample collected from the central basin of Lake Erie and to relate these to the lake ecosystem, as well as the inputs from various sources within and surrounding the Lake Erie.
The specific aims included:
Enumerate species from the metagenomic and metatranscriptomic sequences obtained from a
Lake Erie ice sample.
● Determine the physiological characteristics of the species.
● Provide a compilation of the metabolic characteristics of the species.
● Produce a model of the microbial community in the ice and compare this to other studies
of Lake Erie water samples.
27
Materials and methods
Sample preparation
The sample used in this study was collected from Station 84 (41°56.08 N, 80°52.18 W) in the central basin of Lake Erie in January 2010 (Figure 2). The ice was cut from the surface ice with chainsaws. In the lab, the surfaces of the ice sample were decontaminated with cold (4°C) sodium hypochlorite, followed by rinsing with cold sterile RO water (18 mΩ, <1 ppm total organic carbon), and then melting at room temperature in a sterile hood. Cells and nucleic acids were concentrated by ultracentrifugation at 100,000 xg for 16 hours using the Beckman L8-M ultracentrifuge (described in Rogers et al., 2013 & Shtarkman et al., 2013).
Figure 2. Location of sample. Station 84 of the central basin of Lake Erie. 28
DNA/RNA extraction
Pellets from ultracentrifugation were rehydrated in 50 μl of sterile 0.1X TE (1 mM Tris
[pH 7.5], 0.1 mM EDTA). DNA and RNA were extracted using a MinElute Virus Spin Kit
(QIAGEN, Valencia, CA), according to the manufacturer's instructions. About 1100 μl CSF
NPS-lysis buffer mixture was mixed with 75 μl of protease, and then 550 μl of a Buffer
AL/Carrier RNA mixture was added. After incubating at 56 °C for 15 min, 600 μl of ethanol was added, and the mixture was incubated for five more minutes. The entire volume of the sample was then added to a spin column. The sample was then drawn through the column to allow the nucleic acids to bind to the silica membrane. A series of washes with ethanol were performed, and nucleic acids were eluted into 55 μl of Buffer AVE. cDNA synthesis
Complementary DNA copies (cDNA) were made from the RNA using a cDNA kit
(Invitrogen SuperScript II Choice System, Invitrogen, Grand Island, NY, USA), with random hexamer primers, following the manufacturer's instructions (described in Rogers et al. 2013,
Shtarkman et al., 2013), including ligation of EcoRI (NotI) adapters onto the ends of the cDNAs.
The resulting cDNAs were fractionated (single drops) on Sephacryl S-500 HR columns.
Fractions 6-25 were chosen for PCR reactions to ensure that the cDNAs’ size meet the sequencing criteria. Following PCR amplification conditions, using EcoRI (NotI) primers
(AATTCGCGGCCGCGTCGA), all were assayed by agarose gel electrophoresis. Each fraction was precipitated with ethanol, dried, and rehydrated in 0.1X TE. Next, 454 primers A
(CGTATCGCCTCCCTCGCGCCATCAGAATTCGCGGCCGCGTCGAC) and B
(CTATGCGCCTTGCCAGCCCGCTCAGAATTCGCGGCCGCGTCGAC) were added in a
PCR amplification reaction (described in Rogers et al. 2013, Shtarkman et al. 2013). Following 29 quantification by agarose gel electrophoresis, the samples were sent to Roche Life Sciences 454
Technologies (Roche Life Sciences, Branford, CT, USA) for 454 pyrosequencing using a 454
GS Junior System Sequencer.
Sequence analysis
The high-quality sequences were extracted from the file determined by the sequencing facility in a FASTQ format. They were subjected to MegaBLAST analysis, using a cut-off e- value of 10-10. Taxonomic assignments were made based on the top BLAST matches. Duplicate accession numbers were removed. The top 10 similar sequences that could be aligned over at least 100 nucleotides were retrieved. Then, the top BLASTN matches that specified a genus, species, and/or strain/isolate from the top 10 similar sequences were retrieved and determined and one consensus was used for taxonomic classification.
Taxonomic proportions
Detailed analyses of taxonomic proportions were determined at the Domain, Kingdom, and Phylum levels using MG-RAST (The Metagenomics RAST server, BMC Bioinformatics
2008; www.mg-rast.org) and Galaxy (The Galaxy platform; www.usegalaxy.org).
Metabolic classifications
After the duplicate sequences were removed, 68,422 unique sequences remained. Of these, approximately 80% sequences were bacterial sequences. Excluding the uncultured bacterial sequences, the sequences were analyzed and sorted into tables showing their taxonomic affiliations, important metabolic capabilities, habitat, and any special functions for each organism. This information was retrieved through internet searches, online publications, uniport database (available at https://www.uniprot.org/), and the Bacdive database (available at 30 https://bacdive.dsmz.de/). Finally, the information retrieved about these organisms was used to compile their potential metabolic activities, such as carbon fixation and nitrogen fixation.
Comparison with previous Lake Erie water study
Previous information from Lake Erie water and sediment studies were considered for comparison. The taxonomic taxa represented in a study conducted by Beall et al., 2016 with and without ice cover (using 16S rRNA sequences) was compared with the results of this research.
Results and discussion
Result summary
An ice sample collected from Lake Erie's central basin was analyzed in this research, and
68,422 unique sequences were recovered belonging to Bacteria, Archaea, and Eukarya. The results presented in this study show that Lake Erie ice consists of a broad diversity of organisms, some of which have not been reported in the lake water itself. A total of 42,967 (67%) of the sequences could not be determined to species, but 40,010 were classified as bacteria, 70 were archaea, and 1,549 sequences were eukaryotes. After the removal of unknown sequences, a total number of known sequences was 25,450 sequences with 57, 19,716, and 5,677 belonging to
Archaea, Bacteria, and Eukarya, respectively. The sequences identified as bacteria belonged to numerous phyla, including Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,
Bacteroides, Chloroflexi, Chlorobi, Firmicutes, Tenericutes, Thermotogae, Deinococcus-
Thermus, and Verrucomicrobia, with more than half of the sequences in the Proteobacteria.
Amongst the bacteria, the sequences matched 386 species with 100% percentage identity, and
845 species with at least 97% percentage identity (percentage identities are presented in
Appendix B). The 57 archaeal sequences found were within the Euryarchaeota and
Thaumarcheota. Among the Eukarya, the largest representation was from the Opisthokonta 31
(primarily Arthropoda), Stramenopiles (primarily Bacilliarophyta), and Archaeplastida
(primarily Chlorophyta and Streptophyta). (Table 1). The eukarya sequences matched 284 species with 100% percentage identity, and 569 species with at least 97% percentage identity
(Appendix B) (Table 1). The species identified in this research live in habitats such as lakes, lake sediments, rivers, and oceans. Some are associated with animals and plants. A detailed compilation of all the species based on the sequences derived in this study is presented in
Appendix A.
In this study, the organisms found are potentially capable of several metabolic functions, such as nitrogen fixation, carbon fixation, iron reduction, sulfur oxidation, and hydrocarbon degradation (Table 1). Pathogen and toxin-producing organisms also were found in the sequences. These results suggest that the ice contains a large diversity of organisms with a broad range of metabolic activities. Microbial diversity in Lake Erie water has been reported to vary between the summer and winter seasons. Diverse bacterial communities, including
Verrucomicrobia, Proteobacteria, Bacteroidetes, and others have been found in Lake Erie under ice cover. The research described here indicates that a large diversity of organisms also exists in the winter ice, which differs from the collection of microbes in the underlying water. The presence of a microbial community associated with human activity such as industrial effluents, discharges from boats and ships, agricultural activity, and domestic and hospital waste indicates significant anthropogenic influences on the lake (Table 1). 32
Table 1: Summary of organisms from Lake Erie ice samples with information on physiology, ecology, and other important characteristics
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences EUKARYOTA 7266 1231 Amoebozoa 101 26 Aquatic, intracellular Heterotrophs parasite Apusozoa 38 5 Soil, aquatic Heterotroph, feed on bacteria Archaeplastida 598 186 Freshwater, marine, Autotrophs, photoautotrophic Glaucocystophyta 8 ND cold Rhodophyta 25 14 water environment, soil Viridplantae 485 172 Chlorophyta ND 109 Streptophyta ND 63
Protista 2016 387 Excavata 88 ND Freshwater, soil, marine Heterotrophic, autotrophic, parasitic
Hacrobia 101 21 Freshwater, marine, Mixotrophy, phototroph, Cryptophyta 74 21 brackish heterotroph
Haptophyta 8 ND SAR 1827 366 Stramenopiles 959 188 Soil, aquatic Photosynthetic Alveolata 538 120 Aquatic Heterotrophs, feeds on bacteria Rhizaria 330 28 Aquatic Heterotroph Opisthokonta 3006 638 Aquatic Heterotroph Fungi 1192 161 33
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Ascomycota 425 90 Freshwater, saltwater, Heterotroph decaying matters, extreme environment, terrestrial Basidiomycota 142 43 Terrestrial, freshwater, Heterotroph marine Blastocladiomycota 6 1 Freshwater, mud, soil, Heterotroph, feed on decomposing parasitize arthropods matter (saprotroph) Chytridiomycota 159 10 Aquatic, terrestrial, Heterotroph ponds, springs, arctic and Antarctic soil, peats, bogs, rivers, acidic soil Entorrhizomycota 2 ND Glomeromycota 37 4 Terrestrial, wetlands, Heterotroph salt marshes, associated with epiphytic plants Zygomycota 64 13 Soil, decaying plant Heterotroph material Unknown/unclassified fungi 356 ND Unknown Unknown Metazoan/Animalia 1799 464 Bilateria 1379 343 Acanthocephala 5 ND Parasitic, intestinal tract Heterotoph of fishes Annelida 60 13 Ocean, freshwater, damp Heterotroph, filter feeder, parasitic soil Arthropoda 575 151 Marine, fresh water, Heterotrophic, parasitic, filter terrestrial feeders Brachiopoda 2 1 Sea water Heterotrophic, filter feeder 34
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Bryozoa 9 2 Freshwater, lakes, Heterotrophic ponds Chordata 219 43 Marine, freshwater, Heterotrophic terrestrial Cephaloryncha 2 2 Marine sand, mud, Heterotrophic gravel Echinodermata 11 1 Marine Heterotrophic, filter feeder Gastrotricha 16 3 Freshwater, marine Heterotrophic
Kinorhyncha 3 ND Marine mud Heterotrophic Mollusca 132 45 Aquatic, marine, mud, Heterotroph, parasitic, free-living sand Nematoda 74 17 Soil Heterotrophic, parasitic Nematomorpha 3 2 Marine, freshwater Heterotrophic Nemertea 4 3 Marine, freshwater, Heterotrophic terrestrial Platyhelminthes 43 24 Freshwater, marine Free-living, parasitic, heterotrophic
Priapulida 2 2 Ocean sand, mud Heterotrophic Phoronida 1 1 - - Rotifera 121 24 Freshwater, moist land, Heterotrophic, parasitic marine, brackish water Sipuncula 2 1 Marine, benthic Heterotrophic Tardigrada 30 4 Aquatic, lake sediment, Heterotrophic freshwater Xenacoelomorpha 4 4 Marine Heterotrophic
Unclassified Bilateria 61 ND Unknown Unknown 35
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Cnidaria 335 118 Aquatic, marine Heterotroph Ctenophora 2 2 Marine Heterotroph Placozoa 7 ND Aquatic Heterotroph Porifera 48 11 Marine, freshwater Heterotroph lake/streams Unknown/unclassified 31 ND Unknown Unknown metazoan Unknown/unclassified 60 12 Marine Heterotroph Opisthokontha Uncultured/unclassified eukaryotes 1656 ND Unknown Unknown ARCHAEA 137 24
Euryarchaeota 44 18 Aquatic, marine, Methanogen, methanotroph Antarctica thermophilic, halophilic, extremophilic Thaumarchaeota 13 6 Aquatic, marine Methanogen halophilic, extremophilic Uncultured Archaea 70 ND Unknown Unknown BACTERIA 59726 2120 Acidobacteria 815 16 Soil, aquatic, mud, Heterotroph, chemoorganotroph tundra soil, thermophilic, acidophilic, psychrophilic 36
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Actinobacteria 1169 228 Soil, aquatic, sediment, Heterotroph, fixes nitrogen, nitrite thermophilic oxidation, ammonia oxidation, organic decomposition Aquificae 13 6 Marine, sediment, Autotroph, oxidizes hydrogen, thermophilic, reduces sulfate Armatimonadetes 15 3 Aquatic, soil Chemoheterotrophic Bacteroidetes/chlorobi group 1623 159 Aquatic, sediments, soil Fixes carbon thermophilic, psychrophilic, alkaliphilic Caldisericia 3 1 Thermophilic Sulfur reduction, chemoheterotroph Chlorochromatium 1 1 Freshwater Photoautotroph Chloroflexi 393 16 Thermophilic Phototroph Chlamydiae 60 16 Marine sediment - Chrysiogenetes 2 1 Aquatic Utilizes arsenic, reduces selenate
Cloacimonetes 2 1 Waste water - Cyanobacteria 1430 169 Aquatic, damp soil, Fixes nitrogen, carbon fixation Deferribacteres 9 3 Mesophilic, Chemoorganotroph, heterotroph thermophilic Deinococcus-Thermus 42 14 Radiation resistant, Chemoorganotroph, heterotroph aquatic, thermophilic, extremophilic Elusimicrobia 11 2 Marine, soils, sewage Cellulolytic sludge Fibrobacteres 20 1 Rumen Cellulolytic Firmicutes 861 270 Rumen, extremophilic, Heterotroph, cellulolytic thermophilic, 37
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences mesophilic, psychrophilic, psychroto lerant, halophilic, hot springs, deep sea thermophilic, anaerobic, aerobic Fusobacter 24 9 Anaerobic, parasitic Chemoorganotroph, heterotroph Gemmatimonadetes 120 1 Soil Aerobic heterotrophs Lentisphaerae 25 2 Marine Chemoheterotrophic Nitrospira 204 6 Marine Nitrite oxidation, hydrogen oxidation Planctomycetes 537 23 Fresh, brackish and Chemoautolithotrophic anammox, saline lakes/ponds, nitrite reduction using ammonium as anaerobic electron donor Proteobacteria 10189 1079 Alphaproteobacteria 1848 283 Glacial ice, soil, aquatic Nitrite reduction, nitrifying bacteria, denitrification, methylotrophic, uses inorganic sulfur, oxidizes sulfate and thiosulfate, carbon fixation Betaproteobacteria 3771 270 Thermophilic, Nitrogen fixation, nitrate reduction, mesophilic, methylotrophic, ammonia oxidation, psychrophilic, aquatic, carbon fixation, manganese- aerobic oxidation, iron oxidation, inorganic sulfur oxidation, arsenic oxidation Gammaproteobacteria 2691 427 Marine, soil, nitrogen fixation, nitrate reduction, thermophilic, halophilic, nitrite respiration psychrophilic, Delta/Epsilon 1314 98 Aquatic, halophilic, soil Sulfate reduction, carbon fixation, proteobacteria sulfur reduction, iron reduction 38
Phylum Reads Number of unique Ecology Potential metabolic capabilities sequences Zetaproteobacteria 2 1 Marine - Uncultured/unclassified 563 ND Unknown Unknown Proteobacteria Spirochaetia 82 25 Associated with animals Heterotroph Synergistia 9 5 Anaerobic, associated Heterotroph with human GIT, thermophilic Tenericutes 45 24 Associated with animals Heterotroph
Thermodesulfobacteria 5 3 Thermophilic, aquatic Sulfate reduction
Thermotogae 32 18 Thermophilic, aquatic Sulfur oxidation, sulfate reduction, degrades methanol Verrucomicrobia 660 18 Aquatic, soil, Antarctic Degrades mucin sea ice, acidophilic Uncultured bacterium 30384 ND Unknown Unknown 39
Summary of organisms
Archaea
A total of 24 unique archaeal organisms belonged to the Euryarchaeota (17) and
Thaumarchaeota (7). Most of them were closest to species that were thermophilic, halophilic, alkaliphilic, methanogenic, and methanotrophic (Table 2).
Bacteria
A total of 59,726 sequences that represented bacteria, with 2,120 unique sequences belonging totaxa, including Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,
Armatimonadetes, Aquficae, Bacteroidetes, Chloroflexi, Firmicutes, Tenericutes, Caldisericia,
Chlorobi, Chlorochromatium, Chlymadia, Chrysiogenetes, Cloacimonates, Cyanobacteria,
Defferibacteres, Elusmicrobia, Endomicrobia, Fibrobacteres, Fusobacteria, Gemmatimonadetes,
Lentisphareae, Nitrospira, Planctomycetes, Proteobacteria (Alphaproteobacteria,
Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria, Epsilonproteobacteria, and
Zetaproteobacteria), Spirochaetia, Synergista, and others (Table 1). Most of the bacterial sequences belonged to the Proteobacteria, with 11,503 sequences. Out of these only 563 sequences were unknown and not classified into the six subclasses. The majority of the organisms (3,771) were within the Betaproteobacteria. Some notable examples are Aquinicola tertiaricarbonis (97% identity to A. tertiaricarbonis strain L10), Cupraividus metallidurans
(98% identity to C. metallidurans CH34 megaplasmid), and Methylibium petroleiphilum (97% to
M. petroleiphilum strain X3b). They have been previously isolated from contaminated water sources (industrial wastewater and groundwater). This is followed by Gammaproteobacteria,
Alphaproteobacteria, Deltaproteobacteria, Epsilonbacteria, and Zetaproteobacteria, in order of prevalence. The organisms in Bacteria live in different environments, including marine, 40 freshwater, soil/sediments, ice, plants, and animals (Table 2). According to the environmental condition where the organisms can live and survive, the lake has a mix of mesophilic, thermophilic, thermotolerant, psychrophilic, psychrololerant, alkaliphilic, halophilic, and halotolerant bacteria (Figure 3).
Table 2: Number of unique sequences and their habitat information
Habitat Number of unique sequences
Soil/sediment 611
Plants associated 175
Fish associated 45
Ice/glaciers 57
Marine 183
Associated with clinical specimens 17
41
Figure 3. Proportions of unique sequences in different environmental conditions
Halo denotes halophilic and halotolerant organisms. Thermo denotes thermophilic, hyperthermophilic, and thermotolerant organisms. Psychro denotes psychrophilic or psychrotolerant organisms. RadioA denotes radiation-resistant organisms. Acid denotes acidophilic and acidotolerant organisms. Alkali denotes alkaliphilic and alkalitolerant organisms.
Extremophiles
In this study, we found 153 sequences close to organisms that were thermophilic or thermotolerant, and 27 organisms found in the sequences were previously isolated from hydrothermal vents. This suggests that the organisms might be entering the lake from industrial cooling wastewater from the industries and electrical power generation plants around, or from other warm water sources. There also were 92 sequences close to organisms known to be psychrophilic or psychrotolerant. This is understandable given that parts of Lake Erie are cold or frozen during parts of the year. We found 11 sequences in this study that are close to radiophilic 42 and radiotolerant organisms. They are found within the Deinococcus-Thermus (7), Bacteroidetes
(1), Actinobacteria (2) and Alphaproteobacteria (1). Generally, Deinoccoccus-Thermus consists of extremophiles. A notable organism is Deinococcus radiotolerans. It is a polyextremophile referred to as one of the world's toughest organisms. It can survive extreme conditions from cold to dehydration, extreme low pressures, low pH, and high doses of ionizing radiation. It was first isolated from canned food that had been exposed to high doses of gamma radiation, and recently it was found to have survived three years in outer space (Kawaguchi et al., 2020). In our study, there were 133 organisms similar to halophilic organisms belonging to Archaea and Bacteria.
The presence of halophilic organisms is attributed to the dumping of ballast water from ships, run-offs from road salt, as well as from industrial waste. A notable example is Halomonas salaria, a halophilic, piezophilic organism that has been previously isolated from saline water
(Kim et al., 2007). In this study, we also found two other notable halophilic organisms –
Alcanivorax diesellolei and Salinicola socius, which are capable of degrading alkanes and naphthalene, respectively. Again, this hints at an anthropogenic source for these organisms. We found three extreme halophilic archaea, including Halorubrum lacusprofundi, Halorubrum lacusprofundi, Halopiger xanaduensis and Natronobacterium gregoryi. The presence of extremely halophilic organisms is attributed to the dumping of ballast water from ships, from road salt, as well as from industrial waste. In this study, there were 35 sequences close to alkaliphilic organisms in the Bacteria and Archaea group. This also points to a possible anthropogenic source for these organisms. The ballast water tanks of ships can be filled with freshwater, saltwater, or brackish water, and subsequently dump them in Lake Erie (and other lakes) thereby introducing organisms that are not native to the lake. These ships introduce water 43 from the ocean and marine environments. Alternatively, it could also be that the sequences found in this study are similar to closely related freshwater species.
Cyanobacteria
A total of 1,430 unique cyanobacterial sequences were found. This represents the third largest phylum after Proteobacteria and Bacteroidetes/Chlorobi. There were 169 unique sequences that were similar to different cyanobacterial taxa. Some are known to be toxic and known to cause the seasonal algal blooms experienced in Lake Erie in the summer months. They can produce neurotoxins and hepatotoxins, which are toxic to humans and other animals. We found four of the most common five species of cyanobacteria commonly found in the great lakes
- Microcystis aeruginosa, Anabaena circinalis, Anabaena flos-aquae, and Aphanizomenon flos- aquae. In Lake Erie, the most common harmful species associated with blooms include species of Anabaena, Aphanizomenon, and Microcystis (Rinta-kanto et al. 2005). In the western basin of
Lake Erie, the Microcystis sp. are the most dominant taxa during the summer. The Microcystis found include M. aeruginosa, M. ichthyoblabe, M. flos-aquae, M. viridis, M. wessenbergi, M. botrys, and M. panniformis. The majority of the Microcystis species were M. aeruginosa. They are known to be the primary producers of microcystin in Lake Erie. (Rinta-kanto and Wilhelm,
2006). Many species, in addition to Microcystis species, can produce microcystins, including
Planktothrix (Ernst et al., 2001) Oscillatoria (Luukkainen et al., 1993), Nostoc (Beattie et al.,
1998), Anabaena (Halinen et al., 2007; Chorus & Welker, 2021) and Gloeotrichia (Carey et al.,
2007). We found 26 different species of Anabaena. Notables commonly implicated in algal bloom formation include Anabaena flos-aquae, A, circinalis, and A. spiroides. They are known for their ability to produce microcystins (Sivonen et al., 1992). Notable species found in
Aphanizomenon were Aphanizomenon flos-aquae. It has been previously isolated from 44 freshwater lakes and found to produce microcystin and cylindrospermopsin (Saker et al., 2005).
Others include A. ovalisporum and A. issatschenkoi that are producers of cylindrospermopsin and anatoxin, respectively (Quesada et al. 2006; Wood et al., 2007).
Our findings in this study differs from the work of Beall et al., 2016, where they reported low occurrences of cyanobacteria in lake water samples under the ice. This suggests that the cyanobacteria occurrence may be low in the lake water, but are present in higher numbers in the ice and then are seeded back into the water as the ice melts in the spring. Another study by
Kitchen et al. 2018 found that Microcystis species could survive in the lake sediments through the winter and that the Lake Erie sediments might be seeding the Microcystin species into the lake water during summer. This may be the same case with Lake Erie ice, such that the organisms are preserved until spring when the ice melts, thus releasing them back to the water.
This may suggest that the low abundance of cyanobacteria in the water during winter may be due to its greater survival in the lake sediment and ice.
Cellulolytic bacteria
Cellulolytic bacteria found were within the following taxa – Actinobacteria,
Bacteroidetes, Firmicutes, Fibrobacteres, Proteobacteria, Spirochaetes, and Thermotogae
(Intriago, 2012). The majority were within the Firmicutes (mainly Clostridium sp.) and
Actinobacteria (Carere et al. 2008). In this study we found 31 bacteria that can degrade cellulose, within the Actinobacteria (6), Bacteroidetes (3), Firmicutes (15), Proteobacteria,
Alphaproteobacteria (5) and Deltaproteobacteria (1)) and Fibrobacteres (1). Notable examples include Fibrobacter succinogenes and Clostridium cellulovorans. They are usually found in soil, human and animal gut, they aid in digesting cellulose and other complex carbohydrates. It is 45 likely that some of these originated in parts of animal fees that traveled to the lake in streams and rivers.
Oil/hydrocarbon degraders
In this study, 37 sequences were found that were closest to hydrocarbonoclastic bacteria within the Alphaproteobacteria (15), Betaproteobacteria (4), Gammaproteobacteria (13) and
Actinobacteria (4). These organisms are associated with the metabolism of benzene, squalene, toluene, ethylene, nitrobenzene, and polyaromatic hydrocarbons. Previously, the lake has been found to contain moderate concentrations of hydrocarbons (Eadie and Robbins 1987). This may be attributed to proximity of Lake Erie to oil refineries, oil storage facilities, coal-powered generating plants, leaking ships and boats, and transportation of crude oil across the lake by ships and pipelines. Two notable hydrocarbon degrading bacteria found in this study were
Pseudoxanthomonas spadix and Oleispira antarctica. The latter species is a psychrophilic bacterium previously isolated from the coast of Antarctica. It is a potential biodegradation candidate for remediation of oily water (Yakimov et al. 2003). Pseudoxanthomonas spadix was earlier isolated from gasoline contaminated water and can degrade all the six BTEX compounds - benzene, toluene, ethylbenzene, and o-, m-, and p-xylene (Kim et al., 2008). Alcanivorax borkumensis, Alcanivorax dieselolei, Alcanivorax sp. can degrade alkanes, while
Desulfatibacillum alkenivorans can degrade alkenes (Cravo-Laureau 004; Yakimov et al., 2007).
Their exact function in the lake is not clear, but may be able to degrade oil released into the lake.
Pathogens
In this study, we found sequences similar to organisms associated with diseases in plants, animals, and humans. Some pathogens (e.g Escherichia coli) may be able to persist for a long time in natural environment and cause disease once host contact is established. It has been shown 46 that as the population of E. coli O157:H7 reduced, some cells could survive for up to 234 days
(Duffitt et al., 2011). River inflow is a major source of transportation of pathogens into the lake
(Brookes et al., 2004), Lake Erie has about 90% of its inflow from Detroit River, and other inflows from surrounding rivers. These inflows may be the source of supply of pathogens into the lake.
Human pathogens
We found 163 species associated with a variety of diseases, and in humans some of them cause infections that are difficult to treat. In this study, we found species of organisms transmitted through vertebrates and invertebrates, including the 13 rickettsia species. They are tick-borne and are associated with cats, dogs, and humans. Others include Anaplasma phagocytophilum, Bartonella quintana, Kingella potus, Neisseria weaveri and Francisella tularensis transmitted through ticks, lice, and animal contacts. Some can cause diseases in humans and other animals. A notable example includes Waddlia chondrophila, which has been implicated in bovine (Rurangirwa et al., 1999) and human spontaneous abortions (Baud et al.,
2014). Also, Clostridium chauvoei is known for being pathogenic in cattle, but is now known to also be pathogenic in humans. Other important species include Streptococcus dysgalactiae,
Burkholderia mallei, and B. pseudomallei. Some of these organisms are emerging pathogens whose role in human disease is still unclear and can be difficult to treat. Examples include
Nocardia cyriacigeorgica, Klebsiella michiganensis, and Mycobacterium goodii. Some are pathogenic and are foodborne. This includes Cronobacter sakazakii and Cronobacter turicensis.
Pathogenic in animals
In our study, we found organisms that are associated with livestock animals, insects, fishes, and nematodes. We found 52 unique sequences similar to organisms that have been 47 previously found to be associated with insects. At least 34 of them form symbiotic relationships with insects such as rice weevils, beetles, ticks, ants, and aphids. However, we found five organisms that are pathogenic in insects. They include Photorhabdus asymbiotica, Photorhabdus luminescens, Pseudomonas entomophila, Bacillus thuringiensis, and Brevibacillus laterosporus.
We found 132 unique sequences similar to organisms associated with animals, including sheep, goats, cattle, cats, dogs, pigs, horses, and poultry (and other avians). Of these, 42 were similar to organisms that cause infections in animals. Notable examples include Bacillus anthracis,
Bartonella grahamii, Mycoplasma agalactiae, and Ornithobacterium rhinotracheale. Some cause infections of the gastrointestinal tracts of livestock. We found 44 unique sequences similar to organisms associated with fishes, 25 of which were pathogenic. It is interesting to find that in our sequences there are three species pathogenic in salmonid fish Renibacterium salmoninarum,
Piscirickettsia salmonis --- Flavobacterium psychrophilum. Flexibacter roseolus is another notorious fish pathogen.
Pathogenic in plants
Organisms associated with plants were found, including legumes, grasses, tomatoes, potatoes, and others. Some of them are beneficial such that they contribute significantly to the growth of the plants. This includes those that form an association with the plant root nodules to fix nitrogen. Some notable examples found in this study include Frankia sp., Mesorhizobium australicum, Mesorhizobium cicero, Methylobacterium nodulans, Rhizobium etli, Sinorhizobium americanum, Sinorhizobium arboris, Sinorhizobium morelense, Burkholderia nodosa,
Burkholderia diazotrophica, and Herbaspirillum lusitanum. However, 39 unique sequences similar to pathogenic organisms in plants also were found. Some notable examples include
Xanthomonas sacchari, a pathogenic bacterium that has been previously isolated from diseased 48 sugarcane. Also present were sequences of Xanthomonas oryzae and Dickeya zeae, which are both pathogenic in rice. Dickeya dadantii is a pathogen spread through water from infected plants or recycled irrigation water. It is also an insect pathogen in aphids. Agrobacterium tumefaciens and Spiroplasma kunkelii infect maize.
Comparison of the bacterial community with Lake Erie water study
A major finding is that the winter lake water sample with and without ice cover contained low numbers of cyanobacterial sequences. However, in this study there were relatively high numbers of cyanobacteria in the ice, which could then “seed” the water with cyanobacteria as the ice melts. In both the water and ice, proteobacterial (Alphaproteobacteria, Betaproteobacteria,
Gammaproteobacteria and Deltaproteobacteria) sequences occurred in high abundance in the lake. In the water and ice sample, the most and least abundant Classes were Betaproteobacteria and Deltaproteobacteria, respectively. This suggests that in Lake Erie the diversities of organisms in the water and in ice differ. In sea ice, there are many species that naturally live within the ice, as well as in pockets of air and water enveloped by ice (Boetius et al., 2015). It would be interesting to study the water ice interfaces, as well as areas of cracks, crevices, and air pockets in Lake Erie.
Eukaryotes
In this study, there were 7,226 sequences within Eukarya, with about 1,656 unclassified sequences. They belonged to 13 major taxonomic groups, including Alveolata, Amoebozoa,
Apusozoa, Euglenozoa, Cryptophyta, Glaucophyta, Haptophyta, Katablepharidophyta,
Opisthokonta, Rhizaria, Rhodophyta, Stramenopiles, and Viridiplantae. These eukaryotes are commonly found in terrestrial, marine, brackish water, and freshwater environments. 49
The highest proportion of sequences were within the Opisthokonta, which is divided into
Fungi and Animalia, including humans. Within the fungi, there were species within nine subdivisions, including Ascomycota, Basidiomycota, Enthomophthoromycota,
Blastocladiomycetes, Chytridiomycota, Glomeromycota, Kickxellomycota, Mucoromycota, and
Entorrhizomycota. Under the Animalia, sequences within the Bilateria, Cnidaria, Ctenophora,
Phoronida, and Porifera were present. The Opisthokonta (3,006) are the most abundant, followed by the Stramenopiles (959), Alveolata (538), Viridiplantae (485), and Amoebozoa (101).
SAR (stramenopiles, alveolates, rhizaria)
The SAR clade includes Stramenopiles, Alveolata, and Rhizaria. It contains a large diversity of organisms, with at least 60,944 described species (Grattepanche et al., 2018). They represent a large part (50%) of the eukaryotic diversity (del Campo et al., 2014) and are found in diverse environments, including marine, freshwater, soil, and many are involved in symbiotic and endosymbiotic relationships. Stramenopiles include the diatoms, brown algae and oomycetes. The Alveolata consists of dinoflagellates, apicomplexa, and ciliates. The Rhizaria contains the Cercozoa, Foraminifera, and the Polycystinea. Overall, in this study, Stramenopiles comprised 72% of the unique species (sequences) within the SAR group. Diatoms predominated among the Stramenopiles (91 of the 182 unique sequences). The majority of diatoms are photoautotrophs, which partly explains their presence at the lake surface (within the ice). Small numbers are either animal pathogens (16) or plant pathogens (14). The alveolates are the next most numerous (43, in terms of unique species/sequences), comprising 17% of the total. Of these, most are dinoflagellates (42%; 18 total). One-third of the alveolate species are animal pathogens. Only a few representatives of Rhizarians were found (28 total). 50
The Stramenopiles consist of heterokonts and oomycetes. The group consists of a large diversity of organisms such as free-living flagellates, parasites, single-cell diatoms, multicellular brown algae, and water molds (Derelle et al., 2016). In this study we found 959 sequences representing Stramenopiles, with 182 unique organisms. Oomycetes (or water molds) are protists with a mycelial growth that used to be classified as fungi, but now as Stramenopiles, which has been confirmed by a great deal of genomic data. They are mostly found in freshwater environments, but some are found in soils and in marine environments, where they are either free-living or parasitic.
Notable organisms found in this study in the oomycetes group include Achlya sparrowii, Achlya colorata, Amphanomyces, astaci, and Aphanomyces helicoides. Albugo laibachii is an oomycete that is a plant pathogen of Arabidopsis thaliana making the plant vulnerable to other diseases
(Kemen et al., 2011). Aphanomyces astaci is listed among the 100 World´s Worst Invasive Alien
Species (Lowe et al., 2000), and it infects crayfish to cause the cray plaque which is devastating in the European and North American populations (Martín-Torrijos et al., 2017). Another notable
Aphanomyces species is A. helicoides that is pathogenic in plants.
Diatoms are found in freshwater, marine environments, soils, and damp surfaces. They are a major part of the phytoplankton community and play a significant role in the carbon cycle, carbon sequestration, recycling nitrogen, and silica deposition. Through photosynthesis, they can supply enormous amounts of organic material that supports ecosystems and at the same time are involved in biogeochemical cycling of other nutrients such as nitrogen (Armbrust, 2009; Bowler et al., 2010). Microscopic photosynthetic plankton (phytoplankton) provide the organic biomass on which most ocean life depends and fuel a range of essential biogeochemical processes, ranging from the generation of oxygen, the recycling of elemental nutrients, and the removal of carbon dioxide from the atmosphere. They handle around 45% of global primary production and 51 represent just 1% of Earth’s photosynthetic biomass (Field et al., 1998). This is attributed to their rapid multiplication and the photosynthetically active nature of the cells (Benoiston et al., 2017).
In this study, notable members of the diatom group were species of Aulacoseira and
Pseudo-nitzschia calliantha. Aulacoseira species found include A. islandica, A. ambigua, A. baicalensis, A. distans, A. granulata, and A. skvortzowii. These species have previously been found in the Great Lakes water environment including Lake Erie (Lashaway and Carrick 2010;
Twiss et al., 2012; Reavie and Kireta 2015 al. 2012). They are used as environmental bioindicators for phosphorous inflow in lakes. Aulacoseira islandica has been associated with winter blooms in Lake Erie (Twiss et al., 2012). Pseudo-nitzschia species found include P. calliantha, P. galaxiae, P. multiseries, and P. pseudodelicatissima. They are known to produce a neurotoxin called domoic acid (Besiktepe et al., 2008), which is responsible for the neurological disorder in humans (and other animals) known as amnesic shellfish poisoning (ASP) (Bates et al., 1989). Neurological symptoms (including fatalities) occur at levels between 0.3 and 1.3 mg/kg.
Alveolates are mostly unicellular organisms, although some species form filaments or chains, while others have large and complex cells that can extend to millimeters in length
(Grattepanche et al., 2018). They can be parasitic (e.g., apicomplexans), heterotrophic (e.g., ciliates, some dinoflagellates), autotrophic (e.g., some dinoflagellates), and mixotrophic (with true plastids or kleptoplastid; e.g., dinotoms and ciliates; Grattepanche et al., 2018). In this study
538 sequences were found representing organisms in the Alveolata with 140 unique organisms.
The Apicomplexa are single-celled, obligate intracellular protozoan organisms that all have a parasitic lifestyle. However, it is now clear that some species contain non-photosynthetic plastids, and others have been found living freely in the oceans and in the soils of Neotropical 52 forests (De Vargas et al., 2015). A notable member of the Apicomplexa group is Plasmodium, a parasitic organism that causes malaria. Perkinsus atlanticus belongs to the apicomplexan group, which lives on and is pathogenic in bivalve mollusks (e.g clams and oysters). It has become a major concern among marine researchers and food producers since its identification in 1950
(Mackin et al., 1950). Sarcocystis are members of apicomplexan that are parasitic in animals, A notable member of this group found in our study is Sarcocystis rileyi, that causes rice breast diseases in waterfowl. Others that are pathogenic in different animals include Sarcocystis fayeri
(horse pathogen), Sarcocystis moulei (Sheep and goat pathogen), and Sarcocystis muris (cat and mouse pathogen). Also, in this group, organisms were found that are pathogenic in humans and animals, a notable example being the protozoan parasite Toxoplasma gondii that infects warm- blooded animals including humans. Others include Babesia gibsoni (blood parasite in dogs),
Besnoitia darling (infects skin, eyes, mucous membranes of cats, wild animals, and domestic livestock) and Eimeria tenella (pathogenic in chickens and livestock). Neospora caninum is a member of Apicomplexa that is a major pathogen in dogs and also causes diseases in horses, goats, sheep, and deer. Plasmodium cynomolgi is an apicomplexan that is widely spread in south
Asia. It infects macaque monkeys, but rarely infects humans (Martinelli and Culleton, 2018).
Most dinoflagellate species are photosynthetic, and others are predatory and parasitic.
They can be found in both marine and freshwater environments (Hinchliff et al., 2015). Some dinoflagellates cause red tides and can produce toxins. It has become a major concern because of their harmful effects on public health, the environment, fisheries, and other organisms
(Shumway, 1990, Van Dolah, 2000). In this study, some dinoflagellates were found that are associated with red tides, including Tovellia paldangensis, Esoptrodinium sp, Peridiniopsis pernardii, Peridimium aciculiferum, Peridinium baicalense, Peridinium euryceps, Karenia 53 umbella, Karenia mikimoto. The Karenia species are found in marine environments and are known to cause dense algae blooms that are very toxic in fishes and marine animals. Pfiesteria piscicida is a dinoflagellate associated with harmful algal blooms, responsible for killing fishes due to its toxicity and its toxins may have adverse effects in humans (Grattan et al., 2001). Some cold-water dinoflagellates were also found in this research, including Scrippsiella hangoei,
Polarella glacialsis, and Prorocentrum micans. Dinoflagellates can provide ecological benefits by forming associations with Cnidaria (e.g Montastraea cavernova), which creates coral reefs that support some remarkably diverse and productive marine ecosystems (Coffroth et al., 2006).
Because the dinoflagellate sequences found in this research are marine organisms, the origins of the sequences are likely being transported on ships that have recently been travelling in the
Atlantic Ocean.
Ciliates are unicellular, heterokaryotic organisms with a macronucleus and micronucleus that are different in size and function (Raikov 1972). Ciliates are found in a variety of habitats including on or inside various animals as commensals or parasites. Some species can colonize the surface of crustaceans and water beetles, while others can infect fishes (Ichtyophthirius) and humans (Balantidium) (Foissner et al., 2007). In this study, Cryptocaryon irritans, a marine fish pathogen, was found. Kuklikophrya ougandae also was found. It has been previously isolated from soil (Foissner et al., 2008), and feeds on cyanobacteria. Also found was Notohymena apoaustralis, a freshwater ciliate that has been previously isolated from sewage sludge (Naqvi et al., 2016). Stentor muelleri and S. roeselii were found in this study and are usually found in freshwater feeding on bacteria and algae, often on filamentous algae. Another notable organism found was Tokophrya quadripartita, which infects copepods and has been previously found in lake Michigan (Evans et al., 1979). 54
Rhizarians are eukaryotic, single-celled, and free-living organisms with few parasitic members commonly found in freshwater and soil habitats (Grattepanche et al., 2018). While most are non-photosynthetic, members of one group, the chlorarachniophytes are photosynthetic.
In this study sequences were found from rhizarians belonging to chloroarachiphytes, cercozoans, foraminifera, and radiolarians. Two notable organisms found were Plasmodiophora brassicae, which infects plants causing the disease known as clubroot disease; and Rhogostoma minus that are pathogens of trout.
While the majority of species indicated by the sequence comparisons were freshwater species, over 40% were from marine sources, and 4% were brackish water species. There are at least two possible explanations for the large number of marine taxa. The first is that the sequence searches resulted in listing species that were closely related to the sequence in the Lake Erie ice sample, thus indicating a marine species that was closely allied taxonomically to the species that was in the ice sample. The second possibility is that ships transiting through the lake are depositing marine organisms and their nucleic acids into the lake as they pass or discharge ballast or cooling water.
Fungi
In this study, we found 162 unique sequences from fungi that belong to the Ascomycota,
Basidiomycota, Blastocladiomycota, Chytridiomycota, Kickxellomycota, Microsporidia
Chytridiomycota, Kickxellomycota, Microsporidia, Mucoromycota, Zygomycota, and
Glomeromycota. They are mostly Ascomycota (90) and Basidiomycota (43) with few species in the other groups. Fungi have been previously found in freshwater lake and terrestrial environments, with most of them belong to the Ascomycota, Basidiomycota, Chytridiomycota, and Glomeromycota (Shearer et al., 2007). Fungi play a key role in the degradation and recycling 55 of organic materials (e.g., plant leaves, wood, decaying materials) in terrestrial and aquatic environments including freshwater lakes. These species include pathogenic and non-pathogenic species found in a wide variety of environmental conditions (hot and cold, including in ice).
In this study, the members of the Ascomycota were mostly pathogenic species, causing disease in plants and allergenic to humans and animals. Notable examples that are pathogenic in plants include Alternaria alternata, Alternaria tomato, Eremothecium gossypii, Fumiglobus pieridicola, Leptosphaeria biglobosa, Neofusicoccum parvum, Neofusicoccum parvum,
Phaeosphaeriopsis glaucopunctata, and several others. Members of Ascomycota that are pathogenic or allergenic in humans include Pseudogymnoascus destructans, Rasamsonia emersonii, Rhinocladiella mackenziei, Millerozyma farinosa, Pseudogymnoascus destructans,
Cladophialophora yegresii, and Alternaria longipes. Three members of the Ascomycota found in this study are associated with insects, including Metarhizium anisopliae (pathogenic in insects), and Metschnikowia agaves and M. similis (infect daphnia and beetles). Amongst the
Basidiomycota group, several species are indicated, including Armillaria mellea, Coltriciella globosa, Heterobasidion irregulare, Coniophora puteana, Melanopsichium pennsylvanicum,
Phanerochaete carnosa, Phlebiopsis crassa, Pseudozyma hubeiensis, Sporisorium scitamineum,
Stereum gausapatum, Tilletiopsis cremea, T. lilacina, T. washingtonensis, and Trametes versicolor, Punctularia strigosozonata. Amongst the 43 species found in the Basidiomycota, only three are pathogenic in humans and they include Blastomyces gilchristii, Cryptococcus sp., and Trichosporon asahii. Most of the fungus species that were found are non-pathogenic except
56 for a member of Blastocladiomycota, Paraphysoderma sedebokerense (pathogenic in microalgae), and Microspridia sp. (pathogenic in honeybee).
Arthropods
In this study, 151 unique sequences are present that represent different kinds of arthropods. They were mostly crustaceans which include copepods, cladocerans, and parasitoids.
Copepods are small crustaceans that feed on phytoplankton, bacteria, and protists. They are found in either marine or freshwater environments. They are one of the most important marine animals as they form a major part of the food web that links benthic and pelagic organisms, fish and birds (Szaniawska, 2018). Crustaceans are a major carbon sink, because when they die their shells sink to the bottom of the lakes and oceans, thus taking the carbon out of the carbon cycle for some time. Also, they are an important part of the food web because they feed on small insects and other larger insects feed on them.
Daphnia species are small planktonic crustaceans (water fleas) commonly found in freshwater environments including large lakes, temporary pools, and vernal pools (Ebert, 2005). They are the most dominant zooplankton in water environments and are seasonally found in abundance during the spring and summer months (Kasprzak et al., 1999). They serve as food for larger aquatic organisms, feed on smaller organisms (e.g diatoms) and thus they are essential parts of food webs (Ebert, 2005). In this study we found nine Daphnia species including D. ambigua, D. dentifera, D. Dubia, D. laevis, D. longicephala, D. magna, D. occidentalis, D. pulex, and D. pulicaria. Also, two species related to the Daphnia species were found, Daphniopsis ephemeralis and Daphniopsis truncate. Daphnia species are of interest in lake ecology dynamics as they are associated with high transparency of lake environments during summer because they easily feed on smaller flagellates and diatoms from early spring (Kasprzak et al., 1999). Like 57 other crustaceans, cladocerans (including Daphnia sp.) are found in freshwater and feed on smaller organisms such as bacteria and algae through filter feeding. In this study, we found sequences that represent Simocephalus species, including S. beianensis, S. heilongjiangensis, S. serrulatus, and S. vetuloides. They are zooplankton commonly found in lakes and ponds. Some species are parasitoids (infects and kill the host). Notable examples among our sequences were
Copidosoma floridanum, Diaeretus leucopterus, and Fopius arisanus, which infect moths, aphids and tephritid fruit flies, respectively. Other important species found in this study include those that spread human diseases such as Aedes aegypti, Anopheles albimanus, and Cimex lectularius. Aedes aegypti spreads diseases such as yellow fever, Zika, dengue fever, and chikungunya. It has been previously found from the southern US through parts of the Midwest.
Cimex lectularius, commonly known as the bed bugs, infest warm blooded animals including humans and feed off their blood. They are also associated with the infestation of bedding, a major environmental problem in the US. human host and feed off of blood. Because of the wide distributions of arthropods in and around Lake Erie it is not surprising to find their nucleic acids in the lake ice.
Chordata
Chordates are found in marine, freshwater, and terrestrial environments. In this study 219 sequences were found representing the Chordata, with 42 unique species. These sequences indicate the presence of mammals (42.9%); fish (38.1%); reptiles (9.5%); and amphibians, birds, mollusks, and lancelets (collectively 2.4%). These species are found include terrestrial (40.5%); marine/brackish water/estuary (38.1%); freshwater (21.4%) environments.
58
Human activities associated with organisms found in Lake Erie
Our findings showed that organisms found in Lake Erie ice have been influenced by the human activities surrounding the lake. These include agricultural activities such as pig farming, crop farming, and poultry farming. Bovine sequences indicative of agricultural activities were found, as well as sequences from other domestic and native animal species. In addition, sequences from both native, agricultural, and cultivated plants were found. As with other parts of this study, Lake Erie exhibits a mixture of species that are native to the lake, as well as introduced species, some of which can be considered contaminants or pollution, and others that are invasive. There are organisms in the lake that indicate that they are foreign and may have been introduced by ships that dump their ballast water in the lake, including the well-studied zebra mussels (Dreissena polymorpha) and quagga mussels (D. rostiformis). We found thermophilic organisms indicative of dumping industrial water from manufacturing and electrical generation plants, as well as dumping from ships. We also found hydrocarbon-degrading organisms that may be attributed to sunken or leaking ships, recreational boating, and/or the presence of oil/power industries surrounding the lake. We found organisms that may indicate dumping of human, animal, and hospital waste. Many of the organisms were associated with gastrointestinal tracts, including pathogenic species. We found sequences close to Escherichia coli 0157, a serious human pathogen, likely being from human or other animal intestinal tracts.
Metabolic analysis
Organisms present in a specific environment are able to live together and benefit from each other as a result of diverse metabolic capabilities in a way that each organism depends on other metabolic products produced by other organisms and vice versa. The organisms found in
Lake Erie demonstrated notable metabolic activities such as carbon fixation, ammonium 59 oxidizer, iron oxidation, methanogenic, methylotrophic, methanotrophic, and nitrogen fixing ability. Major metabolic potentials demonstrated by organisms represented by the mRNA sequences derived from this study are shown in Figure 4-7.
Methanogenesis
Many species of Archaea are generally classified as methanogenic organisms based on phylogenetic analysis (Boone et al. 1993), however, most of the methanogens are within the
Euryarchaeota. The product of this process is methane, which other organisms are able to utilize
(discussed below). They are able to produce methane from different sources such as hydrogen and CO2, acetate, formate, hydrogen and methanol (Wagner et al., 2018). Amongst the archaeal sequences, we found 13 organisms that are capable of methanogenesis. An important example is Methanocella arvoryzae, which is a hydrogenotrophic methanogen that is capable of producing methane by utilizing hydrogen and CO2, and was previously isolated from a rice field
(Sakai et al., 2010). This is not surprising considering the high agricultural activity occurring around Lake Erie. Methanogenic archaea are frequently found in rice fields. These fields have been previously implicated in an increase of methane emission (Chen and Prinn, 2006). This suggests that the agricultural activity around Lake Erie is influencing the types of organisms found in the area. Another example of hydrogenotrophic methanogen found in this study is Methanoregula boonei which was previously isolated from a peat bog (Brauer et al., 2011).
Methanogenic archaea play a top role in the global carbon cycle and function in the processing of about 1- 2% of the carbon fixed each year (Reeburgh et al. 1993). These organisms can be of benefit in biotechnology, and in the treatment of sewage plants. However, the major implication of methanogenesis is that the methane produced is a major greenhouse gas that contributes 60 significantly to global climate change (Wagner et al., 2018). Taxa found in this study that are capable of methanogenesis are shown in Figure 4.
Figure 4. Potential methane metabolic abilities represented in the 454 sequences from Lake Erie ice
Methylotrophy
Methylotrophic organisms are capable of using one-carbon compounds such as methane and methanol, as their source of carbon and energy (Chistoserdova and Lidstrom, 2013).
Methane is produced biotically by methanogenic archaea and through human and industrial activities such as burning, coal mining and oil industrial activities, and agricultural activities
(plants emit methane, and agricultural practices can cause increases in methanogen populations)
(Iguchi et al., 2015). These organisms are found in both aquatic and terrestrial environments such as water, soil, lakes, wetlands, plants (Trotsenko and Murrell 2008), and extreme environments 61
(Antony et al. 2010). There are non-methane utilizing and methane utilizing methylotrophs. The latter are usually found within the Proteobacteria, (Alphaproteobacteria, Betaproteobacteria,
Gammaproteobacteria) and in the bacteria families Bacillaceae, Pseudonocardiaceae, and
Micrococcaceae (Chistoserdova and Lidstrom, 2013). In this study, we found 26 non-methane utilizing organisms, nine of which were in the Alphaproteobacteria and Betaproteobacteria, five were in the Family Piscirickettsiaceae of the Gammaproteobacteria, and one each was found in the Families Pseudonocardiaceae (Actinobacteria) and Bacillaceae (Firmicutes) (figure 4). A notable organism found among the sequences was Methanosalsum zhilinae. It is an archaeon in the Euryarchaeota that has been previously isolated from a haloalkaliphilic lake. There are areas around and under Lake Erie that are mined for salt and other minerals, which could be the source of this species.
Another notable methylotrophic organism found in the sequence that is able to utilize methanol is Bacillus methylotrophicus. It has been previously isolated from plants and has the ability to promote plant growth. The methane-utilizing methylotrophs are called methanotrophs.
They are able to utilize methane exclusively as a source of carbon and energy and play an important role in the carbon cycle. They are able to reduce methane emitted in the environment and thus might prove useful in reducing methane emissions as one method to reduce the effects of this greenhouse gas (Kumar et al., 2018). As expected, they are found in environments where methane is produced and present, such as wetlands, soils, marshes, rice paddies, landfills, lakes, oceans, and streams (Dalal and Allen, 2008). Many of the methanotrophs are within the
Proteobacteria (Alphaproteobacteria and Gammaproteobacteria) and Verrucomicrobia (Ho et al.,
2012). 62
In this study, 21 sequences were found from organisms that have the ability to utilize methane. Most were within the Proteobacteria (Alphaproteobacteria), while two in the
Verrucomicrobia (figure 4). Previous studies have identified three Verrucomicrobia species in acidophilic environments that are able to utilize methane (Dunfiel et al., 2007, Pol et al., 2007,
Islam et al., 2008). The two organisms are thermoacidophilic Methylacidiphilum fumariolicum and M. infernorum. Methylacidiphilum fumariolicum was isolated from a volcanic region (Pol et al., 2007) and M. infernorum was first isolated from a soil sample collected from a methane-emitting geothermal field (Hou et al., 2008). It is also important to note that we found one sequence that is close to an unculturable organism called Methylomirabilis oxyfera, found in the candidate NC10 phylum, a unique organism that is widely distributed in agricultural soils
(Shen et al., 2016). It is capable of utilizing methane and reducing nitrite (Ettwig et al., 2010).
This is interesting because of its ability to carry out both processes linking the carbon and nitrogen cycles in one organism, and thus plays an important role in biogeochemical processes and in the reduction of methane emitted into the environment (He et al., 2016).
Nitrogen fixation
Some bacteria are able to fix atmospheric N2 into NH3 (Lam et al., 1996). These bacteria are called diazotrophs and they are usually found in soil, water, and associated with plants such as some legumes and grasses. The free-living diazotrophs are found within the
Alphaproteobacteria (Rhizobium, Bradyrhizobium, Rhodobacterium), Betaproteobacteria
(Burkholderia, Nitrosospira), Deltaproteobacteria, Gammaproteobacteria (Pseudomonas,
Xanthomonas), Firmicutes, and Cyanobacteria (Rosenblueth et al., 2018). Some diazotrophs form symbiotic relationships with plants (some legumes) to fix nitrogen. They are found within genera Rhizobium, Bradyrhizobium, Mesorhizobium, and Sinorhizobium within 63
Alphaproteobacteria (Graham and Vance 2003). Nitrogen is a vital nutrient required for plant growth (Santi et al., 2013). However, plants are unable to directly use N2, but it is available to them in the form of ammonium and nitrates (Santi et al., 2013). Often, the amount of available nitrogen in soils is insufficient for crop plants. More than half of the quantity of nitrogen fertilizer amended into agricultural soil is used by the plants, while the remainder leaches into the environment resulting in nitrate contamination of the surrounding environment (Mahmud et al.,
2020) and subsequent eutrophication of streams, rivers, and lakes. This contamination is a source of concern as a result of issues related to health and environmental sustainability. It is worth noting that diazotrophs play major roles in contributing great amounts to the total nitrogen of the biosphere, contributing about 30 – 50% of the total nitrogen in crop fields (Ormeño-Orrillo et al.,
2013), thus reducing the need to use nitrogen fertilizer on the fields. In our study, 97 organisms were found that have the ability to fix nitrogen. Due to the high agricultural activity around Lake
Erie, it attracts substantial numbers of nitrogen-utilizing organisms because of the regular use of nitrate fertilizers, with a smaller proportion of organisms fixing unutilized nitrogen. As shown in figure 5, the majority of nitrogen fixers found in this study belong to the Proteobacteria (69 total;
42 Alphaproteobacteria, 19 Betaproteobacteria, 6 Gammaproteobacteria, and 2
Deltaproteobacteria), while others were within Cyanobacteria (14), Firmicutes (9), Bacteroidetes
(1), and Endomicrobia (1). A notable nitrogen fixer found in this study was Azoarcus tolulyticus, a bacterium that is capable of degrading toluene. It has been previously isolated from petroleum contaminated freshwater sediment (Zhou et al., 1995). It is not surprising to find such organisms in the ice sample because toluenes naturally occur in crude oil, and there are many petroleum- based and petroleum-dependent industries around Lake Erie. In our study, diatoms were found that are capable of forming associations with nitrogen fixing cyanobacteria. This association is 64 called diatom-diazotroph associations (DDA). Diatoms that are able to form this relationship are species within Hemiaulus, Rhizosolenia, Chaetoceros Guinardia, and Bacteriastrum (Caputo et al., 2018). In this study we found eight sequences in the genus Chaetoceros: C. compressus, C. contortus, C. decipiens, C. hirtisetus, C. laciniosus, C. rotosporus, C. simplex, and C. socialis.
The presence of DDAs have been associated with algal blooms that appear regularly during the summer, but their role is often ignored (Caputo et al., 2018, Follet et al., 2018). However, these blooms are a major concern in Lake Erie, as they are indicators of the conditions in the lake.
Figure 5. Potential nitrogen metabolic abilities represented in the 454 sequences from Lake Erie ice
Anaerobic ammonium oxidation
Anaerobic ammonia oxidizing bacteria are able to oxidize ammonia and reduce nitrite to produce nitrogen gas. The process is called anammox reaction. It was originally found in wastewater, however it has now been found in a variety of environments including marine, estuary, freshwater, and terrestrial habitats (Sonthiphand et al., 2014). Anammox bacteria are 65 also found in extreme environments such as extremely saline, cold, and hot environments
(Byrne et al., 2009; Russ et al., 2013). In this study we found seven sequences that were the closest to Anammoximicrobium moscowi, Brocadia annamoxidans, Brocadia sinica, Caldilinea aerophila, Isosphaera pallida, Jettenia asiatica, and Kuenenia stuttgartiensis, they belong to the planctomycetes group (Figure 5). They are of high interest amongst microbial ecologists and biotechnologists because of their unusual and unique metabolic capabilities. Anammox bacteria are responsible for up to 50% and 40% of the nitrogen loss from ocean and freshwater lakes, respectively (Dalsgaard et al., 2005; Yoshinaga et al., 2011). The presence of the unique group in
Lake Erie is not surprising, because low temperature favors the presence anammox bacteria
(Russ et al., 2013). Their presence in this lake also confirms the fact that anammox bacteria thrive in low oxygen environments such as those found in some regions of Lake Erie.
Ammonia oxidation
The process of nitrification includes two steps where ammonia oxidizing microorganisms
(bacteria and archaea) and nitrite oxidizing bacteria are involved in each step, respectively. Ammonia oxidizing microorganisms, including some bacteria and archaea, play important roles in nitrogen recycling. Although it was first thought that only bacteria are capable of ammonium oxidation, we now know that archaea too are capable of doing this (Treusch et al.,
2005). In this study sequences from both bacteria and archaea were found that indicate the presence of species that are able to oxidize ammonia to nitrite. In this study, signatures of 12 organisms were found that are capable of ammonia oxidizing within the Thaumarchaeota (3) and
Proteobacteria (Betaproteobacteria (6) and Gammaproteobacteria (3). The archaeal sequences include those from Nitrosoarchaeum limnia, Nitrosopumilus koreensis, and Nitrosopumilus maritimus. The organisms within the Betaproteobacteria include species of Nitrosomonas 66 communis, Nitrosomonas europaea, Nitrosomonas eutropha, Nitrosomonas oligotropha, Nitrosomonas sp., and Nitrosospira briensis. Organisms within the
Gammaproteobacteria include Nitrococcus oceani, Nitrosococcus halophilus, and Nitrosococcus watsoni. All the taxa represented are shown in figure 5. Ammonia oxidizers have been reported to occur in greater numbers during the summer than in the winter (Beman et al., 2012). This might explain the reason why low numbers of ammonia oxidizing archaea and bacteria were found in the ice.
Nitrite oxidizing bacteria
Nitrite oxidizing bacteria are involved in the second step of nitrification, converting nitrite to nitrate (Prosser, 1989). These organisms are found within the Proteobacteria
(Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria),
Chloroflexi, Nitrospirae, and the newly proposed Nitrospinae (Watson et al., 1986, Alawi et al.,
2007, Starkenburg et al., 2008, Spieck et al., 2014). In this study sequences close to
Magnetobacterium bavaricum, Nitrospira moscoviensis, and Nitrospira sp. were found within the Nitrospira, and Nitrotoga arctica, within the Betaproteobacteria. These organisms play a significant role in the nitrogen cycle, collaborating with ammonia-oxidizing bacteria to ensure a nitrification step in the nitrogen cycle. If nitrite oxidation does not occur, nitrates will be unavailable for plants and microbes that are vital to them (Daims et al., 2016). Additionally, the presence of nitrite prevents the growth of some microbes (Castellani and Niven 1954), and the increase in nitrite is harmful to fishes and other aquatic organisms as it converts hemoglobin to methemoglobin, causing severe oxygen deprivation (Lewis and Morris 1986). This further emphasizes the importance of nitrite oxidizers in aquatic ecosystems.
67
Denitrifying bacteria
Denitrifying bacteria can convert nitrate or nitrite to di-nitrogen or nitrogen in the absence of oxygen. Most are within the Proteobacteria (Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria) (Ji et al., 2015). In this study, we found 33 sequences close to bacteria capable of denitrification within the Alphaproteobacteria (4), Betaproteobacteria (8),
Gammaproteobacteria (14), Deltaproteobacteria (1), Actinomycetes (1), Aquificae (1),
Deferribacteres (3), and one Methylomirabilis oxyfera within the candidate phylum NC10. This suggests that denitrification ability is widespread in bacteria and not limited to certain phyla or genera as earlier suggested. Denitrifiers are involved in the nitrogen cycle to produce nitrogen ultimately. However, not all of them can carry out complete denitrification to nitrogen, resulting in nitrite formation, and the release of nitric oxide and nitrous oxide (greenhouse gases) that contribute to global climate change (Ravishankara et al., 2009, Erisman et al., 2011). The process of denitrification in the absence of oxygen also contributes to methane oxidation, which is a potent greenhouse gas. This is further driven by human activities such as pollution and agricultural activities (Raghoebarsing et al., 2006; Erisman et al., 2011). Denitrifying bacteria are responsible for removing nitrogen from the environment and may help control the degree of eutrophication (Seitzinger, 1986). Some are useful in bioremediation and can be used in waste treatment as they convert large amounts of nitrogen. Therefore, the denitrifying bacterial population in this lake is a very crucial component of the lake ecology. However, it can be inferred from our results and from the nitrogen cycle, the problems that are the result of human activities are complex and will be difficult to rectify. The fact that these organisms exist in the ice during the winter when microbial populations are lower in the water, indicates that a large reservoir of microbes is being released into the water as the ice melts during the spring. 68
Sulfur metabolism
Organisms capable of sulfur metabolism are found in sulfur rich environments and are often reported amongst bacteria (Chlorobi and Proteobacteria) and Archaea. They are commonly found within the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. In this study, 21 unique organisms were found that belongs to the 5 taxa, including Actinobacteria,
Nitrospira, Proteobacteria (Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria),
Thermotogae, and Deinococcus-Thermus (figure 6). One unique organism each was found in the
Actinobacteria, Nitrospira, Deinococcus-Thermus and Thermotogae, including
Acidithiomicrobium sp., Magnetobacterium bavaricum, Sulfurihydrogenibium sp., and Thermus scotoductus, respectively. Three organisms were found in the Betaproteobacteria, including
Sulfurisoma sediminicola, Sulfuritalea hydrogenivorans and Thiobacillus thioparus. Ten organisms were found in the Gammaproteobacteria, including Halothiobacillus neapolitanus,
Sulfuricaulis limicola, Thioalkalimicrobium aerophilum, Thioalkalimucrobium cyclicum,
Thioalkivibrio sp., Thioalkalivibrio sulfidophilus, Thioalkalivibrio versutus, Beggiatoa leptomitiformis, Ruthia magnifica, and Thiovicoccus mobilis. Four organisms were found in the
Deltaproteobacteria, including Sulfuricurvum kujiense, Sulfurimonas autotrophica, Sulfurimonas denitrificans and Sulfurivicum sp. 69
Figure 6. Potential sulfur metabolic abilities represented in the 454 sequences from Lake Erie ice
Sequences that represent organisms that can reduce sulphate were found, belonging to eight phyla, including Proteobacteria (Deltaproteobacteria and Gammaproteobacteria),
Thermodesulfobacteria, Firmicutes, Defferibacteres, Aquificae, Bacteroidetes, Thermotogae and
Defferibacteres (figure 6). The following sulphate reducing organisms found in the
Deltaproteobacteria include Desulfobacca acetoxidans, Desulfobacterium autotrophicum,
Desulfarculus baarsii, Desulfatibacillum alkenivorans, Desulfobacca acetoxidans,
Desulfobacterium autotrophicum, Desulfobacula toluolica, Desulfococcus oleovorans,
Desulfohalobium retbaense, Desulfomicrobium baculatum, Desulfomonile tiedjei,
Desulfonatronum lacustre, Desulfovibrio aespoeensis, Desulfovibrio africanus, Desulfovibrio alaskensis, Desulfovibrio gigas, Desulfovibrio desulfuricans, Desulfovibrio hydrothermalis,
Desulfovibrio magneticus, Desulfovibrio psychrotolerans, Desulfovibrio salexigens,
Desulfovibrio vulgaris, Desulfotalea psychrophila, Desulfovibrio piezophilus, and
Syntrophobacter fumaroxidans. Two were found in the Gammaproteobacteria, Thiocystis 70 violascens and Vesicomyosocius okutanii. All the three organisms found in the
Thermodesulfobacteria that can reduce sulphate are also mostly thermophilic or thermotolerant, including Thermodesulfobacterium commune, Thermodesulfobacterium geofontis, and
Thermodesulfatator indicus. One sequence each was found in the Aquificae, Bacteroidetes,
Thermotogae and Defferibacteres that are able reduce sulfate, including Desulfurobacterium thermolithotrophum, Desulfosporosinus meridiei, Thermotoga elfii, and Deferribacter desulfuricans, respectively. Sequences that represent members of the Firmicutes that can reduce sulfate were found, including Desulfotomaculum gibsoniae, Desulforudis audaxviator,
Desulfosporosinus acidiphilus, Desulfosporosinus orientis, Desulfosporosinus meridiei,
Desulfotomaculum acetoxidans, Desulfotomaculum carboxydivorans, Desulfotomaculum kuznetsovii, Desulfotomaculum reducens, Desulfotomaculum ruminis, Thermodesulfobium narugense, and Thermodesulfovibrio yellowstonii. Other unique organisms were found that can reduce sulfur and they were found in the Deltaproteobacteria and Firmicutes, including
Desulfurella acetivorans, Desulfuromonas acetoxidans, Sulfurospirillum deleyianum,
Shewanella amazonensis (all Deltaproteobacteria), and Clostridium sulfidigenes (Firmicutes).
Organisms involved in sulfur metabolism are important in the cycling of sulfur and protection of organisms in aquatic environment. For example, dissimilatory sulfur oxidation, a process carried out by sulfur oxidizing bacteria, can protect marine organisms from sulfide toxicity (Lavik et al.,
2009). In a hypoxic lake like Lake Erie, the presence of these organisms may be beneficial to mitigate consequences that arises from the lack of oxygen (e.g., loss of marine life, disruption of food webs).
71
Other notable metabolic capabilities
Other metabolic activities represented by the species identified in this study include degradation of iron, manganese, chlorate, and metals, such as uranium. Iron oxidizing bacteria are taxonomically found in the following taxa Proteobacteria (Alphaproteobacteria,
Betaproteobacteria, Gammaproteobacteria, and Zetaproteobacteria), Actinobacteria, Firmicutes,
Chlorobi and Nitrosospirae, and among the Archaea - Euryarchaeota and Chrenarcaeota (Hedrich et al., 2011; Emerson et al., 2013). In this study, sequences representing organisms were found that were capable of iron oxidation in the following taxa – Firmicutes (Desulfosporosinus orientis, Sulfobacillus acidophilus), Nitrospira (Leptospirillum ferriphilum and Leptospirillum ferrooxidans), Betaproteobacteria (Acidovorax ebereus, and Gallionella capsiferriformans), and
Gammaproteobacteria (Marinobacter aquaeolei) (figure 7). Those that have the potential to reduce iron were found in Gammaproteobacteria (Ferrimonas balearica, Shewanella amazonensis, Shewanella oneidensis, Shewanella putrfaciens) and Delatproteobacteria
(Anaeromyxobacter sp., Geobacter daltonii, Geobacter pickeringii, Geoalkalibacter subterraneus).
72
Figure 7. Potential iron metabolic abilities represented in the 454 sequences from Lake Erie ice
The following organisms that were found among the sequences are able oxidize acetate -
Firmicutes (Thermacetogenium phaeum, Tepidanaerobacter acetatoxydans), Deltaproteobacteria
(Desulfurella acetivorans, Desulfuromonas acetoxidans, Geobacter uraniireducens). The following organisms, Desulfovibrio alaskensis , Geobacter daltonii, Geobacter uraniireducens, within the Deltaproteobacteria, can reduce heavy metals such as uranium. Sequences were found representing Dechloromonas hortensis, and Deefgea rivuli which can reduce chlorate and perchlorate, respectively. Organisms represented by the sequences found in this study are capable of alternative metabolic functions outside the common basic metabolic capabilities. This suggests that Lake Erie organisms exhibit a wide range of metabolic capabilities, including some that appear to have been influenced by human activities.
Degradation of organic compounds
Four organisms were found that are capable of degrading polychlorinated biphenyls
(PCBs), including Caldimonas hydrothermale, Rhodococcus jostii, Burkholderia xenovorans and
Variovorax paradoxus. Delftia sp. and Stenotrophomonas acidaminiphila degrade polycyclic 73 aromatic hydrocarbons (PAH). While this is an encouraging finding in that useful bacteria exist in the lake ice, it also indicates that aromatic hydrocarbon pollution has likely led to the presence of these organisms in the lake.
Conclusions of findings
Metagenomic and metatranscriptomic sequences derived from this study showed that the
Lake Erie Ice contains organisms that are alive and functioning. Major microbial community found in the ice include Bacteria (Proteobacteria, Cyanobacteria, Acidobacteria, Actinobacteria,
Bacteroides, Chloroflexi, Chlorobi, Firmicutes, Tenericutes, Thermotogae, Deinococcus-
Thermus, and Verrucomicrobia), Eukarya (diatoms, red algae, green algae, higher plants, fungi, insects, mollusks, nematodes, platyhelminths and chordates) and archaea (Euryarchaeota and
Thaumarcheota). The majority of organisms are characteristic of those in large lakes. However, a substantial proportion indicates an input of organisms from anthropogenic sources. These include human associated organisms, species from industrial activities, those from ships, and additional organisms from recreational and agricultural sources. Many metabolic pathways and cycles are well-represented among the sequences. These include major metabolic pathways that involve nitrogen, carbon, methane, iron, and sulfur. During winter, the Lake Erie ice has a larger diversity of bacteria than the water. This may indicate that the lake ice serves as storage for many organisms that are released into the lake upon melting of the ice. Organisms pathogenic in humans, animals and plants were found in the ice, this may indicate that the lake harbors pathogens that are able to persist for a long time in the environment.
74
Chapter ii references
Alawi, M., Lipski, A., Sanders, T., Pfeiffer, E.M., and Spieck, E. (2007). Cultivation of a novel
cold-adapted nitrite oxidizing betaproteobacterium from the Siberian Arctic. ISME J.
1(3):256-64 doi: 10.1038/ismej.2007.34.
Antony, C., Kumaresan, D., Ferrando, L. Boden, R., Mousers, H., Scavino, A., Shouche,
Y.S., and Murrell, J.C. (2010). Active methylotrophs in the sediments of Lonar Lake,
a saline and alkaline ecosystem formed by meteor impact. ISME J 4, 1470-
1480 https://doi.org/10.1038/ismej.2010.70.
Armbrust, E.V. (2009). The life of diatoms in the world's oceans. Nature. May
14;459(7244):185-92 doi: 10.1038/nature08057.
Bates, S. S., Bird, C. J., Freitas, A. D., Foxall, R., Gilgan, M., Hanic, L. A., Johnson, G. R.,
McCulloch, W., Odense, P. Pocklington, R., Quilliam, M. A., Sim, P. G., Smith, J. C.,
Subba Rao, D. V., Todd, E. C. D., Walter, J. A. and Wright, J. L. C. (1989). Pennate
diatom Nitzschia pungens as the primary source of domoic acid, a toxin in shellfish from
eastern Prince Edward Island, Canada. Canadian Journal of Fisheries and Aquatic
Sciences, 46(7), 1203-1215.
Baud, D., Goy, G., Osterheld, M. C., Croxatto, A., Borel, N., Vial, Y., Pospischil, A., and Greub,
G. (2014). Role of Waddlia chondrophila placental infection in miscarriage. Emerging
infectious diseases, 20(3), 460–464. https://doi.org/10.3201/eid2003.131019.
Beall, B. F. N. Twiss M. R., Smith, E., Oyserman, B. O., Rozmarynowycz, M. J., Binding, C. E.,
Bourbonniere, R. A., Bullerjahn, G.S., Palmer, M.E., Reavie, E.D., Waters, M.K.,
Woityra, W.C., and McKay, R.M.L. (2016). Ice cover extent drives phytoplankton and 75
bacterial community structure in a large north-temperate lake: implications for a warming
climate. Environ. Microbiol. 18(6), 1704–1719. doi:10.1111/1462-2920.12819.
Beattie, K.A., Kaya, K., Sano, T., and Codd, G.A. (1998). Three dehydrobutyrine-containing
microcystins from Nostoc, Phytochemistry, 47(7): 1289 – 1292.
Beman, J.M., Bertics, V.J., Braunschweiler, T., and Wilson, J.M. (2012) Quantification of
ammonia oxidation rates and the distribution of ammonia-oxidizing archaea and
bacteria in marine sediment depth profiles from Catalina Island, California. Front.
Microbio. 3:263 doi: 10.3389/fmicb.2012.00263.
Benoiston, A. S., Ibarbalz, F. M., Bittner, L., Guidi, L., Jahn, O., Dutkiewicz, S., and Bowler, C.
(2017). The evolution of diatoms and their biogeochemical functions. Philosophical
transactions of the Royal Society of London. Series B, Biological sciences, 372(1728),
20160397. https://doi.org/10.1098/rstb.2016.0397.
Benson, B.J., Magnuson, J.J., Jensen, O.P., Card, V.M., Hodgkins, G., Korhonen, J.
Livingstone, D.M., Stewart, K.M., Weyhenmeyer, G.A., and Granin, N.G. (2012).
Extreme events, trends, and variability in Northern Hemisphere lake-ice
phenology (1855–2005). Clim. Change., 112, 299–323 10.1007/s10584-011-0212-8.
Bertilsson, S., Burgin, A., Carey, C.C., Fey, S.B., Grossart, H., Grubisic, L.M., Jones, I., Kirillin,
G., Lennon, J.T., Shade, A., and Smyth, R.L. (2013). The under-ice microbiome of
seasonally frozen lakes. Limnol. Oceanogr. 58(6), 1998-2012.
doi:10.4319/lo.2013.58.6.1998.
Besiktepe, S., Ryabushko, L., Ediger, D., Yilmaz, D., Zenginer, A., Ryabushko, V., and Lee, R.
(2008). Domoic acid production by Pseudo-nitzschia calliantha Lundholm, Moestrup et 76
Hasle (bacillariophyta) isolated from the Black Sea. Harmful Algae, 7(4), 438-442.
https://doi.org/10.1016/j.hal.2007.09.004.
Boetius, A., Anesio, A. M., Deming, J. W., Mikucki, J. A., and Rapp, J. Z. (2015). Microbial
ecology of the cryosphere: sea ice and glacial habitats. Nature reviews. Microbiology,
13(11), 677–690. https://doi.org/10.1038/nrmicro3522
Boone, D.R., Whitman, W.B., and Rouvière, P. (1993). Diversity and Taxonomy of
Methanogens. In: Ferry J.G. (eds) Methanogenesis. Chapman & Hall Microbiology
Series (Physiology / Ecology / Molecular Biology / Biotechnology). Springer, Boston,
MA. https://doi.org/10.1007/978-1-4615-2391-8_2.
Bowler, C., Vardi, A., and Allen, A.E. (2010). Oceanographic and biogeochemical insights from
diatom genomes. Ann Rev Mar Sci. 2:333-365 doi: 10.1146/annurev-marine-120308-
081051.
Bräuer, S.L., Cadillo‐Quiroz, H., Ward, R.J., Yavitt, J.B., and Zinder, S.H. (2011).
Methanoregula boonei gen. nov., sp. nov., an acidiphilic methanogen isolated from an
acidic peat bog. Int J Syst Evol Microbiol 61: 45–52 https://doi.org/10.1099/ijs.0.021782-
0.
Brookes, J. D., Antenucci, J., Hipsey, M., Burch, M. D., Ashbolt, N. J., and Ferguson, C. (2004).
Fate and transport of pathogens in lakes and reservoirs. Environment international, 30(5),
741–759. https://doi.org/10.1016/j.envint.2003.11.006
Byrne, N., Strous, M., Crépeau, V., Kartal, B., Birrien, JL., Schmid, M., Lesongeur, F.,
Schouten, S., Jaeschke, A., Jetten, M., Prieur, D., and Godfroy, A. (2009). 77
Presence and activity of anaerobic ammonium-oxidizing bacteria at deep-sea
hydrothermal vents. ISME J 3, 117-123 https://doi.org/10.1038/ismej.2008.72.
Caputo, A., Stenegren, M., Pernice, M.C., and Foster, R.A. (2018). A Short Comparison of Two
Marine Planktonic Diazotrophic Symbioses Highlights an Un-quantified Disparity.
Front. Mar. Sci. 5:2. doi: 10.3389/fmars.2018.00002.
Carere, C., Sparling, R., Cicek, N., and Levin, D. (2008). Third Generation Biofuels via Direct
Cellulose Fermentation. International Journal of Molecular Sciences, 9(7), 1342–1360.
http://dx.doi.org/10.3390/ijms9071342.
Carey, C.C., Haney, J.F., and Cottingham, K.L. (2007). First Report of microcystin-LR in the
cyanobaterium Gloeotrichia echinulata Environ. Toxicol., 22; 337-339,
https://doi.org/10.1002/tox.20245.
Castellani, A.G., and Niven, C.F. (1955). Factors affecting the bacteriostatic action of sodium
nitrite. Appl Microbiol 3(3):154-9.
Chen, Y.H., and Prinn, R. G. (2006). Estimation of atmospheric methane emissions between
1996 and 2001 using a three-dimensional global chemical transport model, J. Geophys.
Res., 111, doi:10.1029/2005JD006058.
Chistoserdova, L., and Lidstrom, M.E. (2013). Aerobic methylotrophic prokaryotes. In:
Rosenberg E, DeLong EF, Thompson F, Lory S, Stackebrandt E, editors. The
prokaryotes. Fourth edition. Berlin, Heidelberg: Springer-Verlag, pp. 267–285.
Chorus, I., and Welker, M. (2021). Toxic cyanobacteria in water: a guide to their public health
consequences, monitoring and management (p. 858). Taylor & Francis. 78
Coffroth, M.A., Lewis, C.F., Santos, S.R., and Weaver, J.L. (2006). Environmental
populations of symbiotic dinoflagellates in the genus Symbiodinium can initiate
symbioses with reef cnidarians. Curr Biol. 6(23): R985-7. doi:
10.1016/j.cub.2006.10.049.
Cravo-Laureau, C., Matheron, R., Joulian, C., Cayol, J.L., and Hirschler-Réa, A. (2004).
Desulfatibacillum alkenivorans sp. nov., a novel n-alkene-degrading, sulfate-reducing
bacterium, and emended description of the genus Desulfatibacillum. Int J Syst Evol
Microbiol. 54(Pt 5):1639-1642. doi: 10.1099/ijs.0.63104-0
Daims, H., Lücker, S., and Wagner, M. (2016). A New Perspective on Microbes Formerly
Known as Nitrite-Oxidizing Bacteria. Trends in microbiology, 24(9), 699–712.
https://doi.org/10.1016/j.tim.2016.05.004.
Dalal, R. C., and Allen, D. E. (2008). Greenhouse gas fluxes from natural ecosystems.
Australian Journal of Botany, 56(5), 369-407 https://doi.org/10.1071/BT07128
Dalsgaard, T., Thamdrup, B., and Canfield, D. E. (2005). Anaerobic ammonium oxidation
(anammox) in the marine environment. Res. Microbiol. 156, 457–464
https://doi.org/10.1016/j.resmic.2005.01.011.
De Vargas, C., Audic, S., Henry, N., Decelle, J., Mahé, F., Logares, R., Lara, E., Berney, C.,
Le Bescot, N., Probert, I., Carmichael, M., Poulain, J., Romac, S., Colin, S., Aury,
J.M., Bittner, L., Chaffron, S., Dunthorn, M., Engelen, S., Flegontova, O., Guidi, L.,
Horák, A., Jaillon, O., Lima-Mendez, G., Lukeš, J., Malviya, S., Morard, R., Mulot,
M., Scalco, E., Siano, R., Vincent, F., Zingone, A., Dimier, C., Picheral, M.,
Searson, S., Kandels- Lewis, S., Acinas, S.G., Bork, P., Bowler, C., Gorsky, 79
G., Grimsley, N., Hingamp, P., Iudicone, D., Not, F., Ogata, H., Pesant, S., Raes, J.,
Sieracki, M.E., Speich, S., Stemmann, L., Sunagawa, S., Weissenbach, J., Wincker,
P., and Karsenti, E. (2015). Ocean plankton. Eukaryotic plankton diversity in the
sunlit ocean. Science. 22;348(6237):1261605. doi: 10.1126/science.1261605.
Del Campo, J., Sieracki, M.E., Molestina, R., Keeling, P., Massana, R., and Ruiz‐Trillo, I.
(2014). Trends Ecol. Evol 29(5):252-9. doi: 10.1016/j.tree.2014.03.006.
DeLong, E.F. (1998). Everything in moderation: archaea as 'non-extremophiles'. Curr Opin
Genet Dev. 8(6):649-54. doi: 10.1016/s0959-437x(98)80032-4.
Derelle, R., López-García, P., Timpano, H., and Moreira, D. (2016). A Phylogenomic
Framework to Study the Diversity and Evolution of Stramenopiles
(=Heterokonts). Molecular biology and evolution, 33(11), 2890–2898.
https://doi.org/10.1093/molbev/msw168.
Duffitt, A. D., Reber, R. T., Whipple, A., and Chauret, C. (2011). Gene Expression during
Survival of Escherichia coli O157:H7 in Soil and Water. International journal of
microbiology, 2011, 340506. https://doi.org/10.1155/2011/340506
Dunfield, P., Yuryev, A., Senin, P., Smirnova, A.V., Stott, M.B., Hou, S., Ly, B., Saw,
J.H., Zhou, Z., Ren, Y., Wang, J., Mountain, B.W., Crowe, M.A, Weatherby,
T.M., Bodelier, P.L.E., Liesack, W., Feng, L., Wang, L., and Alam, M. (2007).
Methane oxidation by an extremely acidophilic bacterium of the phylum
Verrucomicrobia. Nature 450, 879–882. https://doi.org/10.1038/nature06411.
Eadie, B.J. and Robbins, J.A. (1987). The role of particulate matter in the movement of
contaminants in the Great Lakes. In Advances in Chemistry Series No. 216, Sources and 80
Fates of Aquatic Pollutants, R.A. Hites, and S. J. Eisenreich (eds.). American Chemical
Society, 319-364.
Ebert, D. (2005). Ecology, Epidemiology, and Evolution of Parasitism in Daphnia [Internet].
Bethesda (MD): National Center for Biotechnology Information (US); 2005.
Chapter 2, Introduction to Daphnia Biology. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK2042/.
Emerson, D., Fleming, E.J., and McBeth, J. M. (2010). "Iron-Oxidizing Bacteria: An
Environmental and Genomic Perspective". Annual Review of Microbiology. 64 (1):
561–583. doi:10.1146/annurev.micro.
Erisman, J.W., van Grinsven, H., Grizzetti, B., Bouraoui, F., Powlson, D., Sutton, M.A., Bleeker,
A., and Reis, S. (2011). The European nitrogen assessment, ch. 2: the European nitrogen
problem in a global perspective, pp. 9–31 Cambridge, UK: Cambridge University Press.
Ernst, B., Hitzfeld, B., and Dietrich, D. (2001). Presence of Planktothrix sp. and cyanobacterial
toxins in Lake Ammersee, Germany and their impact on whitefish (Coregonus lavaretus
L.). Environ. Toxicol., 16 (2001), pp. 483-488, https://doi.org/10.1002/tox.10006.
Ettwig, K., Butler, M., Le Paslier, D., Pelletier, E., Mangenot, S., Kuypers, M.M.M., Schreiber,
F., Dutilh, B.E., Zedelius, J., De Beer, D., Gloerich, J., Wessels, H.J.C.T., Van Alen, T.,
Luesken, F., Wu, M.L., Van de Pas-Schoonen, K.T., Op den Camp, H.J.M., Janssen-
Megens, E.M., Francoijs, K., Stunnenberg, H., Weissenbach, J., Jetten, M.S.M., and
Strous, M. (2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria.
Nature 464, 543–548. https://doi.org/10.1038/nature08883. 81
Evans, M., Sicko-Goad, L., and Omair, M. (1979). Seasonal Occurrence of Tokophrya
quadripartita (Suctoria) as Epibionts on Adult Limnocalanus macrurus (Copepoda:
Calanoida) in Southeastern Lake Michigan. Transactions of the American
Microscopical Society, 98(1), 102-109. doi:10.2307/3225944.
Field, C.B., Behrenfeld, M.J., Randerson, J.T. and Falkowski, P.G. (1998). Primary production
of the biosphere: integrating terrestrial and oceanic components. Science 281, 237–240
DOI: 10.1126/science.281.5374.237.
Foissner, W., Chao, A., and Katz, L.A. (2007). Diversity and geographic distribution of
ciliates (Protista: Ciliophora). Journal of Biodiversity and Conservation, 17(2), 345–
363. DOI:10.1007/s10531-007-9254-7.
Foissner, W., Quintela-Alonso, P., and Al-Rasheid, K. (2008). Soil Ciliates from Saudi
Arabia, Including Descriptions of Two New Genera and Six New Species. Acta
protozoologica, 47(4), 317–352.
Follett, C., Dutkiewicz, S., Karl, D.M., Inomura, K., and Follows, M.J. (2018). Seasonal resource
conditions favor a summertime increase in North Pacific diatom–diazotroph associations.
ISME J 12, 1543–1557 https://doi.org/10.1038/s41396-017-0012-x.
Foss, A.J., and Aubel, M.T. (2015). Using the MMPB technique to confirm microcystin
concentrations in water measured by ELISA and HPLC (UV, MS, MS/MS). Toxicon.
15;104:91-101 doi: 10.1016/j.toxicon.2015.07.332.
Glatz, R., Lepp, W., Ward, B., and Francis, C. (2006). Planktonic microbial community
composition across steep physical/chemical gradients in permanently ice-covered Lake
Bonney, Antarctica. Geobiology 4, 53–67. doi:10.1111/j.1472-4669.2006.00057.x. 82
Graham, J.L., Loftin, K.A., Meyer, M.T., and Ziegler, A.C. (2010). Cyanotoxin mixtures and
taste-and-odor compounds in cyanobacterial blooms from the Midwestern United States.
Environ Sci Technol 44(19):7361-8. doi: 10.1021/es1008938.
Graham, P.H., and Vance, C.P. (2003). Legumes: importance and constraints to greater use.
Plant Physiol. 131(3):872-7. doi: 10.1104/pp.017004.
Grattan, L.M., Oldach, D., and Morris, J.G. (2001). Human Health Risks of Exposure
to Pfiesteria piscicida: Environmental exposure to toxic Pfiesteria piscicida produces
a distinct clinical syndrome in some persons; efforts to identify the toxin(s)
responsible for the syndrome and to increase understanding of how it disrupts the
central nervous system have important implications for public health, BioScience, 51,
10, 853–857.https://doi.org/10.2307/3454928.
Grattepanche, J.D., Walker, L.M., Ott, B.M., Paim Pinto, D.L., Delwiche, C.F., Lane, C.E.,
and Katz, L.A. (2018). Microbial Diversity in the Eukaryotic SAR Clade:
Illuminating the Darkness Between Morphology and Molecular Data. Bioessays.
40(4):e1700198. doi:10.1002/bies.201700198.
Gura, C., and Rogers, S.O. (2020). Metatranscriptomic and metagenomic analysis of
biological diversity in Subglacial Lake Vostok (Antarctica). Biology 9, 55
https://doi.org/10.3390/biology9030055.
Halinen, K., Jokela, J., Fewer, D. P., Wahlsten, M., and Sivonen, K. (2007). Direct evidence
for production of microcystins by Anabaena strains from the Baltic Sea. Applied and
environmental microbiology, 73(20), 6543–6550https://doi.org/10.1128/AEM.01377-
07. 83
He, Z., Cai, C., Wang, J., Xu, X., Zheng, P., Jetten, M. S., and Hu, B. (2016). A novel
denitrifying methanotroph of the NC10 phylum and its microcolony. Scientific
reports, 6, 32241. https://doi.org/10.1038/srep32241.
Hedrich, S., Schlomann, M., and Johnson, D. B. (2011). "The iron-oxidizing
proteobacteria". Microbiology. 157 (6): 1551–1564. doi:10.1099/mic.0.045344-0.
Hinchliff, C.E., Smith, S.A., Allman, J.F., Burleigh, J.G., Chaudhary, R., Coghill, L.M.,
Crandall, K.A., Deng, J., Drew, B.T., Gazis, R., Gude, K., Hibbett, D.S., Katz, L.A.,
Laughinghouse, H.D., McTavish, E.J., Midford, P.E., Owen, C.L., Ree, R.H., Rees,
J.A., Soltis, D.E., Williams, T., and Cranston, K.A. (2015). Synthesis of phylogeny
and taxonomy into a comprehensive tree of life. Proc Natl Acad Sci U S A.
112(41):12764-9. doi: 10.1073/pnas.1423041112.
Ho, A., Kerckhof, F., Luke, C., Reim, A., Krause, S., Boon, N., Bodelier, P. L. E.
(2012). Conceptualizing functional traits and ecological characteristics of methane-
oxidizing bacteria as life strategies. Environ. Microbiol. Rep. 5, 335–345
https://doi.org/10.1111/j.1758-2229.2012.00370.x.
Hou, S., Makarova, K. S., Saw, J. H., Senin, P., Ly, B. V., Zhou, Z., Ren, Y., Wang, J.,
Galperin, M. Y., Omelchenko, M. V., Wolf, Y. I., Yutin, N., Koonin, E. V., Stott, M.
B., Mountain, B. W., Crowe, M. A., Smirnova, A. V., Dunfield, P. F., Feng, L.,
Wang, L., and Alam, M. (2008). Complete genome sequence of the extremely
acidophilic methanotroph isolate V4, Methylacidiphilum infernorum, a
representative of the bacterial phylum Verrucomicrobia. Biology direct, 3, 26.
https://doi.org/10.1186/1745-6150-3-26. 84
Iguchi, H., Yurimoto, H., and Sakai, Y. (2015). Interactions of Methylotrophs with Plants and
Other Heterotrophic Bacteria. Microorganisms, 3(2), 137-151.
https://doi.org/10.3390/microorganisms3020137.
Intriago, P. (2012). Marine Microorganisms: perspectives for getting involved in cellulosic
ethanol. AMB Express, 2(1), 46. https://doi.org/10.1186/2191-0855-2-46.
Islam, T., Jensen, S., Reigstad, L. J., Larsen, O., and Birkeland, N. K. (2008). Methane
oxidation at 55 degrees C and pH 2 by a thermoacidophilic bacterium belonging to
the Verrucomicrobia phylum. Proceedings of the National Academy of Sciences of
the United States of America, 105(1), 300-304.
https://doi.org/10.1073/pnas.0704162105.
Ji, B., Yang, K., Zhu, L., Yu Jiang, Wang, H., Zhou, J., and Zhang, H. (2015). Aerobic
denitrification: A review of important advances of the last 30 years. Biotechnol
Bioproc E 20, 643–651 https://doi.org/10.1007/s12257-015-0009-0.
Kasprzak, P., Lathrop, R.C., and Carpenter, S.R. (1999). Influence of different
sized Daphnia species on chlorophyll concentration and summer phytoplankton
community structure in eutrophic Wisconsin lakes, Journal of Plankton Research,
21(1), 2161 – 2174 https://doi.org/10.1093/plankt/21.11.2161.
Kawaguchi, Y., Shibuya, M., Kinoshita, I., Yatabe, J., Narumi, I., Shibata, H., Hayashi, R.,
Fujiwara, D., Murano, Y., Hashimoto, H., Imai, E., Kodaira, S., Uchihori, Y., Nakagawa,
K., Mita, H., Yokobori, S., and Yamagishi, A. (2020). DNA Damage and Survival Time
Course of Deinococcal Cell Pellets During 3 Years of Exposure to Outer Space. Front.
Microbiol. 11:2050. doi: 10.3389/fmicb.2020.02050. 85
Kemen, E., Gardiner, A., Schultz-Larsen, T., Kemen, A. C., Balmuth, A. L., Robert-
Seilaniantz, A., Bailey, K., Holub, E., Studholme, D. J., Maclean, D., and Jones, J. D.
(2011). Gene gain and loss during evolution of obligate parasitism in the white rust
pathogen of Arabidopsis thaliana. PLoS biology, 9(7), e1001094.
https://doi.org/10.1371/journal.pbio.1001094.
Kim, J. M., Le, N. T., Chung, B. S., Park, J. H., Bae, J. W., Madsen, E. L., and Jeon, C. O.
(2008). Influence of soil components on the biodegradation of benzene, toluene,
ethylbenzene, and o-, m-, and p-xylenes by the newly isolated bacterium
Pseudoxanthomonas spadix BD-a59. Applied and environmental microbiology, 74(23),
7313–7320. https://doi.org/10.1128/AEM.01695-08.
Kim, K.K., Jin, L., and Yang, H.C. (2007). Halomonas gomseomensis sp. Nov., Halomonas
janggokensis sp nov, and Halomonas denitrificans sp. moderately halophilic bacteria
isolated from saline water. Int J Syst Evol Microbiol. 57(4): 675-681. doi:
10.1099/ijs.0.64767-0.
Kitchens, C.M., Johengen, T.H., and Davis, T.W (2018). Establishing spatial and temporal
patterns in Microcystis sediment seed stock viability and their relationship to
subsequent bloom development in Western Lake Erie. PLoS ONE 13(11): e0206821.
https://doi.org/10.1371/journal.pone.0206821.
Kumar, M., Saxena, R., Tomar, R. S., Rai, P. K., and Paul, D. (2018). Role of methylotrophic
bacteria in climate change mitigation. Microbes for Climate Resilient Agriculture, 149-
164. 86
Lam, H.M., Coshigano, K., Oliveira, I., Melo‐Oliveira, R., and Coruzzi, G (1996). The molecular
genetics of nitrogen assimilation into amino acids in higher plants. Annual Review of
Plant Physiology and Plant Molecular Biology 47, 569-
593.10.1146/annurev.arplant.47.1.569.
Lashaway, A.R., and Carrick, H.J. (2010) Effects of light, temperature and habitat quality on
meroplanktonic diatom rejuvenation in Lake Erie: implications for seasonal hypoxia.
Journal of Plankton Research, 32: 479-490.
Lavik, G., Stührmann, T., Brüchert, V., Van der Plas, A., Mohrholz, V., Lam, P., Mussmann, M.,
Fuchs, B.M., Amann, R., Lass, U., and Kuypers, M.M.M. (2009). Detoxification of
sulphidic African shelf waters by blooming chemo-lithotrophs. Nature, 457: 581–584
Lewis, W.M., and Morris, D.P. (1986). Toxicity of nitrite to fish: a review. Trans Am Fish Soc,
115, 183-195. https://doi.org/10.1577/1548-8659.
Loftin, K.A., Graham, J.L., Hilborn, E.D., Lehmann, S.C., Meyer, M.T., Dietze, J.E., and
Griffith, C.B. (2016). Cyanotoxins in inland lakes of the United States: Occurrence and
potential recreational health risks in the EPA National Lakes Assessment 2007. Harmful
Algae. 56:77-90. doi: 10.1016/j.hal.2016.04.001.
Lowe, S., Browne, M., Boudjelas, S., and De Poorter, M. (2000). 100 of the World’s Worst
Invasive Alien Species A selection from the Global Invasive Species Database.: The
Invasive Species Specialist Group (ISSG) a specialist group of the Species Survival
Commission (SSC) of the World Conservation Union (IUCN). p. 12
Luukkainen, R., Sivonen, K., Namikoshi, M., Färdig, M., Rinehart, K.L. and Niemelä, S.I.
(1993). Isolation and identification of eight microcystins from thirteen Oscillatoria 87
agardhii strains and structure of a new microcystin. Applied and Environmental
Microbiology 59 (7) 2204-2209.
Mackin, J.G., Owen, H.M., and Collier, A. (1950). Preliminary Note on the Occurrence of a
New Protistan Parasite, Dermocystidium marinum n. sp. in Crassostrea virginica
(Gmelin). Science. 31;111(2883):328-9. doi: 10.1126/science.111.2883.328.
Mahmud, K., Makaju, S., Ibrahim, R., and Missaoui, A. (2020). Current Progress in Nitrogen
Fixing Plants and Microbiome Research. Plants (Basel, Switzerland), 9(1), 97.
https://doi.org/10.3390/plants9010097.
Martinelli, A., and Culleton, R. (2016). Non-human primate malaria parasites: out of the
forest and into the laboratory. Parasitology 145(1):41-54. doi:
10.1017/S0031182016001335.
Martín-Torrijos, L., Campos Llach, M., Pou-Rovira, Q., and Diéguez-Uribeondo, J. (2017).
Resistance to the crayfish plague, Aphanomyces astaci (Oomycota) in the endangered
freshwater crayfish species, Austropotamobius pallipes. PloS one, 12(7), e0181226.
https://doi.org/10.1371/journal.pone.0181226.
Moore, M.V., Hampton, S.E., Izmest’eva, L.R., Silow, E.A., Peshkova, E.V., and Pavlov,
B.K. (2009). Climate change and the world’s “Sacred Sea”—lake baikal, siberia.
Bioscience, 59, 405–417 https://doi.org/10.1525/bio.2009.59.5.8.
Naqvi, I., Gupta, R., Makhija, S., Toteja, R., Abraham, J. S., Sripoorna, S., El-Serehy, H. A.,
and Al-Misned, F. A. (2016). Morphology and morphogenesis of a new oxytrichid
ciliate, Notohymena limus n. sp. (Ciliophora, Oxytrichidae) from Delhi, India. Saudi
journal of biological sciences, 23(6), 789–794. https://doi.org/10.1016/j.sjbs.2016.10.008 88
Ormeño-Orrillo, E., Hungria, M., and Martínez-Romero E. (2013). “Dinitrogen-fixing
prokaryotes,” in The Prokaryotes: Prokaryotic Physiology and Biochemistry, eds
Rosenberg E., Long E. F. de, Lory S., Stackebrandt E., Thompson F. (Berlin:
Springer-Verlag), 427–451. 10.1007/978-3-642-30141-4_72.
Pachiadaki, M.G., Sintes, E., Bergauer, K., Brown, J.M., Record, N.R., Swan,
B.K., Mathyer, E., Hallam, S.J., Lopez-Garcia, P., Takaki, Y., Nunoura, T., Woyke,
T., Herndl, G.J., and Stepanauskas, R. (2017). Major role of nitrite-oxidizing bacteria in
dark ocean carbon fixation. Science. 24;358(6366):1046-1051.
doi:10.1126/science.aan8260.
Pol, A., Heijmans, K., Harhangi, H., Tedesco, D., Jetten, M.S.M., and Huub J. M.
(2007). Methanotrophy below pH 1 by a new Verrucomicrobia species. Nature
450,874–878. https://doi.org/10.1038/nature06222.
Priscu, J.C., Adams, E.E., Lyons, W.B., Voytek, M.A., Mogk, D.W., Brown, R.L., McKay, C.P.,
Takacs, C.D., Welch, K.A., Wolf, C.F., Kirshtein, J.D., and Avci, R. (1999).
Geomicrobiology of Subglacial Ice Above Lake Vostok, Antarctica. Science 286 (5447),
2141-2144 doi: 10.1126/science.286.5447.2141.
Prosser, J.I. (1989). Autotrophic nitrification in bacteria. Adv. Microb. Physiol. 30:125–
81 https://doi.org/10.1016/S0065-2911(08)60112-5.
Quesada, A., Moreno, E., Carrasco, D., Paniagua, T., Wormer, L., De Hoyos, C., and Sukenik.
A. (2006). Toxicity of Aphanizomenon ovalisporum (Cyanobacteria) in a Spanish water
reservoir, European Journal of Phycology, 41:1, 39-45, DOI:
10.1080/09670260500480926. 89
Raghoebarsing, A.A., Pol, A., van de Pas-Schoonen, K.T., Smolders, A.J., Ettwig, K.F.,
Rijpstra, W.I., Schouten, S., Damsté, J.S., Op den Camp, H.J., Jetten, M.S., and
Strous, M.A, (2006). Microbial consortium couples anaerobic methane oxidation to
denitrification. Nature. 13;440(7086):918-21 doi: 10.1038/nature04617.
Raikov, I.B. (1972). Nuclear phenomena during conjugation and autogamy in ciliates. In:
Chen T-T (ed) Research in protozoology vol 4. Pergamon Press, New York, pp 146–
289
Ravishankara, A.R., Daniel, J.S., and Portmann, R.W. (2009). Nitrous oxide (N2O): the
dominant ozone-depleting substance emitted in the 21st century. Science
326(5949): 123–5 DOI: 10.1126/science.1176985.
Reavie, E.D., and Kireta, A.R. (2015). Centric, Araphid and Eunotioid Diatoms of the
Coastal Laurentian Great Lakes Bibliotheca Diatomologica 62:1-184.
Reeburgh, W. S., Whalen S. C., and Alperin M. J. (1993). The role of methylotrophy in the
global methane budget Microbial growth on C1 compounds. Proceedings of the 7th
International Symposium. Murrell J. C., Kelly D. P. 1 14 American Society for
Microbiology Washington, D.C.
Rinta-Kanto, J. M., Ouellette, A. J. A., Boyer, G. L., Twiss, M. R., Bridgeman, T. B.,
and Wilhelm S. W. (2005). Quantification of Toxic Microcystis spp. during the 2003
and 2004 Blooms in Western Lake Erie using Quantitative Real-Time PCR.
Environmental Science & Technology 39 (11), 4198-4205 doi: 10.1021/es048249u. 90
Rinta-Kanto, J.M., and Wilhelm S.W. (2006). Diversity of Microcystin-Producing
Cyanobacteria in Spatially Isolated Regions of Lake Erie. Applied and Environmental
Microbiology 72 (7) 5083-5085. doi: 10.1128/AEM.00312-06.
Rogers, S.O., Rehner, S., Bledsoe, C., Mueller, G.J., and Ammirati, J.F. (1989). Extraction of
DNA from Basidiomycetes for ribosomal DNA hybridizations. Can J Bot. 67, 1235–
1243.
Rogers, S.O., Shtarkman, Y.M., Koçer, Z.M., Edgar, R., Veerapaneni, R., and D’Elia, T. (2013).
Ecology of subglacial Lake Vostok (Antarctica) based on
metagenomic/metatranscriptomic analyses of accretion ice. Biology 2(2), 629–650. doi:
10.3390/biology2020629.
Rosenblueth, M., Ormeño-Orrillo, E., López-López, A., Rogel, M. A., Reyes-Hernández, B.
J., Martínez-Romero, J. C., Reddy, P. M., and Martínez-Romero, E. (2018). Nitrogen
Fixation in Cereals. Frontiers in microbiology, 9, 1794.
https://doi.org/10.3389/fmicb.2018.01794
Rurangirwa, F.R., Dilbeck, P.M., Crawford, T.B., McGuire, T.C. and McElwain, T.F. (1999).
Analysis of the 16S rRNA gene of micro-organism WSU 86-1044 from an aborted
bovine foetus reveals that it is a member of the order Chlamydiales: proposal of
Waddliaceae fam. nov., Waddlia chondrophila gen. nov., sp. nov. Int J Syst Bacteriol. 49
(2):577-581 doi: 10.1099/00207713-49-2-577.
Russ, L., Kartal, B., op den Camp, H.J.M., Sollai, M., Le Bruchec, J., Caprais, J-C., Godfroy,
A., Damsté, S.J.S., and Jetten, M.S.M. (2013). Presence and diversity of anammox 91
bacteria in cold hydrocarbon-rich seeps and hydrothermal vent sediments of the
Guaymas Basin. Front. Microbiol. 4:219 doi: 10.3389/fmicb.2013.00219.
Sakai, S., Conrad, R., Liesack, W., and Imachi, H. (2010). Methanocella arvoryzae sp. nov., a
hydrogenotrophic methanogen isolated from rice field soil. Int J Syst Evol Microbiol.
60(12):2918-2923 doi: 10.1099/ijs.0.020883-0.
Saker, M.L., Jungblut, A. D., Neilan, B.A., Rawn, D.F.K., and Vasconcelos, V.M.
(2005). Detection of microcystin synthetase genes in health food supplements
containing the freshwater cyanobacterium Aphanizomenon flos-aquae, Toxicon,
(46)5, 555-562, https://doi.org/10.1016/j.toxicon.2005.06.021.
Santi, C., Bogusz, D., and Franche, C. (2013). Biological nitrogen fixation in non-legume
plants. Annals of botany, 111(5), 743–767. https://doi.org/10.1093/aob/mct048.
Scavia, D., Allan, J.D., Arend, K.K., Bartell, S., Beletsky, D., Bosch, N.S., Brandt,
S.B., Briland, R.D., Daloglu, I., De Pinto, J.V., Dolan, D.M., Evans, M.A., Farmer,
T.M., Goto, D., Han, H., Hook, T., Knight, R., Ludsin, S.A., Mason, D., Michalak,
A.M., Richards, R.P., Roberts, J.J., Rucinski, D.K., Rutherford, E., Schwab,
D.J., Sesterhenn, T.M., Zhang, H., and Zhou, Y. (2014). Assessing and addressing the
Re-eutrophication of Lake Erie: Central Basin Hypoxia. J Great Lakes Res. 40(2):
226–246. https://doi.org/10.1016/j.jglr.2014.02.004.
Seitzinger, S.P. (1988). Denitrification in freshwater and coastal marine ecosystems:
ecological and geochemical importance. Limnol. Oceanogr. 33: 702–
724. https://doi.org/10.4319/lo.1988.33.4part2.0702. 92
Shearer, C. A., Descals, E., Kohlmeyer, B., Kohlmeyer, J., Marvanová, L., Padgett,
D., Porter, D., Raja, H.A., Schmit, J.P., Thorton, H.A., and Voglymayr, H. (2007).
Fungal biodiversity in aquatic habitats. Biodiversity and Conservation, 16(1), 49-
67. https://doi.org/10.1007/s10531-006-9120-z.
Shen, L.D., Wu, H.S., Gao, Z.Q., Liu, X., and Li, J. (2016). Comparison of community
structures of Candidatus Methylomirabilis oxyfera-like bacteria of NC10 phylum in
different freshwater habitats. Sci Rep 6: 25647 10.1111/jam.13119.
Sherr, B.F., del Giorgio, P., and Sherr, E.B. (1999). Estimating abundance and single-cell
characteristics of respiring bacteria via the redox dye CTC. Aquat Microb Ecol. 18, 117–
131.
Shtarkman, Y., Koçer, Z., Edgar, R., Veerapaneni, R., D'Elia, T., Morris, P., and Rogers, S.
(2013). Subglacial Lake Vostok (Antarctica) accretion ice contains a diverse set of
sequences from aquatic, marine and sediment-inhabiting Bacteria and Eukarya. Plos One,
8(7), e67221. doi:10.1371/journal.pone.0067221.
Shumway, S. E. (1990). A review of the effects of algal blooms on shellfish and
aquaculture. Journal of the world aquaculture society, 21(2), 65-104.
Sivonen, K., Namikoshi, M., Evans, W.R., Carmichael, W.W., Sun, F., Rouhiainen, L.,
Luukkainen, R., and Rinehart, K.L. (1992). Isolation and characterization of a variety
of microcystins from seven strains of the cyanobacterial genus Anabaena. Applied
and Environmental Microbiology, 58 (8) 2495-2500. 93
Sonthiphand, P., Hall, M. W., and Neufeld, J. D. (2014). Biogeography of anaerobic
ammonia-oxidizing (anammox) bacteria. Frontiers in microbiology, 5, 399.
https://doi.org/10.3389/fmicb.2014.00399.
Spieck, E., Keuter, S., Wenzel, T., Bock, E., and Ludwig, W. (2014). Characterization of a
new marine nitrite oxidizing bacterium, Nitrospina watsonii sp. nov., a member of the
newly proposed phylum "Nitrospinae". Syst Appl Microbiol. May;37(3):170-6 doi:
10.1016/j.syapm.2013.12.005.
Starkenburg, S.R., Arp, D.J., and Bottomley, P.J. (2008). Expression of a putative nitrite
reductase and the reversible inhibition of nitrite-dependent respiration by nitric oxide
in Nitrobacter winogradskyi Nb-255. Environmental Microbiology. 10(11):3036-
3042. DOI: 10.1111/j.1462-2920.2008.01763.x.
Szaniawska, A. (2018). Function and Importance of Crustaceans. In: Baltic Crustaceans.
Springer, Cham. https://doi.org/10.1007/978-3-319-56354-1_11.
Treusch, A.H., Leininger, S., Kletzin, A, Schuster, S, C., Klenk, H.P, and Schleper, C.
(2005). Novel genes for nitrite reductase and Amo-related proteins indicate a role of
uncultivated mesophilic crenarchaeota in nitrogen cycling. Environ Microbiol. 2005
7(12):1985-95. j.1462-2920.2005.00906.x .
Trotsenko, Y.A., and Murrell, J.C. (2008). Metabolic Aspects of Aerobic Obligate
Methanotrophy, Advances in Applied Microbiology, 63, 183-229,
https://doi.org/10.1016/S0065-2164(07)00005-6. 94
Twiss, M.R., McKay, R.M.L., Bourbonniere, R.A., Bullerjahn, G.S., Carrick, H., Smith, R.E.H.,
Winter, J.G., D'souza, N.A., Furey, P.C., Lashaway, A.R., and Saxton, M.A. (2012).
Diatoms abound in ice-covered Lake Erie: An investigation of offshore winter limnology
in Lake Erie over the period 2007 to 2010. J. Great Lakes Res. 38, 18-30.
doi:10.1016/j.jglr.2011.12.008.
Van Dolah, F. M. (2000). Marine algal toxins: origins, health effects, and their increased
occurrence. Environmental health perspectives, 108 Suppl 1(Suppl 1), 133–141.
https://doi.org/10.1289/ehp.00108s1133
Wagner, T., Watanabe, T., and Shima S. (2018). Hydrogenotrophic Methanogenesis. In: Stams
A., Sousa D. (eds) Biogenesis of Hydrocarbons. Handbook of Hydrocarbon and Lipid
Microbiology. Springer, Cham. https://doi.org/10.1007/978-3-319-53114-4_3-1.
Watson, S.W., Bock, E., Valois, F.W., Waterbury, J.B., and Schlosser, U. (1986). Nitrospira
marina gen. nov. sp. nov.: a chemolithotrophic nitrite-oxidizing bacterium. Arch.
Microbiol. 144, 1–7 https://doi.org/10.1007/BF00454947.
Wetzel, R.G. (2001). Limnology: Lake and River Ecosystems. Gulf Professional
Publishing, Academic Press, San Diego.
Wood, S. A., Rasmussen, J. P., Holland. P. T., Campbell, R., and Crowe, A. L. M. (2007). First
report of cyanotoxin anatoxin-a from Aphanizomenon issatschenkoi (cyanobacteria).
Journal of Phycology 43:356-365. https://doi.org/10.1111/j.1529-8817.2007.00318.x.
Yakimov, M.M., Giuliano, L., Gentile, G., Crisafi, E., Chernikova, T.N., Abraham, W.R.,
Lunsdorf, H., Timmis, K.N., and Golyshin, P.N. (2003) Oleispira antarctica gen. nov., 95
sp. nov., a novel hydrocarbonoclastic marine bacterium isolated from Antarctic coastal
sea water. Int J Syst Evol Microbiol 53: 779 785 https://doi.org/10.1099/ijs.0.02366-0.
Yakimov, M.M., Timmis, K.N., and Golyshin, P.N. (2007). Obligate oil-degrading marine
Bacteria. Curr Opin Biotechnol. 18(3):257-66. doi: 10.1016/j.copbio.2007.04.006
Yoshinaga, I., Amano, T., Yamagishi, T., Okada, K., Ueda, S., Sako, Y., and Suwa, Y.
(2011) Distribution and diversity of anaerobic ammonium oxidation (anammox)
bacteria in the sediment of a eutrophic freshwater lake, Lake Kitaura, Japan.
Microbes Environ. 26(3):189-97 doi: 10.1264/jsme2.me10184.
Zhou, J., Fries, M.R., Chee-Sanford, J.C., and Tiedje, J.M. (1995). Phylogenetic analyses of
a new group of denitrifiers capable of anaerobic growth of toluene and description of
Azoarcus tolulyticus sp. nov. Int J Syst Bacteriol. 45(3):500-6 doi:
10.1099/00207713-45-3-500.
96
APPENDIX A. SPECIES (BASED ON SEQUENCES) FROM LAKE ERIE ICE SAMPLE,
ORGANIZED TAXONOMICALLY
Domain BACTERIA
MONODERMS
Actinobacteria
Acidimicrobium ferrooxidans - oxidizes ferrous iron, thermophilic, acidophilic
Acidithiomicrobium sp. - oxidizes sulfur, geothermal environment
Acidothermus cellulolyticus - acidophilic, thermophilic, cellulolytic, thermal spring
Actinoallomurus spadix - soil, dung samples
Actinobaculum schaalii - pathogen of urinary tract
Actinomadura cremea - human pathogen, sputum, bronchoalveolar lavage fluid,
honeybee hive
Actinomadura umbrina - soil
Actinomyces bovis - pathogenic in cattle and humans
Actinomyces graevenitzii - pathogenic in human
Actinomyces weissii - oral cavity of dogs
Actinoplanes friuliensis - soil
Actinoplanes missouriensis - soil
Actinoplanes sp. - soil
Actinosynnema pretiosum - plant leaves
Adlercreutzia equolifaciens - human feces, metabolizes daidzeins (from soybeans) to
equol (an estrogen)
Alloscardovia omnicolens - soil 97
Amycolatopsis mediterranei - methylotrophic
Amycolatopsis methanolica - pathogenic in human and goats
Amycolatopsis orientalis - oil polluted saline soil, moderately halophilic
Amycolicicoccus subflavus - aquatic, freshwater
Aquihabitans daechungensis - human and animal intestinal tract
Arcanobacterium canis - associated with dogs
Arcanobacterium hippocoleae - associated with horses
Arcanobacterium pluranimalium - associated with animals
Arcanobacterium pyogenes - associated with pigs, pathogenic in livestock
Arthrobacter agilis - psychrophilic, lake water, Antarctic sea ice
Arthrobacter aurescens - soil, metabolizes striazine, utilizes anethole
Arthrobacter flavus - psychrophilic, aquatic
Arthrobacter tumbae - associated with biofilm
Atopobium vaginae - pathogenic in humans
Bifidobacterium actinocoloniiforme - associated with bumblebee digestive tract
Bifidobacterium angulatum - human gastrointestinal tract
Bifidobacterium asteroides - associated with honeybees
Bifidobacterium bifidum - associated with mammals (including humans)
Bifidobacterium breve - human gastrointestinal tract
Bifidobacterium longum - human gastrointestinal tract
Bifidobacterium scardovii - associated with clinical samples
Bifidobacterium thermacidophilum - thermophilic, anaerobic digester, feces of pigs
Bifidobacterium thermophilum - bovine rumen, feces 98
Blastococcus saxobsidens - rock, alcarenite (limestone)
Catenulispora acidiphila - freshwater, acidophilic
Cellulomonas fimi - cellulolytic
Cellulomonas flavigena - soil, degrades cellulose
Cellvibrio gilvus - cellulolytic
Coriobacterium glomerans - gastrointestinal tract of fireflies
Corynebacterium camporealensis - associated with sheep milk, pathogenic
Corynebacterium casei - grows on surface of cheeses
Corynebacterium diphtheriae - pathogenic in humans
Corynebacterium glycinophilum - decaying banana
Corynebacterium halotolerans - halotolerant, saline soil
Corynebacterium lactis - associated with cow milk
Corynebacterium pseudotuberculosis - pathogenic in horses and cattle
Corynebacterium resistens - pathogenic in human
Corynebacterium riegelii - pathogenic in humans
Corynebacterium sp. - pathogenic, associated with clinical samples
Corynebacterium terpenotabidum - degrades squalene, soil
Corynebacterium uterequi - associated with horses
Crossiella equi - associated with horses
Dermacoccus nishinomiyaensis - pathogenic in humans
Cryobacterium sp. - psychrotolerant
Eggerthella lenta - human gastrointestinal tract, pathogenic
Eggerthella sp. - associated with human colon 99
Frankia alni - root nodule, nitrogen fixing
Frankia sp. - nitrogen fixer, root nodules
Gaiella occulta - deep mineral water
Gordonia bronchialis - pathogenic in human
Gordonia polyisoprenivorans - degrades rubber, pathogenic
Gordonibacter pamelaeae - associated with human gastrointestinal tract
Gordonia sp. - soil, water
Ilumatobacter fluminis - sediment
Intrasporangium calvum - air, reduces nitrate
Isoptericola variabilis - associated with termite guy, hydrolyzes nitrile
Jonesia denitrificans - pathogenic
Kibdelosporangium phytohabitans - associated with plants
Kitasatospora cineracea - soil
Kitasatospora griseola - soil
Kitasatospora niigatensis - soil
Kitasatospora phosalacinea - soil
Kitasatospora setae -soil
Kocuria rhizophila - soil
Kutzneria albida - soil
Kytococcus sedentarius - marine
Lentzea violacea - gold mine
Leucobacter sp. - aquatic areas, sludge, and soil samples
Luteipulveratus mongoliensis - soil 100
Marmoricola bigeumensis - soil
Microbacterium sp. - associated with clinical specimen
Microbacterium testaceum - associated with plant tissue e.g corn, sorghum
Microlunatus phosphovorus - activated sludge, accumulates polyphosphate
Micromonospora aurantiaca - soil, freshwater, marine, fixes nitrogen
Micromonospora chersina - aquatic, soil
Micromonospora echinospora - soil, produces antibiotics
Micromonospora inyonensis - soil
Mobiluncus curtisii - pathogenic in human
Modestobacter marinus - psychrotolerant, deep sea sediment
Modestobacter versicolor - soil
Mycobacterium abscessus - water, soil, pathogenic
Mycobacterium asiaticum - sputum, monkeys
Mycobacterium bovis - pathogenic in cattle
Mycobacterium canettii - pathogenic in humans
Mycobacterium chubuense - soil
Mycobacterium confluentis - human oral cavity and airways
Mycobacterium fallax - aquatic, river
Mycobacterium fortuitum - pathogenic in humans
Mycobacterium goodii - pathogenic, associated with clinical samples
Mycobacterium hodleri - degrades polycyclic aromatic hydrocarbon
Mycobacterium indicus - soil
Mycobacterium intracellulare - pathogenic in frogs 101
Mycobacterium liflandii - pathogenic
Mycobacterium kansasii - pathogenic in humans
Mycobacterium marinum - aquatic, associated with fish
Mycobacterium neoaurum - pathogenic in human
Mycobacterium obuense - soil, aquatic, degrades organic compounds
Mycobacterium phlei - soil, dust and plants. Associated with an immunocompetent
pediatric patient
Mycobacterium rhodesiae - soil, pathogenic, degrades PAH
Mycobacterium smegmatis - skin lesion, marine
Mycobacterium vanbaalenii - petroleum-contaminated estuarine sediments,
aquatic, contaminated soils, can utilize polycyclic aromatic hydrocarbons
Nocardia brasiliensis - soil, pathogenic in human
Nocardia cyriacigeorgica - pathogenic
Nocardia farcinica - soil, plant, animal tissue
Nocardia nova - soil, plant materials
Nocardia seriolae - associated with fishes, pathogenic in fish, man, cats
Olsenella uli - pathogenic in humans
Patulibacter medicamentivorans - activated sludge, degrades ibuprofen
Propionibacterium acidipropionici - propionic acid-tolerant, soil, rumen
Propionibacterium avidum - human normal oral flora
Propionibacterium propionicum - human normal skin flora
Pseudonocardia dioxanivorans - industrial sludge
Rathayibacter toxicus - pathogenic in rye grass (kills livestock that consumes it) 102
Renibacterium salmoninarum - pathogenic in salmonoid fishes
Rhodococcus equi - soil, pathogenic in foal (horse < 1 year old) and humans
Rhodococcus fascians - associated with leafy gall disease, soil, activated sludge,
water treatment plant
Rhodococcus jostii - soil, degrades PCB
Rhodococcus pyridinivorans - industrial wastewater, degrades pyridine
Rhodococcus sp. IGTS8 - Soil, compost
Rothia dentocariosa - associated with human teeth
Rubrobacter radiotolerans - aquatic, hot-springs, extremely resistant to UV
Rubrobacter xylanophilus - thermophile, extreme gamma radiation resistant, hot
springs, can degrade xylan and hemicellulose
Saccharomonospora viridis - soil, hot compost
Saccharothrix espanaensis - soil, produces saccharomicins (an antibiotic)
Salinispora arenicola - marine
Salinispora tropica - marine, sediment, psychrophilic
Sanguibacter keddieii - associated with cattle
Segniliparus rotundus - pathogenic in humans
Slackia heliotrinireducens - associated with ruminal flora of sheep
Spirillospora rubra - soil
Sporichthya brevicatena - soil
Stackebrandtia nassauensis - soil
Streptacidiphilus jiangxiensis - soil
Streptacidiphilus oryzae - ricefield soil 103
Streptomyces abikoensis - soil
Streptomyces acrimycini - soil
Streptomyces albireticuli - soil
Streptomyces albulus - soil
Streptomyces albus - soil
Streptomyces ambofaciens - soil
Streptomyces aomiensis - soil
Streptomyces bingchenggensis - soil, produces milbemycin (an insecticidal macrolide
compound)
Streptomyces caviscabies - soil, pathogenic in potatoes
Streptomyces catbensis - soil
Streptomyces collinus - soil
Streptomyces cyaneogriseus - soil, thermotolerant
Streptomyces davawensis - soil
Streptomyces finlayi - soil
Streptomyces flavofuscus - soil
Streptomyces flavoviridis - soil
Streptomyces fulvissimus - soil
Streptomyces glaucescens - soil
Streptomyces griseobrunneus - soil
Streptomyces griseolus - soil, antifungal
Streptomyces griseoplanus - soil
Streptomyces hygroscopicus - soil 104
Streptomyces hypolithicus - soil
Streptomyces incarnatus - soil
Streptomyces iranensis - soil
Streptomyces leeuwenhoekii - soil
Streptomyces netropsis - soil, antifungal
Streptomyces nitrosporeus - soil
Streptomyces olivaceiscleroticus - soil
Streptomyces purpeofuscus - soil
Streptomyces scabiei - soil, pathogenic in plants
Streptomyces speibonae - soil
Streptomyces tanashiensis - soil
Streptomyces venezuelae - soil
Streptomyces vietnamensis - soil
Streptomyces violaceusniger - soil
Streptomyces viridiflavus - soil
Streptomyces xiamenensis - soil
Tepidimonas arfidensis - thermophilic, pathogenic
Terracoccus luteus - soil
Thermobifida fusca - thermophilic, compost heaps, rotting hay, manure piles
Thermobispora bispora - thermophilic
Thermomonospora chromogena - thermophilic, soil, composted garbage
Tropheryma whipplei - associated with the Whipple disease, sewage water, fecal
material, sewage plant workers 105
Tsukamurella paurometabola - soil, sludge
Verrucosispora maris - marine sediment
Chloroflexi
Anaeolinea thermophila - thermophilic, activated sludge
Chloroflexus aggregans - thermophilic
Chloroflexus aurantiacus - thermophilic, hot springs, utilizes sulfur, fixes carbon
through the Calvin cycle and 3-hydroxy-propionate pathway
Dehalococcoides ethenogenes - contaminated groundwater, dechlorinate
perichloroethylene
Dehalococcoides mccartyi - contaminated soil/groundwater
Dehalococcoides sp. - contaminated environment, reduce contaminants such as
perichloroethylene and thrichloroethylene
Dehalogenimonas lykanthroporepellens - groundwater
Herpetosiphon aurantiacus - aquatic
Litorilinea aerophila - qquatic, thermophilic
Roseiflexus castenholzii - thermophilic, hot springs
Roseiflexus sp. - thermophilic, microbial mats of hot springs
Sphaerobacter thermophilus - thermophilic, sewage sludge
Thermobaculum terrenum - hyperthermophilic, thermal soil
Thermomicrobium roseum - thermophilic
Thermosporothrix hazakensis - thermophilic, compost
Firmicutes
Acidaminococcus intestini - human pathogens 106
Alicyclobacillus acidocaldarius - thermophilic, acidophilic
Alkaliphilus metalliredigens - akaliphilic, moderately halophilic, metal-reducing
bacterium
Alkaliphilus oremlandii - river sediments
Ammonifex degensii - thermophilic, volcanic hot spring
Amphibacillus xylanus - degrades xylan, compost manure
Aneurinibacillus thermoaerophilus - decomposes thiamine, human feces
Anoxybacillus gonensis - aquatic, thermophilic, utilizes xylan
Bacillus amyloliquefaciens - soil
Bacillus anthracis - soil, animal pathogen
Bacillus atrophaeus - soil
Bacillus bombysepticus - silkworm (insect) pathogen
Bacillus cellulosilyticus - soil, alkaliphilic
Bacillus cereus - soil, raw food, pathogenic in human
Bacillus circulans - soil, pathogenic
Bacillus clausii - soil
Bacillus coagulans - milk, pathogenic
Bacillus infantis - marine, pathogenic in infants
Bacillus halodurans - dried sewage sludge, soil, gastrointestinal tract, stool
Bacillus lehensis - soil, alkalitolerant
Bacillus licheniformis - soil, plants
Bacillus megaterium - saprophytic, soil (agricultural)
Bacillus methylotrophicus - methylotrophic, soil 107
Bacillus pseudofirmus - alkaliphilic, alkalotolerant, soil
Bacillus pumilus - fixes nitrogen, soil, aquatic
Bacillus selenitireducens - lake, haloalkaliphilic
Bacillus sp. PS3 - thermophilic
Bacillus smithii - thermophilic
Bacillus subtilis - Soil, gastrointestinal tract of animals (incl. humans)
Bacillus thuringiensis - soil, entomopathogenic
Brevibacillus brevis - air, water, decaying matter
Brevibacillus laterosporus - Entomopathogenic
Caldicellulosiruptor hydrothermalis - hyperthermophilic, thermal spring, degrades
cellulose
Caldicellulosiruptor kristjanssonii - thermophilic, cellulolytic
Caldicellulosiruptor kronotskyensis - thermophilic, cellulolytic, hot springs
Caldicellulosiruptor lactoaceticus - thermophilic, aquatic, thermal spring
Caldicellulosiruptor owensensis - extremely thermophilic, xylanolytic, marine
sediment
Caldicellulosiruptor saccharolyticus - thermophilic, cellulolytic, freshwater, thermal
spring
Carboxydothermus hydrogenoformans - thermophilic, hot springs
Carnobacterium maltaromaticum - psychrotrophic, associated with spoilage of meat
products
Carnobacterium sp. - aquatic, psychrotrophic, ice
Cellulosilyticum lentocellum - river estuarine sediment, degrades cellulose 108
Clostridiales sp. - Soil, human and animal gastrointestinal tracts
Clostridium aceticum - soil, acetogenic
Clostridium acetobutylicum - digests sugar, starch, and cellulose
Clostridium autoethanogenum - autotrophic, acetogenic
Clostridium beijerinckii - soil
Clostridium bifermentans - toxic to mosquito larvae, soil, marine sediment
Clostridium baratii - human (animal) pathogen
Clostridium botulinum - pathogenic, soil, marine sediment
Clostridium butyricum - human and animal gastrointestinal tracts
Clostridium carboxidivorans - sediment, acetogenic
Clostridium carnis - soil
Clostridium cavendishii - contaminated groundwater
Clostridium cellulolyticum - cellulolytic
Clostridium cellulosi - cellulolytic
Clostridium cellulovorans - cellulolytic
Clostridium chauvoei - human and animal pathogen
Clostridium clariflavum - thermophilic, sludge, cellulolytic
Clostridium disporicum - associated with rat caecum, human pathogen
Clostridium haemolyticum - soil, pathogenic in cattle
Clostridium lentocellum - cellulolytic, aquatic
Clostridium ljungdahlii - homoacetogenic
Clostridium pasteurianum - fixes nitrogen
Clostridium perfringens - soil, marine, animal gastrointestinal tracts, human 109
pathogen, raw meat/poultry
Clostridium phytofermentans - forest soil, ferments plant polysaccharides
Clostridium saccharobutylicum - indole, acetone, butanol, and ethanol-producing
Clostridium saccharolyticum - sewage sludge
Clostridium saccharoperbutylacetonicum - butanol-producing
Clostridium scatologenes - acetogenic, sediment
Clostridium septicum - gastrointestinal tracts, human pathogen
Clostridium sordellii - human pathogen
Clostridium sp. - soil, gastrointestinal tracts
Clostridium sporogenes - Soil, human pathogen
Clostridium stercorarium - cellulolytic, thermophilic
Clostridium sticklandii - metabolizes amino acids, black mud
Clostridium sulfidigenes - pond sediment, reduces sulfur and thiosulfate
Clostridium tetani - human clinical samples, soil, intestinal tract of human,
associated with tetanus
Clostridium thermocellum - thermophilic, cellulolytic, ethanologenic, soil, water
sediment, intestinal tract of mammals
Clostridium tyrobutyricum - dairy products (cheese and milk)
Coprococcus catus - associated with human fecal flora
Dehalobacter restrictus - soil, dechlorinates Tetra- and Trichloroethene
Dehalobacter sp. - deep soils, groundwater aquifers, and river sediments
Desulfitobacterium dehalogenans - freshwater pond sediment, reductive
dechlorination of chloroaromatic compounds 110
Desulfitobacterium dichloroeliminans - contaminated ground water
Desulfotomaculum gibsoniae - freshwater, heterotrophic, reduces sulfate
Desulfitobacterium hafniense - capable of reductive dechlorination of organohalides,
sewage sludge, freshwater sediment, soil
Desulfitobacterium metallireducens - reduce metal, aquifer sediment (uranium
contaminated)
Desulforudis audaxviator - aquatic, fixes nitrogen, reduces sulfate
Desulfosporosinus acidiphilus - acidophilic, reduces sulfate, acid mining drainage
sediments
Desulfosporosinus orientis - reduce sulfate, terrestrial, reduces iron
Desulfosporosinus meridiei - reduce sulfate, groundwater, aquatic
Desulfotomaculum acetoxidans - reduces sulfate, animal waste, contaminated
freshwater
Desulfotomaculum carboxydivorans - moderately thermophilic, sludge, aquatic,
reduces sulfate
Desulfotomaculum kuznetsovii - thermophilic, soil, reduces sulfate, aquatic
Desulfotomaculum reducens - aquatic, sediment contaminated with heavy metals,
sulfate reducing, uranium and chromium reducing
Desulfotomaculum ruminis - reduces sulfate, associated with animal rumen
Dictyoglomus thermophilum - thermophilic
Enterococcus avium - birds, human feces
Enterococcus casseliflavus - Pathogenic
Enterococcus cecorum - poultry birds, , blood, feces 111
Enterococcus columbae - pigeon intestine, blood, gastrointestinal tracts
Enterococcus durans - associated with human intestine
Enterococcus faecalis - associated with animal and human gastrointestinal tracts
Enterococcus faecium - gastrointestinal tracts of human and animal
Enterococcus hirae - pathogenic
Enterococcus malodoratus - cheese, oral cavity and airways, gastrointestinal tracts,
human liver abscess biopsy, blood
Enterococcus mundtii - Soil, plant, gastrointestinal tracts
Enterococcus saccharolyticus - herbaceous plants, fresh broccoli
Enterococcus sulfureus - plants
Eubacterium acidaminophilum - wastewater, degrades amino acids
Eubacterium limosum - anaerobic digester, acetogenic
Eubacterium rectale - human gastrointestinal tract
Exiguobacterium acetylicum - rhizospheric soil
Exiguobacterium antarcticum - psychrophilic, microbial mats
Exiguobacterium sibiricum - psychrophilic, aquatic
Exiguobacterium sp. - hyperarsenic lake, extremophile, halotolerant
Filifactor alocis - associated with periodontitis
Geobacillus thermoglucosidasius - thermophilic, soil, aquatic
Geobacillus thermoleovorans - thermophilic, hotsprings
Halanaerobium hydrogeniformans - alkaliphilic, haloalkaline lake
Halanaerobium praevalens - halophilic, surface sediments of hypersaline lakes,
hydrolytic bacterium 112
Halobacillus halophilus - halophilic, salt marsh soil, aquatic
Halothermothrix orenii - halophilic, thermophilic
Hathewaya histolytica - Soil, oral cavity and airways (gingiva and plaque),
gastrointestinal tract
Hazenella coriacea - human blood
Heliobacterium modesticaldum - cellulolytic, soil
Kyrpidia tusciae - thermophilic, hot-springs, aquatic, soil
Lachnoclostridium phytofermentans - thermophilic, acidophilic
Lactobacillus acidophilus - gastrointestinal tracts
Lactobacillus amylovorus - associated with human gastrointestinal tracts
Lactobacillus animalis - dental plaque, gastrointestinal tracts
Lactobacillus bifermentans - degrades lactate
Lactobacillus brevis - normal human microbiota, heterofermentation of lactic acid
Lactobacillus casei - associated with human urinary tract and mouth
Lactobacillus coryniformis - grass silage, antifungal, plants, cow manure
Lactobacillus delbrueckii - milk, fermented products, gastrointestinal tracts, used in
the production of yoghurt
Lactobacillus fermentum - probiotic bacterium
Lactobacillus gasseri - probiotic, found in fermented foods, human breast milk
Lactobacillus ginsenosidimutans - associated with fermented food
Lactobacillus heilongjiangensis - fermentation of lactic acid
Lactobacillus johnsonii - associated with human and animal gastrointestinal tracts
Lactobacillus lactis - plants, animal gastrointestinal tracts 113
Lactobacillus murinus - gastrointestinal tracts
Lactobacillus paracasei - human gastrointestinal tracts
Lactobacillus pentosus - associated with olives, pickles
Lactobacillus pontis - associated with sourdough
Lactobacillus ruminis - bovine rumen
Lactobacillus reuteri - probiotic bacterium, gastrointestinal tracts
Lactobacillus rhamnosus - gastrointestinal tracts
Lactobacillus sakei - dry sausage, meat, pork, stool, fermented cabbage
Lactobacillus sanfranciscensis - sourdough, fermentation of lactic acid
Lactobacillus salivarius - saliva, probiotic, gastrointestinal tracts
Lactobacillus sp. wkB8 - associated with honey bee gastrointestinal tracts
Lactobacillus zymae - associated with sourdough
Lactococcus garvieae - fish pathogen, associated with aquatic animals
Lactococcus lactis - Cheese, plant surfaces, digestive tracts of cattle
Limnochorda pilosa - thermophilic, aquatic
Listeria grayi - gastrointestinal tracts, stool, plant leaf/stem, agricultural watershed
oil, soil
Listeria monocytogenes - associated with food, pathogenic
Macrococcus caseolyticus - associated with meat, sheep, goat, and milk
Mahella australiensis - thermophilic, oil reservoir
Megamonas hypermegale - Human gastrointestinal tracts
Melissococcus plutonius - assocaited with honey bees
Methylotenera mobilis - utilizes methylamine, denitrifying bacterium 114
Mucinivorans hirudinis - degrades mucin, digestive tract of medicinal leeches
Natranaerobius thermophilus - aquatic, sediments, halophilic, thermophilic
Oceanobacillus iheyensis - halophilic, alkaliphilic, deep sea sediment
Oenococcus kitaharae - fermentation of lactic acid
Oscillibacter valericigenes - produces valerate, sea coast, gastrointestinal tracts of
mollusks
Paenibacillus beijingensis - soil, fixes nitrogen
Paenibacillus durus - plant roots, fixes nitrogen
Paenibacillus graminis - soil, plant root, food
Paenibacillus mucilaginosus - silicate bacterium, soil, fixes nitrogen
Paenibacillus odorifer - associated with milk, wheat roots
Paenibacillus peoriae - soil
Paenibacillus polymyxa - soil, marine sediment, fixes nitrogen
Paenibacillus popilliae - soil, associated with milky spore (a disease in Japanese
beetles)
Paenibacillus riograndensis - fixes nitrogen, wheat rhizosphere
Paenibacillus sabinae - rhizospheric soil, fixes nitrogen
Paenibacillus stellifer - food packaging board, produces cyclodextrin
Paenibacillus terrae - mesophilic, earthworm gut
Pectinatus frisingensis - fermented beverages, beer, spoilt beer
Pediococcus acidilactici - plants
Pediococcus inapinatus - fermented beverages
Pediococcus claussenii - fermented beverages 115
Pediococcus damnosus - fermented beverages
Pediococcus pentosaceus - Lactic acid bacteria, plant materials, ripened cheese,
vegetables, produces a bacteriocin called pediocin
Pediococcus stilesii - maize
Pelotomaculum thermopropionicum - thermophilic, propionate-oxidizing bacterium
Pelosinus fermentans - aquatic, ground water, reduces metal
Pelosinus sp. - aquifier sediment
Peptoclostridium difficile - human pathogen
Peptococcus niger - human umbilical and human flora, ovine foot rot disease of
hooved animals
Peptostreptococcus anaerobius - associated with human oral cavity
Roseburia hominis - human gut/ feces
Ruminiclostridium thermocellum - amylolytic bacterium, associated with human
colon, degrades resistant starch in the colon
Psychrobacillus insolitus - soil, psychrophilic
Ruminococcus albus - thermophilic, cellulolytic
Ruminococcus bicirculans - human gastrointestinal tract
Ruminococcus bromi - human gastrointestinal tract, degrades cellulose
Ruminococcus chamanellensis - human gastrointestinal tract, degrades cellulose
Ruminococcus obeum - associated with human gut
Savagea faecisuis - associated with swine manure
Selenomonas ruminantium - animal rumen
Selenomonas sputigena - human pathogen 116
Solibacillus silvestris - forest soil
Sporosarcina aquimarina - aquatic, halophilic
Sporosarcina contaminans - industrial clean-room floor
Sporosarcina globispora - soil, human associated (blood)
Sporosarcina koreensis - soil
Sporosarcina newyorkensis - human blood, raw cow milk
Sporosarcina soli - soil
Sporosarcina thermotolerans - thermotolerant, human blood
Sporosarcina ureae - soil
Staphylococcus haemolyticus - normal human skin flora
Staphylococcus lugdunensis - human pathogen
Staphylococcus pasteuri - human pathogen
Staphylococcus piscifermentans - fermented fish/seafood (shrimp), dog feces
Staphylococcus pseudintermedius - associated with dog’s skin, human and dog
pathogen
Staphylococcus saprophyticus - Normal flora in female genital tracts, associated with
urinary tract infections, aquatic
Staphylococcus schleiferi - dog pathogen
Staphylococcus warneri - human pathogen
Staphylococcus xylosus - soil, human skin, food
Streptococcus agalactiae - pathogenic in humans
Streptococcus dysgalactiae - human and animal pathogen
Streptococcus equi - horse pathogen 117
Streptococcus iniae - fish pathogen
Streptococcus pneumoniae - human pathogen
Streptococcus pseudopneumoniae - pathogenic in humans
Streptococcus pyogenes - pathogenic, skin microbiota
Sulfobacillus acidophilus - oxidizes mineral sulfides and ferrous iron, acidophilic,
thermophilic
Symbiobacterium thermophilum - compost, soil, feces, thermophilic
Syntrophomonas wolfei - anaerobic digestor, sewage sludge
Syntrophothermus lipocalidus - thermophilic, sludge, oxidizes fatty acids
Tepidanaerobacter acetatoxydans - silage, oxidizes acetate
Tetragenococcus halophilus - halophilic, lactic acids bacteria
Thermacetogenium phaeum - aquatic, wastewater, thermophilic, oxidizes acetate
Thermaerobacter marianensis - extremely thermophilic, marine, deep sea floor
Thermincola potens - thermophilic, reduces metal
Thermincola sp. - thermophilic
Thermoanaerobacter brockii - thermophilic, aquatic, sediment
Thermoanaerobacter italicus - thermophilic, hot springs
Thermoanaerobacter kivui - thermophilic, freshwater lake sediment, reduces CO2
Thermoanaerobacter mathranii - hot spring, extremely thermophilic, produces
ethanol
Thermoanaerobacter sp. - extremely thermophilic
Thermoanaerobacterium thermosaccharolyticum - thermophilic, degrades cellulose,
starch 118
Thermoanaerobacter pseudethanolicus - thermophiic
Thermobacillus composti - thermophilic
Thermodesulfobium narugense - reduce sulfate, thermophilic, aquatic
Thermodesulfovibrio yellowstonii - thermophilic, reduces sulfate
Thermosediminibacter oceani - thermophilic, deep sea sediment
Veillonella parvula - aquatic, pathogenic in some fishes (trout)
Weissella ceti - gut and oral cavity of human
Weissella cibaria - lactic acid bacteria
Weissella hellenica - fermented sausage, flounder intestine
Weissella thailandensis - associated with fermented food and fish
Weissella viridescens - meat, pasteurized milk
DIDERMS
Acidobacteria
Alicyclobacillus acidocaldarius - thermophilic, acidophilic
Alicyclobacillus contaminans - acidophilic, moderately thermophilic
Alicyclobacillus cycloheptanicus - soil, acidophilic
Alicyclobacillus pomorum - acidophilic, thermophilic
Alicyclobacillus sp. - acidophilic, thermophilic
Alicyclobacillus vulcanalis - acidophilic, thermophilic, hot spring
Bryobacter aggregatus - peat moss, acidotolerant, chemoorganotrophic
Cellulosimicrobium cellulans - soil, pathogenic in human
Chloracidobacterium thermophilum - acidophilic, hot spring, thermophilic
Geothrix fermentans - aquatic, petroleum contaminated aquifer sediments, reduces 119
iron
Granulicella mallensis - acidophilic, psychrophilic, soil
Granulicella tundricola - psychrophilic, soil, tundra
Holophaga foetida - freshwater mud, can degrade aromatic compounds
Koribacter versatilis Ellin345 - soil, carbon oxidizing
Sphaerochaeta globose - freshwater sediment
Terriglobus roseus - agricultural soil
Terriglobus saanensis - tundra, psychrophilic, soil
Aquifacae
Aquifex pyrophilis - hot marine sediment (Iceland), underwater volcanoes,
thermophilic
Desulfurobacterium thermolithotrophum - reduces sulfate, thermophilic, marine,
deep-sea hydrothermal vent
Persphonella marina - chemolithotrophic, thermophilic hydrogen-oxidizing, deep sea
hydrothermal vent, fixes CO2
Thermocrinis albus - hyperthermophilic
Thermocrinis ruber - hyperthermophilic
Thermovibrio ammonificans - thermophilic, nitrate ammonifying, deep sea
hydrothermal vent
Armatimonadetes
Chthonomonas calidirosea - thermophilic, soil, carbohydrate scavenging bacterium
Armatimonas rosea - freshwater
Fimbriimonas ginsengisoli - soil 120
Bacteria Candidate Phylum
Acetothermus autotrophicum - thermophilic
Methylomirabilis oxyfera - denitrifying, methanotroph
Bacteroidetes
Aequorivita sublithincola - quartz stone from the Antarctic
Alistipes shahii - associated with human appendix tissue
Alistipes finegoldii - associated with human appendix tissue
Algoriphagus sp. - marine
Amoebophilus asiaticus - Intracellular symbiont of amoeba
Azobacteroides pseudotrichonymphae - Endosymbiont of termites
Bacteroides cellulosilyticus - human and animal gastrointestinal tract, degrades
cellulose
Bacteroides dorei - human and animal gastrointestinal tract
Bacteroides helcogenes - Associated with pigs
Bacteroides ovatus - human gastrointestinal tract
Bacteroides salanitronis - Associated with chicken caecum
Bacteroides stercoris - Normal flora of gastrointestinal tract
Bacteroides thetaiotaomicron - gastrointestinal tract flora
Bacteroides ureolyticus - gastrointestinal tract flora
Bacteroides vulgatus - gastrointestinal tract flora
Bacteroides xylanisolvens - associated with human intestine
Barnesiella viscericola - chicken caecum microbiota 121
Belliella baltica - aquatic
Blattabacterium punctulatus - associated with cockroaches (Crytocercus darwini),
nitrogen recycler
Blattabacterium sp. - associated with cockroaches
Butyrivibrio proteoclasticus - produces butyrate, associated with the rumen
Capnocytophaga canimorsus - normal flora of canine and feline species, pathogenic
in human
Capnocytophaga cynodegmi - associated with dogs
Cardinium endosymbiont - nematode symbiont
Cellulophaga algicola - psychrophilic, sea ice, marine
Cellulophaga baltica - psychrophilic, halophilic, marine, associated with marine alga
Cellulophaga lytica - aquatic, mud
Chryseobacterium gallinarum - associated with chicken, degrades keratin
Chryseobacterium sp. - associated with potato root, degrades lactone
Croceibacter atlanticus - marine
Cyclobacterium amurskyense - marine
Cyclobacterium marinum - marine
Cytopaga sp. - sand, aquatic
Cytophaga aurantiaca - soil
Desulfosporosinus meridiei - reduces sulfate, aquatic, contaminated groundwater
Dokdonia sp. - marine, phototrophic
Draconibacterium orientale - marine, chemoorganotrophic
Dyadobacter fermentans - associated with Zea mays 122
Echinicola vietnamensis - halotolerant, sea water
Elizabethkingia anophelis - pathogenic in humans, associated with mosquitoes
Elizabethkingia meningoseptica - freshwater and salt water, soil, associated with fish
and frogs
Elizabethkingia sp. - soil, river water and reservoirs
Emticicia oligotrophica - aquatic
Fibrella aestuarina - coastal mud, aquatic
Flavimarina pacifica - marine
Flavobacterium antarcticum - psychrotolerant, soil (Antarctica)
Flavobacterium aquatile - aquatic
Flavobacterium aquidurense - aquatic
Flavobacterium branchiophilum - freshwater, pathogenic in fishes
Flavobacterium cheniae - sediment
Flavobacterium chilense - associated with salmonid fishes
Flavobacterium columnare - aquatic, fish pathogen
Flavobacterium degerlachei - microbial mats in Antarctic lake, psychrophilic
Flavobacterium frigidarium - aquatic, psychrophilic, xylanolytic
Flavobacterium frigoris - psychrophilic, microbial mat
Flavobacterium glaciei - psychrophilic, glacier
Flavobacterium granuli - living on granules used in wastewater treatment plant
Flavobacterium hercynium - freshwater
Flavobacterium hibernum - freshwater, psychrotrophic
Flavobacterium hydatis - fish pathogen 123
Flavobacterium indicum - aquatic, warm spring water
Flavobacterium johnsoniae - muddy soil, freshwater, degrades chitin
Flavobacterium limicola - river sediment, psychrophilic, freshwater
Flavobacterium pectinovorum - soil
Flavobacterium psychrolimnae - psychrophilic, microbial mats of Antarctic ice
Flavobacterium psychrophilum - fish pathogen, psychrophilic
Flavobacterium saccharophilum - aquatic
Flavobacterium segetis - psychrophilic, soil
Flavobacterium sinopsychrotolerans - psychrophilic, frozen soil
Flavobacterium sp. - soil, hypersaline Antarctic lake, pathogenic in freshwater fish
Flavobacterium succinicans - aquatic, associated with diseased fish
Flavobacterium tiangeerense - psychrophilic
Flavobacterium xinjiangense - psychrophilic
Flexibacter flexilis - aquatic, pond
Flexibacter litoralis - aquatic
Flexibacter roseolus - marine, thermal springs, pathogenic in fish
Fluviicola taffensis - freshwater
Formosa agariphila - marine, agarolytic
Formosa sp. - marine
Geojedonia litorea - marine
Gramella forsetii - marine, surface waters, organic matters, involved in carbon cycle
Haliscomenobacter hydrossis - activated sludge
Hymenobacter gelipurpurascens - soil 124
Hymenobacter perfusus - uranium mine waste-water system
Hymenobacter sp. - Antarctic lichen, soil
Hymenobacter swuensis - mountain soil, gamma-radiation resistant
Ignavibacterium album - thermophilic, hot springs, aquatic
Indibacter alkaliphilus - haloalkaline lake, alkaliphilic
Krokinobacter sp. - marine
Lacibacter cauensis - eutrophic lake
Lacinutrix sp. - psychrophilic, subsea floor sediment
Leadbetterella byssophila - associated with cotton waste compost
Litoribacter alkaliphilus - haloalkaliphile, soil
Maribacter sp. - marine
Marivirga tractuosa - beach sand, freshwater, terrestrial wet environments
Melioribacter roseus - thermophilic, aquatic, cellulolytic
Muricauda lutaonensis - aquatic, thermophilic
Muricauda ruestringensis - marine
Myroides odoratus - chronic wounds, human ulcer swabs, urine
Myroides profundi - deep sea sediment, psychrophilic
Niabella soli - soil
Niastella koreensis - soil
Nonlabens dokdonensis - marine, mesophilic
Nonlabens marinus - Marine
Odoribacter splanchnicus - human blood, gastrointestinal tract, and gums of dogs
Ornithobacterium rhinotracheale - pathogenic in poultry birds 125
Owenweeksia hongkongensis - marine
Paludibacter propionicigenes - soil, rice plant residue, propionate-producing
bacterium
Parabacteroides distasonis - gastrointestinal tract
Parapedobacter composti - cotton waste compost
Pedobacter aquatilis - aquatic, freshwater
Pedobacter jejuensis - soil
Pedobacter heparinus - soil
Pedobacter saltans - soil
Pedobacter sp. - soil
Pontibacter korlensis - desert soil
Porphyromonas gingivalis - human pathogen
Porphyromonas asaccharolytica - associated with human teeth, pathogenic
Prevotella denticola - associated with human oral flora
Prevotella dentalis - associated with human oral flora
Prevotella melaninogenica - associated with the upper respiratory tract, human
pathogen
Prevotella fusca - associated with oral microbiome
Prevotella ruminicola - degrades hemicellulose and pectin, human rumen
Psychroflexus torquis - psychrophilic, Antarctic sea ice
Rhodothermus marinus - geothermal environment, thermophilic, halophilic
Riemerella anatipestifer - associated with disease in ducks and geese
Robiginitalea biformata - marine 126
Rudanella sp. - air, activated sludge
Rufibacter tibetensis - marine
Runella slithyformis - freshwater lake, aquatic
Salinirepens amamiensis - marine
Saprospira grandis - marine littoral sand, coastal regions
Sediminibacter furfurosus- marine sediment
Sediminibacter sp. - marine
Siansivirga zeaxanthinifaciens - marine
Solitalea canadensis - soil
Spirosoma linguale - freshwater
Sphingobacterium sp. - Antarctic soil
Sulcia muelleri - associated with sap-feeding insects (endosymbiont)
Tannerella forsythia - associated with subgingival cavity, pathogenic
Uzinura diaspidicola - insect endosymbiont
Weeksella virosa - associated with human urinary tract
Winogradskyella sp. - marine
Zobellia galactanivorans - marine, associated with red algae
Zunongwangia profunda - deep sea sediment, halophilic
Caldisericia
Caldisericum exile - Thermophilic, aquatic, thiosulfate-reducing bacterium, hotspring
Chlamydiae
Chlamydia avium - feral pigeon droppings
Chlamydia pecorum - pathogenic in animals 127
Chlamydia trachomatis - pathogenic
Chlymadia pneumoniae - cause respiratory tract infections, human serum
Chlamydophila psittaci - pathogenic in birds and humans
Criblamydia sequanensis - aquatic, amoeba resisting bacterium
Estrella lausannensis - amoeba-resisting bacterium
Metachlamydia lacustris - endosymbiont of amoeba
Neochlamydia hartmannellae - endosymbiont of Hartmannellae vermiformis
Parachlamydia acanthamoebae - activated sludge, wastewater, wastewater
treatment plant, associated with amoebae
Protochlamydia amoebophila - Soil, endosymbiont of acanthamoeba
Protochlamydia naegleriophila - Associated with pneumonia
Simkania negevensis - human pathogen
Waddlia chondrophila - cattle, bovine abortion tissue, causative agent of human and
bovine abortion
Chrysiogenetes
Desulfurispirillum indicum - aquatic, river sediment, reduces selenate
Cloacimonetes
Cloacamonas acidaminovorans - anaerobic digester of wastewater
Chlorobi
Chlorobi sp. - aquatic, hot springs (>45°C), thermophilic
Chlorobium limicola - aquatic
Chlorobaculum tepidum - thermophilic, acidic high sulfide hot-springs
Chlorobium luteolum - aquatic 128
Chlorochromatium aggregatum - aquatic, epibiont
Chlorobium chlorochromatii - freshwater, stratified lakes, ice-covered lakes in
Antarctica
Chlorobium phaeobacteroides - aquatic, hot springs
Chlorobium phaeovibrioides - utilizes thiosulfate, fixes nitrogen
Chlorobaculum parvum - chlorophototrophic, utilizes thiosulfate
Chloroherpeton thalassium - marine
Pelodictyon phaeoclathratiforme - freshwater lakes
Prosthecochloris aestuarii - aquatic
Cyanobacteria
Acaryochloris marina -marine
Acaryochloris sp. - freshwater
Anabaena affinis - freshwater
Anabaena bergii - brackish water
Anabaena catenula - freshwater
Anabaena circinalis - freshwater
Anabaena compacta - freshwater
Anabaena crassa - freshwater
Anabaena cylindrica - aquatic, nitrogen fixer
Anabaena eucompacta - freshwater
Anabaena flos-aquae - freshwater
Anabaena gelatinicola - freshwater
Anabaena lemmermannii - freshwater, produces cyanotoxins 129
Anabaena mendotae - freshwater
Anabaena minispora - freshwater
Anabaena oryzae - freshwater
Anabaena oumiana - freshwater
Anabaena planctonia - aquatic, sediment, fixes nitrogen
Anabaena pseudocompacta - freshwater, eutrophic lakes
Anabaena sedovii - freshwater
Anabaena smithii - freshwater
Anabaena solitaria - aquatic
Anabaena sp. - moist soil, rocks, aquatic
Anabaena sphaerica - aquatic, hypersaline estuary, natronophilic
Anabaena spiroides - aquatic
Anabaena tenericaulis - freshwater
Anabaena torulosa - freshwater
Anabaena ucrainica - freshwater
Anabaena variabilis - aquatic, nitrogen fixer
Anacystis nidulans - freshwater and marine environments, photosynthetic
Aphanizomenon flos-aquae - brackish water, freshwater, fixes nitrogen
Aphanizomenon gracile - freshwater
Aphanizomenon issatschenkoi - freshwater, fixes nitrogen
Aphanizomenon ovalisporum - lakes, water reservoir
Aphanizomenon sp. - aquatic, psychrophilic
Aphanothece clathrata - freshwater 130
Arthrospira erdosensis - freshwater
Arthrospira platensis - freshwater lake, alkaliphilic
Atelocyanobacterium thalassa - marine, fixes nitrogen
Calothrix brevissima - hot springs, thermophilic
Calothrix sp. - freshwater
Chamaesiphon minutus - freshwater
Chroococcales cyanobacterium - freshwater
Chroococcidiopsis thermalis - freshwater
Coleofasciculus chthonoplastes - marine
Coelomoron pusillum - freshwater
Crinalium epipsammum - terrestrial
Cuspidothrix issatschenkoi freshwater
Cyanobacterium aponinum - freshwater
Cyanobacterium stanieri - freshwater
Cyanobium gracile - freshwater
Cyanobium sp. - freshwater lakes
Cyanothece sp. - freshwater, nitrogen fixer
Cylindrospermum catenatum - freshwater, terrestrial
Cylindrospermum siamensis - freshwater
Cylindrospermum stagnale - freshwater, terrestrial
Cylindrospermum muscicola - terrestrial
Dolichospermum affine - freshwater
Dolichospermum circinale - aquatic, associated with blooms 131
Dolichospermum crassum - freshwater
Dolichospermum compactum - freshwater
Dolichospermum ellipsoides - nitrogen fixer
Dolichospermum flos-aquae - freshwater, causes blooms
Dolichospermum lemmermannii - large lakes, associated with surface bloom
formation
Dolichospermum macrosporum - aquatic, forms bloom
Dolichospermum mendotae - freshwater
Dolichospermum mucosum - freshwater
Dolichospermum planctonicum - freshwater
Dolichospermum sigmoideum - freshwater
Dolichospermum smithii - freshwater
Dolichospermum viguieri - freshwater
Euhalothece sp. - Antarctic lake
Fischerella muscicola - aquatic, psychrophilic
Geitlerinema sp. - aquatic
Gloeobacter kilaueensis - surface of rocks
Gloeobacter violaceus - surface of rocks in Switzerland
Gloeocapsa sp. - halophiles, hypersaline lakes
Gloeocapsa sp. - hypersaline lakes, fixes nitrogen
Gloeotrichia sp. - freshwater, sediments
Halothece sp. - fixes nitrogen, halotolerant, lake
Halotia longispora - terrestrial 132
Hassallia andreassenii - terrestrial
Hassallia antarctica - marine, deglaciated lake
Hydrocoleum majus - marine
Hydrocoryne spongiosa - freshwater, marine
Leptolyngbya mycoidea - marine
Leptolyngbya sp. - terrestrial, freshwater
Limnococcus limneticus - freshwater
Limnoraphis robusta - freshwater
Lyngbya aestuarii - marine
Lyngbya hieronymusii - freshwater
Lyngbya majuscula - warm/temperate waters, freshwater
Lyngbya robusta - freshwater
Microcoleus chthonoplastes - sediments, psychrophilic, freshwater
Microcoleus paludosus - freshwater
Microcoleus sp. - freshwater
Microcystis aeruginosa - brackish water, psychrophilic
Microcystis botrys - freshwater
Microcystis flos-aquae - freshwater
Microcystis ichthyoblabe - freshwater
Microcystis panniformis - freshwater
Microcystis sp. - river, associated with large surface blooms
Microcystis viridis - freshwater
Microcystis wesenbergii - aquatic 133
Nodosilinea epilithica - sediment, psychrophilic
Nodularia sphaerocarpa - freshwater
Nodularia spumigena - nitrogen fixer, hypersaline lakes
Nostoc azollae - sediments
Nostoc calcicola - associated with water fern, fixes nitrogen
Nostoc commune - terrestrial
Nostoc ellipsosporum - marine
Nostoc insulare - terrestrial
Nostoc piscinale - terrestrial
Nostoc punctiforme - freshwater
Nostoc sp. - freshwater, sediment
Okeania sp. - moist rock, soil, bottom of deep lakes and springs (freshwater and salt
water), psychrophilic
Oscillatoria geminata - marine
Oscillatoria nigroviridis - freshwater
Planktothrix agardhii - aquatic
Planktothrix cryptovaginata - freshwater
Planktothrix sp. - freshwater
Planktothrix suspensa - freshwater
Planktothrix rubescens - freshwater
Plectolyngbya hodgsonii - freshwater, turbid lakes
Plectonema terebrans - freshwater
Pleurocapsa sp. - freshwater 134
Prochlorococcus marinus - forest soil, grows in association with mosses, moist
meadow
Prochlorococcus sp. - aquatic
Prochlorothrix hollandica - freshwater, saline environment
Pseudanabaena catenata - aquatic, psychrophilic
Pseudanabaena frigida - freshwater
Pseudanabaena sp. - freshwater
Radiocystis sp. - aquatic, fixes nitrogen, can utilize organic phosphonoate
Raphidiopsis curvata - freshwater
Rivularia sp. - marine
Scytonema cf. fritschii - freshwater
Scytonema stuposum - moist rock, damp soil
Snowella litoralis - soil
Snowella rosea - marine
Sphaerospermopsis aphanizomenoides - freshwater
Sphaerospermopsis kisseleviana - freshwater
Sphaerospermopsis torques-reginae - freshwater
Spirulina major - aquatic
Spirulina maxima - marine and freshwater, hot springs
Spirulina sp. - marine
Spirulina subsalsa - marine
Stanieria cyanosphaera - freshwater
Stigonema ocellatum - freshwater, water reservoirs 135
Symploca sp. - marine, may possess anti-cancer compounds
Synechococcus elongatus - freshwater
Synechococcus rubescens - aquatic
Synechococcus sp. - freshwater
Synechocystis minuscula - marine
Synechococcus spongiarum - freshwater
Synechocystis salina - brackish water
Synechocystis sp. - freshwater, psychrophilic, sediments
Thermosynechococcus elongatus - marine
Thermosynechococcus sp. - thermophilic, hot spring
Tolypothrix sp. - psychrophilic, sediments
Trichodesmium erythraeum IMS101 - freshwater
Trichormus variabilis - fixes nitrogen, freshwater, terrestrial
Wilmottia murrayi - freshwater
Woronichinia naegeliana - freshwater
Woronichinia sp. - freshwater
Deferribacteres
Calditerrivibrio nitroreducens - thermophilic, aquatic, thermal spring, reduces nitrate
Deferribacter desulfuricans - thermophilic, hydrothermal vent, reduces sulfate,
arsenate, and nitrate
Denitrovibrio acetiphilus - reduces nitrate, oil reservoir
Deinococcus-Thermus-Fusobacteria
Deinococcus deserti - radiotolerant, desert soil 136
Deinococcus geothermalis - thermophilic, radiophilic, hot springs
Deinococcus gobiensis - radiation resistant
Deinococcus maricopensis - radiation resistant, desert soil
Deinococcus peraridilitoris - radiation resistant, desert soil
Deinococcus radiodurans - radiation resistant, extremophilic (polyextremophile)
Fusobacterium necrophorum - bovine liver abscess, blood, alimentary canal of
humans and animals
Fusobacterium nucleatum - throat, wound, animal colon, blood, amniotic fluid
Ilyobacter insuetus - marine, anoxic sediment, fermentative
Ilyobacter polytropus - marine, mud
Ilyobacter tartaricus - mud, canal sediment
Leptotrichia buccalis -associated with human dental plaque
Marinithermus hydrothermalis - thermophilic, heterotrophic, marine
Meiothermus ruber - thermophilic, heterotrophic
Meiothermus silvanus - thermophilic
Oceanithermus profundus - thermophilic, organotrophic
Propionigenium maris - marine, intertidal mud
Propionigenium modestum - mud, human saliva
Sebaldella termitidis - associated with termite gastrointestinal tract, uricolytic
Thermus scotoductus - thermophilic, oxidizes sulfur
Thermus sp. - thermophilic, hot spring
Thermus thermophilus - thermal spring, extremely thermophilic
Truepera radiovictrix - radiation resistant, hot spring 137
Elusimicrobia
Elusimicrobium minutum - associated with termite gastrointestinal tract
Endomicrobia
Endomicrobium proavitum - symbiont of termites, fixes nitrogen
Fibrobacteres
Fibrobacter succinogenes - associated with cattle rumen, cellulolytic bacterium
Gemmatimonadetes
Gemmatimonas aurantiaca - wastewater
Lentisphaerae
Lentisphaera marina - marine
Lentisphaera profunda - marine
Nitrospirae
Leptospirillum ferriphilum - oxidizes iron, aquatic, acidophilic
Leptospirillum ferrooxidans - iron oxidizer, fresh volcanic ash, copper deposits, acid
mine drainage water
Magnetobacterium bavaricum - magnetotactic, lake sediment, oxidizes sulfur
oxidizes nitrite, wastewater
Nitrospira defluvii - chemolithoautotrophic bacteria, freshwater/saltwater, deltaic
sediments, deep-sea sediment, soil, iron pipe of a heating system
Nitrospira moscoviensis - soil, aquatic, oxidizes nitrite
Nitrospira sp. - oxidizes nitrite
Planctomyces 138
Anammoximicrobium moscowii - anaerobic ammonia oxidation, wastewater
Blastopirellula marina - freshwater, brackish water, halotolerant
Brocadia annamoxidans - aquatic, oxidizes ammonium anaerobically
Brocadia sinica - oxidizes ammonium
Caldilinea aerophila - freshwater, brackish water, ammonium oxidizer, thermophilic
Gemmata obscuriglobus - freshwater, nucleus-like organelle
Gemmata sp. - marine, coastal
Gimesia maris - hot springs, salmon colored
Isosphaera pallida - anaerobic ammonium oxidizing, sludge of an anaerobic
bioreactor
Jettenia asiatica - wastewater treatment plant, bioreactor
Kuenenia stuttgartiensis - Marine, wastewater treatment plant
Pirellula sp. - marine, anaerobic digester at wastewater treatment plant
Pirellula staleyi - aquatic
Phycisphaera mikurensis - marine
Planctomyces brasiliensis - fresh and salt water, halophilic
Planctomyces limnophilus - aquatic, surface water
Planctopirus limnophila - brackish water, sediment, algal surface
Rhodopirellula baltica - aquatic, hypersaline lake, water from salt pit
Rubinisphaera brasiliensis - aquatic
Singulisphaera acidiphila - wetlands, associated with peat plants
Syntrophobotulus glycolicus - sewage sludge, anoxic freshwater sediment
Telmatocola sphagniphila - wetland 139
Proteobacteria
Alphaproteobacteria
Acetobacter aceti - flowers, fruits, soil
Acetobacter cibinongensis - associated with fruits and flowers, acetogenic
Acetobacter indonesiensis - human pathogen (lung infections, bacteremia), fruits,
plants, vinegar production
Acetobacter oeni - acetic acid bacteria, sugary environment, associated with
wine
Acetobacter pasteurianus - produces acetic acid, associated with plants and
plant products
Acetobacter sp. - fixes nitrogen, acetic acid bacterium
Acetobacter tropicalis - associated with olive fruit fly, acetic acid bacterium
Acidiphilium multivorum - acidophilic, mine, aquatic, metal-resisting
Acidiphilium sp. - aquatic, metal-rich environment, acidophilic
Acidiphilium symbioticum - acidophilic, sulfidic mine environment,
Acidisoma sp. - acidophilic, psychrotolerant, wetland
Acidisphaera sp. - acidic hot-springs, mine drainage
Acidocella aromatica - mud, acidophilic
Acidocella facilis - aquatic, acidophilic, geothermal lake
Acidocella sp. - acidophilic, geothermal lake, mine drainage, freshwater
Afipia broomea - human sputum, industrial water for injection
Afipia felis - lake sediment, human lymph node tissue 140
Afipia sp. - atmosphere, contaminated sediment, roots
Agrobacterium fabrum - pathogenic in plants, soil
Agrobacterium sp. - pathogenic in plants
Agrobacterium vitis - pathogenic in plants, soil
Albidovulum xiamenense - thermophilic, aquatic, hot spring
Allorhizobium undicola - aquatic (waterlogged area), fixes nitrogen
Altererythrobacter atlanticus - marine
Altererythrobacter epoxidivorans - marine sediment
Altererythrobacter marensis - marine
Altererythrobacter sp. - sediment, marine, tidal flat
Anaplasma phagocytophilum - transmitted by ticks, human pathogen, blood
Ancalomicrobium adetum - freshwater creeks
Asaia bogorensis - acetic acid bacterium, flowers, fruits
Asaia krungthepensis - acetic acid bacterium, flowers, plant derived materials
Asaia lannensis - acetic acid bacterium, pathogenic
Asaia siamensis - acetic acid bacterium, flower
Asticcacaulis excentricus - aquatic, pond water
Aurantimonas manganoxydans - marine
Aurantimonas coralicida - pathogenic in corals
Aureimonas altamirensis - terrestrial
Aureimonas frigidaquae - aquatic
Azorhizobium caulinodans - stem nodule, nitrogen fixer
Azorhizophilus paspali - soil, rhizosphere, plants 141
Azospirillum sp. - fixes nitrogen
Azospirillum brasilense - fixes nitrogen, soil, rhizosphere
Azospirillum lipoferum - plant root, fixes nitrogen
Azospirillum thiophilum - aquatic, sulfur bacterial mat, fixes nitrogen
Bartonella ancashi - human pathogen
Bartonella australis - associated with kangaroo
Bartonella bacilliformis - pathogenic, associated with sandflies
Bartonella clarridgeiae - associated with cats
Bartonella grahamii - animal pathogen, ocular fluids
Bartonella henselae - associated with cat-scratch disease in humans
Bartonella quintana - human pathogen, transmitted by the human body louse
Bartonella schoenbuchensis - associated with deer fly
Bartonella vinsonii - human pathogen, associated with dogs and wild canines
Beijerinckia indica - acidophilic, fixes nitrogen, soil
Belnapia rosea - forest soil
Blastochloris viridis - aquatic
Bradyrhizobium denitrificans - aquatic, lake water
Bradyrhizobium diazofficiens - plant nodules, fixes nitrogen
Bradyrhizobium elkanii - fixes nitrogen, aquatic, soil
Bradyrhizobium jicamae - plant nodules, fixes nitrogen
Bradyrhizobium lupine - plant roots, nitrogen fixer
Bradyrhizobium oligotrophicum - fixes nitrogen, rice paddy field soil
Brevundimonas basaltis - terrestrial (black sand) 142
Brevundimonas denitrificans - aquatic sediment, denitrifying bacterium
Brevundimonas diminuta - Aaquatic, soil, cow/cattle (in their skin, nail, hair)
Brevundimonas intermedia - aquatic
Brevundimonas sp. - aquatic, it can survive simulated cosmic radiation
Brevundimonas subvibrioides - freshwater
Brevundimonas vesicularis - aquatic, associated with clinical samples
Brevundimonas viscosa - soil
Brucella abortus - pathogenic in cattle
Brucella canis - pathogenic in dogs and other canids
Brucella ceti - pathogenic in cetaceans
Brucella microti - soil, pathogenic in human
Brucella suis - pathogenic in animals
Caedibacter caryophilus - Paramecium caudatum symbiont
Caedibacter macronucleorum - obligate endosymbiont of paramecia, has R
bodies
Caedibacter acanthamoebae - endosymbiont of paramecium species
Catellibacterium nectariphilum - activated sludge
Caulobacter crescentus - freshwater
Caulobacter fusiformis - aquatic
Caulobacter leidyia - aquatic
Caulobacter vibrioides - aquatic, fresh water
Celeribacter marinus - marine
Chelativorans sp. BNC1 - polycyclic aromatic hydrocarbon degradation 143
Croceicoccus naphthovorans - marine, degrade hydrocarbon
Cytophaga hutchinsonii - soil, digest crystalline cellulose
Devosia ginsengisoli - soil
Devosia riboflavina - soil
Dinoroseobacter shibae - marine
Dongia rigui - freshwater
Endolissoclinum faulkneri - aquatic, coral reef
Ensifer adhaerens - soil, nitrogen fixer
Erythrobacter sp. - coastal sea water
Erythromicrobium sp. - resistant to heavy metal oxide, freshwater
Fulvimarina pelagi - marine
Gemmobacter tilapiae - freshwater pond
Gluconacetobacter diazotrophicus - associated with sugarcane, fixes nitrogen,
acetic acid bacteria
Gluconacetobacter xylinus - Produce cellulose, acetic acid bacteria
Gluconacetobacter takamatsuzukensis - from plaster in tomb, acetic acid
bacteria
Gluconacetobacter tumulisoli - from plaster in tomb, acetic acid bacteria
Gluconobacter oxydans - sugar-rich environment, fruits
Granulibacter bethesdensis - pathogenic
Haematobacter massiliensis - associated with clinical specimens
Hirschia baltica - marine, chemoheterotrophic
Hyphomicrobium denitrificans - marine 144
Hyphomicrobium vulgare - aquatic
Hyphomicrobium nitrativorans - biofilm, denitrifying bacterium
Jannaschia sp. CCS1 - marine
Kaistia granuli - chemoorganotroph, anaerobic sludge (granule part)
Ketogulonicigenium vulgare - soil
Komagataeibacter europaeus - cider vinegar, cellulose producer
Komagataeibacter intermedius - fermented fruit juice, cellulose producer
Komagataeibacter medillinensis - cellulolytic
Komagataeibacter xylinus - shrubs, fruit (seeds), trees, produces cellulose
Kozakia baliensis - acetic acid bacterium, plants
Leisingera methylohalidivorans - psychrophilic, marine
Liberibacter americanus - pathogenic in citrus plants
Liberibacter crescens - insect symbions, plant pathogen
Loktanella hongkongensis - marine biofilm
Magnetospirillum gryphiswaldense - freshwater, sediments
Magnetospirillum magneticum - magnetotactic, aquatic
Magnetococcus marinus - magnetotactic, marine
Maricaulis maris MCS10 - marine, forms biofilm, volatizes mercury
Martelella endophytica - associated with halophytes, antifungal
Mesorhizobium amorphae - root nodule, soil
Mesorhizobium australicum - associated with plant root nodules
Mesorhizobium ciceri - fix nitrogen, root nodules
Mesorhizobium erdmanii - soil 145
Mesorhizobium huakuii - root nodule
Mesorhizobium opportunistum - associated with root nodule, fixes nitrogen
Mesorhizobium sp. - soil
Methylarcula sp. - coastal saline habitat, facultatively methanotroph
Methylobacterium adhaesivum - aquatic, methylotrophic
Methylobacterium aquaticum - aquatic
Methylobacterium gnaphalii - associated with leaves of Gnaphalium Spicatum
Methylobacterium nodulans - methylotrophic, root nodules, nitrogen-fixing
bacteria
Methylobacterium oryzae - associated with rice stem, methylotrophic
Methyloceanibacter caenitepidi - thermophilic, marine sediment, methylotrophic
Methylocella silvestris - oxidizes methane
Methylocystis sp. - methanotrophic, aquatic
Methylosinus sp. - fixes nitrogen
Micavibrio aeruginosavorus - wastewater, epibiont
Midichloria mitochondrii - endosymbiont of ticks
Mycoplana dimorpha - soil
Neoasaia chiangmaiensis - osmotolerant acetic acid bacterium, flower
Neorhizhobium huautlense - root nodule, fixes nitrogen
Neorhizobium galegae - nitrogen fixer, root nodule
Neorickettsia helminthoeca - associated with fish, pathogenic in dogs
Neorickettsia risticii - lives in aquatic insects, associated with the Potomac horse
fever 146
Neorickettsia sennetsu - associated with fishes, human pathogen
Nitrobacter winogradskyi - soil, aquatic
Novosphingobium barchaimii - contaminated soil (with hexachlorocyclohexane)
Novosphingobium pentaromativorans - estuarine sediment, degrades
hydrocarbons
Novosphingobium sp. - soil, aquatic, degrades hydrocarbons
Nordella oligomobilis - aquatic
Nucleicultrix amoebiphila - amoeba symbiont
Ochrobactrum intermedium - associated with human, soil, polluted environment,
water, rhizosphere
Octadecabacter antarcticus - sea ice, psychrophilic, aquatic
Octadecabacter arcticus - psychrophilic, aquatic, sea ice
Oligotropha carboxidovorans - soil
Orientia tsutsugamushi - human pathogen, mite-borne bacterium
Paracaedibacter acanthamoebae - endosymbiont of Paramecium caudatum
Paracoccus aminophilus - heterotrophic, methylotroph
Paracoccus denitrificans - meadow, soil, associated with agriculture, wastewater
treatment plant
Paracoccus sp. - soil, mud volcano soil, cow dung, activated sludge
Paraherbaspirillum soli - soil
Parvibaculum lavamentivorans - degrades hydrocarbons, aquatic
Parvularcula bermudensis - marine
Pelagibacter ubique - salt and freshwater, heterotrophic 147
Pelagibacterium halotolerans - halotolerant, aquatic
Pelagibacter sp. - marine
Phaeobacter gallaeciensis - aquatic
Phenylobacterium lituiforme - freshwater, moderately thermophilic
Phenylobacterium zucineum - subsurface aquifer, alkaline groundwater, activated sludge, wastewater treatment plant, soil
Phyllobacterium myrsinacearum - sugar beet root, leaf nodule, aquatic, industrial
wastewater
Phyllobacterium sp. - associated with plant nodules, fixes nitrogen
Phycosocius bacilliformis - associated with green algae
Polymorphum gilvum - saline soil, degrades oil
Pseudorhodobacter antarcticus - Antarctic sandy sediment
Pseudorhodobacter ferrugineus - brackish water
Pseudorhodobacter sp. - aquatic
Pseudovibrio sp. - aquatic
Puniceispirillum marinum - associated with marine invertebrates
Rhizobium etli - soil, root nodules, commonly associated with beans
Rhizobium gallicum - root nodules, fixes nitrogen
Rhizobium phenanthrenilyticum - degrades phenanthrene, petroleum residue
treatment plant, fixes nitrogen
Rhizobium sp. - fixes nitrogen
Rhizobium tropici - nitrogen fixer, legume roots
Rhodobacter azotoformans - alkali-tolerant, aquatic 148
Rhodobacter blasticus - aquatic
Rhodobacter capsulatus - muddy pond rich in decomposing organic matter, soil
Rhodobacter changlensis - phototrophic, psychrotolerant
Rhodobacter johrii - semi-arid soil
Rhodobacter megalophilus - soil
Rhodobacter sp. - aquatic, psychrophilic
Rhodobacter veldkampii - freshwater pond
Rhodomicrobium vannielii - thermophilic, marine, soil, coastal sediments
Rhodospirillum centenum - thermotolerant
Rhodospirillum photometricum - freshwater
Rhodospirilum rubrum - mud (sludge), grassland
Rhodovastum atsumiense - marine, phototrophic
Rhodovulum sp. - rice paddy soil, fixes nitrogen
Rhodovulum sulfidophilum - aquatic, mud (mud sludge)
Rickettsia akari - associated with ricketssial pox, transmitted by rodent mites
Rickettsia amblyommii - associated with ticks, pathogenic
Rickettsia bellii - tick-borne, pathogenic
Rickettsia felis - associated with dogs and cats, human pathogen
Rickettsia heilongjiangensis - associated with ticks, human pathogen
Rickettsia japonica - pathogenic
Rickettsia limoniae - transmitted by ticks
Rickettsia monacensis - tick borne, human pathogen
Rickettsia prowazekii - pathogenic 149
Rickettsia rhipicephali - pathogenic, associated with ticks
Rickettsia rickettsii - associated with ticks, pathogenic
Rickettsia slovaca - associated with ticks, pathogenic
Rickettsia typhi - associated with murine typhus, use tick as carrier
Roseibacterium elongatum - marine, sand
Roseobacter denitrificans - marine sediment, phototroph
Roseobacter litoralis - marine, psychrophilic
Roseobacter sp. - sediments, sea ice
Roseococcus thiosulfatophilus - freshwater, thermal springs, bacteriochlorophyll
a-containing bacteria
Roseomonas lacus - aquatic, freshwater lake sediment
Roseomonas riguiloci - freshwater
Roseospira sp. Ber2104 - marine
Ruegeria pomeroyi - aquatic, coastal lagoon sediments, saline sulfur springs,
microbial mats
Sandarakinorhabdus limnophila - freshwater lake, psychrophilic
Silicibacter sp. TM1040 - marine, involved global sulfur cycle
Sinorhizobium americanum - fixes nitrogen, root nodules
Sinorhizobium arboris2 - leguminous trees, root nodules, fixes nitrogen
Sinorhizobium fredii - fixes nitrogen, plants, root nodule
Sinorhizobium kostiense - leguminous trees, nitrogen fixer
Sinorhizobium medicae - fixes nitrogen, root of leguminous plants, acid tolerant
Sinorhizobium meliloti - fixes nitrogen, soil 150
Sinorhizobium morelense - root nodules, nitrogen fixer
Sinorhizobium saheli - fixes nitrogen, roots, rhizosphere
Sinorhizobium terangae - nitrogen fixer, plants
Sinorhizobium xinjiangense - soybean nodules
Skermanella aerolata - air
Sphingobium chlorophenolicum- soil contaminated with pentachlorophenol,
mineralizes pentachlorophenol
Sphingobium chungbukense - soil, metabolizes polycyclic hydrocarbons,
extracellular polysaccharides and antibiotics
Sphingobium sp. SYK-6 - soil, degrades lignin-derived compounds
Sphingomonas sanxanigenens - soil
Sphingomonas sp. - oil and uranium contaminated soil, marine, can break down
polycyclic hydrocarbons, water from ricefields, volcano
Sphingomonas taxi - associated with a plant root (Cucurbita pepo), degrades DDE
(Dichlorodiphenyldichloroethylene)
Sphingopyxis alaskensis - marine
Sphingopyxis fribergensis - meadow soil, degrades styrene and phenylacetic acid
Sphingopyxis macrogoltabida - soil
Sphingopyxis sp. - freshwater lake, psychrophilic
Sphingorhabdus planktonica - degrades crude oil, marine
Sphingosinicella soli - alkaline soil
Starkeya novella - soil, methylotrophic
Swaminathania salitolerans - Plants associated, nitrogen fixing bacteria, 151
phosphate solubilizing, rhizosphere, roots and stems of salt-tolerant,
mangrove-associated wild rice
Sulfitobacter sp. - marine
Thalassobius aestuarii - tidal flat sediment, reduces nitrite
Thalassospira xiamenensis - aquatic, surface water oof an oil pool
Tistrella mobilis - wastewater, polyhydroxyalkanoate-producing bacterium
Woodsholea maritima - marine
Xanthobacter autotrophicus - fixes nitrogen, methylotroph, activated sludge,
oxidizes propene, degrades trichloroethylene
Zymomonas mobilis - aquatic, associated with beer spoilage and alcoholic
beverages
Betaproteobacteria
Accumulibacter phosphatis - sewage and wastewater treatment plant
Bacillus endophyticus - pathogenic, associated with otitis media and cystic
fibrosis
Acidovorax avenae - plant pathogen
Acidovorax citrulli - plant pathogen
Acidovorax delafieldii - soil
Acidovorax ebreus - oxidizes iron and uranium
Acidovorax facilis - soil
Acidovorax sp. JS42 - aquatic, nitrobenzene contaminated sediment,
contaminated soil
Acidovorax temperans - soil, water 152
Acidovorax valerianellae - Pathogenic in lamb’s lettuce (plant)
Advenella kashmirensis - oxidizes etrathionate, soil
Advenella mimigardefordensis - compost, utilizes organic disulfide 3,39-
dithiodipropionic acid.
Albidiferax ferrireducens - aquatic sediment
Alcaligenes faecalis - aquatic, brackish water, feces
Algoriphagus machipongonensis - mud
Alicycliphilus denitrificans - reduces nitrate, wastewater and sewage treatment
plant
Aquabacterium limnoticum - freshwater spring
Aquabacterium sp. - aquatic, soil
Aquaspirillum arcticum - aquatic
Aquaspirillum serpens - aquatic, psychrophilic, Arctic sediment
Aquincola tertiaricarbonis - pond water
Aquitalea denitrificans - contaminated groundwater, wastewater
Aromatoleum aromaticum EbN1 - soil, denitrifying bacterium
Azoarcus sp. - freshwater, soil
Azoarcus toluclasticus - nitrogen fixer, wastewater, activated sludge
Azoarcus tolulyticus - soil, water, fixes nitrogen
Azoarcus toluvorans - contaminated soil, sediments, aquifer, degrades toluene,
fixes nitrogen
Azospira restricta - contaminated soil and water
Azospira oryzae - fixes nitrogen, groundwater 153
Azospira sp. - swine waste, reduces selenite and selenate
Azovibrio restrictus - fixes nitrogen
Basilea psittacipulmonis - grass, roots (surface sterilized) Pakistan
Bordetella avium - lungs of a parakeet
Bordetella bronchiseptica - avian oral cavity and airway
Bordetella hinzii - animal pathogen
Bordetella holmesii - associated with poultry with respiratory disease, chicken
trachea
Bordetella parapertussis - associated with whooping cough in humans
Bordetella pertussis - associated with whooping cough in humans
Burkholderia caribensis - associated with whooping cough in humans
Burkholderia cepacia - soil, degrades haloacids
Burkholderia contaminans - aquatic, soil
Burkholderia diazotrophica - marine
Burkholderia dolosa - root nodules, fixes nitrogen
Burkholderia fungorum - associated with cystic fibrosis
Burkholderia gladioli - associated with fungus, plant and animals clinical samples
Burkholderia lata - soil, water, rhizosphere, isolated from an insect,
plants and animal pathogen, decomposing plants, fruits (seed)
Burkholderia mallei - soil, aquatic
Burkholderia mimosarum - humans and animal pathogen
Burkholderia nodosa - soil, root nodule
Burkholderia oklahomensis - root nodules, fix nitrogen 154
Burkholderia phenoliruptrix - mine waste, chlorate reducing
Burkholderia phytofirmans - heat-tolerant, nitrogen-fixing symbiont of Mimosa
flocculosa
Burkholderia plantarii - associated with plants
Burkholderia pseudomallei 688 - rice pathogen
Burkholderia pyrrocinia - soil, water, pathogenic
Burkholderia rhizoxinica - coil, sputum of cycstic fibrosis patients
Burkholderia thailandensis - associated with a plant pathogenic fungus (Rhizopus
microspores)
Burkholderia ubonensis - soil, water, human pathogen
Burkholderia xenovorans - soil, catabolizes aromatic compounds, aerobic
Caldimonas hydrothermale - thermophilic, thermal spring
Caldimonas manganoxidans - aquatic, thermophilic, hot spring, degrades
manganese
Caldimonas taiwanensis - hot-spring, amylase-producing bacterium
Castellaniella defragrans - Soil, reduces nitrate
Chitinibacter sp. - soil, chitin-degrading
Chitinibacter suncheonensis - soil, chitin-degrading
Chitinibacter tainanensis - degrades chitin, mud
Chitinivorax tropicus - soil, degrades chitin
Chromobacterium violaceum - freshwater lake, chitinlolytic
Chromobacterium sp. - soil, stagnant water
Collimonas arenae - wastewater, effluent from a fiber glass industry 155
Collimonas fungivorans - soi
Collimonas sp. - soil, antifungal
Comamonas koreensis - soil
Comamonas sp. - wetlands
Cupriavidus basilensis - halotolerant
Cupriavidus gilardii - soil
Cupriavidus necator - human pathogen
Cupriavidus oxalaticus - soil, mud (sludge), small ponds, hydrogen oxidizer
Cupriavidus pinatubonensis - soil
Cupriavidus taiwanensis - volcanic ash deposits, mud sludge
Cupriavidus wautersia - fixes nitrogen, plant roots
Curvibacter delicatus - soil
Curvibacter fontanus - aquatic, well water
Dechloromonas aromatica - aquatic, well water, industrial wastewater
Dechloromonas hortensis - aquatic sediment
Dechloromonas sp. - Psychrophilic
Dechlorosoma suillum - mine waste, chlorate reducing
Deefgea chitinilytica - aquatic
Deefgea rivuli - aquatic
Deefgea sp. - freshwater, reduces perchlorate
Delftia acidovorans - aquatic
Delftia sp. - soil, sewage
Denitratisoma oestradiolicum - degrades polyaromatic hydrocarbons, 156
polyaromatic hydrocarbon contaminated soil
Derxia gummosa - denitrifying bacterium, wastewater, sludge
Duganella sp. - soil, fixes nitrogen
Flexibacter ruber - water, soil
Gallionella capsiferriformans - marine
Glomeribacter gigasporarum - oxidizes iron, iron contaminated groundwater
Herbaspirillum autotrophicum - endosymbiont of arbuscular mycorrhizal fungi
(Gigaspora margarita)
Herbaspirillum chlorophenolicum - aquatic, paddy soil
Herbaspirillum frisingense - soil, degrades chloropheno
Herbaspirillum hiltneri - nitrogen fixer, soil, associated with C4-fibre plants
Herbaspirillum huttiense - plant roots, soil
Herbaspirillum lusitanum - nitrogen fixer, plant roots
Herbaspirillum rubrisubalbicans - root nodules, nitrogen fixer, soil
Herbaspirillum seropedicae - nitrogen fixer, roots and stems of sugarcane,
sorghum, and rice
Herbaspirillum sp. - aquatic, mud (sludge), freshwater, leaf (phyllosphere)
Herminiimonas arsenicoxydans - Metal resistant, industrial sludge contaminated
with arsenic, can oxidize arsenic
Herminiimonas sp. - aquatic
Hydrogenophaga sp. - oxidizes hydrogen, autotroph
Hydrogenophaga palleronii - aquatic, degrades aminobenzenesulfonate, oxidizes
hydrogen 157
Hylemonella gracilis - aquatic, pond water
Hylemonella sp. - aquatic
Inhella inkyongensis - freshwater, activated sludge
Ideonella dechloratans - aquatic, uses chlorate as an electron acceptor
Iodobacter arcticus - psychrotolerant, stream sediment
Iodobacter fluviatilis - aquatic, river
Iodobacter glacier - psychrophilic
Iodobacter limonosediminis - lake sediment
Iodobacter sp. - Freshwater, psychrophilic
Janthinobacterium agaricidamnosum - pathogenic in Agaricus bisporus
mushrooms
Janthinobacterium lividum - soil
Janthinobacterium sp. -soil, lake sediment, aquatic, psychrotolerant
Kerstersia gyiorum - associated with human clinical samples
Kinetoplastibacterium crithidii - endosymbiont of trypanosome
Kinetoplastibacterium desouzaii - endosymbiont of trypanosome
Kingella kingae - pathogenic in human
Kingella potus - associated with wounds caused by animal bites
Lampropedia hyalina - liquid manure (from livestock)
Leptothrix mobilis - freshwater sediment
Leptothrix sp. - soil, plants
Limnohabitans parvus - freshwater
Limnohabitans planktonicus - Aquatic, chemoorganotroph 158
Limnohabitans sp. - soil (heavy metal contaminated soil)
Massilia aurea - aquatic
Massilia lutea - freshwater lake, streams
Massilia sp. - soil, fixes nitrogen
Massilia varians - associated with clinical samples
Methylibium fulvum - soil of a ginseng field
Methylibium sp. - soil, groundwater
Methylobacillus flagellatus - marine, methylotrophic
Methylotenera mobilis - utilizes methylamine, lake sediment
Methylotenera versatilis - methylotrophic, lake sediment, freshwater, acid mine
drainage
Methyloversatilis universalis - methylotrophic, contaminated soil
Methylovorus glucosetrophus - methylotroph, lake
Methylovorus glucosotrophus - utilizes fructose, methylotroph
Methylopumilus planktonicus - freshwater, methylotrophic
Methylovorus sp. - methylotrophic
Methylopumilus turicensis - freshwater, methylotrophic
Mitsuaria chitosanitabida - produces chitosanase, soil
Neisseria animaloris - associated with human wound infection
Neisseria canis - oral cavity of dog and cat
Neisseria cinerea - human commensal
Neisseria dentiae - associated with dental plaque of cows
Neisseria elongata - oral floral, pathogenic 159
Neisseria gonorrhea - urogenital tract, urine
Neisseria lactamica - harmless resident of infant respiratory tract
Neisseria macacae - oropharynx flora of healthy Rhesus Monkeys
Neisseria meningitidis - pathogenic
Neisseria oralis - mesophilic, gingival plaque
Neisseria shayeganii - associated with clinical specimen
Neisseria sicca - human oropharynx flora
Neisseria wadsworthii - associated with clinical specimen
Neisseria weaveri - associated with dog bites, pathogenic in human
Neisseria zoodegmatis - associated with human wound infection
Nitrosomonas communis - oxidizes ammonium, wastewater
Nitrosomonas europaea - soil, sewage, fresh water, surfaces of building
Nitrosomonas eutropha - ammonium-oxidizing, dirt and untreated water,
sewage
Nitrosomonas oligotropha - ammonia oxidizer, water systems,
Nitrosomonas sp. - freshwater, soil, building surfaces, ammonium oxidizer
Nitrosospira briensis - acidic agricultural soil, chemolithotrophic ammonium
oxidizer
Nitrosospira sp. - soil, freshwater sediments
Nitrotoga arctica - permafrost soil, oxidizes nitrite
Noviherbaspirillum canariense - mountain volcanic soil
Pandoraea apista - associated with clinical samples (sputum of CF patients)
Pandoraea oxalativorans - soil, degrades oxalate 160
Pandoraea pnomenusa - soil, aquatic, associated with clinical samples (sputum
of cystic fibrosis patients)
Pandoraea pulmonicola - lake sediment
Pandoraea sputorum - soil, aquatic, associated with CF patients
Pelomonas puraquae - aquatic, industrial wastewater
Pandoraea thiooxydans - rhizospheric soil, oxidizes thiosulfate
Pandoraea vervacti - human pathogen
Paucibacter toxinivorans - soil
Pelodictyon luteolum - aquatic
Pelomonas soli - soil
Pigmentiphaga daeguensis - sewage plant, dye wastewater
Piscinibacter aquaticus - freshwater
Polaromonas hydrogenivorans - psychrotolerant, oxidizes hydrogen, soil
Polaromonas naphthalenivorans - freshwater, coal tar contaminated sediment,
can degrade naphthalene
Polaromonas sp. - psychrophiles, Antarctic sea water, aquatic, can degrade
ground water contaminants
Polynucleobacter acidiphobus - freshwater, chemoorganotroph
Polynucleobacter difficilis - freshwater, chemoorganotroph
Polynucleobacter necessarius - aquatic, freshwater, endosymbiont of ciliates
Pseudogulbenkiania sp. - denitrifying bacteria, rice-soybean field
Procabacter acanthamoebae - obligate endosymbiont of Acanthamoeba
Profftella armatura - symbiont of psyllids 161
Providencia stuartii - pathogenic
Pusillimonas sp. - degrades oil, cold tolerant
Ralstonia mannitolilytica - human pathogens
Ralstonia solanacearum - grass, banana plant, associated with bacterial wilt in
host plants
Ralstonia syzygii - sub-desert soil
Ramlibacter tataouinensis - soil
Rhizobacter dauci - associated with plants
Rhodoferax antarcticus - psychrophilic, Antarctic microbial mat
Rhodoferax ferrireducens - aquatic, sediment, psychrotolerant
Rhodoferax saidenbachensis - freshwater, psychrotolerant
Rhodoferax sp. - aquatic
Roseateles depolymerans - aquatic
Roseateles terrae - aquatic, greenhouse basin, freshwater ponds, sewage
ditches, activated sludge, and food processing wastewater
Rubrivivax gelatinosus - soil
Rubrivivax benzoatilyticus - degrades hydrocarbon
Silvimonas amylolytica - degrades starch, soil
Silvimonas sp. - degrades chitin
Silvimonas terrae - degrades chitin
Simplicispira metamorpha - putrid infusion of freshwater shellfish, decomposing
animals, aquatic, activated sludge, wastewater, container (reservoir)
Snodgrassella alvi - gut symbiont of honey and bumble bees 162
Sphaerotilus montanus - freshwater sediment (containing iron oxides), sludge
Sphaerotilus natans - sewage, wastewater, activated sludge
Sterolibacterium denitrificans - denitrifying bacterium, oxidizes cholesterol
Sulfuricella dentrificans - oxidizes sulfur, autotrophic, freshwater lake
Sulfurisoma sediminicola - oxidizes sulfur, autotrophic, freshwater lake sediment
Sulfuritalea hydrogenivorans - autotroph, freshwater lake
Taylorella equigenitalis - pathogenic in horse
Taylorella asinigenitalis - Associated with donkeys
Telluria sp. - soil
Tepidimonas sp. - slightly thermophilic, hot water tanks, thermal springs
Thauera sp. - wastewater
Thiobacillus denitrificans - nitrate rich habitat, soil, water, sewage, mines
Thiobacillus sp. - oxidizes sulfur
Thiobacillus thioparus - soil
Thiomonas delicate - aquatic, mine water
Thiomonas sp. - thermal spring, aquatic, creek sediment, thermophilic, degrades
urea
Tremblaya phenacola - endosymbiont of Phenacoccus peruvianus (mealybug)
Undibacterium oligocarboniphilum - aquatic
Undibacterium parvum - aquatic
Undibacterium pigrum - aquatic
Undibacterium seohonense - freshwater
Undibacterium sp. - freshwater 163
Undibacterium terreum - permafrost soil
Variovorax boronicumulans - soil, accumulates boron
Variovorax ginsengisoli - denitrifying bacterium, soil
Variovorax paradoxus - degraded PCBs, heavy-metal tolerant, deep marine
sediments
Variovorax soli - greenhouse soil
Verminephrobacter eiseniae - nephridia symbiont of earthworms
Vogesella indigofera - freshwater, soil
Vogesella perlucida - aquatic, spring water
Xenophilus aerolatus - air
Xenophilus azovorans - soil, can degrade azo dyes
Xylophilus ampelinus - pathogenic in grapes
Zoogloea sp. - aquatic, pond
Deltaproteobacteria
Anaeromyxobacter dehalogenans - aquatic, sediments, soil
Anaeromyxobacter sp. - reduces iron, sediments, aquatic
Babela massiliensis - parasite of Acanthamoeba castellanii
Bacteriovorax marinus - marine
Bacteriovorax sp. - halophilic, aquatic
Bdellovibrio bacteriovorus - soil, human gut, rhizosphere, aquatic, sewage, feces, oyster shells, gills of crabs
Bdellovibrio exovorus - rivers, soil, compost, raw sewage, and wastewater
Bdellovibrio sp. - freshwater, rhizosphere, soil, animal gastrointestinal tracts 164
Corallococcus coralloides - soil
Corallococcus macrosporus - soil
Chondromyces apiculatus - soil with plant residues, decayed wood
Chondromyces crocatus - soil
Chondromyces pediculatus - soil with decaying plant material, has antifungal
activity
Cystobacter gracilis - tree bark, soil with rotten plant material, rotting wood
Deferrisoma camini - aquatic, thermophilic
Desulfarculus baarsii - freshwater sediment, reduces sulfate
Desulfatibacillum alkenivorans - degrades alkenes, reduces sulfates
Desulfobacca acetoxidans - deduces sulfates, sludge
Desulfobacterium autotrophicum - marine, reduces sulfate
Desulfobacula toluolica - aquatic, marine mud, reduces sulfates, reduces
aromatic compounds
Desulfobulbus propionicus - aquatic, freshwater mud
Desulfocapsa sulfexigens - marine sediment, fixes nitrogen
Desulfococcus oleovorans - oil fields, utilizes C12-C20 alkanes, reduces sulfates
Desulfoglaeba sp. - aquatic, oily wastewater
Desulfohalobium retbaense - reduces sulfates, halophilic, hypersaline lake
Desulfomicrobium baculatum - reduces sulfates, freshwater
Desulfomonile tiedjei - reduce sulfates, sewage sludge
Desulfonatronum lacustre - lake sediment, mud, alkaliphilic, reduces sulfates
Desulfotalea psychrophila - psychrophilic, muds 165
Desulfovibrio aespoeensis - groundwater, reduces sulfates, aquatic
Desulfovibrio africanus - reduces sulfates, aquatic sediment
Desulfovibrio alaskensis - sulfate reducing, can reduce heavy metals like uranium
and chromium, aquatic
Desulfovibrio gigas - reduces sulfates
Desulfovibrio desulfuricans - reduces sulfates, soil, water
Desulfovibrio hydrothermalis - aquatic, hydrothermal vent, reduces sulfatea
Desulfovibrio magneticus - reduces sulfates, magnetotactic
Desulfovibrio psychrotolerans - salt water lake, alkaliphilic, psychrotolerant,
reduces sulfates
Desulfovibrio salexigens - marine, reduces sulfates
Desulfovibrio vulgaris - sulfate-reducing, soil, termite gut, rice paddy field, animal
intestines and feces, and fresh and salt water
Desulfurella acetivorans - thermophilic, oxidizes acetate, reduces sulfur
Desulfurivibrio alkaliphilus - sulfidogenic, haloalkaliphilic
Desulfotalea psychrophila - marine, psychrophilic, reduces sulfates
Desulfovibrio piezophilus - piezophilic, reduces sulfates
Desulfuromonas acetoxidans - marine sediment, reduces sulfur, oxidizes acetate
Desulfuromonas chloroethenica - aquatic, freshwater contaminated with
chlorinated ethylenes, metal-reducing
Enhygromyxa salina - aquatic, coastal mud, halophilic
Geobacter bemidjiensis - reduces metal, petroleum contaminated aquifer 166
sediment
Geobacter daltonii - reduces iron and uranium, sediment
Geobacter pickeringii - Freshwater, reduces iron
Geobacter sp. - industrial wastewater, paddy soil, sludge
Geoalkalibacter subterraneus - aquatic, reduces iron
Geobacter sulfurreducens - reduces sulfur and metal, aquatic, soil
Geobacter uraniireducens - sediment undergoing uranium bioremediation,
oxidizes acetates, reduces metals
Haliangium ochraceum - halophilic, marine
Helicobacter cinaedi - human pathogen
Helicobacter heilmanii - gastrointestinal tract biota of animals
Helicobacter pylori - Human gastrointestinal tracts, human pathogens
Hippea maritima - thermophilic, sediment, hydrothermal vent
Jahnella thaxteri - soil
Labilithrix luteola - soil
Myxococcus fulvus - halotolerant, soil, aquatic
Myxococcus sp. - soil
Myxococcus stipitatus - soil
Myxococcus virescens - soil
Nannocystis exeden - plants, soil
Pelobacter carbinolicus - aquatic, ferments 2,3-butanediol and acetoin
Pelobacter propionicus - aquatic, mud sludge, ferments 2,3-butanediol and
acetoin 167
Pelobacter sp. - canned food, industrial wastewater, sediments (fresh and
saltwater), anaerobic digester
Phaselicystis flava - forest soil, mesophilic
Polyangium sorediatum - soil, decomposing plants
Polyangium spumosum - decomposing plants, soil
Pseudenhygromyxa salsuginis - mud
Stigmatella aurantiaca - tree bark (Canada), decaying wood (USA), soil from a
brookside (Germany)
Sulfuricurvum sp. - oxidizes sulfur
Syntrophobacter fumaroxidans - synotrophic propionate degrading, sulfate-
reducing, sugar waste, anaerobic digestor
Syntrophus aciditrophicus - sewage sludge
Vulgatibacter incomptus - soil
Epsilonproteobacteria
Arcobacter cryaerophilus - water, food, farm animals, pathogenic in humans
Arcobacter nitrofigilis - marine, fixes nitrogen
Campylobacter ureolyticus - animal gastrointestinal tracts, pathogenic
Helicobacter marmotae - liver, intestine
Helicobacter mustelae - associated with ferret gastrointestinal tracts
Nautilia profundicola - hydrothermal vent, ocean
Nitratifractor salsuginis - reduces nitrate, thermophilic, aquatic
Sulfurimonas denitrificans - hydrothermal habitats, oxidizes sulfur, denitrifying
bacterium 168
Sulfurimonas autotrophica - oxidizes sulfur and thiosulfate, deep sea sediment
Sulfurimonas gotlandica - aquatic, psychrophilic
Sulfurospirillum barnesii - selenium-contaminated freshwater marsh
Sulfurospirillum deleyianum - reduces sulphur, freshwater ponds
Sulfurospirillum multivorans - polluted soil, reduces perchloroethylene
Sulfuricurvum kujiense - oxidizes sulfur, oil reservoir
Sulfurovum sp. - aquatic, deep sea vent, can utilize hydrogen, sulfur compounds
and nitrate, thermophilic
Wolinella succinogenes - cattle rumen, metabolizes cellulose, soil, tree bark
Gammaproteobacteria
Achromatium minus - freshwater sediments, acidic lake (Germany)
Achromatium sp. - sulfur bacteria, lake sediments, hydrothermal vents
Acinetobacter calcoaceticus - associated with human intestinal floral
Acinetobacter guillouiae - aquatic, soil, sewage
Acinetobacter lwoffii - normal flora of skin and human oropharynx
Acinetobacter oleivorans - rice paddy soil
Aeromonas bestiarum - aquatic, fish pathogen (carp)
Aeromonas caviae - freshwater, associated with pigs, pathogenic in humans
Aeromonas diversa - wound
Aeromonas encheleia - aquatic, European eels, soil
Aeromonas jandaei - freshwater, feces, gastrointestinal tracts, fish
Aeromonas media - aquatic, soil
Aeromonas popoffii - freshwater, drinking water production plant, water 169
reservoirs
Aeromonas salmonicida - aquatic, pathogenic in fish
Aeromonas schubertii - freshwater, forehead abscess, aquarium water, human
wound
Aeromonas sobria - fish, activated sludge, human urine and stool, freshwater
Aeromonas sp. - aquatic, soil
Aeromonas veronii - freshwater, symbiont in leeches
Actinobacillus suis - human pathogen, associated with swine
Agarivorans gilvus - produces agarose, associated with plants (seaweed)
Aggregatibacter actinomycetemcomitans - capnophilic, human oral flora,
reduces nitrate
Aggregatibacter aphrophilus - capnophilic, human oral flora
Alcanivorax borkumensis - aquatic, seawater containing crude oil, can degrade
alkanes
Alcanivorax dieselolei - degrades alkanes, aquatic, halophilic
Alcanivorax sp. - marine, degrades alkanes
Algoriphagus aquatilis - freshwater
Aliivibrio salmonicida - associated with fishes, marine
Aliivibrio wodanis - aquatic, pathogenic in fishes, psychrophilic
Alkalilimnicola ehrlichii - aquatic, haloalkaliphilic, arsenite-oxidizing
Allochromatium vinosum - ponds, marine, stagnate freshwater, oxidizes sulfide
and thiosulfate
Alteromonas australica - marine, halophilic, degrades starch 170
Alteromonas macleodii - marine
Anaerobiospirillum succiniciproducens - associated with dogs
Aquicella siphonis - aquatic, infects arthropods and protozoans
Arenimonas aquatica - freshwater
Arenimonas daejeonensis - compost manure
Arenimonas donghaensis - seashore sand
Arsenophonus endosymbiont - symbionts of insects
Arsenophonus nasoniae - associated with insects
Azorhizophilus paspali - rhizosphere soil
Azotobacter chroococcum - fixes nitrogen
Azotobacter vinelandii - soil, fixes nitrogen, aquatic
Basfia succiniciproducens - bovine rumen
Baumannia cicadellinicola - obligate endosymbiont parasite of leafhopper insect
Beggiatoa leptomitiformis - aquatic, oxidizes sulfur
Beggiatoa sp. - hydrothermal vents, mud, sulfur spring, sewage contaminated
water, high concentration of hydrogen sulfide
Berkiella cookevillensis - obligate intranuclear endosymbionts of freshwater
amoebae
Bibersteinia trehalos - pathogenic in ruminant animals
Blochmannia pennsylvanicus - ant endosymbiont
Buchnera aphidicola - endosymbiont of aphids
Cardiobacterium hominis - associated with human nose, throat, and mouth
Carnimonas nigrificans - associated with meats 171
Cedecea neteri - aquatic, human pathogen
Cellvibrio japonicus - soil, degrades plant cell wall and storage polysaccharides
Chromohalobacter beijerinckii - halophilic, soil
Chromohalobacter canadensis - halophilic, hypersaline environment
Chromohalobacter nigrandesensis - halophilic, lake sediment
Chromohalobacter salaries - halophilic
Chromohalobacter sarecensis - halophilic, psychrotolerant
Chromatocurvus halotolerans - halophilic, aquatic, brine spring
Citrobacter freundii - wound swab, infections of the respiratory tract, urinary
tract and blood, aquatic, mud (sludge), anaerobic digester, sewage
Citrobacter rodentium - associated with mouse gastrointestinal tracts
Clonothrix fusca - freshwater
Cobetia sp. - marine, degrades hydrocarbon
Colwellia psychrerythraea - eggs, psychrophilic, marine environment
Competibacter phosphatis - denitrifying bacteria, can be used for phosphate
removal
Congregibacter litoralis - aquatic, pleomorphic
Coxiella burnetii - associated with tick, pathogenic
Cronobacter condimenti - associated with food
Cronobacter dublinensis - associated with milk
Cronobacter malonaticus - associated with food
Cronobacter sakazakii - pathogenic, associated with low moisture food
Cronobacter turicensis - food borne pathogen 172
Cycloclasticus sp. - marine sediment
Cycloclasticus zancles - marine, degrades hydrocarbon
Dasania marina - psychrophilic, marine sediment
Dichelobacter nodosus - associated with foot rot in sheep
Dickeya dadantii - plant pathogen
Dickeya zeae - plant pathogen
Dyella japonica - soil
Dyella jiangningensis - potassium bearing rock
Edwardsiella ictaluri - aquatic, pathogenic in fishes
Edwardsiella piscicida - aquatic, pathogenic in fishes
Edwardsiella tarda - freshwater, gut of fishes, birds, and mammals, fish pathogen
Enterobacter aerogenes - gastrointestinal tracts, soil, waste
Enterobacter asburiae - human pathogen
Enterobacter lignolyticus - degrades lignin, soil
Enterobacter sacchari - fixes nitrogen, associated with sugarcane
Erwinia amylovora - plant pathogen
Erwinia billingiae - associated with plants
Erwinia tasmaniensis - associated with apple and pear trees
Erwinia toletana - plants, trees, olive knots
Escherichia coli O157:H7 - soil, feces, water, human pathogen
Escherichia coli UTI89 - gastrointestinal tracts, urinary tracts, uropathogenic
Escherichia fergusonii - associated with infections in human
Ferrimonas balearica - sediment, marine, reduces iron(iii) 173
Francisella cf. novicida - aquatic, arthropod-borne, pathogenic in human
Francisella noatunensis - pathogenic in fishes, aquatic
Francisella sp. - human pathogen
Francisella philomiragia - aquatic, human pathogen
Frateuria aurantia - solubilizes potassium, associated with lily and fruits of
raspberry
Francisella tularensis - pathogenic, soil, aquatic
Frischella perrara - Bee gut microbiota
Gilliamella apicola - gut symbionts of honey and bumble bees
Glaciecola nitratireducens - psychrophilic, halophilic, aquatic
Glaciecola psychrophila - psychrophilic
Gynuella sunshinyii - halophilic, antifungal
Haemophilus ducreyi - human pathogen
Haemophilus influenzae - human pathogen
Haemophilus paracuniculus - gastrointestinal tracts of rabbits
Haemophilus parainfluenzae - human pathogen
Haemophilus parasuis - associated with pigs
Haemophilus somnus - pathogenic in cattle, parasitic, upper respiratory tract of
cattle
Hafnia alvei - human pathogen
Hahella chejuensis - marine, halophilic
Haliea rubra - marine
Haliea sp. - marine 174
Halomonas alimentaria - halophilic
Halomonas alkaliantarctica - halophilic, alkaliphilic
Halomonas almeriensis - halophilic
Halomonas anticariensis - halophilic
Halomonas aquamarina - halophilic, marine
Halomonas axialensis - halophilic, deep sea hydrothermal vent
Halomonas boliviensis - soil, halophilic, alkalitolerant
Halomonas campaniensis - aquatic, haloalkaliphilic
Halomonas campisalis - aquatic, halophilic, soil
Halomonas cupida - halophilic, aquatic
Halomonas desiderata - sewage treatment plant, halophilic, denitrifying
bacterium
Halomonas elongata - estuaries, marine, saline lakes, halophilic
Halomonas halmophila - aquatic, halophilic
Halomonas halocynthiae - marine, associated with fish gill, halophilic
Halomonas halophila - halophilic, soil
Halomonas koreensis - halophilic
Halomonas magadiensis - halophilic, extremophilic, alkaliphilic
Halomonas muralis - halophilic
Halomonas neptunia - halophilic, deep sea hydrothermal vent
Halomonas olivaria - halophilic
Halomonas organivorans - halophilic, soil
Halomonas pantelleriensis - aquatic, sandy soil from lake, halophilic 175
Halomonas phosphatis - accumulates polyphosphate
Halomonas salaria - halophilic, piezophilic, salt water
Halomonas salina - aquatic, halophilic
Halomonas sp. - aquatic, halophilic
Halomonas subglaciescola - Antarctic, hypersaline, meromictic lake, fermenting
seafood
Halomonas sulfidaeris - halophilic, hydrothermal vent
Halomonas taeanensis - aquatic, halophilic
Halomonas titanicae - marine, heterotrophic, halophilic
Halomonas variabilis - halophilic, leaf surface, aquatic
Halomonas ventosae - halophilic, soil, denitrifying bacterium
Halomonas zhanjiangensis - halophilic
Halorhodospira halochloris - halophilic, lake
Halorhodospira halophila SL1 - hypersaline lake, halophilic, metabolizes sulfur
Halotalea alkalilenta - osmotolerant, alkalitolerant, sludge like waste
Halothiobacillus neapolitanus - halotolerant, oxidizes sulfur
Halyomorpha halys - endosymbiont of stink bug
Histophilus somni - pathogenic in cattle
Idiomarina loihiensis - hydrothermal vents, aquatic
Ignatzschineria indica - associated with the larvae of flesh flies and human
wounds infested with maggots
Ignatzschineria larvae - associated with larvae of fresh flies
Kangiella koreensis - aquatic, tidal flat 176
Kangiella geojedonensis - marine
Klebsiella michiganensis - human gastrointestinal tract, pathogenic
Klebsiella oxytoca - associated with clinical samples, pathogenic
Kushneria aurantia - leaves, aquatic, halophilic
Kushneria avicenniae - leaves, halophilic
Kushneria indalinina - halophilic, aquatic
Kushneria marisflavi - halophilic
Legionella anisa - aquatic
Legionella cardiaca - human pathogen
Legionella hackeliae - associated with clinical samples (lung biopsy)
Legionella jeonii - associated symbiotically with Amoeba proteus
Legionella jordanis - aquatic, sewage, human pathogens, air conditioners, spa
equipment, fountains, humidifiers, or showers, water distribution
systems
Legionella longbeachae - soil, compost, pathogenic in humans
Legionella oakridgensis - aquatic, industrial tower cooling water
Legionella pneumophila - freshwater, soil, pathogenic in human, Amoeba
pathogen
Legionella sp. - Associated with free-living amoebae, water, soil and aquatic
system
Leucothrix mucor - epibiont, Aquatic plants
Listonella anguillarum - marine, pathogenic in fishes
Luteimonas sp. - greenhouse soil 177
Lysobacter brunescens - aquatic, lake water
Lysobacter daecheongensis - stream sediment
Lysobacter niabensis - marine
Lysobacter oligotrophicus - soil
Lysobacter sp. - marine, beach sludge
Marichromatium purpuratum - freshwater
Mannheimia succiniciproducens - capnophilic, produces succinic acid
Mannheimia varigena - pathogenic in ruminant animals
Marinobacter adhaerens - marine, from thermophilic to psychrophilic
Marinobacter aquaeolei - aquatic, polluted sea water, sediment, halophilic,
psychrophilic, can degrade n-hexadecane, pristane and some crude oil
components, oxidizes iron
Marinobacter salarius - marine
Marinobacter similis - marine
Marinobacter hydrocarbonoclasticus - marine, degrades hydrocarbon,
halotolerant
Marinobacter sp. - marine, can degrade hydrocarbons, sediments
Marinomonas mediterranea - marine
Marinomonas posidonica - seagrass
Marinobacter psychrophilus - marine, psychrophilic, aquatic
Marinomonas sp. - psychrophilic, aquatic
Methylobacter luteus - methane oxidizer, oxic soil, freshwater wetland
Methylobacter psychrophilus - oxidizes methane, psychrophilic 178
Methylocaldum caldum - marine, thermotolerant, oxidizes methane
Methylocaldum sp. - methanotrophic, metabolizes sulfur
Methylocaldum szegediense - marine, thermotolerant, methanotroph
Methylococcus capsulatus - methylotrophic, thermotolerant, oil processing
plants
Methylococcus mobilis - utilizes methane
Methylococcus sp. - methanotroph, thermotolerant
Methylohalomonas lacus - halophilic, methylotrophic, hypersaline lake
Methylomicrobium album - methanotrophic, soil
Methylomicrobium alcaliphilum - methanotrophic, alkaliphilic, halotolerant
Methylomonas methanica - methanotrophic, lakes, ponds, freshwater sediment,
marshy ground
Methylomonas sp. - methanotrophs, floodwater of a rice paddy field
Methylophaga frappieri - marine, brackish water, reduces nitrate
Methylophaga sp. - halophilic, methylotrophic
Methylophaga nitratireducenticrescens - marine, reduces nitrate
Methylosarcina fibrate - oxidizes methane, soil
Methylosarcina lacus - freshwater sediment, methanotroph
Methylosoma difficile - methanotroph, lake sediment
Microbulbifer sp. - halophilic, estuarine sediment
Modicisalibacter tunisiensis - halophilic
Moranella endobia - endosymbiont of mealy bugs
Moraxella bovoculi - eye fluid of a calf, pathogenic in calves 179
Moraxella catarrhalis - human pathogen
Moraxella ovis - eye of sheep, pathogenic in sheep
Morganella morganii - Intestinal flora of human, animal, and reptiles
Nitrococcus oceani - marine, ammonia-oxidizing
Nitrosococcus halophilus - salt-adapted, oxidizes ammonia, saline pond
Nitrosococcus oceani - marine
Nitrosococcus watsoni - marine, oxidizes ammonia
Oceanicoccus sagamiensis - marine
Oceanimonas sp. - marine
Oleispira antarctica - hydrocarbonoclastic, marine, psychroplilic
Pantoea carbekii - endosymbiont of stink bug
Pantoea rwandensis - plant pathogen
Pasteurella multocida - plant pathogen
Pectobacterium atrosepticum - human pathogen
Pectobacterium carotovorum - plant pathogen
Pectobacterium wasabiae - plant pathogen
Perlucidibaca piscinae - symbiont of stink bug
Plautia stali - marine, pathogenic in marine animals
Photobacterium damselae - freshwater
Photobacterium profundum - psychrophilic, sediments
Photorhabdus asymbiotica - pathogenic in insects and human
Photorhabdus luminescens - pathogen of insects, gut of nematodes
Piscirickettsia salmonis - pathogenic in salmonid fishes 180
Plesiomonas shigelloides - freshwater, Estuarine or brackish water,
gastrointestinal tracts, feces (dog and human)
Portiera aleyrodidarum - endosymbiont of whiteflies
Pragia fontium - aquatic
Proteus mirabilis - soil, water
Proteus vulgaris - soil, water, human gastrointestinal tracts, reduces nitrate
Pseudoalteromonas atlantica - marine, primarily produces biofilms, pathogenic
in crabs (Cancer pagurus)
Pseudoalteromonas haloplanktis - marine, psychrophilic, Antarctica coastal sea
water
Pseudoalteromonas sp. - deep sea marine, psychrophilic
Pseudomonas alkylphenolia - soil, metabolizes alkylphenol
Pseudomonas balearica - denitrifying bacterium, aquatic, wastewater treatment
plant, degrades napthalene
Pseudomonas brassicacearum - soil, pathogenic in plants
Pseudomonas cichorii - soil, pathogenic in plants
Pseudomonas chlororaphis - soil, denitrifying bacterium
Pseudomonas cremoricolorata - plant pathogens
Pseudomonas deceptionensis - psychrotolerant
Pseudomonas denitrificans - denitrifying bacterium, soil
Pseudomonas fragi - psychrophilic, associated with dairy food spoilage
Pseudomonas fulva - associated with rice plants, grains, rice paddy fields, human
pathogen 181
Pseudomonas knackmussi - sewage plant, degrades chloroaromatic compounds
Pseudomonas kuykendallii - soil, bioreactor (built to degrade hexazinone)
Pseudomonas koreensis - soil
Pseudomonas mandelii - aquatic, mineral water
Pseudomonas marina - marine
Pseudomonas monteilii - human pathogen
Pseudomonas mosselii - associated with clinical samples
Pseudomonas nitroreducens - soil, synthesize polyhydroxybutyrate
Pseudomonas perfectomarina - cerebrospinal fluid, rhizosphere of Sorghum
mutans
Pseudomonas pseudoalcaligenes - soil, aquatic (swimming pool)
Pseudomonas psychrophila - psychrophilic, aquatic
Pseudomonas oryzihabitans - pathogenic in humans
Pseudomonas plecoglossicida - associated with fishes
Pseudomonas poae - associated with grass phyllosphere
Pseudomonas protegens - soil, plant roots
Pseudomonas resinovorans - soil, degrades carbazole, commonly found in lubricating oils of wood mills
Pseudomonas rhizosphaerae - rhizospheric soil
Pseudomonas savastanoi - plant leaves, plant pathogen (olive plants)
Pseudoxanthomonas icgebensis - associated with mosquitoes (Anopheles
stephensi)
Pseudomonas taeanensis - aquatic, oil contaminated sea water 182
Pseudomonas trivialis - grass phyllosphere
Pseudoxanthomonas sp. - waste, biofilter
Pseudoxanthomonas spadix - contaminated soil, degrades all six BTEX (benzene,
toluene, ethylbenzene, and o-, m-, and p-xylene)
Pseudoxanthomonas suwonensis - cotton waste compost, soil
Psychrobacter aquaticus - psychrophilic, halotolerant, aquatic, microbial mat
Psychrobacter arcticus - psychrophilic, aquatic, permafrost sediment core
Psychrobacter arenosus - psychrotolerant, sea ice, pathogenic in human
Psychrobacter cryohalolentis - permafrost, psychrophilic, aquatic, saline water
Psychrobacter faecalis - air, associated with pigeon feces
Psychrobacter frigidicola - psychrophilic, halotolerant, soil
Psychrobacter glacincola - aquatic, ice, psychrophilic, halotolerant
Psychrobacter luti - psychrophilic, aquatic, mud
Psychrobacter lutiphocae - associated with the feces of seals
Psychrobacter pulmonis - associated with a lamb lung sample
Psychrobacter sanguinis - marine
Psychrobacter sp. - Psychrophilic, soil, sediment, ice
Psychrobacter urativorans - psychrophilic
Psychromonas ingrahamii - aquatic, ice water, psychrophilic
Rahnella aquatilis - freshwater, soil, human pathogen
Rahnella sp. - contaminated subsurface soil
Raoultella ornithinolytica - aquatic, associated with fish, human pathogen
Rhodanobacter denitrificans - denitrifying bacterium, associated with nuclear 183
sites contaminated with heavy metals, nitrates, acids
Rickettsiella melolonthae - associated with ticks, pathogenic
Rickettsiella tipulae - pathogenic in crane fly
Ruthia magnifica - symbiont of Calyptogena magnifica (giant white clam),
oxidizes sulfur
Saccharophagus degradans - wetland, salt mash, decomposing plants
Salinicola socius - halophilic, utilize naphthalene
Salinicola peritrichatus - associated with frogs
Salmonella bongori - deep sea sediment
Salmonella enterica - pathogenic
Serratia fonticola - human pathogen
Serratia liquefaciens - human pathogen
Serratia marcescens - Soil, water, associated with hospital acquired infections
Serratia plymuthica - pathogenic
Serratia symbiotica - symbionts of aphids
Shewanella amazonensis - aquatic, coastal muds, intertidal sediments, reduces
iron and manganese oxides, thiosulfate, and elemental sulfur, denitrifies
nitrate to nitrite and nitrite to N2
Shewanella baltica OS155 - aquatic, oil reservoir, can utilize acetate and lactate
Shewanella denitrificans - aquatic, denitrifying bacterium
Shewanella halifaxensis - psychrophilic, marine sediment
Shewanella loihica - aquatic, iron-rich microbial mat, hydrothermal vent,
Shewanella oneidensis - soil, sediment, lake, reduces iron 184
Shewanella pealeana - marine, psychrotolerant
Shewanella piezotolerans - deep sea sediment, piezotolerant, psychrotolerant
Shewanella putrefaciens - reduces uranium, iron and magnesium, marine,
associated with fish
Shewanella sediminis - psychrophilic, aquatic, sediment
Shewanella sp. - aquatic, surface flora in fishes, associated with fish spoilage
Shewanella violacea - psychrophilic, marine sediment, high-pressure
environment
Shewanella woodyi - marine, deep seas, barophilic
Shigella boydii - pathogenic
Shigella flexneri - human pathogen, gastrointestinal tracts
Shigella sonnei - human pathogen, human gastrointestinal tract, water
Shimwellia blattae - hindgut of cockcroach, synthesize vitamin B12 de novo
Simiduia agarivorans - heterotrophic, marine
Sodalis glossinidius - endosymbiont of tsetse fly
Sodalis pierantonius - endosymbiont of rice weevil
Sodalis praecaptivus - insect endosymbiont (weevil)
Spiribacter salinus - halophilic
Spongiibacter marinus - halophilic, marine
Spongiibacter tropicus - Associated with Synechococcus (cyanobacterium) culture
Stenotrophomonas acidaminiphila - aquatic, industrial wastewater, degrades
polyaromatic hydrocarbons 185
Stenotrophomonas nitritireducens - soil
Stenotrophomonas rhizophila - associated with plants
Stenotrophomonas sp. - aquatic
Sulfuricaulis limicola - lake sediment, oxidizes sulfur
Teredinibacter turnerae - freshwater
Thalassolituus oleivorans - marine, degrades hydrocarbon
Thioalkalimicrobium aerophilum - oxidizes sulfur, alkaline lake,
chemolithoautotroph
Thioalkalimicrobium cyclicum - haloalkaliphilic, aquatic, oxidizes sulfur
Thioalkalivibrio nitratireducens - lake sediment, halophilic, alkaliphilic
Thioalkalivibrio paradoxus - alkaliphilic, autotrophic, oxidizes sulfur, lakes
Thioalkalivibrio sp. - lake sediment, natronophilic, oxidizes sulfur
Thioalkalivibrio sulfidophilus - oxidizes sulfur, haloalkaliphilic
Thioalkalivibrio versutus - oxidizes sulfur, alkaliphilic, soda lake
Thiocystis violascens - aquatic, brackish pond, reduces sulfate
Thioflavicoccus mobilis - microbial mat of a salt marsh, oxidizes sulfur
Thiomargarita sp. - oxidizes sulfur
Thiomicrospira crunogena - sulfur-oxidizing, aquatic, hydrothermal vents
Thioploca ingrica - freshwater lake (Japan), sulfur oxidizer
Thioploca sp. - sulfur bacteria, freshwater and marine sediments
Tolumonas auensis - produces toluene, freshwater lake
Variovorax sp. - soil
Vesicomyosocius okutanii - endosymbiont of Calyptogena okutanii (deep-sea 186
clam), reduces sulfate
Vibrio agarivorans - halophilic, aquatic, agarolytic
Vibrio alginolyticus - marine, pathogenic in humans
Vibrio anguillarum - marine, pathogenic in fishes
Vibrio campbellii - human pathogen
Vibrio cholerae - aquatic, pathogenic in aquatic organisms, human pathogen
Vibrio coralliilyticus - aquatic, pathogenic in coral
Vibrio fischeri - marine
Vibrio furnissii - halophilic, marine, human pathogens
Vibrio harveyi - halophilic, marine, pathogenic in marine organisms
Vibrio lentus - marine, associated with oysters
Vibrio mediterranei - aquatic, coastal sediment
Vibrio nigripulchritudo - associated with shrimp
Vibrio parahaemolyticus - brackish water, salt water, human pathogen
Vibrio splendidus - marine
Vibrio tubiashii - marine, pathogenic in corals
Vibrio vulnificus - Marine, human pathogen
Wenzhouxiangella marina - marine
Westeberhardia cardiocondylae - endosymbiont of ants
Wigglesworthia glossinidia - endosymbiont of tsetse fly
Wohlfahrtiimonas chitiniclastica - associated with open wound infections, found
in the larva of Wohlfahrtia magnifica (spotted flesh fly)
Xanthomonas albilineans - plant pathogen 187
Xanthomonas arboricola - plant pathogen
Xanthomonas citri - pathogenic in citrus plants
Xanthomonas euvesicatoria - plants, pathogenic in tomatoes
Xanthomonas fuscans - pathogenic in bean plants
Xanthomonas oryzae - pathogenic in rice
Xanthomonas sacchari - pathogenic, associated with sugarcane
Xanthomonas sp. - plant pathogen
Xanthomonas translucens - plant pathogen
Xenorhabdus bovienii - associated with nematodes
Xenorhabdus doucetiae - associated with nematodes
Xenorhabdus ehlersii - soil, associated with nematodes
Xenorhabdus hominickii - associated with nematodes
Xenorhabdus poinarii - associated with nematodes
Xylella fastidiosa - plant pathogen
Yersinia aldovae - soil, aquatic
Yersinia aleksiciae - associated with animal feces
Yersinia enterocolitica - human pathogen
Yersinia kristenseni - pathogenic in mice
Yersinia pestis - human pathogen, plague
Yersinia pseudotuberculosis - associated with a scarlet-like fever in human, food-
borne pathogen
Yersinia ruckeri - marine, pathogenic in marine organisms
Zymobacter palmae - plant sap, ferments ethano 188
Zetaproteobacteria
Mariprofundus sp. - marine, Fe (II)-rich deep-sea hydrothermal vents
Spirochaetes
Borrelia burgdorferi - tick-borne, human pathogen (Lyme disease)
Borrelia coriaceae - associated with soft ticks
Borrelia crocidurae - tick borne, human pathogen
Brachyspira alvinipulli - intestinal pathogen of chickens
Brachyspira intermedia - pathogenic in pigs, intestines of mammals and avians
Brachyspira sp. - pathogenic in pigs, birds, dogs and humans
Brachyspira pilosicoli - gastrointestinal tracts of pigs and chicken, human pathogen
Leptospira biflexa - stagnant water sources (bogs, shallow lakes, ponds, puddles),
pathogenic
Leptospira borgpetersenii serovar - causes bovine leptospirosis, found in cattle
Hardjo bovis - pathogenic in human, infection with this bacterium is zoonotic, found
in food, soil and water containing urine of infected animals
Leptospira interrogans - marine, hotspring
Salinispira pacifica - hypersaline microbial mat
Sphaerochaeta coccoides - associated with termites
Sphaerochaeta globose - freshwater, pond
Spirochaeta africana - Lake, alkaliphilic, halophilic
Spirochaeta aurantia - freshwater mud, pond, swamp water 189
Spirochaeta smaragdinae - Oil
Spirochaeta sp. - lakes (hypersaline), microbial mat, aquatic sediment, sulfuric
spring, anaerobic bioreactor (USA)
Spirochaeta thermophila - thermophilic, aquatic, sediment
Treponema azotonutricium - associated with termite gut
Treponema brennaborense - associated with a diseased cow
Treponema caldaria - aquatic, thermophilic, freshwater hotspring
Treponema primitia - associated with termite gut
Treponema succinifaciens - associated with colon of swine
Turneriella parva - aquatic
Synergistetes
Anaerobaculum mobile - thermophilic, aquatic, wastewater treatment plant
Aminobacterium colombiense - anaerobic lagoon, dairy waste treatment plant
Synergistes sp. - animal gastrointestinal tracts, soil, oil wells, wastewater treatment
plants
Thermanaerovibrio acidaminovorans - thermophilic, methanogenic sludge
Thermovirga lienii - moderately thermophilic, degrades amino acids, oil well
Tenericutes
Acholeplasma equifetale - associated with lung tissue of horse
Acholeplasma laidlawii - sewage, wastewater
Hepatoplasma crinochetorum - midgut of isopods
Mesoplasma florum - flower of a lemon tree, associated with environment rich in
sugar and cholesterol 190
Mycoplasma agalactiae - milk of sheep and goat, pathogenic in animals
Mycoplasma bovoculi - pathogenic in cattle
Mycoplasma conjunctivae - pathogenic in goat and sheep
Mycoplasma hominis - urinary tract, pathogenic
Mycoplasma hyorhinis - respiratory tract and tonsils of pigs
Mycoplasma microti - lung tissue
Mycoplasma mobile - gills of freshwater fish
Mycoplasma mycoides - associated with ruminants, pathogenic in cattle and goats
Mycoplasma penetrans - associated with human urogenital and respiratory system,
pathogenic in human
Mycoplasma putrefaciens - pathogenic in goats
Mycoplasma salivarium - human oral cavity
Mycoplasma yeatsii - associated with goats
Spiroplasma cantharicola - associated with soldier beetle
Spiroplasma diabroticae - associated with the rootworm beetle
Spiroplasma kunkelii - infects maize, resides in insect
Spiroplasma litorale - associated with tabanid flies
Spiroplasma sabaudiense - associated with mosquitoes
Spiroplasma sp. - associated with ticks
Spiroplasma taiwanense - associated with Culex mosquitoes
Ureaplasma sp. - associated with human urinary and genital tract
Thermodesulfobacteria
Thermodesulfobacterium commune - thermophilic, reduces sulfate, aquatic 191
Thermodesulfobacterium geofontis - hyperthermophilic, reduces sulfate, aquatic
Thermodesulfatator indicus - thermophilic, reduces sulfate, aquatic, hydrothermal
vent
Thermotogae
Defluviitoga tunisiensis - thermophilic, anaerobic digester
Fervidobacterium islandicum - icelandic hot spring, aquatic, extremely thermophilic
Fervidobacterium nodosum - thermophilic, thermal springs
Fervidobacterium pennivorans - thermophilic
Kosmotoga olearia - thermophilic
Mesotoga prima - sediment, mesophilic
Sulfurihydrogenibium sp. - thermophilic, sulfur oxidizing
Thermosipho africanus - thermophilic, marine hydrothermal area
Thermosipho melanesiensis -thermophilic, deep sea hydrothermal vents
Thermotoga caldifontis - thermophilic, terrestrial hot springs
Thermotoga elfii - thermophilic, reduces sulfate
Thermotoga hypogea - xylanolytic, thermophilic
Thermotoga lettingae - thermophilic, degrades methanol
Thermotoga maritima - hyperthermophilic
Thermotoga neapolitana - thermophilic, capnophilic
Thermotoga profunda - thermophilic, terrestrial hot spring
Thermotoga thermarum - hyperthermophilic, solfataric spring
Verrumicrobia
Akkermansia muciniphila - human intestine, degrades mucin 192
Bacterium Ellin - soil
Brevifollis gellanilyticus - gellan-gum degrading bacterium
Chthoniobacter flavus - soil, plants
Coraliomargarita akajimensis - aquatic
Criblamydia sequanensis - aquatic, amoeba resisting bacterium
Luteolibacter algae - marine
Luteolibacter luojiensis - psychrophilic, tundra soil
Methylacidiphilum fumariolicum - autotrophic, fixes CO2 , thermoacidophilic,
methanotrophic
Methylacidiphilum infernorum - soil, extremely acidophilic, methanotrophic
Pedosphaera parvula - soil
Prosthecobacter debontii - freshwater, Antarctic sea ice
Prosthecobacter dejongeii - freshwater
Prosthecobacter fusiformis - freshwater, Antarctic sea ice
Prosthecobacter vanneervenii - aquatic, activated sludge
Protochlamydia amoebophila - soil, endosymbiont of acanthamoeba
Verrucomicrobium spinosum - freshwater, karst cave, ancient man-made soil
(biochar), bog lake
Domain ARCHAEA
Euryarchaeota
Halopiger xanaduensis - extremely halophilic, aquatic, saline lake
Halorubrum lacusprofundi - extreme halophile, psychrophilic, deep lake Antarctica
Methanocella arvoryzae - hydrogenotrophic, methanogen, soil 193
Methanoculleus marisnigri - autotroph, methanogenic
Methanoplanus petrolearius - methanogenic, oil field
Methanoregula boonei - acidophilic, hydrogenotrophic, methanogen
Methanoregula formicica - methanogen, sludge
Methanosaeta concilii - methanogenic
Methanosaeta harundinacea - methanogenic, industrial waste water
Methanosaeta thermophila - methanogen, metabolizes acetate, aquatic, thermophilic
Methanosalsum zhilinae - halophilic, alkaliphilic, methylotrophic, aquatic
Methanosarcina acetivorans - methanotroph, aquatic
Methanosarcina barkeri - methanotrophic, sewage, aquatic
Methanosarcina horonobensis - methanogenic, aquatic, groundwater
Methanosarcina lacustris - psychrotolerant, anoxic lake sediment, methanogenic
Methanosarcina mazei - methanogen, halophilic, fixes nitrogen
Methanosphaerula palustris - methanogen, minetrophic fern
Natrialba magadii - extremophile, alkaline and hypersaline environment, thermotolerant
Thaumarchaeota
Natronobacterium gregoryi - extreme halophile and alkaliphile
Methanoregula formicicum - methanogen, activated sludge
Pyrococcus sp. - marine, hyperthermophilic, deep sea hydrothermal vent
Nitrosoarchaeum limnia - oxidizes ammonium, estuary, low salinity environment
Nitrosopumilus koreensis - marine sediment, oxidizes ammonia
Nitrosopumilus maritimus - marine, ammonium oxidizer, moderately halophilic
194
Domain EUKARYOTA
SAR
Rhizaria
Cercozoa
Plasmodiophora brassicae - plant pathogen (clubroot disease), including
cultivated plants
Rhogostoma minus - infects trout, freshwater, soils
Alveolata
Apicomplexa
Babesia gibsoni - blood parasite in dogs
Besnoitia darling - species infect skin, eyes, mucous membranes of cats, wild
animals, domestic livestock
Eimeria tenella - pathogen of chickens and livestock
Neospora caninum - pathogen of deer, livestock, dogs, rhinos, foxes, camels,
felids, buffalo, etc.
Plasmodium cynomolgi - causes malaria, mosquito vector
Sarcocystis rileyi, S. fayeri, S. moulei, S. muris - animal (mammals, reptiles,
birds) pathogens (ducks, skunks, etc.)
Theileria orientalis - pathogen of cattle
Toxoplasma gondii - parasitic in warm-blooded animals, infects most birds and
mammals (cats primarily)
Ciliophora 195
Cryptocaryon irritans - marine fish pathogen
Kuklikophrya ougandae - feeds on cyanobacteria
Notohymena apoaustralis - sewage sludge
Spathidium amphoriforme, S. rectitoratum - soil and in filamentous algae,
pathogen of birds of prey and rodents
Stentor muelleri, S. roeselii -ciliate feeds on algae, found on filamentous algae
Sterkiella sp. Aspen - from forest soil
Tokophrya quadripartita - Lake Michigan, marsh areas - infect copepods
Vorticella aequilata - associated with mosquitoes, crustaceans, amphibians,
nematodes
Dinoflagellata
Karenia umbella - toxic marine dinoflagellate
Karenia mikimotoi - toxic marine dinoflagellate
Tovellia paldangensis - dinoflagellate, marine, encysts, related species cause red
tides in freshwater lakes
Esoptrodinium sp. - freshwater dinoflagellate (mixotrophic)
Peridiniopsis niei - red tide dinoflagellate
Peridiniopsis pernardii, P. aciculiferum, P. baicalense, P. euryceps - red tide
dinoflagellate, forms on lower surfaces of ice in lakes, blooms are in
winter (marine, brackish, fresh water), encysts in ice
Pfiesteria piscicida - dinoflagellate, toxic blooms responsible for major fish kills,
toxin dangerous to humans
Polarella glacialsis - dinoflagellate, cold-water adapted 196
Prorocentrum micans - cold water
Protocruzia sp. - dinoflagellate, found in shellfish
Scrippsiella hangoei - dinoflagellate, red tide, cold water
Tovellia paldangensis - lake sediments
Perkinsozoa
Perkinsus atlanticus - lives on bivalves
Stramenopiles
Heterokonta
Ochrophyta
Bacilliarophyta (diatoms)
Amphora affinis - freshwater, diatom
Attheya septentrionalis - marine, diatom
Aulacoseira islandica, A. ambigua, A. baicalensis, A. distans, A. granulata,
A. islandica, A. skvortzowii.- Diatoms, common in lake
environments, including Lake Erie
Navicula minima - freshwater, diatom
Chysophyta (golden algae)
Chroomonas mesostigmatica - marine
Cryptomonas marssonii, C. obovata, C. paramecium, C. curvata, C.
gyropyrenoidosa, C. marssonii, C. obovoidea, C. ovata, C.
parapyrenoidifera, C. phaseolus, C. pyrenoidifera, C.
tetrapyrenoidosa - freshwater, brackish water, photolithotrophs,
food for zooplankton and fish 197
Goniomonas avonlea, G. truncata - freshwater, no plastids
Guillardia theta - marine
Hanusia phi - marine
Plagioselmis nannoplanctica - freshwater
Rhodomonas minuta - freshwater
Storeatula sp. - freshwater
Teleaulax amphioxeia - marine, important food source for marine organisms
Phaeophyta (brown algae)
Syringoderma phinneyi - marine, brown alga
Oomycota (water molds)
Achlya colorata, A. sparrowii - plant pathogens
Alaria esculenta - Atlantic seaweed (edible) - probably on ships
Albugo laibachii - plant pathogen
Aphanomyces astaci - crustacean pathogen
Aphanomyces helicoides - plant pathogen
Aphanomyces laevis - fish pathogen
Hacrobia
Haptophyta
Chlamydaster sterni - brackish cold water
Plantae (Archaeplastida)
Rhodophyta (red algae)
Antithamnion erucacladellum - marine, multicelular
Bangia fuscopurpurea - marine, on rock, wood, fleecy mat, widespread 198
Cyanidium caldarium - unicellular, microscopic, acidic hot springs, bogs, moist acidic
soils, worldwide
Glaucosphaera vacuolata - freshwater, soil
Gracilariopsis lemaneiformis - marine, freshwater, soil
Gymnogongrus griffithsiae - marine, widespread
Kumanoa intorta - freshwater, widespread
Porphyra purpurea - marine, on rocks, pebbles, and mollusks
Porphyridium purpureum - marine
Pyropia fucicola, P. haitanensis, P. kanakaensis, P. nítida, P. yezoensis - marine,
intertidal, shallow water, attaches to stones and shells, edible Nori
Viriplantae
Chlorophyta (green algae)
Acetabularia acetabulum - marine, unicellular, shallow water
Acrosiphonia spinescens - marine, multicellular, intertidal
Actinastrum sp. - freshwater, unicellular, colonial
Acutodesmus obliquus - freshwater, unicellular
Ankistrodesmus bibraianu, A. gracilis - freshwater, unicellular, colonial
Ankistrodesmus falcatus, A. stipitatus - freshwater, terrestrial, unicellular, colonial
Asterarcys quadricellulare - freshwater, unicellular
Asteromonas gracillis - freshwater to high salinity, unicellular
Auxenochlorella protothecoides - facultative heterotroph, freshwater, acidic
volcanic soil, tree sap, used in biofuel production and wastewater
treatment 199
Bathycoccus prasinos - marine, unicellular, picoplankton
Bracteacoccus aerius, B. minor - terrestrial, unicellular
Chaetosphaeridium globosum - freshwater, unicellular
Characiochloris acuminata - freshwater, unicellular
Chlamydomonas agloeformis - unicellular, freshwater, stagnant water
Chlamydomonas geitleri - unicellular, freshwater
Chlamydomonas mexicana - unicellular, terrestrial
Chlamydomonas mutabilis - unicellular, freshwater
Chlamydomonas peterfii - unicellular, freshwater, terrestrial
Chlamydomonas reinhardtii - unicellular, freshwater, soil, model organism
Chlamydomonas zebra -unicellular, freshwater, marine
Chlorella emersonii, C. mirabilis, C. sorokiniana, Chlorella sp., C. variabilis, C.
vulgaris - unicellular, freshwater, terrestrial, widespread
Chlorogonium elongatum - unicellular, freshwater, soil, eutrophic lakes, ponds,
mutualistic relationship with toads (tadpoles), widespread
Chlorokybus atmophyticus - multicellular (simple - few cells), soil
Chlorosarcinopsis arenicola - unicellular, terrestrial
Choricystis parasitica - unicellular, freshwater
Chromochloris zofingiensis - unicellular, terrestrial
Closterium baillyanum, C. calosporum, C. spinosporum - unicellular, freshwater
Coccomyxa simplex - unicellular, freshwater, terrestrial
Coccomyxa subellipsoidea - unicellular, freshwater
Coelastrum astroideum, C. microporum - freshwater unicellular, colonial 200
Desmochloris halophila - marine, unicellular
Follicularia botryoides - freshwater, unicellular
Fusochloris perforata - terrestrial, unicellular
Geminella minor - freshwater, terrestrial, filamentous, multicellular
Gloeotilopsis sterilis - marine, terrestrial, filamentous, multicellular
Interfilum terricola - terrestrial, unicellular
Kirchneriella aperta - freshwater, unicellular, colonial
Koliella longiseta - freshwater, unicellular
Lacunastrum gracillimum - freshwater, multicellular
Lobocharacium coloradoense - freshwater, unicellular, colonial
Lobosphaera incisa - freshwater, unicellular
Marsupiomonas pelliculata - brackish water, unicellular
Marvania geminata - freshwater, terrestrial, unicellular
Mesostigma viride - freshwater, unicellular, early diverging species
Mesotaenium caldariorum - freshwater, unicellular
Micractinium reisseri - freshwater, unicellular
Microglena monadina - freshwater, unicellular
Micromonas sp. RCC299 - marine, picophytoplankton
Microthamnion kuetzingianum - freshwater, terrestrial, multicellular
Monactinus sturmii - freshwater, multicellular
Monoraphidium minutum, M. neglectum - freshwater, unicellular
Mychonastes homosphaera - terrestrial, unicellular
Mychonastes huancayensis, M. jurisii - freshwater, unicellular 201
Mychonastes sp. - brackish water, unicellular
Myrmecia israelensis - terrestrial, unicellular
Nannochloris sp. - freshwater, brackish water, unicellular
Neochloris aquatica - terrestrial, freshwater, unicellular
Neocystis brevis - terrestrial, unicellular
Nephroselmis olivacea - freshwater, unicellular
Nephroselmis pyriformis - marine, unicellular
Oltmannsiellopsis sp. - marine, brackish water, unicellular
Oocystis solitaria - freshwater, unicellular
Oophila amblystomatis - salamander algae, freshwater, woodland ponds,
unicellular, symbiotic with salamanders
Ourococcus multisporus - terrestrial, unicellular
Parachlorella kessleri - freshwater, terrestrial, unicellular
Paradoxia multiseta - freshwater, unicellular
Pediastrum biradiatum, P. duplex - freshwater, multicellular
Planctonema lauterbornii - marine, freshwater, multicellular, filamentous
Planktosphaeria gelatinosa - freshwater, unicellular, colonial
Prasiola crispa - marine or terrestrial, moist shady areas, multicellular
Pseudochloris wilhelmii - freshwater, marine, unicellular
Pseudoschroederia antillarum - freshwater, unicellular
Pyramimonas gelidicola, P. parkeae - marine, unicellular
Radiococcus polycoccus - freshwater, unicellular, colonial
Resultomonas moestrupii - marine, unicellular 202
Rotundella rotunda - terrestrial, unicellular
Roya obtusa - freshwater, unicellular
Scenedesmus oblique, S. rotundus - freshwater, unicellular, colonial
Spermatozopsis exsultans - freshwater, unicellular
Spirogyra maxima - freshwater, multicellular
Stigeoclonium subsecundum - freshwater, multicellular
Tetraselmis carteriiformis - saline soil, unicellular
Tetraselmis subcordiformis - marine, unicellular
Trebouxia arboricola - aeophytic, unicellular, clonal, lichen alga
Trebouxia asymmetrica, T. impressa, T. usneae - terrestrial, unicellular, clonal,
lichen alga
Trichosarcina mucosa - terrestrial, unicellular, colonal
Tumidella tumida - terrestrial, unicellular, clonal
Ulothrix zonata - terrestrial, multicellular
Uronema sp. - freshwater, stagnant water, unicellular to filamentous
Volvox carteri - freshwater, clonal
Streptophyta
Charophyta
Embryophyta
Non-vascular plants
Anthocerotophyta
Phaeocerosv laevis - smooth hornwort, terrestrial, moist soil, banks of
streams and rivers 203
Bryophyta
Buxbaumia punctata - bug moss, terrestrial
Entosthodon obtusus - blunt cord-moss, terrestrial
Funaria hygrometrica - bonfire moss, terrestrial, moist walls and
crevices
Lyellia platycarpa - moss, terrestrial
Nyholmiella obtusifolia - blunt-leaved bristle moss, grow on trees and
shrubs
Oedipodium griffithianum - gouty-moss, moist soil, humus, rock
crevices
Polytrichum commune - common haircap moss, moist soils, high
humidity/rainfall
Tetraplodon mnioides - moss, bogs, open forest, trail margins,
terrestrial
Lycophyta
Selaginella moellendorffii - lycophyte, terrestrial, cultivated
Marchantiophyta
Marchantia paleacea - liverwort, terrestrial
Marchantia polymorpha - liverwort, terrestrial
Vascular Plants
Gnetophyta
Ephedra distachya - shrub, widespread, terrestrial
204
Magnoliophyta (flowering plants)
Aegilops tauschii - monocot, Poaceae, Tausch’s goat grass, related to
wheat (the D diploid genome of hexaploid wheat)
Alloteropsis semialata - monocot, Poaceae, black seed grass, C3 and
C4 photosynthesis systems, studied for photosynthetic
pathways
Amborella trichopoda - primitive angiosperm, shrub, small trees
Atropa belladonna - eudicot, deadly mightshade, perennial,
herbaceous, widespread
Brachypodium distachyon - monocot, Poaceae, related to agricultural
cereal grasses
Brassica rapa - eudicot, cultivated turnip, bok choi, cabbage,
mustard
Corallorhiza trifida - monocot, coralroot orchid, terrestrial
Corylopsis sinensis - eudicot, witch-hazel, terrestrial
Cucumis melo - eudicot, melon, terrestrial, agricultural crop
Eutrema salsugineum - eudicot, terrestrial, salt tolerant, drought
tolerant, heat/cold tolerant, low nitrogen tolerant
Gossypium herbaceum - eudicot, Levant cotton, perennial shrub,
terrestrial
Gossypium hirsutum - eudcot, upland cotton, perennial shrub,
agricultural, terrestrial
Heliamphora minor - marsh pitcher plant, widely cultivated, bogs 205
Hordeum jubatum - monocot, Poaceae, foxtail barley, worldwide,
terrestrial
Hydnocarpus heterophyllus - eudicot, large tree, terrestrial
Itea virginica - eudicot, Virginia sweetspire, small shrub
Lilium tsingtauense - monocot, lily, cultivated, terrestrial
Liquidambar styraciflua - eudicot, American sweetgum, tree,
terrestrial, cultivated
Lotus japonicus - eudicot, legume, terrestrial, agricultural
Lycopersicon esculentum - eudicot, tomato, terrestrial, cultivated
Medicago truncatula - eudicot, barrelclover, legume, terrestrial,
small annual
Momordica charantia - eudicot, bitter melon, terrestrial, cultivated
Nelumbo lutea - eudicot, lotus, aquatic
Oryza sativa - monocot, Poaceae, rice, cultivated
Paspalum vaginatum - monocot, Poaceae, silt grass, invasive,
cultivated as turfgrass
Phaseolus vulgaris - eudicot, cultivated bean, terrestrial, herbaceous
Phelipanche ramosa - eudicot, broomrape, terrestrial, invasive
Physalis virginiana - eudicot, Virginia groundcherry, terrestrial,
invasive
Populus trichocarpa - eudicot, black cottonwood, terrestrial, native
to North America
Roupala macrophylla - eudicot, shrub, tree, terrestrial 206
Sarracenia purpurea - eudicot, purple pitcher plant, bogs, damp soil,
carnivorous
Silene antirrhina - eudicot, sleepy silane, terrestrial, coarse soil, sand
Solanum lycopersicum - eudicot, tomato, terrestrial, cultivated
Solanum pennellii - eudicot, drought-tolerant wild tomato, terrestrial
Sorghum bicolor - monocot, Poaceae, sorghum, terrestrial, cultivated
Staphylea trifolia - eudicot, American bladdernut,shrub, native to
eastern North America, ornamental plant
Stellaria media - eudicot, chickweed, terrestrial, cultivated
Triticum aestivum - monocot, Poaceae, wheat, cultivated
Pinophyta (conifers)
Picea glauca - gymnosperm, white spruce, native to N.A., widely
cultivated, terrestrial
Picea asperata - gymnosperm, dragon spruce, terrestrial, cultivated
Pinus mugo - gymnosperm, mugo pine, terrestrial, widely cultivated
Pinus peuce - gymnosperm, Macedonian pine, terrestrial, cultivated
as an ornamental tree
Pinus strobus - gymnosperm, eastern white pine, terrestrial, native
to North America
Polypodiophyta (ferns)
Lygodium japonicum - Japanese climing fern, terrestrial, cultivated
Osmunda javanica - American royal fern, widespread from Canada to 207
Argentina, wet soils, bogs, along streams and lakes
Amoebozoa
Lobosa
Discosea
Acanthamoeba polyphaga - widespread, soil, aquatic, marine, can cause disease,
harbor large viruses (e.g., Mimivirus, Megavirus, Pandoravirus), some
harbor bacterial pathogens
Balamuthia mandrillaris - Free living amoeba, soil, causes a deadly neurological
condition known as granulomatous amoebic encephalitis, can be treated
early in infection
Neoparamoeba pemaquidensis - marine, causes amoebic gill diesease in fishes,
harbor kinetoplastid protists
Pseudoparamoeba pagei - marine
Vannella sp. - freshwater, can cause ocular keratitis in humans
Tubulinea
Difflugia garmen - freshwater, feed on algae
Hartmannellidae sp. - soil, freshwater, marine
Nolandella hibernica - marine
Paraflabellula hoguae - marine
Physochila griseola - swamps, peat, mineral soils
Quadrulella symmetrica - in wet mosses, freshwater, forest litter, soils, worldwide
Rhizamoeba sp. - freshwater, sediments
Saccamoeba limax - soil, freshwater, marine 208
Vermamoeba vermiformis - common, terrestrial, aquatic, swimmning pools, tap
water, hospital water systems, can cause severe infections in humans,
severe keratitis, can harbor giant viruses
Evosida
Conosa
Archamoeba
Mastigella eilhardi, M. erinacea - freshwater and marine sediments
Rhizomastix libera - intestinal commensals of insects, amphibians, reptiles;
inhabit freshwater sediments
Semiconosa
Dictyostelea
Acytostelium subglobosum - Inhabit surface humus and leaf mold of forest
soils, widely distributed in different forests of the world
Dictyostelium fasciculatum, D. discoideum - soil, slime mold
Apusozoa
Amastigomonas mutabilis - marine, feed on bacteria
Apusomonas proboscidea - freshwater, estuaries, feed on bacteria
Fabomonas tropica - marine sediments
Nutomonas howeae - freshwater, sediment, sand
Planomonas brevis - marine, freshwater, feed on bacteria
Opisthokonta
Animalia
Annelida 209
Aporrectodea trapezoids- common earthworm, important in soil formation,
agriculturally useful, fishing bait
Chtonobdella meyeri - jawed land leech
Dendrobaena pygmaea- rare earthworm, damp soil, mossy soil, stream banks
Eisenia fetida- feeds on decaying organic material, found on top of soil (epigean)
Eiseniona gerardoi - soil, sandy loam, earthworm
Helobdella robusta - leech, feshwater
Leodamas dubia - marine, polychaete
Ophelia bicornis - marine, polychaete
Osedax frankpressi, Osedax sp.- marine, feed on bones on seabeds
Pectinaria regalis - marine, polychaete
Platynereis dumerilii - marine, polychaete
Urechis unicinctus - marine, spoon worm, feeds on detritus
Arthropoda
Arachnida (spiders)
Ananteris franckei - scorpion
Brotheas amazonicus - scorpion
Crustacea
Aetideopsis carinata - marine, calanoid copepod
Anomalocera patersoni - copepod
Arctodiaptomus sp. - freshwater copepod
Boeckella sp. - freshwater, copepod
Caenestheriella setosa - brittletail clam shrimp, freshwater 210
Calamoecia sp. - marine, saline lakes, copepod native to Australia and Asia
Calanus finmarchicus - sea water, species of copepods, zooplankton, subarctic
waters
Calanus hyperboreus - copepod, Arctic to North Atlantic
Caligus rogercresseyi- sea louse, parasite, causative agent of caligidosis,
infects salmon
Candacia curta - marine, copepod, subtropical, pelagic
Chiridius obtusifrons - marine, copepod, pelagic, Arctic
Cyclops insignis - common freshwater copepod
Diacyclops bicuspidatus - marine, copepod native to lagoons
Diacyclops scanloni - planktonic copepod common in Great Lakes, benthic
Echinolaophonte armiger - marine, copepod, found on Gulf of Mexico
Eodiaptomus wolterecki - copepods, calanoid, also found in ancient tropical
lake in Indonesia
Eucalanus bungii - copepod found in North Pacific waters, phytoplanktivore
Euchaeta Antarctica - calanoid copepod, most common copepod in Antarctic
Eudactylopus robustus - copepod, sublittoral
Eudiaptomus graciloides - most common calanoid copepod in North-Norway
Eurytemora affinis - copepod, epibenthic
Evadne nordmanni - copepod, prefers coastal waters
Gomphiocephalus hodgsoni- Antarctic springtail
Labidocera aestiva - copepod, pelagic calanoid
Labidocera pectinata - pontellid copepod, tropical 211
Labidocera scotti - copepod, on Atlantic Coast
Laophontella armata - copepod species
Longipedia gonzalezi - marine, freshwater, copepod
Lucayostratiotes cornuta - water sprite species, harpacticoid copepod
Lucicutia flavicornis - marine, copepod, pelagic,
Macrocyclops albidus - larvivorous copepod
Macrocyclops distinctus - cyclopoid copepod
Mesocyclops leuckarti - common freshwater copepod
Neocalanus cristatus - northern Pacific copepod species, marine
Neocalanus plumchrus - large copepod found in Pacific and Arctic Oceans
Parabroteas sarsi - marine, calanoid copepod found in lakes
Paracalanus sp. - marine, copepod found worldwide
Paraeuchaeta sp. - marine, bathypelagic copepod
Parvocalanus crassirostris - marine, small pelagic calanoid copepod
Phyllodiaptomus sp. - freshwater, copepod
Pseudocalanus sp. - copepod found in Artic and northern Pacific waters
Pseudodiaptomus annandalei - marine, brackish, calanoid copepod
Pseudodiaptomus coronatus - calanoid copepod, temperate, coastal waters
Scolecithricellas sp. - calanoid copepod
Temora longicornis - marine copepod found in Atlantic.
Tigriopus californicus - intertidal copepod found on Pacific
Undeuchaeta plumosa - marine, aetideid calanoid copepod
212
Branchiopoda
Acantholeberis curvirostris - acidic peaty pools, humic lakes
Bosmina coregoni - water flea, freshwater
Bythotrephes cederstroemi, B. longimanus - water flea, freshwater,
invasive in North America, common in Great Lakes
Bythotrephes longimanus - spiny water flea, invasive, freshwater
Daphnia ambigua - marine, small planktonic, water flea, smallest of the
Daphnia species
Daphnia dentifera - water flea, freshwater lakes and ponds, small
Daphnia dubia - freshwater, water flea, benthic, arctic
Daphnia laevis - water flea species, freshwater
Daphnia longicephala - freshwater, water flea
Daphnia magna - planktonic, freshwater, water flea
Daphnia occidentalis - endemic to Australia
Daphnia pulex - most common species of water flea
Daphnia pulicaria - water flea, freshwater, model organism for scientific
research
Holopedium amazonicum - water flea, found in warm regions in North
America
Ilyocryptus sp. - species of water flea
Leptodora kindtii - transparent predatory water flea
Moina affinis - small water flea 213
Simocephalus beianensis, S. heilongjiangensis, S. serrulatus, S.
vetuloides - cladocerans, zooplankton common in lakes and ponds
Entognatha (springtails)
Anurida maritima - marine springtail, scavangers, feed on dead animals
Bilobella aurantiaca - springtail
Insecta
Aedes aegypti- yellow fever mosquito, spreads many diseases, has been found
in Ohio
Anopheles albimanus- mosquito, spreads malaria, common in the Americas
Argia oculata - damselfly, predatory
Athalia rosae - sawfly, larvae feed on brassica species, adults feed on nectar
Attelabus analis - weevil, feeds on oak
Bactrocera cucurbitae - melon fly, feed on cucurbits, agricultural pest, p
olinators of some plants
Bactrocera dorsalis - oriental fruit fly, agricultural pest, pollinators of some
plants
Bactrocera oleae - olive fruit fly, agricultural pest
Bombus impatiens - common eastern bumble bee, pollinator
Cimex lectularius- bed bugs, Human hosts, common in the US
Copidosoma floridanum- insect, wasp, parasitoid of moths
Diaeretus leucopterus - wasp, aphid parasitoid
Fopius arisanus - wasp, egg-pupal parasitoid of tephritid fruit flies, used for
biological control of fruit flies 214
Sergentomyia minuta - sand fly, parasitic, feed on blood of cold-blooded and
warm-blooded animals, associated with leishmaniasis
Brachiopoda
Lingula rostrum - marine, brachiopod, shallow, intertidal, filter-feeder, free-
swimming larva
Bryozoa
Flustrellidra hispida - marine, mud, intertidal zone, colonizes protist algae
Hornera robusta - marine, shallow, suspension feeder
Choanaflagellates
Didymoeca costata - marine, brackish water, saltmarshes
Ichthyophonus hoferi - marine, freshwater, parasite of fish (marine, freshwater, and
anadromous fishes)
Monosiga brevicollis - marine and freshwater, feed on bacteria and detritus
Salpingoeca euryoecia - marine, brackish water, freshwater
Salpingoeca fusiformis - freshwater, living on algae
Salpingoeca infusionum - marine, live on sponges
Chordata
Cephalochordata
Branchiostoma floridae - lancelet, marine
Olfactores
Tunicata
Vertebrata
Balaenoptera acutorostrata - minke whale, marine, mammal 215
Callorhinchus milii - chimaera, related to sharks, marine fish
(Chondrichthyes)
Chelonia mydas - green sea turtle, Coastal US Atlantic as far north as
Canada, marine reptile
Chinchilla lanigera - domesticated rodent, terrestrial mammal
Chrysemys picta - common painted turtle, freshwater North America reptile
Danio rerio - zebrafish, freshwater, research organism, popular aquarium
fish
Dicentrarchus labrax - European bass, marine and freshwater, fish
Epinephelus coioides - orange-spotted grouper, estuary cod, marine and
brackish water fish
Eptesicus fuscus - big bown bat, terrestrial mammal
Gorilla gorilla - gorilla (from human or zoo?) terrestrial mammal
Homo sapiens - human, terrestrial mammal
Ictidomys tridecemlineatus - three-lined ground squirrel, North America,
terrestrial mammal
Jaculus jaculus - lesser jerboa, small terrestrial rodent (mammal)
Lampadena urophaos - lanternfish, maine fish
Lepisosteus oculatus - spotted gar, North America, freshwater fish
Lipotes vexillifer - freshwater mammal (dolphin)
Macaca mulatta - Rhesus macaque, terrestrial mammal (from human)
Monodelphis domestica - gray short-tailed opossum, terrestrial mammal
(marsupial) 216
Mus musculus - common mouse, terrestrial mammal
Myotis lucifugus - little brown bat, terrestrial mammal
Ornithorhynchus anatinus - platypus, semiaquatic mammal (monotreme)
Oryzias latipes - ricefish, freshwater, brackish water fish
Otolemur garnettii - northern greater galago, terrestrial mammal
Pantholops hodgsonii -Tibetan antelope (zoo?), terrestrial mammal
Pelodiscus sinensis - softshell turtle, freshwater, brackish water reptile,
widespread
Phodopus sungorus - winter white dwarf hamster, terrestrial mammal
Poecilia formosa, P. reticulata - Amazon molly, guppy, freshwater fish
Pongo abelii - oragutan, (human?), terrestrial mammal
Protomyctophum gemmatum - lanternfish, circumglobal, marine fish
Pseudopodoces humilis - ground tit, ground jay, terrestrial avian
Pteropus alecto - flying fox, terrestrial mammal
Raja schmidti - ray (Chondrichthyes), marine fish
Rhinobatos productos - shovelnose guitarfish (Chondrichthyes), marine fish
Salmo salar - Atlantic salmon, marine fish
Sciaenops ocellatus - Atlantic red drum, marine fish
Scyliorhinus torazame - cloudy catshark (Chondrichthyes), marine fish
Taaningichthys minimus - lanternfish, widespread, marine fish
Takifugu rubripes - pufferfish, marine, brackish water, fish
Thamnophis sirtalis - common garter snake, terrestrial reptile
Xenopus tropicalis - western clawed frog, freshwater amphibian 217
Cnidaria
Actinernus elongatus - marine, sea anemone, benthic
Adamsia palliata - marine, sea anemone found on hermit crab shells, shallow
water
Antennella ansini - marine, coral, benthic
Antipathes atlántica - marine, black coral, benthic
Asyncoryne ryniensi s- marine, hydroid, sub-littoral
Aulactinia stella- Silver spotted sea anemone subtropical
Boloceroides mcmurrichi - sea anemone, benthic, tropical
Bunodactis reynaudi - marine, sandy sea anemone, shallow water, southern Africa
Calycella syringa - marine, sessile hydroid, subtropical
Carybdea xaymacana - marine, box jellyfish, tropical
Chironex fleckeri - marine venomous box jellyfish, shallow water
Corynactis viridis - marine, jewel sea anemone, brightly colored, sublittoral zone
Dendrobathypathes boutillieri - marine, coral, benthic
Diadumene cincta - marine, small, orange sea anemone, intertidal to sublittoral
Diadumene leucolena - marine, white sea anemone, intertidal to sublittoral
Drymonema larsoni - marine, jellyfish, tropical
Ectopleura crocea - marine, tubular hydroid, temperate coastal waters
Edwardsia timida - marine, sea anemone, sublittoral zones
Edwardsia elegans - marine, burrowing sea anemone, benthic
Epiactis handi - marine, sea anemone, benthic 218
Eutima curva - marine, hydrozoa, pelagic, tropical waters
Favites abdita - marine, stony coral native, Indo-Pacific region, littoral zone
Gonothyraea loveni - marine, hydroid, subtidal zones
Halecium labrosum - marine, hydroid, benthic
Halopteris schucherti - marine, hydrozoa, benthic, subtropical
Hebella venusta - marine, hydroid, shallow water
Hydra circumcincta - marine, hydra, common in tropical regions
Hydra littoralis - small, freshwater, subtropical, demersal
Hydra sinesis - freshwater, small
Hydrissa sodalis - marine, benthic
Kirchenpaueria halecioides - marine, hydroid, benthic
Laodicea undulata - marine, hydroid, subtropical, pelagic
Leiopathes cf. expansa - marine, sea pen, benthic
Leioptilus fimbriatus - marine, sea pen, sublittoral
Mitrocomella fulva - marine, hydroid, coastal waters
Modeeria rotunda - marine, hydroid, subtropical, benthopelagic
Moerisia inkermanica- invasive hydrozoan, demersal, subtropical
Nausithoe punctata - marine, crown jellyfish, pelagic, tropical
Nematostella vectensis- marine, starlet sea anemone, coastal
Obelia bidentate - aquatic, brackish water, coastal
Odessia maeotica - marine, brackish water, hydrozoa, pelagic, subtropical
Paranthus niveus - sea anemone, benthic, subtropical
Parantipathes cf. hirondelle - marine, benthic, black coral 219
Parazoanthus axinellae - marine, yellow cluster anemone, benthic
Parvicapsula petuniae - marine, fish parasite
Pavona cactus - cactus coral, found in tropical shallow waters or lagoons
Phialella quadrata - marine, hydrozoan, shallow water
Polyorchis haplus - marine, hydrozoan, coastal
Ricordea florida- coral, glows under UV light, shallow water
Sagarita ornata - marine, sea anemone, shallow water
Sagartia troglodytes - marine, cave-dwelling sea anemone, shallow water
Sarsia apicula - marine, hydrozoan, pelagic, subtropical
Sertularella gayi, S. mediterránea - marine, hydrozoan, sublittoral
Schuchertinia sp. - marine, hydrozoan, shallow water
Sphaerocoryne agassizii - marine, hydrozoan, pelagic, subtropical
Stauropathes cf. punctata - marine, coral species, cold water
Staurocladia wellingtoni - marine, hydrozoan, subtropical, demersal
Stegopoma plicatile - marine, hydrozoan, sessile, cold water
Stichopathes dissimilis - marine, coral, sessile, tropical
Thyroscyphus marginatus - marine, small, immortal jellyfish, temperate to tropics
worldwide, benthic
Tiaricodon coeruleus - marine, hydrozoan, pelagic, subtropical
Tiaropsis multicirrata - marine, hydrozoan, shallow waters
Triactis producto - marine, sea anemone, shallow reefs, tropical
Trissopathes pseudotristicha - marine, benthic, tropical
Tubastraea coccinea - marine, stony coral, sun coral, heterotrophic, shallow water 220
Turritopsis lata - marine, hydrozoan, subtropical, benthopelagic
Viatrix globulifera - turtle grass anemone, poisonous, sessile, subtropical
Ctenophora
Mnemiopsis leidyi - marine, comb jelly, Western Atlantic, tolerates a wide range
in salinity
Pleurobrachia bachei - marine, com jelly, feed on copepods and plankton
Echinodermata
Florometra serratissima - crinoid, marine, plankton feeder
Gastrotrichia
Chaetonotus sp. - Freshwater, gastrotrichs
Halichaetonotus sp. - freshwater, estuary, and marine sediments, gastrotrichs
Heterolepidoderma sp. - freshwater, gastrotrichs
Hemichordata
Holomycota
Nuclearia moebiusi, N. simplex - freshwater, brackish water
Holozoa
Capsaspora owczarzaki - freshwater, sister group to choanoflagellates and fungi,
endosymbiont of snails
Kinorhyncha
Echinoderes dujardinii, E. sensibilis - Small marine mud dragon, intertidal to deep
sea, worldwide
Mollusca
Abra alba - marine bivalve, shallow water, soft sediments 221
Acila castrensis - marine bivalve, shallow water, soft sediment and sand
Amblychilepas nigrita - marine limpet, shallow water under stones
Aplysia californica - marine sea slug, research lab animal
Arctica islandica - marine bivalve, edible
Asaphis deflorata - marine bivalve, shallow water, mud and/or sand
Barnea candida - marine bivalve, shallow water, sublittoral, burrows into wood,
peat, and soft rock
Calyptogena magnifica - large white clam, deep ocean, around hydrothermal vents
Chama macerophylla - marine bivalve, attaches to ship hulls and floating debris,
invaisve
Chione elevata - marine bivalve, shallow water, sand
Congeria jalzici - subterranean bivalve, cave-dwelling
Corbicula fluminea - freshwater bivalve, invasive
Corbula tunicata - small marine clam
Cyrenoida floridana - freshwater (marsh) bivlave
Diaulula sandiegensis - marine sea slug, nudibranch, rocky areas
Dimya japónica - marine bivalve, subtidal, sand, gravel, shells
Donax trunculus - marine bivalve, edible, shallow water in sand
Dreissena bugensis - freshwater mussel (quagga mussel), invasive
Dreissena polymorpha - freshwater mussel (zebra mussel), invasive
Episiphon yamakawai - marine tusk shell
Glauconome rugosa - freshwater mussel
Glossus humanus - marine bivalve, deep water, mud, sand 222
Hiatella arctica - marine bivalve, rock-borer, arctic, tidal to deep water
Leiopyrga octona -marine, eight-ringed weed shell, shallow water
Leptochiton vietnamensis - marine chiton, deep water
Lima fujitai - marine bivalve, moderate depth
Lithophaga nigra - marine mussel, shallow water, coral rock borer
Modiolus nipponicus - marine bivalve, shallow to deep water
Mya arenaria - marine bivalve, soft-shell, edible, sandy and muddy tidal flats
Mysella charcoti - marine bivlave, burrow into soft sediment
Mytilopsis leucophaeata - small marine bivalve, estuaries, brackish water, common
in ship ballast water, invasive
Nierstraszella andamanica - marine chiton, deep sea
Paphia undulata - marine bivalve, shallow water, sand, edible
Petricola lapicida - marine bivalve, shallow water, coral rock borer
Pinna muricate, P. saccate - marine bivalve, pen shell, shallow water, widespread,
soft sediments
Saccostrea kegaki - marine bivalve, rock oyster, estuaries, common
Septifer excisus, S. virgatus - marine mussels, on exposed rocks, corals, and oyster
shells
Sphaerium nucleus - freshwater bivalve, swamps
Tagelus plebeius - bivalve, brackish water, sandy beaches, razor clam
Teredo clappi - marine bivalve, wood borers
Turbo marmoratus - marine gastropod, spiral shell, feed on algae, nocturnal
Velesunio ambiguus - freshwater mussel, static water 223
Venus verrucosa - marine bivalve, shallow to moderate depths, mud or sand,
edible
Varicorbula dissimilis - marine bivalve, ocean and estuaries, mud or sand
Nematomorpha
Chordodes morgana - horsehair worm, parasite of arthropods (praying mantis), lay
eggs in freshwater
Gordius aquaticus - horsehair worm, parasites of arthropods (beetles and
mantids), lay eggs in freshwater
Nematoda
Angiostrongylus cantonensis- infects rats
Anisakis simplex - infects humans
Brugia pahangi - parasitic roundworm infecting cats and wild animals
Brugia timori - parasitic roundworm, infects humans
Cyclopidae sp. - plant pathogenic nematode, freshwater
Cylicostephanus goldi - parasite in horses
Haemonchus placei - cattle parasite
Nematodirus helvetianus - cattle parasite
Parascaris equorum - horse parasite
Strongyloides venezuelensis - Mouse parasite
Strongylus vulgaris - horse parasite
Toxocara canis - canine parasite
Trichodorus arasbaranensis - plant pathogen
Trichodorus orientalis - plant pathogen 224
Wuchereria bancrofti - human parasite
Xiphinema rivesi - plant pathogen
Nemertea
Amphiporus sp. - ribbon worm, freshwater, eat amphipods (small crustaceans)
Baseodiscus unicolor - ribbon worm, proposcis worm, marine, brackish water,
sand, under rocks
Drepanophorus spectabilis - ribbon worm, predatory, marine, estuary, coastal,
sand, beneath boulders
Platyhelminthes
Acholades asteris - turbellarian flatworm, marine, no mouth, pharynx, or
intestines, parasite of sea-stars (encysts in tube feet)
Diphyllobothrium latum - tapeworm, infects fish, crustaceans, and mammals
(including humans), marine or aquatic
Dollfustrema hefeiensis - marine worms, infect bivalves and fish
Geocentrophora applanate, G. baltica, G. marcusi, G. sphyrocephala - turbellarian
flatworms, freshwater
Kronborgia isopodicola - turbellarian flatworm, parasite of isopods, marine
intertidal reefs
Mesocestoides corti - tapeworm, common in carnivores (canines, felines, racoons,
mice; rarely humans)
Notocaryoplana arctica - turbellarian flatworm, marine, widespread
Orectolobicestus randyi - tapeworm, parasite of sharks
Polystyliphora karlingi - turbellarian flatworm, marine, subtidal sand 225
Polystomoides malayi - trematode, fluke, freshwater, parasites of mollusks and
vertebrates
Protopolystoma xenopodis - flatworm, infects amphibians, freshwater
Prorhynchus fontinalis - flatworm, freshwater, groundwater
Pseudofabriciola quasiincisura - polychaete, marine, shallow water
Schistocephalus solidus - tape worm of fish, fish-eating birds,and rodents,
intermediate hosts are copepods
Schistosoma rodhaini - schistosomes (trematode), freshwater, infect rodents
Schistosomatium douthitti - schistosomes (trematode), freshwater, infects birds
and small mammals, mild infections in humans
Spirometra erinaceieuropaei - tapeworm, freshwater, infects animals (including
humans), worldwide
Stylochus zebra - flatworms, live in rocks and pilings, infests hermit crabs
Taenia asiatica - tapeworm, infests humans and porcines
Toia ycia - turbellarian flatworm, marine
Trichobilharzia regenti - neuropathogenic parasitic flatworm of birds, causes
cercarial dermatitis (swimmers itch) in humans, mollusk intermediate,
freshwater
Porifera
Clathrina blanca, C. clathrus, C. rubra - calcareous sponge, marine, shallow water
and in ocean caverns
Dysidea arenaria - marine, sponge, invasive
Halichondria panicea - breadcrumb sponge, marine, shallow to deep water, 226
common, wide range of habitats
Hyrtios erectus - marine, attach to corals, shallow water
Leucetta chagosensis - marine, outer reef slope, on hard substrates
Leucosolenia sp. - marine, calcareous sponge, in tide pools, clustered around
seaweed or on rocks
Monanchora arbuscula - marine, wave-exposed areas, veticle or overhanging
encrustations
Plectroninia neocaledoniense - marine, calcareous sponge, deep water
Ute ampullaceal - marine, calcareous sponge, on reefs
Priapulida
Halicryptus spinulosus - marine worm, soft sediment (mud),shallow to moderate
depth water
Priapulus caudatus - marine worm, soft sediment (mud), subtidal zone, shallow to
moderate depth water, widespread
Rotifera
Adineta vaga - bdelloid rotifer, freshwater, exclusively parthenogenic
Beauchampia crucigera - freshwater, near outflow of cooling water from power
plant
Brachionus calyciflorus, B. patulus - freshwater, planktonic
Brachionus plicatilis - salt lakes, tolerates a wide range of salinity, planktonic
Conochilus coenobasis, C. unicornis - freshwater, planktonic
Floscularia armata, F. bífida - freshwater, sessile on awuatic plants
Keratella cochlearis - marine, brackish water, freshwater, worldwide, planktonic 227
Lacinularia flosculosa - freshwater, sessile on aquatic plants
Lacinularoides coloniensis - freshwater, sessile on aquatic plants
Lecane ungulata - freshwater, in bogs and among mosses
Limnias ceratophylli, L. melicerta - freshwater, sessile on aquatic plants and
sediment
Octotrocha speciosa - freshwater, sessile on aquatic plants
Ptygura beauchampi, P. longicornis - acid bog, freshwater, sessile on aquatic plants
(bladderwort)
Sinantherina semibullata, S. sociales, S. pectinata - freshwater, sessile on aquatic
plants, colonial
Testudinella clypeata - marine, brackish water, among aquatic plants
Testudinella patina - marine, brackish water, freshwater, tolerant of changing
salinity, among mosses
Trichotria tetractis - marine, brackish water, freshwater, among sphagnum
Spinicula
Phascolopsis gouldii - marine non-segmented worm, shallow water, burrows in
sandy mud, filter feeder
Tarigrada
Dactylobiotus ambiguus- forest soil, bogs, lake sediment, freshwater, polar
Dactylobiotus parthenogeneticus - freshwater, from freshwater alga
Milnesium sp. - common tardigrade, worldwide, marine, in lichens and moss
(freshwater habitats), humid forests 228
Murrayon pullari - terrestrial, freshwater, from peat bog, on moss, on aquatic
plants
Xenacoelomorpha
Ascoparia sp. - marine, flatworm, sediment
Childia groenlandica - marine, flatworm, sediment, shallow water
Hallangia proporoides - marine, flatworm, sediment, shallow water, epizoic on
hydroids
Isodiametra pulchra - marine, flatworm, widespread, sediment, shallow water
Fungi
Eumycota
Chytridiomyceta
Chytridiomycota
Batrachochytrium dendrobatidis- causes chytridiomycosis in amphibians
Boothiomyces macroporosum - grows on pollen, forest soils
Gonapodya polymorpha, G. prolifera - aquatic, grow on decaying plant
tissues
Gromochytrium mamkaevae- parasite of yellow-green algae (SAR, protists)
Monoblepharis hypogyna - aquatic
Nowakowskiella hemisphaerospora - grows on decaying plant tissues
Rhizophydium patellarium - forest soils, plant and fungus parasite
Neocallimastigomycota
Piromyces sp - grow in the gut of herbivores, have hydrogenosomes (no
mitochondria) 229
Blastocladiomyceta
Blastoclasiomycota
Paraphysoderma sedebokerense- Facultative pathogenic chytrid, causes
irreversible damage to green algae
Mucormyceta
Calcarisporiellomycota
Mucoromycota
Calcarisporiella sp. - endophyte of moss
Circinella simplex, C. umbellata - soil, leaf, freshwater
Endogone flammicorona, E. lactiflua - ectomycorrhizal on conifer, truffles
Mortierella sp. - soil, widespread
Mucor racemosus - common, worldwide, soil, houses
Thermomucor indicae-seudaticae - thermophilic, soil
Umbelopsis autotrophica - soil, dung, dead plant material, rhizospheric
soil/roots
Symbiomycota
Dikarya
Ascomycota
Alternaria alternata - plant pathogen, animal (human) allergen
Alternaria longipes - animal (human) pathogen, allergen
Alternaria tomato - plant pathogen
Arthrinium arundinis - soils 230
Articulospora atra - aquatic (freshwater)
Ascoidea rubescens- associated with bark beetles, dead wood
Aspergillus nidulans - commonly used in genetic research
Aureobasidium pullulans, A. pullulans - epiphyte, endophyte on many
plants, human allergen
Bacidia rosella - lichenized fungus, grows on deciduous trees
Bipolaris maydis, B. microstegii, B. sorokiniana - plant pathogens
Botrytis cinerea - necrotrophic on plants, including grapes
Candida glabrata, C. glucosophila - commensal on humans (and other
animals)
Capronia coronata - soil, plant pathogen, wood
Cladophialophora yegresii - cactus spines, human pathogen
Cladosporium bruhnei, C. delicatulum, C. sphaerospermum - plant
pathogens, human allergen, air, soil, indoors, common
Colletotrichum graminícola - plant pathogen (including on wheat and
maize)
Curvularia fallax, C. spicifera - plant pathogen
Darkera picea - endophyte of Picea needles
Eiglera flavida - lichenized fungus (crustose)
Endocarpon pusillum - lichenized fungus
Epicoccum nigrum - plant pathogen, endophyte
Eremothecium gossypii - plant pathogen
Exophiala xenobiotica - human pathogen (cutaneous - opportunistic) 231
Fumiglobus pieridicola - plant pathogen
Fusarium fujikuroi, F. graminearum - plant pathogen
Gaeumannomyces graminis - plant pathogen
Geoglossum nigritum - saprobic, non-pathogenic
Haplographium delicatum - grows on deteriorating wood of
angiosperms
Hyphopichia heimii - associated with rotting wood, transmitted by
insects
Hypocrea jecorina - cellulose degrading fungus
Kluyveromyces lactis, K. marxianus - ubiquitous - on corn, in milk, soil
Knufia petricola - rock-inhabiting, limestone
Lasallia sp. - lichenized fungi
Leptosphaeria biglobosa, L. doliolum, L. maculans - plant pathogen
(stem cankers in crucifers)
Lichenothelia arida - rock-inhabiting fungus
Marssonina brunnea - pathogenic to poplars
Metarhizium anisopliae - insect pathogen, parasitoid
Metschnikowia agaves, M. similis - infect Daphnia and beetles
Millerozyma farinosa - ubiquitous, salt-tolerant, infects
immunocompromised humans
Myceliophthora thermophila - lignocellulose (wood) degradation
Mycofalcella calcarata - aquatic, root endophytes
Nadsonia fulvescens - no details 232
Neofusicoccum parvum - plant pathogen
Neosetophoma clematidis - plant pathogen (grasses), soils
Pachysolen tannophilus - pentose-fermeting fungus
Paraconiothyrium lycopodinum, P. polonense - endophyte
Peltula obscurans - lichenized fungi, grows on rocks and soils
Penicillium rubens - common in environment
Pertusaria trachythallina - lichenized fungus
Pestalotiopsis fici - plant pathogen and endophyte
Peterozyma toletana - methanol-assimilation
Phaeosphaeriopsis glaucopunctata - plant pathogen
Phaeosphaeria juncicola - saprotrophs on plants
Phaffomyces opuntiae - grows on cactus and other plants
Phomopsis sp. - plant pathogen
Pseudocercospora angolensis - plant pathogen
Pseudogymnoascus destructans - psychrotrophic, pathogenic on
mammals, including bats (white, nose disease)
Rasamsonia emersonii - themotolerant, animal pathogen
Rhinocladiella mackenziei - human pathogen (cerebral
phaeohyphomycosis)
Saccharomyces cerevisiae - bread, wine, beer yeast
Saitoella complicate - saprobic
Setosphaeria turcica - plant pathogic on grasses (including maize) 233
Stenocarpella maydis - plant pathogic on grasses (including maize and
sugar cane)
Sydowia polyspora - plant pathogen and endophyte of gymnosperms
Talaromyces stipitatus - non-pathogenic, decays oplant matter
Tetrapisispora phaffii - toxic to other fungi
Thielavia terrestris - thermophilic, marine, terrestrial, plant pathogen
Trichoderma atroviride - common soil fungus
Tuber aestivum, T. borchii - edible truffles
Umbilicaria sp. - lichenized fungus on rock
Wickerhamia fluorescens - no information
Zygotorulaspora mrakii - on tree bark and wood
Basidiomycota
Anthracocystis flocculosa - used as a biocontrol agent
Athelia arachnoidea - pathogen of lichens
Armillaria mellea - common plant pathogen
Auricularia subglabra - jelly fungus
Basidioascus magus, B. undulates - soil, saprobe
Blastomyces gilchristii - human pathogen
Candelabrochaete africana - crust fungus, decompose dead plant
material and wood
Clavaria fumosa - coral fungus, saprobe
Coltricia crassa - tiger's eye fungus, saprobe
Coltriciella globosa - wood-inhabiting (rotting) 234
Coniophora puteana - wood-rotting, brown-rot
Cryptococcus sp. - human pathogen, meningocephalitis
Dichomitus kirkii, D. squalens - white rot fungus
Filobasidiella neoformans - parasitic on other fungi
Heterobasidion irregulare - tree root rot
Hypsizygus marmoreus - white beech mushroom, edible
Inocybe maculate - toxic (muscarine)
Lignosus rhinocerotis - saprobe
Macrocybe titans - saprobe
Melanopsichium pennsylvanicum - parasitic on plants
Peniophora nuda - grows on bark and wood
Phanerochaete carnosa - crust fungus, plant pathogen
Phlebiopsis crassa - crust fungus, saprobic, possible plant parasite
Pichia fermentans - live on decaying plants
Pseudozyma hubeiensis - plant pathogen, decaying material, possible
animal pathogen
Punctularia strigosozonata - white-rot fungus, plant pathogen
Scytinopogon havencampii - saprobe
Sporisorium scitamineum - sugar cane smit, plant pathogen (grasses)
Tilletiopsis cremea, T. lilacina, T. washingtonensis - plant pathogen
Trametes versicolor - plant pathogen
Tremella mesenterica - parasite of other fungi
Tremiscus helvelloides - jelly fungus, saprobe 235
Tricholoma sp. - tree synbiont, ectomycorrhizal
Trichosporon asahii - human pathogen (sometimes fatal in
immunocompromised patients)
Xanthophyllomyces dendrorhous - grows in plants
Glomeromycota
Acaulospora laevis - arbuscular mycorrhiza and vesicles in roots
Diversispora celata - arbuscular mycorrhiza
Rhizophagus intraradices - arbuscular mycorrhizal fungus
Sacculospora báltica - maritime sand dunes, fungi, arbuscular mycorrhiza
Zoopagomyceta
Entomorphthoromycota
Basidiobolus ranarum- decaying fruit, filamentous, worldwide
Kickxellomycota
Barbatospora ambicaudata - aquatic arthropod symbiont
Zoopagomycota
Kuzuhaea moniliformis - soil, dung, parasitic on fungi and animals
Rozellomyceta
Microsporidia
Nosema sp. - pathogenic in honeybee, parasite, affects flight behavior
Rozellomycota
Amoeboaphelidium protococcarum - freshwater, unicellular, parasite of
algae
Rozella allomycis- variety of hosts, parasite of water molds (oomycetes) 236
APPENDIX B. BACTERIAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99% AND 100%
≥97% ≥99% =100% Bryobacter aggregatus Cellulosimicrobium cellulans Holophaga foetida Cellulosimicrobium cellulans Geothrix fermentans Actinobaculum schaalii Geothrix fermentans Holophaga foetida Actinoplanes missouriensis Holophaga foetida Actinobaculum schaalii Actinoplanes sp Acidothermus cellulolyticus Actinoplanes missouriensis Corynebacterium pseudotuberculosis Actinobaculum schaalii Actinoplanes sp Frankia sp. Actinoplanes missouriensis Aquihabitans daechungensis Intrasporangium calvum Isoptericola variabilis Actinoplanes sp Corynebacterium Kutzneria albida Aquihabitans daechungensis pseudotuberculosis Microbacterium sp Catenulispora acidiphila Frankia sp. Mycobacterium bovis Corynebacterium pseudotuberculosis Intrasporangium calvum Nocardia farcinica Frankia sp. Isoptericola variabilis Streptomyces collinus Intrasporangium calvum Kutzneria albida Streptomyces leeuwenhoekii Isoptericola variabilis Leucobacter sp. Algoriphagus sp Kutzneria albida Microbacterium sp Bacteroides ovatus Kytococcus sedentarius Modestobacter versicolor Bacteroides xylanisolvens Luteipulveratus mongoliensis Mycobacterium abscessus Blattabacterium sp Marmoricola bigeumensis Mycobacterium bovis Cytophaga sp Microbacterium sp Mycobacterium confluentis Dyadobacter fermentans Flavobacterium Microlunatus phosphovorus Mycobacterium hodleri aquidurense Modestobacter marinus Mycobacterium intracellulare Flavobacterium branchiophilum Modestobacter versicolor Mycobacterium smegmatis Flavobacterium columnare Mycobacterium abscessus Nocardia farcinica Flavobacterium degerlachei Mycobacterium asiaticum Sporichthya brevicatena Flavobacterium frigidarium Mycobacterium bovis Streptomyces collinus Flavobacterium granuli Mycobacterium chubuense Streptomyces leeuwenhoekii Flavobacterium hercynium Mycobacterium confluentis Aequorivita sublithincola Flavobacterium hydatis Mycobacterium goodii Algoriphagus sp Flavobacterium indicum Mycobacterium intracellulare Bacteroides helcogenes Flavobacterium johnsoniae 237
≥97% ≥99% =100% Mycobacterium kansasii Bacteroides ovatus Flavobacterium limicola Flavobacterium Mycobacterium neoaurum Bacteroides vulgatus psychrophilum Mycobacterium obuense Bacteroides xylanisolvens Flavobacterium sp. Mycobacterium rhodesiae Barnesiella viscericola Flavobacterium succinicans Mycobacterium smegmatis Blattabacterium sp Flavobacterium tiangeerense Mycobacterium vanbaalenii Cytophaga sp Flavobacterium xinjiangense Nocardia farcinica Dyadobacter fermentans Formosa sp Rhodococcus jostii Flavobacterium antarcticum Haliscomenobacter hydrossis Sanguibacter keddieii Flavobacterium aquatile Hymenobacter perfusus Sporichthya brevicatena Flavobacterium aquidurense Hymenobacter sp Streptomyces albireticuli Flavobacterium branchiophilum Marivirga tractuosa Streptomyces collinus Flavobacterium chilense Niabella soli Streptomyces hygroscopicus Flavobacterium columnare Niastella koreensis Streptomyces leeuwenhoekii Flavobacterium degerlachei Odoribacter splanchnicus Streptomyces netropsis Flavobacterium frigidarium Pedobacter saltans Terracoccus luteus Flavobacterium glaciei Chlorochromatium aggregatum Armatimonas rosea Flavobacterium granuli Herpetosiphon aurantiacus Persephonella marina Flavobacterium hercynium Anabaena bergii Aequorivita sublithincola Flavobacterium hydatis Anabaena circinalis Alistipes shahii Flavobacterium indicum Anabaena cylindrica Alistipes finegoldii Flavobacterium johnsoniae Anabaena ellipsoides Algoriphagus sp Flavobacterium limicola Anabaena flos-aquae Bacteroides helcogenes Flavobacterium psychrolimnae Anabaena lemmermannii Bacteroides ovatus Flavobacterium psychrophilum Anabaena oumiana Bacteroides vulgatus Flavobacterium segetis Anabaena solitaria Bacteroides xylanisolvens Flavobacterium sp. Anabaena sp Barnesiella viscericola Flavobacterium succinicans Anabaena variabilis Blattabacterium sp Flavobacterium tiangeerense Aphanizomenon flos-aquae Cellulophaga algicola Flavobacterium xinjiangense Aphanizomenon gracile Cyclobacterium amurskyense Fluviicola taffensis Aphanizomenon issatschenkoi Cyclobacterium marinum Formosa sp Aphanizomenon ovalisporum Cytophaga sp Haliscomenobacter hydrossis Aphanizomenon sp. 238
≥97% ≥99% =100% Draconibacterium orientale Hymenobacter gelipurpurascens Aphanothece clathrata Dyadobacter fermentans Hymenobacter perfusus Calothrix sp Echinicola vietnamensis Hymenobacter sp Coelomoron pusillum Emticicia oligotrophica Leadbetterella byssophila Cyanobium gracile Fibrella aestuarina Marivirga tractuosa Cyanobium sp Flavimarina pacifica Niabella soli Cyanothece sp Flavobacterium antarcticum Niastella koreensis Cylindrospermum stagnale Flavobacterium aquatile Odoribacter splanchnicus Dolichospermum affine Flavobacterium aquidurense Parabacteroides distasonis Dolichospermum circinale Flavobacterium branchiophilum Pedobacter saltans Dolichospermum flos-aquae Flavobacterium columnare Porphyromonas gingivalis Dolichospermum lemmermannii Flavobacterium degerlachei Salinirepens amamiensis Dolichospermum mendotae Flavobacterium frigidarium Sediminibacter furfurosus Dolichospermum planctonicum Flavobacterium frigoris Winogradskyella sp Dolichospermum smithii Flavobacterium glaciei Chlorochromatium aggregatum Limnococcus limneticus Flavobacterium granuli Herpetosiphon aurantiacus Microcystis aeruginosa Flavobacterium hercynium Anabaena affinis Microcystis botrys Flavobacterium hibernum Anabaena bergii Microcystis panniformis Flavobacterium hydatis Anabaena circinalis Microcystis sp. Flavobacterium indicum Anabaena cylindrica Microcystis viridis Flavobacterium johnsoniae Anabaena ellipsoides Nodularia sphaerocarpa Flavobacterium limicola Anabaena flos-aquae Nodularia spumigena Flavobacterium psychrolimnae Anabaena lemmermannii Nostoc azollae Flavobacterium psychrophilum Anabaena mendotae Nostoc piscinale Flavobacterium saccharophilum Anabaena minispora Nostoc punctiforme Flavobacterium segetis Anabaena oumiana Nostoc sp. Flavobacterium sinopsychrotolerans Anabaena smithii Planktothrix agardhii Flavobacterium sp. Anabaena solitaria Planktothrix cryptovaginata Flavobacterium succinicans Anabaena sp Planktothrix sp Flavobacterium tiangeerense Anabaena sphaerica Planktothrix suspensa Flavobacterium xinjiangense Anabaena variabilis Prochlorococcus marinus Fluviicola taffensis Aphanizomenon flos-aquae Radiocystis sp 239
≥97% ≥99% =100% Formosa agariphila Aphanizomenon gracile Raphidiopsis curvata Formosa sp Aphanizomenon issatschenkoi Snowella litoralis Geojedonia litorea Aphanizomenon ovalisporum Sphaerospermopsis aphanizomenoides Haliscomenobacter hydrossis Aphanizomenon sp. Stanieria cyanosphaera Hymenobacter gelipurpurascens Aphanothece clathrata Synechococcus rubescens Hymenobacter perfusus Calothrix sp Synechococcus sp Hymenobacter sp Coelomoron pusillum Synechococcus spongiarum Hymenobacter swuensis Cyanobium gracile Synechocystis sp Lacinutrix sp Cyanobium sp Tolypothrix sp. Leadbetterella byssophila Cyanothece sp Trichodesmium erythraeum IMS101 Marivirga tractuosa Cylindrospermum stagnale Woronichinia naegeliana Myroides odoratus Dolichospermum affine Woronichinia sp. Niabella soli Dolichospermum circinale Deinococcus gobiensis Niastella koreensis Dolichospermum crassum Meiothermus ruber Nonlabens marinus Dolichospermum flos-aquae Meiothermus silvanus Odoribacter splanchnicus Dolichospermum lemmermannii Clostridium pasteurianum Owenweeksia hongkongensis Dolichospermum mendotae Clostridium saccharoperbutylacetonicum Parabacteroides distasonis Dolichospermum mucosum Clostridium sulfidigenes Pedobacter heparinus Dolichospermum planctonicum Clostridium tetani Pedobacter saltans Dolichospermum sigmoideum Dehalobacter restrictus Pedobacter sp Dolichospermum smithii Dehalobacter sp. Porphyromonas gingivalis Hydrocoryne spongiosa Desulforudis audaxviator Salinirepens amamiensis Limnococcus limneticus Lactobacillus fermentum Saprospira grandis Limnoraphis robusta Lactobacillus pentosus Sediminibacter furfurosus Lyngbya hieronymusii Methylotenera mobilis Sulcia muelleri Microcystis aeruginosa Paenibacillus polymyxa Winogradskyella sp Microcystis botrys Paenibacillus sabinae Zunongwangia profunda Microcystis panniformis Ruminococcus obeum Chlorochromatium aggregatum Microcystis sp. Staphylococcus haemolyticus Anaerolinea thermophila Microcystis viridis Staphylococcus lugdunensis Chloroflexus aggregans Nodularia sphaerocarpa Staphylococcus pasteuri Herpetosiphon aurantiacus Nodularia spumigena Staphylococcus pseudintermedius 240
≥97% ≥99% =100% Litorilinea aerophila Nostoc azollae Streptococcus pyogenes Desulfurispirillum indicum Nostoc piscinale Veillonella parvula Anabaena affinis Nostoc punctiforme Weissella cibaria Anabaena bergii Nostoc sp. Gemmatimonas aurantiaca Anabaena catenula Planktothrix agardhii Nitrospira defluvii Anabaena circinalis Planktothrix cryptovaginata Nitrospira moscoviensis Anabaena crassa Planktothrix sp Nitrospira sp. Anabaena cylindrica Planktothrix suspensa Caldilinea aerophila Anabaena eucompacta Prochlorococcus marinus Gemmata obscuriglobus Anabaena ellipsoides Pseudanabaena catenata Gimesia maris Anabaena flos-aquae Radiocystis sp Pirellula staleyi Anabaena lemmermannii Raphidiopsis curvata Planctomyces brasiliensis Anabaena mendotae Scytonema stuposum Rhodopirellula baltica Anabaena minispora Snowella litoralis Acetobacter tropicalis Anabaena oumiana Snowella rosea Acidisoma sp Anabaena pseudocompacta Sphaerospermopsis Afipia sp Anabaena smithii aphanizomenoides Agrobacterium tumefaciens Anabaena solitaria Sphaerospermopsis kisseleviana Agrobacterium vitis Anabaena sp Stanieria cyanosphaera Azospirillum brasilense Anabaena sphaerica Synechococcus elongatus Bartonella schoenbuchensis Anabaena spiroides Synechococcus rubescens Bradyrhizobium denitrificans Anabaena torulosa Synechococcus sp Bradyrhizobium japonicum Anabaena variabilis Synechocystis minuscula Bradyrhizobium jicamae Aphanizomenon flos-aquae Synechococcus spongiarum Brevundimonas basaltis Aphanizomenon gracile Synechocystis sp Brevundimonas denitrificans Aphanizomenon issatschenkoi Tolypothrix sp. Brevundimonas sp. Aphanizomenon ovalisporum Trichodesmium erythraeum Brevundimonas subvibrioides Aphanizomenon sp. IMS101 Caedibacter caryophilus Aphanothece clathrata Woronichinia naegeliana Caedibacter macronucleorum Calothrix sp Woronichinia sp. Caulobacter fusiformis Coelomoron pusillum Deinococcus gobiensis Caulobacter sp. Cuspidothrix issatschenkoi Meiothermus ruber Chelativorans sp. BNC1 241
≥97% ≥99% =100% Cyanobacterium stanieri Meiothermus silvanus Devosia ginsengisoli Cyanobium gracile Clostridium pasteurianum Haematobacter massiliensis Cyanobium sp Clostridium saccharobutylicum Mesorhizobium sp. Cyanothece sp Clostridium Methylobacterium sp Cylindrospermum catenatum saccharoperbutylacetonicum Methylocystis sp Cylindrospermum siamensis Clostridium sulfidigenes Methylosinus sp Cylindrospermum stagnale Clostridium tetani Novosphingobium barchaimii Cylindrospermum muscicola Dehalobacter restrictus Paracoccus aminophilus Dolichospermum affine Dehalobacter sp. Phenylobacterium zucineum Dolichospermum circinale Desulforudis audaxviator Polymorphum gilvum Dolichospermum crassum Enterococcus durans Pseudorhodobacter sp Dolichospermum flos-aquae Enterococcus faecalis Rhizobium etli Dolichospermum lemmermannii Enterococcus faecium Rhizobium leguminosarum Dolichospermum mendotae Lactobacillus casei Rhodobacter blasticus Dolichospermum mucosum Lactobacillus fermentum Rhodobacter capsulatus Dolichospermum planctonicum Lactobacillus pentosus Rhodobacter changlensis Dolichospermum Methylotenera mobilis Rhodobacter sp. sigmoideumDolichospermum smithii Paenibacillus polymyxa Rhodobacter sphaeroides Dolichospermum viguieri Paenibacillus sabinae Rhodovulum sp. Gloeocapsa sp Ruminococcus obeum Rhodovulum sulfidophilum Halotia longispora Staphylococcus haemolyticus Silicibacter sp. TM1040 Hydrocoryne spongiosa Staphylococcus lugdunensis Sinorhizobium meliloti Limnococcus limneticus Staphylococcus pasteuri Sphingobium sp. SYK-6 Limnoraphis robusta Staphylococcus pseudintermedius Sphingomonas sp. Lyngbya aestuarii Streptococcus pyogenes Sphingomonas wittichii Lyngbya hieronymusii Veillonella parvula Sphingopyxis alaskensis Lyngbya majuscula Weissella cibaria Sphingopyxis fribergensis Microcystis aeruginosa Gemmatimonas aurantiaca Sphingopyxis macrogoltabida Microcystis botrys Nitrospira defluvii Sphingopyxis sp Microcystis ichthyoblabe Nitrospira moscoviensis Sulfitobacter sp Microcystis panniformis Nitrospira sp. Thalassobius aestuarii Microcystis sp. Caldilinea aerophila Thalassospira xiamenensis 242
≥97% ≥99% =100% Microcystis viridis Gemmata obscuriglobus Tistrella mobilis Nodularia sphaerocarpa Gemmata sp Xanthobacter autotrophicus Nodularia spumigena Gimesia maris Accumulibacter phosphatis Nostoc azollae Pirellula staleyi Acidovorax avenae Nostoc calcicola Planctomyces brasiliensis Acidovorax citrulli Nostoc calcicola Rhodopirellula baltica Acidovorax ebreus Nostoc commune Acetobacter aceti Acidovorax facilis Nostoc ellipsosporum Acetobacter cibinongensis Acidovorax sp. JS42 Nostoc insulare Acetobacter sp Acidovorax temperans Nostoc piscinale Acetobacter tropicalis Acidovorax valerianellae Albidiferax Nostoc punctiforme Acidiphilium cryptum ferrireducensAlicycliphilus denitrificans Nostoc sp. Acidiphilium multivorum Aquabacterium sp Planktothrix agardhii Acidisoma sp Aromatoleum aromaticum EbN1 Planktothrix cryptovaginata Acidisphaera sp Azoarcus sp. Planktothrix sp Afipia sp Azospira oryzae Planktothrix suspensa Agrobacterium tumefaciens Bordetella bronchiseptica Plectolyngbya hodgsonii Agrobacterium vitis Bordetella holmesii Pleurocapsa sp Altererythrobacter epoxidivorans Burkholderia caribensis Prochlorococcus marinus Altererythrobacter marensis Burkholderia cenocepacia Pseudanabaena catenata Altererythrobacter sp Burkholderia cepacia Pseudanabaena frigida Azospirillum brasilense Burkholderia diazotrophica Pseudanabaena sp Bartonella schoenbuchensis Burkholderia pseudomallei 688 Radiocystis sp Bradyrhizobium denitrificans Burkholderia pyrrocinia Raphidiopsis curvata Bradyrhizobium japonicum Burkholderia rhizoxinica Scytonema stuposum Bradyrhizobium jicamae Burkholderia sp. Snowella litoralis Brevundimonas basaltis Burkholderia thailandensis Snowella rosea Brevundimonas denitrificans Castellaniella defragransChitinibacter sp Sphaerospermopsis aphanizomenoides Brevundimonas diminuta Chromobacterium violaceum Sphaerospermopsis kisseleviana Brevundimonas sp. Chromobacterium sp Stanieria cyanosphaera Brevundimonas subvibrioides Collimonas arenae Synechococcus elongatus Caedibacter caryophilus Collimonas fungivorans Synechococcus rubescens Caedibacter macronucleorum Comamonas koreensis 243
≥97% ≥99% =100% Synechococcus sp Caulobacter fusiformis Comamonas sp Synechocystis minuscula Caulobacter sp. Comamonas testosteroniCupriavidus basilensis Synechococcus spongiarum Chelativorans sp. BNC1 Cupriavidus necator Synechocystis sp Croceicoccus naphthovorans Cupriavidus taiwanensis Tolypothrix sp. Devosia ginsengisoli Curvibacter delicatus Trichodesmium erythraeum IMS101 Dongia rigui Dechloromonas aromatica Trichormus variabilis Gemmobacter tilapiae Dechloromonas hortensis Woronichinia naegeliana Gluconacetobacter diazotrophicus Dechlorosoma suillum Woronichinia sp. Gluconacetobacter Deefgea chitinilytica Denitrovibrio acetiphilus takamatsuzukensis Deefgea rivuli Deinococcus gobiensis Gluconacetobacter tumulisoli Delftia acidovorans Deinococcus maricopensis Granulibacter bethesdensis Delftia sp Deinococcus radiodurans Haematobacter massiliensis Duganella sp Meiothermus ruber Komagataeibacter xylinus Gallionella capsiferriformans Meiothermus silvanus Mesorhizobium sp. Herbaspirillum autotrophicum Oceanithermus profundus Methylobacterium adhaesivum Herbaspirillum hiltneri Bacillus circulans Methylobacterium sp Herbaspirillum lusitanum Clostridium cavendishii Methylocystis sp Herbaspirillum seropedicae Clostridium disporicum Methylosinus sp Herminiimonas arsenicoxydans Clostridium pasteurianum Novosphingobium aromaticivorans Herminiimonas sp Clostridium saccharobutylicum Novosphingobium barchaimii Iodobacter fluviatilis Clostridium Paracoccus aminophilus Iodobacter sp. saccharoperbutylacetonicum Paraherbaspirillum soli Janthinobacterium agaricidamnosum Clostridium sulfidigenes Phenylobacterium zucineum Janthinobacterium lividum Clostridium tetani Polymorphum gilvum Janthinobacterium sp Dehalobacter restrictus Pseudorhodobacter sp Leptothrix cholodnii Dehalobacter sp. Rhizobium etli Leptothrix sp. Desulfitobacterium dichloroeliminans Rhizobium leguminosarum Limnohabitans sp Desulfitobacterium hafniense Rhodobacter blasticus Massilia aurea Desulforudis audaxviator Rhodobacter capsulatus Massilia sp Desulfotomaculum ruminis Rhodobacter changlensis Methylibium petroleiphilum Enterococcus durans Rhodobacter megalophilus Methylibium sp 244
≥97% ≥99% =100% Enterococcus faecalis Rhodobacter sp. Methylobacillus flagellatus Enterococcus faecium Rhodobacter sphaeroides Methylotenera mobilis Lactobacillus casei Rhodopseudomonas palustris Methylotenera versatilis Lactobacillus fermentum Rhodovulum sp. Methyloversatilis universalis Lactobacillus pentosus Rhodovulum sulfidophilum Methylovorus glucosetrophus Methylotenera mobilis Roseomonas lacus Methylopumilus planktonicus Paenibacillus polymyxa Silicibacter sp. TM1040 Methylovorus sp Paenibacillus sabinae Sinorhizobium meliloti Methylopumilus turicensis Ruminococcus obeum Sphingobium sp. SYK-6 Mitsuaria chitosanitabida Sporosarcina aquimarina Sphingomonas sp. Neisseria gonorrheae Sporosarcina newyorkensis Sphingomonas taxi Neisseria lactamica Staphylococcus haemolyticus Sphingomonas wittichii Neisseria meningitidis Staphylococcus lugdunensis Sphingopyxis alaskensis Nitrosomonas communis Staphylococcus pasteuri Sphingopyxis fribergensis Nitrosomonas eutropha Staphylococcus pseudintermedius Sphingopyxis macrogoltabida Nitrosomonas sp. Streptococcus pyogenes Sphingopyxis sp Nitrosospira briensis Veillonella parvula Sphingorhabdus planktonica Nitrosospira multiformis Weissella cibaria Sulfitobacter sp Noviherbaspirillum canariense Gemmatimonas aurantiaca Thalassobius aestuarii Pandoraea pnomenusa Nitrospira defluvii Thalassospira xiamenensis Pandoraea pulmonicola Nitrospira moscoviensis Tistrella mobilis Pelomonas puraquae Nitrospira sp. Xanthobacter autotrophicus Paucibacter toxinivorans Polaromonas Anammoximicrobium moscowii Zymomonas mobilis hydrogenivorans Caldilinea aerophila Accumulibacter phosphatis Polaromonas naphthalenivorans Gemmata obscuriglobus Acidovorax avenae Polaromonas sp Gemmata sp Acidovorax citrulli Polynucleobacter necessarius Gimesia maris Acidovorax delafieldii Pseudogulbenkiania sp Isosphaera pallida Acidovorax ebreus Profftella armatura Pirellula staleyi Acidovorax facilis Pusillimonas sp Planctomyces brasiliensis Acidovorax sp. JS42 Ralstonia eutropha H16 Planctomyces limnophilus Acidovorax temperans Ralstonia mannitolilyticaRalstonia pickettii Rhodopirellula baltica Acidovorax valerianellae Rhodoferax ferrireducens 245
≥97% ≥99% =100% Singulisphaera acidiphila Albidiferax ferrireducens Rhodoferax sp. Acetobacter aceti Alicycliphilus denitrificans Roseateles terrae Acetobacter cibinongensis Aquabacterium sp Rubrivivax gelatinosus Acetobacter europaeus Aquincola tertiaricarbonis Rubrivivax benzoatilyticus Acetobacter pasteurianus Aromatoleum aromaticum EbN1 Sideroxydans lithotrophicus Acetobacter sp Azoarcus sp. Sulfuricella denitrificans Acetobacter tropicalis Azospira oryzae Sulfurisoma sediminicolaSulfuritalea Acidiphilium cryptum Azospira sp hydrogenivorans Acidiphilium multivorum Basilea psittacipulmonis Thiobacillus denitrificans Thiomonas intermedia Acidisoma sp Bordetella bronchiseptica Thiomonas sp. Acidisphaera sp Bordetella hinzii Undibacterium oligocarboniphilum Afipia sp Bordetella holmesii Undibacterium seohonense Agrobacterium tumefaciens Bordetella pertussis Undibacterium sp Agrobacterium vitis Bordetella petrii Variovorax boronicumulans Altererythrobacter epoxidivorans Burkholderia caribensis Variovorax ginsengisoli Altererythrobacter marensis Burkholderia cenocepacia Variovorax paradoxus Altererythrobacter sp Burkholderia cepacia Variovorax soli Asaia lannensis Burkholderia diazotrophica Verminephrobacter eiseniae Asaia siamensis Burkholderia multivorans Aeromonas veronii Asticcacaulis excentricus Burkholderia pseudomallei 688 Agarivorans gilvus Aureimonas altamirensis Burkholderia pyrrocinia Allochromatium vinosum Aureimonas frigidaquae Burkholderia rhizoxinica Alteromonas macleodii Azospirillum brasilense Burkholderia sp. Citrobacter freundii Bartonella quintana Burkholderia thailandensis Competibacter phosphatis Bartonella schoenbuchensis Castellaniella defragrans Congregibacter litoralis Beijerinckia indica Chitinibacter sp Cronobacter malonaticus Bradyrhizobium denitrificans Chromobacterium violaceum Cronobacter sakazakii Bradyrhizobium elkanii Chromobacterium sp Dickeya dadantii Bradyrhizobium japonicum Collimonas arenae Dyella japonica Bradyrhizobium jicamae Collimonas fungivorans Dyella jiangningensis Brevundimonas basaltis Collimonas sp. Enterobacter asburiae Brevundimonas denitrificans Comamonas koreensis Frateuria aurantia 246
≥97% ≥99% =100% Brevundimonas diminuta Comamonas sp Gynuella sunshinyii Brevundimonas intermedia Comamonas testosteroni Haemophilus ducreyi Brevundimonas sp. Cupriavidus basilensis Haemophilus parasuis Brevundimonas subvibrioides Cupriavidus metallidurans Halomonas sp Brevundimonas vesicularis Cupriavidus necator Halomonas variabilis Brevundimonas viscosa Cupriavidus taiwanensis Halorhodospira halochloris Caedibacter caryophilus Curvibacter delicatus Kushneria indalinina Caedibacter macronucleorum Dechloromonas aromatica Legionella jeonii Caedibacter acanthamoebae Dechloromonas hortensis Legionella oakridgensis Caulobacter crescentus Dechloromonas sp. Marichromatium purpuratum Caulobacter fusiformis Dechlorosoma suillum Marinobacter sp. Caulobacter segnis Deefgea chitinilytica Marinobacter psychrophilus Caulobacter sp. Deefgea rivuli Methylomicrobium alcaliphilum Caulobacter vibrioides Deefgea sp Methylomonas methanica Chelativorans sp. BNC1 Delftia acidovorans Modicisalibacter tunisiensis Croceicoccus naphthovorans Delftia sp Nitrosococcus oceani Devosia ginsengisoli Duganella sp Nitrosococcus watsoni Dongia rigui Gallionella capsiferriformans Pasteurella multocida Ensifer adhaerens Herbaspirillum autotrophicum Pseudoalteromonas haloplanktis Erythrobacter sp. Herbaspirillum chlorophenolicum Pseudoalteromonas sp Gemmobacter tilapiae Herbaspirillum hiltneri Pseudomonas alkylphenolia Gluconacetobacter diazotrophicus Herbaspirillum huttiense Pseudomonas brassicacearum Gluconacetobacter xylinus Herbaspirillum lusitanum Pseudomonas cichorii Gluconacetobacter takamatsuzukensis Herbaspirillum rubrisubalbicans Pseudomonas deceptionensis Gluconacetobacter tumulisoli Herbaspirillum seropedicae Pseudomonas fulva Granulibacter bethesdensis Herminiimonas arsenicoxydans Pseudomonas knackmussi Haematobacter massiliensis Herminiimonas sp Pseudomonas mandelii Hyphomicrobium denitrificans Hydrogenophaga sp Pseudomonas protegensPseudomonas Hyphomicrobium vulgare Hylemonella gracilis resinovorans Hyphomicrobium nitrativorans Hylemonella sp. Pseudomonas trivialis Ketogulonicigenium vulgare Ideonella dechloratans Pseudoxanthomonas spadix Komagataeibacter medellinensis Iodobacter fluviatilis Pseudoxanthomonas suwonensis 247
≥97% ≥99% =100% Komagataeibacter xylinus Iodobacter sp. Psychrobacter sp Magnetospirillum gryphiswaldense Janthinobacterium Rhodanobacter denitrificans Magnetospirillum magneticum agaricidamnosum Saccharophagus degradans Magnetococcus marinus Janthinobacterium lividum Salmonella enterica Mesorhizobium australicum Janthinobacterium sp Shewanella sp. Mesorhizobium ciceri Kinetoplastibacterium desouzaii Shigella boydii Mesorhizobium huakuii Leptothrix cholodnii Shigella sonnei Mesorhizobium opportunistum Leptothrix sp. Stenotrophomonas acidaminiphila Mesorhizobium sp. Limnohabitans sp Stenotrophomonas rhizophila Methylobacterium adhaesivum Massilia aurea Teredinibacter turnerae Methylobacterium extorquens Massilia sp Thioalkalivibrio nitratireducens Methylobacterium gnaphalii Methylibium petroleiphilum Thioalkalivibrio paradoxus Methylobacterium oryzae Methylibium sp Thioalkalivibrio versutus Methylobacterium populi Methylobacillus flagellatus Thiocystis violascens Methylobacterium radiotolerans Methylotenera mobilis Thioploca ingrica Methylobacterium sp Methylotenera versatilis Thioploca sp. Methyloceanibacter caenitepidi Methyloversatilis universalis Variovorax sp Methylocystis sp Methylovorus glucosetrophus Vibrio cholerae Methylosinus sp Methylopumilus planktonicus Vibrio parahaemolyticus Nitrobacter hamburgensis Methylovorus sp Yersinia pestis Nitrobacter winogradskyi Methylopumilus turicensis Zymobacter palmae Novosphingobium aromaticivorans Mitsuaria chitosanitabida Anaeromyxobacter dehalogenans Novosphingobium barchaimii Neisseria gonorrheae Chondromyces crocatus Novosphingobium pentaromativorans Neisseria lactamica Desulfatibacillum alkenivorans Nordella oligomobilis Neisseria meningitidis Desulfobacca acetoxidans Nucleicultrix amoebiphila Nitrosomonas communis Desulfobacula toluolica Oligotropha carboxidovorans Nitrosomonas europaea Geobacter bemidjiensis Paracoccus aminophilus Nitrosomonas eutropha Geobacter pickeringii Paraherbaspirillum soli Nitrosomonas sp. Geobacter sp. Parvibaculum lavamentivorans Nitrosospira briensis Geoalkalibacter subterraneus Pelagibacterium halotolerans Nitrosospira multiformis Geobacter sulfurreducens Phenylobacterium lituiforme Noviherbaspirillum canariense Haliangium ochraceum 248
≥97% ≥99% =100% Phenylobacterium zucineum Pandoraea apista Labilithrix luteola Phycosocius bacilliformis Pandoraea oxalativorans Pelobacter carbinolicus Polymorphum gilvum Pandoraea pnomenusa Pelobacter propionicus Pseudorhodobacter antarcticus Pandoraea pulmonicola Aminobacterium colombiense Pseudorhodobacter ferrugineus Pelomonas puraquae Mycoplasma putrefaciens Pseudorhodobacter sp Paucibacter toxinivorans Bacterium Ellin Pseudovibrio sp Piscinibacter aquaticus Chthoniobacter flavus Rhizobium etli Polaromonas hydrogenivorans Prosthecobacter debontii Rhizobium leguminosarum Polaromonas naphthalenivorans Prosthecobacter dejongeii Rhizobium phenanthrenilyticum Polaromonas sp Prosthecobacter fusiformis Rhodobacter azotoformans Polynucleobacter difficilis Prosthecobacter vanneerveni Rhodobacter blasticus Polynucleobacter necessarius Rhodobacter capsulatus Pseudogulbenkiania sp Rhodobacter changlensis Profftella armatura Rhodobacter megalophilus Pusillimonas sp Rhodobacter sp. Ralstonia eutropha H16 Rhodobacter sphaeroides Ralstonia mannitolilytica Rhodopseudomonas palustris Ralstonia pickettii Rhodospirillum centenum Ralstonia solanacearum Rhodospirillum photometricum Ralstonia syzygii Rhodovulum sp. Ramlibacter tataouinensis Rhodovulum sulfidophilum Rhizobacter dauci Rickettsia limoniae Rhodocyclus purpureus Roseibacterium elongatum Rhodoferax ferrireducens Roseobacter sp. Rhodoferax sp. Roseomonas lacus Roseateles terrae Roseomonas riguiloci Rubrivivax gelatinosus Roseospira sp. Ber2104 Rubrivivax benzoatilyticus Sandarakinorhabdus limnophila Sideroxydans lithotrophicus Silicibacter sp. TM1040 Simplicispira metamorpha Sinorhizobium meliloti Sphaerotilus montanus Sphingobium chlorophenolicum Sulfuricella denitrificans 249
≥97% ≥99% =100% Sphingobium chungbukense Sulfurisoma sediminicola Sphingobium sp. SYK-6 Sulfuritalea hydrogenivorans Sphingomonas sanxanigenens Tepidimonas sp. Sphingomonas sp. Thauera sp. Sphingomonas taxi Thiobacillus denitrificans Sphingomonas wittichii Thiomonas intermedia Sphingopyxis alaskensis Thiomonas sp. Sphingopyxis fribergensis Undibacterium oligocarboniphilum Sphingopyxis macrogoltabida Undibacterium parvum Sphingopyxis sp Undibacterium pigrum Sphingorhabdus planktonica Undibacterium seohonense Starkeya novella Undibacterium sp Sulfitobacter sp Variovorax boronicumulans Thalassobius aestuarii Variovorax ginsengisoli Thalassospira xiamenensis Variovorax paradoxus Tistrella mobilis Variovorax soli Woodsholea maritima Verminephrobacter eiseniae Xanthobacter autotrophicus Xylophilus ampelinus Zymomonas mobilis Zoogloea sp. Accumulibacter phosphatis Acinetobacter guillouiae Acidovorax avenae Aeromonas veronii Acidovorax citrulli Agarivorans gilvus Acidovorax delafieldii Aggregatibacter aphrophilus Acidovorax ebreus Alcanivorax dieselolei Acidovorax facilis Alcanivorax sp Acidovorax sp. JS42 Allochromatium vinosum Acidovorax temperans Alteromonas macleodii Acidovorax valerianellae Beggiatoa leptomitiformis Advenella kashmirensis Chromatocurvus halotolerans Advenella mimigardefordensis Citrobacter freundii Albidiferax ferrireducens Competibacter phosphatis Alcaligenes faecalis Congregibacter litoralis 250
≥97% ≥99% =100% Alicycliphilus denitrificans Cronobacter malonaticus Aquabacterium sp Cronobacter sakazakii Aquincola tertiaricarbonis Cycloclasticus sp Aquitalea denitrificans Cycloclasticus zancles Aromatoleum aromaticum EbN1 Dickeya dadantii Azoarcus sp. Dyella japonica Azospira oryzae Dyella jiangningensis Azospira sp Enterobacter asburiae Basilea psittacipulmonis Frateuria aurantia Bordetella avium Gynuella sunshinyii Bordetella bronchiseptica Haemophilus ducreyi Bordetella hinzii Haemophilus parainfluenzae Bordetella holmesii Haemophilus parasuis Bordetella pertussis Haliea sp Bordetella petrii Halomonas halocynthiae Burkholderia caribensis Halomonas sp Burkholderia cenocepacia Halomonas variabilis Burkholderia cepacia Halorhodospira halochloris Burkholderia diazotrophica Kushneria indalinina Burkholderia fungorum Legionella jeonii Burkholderia multivorans Legionella longbeachae Burkholderia phymatum Legionella oakridgensis Burkholderia phytofirmans Legionella pneumophila Burkholderia pseudomallei 688 Legionella sp. (Amoebal pathogen) Burkholderia pyrrocinia Leucothrix mucor Marinobacter Burkholderia rhizoxinica Lysobacter brunescens Burkholderia sp. Lysobacter sp Burkholderia thailandensis Marichromatium purpuratum Burkholderia xenovorans Marinobacter sp. Castellaniella defragrans Marinobacter psychrophilus Chitinibacter sp Methylobacter psychrophilus Chitinibacter suncheonensis Methylococcus capsulatus 251
≥97% ≥99% =100% Chitinibacter tainanensis Methylomicrobium alcaliphilum Chromobacterium violaceum Methylomonas methanica Chromobacterium sp Methylophaga sp Collimonas arenae Methylosarcina lacus Collimonas fungivorans Modicisalibacter tunisiensis Collimonas sp. Nitrosococcus oceani Comamonas koreensis Nitrosococcus watsoni Comamonas sp Oceanimonas sp Comamonas testosteroni Pasteurella multocida Cupriavidus basilensis Plesiomonas shigelloides Cupriavidus metallidurans Pseudoalteromonas haloplanktis Cupriavidus necator Pseudoalteromonas sp Cupriavidus taiwanensis Pseudomonas alkylphenolia Curvibacter delicatus Pseudomonas brassicacearum Dechloromonas aromatica Pseudomonas cichorii Dechloromonas hortensis Pseudomonas deceptionensis Dechloromonas sp. Pseudomonas denitrificans Dechlorosoma suillum Pseudomonas fulva Deefgea chitinilytica Pseudomonas knackmussi Deefgea rivuli Pseudomonas mandelii Deefgea sp Pseudomonas pseudoalcaligenes Delftia acidovorans Pseudomonas psychrophila Delftia sp Pseudomonas poae Denitratisoma oestradiolicum Pseudomonas protegens Duganella sp Pseudomonas resinovorans Gallionella capsiferriformans Pseudoxanthomonas icgebensis Herbaspirillum autotrophicum Pseudomonas trivialis Herbaspirillum chlorophenolicum Pseudoxanthomonas spadix Herbaspirillum frisingense Pseudoxanthomonas suwonensis Herbaspirillum hiltneri Psychrobacter sanguinis Herbaspirillum huttiense Psychrobacter sp Herbaspirillum lusitanum Rhodanobacter denitrificans 252
≥97% ≥99% =100% Herbaspirillum rubrisubalbicans Saccharophagus degradans Herbaspirillum seropedicae Salmonella enterica Herbaspirillum sp Shewanella halifaxensis Herminiimonas arsenicoxydans Shewanella pealeana Herminiimonas sp Shewanella sp. Hydrogenophaga sp Shigella boydii Hylemonella gracilis Shigella sonnei Hylemonella sp. Sodalis pierantonius Inhella inkyongensis Stenotrophomonas acidaminiphila Ideonella dechloratans Stenotrophomonas rhizophila Iodobacter arcticus Sulfuricaulis limicola Iodobacter fluviatilis Teredinibacter turnerae Iodobacter sp. Thalassolituus oleivorans Janthinobacterium agaricidamnosum Thioalkalivibrio nitratireducens Janthinobacterium lividum Thioalkalivibrio paradoxus Janthinobacterium sp Thioalkalivibrio sp Kerstersia gyiorum Thioalkalivibrio sulfidophilus Kinetoplastibacterium desouzaii Thioalkalivibrio versutus Kingella potus Thiocystis violascens Laribacter hongkongensis Thioploca ingrica Leptothrix cholodnii Thioploca sp. Leptothrix sp. Variovorax sp Limnohabitans planktonicus Vibrio cholerae Limnohabitans sp Vibrio parahaemolyticus Massilia aurea Wenzhouxiangella marina Massilia sp Westeberhardia cardiocondylae Massilia varians Xanthomonas albilineans Methylibium petroleiphilum Xanthomonas arboricola Methylibium sp Xanthomonas citri Methylobacillus flagellatus Xanthomonas fuscans Methylotenera mobilis Xanthomonas oryzae Methylotenera versatilis Xylella fastidiosa 253
≥97% ≥99% =100% Methyloversatilis universalis Yersinia pestis Methylovorus glucosetrophus Zymobacter palmae Methylopumilus planktonicus Anaeromyxobacter dehalogenans Methylovorus sp Chondromyces crocatus Methylopumilus turicensis Desulfobacca acetoxidans Mitsuaria chitosanitabida Desulfobacula toluolica Neisseria gonorrheae Desulfomonile tiedjei Neisseria lactamica Geobacter bemidjiensis Neisseria meningitidis Geobacter pickeringii Nitrosomonas communis Geobacter sp. Nitrosomonas europaea Geoalkalibacter subterraneus Nitrosomonas eutropha Geobacter sulfurreducens Nitrosomonas sp. Haliangium ochraceum Nitrosospira briensis Labilithrix luteola Nitrosospira multiformis Pelobacter carbinolicus Nitrotoga arctica Pelobacter propionicus Noviherbaspirillum canariense Aminobacterium colombiense Pandoraea apista Mycoplasma putrefaciens Pandoraea oxalativorans Bacterium Ellin Pandoraea pnomenusa Chthoniobacter flavus Pandoraea pulmonicola Prosthecobacter debontii Pandoraea sputorum Prosthecobacter dejongeii Pelomonas puraquae Prosthecobacter fusiformis Pandoraea thiooxydans Prosthecobacter vanneervenii Paucibacter toxinivorans Verrucomicrobium spinosum Piscinibacter aquaticus Polaromonas hydrogenivorans Polaromonas naphthalenivorans Polaromonas sp Polynucleobacter difficilis Polynucleobacter necessarius Pseudogulbenkiania sp 254
≥97% ≥99% =100% Profftella armatura Pusillimonas sp Ralstonia eutropha H16 Ralstonia mannitolilytica Ralstonia pickettii Ralstonia solanacearum Ralstonia syzygii Ramlibacter tataouinensis Rhizobacter dauci Rhodocyclus purpureus Rhodoferax ferrireducens Rhodoferax sp. Roseateles depolymerans Roseateles terrae Rubrivivax gelatinosus Rubrivivax benzoatilyticus Sideroxydans lithotrophicus Silvimonas sp Simplicispira metamorpha Snodgrassella alvi Sphaerotilus montanus Sphaerotilus natans Sulfuricella denitrificans Sulfurisoma sediminicola Sulfuritalea hydrogenivorans Taylorella equigenitalis Taylorella asinigenitalis Tepidimonas sp. Thauera sp. Thiobacillus denitrificans Thiobacillus thioparus Thiomonas delicata 255
≥97% ≥99% =100% Thiomonas intermedia Thiomonas sp. Undibacterium oligocarboniphilum Undibacterium parvum Undibacterium pigrum Undibacterium seohonense Undibacterium sp Undibacterium terreum Variovorax boronicumulans Variovorax ginsengisoli Variovorax paradoxus Variovorax soli Verminephrobacter eiseniae Vogesella perlucida Xenophilus azovorans Xylophilus ampelinus Zoogloea sp. Achromatium minus Acinetobacter guillouiae Aeromonas veronii Agarivorans gilvus Aggregatibacter aphrophilus Alcanivorax dieselolei Alcanivorax sp Algoriphagus aquatilis Allochromatium vinosum Alteromonas australica Alteromonas macleodii Aquicella siphonis Arsenophonus endosymbiont Beggiatoa leptomitiformis Beggiatoa sp. 256
≥97% ≥99% =100% Cardiobacterium hominis Cellvibrio japonicus Chromatocurvus halotolerans Citrobacter freundii Competibacter phosphatis Congregibacter litoralis Coxiella burnetii Cronobacter malonaticus Cronobacter sakazakii Cycloclasticus sp Cycloclasticus zancles Dichelobacter nodosus Dickeya dadantii Dickeya zeae Dyella japonica Dyella jiangningensis Enterobacter aerogenes Enterobacter asburiae Francisella cf. novicida Francisella noatunensis Frateuria aurantia Francisella tularensis Gynuella sunshinyii Haemophilus ducreyi Haemophilus parainfluenzae Haemophilus parasuis Hahella chejuensis Haliea sp Halomonas alimentaria Halomonas halocynthiae Halomonas halophila Halomonas organivorans 257
≥97% ≥99% =100% Halomonas phosphatis Halomonas salina Halomonas sp Halomonas variabilis Halorhodospira halochloris Halorhodospira halophila SL1 Halothiobacillus neapolitanus Idiomarina loihiensis Klebsiella michiganensis Kushneria indalinina Legionella anisa Legionella hackeliae Legionella jeonii Legionella longbeachae Legionella oakridgensis Legionella pneumophila Legionella sp. (Amoebal pathogen) Leucothrix mucor Marinobacter Listonella anguillarum Lysobacter brunescens Lysobacter daecheongensis Lysobacter sp Marichromatium purpuratum Marinobacter aquaeolei Marinobacter salarius Marinobacter hydrocarbonoclasticus Marinobacter sp. Marinobacter psychrophilus Methylobacter psychrophilus Methylocaldum marinum Methylocaldum sp Methylococcus capsulatus 258
≥97% ≥99% =100% Methylomicrobium alcaliphilum Methylomonas methanica Methylomonas sp. Methylophaga sp Methylophaga nitratireducenticrescens Methylosarcina lacus Modicisalibacter tunisiensis Nitrosococcus oceani Nitrosococcus watsoni Oceanimonas sp Pasteurella multocida Photobacterium damselae Photobacterium profundum Plesiomonas shigelloides Proteus mirabilis Proteus vulgaris Pseudoalteromonas haloplanktis Pseudoalteromonas sp Pseudomonas alkylphenolia Pseudomonas balearica Pseudomonas brassicacearum Pseudomonas cichorii Pseudomonas deceptionensis Pseudomonas denitrificans Pseudomonas fulva Pseudomonas knackmussi Pseudomonas koreensis Pseudomonas mandelii Pseudomonas pseudoalcaligenes Pseudomonas psychrophila Pseudomonas poae Pseudomonas protegens 259
≥97% ≥99% =100% Pseudomonas resinovorans Pseudomonas rhizosphaerae Pseudomonas savastanoi Pseudoxanthomonas icgebensis Pseudomonas trivialis Pseudoxanthomonas sp Pseudoxanthomonas spadix Pseudoxanthomonas suwonensis Psychrobacter aquaticus Psychrobacter faecalis Psychrobacter frigidicola Psychrobacter glacincola Psychrobacter luti Psychrobacter pulmonis Psychrobacter sanguinis Psychrobacter sp Rahnella aquatilis Rahnella sp Rhodanobacter denitrificans Saccharophagus degradans Salinicola peritrichatus Salmonella enterica Serratia fonticola Serratia liquefaciens Serratia marcescens Serratia symbiotica Shewanella halifaxensis Shewanella pealeana Shewanella sp. Shigella boydii Shigella sonnei Shimwellia blattae 260
≥97% ≥99% =100% Simiduia agarivorans Sodalis pierantonius Spiribacter salinus Stenotrophomonas acidaminiphila Stenotrophomonas rhizophila Sulfuricaulis limicola Teredinibacter turnerae Thalassolituus oleivorans Thioalkalivibrio nitratireducens Thioalkalivibrio paradoxus Thioalkalivibrio sp Thioalkalivibrio sulfidophilus Thioalkalivibrio versutus Thiocystis violascens Thioflavicoccus mobilis Thiomargarita sp Thioploca ingrica Thioploca sp. Tolumonas auensis Variovorax sp Vibrio alginolyticus Vibrio anguillarum Vibrio cholerae Vibrio nigripulchritudo Vibrio parahaemolyticus Wenzhouxiangella marina Westeberhardia cardiocondylae Xanthomonas albilineans Xanthomonas arboricola Xanthomonas citri Xanthomonas fuscans Xanthomonas oryzae 261
≥97% ≥99% =100% Xanthomonas sacchari Xanthomonas translucens Xylella fastidiosa Yersinia enterocolitica Yersinia pestis Zymobacter palmae Anaeromyxobacter dehalogenans Bdellovibrio bacteriovorus Bdellovibrio exovorus Bdellovibrio sp. Corallococcus coralloides Chondromyces apiculatus Chondromyces crocatus Chondromyces pediculatus Deferrisoma camini Desulfatibacillum alkenivorans Desulfobacca acetoxidans Desulfobacula toluolica Desulfobulbus propionicus Desulfocapsa sulfexigens Desulfohalobium retbaense Desulfomonile tiedjei Desulfotalea psychrophila Enhygromyxa salina Geobacter bemidjiensis Geobacter daltonii Geobacter pickeringii Geobacter sp. Geoalkalibacter subterraneus Geobacter sulfurreducens Haliangium ochraceum Jahnella thaxteri 262
≥97% ≥99% =100% Labilithrix luteola Nannocystis exeden Pelobacter carbinolicus Pelobacter propionicus Sulfuricurvum sp Syntrophus aciditrophicus Sulfurimonas denitrificans Sulfuricurvum kujiense Spirochaeta sp. Aminobacterium colombiense Mycoplasma putrefaciens Spiroplasma kunkelii Mesotoga prima Sulfurihydrogenibium sp Akkermansia muciniphila Bacterium Ellin Chthoniobacter flavus Methylacidiphilum fumariolicum Methylacidiphilum infernorum Prosthecobacter debontii Prosthecobacter dejongeii Prosthecobacter fusiformis Prosthecobacter vanneervenii Protochlamydia amoebophila Verrucomicrobium spinos
263
APPENDIX C. EUKARYAL SPECIES WITH PERCENTAGE IDENTITY OF ≥97%, ≥99% AND 100%
≥97% ≥99% =100
Acavomonas peruviana Acineta flava Acineta flava Acineta flava Amphisiella pulchra Antiokeronopsis flava Amphisiella pulchra Antiokeronopsis flava Campanella umbellaria Anteholosticha monilata Arcuospathidium namibiense Durinskia baltica Antiokeronopsis flava Campanella umbellaria Gymnodinium catenatum Arcuospathidium namibiense Diophrys japonica Hypotrichida sp Campanella umbellaria Durinskia baltica Oxytricha granulifera Carchesium polypinum Gymnodinium catenatum Paraurostyla viridis Cryptocaryon irritans Hypotrichida sp Peridiniopsis niei Diophrys japonica Oxytricha granulifera Peridiniopsis penardii Diophrys oligothrix Paraurostyla viridis Stentor muelleri Durinskia baltica Peridiniopsis niei Stentor roeselii Gymnodinium aureolum Peridiniopsis penardii Stylonychia Mytilus Gymnodinium catenatum Peridinium aciculiferum Acanthamoeba polyphaga Hypotrichida sp Peridinium baicalense Acanthamoeba sp Lagynophrya acuminata Peridinium euryceps Dictyostelium fasciculatum Oxytricha granulifera Perisincirra paucicirrata Vermamoeba vermiformis Paramecium tetraurelia Pfiesteria piscicida Nutomonas howeae Paraurostyla viridis Plasmodium cynomolgi Chlamydaster sterni Peridiniopsis niei Scrippsiella hangoei Cryptomonas tetrapyrenoidosa Peridiniopsis penardii Spathidium amphoriforme Goniomonas avonlea Peridinium aciculiferum Spathidium rectitoratum Goniomonas truncata Peridinium baicalense Stentor muelleri Storeatula sp Peridinium euryceps Stentor roeselii Alternaria alternata Perisincirra paucicirrata Stylonychia Mytilus Bacidia rosella Pfiesteria piscicida Acanthamoeba polyphaga Bipolaris maydis Phialina salinarum Acanthamoeba sp Bipolaris microstegii Philaster apodigitiformis Dictyostelium fasciculatum Bipolaris sorokiniana Plasmodium cynomolgi Vermamoeba vermiformis Botrytis cinerea 264
≥97% ≥99% =100
Prorocentrum micans Nutomonas howeae Cladophialophora carrionii Scrippsiella hangoei Chlamydaster sterni Cladophialophora yegresii Spathidium amphoriforme Cryptomonas marssonii Cladosporium bruhnei Spathidium rectitoratum Cryptomonas obovata Cladosporium sphaerospermum Stentor muelleri Cryptomonas curvata Colletotrichum graminícola Stentor roeselii Cryptomonas marssonii Curvularia fallax Sterkiella histriomuscorum Cryptomonas parapyrenoidifera Endocarpon pusillum Stylonychia Mytilus Cryptomonas tetrapyrenoidosa Fumiglobus pieridicola Uronemella parafilificum Goniomonas avonlea Gaeumannomyces graminis Vorticella microstoma Goniomonas truncata Kluyveromyces marxianus Acanthamoeba polyphaga Plagioselmis nannoplanctica Leptosphaeria maculans Acanthamoeba sp Rhodomonas minuta Leptosphaeria doliolum Dictyostelium fasciculatum Storeatula sp Marssonina brunnea Dictyostelium discoideum Teleaulax amphioxeia Millerozyma farinosa Mastigella erinacea Alternaria alternata Neofusicoccum parvum Paraflabellula hoguae Aureobasidium pullulans Neosetophoma clematidis Pseudoparamoeba pagei Bacidia rosella Pseudogymnoascus destructans Rhizamoeba sp Bipolaris maydis Rasamsonia emersonii Vermamoeba vermiformis Bipolaris microstegii Rhinocladiella mackenziei Apusomonas proboscidea Bipolaris sorokiniana Thielavia terrestris Nutomonas howeae Botrytis cinerea Anthracocystis flocculosa Chlamydaster sterni Cladophialophora carrionii Auricularia subglabra Cryptomonas marssonii Cladophialophora yegresii Candelabrochaete africana Cryptomonas obovata Cladosporium bruhnei Coltricia crassa Cryptomonas curvata Cladosporium sphaerospermum Coltriciella globosa Cryptomonas marssonii Colletotrichum graminícola Coniophora puteana Cryptomonas parapyrenoidifera Curvularia fallax Heterobasidion irregulare Cryptomonas tetrapyrenoidosa Endocarpon pusillum Inocybe maculata Goniomonas avonlea Epicoccum nigrum Punctularia strigosozonata Goniomonas truncata Fumiglobus pieridicola Scytinopogon havencampii Guillardia theta Gaeumannomyces graminis Sporisorium scitamineum 265
≥97% ≥99% =100
Plagioselmis nannoplanctica Kluyveromyces marxianus Tilletiopsis cremea Rhodomonas minuta Leptosphaeria maculans Tilletiopsis lilacina Storeatula sp Leptosphaeria doliolum Tilletiopsis washingtonensis Teleaulax amphioxeia Marssonina brunnea Tremella mesenterica Alternaria alternata Millerozyma farinosa Paraphysoderma sedebokerense Ascoidea rubescens Neofusicoccum parvum Gromochytrium mamkaevae Aureobasidium namibiae Neosetophoma clematidis Circinella simplex Aureobasidium pullulans Pseudocercospora angolensis Circinella umbellata Bacidia rosella Pseudogymnoascus destructans Kuzuhaea moniliformis Bipolaris maydis Rasamsonia emersonii Eiseniona gerardoi Bipolaris microstegii Rhinocladiella mackenziei Arctodiaptomus sp Bipolaris sorokiniana Thielavia terrestris Bombus impatiens Botrytis cinerea Anthracocystis flocculosa Calanus hyperboreus Candida glucosophila Auricularia subglabra Cimex lectularius Capronia coronata Candelabrochaete africana Copidosoma floridanum Cladophialophora carrionii Coltricia crassa Cyclops insignis Cladophialophora yegresii Coltriciella globosa Daphnia dentifera Cladosporium bruhnei Coniophora puteana Daphnia dubia Cladosporium delicatulum Heterobasidion irregulare Daphnia magna Cladosporium sphaerospermum Hypsizygus marmoreus Daphnia pulex Colletotrichum graminícola Inocybe maculata Daphnia pulicaria Curvularia fallax Punctularia strigosozonata Daphniopsis ephemeralis Dermatocarpon miniatum Scytinopogon havencampii Darcythompsonia fairliensis Endocarpon pusillum Sporisorium scitamineum Drosophila busckii Epicoccum nigrum Tilletiopsis cremea Eodiaptomus wolterecki Fumiglobus pieridicola Tilletiopsis lilacina Eudiaptomus graciloides Gaeumannomyces graminis Tilletiopsis washingtonensis Hemidiaptomus sp Kluyveromyces marxianus Tremella mesenterica Pseudothericles compressifrons Leptosphaeria biglobosa Paraphysoderma sedebokerense Solenopsis invicta Leptosphaeria maculans Gromochytrium mamkaevae Systolederus spicupennis Leptosphaeria doliolum Sacculospora baltica Tigriopus californicus 266
≥97% ≥99% =100
Marssonina brunnea Barbatospora ambicaudata Lingula rostrum Millerozyma farinosa Circinella simplex Balaenoptera acutorostrata Neofusicoccum parvum Circinella umbellata Callorhinchus milii Neosetophoma clematidis Kuzuhaea moniliformis Chelonia mydas Paraconiothyrium lycopodinum Eiseniona gerardoi Chinchilla lanigera Paraconiothyrium polonense Helobdella robusta Corbula tunicata Peltula obscurans Leodamas dubia Danio rerio Pseudocercospora angolensis Anomalocera patersoni Dicentrarchus labrax Pseudogymnoascus destructans Arctodiaptomus sp Ictidomys tridecemlineatus Rasamsonia emersonii Boeckella sp Jaculus jaculus Rhinocladiella mackenziei Bombus impatiens Lepisosteus oculatus Stenocarpella maydis Calanus finmarchicus Macaca mulatta Thielavia terrestris Calanus hyperboreus Monodelphis domestica Tuber aestivum Candona candida Ornithorhynchus anatinus Anthracocystis flocculosa Cimex lectularius Oryzias latipes Auricularia subglabra Copidosoma floridanum Otolemur garnettii Candelabrochaete africana Cyclopidae sp Phodopus sungorus Coltricia crassa Cyclops insignis Poecilia formosa Coltriciella globosa Diaphanosoma sp Poecilia reticulata Coniophora puteana Daphnia dentifera Takifugu rubripes Filobasidiella neoformans Daphnia dubia Thamnophis sirtalis Heterobasidion irregulare Daphnia magna Xenopus tropicalis Hypsizygus marmoreus Daphnia pulex Heterolepidoderma sp Inocybe maculata Daphnia pulicaria Abra alba Melanopsichium pennsylvanicum Daphniopsis ephemeralis Aplysia californica Phomopsis sp Darcythompsonia fairliensis Asaphis deflorata Punctularia strigosozonata Diaphanosoma sp Congeria jalzici Scytinopogon havencampii Drosophila busckii Dreissena bugensis Sporisorium scitamineum Eodiaptomus wolterecki Dreissena polymorpha Tilletiopsis cremea Eucalanus bungii Mya arenaria Tilletiopsis lilacina Eudiaptomus graciloides Mysella charcoti 267
≥97% ≥99% =100
Tilletiopsis washingtonensis Fabaeformiscandona sp Mytilopsis leucophaeata Tremella mesenterica Hemidiaptomus sp Brugia pahangi Paraphysoderma sedebokerense Parabroteas sarsi Brugia timori Boothiomyces macroporosum Phyllodiaptomus sp Parastrongyloides trichosuri Gromochytrium mamkaevae Pontomalota opaca Diphyllobothrium latum Rhizophydium patellarium Pseudothericles compressifrons Geocentrophora applanate Sacculospora baltica Rhinocyllus conicus Geocentrophora baltica Circinella simplex Scapholeberis rammneri Geocentrophora marcusi Circinella umbellata Simocephalus beianensis Geocentrophora sphyrocephala Kuzuhaea moniliformis Simocephalus heilongjiangensis Mesocestoides corti Thermomucor indicae-seudaticae Simocephalus vetuloides Protopolystoma xenopodis Eiseniona gerardoi Solenopsis invicta Prorhynchus fontinalis Helobdella robusta Systolederus spicupennis Spirometra erinaceieuropaei Leodamas dubia Temora longicornis Taenia asiatica Ophelia bicornis Tigriopus californicus Trichobilharzia regenti Anomalocera patersoni Lingula rostrum Brachionus calyciflorus Anurida maritima Flustrellidra hispida Brachionus patulus Arctodiaptomus sp Balaenoptera acutorostrata Brachionus plicatilis Athalia rosae Callorhinchus milii Conochilus coenobasis Bilobella aurantiaca Chelonia mydas Conochilus unicornis Boeckella sp Chinchilla lanigera Floscularia armata Bombus impatiens Corbula tunicata Floscularia bífida Brotheas amazonicus Danio rerio Octotrocha speciosa Bythotrephes cederstroemi Dicentrarchus labrax Ptygura longicornis Calamoecia sp Gorilla gorilla Sinantherina semibullata Calanus finmarchicus Ictidomys tridecemlineatus Sinantherina socialis Calanus hyperboreus Jaculus jaculus Synchaeta pectinata Candona candida Lepisosteus oculatus Testudinella patina Ceriodaphnia rotunda Macaca mulatta Trichotria tetractis Chironomus tentans Monodelphis domestica Dactylobiotus ambiguus Cimex lectularius Ornithorhynchus anatinus Dactylobiotus parthenogeneticus 268
≥97% ≥99% =100
Copidosoma floridanum Oryzias latipes Murrayon pullari Cormocephalus hartmeyeri Otolemur garnettii Aulactinia stella Cyclaspis caprella Pantholops hodgsonii Bouillonactinia sp Cyclopidae sp Phodopus sungorus Coniothyrium cereale Cyclops insignis Poecilia formosa Drymonema larsoni Diaphanosoma sp Poecilia reticulata Ectopleura crocea Daphnia dentifera Takifugu rubripes Ectopleura wright Daphnia dubia Thamnophis sirtalis Edwardsia timida Daphnia magna Xenopus tropicalis Epiactis handi Daphnia pulex Heterolepidoderma sp Halopteris schucherti Daphnia pulicaria Abra alba Hebella venusta Daphniopsis ephemeralis Aplysia californica Hydra circumcincta Daphniopsis truncata Asaphis deflorata Hydra hymanae Darcythompsonia fairliensis Chione elevata Hydra oligactis Diacyclops bicuspidatus Congeria jalzici Hydra sinensis Diacyclops scanloni Dreissena bugensis Hydra utahensis Diaeretus leucopterus Dreissena polymorpha Hydra vulgaris Diaphanosoma sp Mya arenaria Hydra zhujiangensis Drosophila busckii Mysella charcoti Moerisia inkermanica Eodiaptomus wolterecki Mytilopsis leucophaeata Nematostella vectensis Eucalanus bungii Velesunio ambiguus Sertularella africana Eudiaptomus graciloides Venus verrucosa Tiaricodon coeruleus Eurytemora affinis Anisakis simplex Turritopsis lata Evadne nordmanni Brugia pahangi Halichondria panicea Fabaeformiscandona sp Brugia timori Didymoeca costata Gomphiocephalus hodgsoni Parastrongyloides trichosuri Monosiga brevicollis Hemidiaptomus sp Amphiporus sp Nuclearia simplex Lernaea cyprinacea Diphyllobothrium latum Parvicapsula petuniae Limnocalanus macrurus Geocentrophora applanate Bodomorpha minima Megacyllene robiniae Geocentrophora baltica Elphidium williamsoni Neocalanus cristatus Geocentrophora marcusi Elphidium sp 269
≥97% ≥99% =100
Neocalanus plumchrus Geocentrophora sphyrocephala Paulinella chromatophora Oligotoma sp Mesocestoides corti Plasmodiophora brassicae Opisthacanthus cayaporum Protopolystoma xenopodis Pseudodifflugia gracilis Palophagoides vargasorum Prorhynchus fontinalis Spongotrochus glacialis Parabroteas sarsi Spirometra erinaceieuropaei Pyropia nítida Phyllodiaptomus sp Taenia asiatica Pyropia yezoensis Plagiostira albonotata Podura aquatica Trichobilharzia regenti Albugo laibachii Pontomalota opaca Beauchampia crucigera Ankylochrysis lutea Pseudothericles compressifrons Brachionus calyciflorus Aphanomyces astaci Rhinocyllus conicus Brachionus patulus Aphanomyces laevis Scapholeberis rammneri Brachionus plicatilis Asterionellopsis glacialis Simocephalus beianensis Conochilus coenobasis Aulacoseira ambigua Simocephalus heilongjiangensis Conochilus unicornis Aulacoseira granulata Simocephalus vetuloides Floscularia armata Aulacoseira islandica Solenopsis invicta Floscularia bífida Aulacoseira skvortzowii Systolederus spicupennis Keratella cochlearis Aureococcus anophagefferens Temora longicornis Lacinularoides coloniensis Cerataulina daemon Tetrodontophora bielanensis Lecane ungulata Chaetoceros simplex Tigriopus californicus Limnias ceratophylli Coscinodiscus radiatus Lingula rostrum Limnias melicerta Cyclostephanos dubius. Flustrellidra hispida Octotrocha speciosa Cylindrotheca closterium Balaenoptera acutorostrata Ptygura beauchampi Discostella sp Branchiostoma floridae Ptygura longicornis Eunotia naegelii Callorhinchus milii Sinantherina semibullata Fistulifera solaris Chelonia mydas Sinantherina socialis Fragilaria capucina Chinchilla lanigera Synchaeta pectinata Fragilaria crotonensis Corbula tunicata Testudinella clypeata Grammonema striatula Danio rerio Testudinella patina Halamphora coffeaeformis Dicentrarchus labrax Trichotria tetractis Halamphora coloradiana Eptesicus fuscus Dactylobiotus ambiguus Halamphora oligotraphenta Gorilla gorilla Dactylobiotus parthenogeneticus Halamphora veneta 270
≥97% ≥99% =100
Ictidomys tridecemlineatus Murrayon pullari Hyphochytrium catenoides Jaculus jaculus Aulactinia stella Lampriscus kittonii Lepisosteus oculatus Bouillonactinia sp Lithodesmium undulatum Macaca mulatta Coniothyrium cereale Melosira arctica Monodelphis domestica Drymonema larsoni Melosira dubia Myotis lucifugus Ornithorhynchus Ectopleura crocea Nannochloropsis gaditana anatinus Ectopleura wright Nannochloropsis granulata Oryzias latipes Edwardsia timida Nannochloropsis limnetica Otolemur garnettii Epiactis handi Nannochloropsis oceanica Pantholops hodgsonii Halopteris schucherti Nannochloropsis oculata Phodopus sungorus Hebella venusta Nannochloropsis salina Poecilia formosa Hydra circumcincta Navicula sp Poecilia reticulata Hydra hymanae Nitzschia longissima Pteropus alecto Hydra oligactis Odontella aurita Takifugu rubripes Hydra sinensis Odontella sinensis Thamnophis sirtalis Hydra utahensis Phytophthora megasperma Xenopus tropicalis Hydra vulgaris Phytophthora sojae Heterolepidoderma sp Hydra zhujiangensis Pseudo-nitzschia calliantha Abra alba Moerisia inkermanica Pseudo-nitzschia galaxiae Acila castrensis Nematostella vectensis Pseudo-nitzschia pseudodelicatissima Aplysia californica Sagartia ornata Pythium anandrum Arctica islandica Sertularella africana Pythium senticosum Asaphis deflorata Tiaricodon coeruleus Pythium takayamanum Calyptogena magnifica Turritopsis lata Pythium viniferum Chione elevata Halichondria panicea Rhizosolenia imbricata Congeria jalzici Didymoeca costata Rhizosolenia setigera Cyrenoida floridana Monosiga brevicollis Saccharina japonica Dreissena bugensis Nuclearia simplex Saprolegnia parasítica Dreissena polymorpha Parvicapsula petuniae Skeletonema costatum Mya arenaria Syringoderma phinneyi Skeletonema potamos Mysella charcoti Bodomorpha minima Skeletonema pseudocostatum 271
≥97% ≥99% =100
Mytilopsis leucophaeata Bodomorpha sp Thalassiosira eccentric Petricola lapicida Elphidium williamsoni Thalassiosira fallax Teredo clappi Elphidium sp Thalassiosira minima Velesunio ambiguus Esquamula lacrimiformis Thalassiosira nordenskioeldii Venus verrucosa Gymnophrys sp Thalassiosira profunda Angiostrongylus cantonensis Paulinella chromatophora Thalassiosira pseudonana Anisakis simplex Plasmodiophora brassicae Thalassiosira rotula Brugia pahangi Pseudodifflugia gracilis Thalassiosira weissflogii Brugia timori Spongotrochus glacialis Triparma laevis Parastrongyloides trichosuri Bangia fuscopurpurea Ulnaria acus Xiphinema rivesi Gracilariopsis lemaneiformis Actinastrum sp Amphiporus sp Pyropia haitanensis Amborella trichopoda Diphyllobothrium latum Pyropia nítida Bathycoccus prasinos Geocentrophora applanate Pyropia yezoensis Brachypodium distachyon Geocentrophora baltica Achlya sparrowii Brassica rapa Geocentrophora marcusi Albugo laibachii Chlorella emersonii Geocentrophora sphyrocephala Amphora affinis Chlorella sorokiniana Mesocestoides corti Ankylochrysis lutea Chlorella sp Protopolystoma xenopodis Aphanomyces astaci Chlorella variabilis Prorhynchus fontinalis Aphanomyces laevis Chlorella vulgaris Schistosoma rodhaini Asterionella formosa Coccomyxa simplex Spirometra erinaceieuropaei Asterionellopsis glacialis Cucumis melo Taenia asiatica Aulacoseira ambigua Gossypium herbaceum Trichobilharzia regenti Aulacoseira distans Gossypium hirsutum Halicryptus spinulosus Aulacoseira granulata Hordeum jubatum Priapulus caudatus Aulacoseira islandica Lycopersicon esculentum Beauchampia crucigera Aulacoseira skvortzowii Medicago truncatula Brachionus calyciflorus Aureococcus anophagefferens Microglena monadina Brachionus patulus Bicosoeca sp Momordica charantia Brachionus plicatilis Cerataulina daemon Monoraphidium neglectum Conochilus coenobasis Chaetoceros simplex Mychonastes sp 272
≥97% ≥99% =100
Conochilus unicornis Chrysosphaerella rotundata Oltmannsiellopsis sp Floscularia armata Coscinodiscus radiatus Paradoxia multiseta Floscularia bífida Cyclostephanos dubius. Phaeocerosv laevis Keratella cochlearis Cyclotella meneghiniana Populus trichocarpa Lacinularoides coloniensis Cylindrotheca closterium Solanum lycopersicum Lecane ungulata Cymatopleura elliptica Sorghum bicolor Limnias ceratophylli Discostella sp Watanabea reniformis Limnias melicerta Eunotia naegelii Octotrocha speciosa Fistulifera solaris Ptygura beauchampi Fragilaria capucina Ptygura longicornis Fragilaria crotonensis Sinantherina semibullata Fragilaria perminuta Sinantherina socialis Grammonema striatula Synchaeta pectinata Halamphora coffeaeformis Testudinella clypeata Halamphora coloradiana Testudinella patina Halamphora oligotraphenta Trichotria tetractis Halamphora veneta Dactylobiotus ambiguus Hyphochytrium catenoides Dactylobiotus parthenogeneticus Lampriscus kittonii Milnesium sp Lithodesmium undulatum Murrayon pullari Mallomonas asmundae Anthopleura elegantissima Melosira arctica Aulactinia stella Melosira dubia Aulactinia verrucosa Microzonia velutina Boloceroides mcmurrichi Nannochloropsis sp Bougainvillia muscus Nannochloropsis gaditana Bouillonactinia sp Nannochloropsis granulata Bunodactis reynaudi Nannochloropsis limnetica Carybdea xaymacana Nannochloropsis oceanica Chironex fleckeri Nannochloropsis oculata Chironex yamaguchii Nannochloropsis salina 273
≥97% ≥99% =100
Clytia xiamenensis Navicula sp Coniothyrium cereale Nitzschia laevis Diadumene cincta Nitzschia longissima Drymonema larsoni Odontella aurita Ectopleura crocea Odontella sinensis Ectopleura wright Phytophthora megasperma Edwardsia elegans Phytophthora sojae Edwardsia timida Pseudo-nitzschia calliantha Eirene brevistylus Pseudo-nitzschia galaxiae Epiactis handi Pseudo-nitzschia multiseries Haloclava producta Pseudo-nitzschia pseudodelicatissima Halopteris schucherti Pythiopsis terrestris Hebella venusta Pythium anandrum Henneguya salminicola Pythium senticosum Hydra circumcincta Pythium takayamanum Hydra hymanae Pythium viniferum Hydra oligactis Rhizosolenia imbricata Hydra sinensis Rhizosolenia setigera Hydra utahensis Roundia cardiophora Hydra vulgaris Saccharina japonica Hydra zhujiangensis Saprolegnia parasítica Janaria mirabilis Skeletonema costatum Leiopathes expansa Skeletonema marinoi Melicertum octocostatum Skeletonema potamos Mitrocomella niwai Skeletonema pseudocostatum Modeeria rotunda Syringoderma phinneyi Moerisia inkermanica Thalassiosira angulata Nectopyramis sp Thalassiosira eccentric Nematostella vectensis Thalassiosira fallax Parantipathes hirondelle Thalassiosira minima Sagartia ornata 274
≥97% ≥99% =100
Sertularella africana Thalassiosira nordenskioeldii Tiaricodon coeruleus Thalassiosira profunda Tiaropsis multicirrata Thalassiosira pseudonana Turritopsis lata Thalassiosira rotula Clathrina blanca Thalassiosira weissflogii Clathrina clathrus Triceratium dubium Clathrina rubra Triparma laevis Halichondria panicea Ulnaria acus Didymoeca costata Ulnaria ulna Ichthyophonus hoferi Actinastrum sp Monosiga brevicollis Alloteropsis semialata Nuclearia moebiusi Amborella trichopoda Nuclearia simplex Atropa belladonna Parvicapsula petuniae Bathycoccus prasinos Salpingoeca fusiformis Brachypodium distachyon Syringoderma phinneyi Brassica rapa Bodomorpha minima Chlorella emersonii Bodomorpha sp Chlorella sorokiniana Collozoum inerme Chlorella sp Elphidium williamsoni Chlorella variabilis Elphidium sp Chlorella vulgaris Esquamula lacrimiformis Coccomyxa simplex Gymnophrys sp Coelastrum astroideum Haynesina germanica Coelastrum microporum Paulinella chromatophora Cucumis melo Plasmodiophora brassicae Gossypium herbaceum Pseudodifflugia gracilis Gossypium hirsutum Rhogostoma minus Hordeum jubatum Sphaerozoum ovodimare Lycopersicon esculentum Spongotrochus glacialis Medicago truncatula Bangia fuscopurpurea Microglena monadina 275
≥97% ≥99% =100
Glaucosphaera vacuolata Momordica charantia Gracilariopsis lemaneiformis Monoraphidium minutum Gymnogongrus griffithsiae Monoraphidium neglectum Pyropia haitanensis Mychonastes homosphaera Pyropia nítida Mychonastes sp Pyropia yezoensis Oltmannsiellopsis sp Achlya sparrowii Parachlorella kessleri Albugo laibachii Paradoxia multiseta Amphora affinis Phaeocerosv laevis Ankylochrysis lutea Pinus peuce Aphanomyces astaci Pinus strobus Aphanomyces laevis Populus trichocarpa Asterionella formosa Solanum lycopersicum Asterionellopsis glacialis Sorghum bicolor Aulacoseira ambigua Syringoderma phinneyi Aulacoseira distans Triticum aestivum Aulacoseira granulata Watanabea reniformis Aulacoseira islandica Aulacoseira skvortzowii Aureococcus anophagefferens Bicosoeca sp Blastocystis hominis Cerataulina daemon Chaetoceros simplex Chaetoceros socialis Chattonella subsalsa Chrysolepidomonas dendrolepidota Chrysosphaerella rotundata Coscinodiscus radiatus Cyclostephanos dubius. Cyclotella meneghiniana 276
≥97% ≥99% =100
Cylindrotheca closterium Cymatopleura elliptica Dictyocha speculum Dictyota dichotoma Discostella sp Eunotia naegelii Fistulifera solaris Fragilaria capucina Fragilaria crotonensis Fragilaria perminuta Frustulia aotearoa Glossomastix chrysoplastos Grammonema striatula Guinardia striata Halamphora coffeaeformis Halamphora coloradiana Halamphora oligotraphenta Halamphora veneta Hantzschia sp Heterosigma akashiwo Hyphochytrium catenoides Laminaria digitata Lampriscus kittonii Lithodesmium undulatum Mallomonas asmundae Mallomonas elongata Mallomonas kalinae Mallomonas morrisonensis Mallomonas muskokana Mallomonas papillosa Mallomonas tonsurata 277
≥97% ≥99% =100
Mallomonas torquata Melosira arctica Melosira dubia Microzonia velutina Monodus guttula Nannochloropsis sp Nannochloropsis gaditana Nannochloropsis granulata Nannochloropsis limnetica Nannochloropsis oceanica Nannochloropsis oculata Nannochloropsis salina Navicula sp Nitzschia laevis Nitzschia longissima Ochromonas Danica Odontella aurita Odontella sinensis Phytophthora megasperma Phytophthora sojae Phytopythium vexans Pseudo-nitzschia calliantha Pseudo-nitzschia galaxiae Pseudo-nitzschia multiseries Pseudo-nitzschia pseudodelicatissima Pteridomonas Danica Pylaiella littoralis Pythiopsis terrestris Pythium anandrum Pythium flevoense Pythium glomeratum 278
≥97% ≥99% =100
Pythium scleroteichum Pythium senticosum Pythium takayamanum Pythium viniferum Rhizochromulina cf. Marina Rhizosolenia imbricata Rhizosolenia setigera Roundia cardiophora Saccharina japonica Saprolegnia parasítica Skeletonema costatum Skeletonema marinoi Skeletonema potamos Skeletonema pseudocostatum Sphacelaria sp Spumella vulgaris Stephanopyxis nipponica Streblonema maculans Syringoderma phinneyi Tessellaria lapponica Thalassiosira angulata Thalassiosira eccentric Thalassiosira fallax Thalassiosira minima Thalassiosira nordenskioeldii Thalassiosira pacifica Thalassiosira profunda Thalassiosira pseudonana Thalassiosira rotula Thalassiosira weissflogii Tribonema aequale 279
≥97% ≥99% =100
Triceratium dubium Triparma laevis Ulnaria acus Ulnaria ulna Vacuolaria virescens Actinastrum sp Acutodesmus obliquus Alloteropsis semialata Amborella trichopoda Ankistrodesmus falcatus Atropa belladonna Bathycoccus prasinos Brachypodium distachyon Brassica rapa Chlamydomonas reinhardtii Chlorella emersonii Chlorella sorokiniana Chlorella sp Chlorella variabilis Chlorella vulgaris Chromochloris zofingiensis Closterium baillyanum Coccomyxa simplex Coelastrum astroideum Coelastrum microporum Corylopsis sinensis Cucumis melo Gossypium herbaceum Gossypium hirsutum Hordeum jubatum Itea virginica 280
≥97% ≥99% =100
Lilium tsingtauense Lycopersicon esculentum Lyellia platycarpa Marsupiomonas pelliculata Medicago truncatula Micractinium reisseri Microglena monadina Momordica charantia Monactinus sturmii Monoraphidium minutum Monoraphidium neglectum Mychonastes homosphaera Mychonastes huancayensis Mychonastes jurisii Mychonastes sp Nelumbo lutea Oltmannsiellopsis sp Ourococcus multisporus Parachlorella kessleri Paradoxia multiseta Paspalum vaginatum Phaeocerosv laevis Phaseolus vulgaris Picea asperata Pinus mugo Pinus peuce Pinus strobus Populus trichocarpa Pyramimonas gelidicola Rotundella rotunda Roupala macrophylla 281
≥97% ≥99% =100
Scenedesmus obliquus Scenedesmus rotundus Selaginella moellendorffii Solanum lycopersicum Solanum pennellii Sorghum bicolor Staphylea trifolia Stigeoclonium subsecundum Syringoderma phinneyi Triticum aestivum Tumidella tumida Watanabea reniformis