Immunohematology Volume 27, Number 2, 2011

Volu m e 27, Nu m be r 2, 2011

CONTENTS

R e v i e w 41 Scianna: the lucky 13th blood group system P.A.R. Brunker and W.A. Flegel

C a s e R e p o r t 58 Possible suppression of fetal erythropoiesis by the Kell blood group antibody anti-Kpa M. Tuson, K. Hue-Roye, K. Koval, S. Imlay, R. Desai, G. Garg, E. Kazem, D. Stockman, J. Hamilton, and M.E. Reid

R e p o r t 61 Challenging dogma: group A donors as “universal plasma” donors in massive transfusion protocols E.J. Isaak, K.M. Tchorz, N. Lang, L. Kalal, C. Slapak, G. Khalife, D. Smith, and M.C. McCarthy

R e p o r t 66 Prevalence of RHD*DOL and RHDCE*ce(818T) in two populations C. Halter Hipsky, D.C. Costa, R. Omoto, A. Zanette, L. Castilho, and M.E. Reid

R e v i e w 68 XG: the forgotten blood group system N.C. Johnson

C o m m u n i c at i o n 72 Erratum Vol. 27, No. 1, 2011, pp. 14, 16, and 18

73 A nnouncements

75 A dvertisements

79 I nstructions f o r A u t h o r s E d i to r - i n -C h i e f E d i to r i a l B oa r d Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Paul M. Ness, MD Pomona, California Baltimore, Maryland M a n ag i n g E d i to r James P. AuBuchon, MD Joyce Poole, FIBMS Cynthia Flickinger, MT(ASCP)SBB Seattle, Washington Bristol, United Kingdom Philadelphia, Pennsylvania Martha R. Combs, MT(ASCP)SBB Mark Popovsky, MD Durham, North Carolina Braintree, Massachusetts S e n i o r M e d i c a l E d i to r Geoffrey Daniels, PhD Marion E. Reid, PhD, FIBMS Geralyn M. Meny, MD Bristol, United Kingdom New York City, New York Philadelphia, Pennsylvania Anne F. Eder, MD S. Gerald Sandler, MD Washington, District of Columbia Washington, District of Columbia Tec h n i c a l E d i to r s George Garratty, PhD, FRCPath Jill R. Storry, PhD Christine Lomas-Francis, MSc Pomona, California Lund, Sweden New York City, New York Brenda J. Grossman, MD David F. Stroncek, MD Dawn M. Rumsey, ART (CSMLT) St. Louis, Missouri Bethesda, Maryland Glen Allen, Virginia Christine Lomas-Francis, MSc New York City, New York E m e r i t u s E d i to r A s s o c i at e M e d i c a l E d i to r s Gary Moroff, PhD Delores Mallory, MT(ASCP) SBB David Moolten, MD Rockville, Maryland Supply, North Carolina Philadelphia, Pennsylvania Ralph R. Vassallo, MD Philadelphia, Pennsylvania

E d i to r i a l A s s i s ta n t Sheetal Patel Immunohematology is published quarterly (March, June, September, and December) by the American Red Cross, National Headquarters, Washington, DC 20006.

C o p y E d i to r Immunohematology is indexed and included in Index Medicus and MEDLINE on the Mary L. Tod MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier BIOBASE/Current Awareness in Biological Sciences (CABS) databases. The subscription price is $40.00 (U.S.) and $50.00 (foreign) per year. P r o o f r e a d e r Lucy Oppenheim Subscriptions, Change of Address, and Extra Copies: Immunohematology, P.O. Box 40325 P r o d u c t i o n A s s i s ta n t Philadelphia, PA 19106 Marge Manigly Or call (215) 451-4902 Web site: www.redcross.org/immunohematology E l ec t r o n i c P u b l i s h e r Copyright 2011 by The American National Red Cross Paul Duquette ISSN 0894-203X

O n O u r C o v e r Ophelia by John William Waterhouse Ophelia is a favorite subject of the pre-Raphaelites and, in particular, John William Waterhouse. The painting, completed in 1910, is one of his more famous. It depicts the doomed daughter of Polonius picking flowers near the river in the moments before she drowns. The red and white blossoms represent both the vitality and the transience of life, as well the curse and fate of lost innocence. The scene is pastoral, but the darker hues and the intensity in her gaze and in how tightly she clutches the flowers and her dress betray her true state of mind. Ophelia mirrors Hamlet in her brooding over the moral collapse around her but is unable to resist the descent into madness. Like sweet bells jangled, out of tune and harsh; That unmatch’d form and feature of blown youth Blasted with ecstasy: O, woe is me, To have seen what I have seen, see what I see! The XG blood group, reviewed in this issue, has been investigated in genetic marker studies suggesting possible linkage with manic-depressive illness. David Moolten, MD R e v i e w Scianna: the lucky 13th blood group system

P.A.R. Brunker and W.A. Flegel

The Scianna system was named in 1974 when it was appreciated titer was demonstrated at 256, and the new antibody to a that two antibodies described in 1962 in fact identified antithetical high-prevalence antigen, originally named anti-Sm, was antigens. However, it was not until 2003 that the protein on demonstrated at a titer of 16. An informative family study which antigens of this system are found and the first molecular revealed three antigen-negative siblings with a likely variants were described. Scianna was the last previously serologically defined, protein-based blood group system to be autosomal dominant mode of antigen inheritance, and no characterized at the molecular level, marking the end of an era unrelated antigen-negative specimens were identified in a in immunohematology. This story highlights the critical role population survey of 600 D– random individuals. A clue that availability of laboratory reagents for serologic testing has to the genetic position of the responsible locus was present played in the initial characterization of a blood group and sets the even in this defining family: based on the pedigree, it could stage for the development of new reagents, such as recombinant proteins, to assist in this process. The central role that genetics not be determined whether the new antigen was part of the has played, both by classical pedigree analysis and by molecular Rh system as it was in linkage disequilibrium with cc in techniques, in the discovery and characterization of this blood that kindred. group is reviewed. Immunohematology 2011;27:41–57. In spite of this very dramatic introduction, the clinical importance of the new antigen was uncertain, as the The high- and low-prevalence antigens that constitute concurrent anti-D clearly could account for the proband’s the Scianna (SC) blood group system are caused by unfortunate obstetric history. While the work of the Miami variants in the erythroid membrane–associated protein group was in the pipeline for publication, the Winnipeg Rh (ERMAP).1 SC was initially identified by serologic methods; Laboratory, in Manitoba, reported an antibody to a new the clinical significance of antibodies specific to SC is low-prevalence antigen arising in a 50-year-old man with uncertain, although case reports demonstrating rare cases stomach cancer.3 In this patient, the antibody originally of hemolytic disease attributed to SC variants exist. Genetic named anti-Bua, found in serum Char., was identified during analyses in both the classical and molecular approaches, a routine pretransfusion crossmatch. As the patient had have been central to the discovery and elaboration of the been transfused with three units of blood 14 days earlier, SC system. This article reviews the story of the SC blood this delayed serologic transfusion reaction was investigated, group from a genetic point of view, emphasizing the way it which revealed that although his serum was crossmatch- has been brought into focus thanks to genetic tools ranging compatible with all three donor samples before transfusion, from pedigree analysis to physical mapping. it reacted with one of the three samples after transfusion. A follow-up survey of 18 panel red blood cells (RBCs) History demonstrated one reactive cell, suggesting a relatively high prevalence for this new antigen; however, this proved not to Nomenclature: Sc1, Sc2, Sc3, and Sc4 be the case, as only one of the next 1,000 donors was positive. The story of the 13th International Society of Blood The families of all three of these probands took part in Transfusion (ISBT) blood group system began in 1962, pedigree analysis, one of which was extremely informative, when a new high-prevalence antigen was reported alongside with a kindred of both parents and nine offspring. These a coexisting anti-D in a 25-year-old, multiparous woman studies in classical genetics demonstrated that the new of Italian descent in Miami, Florida, who experienced locus segregated independently from ABO, MNSs, P, Rh, several fetal deaths as a result of hemolytic disease of the Kell, Kidd, Duffy, and X-chromosome. fetus and newborn (HDFN).2 She came to clinical attention because of difficulty obtaining compatible blood. Her ABO Genetics and Inheritance and Rh typings were O ccddee, and her husband’s were O CCDee. After an unremarkable first pregnancy and birth, It did not take long for the relationship between the Sm she experienced three subsequent and progressively earlier and Bua to be postulated, tested, and proven. In 1964, the fetal demises—at term, at 7, and at 6 months’ gestation— anti-Bua serum was used to type the available members of in the late 1950s. After her second fetal death, her anti-D the index Sm family (Fig. 1). The importance of using this

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 41 P.A.R. Brunker and W.A. Flegel

rigorously examined 19 based on the presence of Bua, it was not until additional reagent serum was available in 1966 that definitive proof of this relationship was found. Further examples of anti-Bua were discovered in a group of individuals from Poland and the United Kingdom (particularly the strongest serum Soch.) who had produced anti-Bua after having been artificially immunized with D+ cells to stimulate the production of Rh antibodies.6 Through a careful study of the donors used for these stimulations, three additional subjects who were also stimulated with these cells were found to have created an anti-Bua, although it was much weaker than that in the Soch. serum. The prevalence of the Bua allele was determined as 0.88 percent in a Warsaw and 0.67 percent in a London cohort. Using this reagent after adsorption to remove the iatrogenically generated anti-D also present in the serum, the Winnipeg Rh Laboratory identified a large, six- generation Mennonite kindred that included two cousin Fig. 1 Index family in the characterization of the Sm antigen and a demonstration of the antithetical relationship between Sm and Bua matings of Sm/Bu heterozygotes, which produced 20 antigens. The proband (patient Ms. Scianna) is indicated by the offspring.7 Through a methodical review of the serologic arrow. Solid color represents Sm+ (Sc:1+) antigen test. Striped fill data from samples from the kindred, which showed the a represents Bu + (Sc:2+) antigen test. Inferred genotype is shown effects of antibody dosage on antigen expression, this report below the symbol for each family member. The proband’s parents were deceased at the time of Bua testing, so are inferred to be confirmed and expanded the definition of the new system heterozygotes, indicated by the interrupted stripes and parentheses to exclude all blood groups reported before 1962 (except a in their genotype designation. The combination of Sm and Bu typing Diego, Yt, and Auberger) and Doa and Csa. Independence confirms that subject AM is a heterozygote, which was suggested 8,9 by observations of dosage effects in serologic testing. (Redrawn from Yt was established in two British families. Finally, with data from references 2 and 4.) the currently accepted nomenclature (Table 1) was proposed in 1974 to reflect the surname of the index family in the serum as a typing reagent is underscored by the fact that it was required to demonstrate that the parent generation consists of Table 1. Alleles, encoded antigens, and ISBT terminology of the Scianna blood group a mating of two Sm/Bua heterozygotes system (parents PM Sr. and RM): the F1 generation Wild-type Variant consists of four Sm– homozygotes, one High- Low- a prevalence prevalence Sm/Bu heterozygote (individual AM), Antigen Trivial name Allele Genotype antigen Allele Genotype antigen a a and one Bu /Bu homozygote (individual 57Gly Sc1 Sca (Sm) SC*01 169g CS). Without it, the zygosities of AM Sc1 and CS could not be determined. This is 57Arg Sc2 Scb (Bua) SC*02 169a the only outbred family in the Sm/Bua Sc2 Frameshift: literature in which both parents are Sm/ Sc3 Sc null SC*03N.01† 307D2 null Bua heterozygotes. 332Stop: Sc3 Sc null 994c 332Arg SC*03N.02† 994t Concurrent with their suggestion null a that Sm and Bu were the result of a 60Pro 60Ala Sc4 Rd 178c SC*04 178g biallelic polymorphism, the Winnipeg Rh Rd– Rd+ Laboratory also reported an extensive 47Glu 47Lys Sc5 STAR 139g SC*05 139a study of a Mennonite population in whom STAR+ STAR– a 81Arg 81Gln the Bu antigen had a considerably higher Sc6 SCER 242g SC*06 242a SCER+ SCER– frequency of 5 in 348 samples than the 35Gly 35Ser Sc7 SCAN 103g SC*07 103a 1 in 1,000 prevalence observed in other SCAN+ SCAN– 4,5 Caucasian populations. Although they †Provisional name suggested by the International Society of Blood Transfusion (ISBT) Working tested 145 Caucasian families for Bua and Party on Red Cell Immunogenetics and Blood Group Terminology

42 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

discovery of anti-Sm, Scianna,10 such that Sm was renamed typically make a polyclonal mixture of antibodies directed Sc1 and Bua was renamed Sc2. at the common epitopes of that system.18 The next report of a null phenotype for SC was described The SC Gene Lies on Chromosome 1 in 1986, in another Pacific Islander.19 This patient was a The focus then shifted from definition of the system 4-year-old girl from Papua New Guinea with thalassemia to characterization of the locus responsible for the antigen major who had been transfused many times. Anti-Sc3 was at a chromosomal level. Much of this seminal work was demonstrated. Erythrocytes from the patient’s mother performed in the Winnipeg Rh Laboratory. So it is not were compatible, and both mother and daughter were surprising that their detailed investigations of the genetic found to have the Sc:–1,–2 phenotype. In this community, mapping of chromosome 1 contributed significantly to the Sc:–1,–2 phenotype was surprisingly common: A survey the progress on SC. Their unique access to informative of 29 family members and apparently unrelated villagers kindreds certainly hastened this process, and in a series revealed 6 others (2 of whom had no obvious relationship of reports from 1976 to 1978, linkage between RH and SC to the patient) who were also Sc:–1,–2. This very high was established, showing a logarithm of the odds ratio phenotype prevalence (20.6%) makes heterozygosity for (LOD score) of 5.34 at a recombination fraction, θ = 0.10 if a putative recessive Sc3 allele in the patient’s father quite paternally segregated,11 and the relative position of SC was likely (although his RBC phenotype is not reported in the determined12–14 and refined.15 short abstract), as well as explaining the homozygosity for the same allele observed in her mother. A Third Antigen in the System: Sc3 or Scianna Null Additional Sc:–1,–2 individuals have been reported Alleles (including a patient who experienced an apparent delayed The appearance of “minus-minus” phenotypes, i.e., hemolytic transfusion reaction), some of whom have also individuals whose RBCs tested negative for both Sc1 and the lacked several other high-prevalence antigens.18 Evidence antithetical Sc2 antigen (Sc:–1,–2), was first documented that each patient in their series produced antibodies with in 1973 and demonstrated the existence of apparent SC different specificities is discussed in Antibodies section. null alleles.16 However, the term Sc3 was not coined until 1980 when an antibody from an Sc:–1,–2 individual Radin: A “New” Low-Prevalence Antigen Is Linked to demonstrated no evidence of a separable anti-Sc1 or anti- Scianna (via RH) Sc2.17 The index patient examined in 1973 was a female When Radin was first described, in 1967,20 the surgical patient from the Likiep Atoll in the Marshall relationship between Radin and Scianna was not Islands, who had been transfused 7 months earlier without appreciated. Although the clinical significance of antibodies crossmatching difficulty. Her cells phenotyped as Sc:–1,– generated to antigens within the SC system in general 2 as did those from one cousin, but both women’s RBCs is controversial, the analysis of the antibodies that led to could still adsorb anti-Sc2. Despite four pregnancies with the discovery of the Radin antigen is based on its clinical an Sc:1,–2 husband, the proband’s cousin had a negative importance, with the initial description encompassing antibody screen. Because these RBCs reduced the titer of five cases of mild to moderate hemolytic disease of the anti-Sc2, but not anti-Sc1, they may have had some weak newborn, of which one required exchange transfusion and Sc2 expression, and a new antigen was not definitively one appeared in the first pregnancy.20 Additional cases characterized at that time. and confirmation of the low general frequency (1 in 205) However, in 1980, a 67-year-old man in New York being appeared shortly thereafter.21 treated with chemoradiotherapy for metastasis to the throat Once again, it was the unique analysis performed by of a carcinoma of unknown origin required a preoperative the Winnipeg Rh Laboratory that elucidated the putative transfusion, and demonstrated a positive antibody screen.17 connection between Radin and SC. Linkage analysis He had been transfused 4 years earlier without event. of eight propositi in ten nuclear families demonstrated Unlike the Likiepian Sc:–1,–2 erythrocytes, RBCs from this linkage between Rd and RH.22 Similar to the Sc1/Sc2 patient did not reduce the titer of either anti-Sc1 or anti- linkage analysis in the present dataset, the Winnipeg Sc2. When tested against the Likiepian Sc:–1,–2 cells, the analysis demonstrated heterochiasmy, with the paternal New York serum did not agglutinate the RBCs. No other LOD score exceeding 3 at a recombination fraction, θ = Sc:–1,–2 cells were found in a family study. No separable 0.10, whereas the corresponding maternal LOD neither anti-Sc1 was present in this patient’s serum, which is suggests nor refutes linkage (LOD = 0.41 at θ = 0.10 ). somewhat unusual because patients who completely lack all This finding was only sufficient to propose the connection known antigens for a blood group and have been transfused between SC and Rd, as heterozygotes at both of these (i.e.,

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 43 P.A.R. Brunker and W.A. Flegel

double recombinants) had not been found. Incorporation of is favored in some tissue types or physiologic conditions. the gene encoding the Rd antigen into the bigger picture of Both transcripts share the common ATG start codon in chromosome 1 mapping placed it so close to SC that it was exon 3; thus, there is no predicted difference in the protein proposed even at that time that the gene encoding Rd “is product of the two transcripts. They differ in both the either very closely linked to or identical with SC.”23 transcript initiation site and the DNA stretch of exon 2 that There were few additional reports on the SC blood group becomes part of the final transcript; consequently, there are system for more than 20 years until its molecular basis was two alternative exon 2s, named exon 2a and exon 2b. The finally resolved in 2003.1 Since then, molecular analysis longer transcript 1 comprises exon 1, exon 2b, and exons has identified the three additional alleles underpinning 3 through 12, whereas the shorter transcript 2 starts with the three antibodies described by Devine and coworkers in exon 2a and also includes exons 3 through 12 (Fig. 2). 1988.18 The Ensembl genome browser curators have delineated five transcripts in ERMAP,30,31 three of which are protein Molecular Basis coding and two of which generate a processed transcript only. Two of the Ensembl transcripts correspond to GenBank’s The ERMAP Expresses the SC Antigens transcripts 1 and 2; however, unique to the Ensembl The molecular basis of the SC blood group system was database is a 3,949-bp transcript (named ERMAP-002),31 identified in 2003 by merging the genetic mapping data which is reported as protein coding and generates a short with protein chemistry showing that the SC antigens were protein encoding 385 amino acids rather than the usual on a single glycoprotein of approximately 60 to 68 kDa 475. However, only the two transcripts that encode the that must be expressed by RBCs.24,25 The SC gene had been 475–amino acid protein are included in the Consensus mapped to chromosome 1, and based on its linkage to the Coding Sequence Project (CCDS; both with identification RH genes, the chromosomal location had been further number CCDS475), so the biological significance of the refined to 1p34 to 1p36. This led to the identification of a 3,949-bp transcript is unclear. strong candidate gene.1 In addition to explaining the Sc1/Sc2 biallelic The ERMAP is a 475-amino acid, type 1 single-pass single nucleotide polymorphism (SNP) at Gly57Arg, a membrane glycoprotein that is a member of the butyrophilin binucleotide GA deletion was identified at nt307 (now (BTN) family and is encoded by the ERMAP gene.26,27 It known as SC*03N.01, provisional name suggested by consists of a predicted signal sequence of 29 amino acids the ISBT Working Party on Red Cell Immunogenetics at the NH3 terminus, an extracellular immunoglobulin and Blood Group Terminology). This deletion causes a V domain (amino acids 50–126), a short transmembrane frameshift and premature stop codon, which explain the domain spanning amino acids 157 through 176, and an SC null phenotype.1 The Rd antigen (Sc4) was defined as intracellular carboxyl terminus encompassing a B30.2 the Pro60Ala variation, and two other variants in the domain from amino acids 238 through 395.1 presumed leader signal peptide (54C>T and 76C>T) were The nomenclature for the transcripts of ERMAP is described in the original study elucidating the molecular complicated and has been revised many times. At least basis by Wagner and colleagues1 (Table 2). two transcript variants have been described, which result from use of an alternative upstream promoter Understanding the Variants Discovered in the Post- and alternative splicing.28 The longer variant is 3,423 ERMAP Era bp and is designated as transcript 1, or as transcript b The knowledge of the gene responsible for the antigens by GenBank curators,29 as it was the second transcript of this blood group protein opened the floodgates through variant identified, and it includes an additional upstream which variant descriptions of unknown, unresolved sero- exon (GenBank NM_001017922.1). The shorter variant is logic cases promptly flow. This was clearly the case for SC, for designated as transcript 2 or as transcript a, is 3,369 bp, which three new variants were discovered within just a few excludes this upstream exon (GenBank NM_018538.3), years after the characterization of ERMAP as the SC gene. begins transcription 45 bp upstream from the start of exon Careful molecular follow-up of the three patients described 2, and was the first variant discovered; thus, early reports by Devine and coworkers18 in 1988 revealed three distinct describe this gene as consisting of 11 exons. However, the ERMAP/SC variants, demonstrating the importance of revised current nomenclature for this gene is based on the molecular testing in the resolution of serologic SC mysteries. presence of 12 exons spanning approximately 28 kb. The The success of these investigations depended not only on relative production of these two mRNAs is not known, nor the cooperation among an international collaborative, but has it been determined whether the use of either promoter also on the supportive participation of two patients and

44 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

Fig. 2 Transcripts, exon structure, and variants of erythroid membrane-associated protein (ERMAP). Codon numbers are indicated above amino acids involved in described variants. The immunoglobulin variable domain is underlined. Exon 4 is expanded to the nucleotide level in the gray box to show the locations of most ISBT-recognized Scianna polymorphisms. The wild-type reference sequence is under the corresponding amino acid and is the chromosome 1 reference sequence GenBank NC_000001.10. * = nucleotide deletion. a family who kindly released two autologous RBC units. demonstrated homozygosity at a new nonsynonymous It was appreciated in the initial case reports in 1988 that polymorphism at amino acid 47 (glutamic acid to lysine), the SC protein carried multiple high-prevalence antigens which is in the N-terminal domain.36 This variation is other than Sc1/2.18 Sera or eluates from these three Sc:1,–2 catalogued as rs56047316 in the SNP database (dbSNP), and patients who had developed high-prevalence antibodies did it results from the guanine–adenine transition at nucleotide not react with the Sc:–1,–2 null RBCs, but the samples were 139 in the complementary DNA (cDNA). Frequencies of this not mutually compatible. allele in population studies have not been reported, nor have additional cases of this antibody. Sc5 (STAR) In 1982, a 65-year-old man with a history of transfusion Sc6 (SCER) and Sc7 (SCAN) of three units of crossmatch-compatible whole blood The remaining two antibody cases described by Devine before presentation underwent routine preoperative blood and colleagues18 were concomitantly resolved using the bank testing, demonstrating anti-C and anti-e. He was same approach as for the Sc5 antigen.37 These investigators transfused with another three units of C–e– RBCs, and 1 sequenced all 11 exons of ERMAP known at the time, week later, a new anti-Jkb and an antibody against a high- which encompasses all cDNA. They also solicited others to prevalence antigen were detected. Because his serum submit suspected SC variants and the eight other orphan reacted with all cells except his own (phenotyped as Sc:1, low-prevalence antigens By, Toa, Pta, Rea, Jea, Lia, SARA, –2), those of a sibling, and Sc:–1,–2 RBCs, it was suspected and Ska. The proband for case 1 reported by Devine and that he had developed an antibody to another antigen on colleagues18 demonstrated homozygosity for a guanine– the SC protein.35 Blood needs for the patient were met with adenine transition at cDNA nucleotide 242, predicted to autologous units. Blood samples from the proband and 16 cause an amino acid change at position 81 (from arginine family members had been frozen. Sequencing of the exons to glutamine), which is in the immunoglobulin V loop.18 encoding the extracellular and transmembrane domains The case 2 proband demonstrated a new homozygous,

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 45 P.A.R. Brunker and W.A. Flegel

Table 2. Erythroid membrane–associated protein polymorphisms in the coding region and global population frequencies

Amino acid (aa) Sc name Descriptive name dbSNP ID: cDNA nt mRNA* Wild-type (WT) Variant Protein effect codon WT aa Variant aa Exon Protein domain Minor allele frequency in blood donors† rs35757049 11 281 c t nonsynonymous substitution 4 Ala Val 3 Leader 0.054 (dbSNP) rs33950227 54 324 c t silent 18 Leu Leu 3 Leader 0.28 (German1), 0.1 (dbSNP) 0.33 (German1), 0.25 (Caucasian North American32), 0.1 (dbSNP), rs33953680 76 346 c t nonsynonymous substitution 26 His Tyr 3 Leader 0.05 (African-American32)

Sc7 SCAN 103 373 g a nonsynonymous substitution 35 Gly Ser 4 NH3-terminus

Sc5 STAR rs56047316 139 409 g a nonsynonymous substitution 47 Glu Lys 4 NH3-terminus a 0.01 (Caucasian North American,33 Brazilian34), 0.008 (German1), Sc1 vs. Sc2 rs56025238 169 439 g (Sc1) nonsynonymous substitution 57 Gly Arg 4 IgV loop (Sc2) 0.005 (Hispanic American33), 0.002 (African-American33), 0 (Asian American33) 0.003 (Slavs33), 0.002 (Caucasian North American,33 Danish,21 German,1 Sc4 Rd rs56136737 178 448 c g nonsynonymous substitution 60 Pro Ala 4 IgV loop New York Jewish20) rs33954154 219 489 c t silent 73 Arg Arg 4 IgV loop 0.017 (dbSNP) Sc6 SCER 242 512 g a nonsynonymous substitution 81 Arg Gln 4 IgV loop

Sc null (D ga together) rs55695242 307 577 g del –1 frameshift 103 Asp frameshift 4 IgV loop Sc null (D ga together) rs56151267 308 578 a del –1 frameshift 103 Asp frameshift 4 IgV loop rs35147822 775 1045 t c nonsynonymous substitution 259 Cys Arg 12 B30.2 domain 0.022 (dbSNP) rs34441268 788 1058 g a nonsynonymous substitution 263 Gly Glu 12 B30.2 domain 0.011 ( dbSNP ) rs35972628 888 1158 g a silent 296 Glu Glu 12 B30.2 domain 0.011 ( dbSNP ) Sc null 994 1264 c t nonsense (STOP) 332 Arg STOP 12 B30.2 domain rs55773259 1227 1497 a g silent 409 Leu Leu 12 C-terminus rs55872827 1324 1594 t c nonsynonymous substitution 442 Ser Pro 12 C-terminus C-terminus at a 3’ dileucine (LL) rs56405033 1355 1625 t c nonsynonymous substitution 452 Leu Pro 12 phosphorylation motif C-terminus at a 3’ dileucine (LL) rs55677363 1356 1626 g t silent 452 Leu Leu 12 0.054 (dbSNP) phosphorylation motif

*NCBI Reference Sequence Position: NM_001017922.1 †Minor allele frequencies for some populations are determined by reports of serologic phenotype and assuming individuals positive for a rare antigen are heterozygotes. cDNA = complementary DNA; dbSNP = single nucleotide polymorphism database; IgV = immunoglobulin V; mRNA = messenger RNA; nt = nucleotide. nonsynonymous variant at cDNA nucleotide position 103 from a Saudi Arabian pedigree,1 which demonstrated (again a guanine–adenine transition), corresponding to homozygosity at three SNPs: the common 54C>T and a glycine to serine change at amino acid 35 in the NH3 76C>T (described in an earlier section) as well as a 2-bp terminus. This specimen also demonstrated two other SNPs deletion starting at cDNA nucleotide 307 (307Δga) that (at cDNA nucleotides 54C>T and 76C>T), which had been is predicted to cause a frameshift mutation and early previously reported, are common in Caucasian populations, termination codon after 113 amino acids. The nt54 and nt76 and are in tight linkage disequilibrium (LD).1 Because these SNPs were genotyped in an additional 111 European blood variants are both in the predicted leader sequence (and the donors and were found in tight LD. The frameshift would 54C>T is a silent mutation), they are not predicted to directly account for a complete lack of an intact ERMAP protein in impact on ERMAP structure. This report also excluded the the cell membrane. eight orphan low-prevalence antigens from the SC system Two Sc:–1,–2 individuals from northern and southern because the only variants found were in the leader sequence California were then sequenced in a follow-up study,37 and or in introns. both shared a new SC null allele formed by a nonsense mutation at codon 332. This is the first report of a variant Molecular Basis of SC Null Phenotypes in the B30.2 intracellular domain in a patient immunized Central to the set of specimens originally reported with to SC. It is not, however, the only variant in the B30.2 the discovery of ERMAP as SC was an Sc:–1,–2 sample domain (Table 2), because three others have been described

46 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

Table 2. Erythroid membrane–associated protein polymorphisms in the coding region and global population frequencies

Sc7 SCAN 103 373 g a nonsynonymous substitution 35 Gly Ser 4 NH3-terminus

in dbSNP, two of which are nonsynonymous amino acid critical tool in the investigation of human disease and basic changes (C259R and G263E) and one of which is silent sciences. Several collaborative projects in human genomics (E296E). This result suggests that an early translation focus on gathering, sharing, and interpreting human termination, even as late as at codon 332 of the expected genetic variation, and although a full cataloguing of these is 475, sufficiently interferes with correct protein trafficking, beyond the scope of this review, we will present variants in membrane insertion, or stability so as to render the ERMAP that are part of two such projects: dbSNP38 and the individual susceptible to alloimmunization at the Sc1/2 site International HapMap Project.39 Table 2 integrates some of (codon 57). these variants (identified by their rs numbers) with those described in the transfusion medicine literature. These Other Variants in ERMAP: Using dbSNP and HapMap data allow informative LD studies of ERMAP (Fig. 3). This Variants in the coding region, particularly those in the LD map shows two distinct LD blocks that correspond to extracellular domain of transmembrane proteins, are of the exons encoding the extracellular immunoglobulin-like particular clinical interest in transfusion medicine, as their domains and the intracellular B30.2 domains of ERMAP. location provides an obvious mechanism for putative clinical The importance of this pattern of LD is that it reveals a significance by alloimmunization. However, much variation possible evolutionary vestige of the modular nature of the in the human genome is found outside of coding regions, butyrophilin-like (BTNL) protein family and is even more and ERMAP is no exception. Studies of this variation are a pronounced in the Nigerian population. Long stretches of

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 47 P.A.R. Brunker and W.A. Flegel

Fig. 3 Pairwise linkage disequilibrium (LD) heat plot of the logarithmic odds ratio (LOD) score for single nucleotide polymorphisms in erythroid membrane–associated protein (ERMAP) in a Nigerian population. Darker shades (black) = areas of high LD, lighter shades (light gray) = areas of lower LD. The areas of tightest LD correspond to the extracellular domains of ERMAP, on the left-hand side of the figure. Increased LD is also seen in the intracellular domains, at the right side. This segmental pattern of LD reveals a possible evolutionary vestige of the modular nature of the butyrophilin-like protein family. YRI = Yoruba in Ibadan, Nigeria. (Source: Haploview™ software run at http:// hapmap.ncbi.nlm.nih.gov/cgi-perl/gbrowse/hapmap3r2_B36/#search; accessed April 27, 2010.)

LD such as that illustrated in the extracellular domain of calling platform, and additional population studies will ERMAP, where all of the SC antigens are encoded, raise the continue to be reported.33 possibility that a selective advantage by genetic hitchhiking may be operating at ERMAP. 40 Biochemistry and Physiology

Global Variation ERMAP Is a Member of the Butyrophilin-like Family of Some ethnographic trends have already been the Immunoglobulin Superfamily historically appreciated with SC variants during the early By virtue of its extracellular immunoglobulin V and years of their investigation (Table 2). For instance, Sc4 has the intracellular B30.2 domains, ERMAP is a member been identified most often in Ashkenazi Jews and Slavic of the BTNL protein family, which is a subset of the populations, and the few Sc:–1,–2 phenotypes have been immunoglobulin superfamily.41 The compact, globular reported particularly in populations from Oceania. Sc2 110–amino acid immunoglobulin domain defines this appears to be more common in a consanguineous Canadian superfamily and is found in three operational domain Mennonite population (derived from a small region in subclasses: variable (immunoglobulin V), intermediate Eastern Europe),5 but it remains very rare in or absent from (immunoglobulin I), or constant (immunoglobulin C).42,43 populations of African5,33 or Native American10 descent. These proteins are central to many immunologic processes, However, it is not sufficient to rely on case reports to especially cell adhesion, costimulation, and signalling.44,45 propose generalizations regarding population frequencies. The immunoglobulin superfamily is one of the largest in Fortunately, recent technologies are available to rapidly all eukaryotic organisms.46 Other members of this family genotype ERMAP variants using an automated genotype- well known to the transfusion medicine community

48 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

Fig. 4 The organization of the butyrophilin-like (BTNL) family in Fig.5 On the left, blood from a fish of the genusNotothenia (with comparison to the butyrophilin (BTN) and B7 families. The B7 hemoglobin-containing erythrocytes) and on the right is blood branch of the immunoglobulin superfamily is characterized by from Chaenocephalus aceratus. Icefish transport oxygen strictly in variable (IgV) and constant (IgC) immunoglobulin domains. The physical solution, without a carrier molecule. The recent discovery BTN subfamily includes the B30.2 intracellular domain. The BTNL that bloodthirsty (bty), a B30.2-domain–containing protein like proteins exhibit various combinations of these features. MOG = ERMAP, has dramatically decreased expression in hemoglobinless myelin oligodendrocyte glycoprotein, an autoantigen implicated in icefish provides a fascinating link between this protein domain and multiple sclerosis. (Modified from reference 52.) erythropoiesis. Courtesy of Professor Guillaume Lecointre. include the Lutheran, LW, OK, JMH, and Indian blood T-cell activation by inhibiting proliferation in response to groups, which are found on the B-CAM, ICAM4, CD147, the stimulatory T-cell receptor signal.55 This inability for CD108, and CD44 molecules, respectively.47 BTN proteins BTNL2 to propagate a cell signal has led some investigators are within the B7-CD28-like branch of this superfamily48 to propose its role as “decoy receptor” because it lacks the and have been extensively studied in cows.49 The prototype B30.2 intracellular domain present in most other BTN and of the human BTN family of proteins is BTN1A1, which is BTNL proteins.54 primarily expressed in the lactating breast, where it makes up 20 percent of the protein in the membrane of milk The B30.2 Cytoplasmic Domain: A Role in fat globules. The name derives from the Greek butyros Erythropoiesis? and philos, meaning “having an affinity for butterfat.” The B30.2 (or PRYSPRY) domain was described in 1993 Although ERMAP is carried on chromosome 1, the genes with the discovery of an exon in the MHC class I region for many members of this family are located in the major showing similarity to other mammalian and amphibian histocompatibility complex (MHC) on chromosome 6.50 proteins, which have since been termed the tripartite The lactational and immunologic functions of BTNs motif family.56,57 Such a domain was demonstrated in as a part of the secretory granule-to-plasma membrane bovine BTN58 and in human BTN proteins.59 The B30.2 zipper complex and as an inhibitor of T-cell activation are domain is proposed to be a recent evolutionary adaptation only recently described,51,52 and even less is known about in the immune system of mammals as a fusion of two the BTNL proteins. There are six known human BTNL ancient domains (PRY and SPRY), which are found in proteins, which are defined by their homology to BTN all eukaryotes.50 The genes for proteins in this family proteins (Fig. 4). The most extensively studied of these is have a modular structure, suggesting that they arose BTNL2, the gene for which is located in the MHC class II by duplication.56 Mutations in the B30.2 domain in the cluster at 6p21.3. A truncating splice site mutation in BTNL2 tripartite motif–branch of the B30.2 proteins have been has been associated with sarcoidosis,53 and although this associated with Opitz syndrome (MID1 protein) and SNP has been investigated in many other infectious and familial Mediterranean fever (pyrin protein). However, autoimmune diseases, some of these associations have human syndromes have not been associated with mutations been attributable to LD with the MHC.54 BTNL2 inhibits in the B30.2 domain of the BTN or BTNL families.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 49 P.A.R. Brunker and W.A. Flegel

The crystal structure of the B30.2 domain of pyrin was expressed-sequence tags using the ERMAP transcript 1 recently elucidated. A β-barrel consisting of two antiparallel (GenBank NM_001017922.1) as the probe detected the β-sheets has been described, forming a central cavity.60 The transcript in cDNA libraries from hematogenous tissues, ligand(s) that interact with the B30.2 domain have yet to be such as bone marrow, a chronic myeloid leukemia cell line, described, although binding analyses suggest that it is the peripheral blood pool, thymus, spleen, and fetal liver, as well site of protein–protein interactions.61 The crystal structure as in neural tissues.68 However, it is difficult to definitively of one other B30.2 domain interacting with a peptide has ascribe transcript production to the nonerythroid cells in shown that there is a conformationally rigid peptide binding the neural tissues, as contamination from the vasculature pocket (consisting of a core β-sandwich around variable cannot be completely eliminated. ERMAP mRNA reaches loops) binding to a short-sequence motif, which may allow peak levels in fetal liver in the 18th through 20th weeks, multiple intracellular targets to bind.62 Recently, BTN1A1 and it is present from the 15th through 32nd weeks in fetal has been shown to bind xanthine oxidoreductase via B30.2, bone marrow, suggesting that ERMAP may be related apparently stabilizing the milk fat globule membrane in to the migration of erythroid cells to these sites during mammary tissue, but it is also hypothesized to function hematopoietic development.69 as a novel signaling pathway in nonmammary tissues or Additional evidence that ERMAP may be involved in perhaps in the innate immune system via generation of erythroid differentiation has been put forward, although reactive oxygen species.63 only abstracts of these reports are available in the English A role for B30.2 domains in erythropoiesis has been literature. Using fluorescent quantitative polymerase revealed through study of an unlikely model organism: chain reaction,70 ERMAP expression has been found in Antarctic icefish. These animals are the only vertebrate the K562 cell line, which is derived from chronic myeloid taxon that fails to produce RBCs (Fig. 5), and as such leukemia and is of undifferentiated granulocytic lineage.71 have been studied in a hunt for genes important in To test the degree of erythroid-specificity of ERMAP erythropoiesis and cardiovascular biology.64 Using in hematopoiesis, this group used cytarabine (Ara-C) this approach, a new B30.2-containing protein, called to induce these cells toward erythroid differentiation bloodthirsty (bty), was identified in the pronephric kidney and 12-O-tetradecanoylphorbol-13-acetate to induce of a red-blooded Antarctic rockcod (Notothenia coriiceps), development toward the macrophage lineage, but found which was present at levels tenfold higher than those in an increase in ERMAP mRNA after an Ara-C stimulation an icefish Chaenocephalus ( aceratus).65 Interestingly, only.72 This finding suggests that although ERMAP may be disruption of bty synthesis in zebrafish suppressed both present on cells of the monocyte/macrophage lineage, its erythrocyte production and hemoglobin synthesis, and functional importance may be limited in these cell types. although interactions between bty and ERMAP have been RNA silencing experiments using an ERMAP shRNA/K562 hypothesized, they have not been empirically demonstrated cell line also reported by this group showed decreased (H. William Detrich, personal communication, January ERMAP expression and morphologic features, including 20, 2010). the relative amounts of surface erythrocyte maturation markers, leading the authors to conclude that ERMAP Functional Studies of ERMAP shRNA inhibited Ara-C–induced erythroid differentiation.73 The function of ERMAP itself, however, is not well A second model of erythroid differentiation using umbilical understood. The murine homolog, Ermap, was described cord blood with two naturally occurring hormones (namely first and named as such because it was found to be produced stem cell factor and IL-3) and erythropoietin to provoke exclusively in erythroid cells.66 The human homolog was differentiation also showed a concurrent rise in ERMAP characterized shortly thereafter, and Northern blots mRNA with erythrocyte maturation.74 demonstrated high expression in hematopoietic tissues, Many structural features of ERMAP point toward a such as fetal liver and bone marrow, with weaker expression putative role in immunity, perhaps by adhering to other in peripheral blood leukocytes, thymus, lymph node, cells or pathogens via its extracellular immunoglobulin V and spleen.26 Sc1 has been demonstrated on phagocytic domain, or by immunoregulatory mechanisms such as the leukocytes using an antibody absorption technique.67 modulation of cellular activation signals via B30.2 as is Recent RNA array expression analysis supports this observed in its BTN family members.52 Much work is needed finding, having detected low levels of ERMAP transcripts in this area to better characterize the proteins that interact in leukocytes, especially monocytes; however, quantitative with ERMAP, both extracellularly and intracellularly, protein expression remains to be assessed.54 An in silico and to determine whether ERMAP has a central role in analysis of nucleotide database searches of human erythropoiesis itself.

50 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

Antibodies in the System antibodies in conjunction with other antibodies and tease out their relative clinical importance, which may have been The discovery of the SC blood group system began previously underestimated. The ERMAP protein has been with and has relied on the detection and investigation of expressed in its native form in a eukaryotic system,87 and alloantibodies. The effects of enzymes and chemicals and so although the initial report describes the utility of this the in vitro characteristics of SC antibodies were recently reagent for detecting the high-prevalence SC antigens, a reported elsewhere.75 In general, SC antigens are resistant screening protein for low-prevalence antigens Sc2 and Sc4 to ficin plus papain, trypsin, α-chymotrypsin, sialidase, would also be feasible. and 50 mM dithiothreitol (DTT), and they are sensitive to Some SC alloantibodies (Table 3) resulted in delayed pronase and 200 mM DTT. The exception to this trend is the serologic transfusion reactions without associated variable sensitivity of Sc4 to trypsin and α-chymotrypsin. hemolysis, including a so-called naturally occurring anti- Enzymatic properties of anti-SCER and anti-SCAN are only Sc4 described in a 55-year-old man without a transfusion described in the initial case report as showing no change history. 21 Many of these patients were transfused with in the strength of antibody activity when tested with RBCs crossmatch-compatible blood without incident. However, that had been treated with ficin, papain, trypsin, ZZAP some surgeries were delayed owing to lack of availability (mixture of 0.1 M DTT plus 0.1% cysteine-activated papain), of crossmatch-compatible units, and other patients or chloroquine diphosphate.18 Anti-STAR demonstrated were transfused with autologous products in nonurgent enhanced reactivity with enzyme-treated RBCs.36 Patients scenarios.18 or donors in whom an antibody to an SC antigen has been The remaining reports of important reactions involving reported (Table 3) have been thoroughly reviewed recently.76 SC antibodies are in cases of autoimmune hemolytic Thirteen of the 19 reports of alloantibodies to SC system anemia. Auto-anti-Sc1 and -Sc3 have been eluted from antigens listed in Table 3 have occurred in cases in which direct antiglobulin test–positive RBCs of these patients. In they do not appear to manifest a major clinical significance. many cases, these antibodies were transient and associated All six of the reports with clinical significance occurred in with decreased expression of SC antigens.79,84 Several cases of HDFN. All six of the reported autoantibodies to SC patients underwent splenectomy in addition to treatment system antigens in patients were in the context of clinically with many types of immunosuppressant medications. One significant autoimmune hemolytic anemia, although five patient with erythroid hypoplasia and diagnosed with an of these cases were presented as an abstract only, without Evans-like syndrome even underwent a total of 20 plasma the full clinical details. Alleles Sc4–7 were not tested in exchanges over the course of 11 weeks.82 After the ninth any of these cases. Such an investigation is warranted exchange, the antibody was no longer detectable, although because heterozygosity for alleles with weak expression it reappeared 1 week later. He was finally transfused after 16 in the Rh blood group system has been associated with D exchanges, despite the continued presence of the antibody, autoantibodies.86 with a resultant rise in his hematocrit from 14% to 30%. Clinically important reactions to an erythrocyte antibody typically result from significant RBC destruction Clinical Significance and usually manifest in the patient as a hemolytic anemia or HDFN. In the SC system, significant HDFN defined the blood Is It Worth Phenotype or Genotype Matching? group in a patient named Ms. Scianna; however, she also Of the 23 cases of SC alloantibodies catalogued here had anti-D to account for her severe obstetric complications (Table 3), one case of HDFN83 and one delayed hemolytic in addition to the anti-Sc1.2 Anti-Sc2 has been reported in transfusion reaction (case 2)18 relate sufficient information a case of HDFN requiring simple transfusion in a 20-day- in their reports to convincingly attribute clinical relevance old infant.83 Importantly, the search for antibodies to low- to SC antibodies. The HDFN cases described in the initial prevalence antigens in this patient was only performed report of the Radin antigen also speak to the potential because the neonate and the mother were ABO-compatible: importance of antibodies to Sc4 (especially the case that had they been ABO-incompatible, the HDFN would likely required exchange transfusion); however, these cases are have been attributed to this, and the anti-Sc2 antibody may not reported in sufficient detail to definitively implicate not have been detected. anti-Sc4 to the exclusion of all other causes.20 Even the The recent availability of recombinant reagents to very dramatic presentation of Ms. Scianna’s antibody does assist in the detection of SC antibodies87 may bring this not incriminate anti-Sc1 as the cause of her poor obstetric ability into the wider immunohematology arena. This novel outcomes, as an anti-D of a higher titer was also found.2 technique will allow one to appraise the relevance of SC The fundamental question of when and whether antibodies

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 51 P.A.R. Brunker and W.A. Flegel

Table 3. Published reports of antibodies to antigens in the Scianna blood group system

Allo or Case Scianna Age Important Other Transfusion/pregnancy Antibody auto? Authors Year identifier phenotype (years) Sex Ethnicity reactions? antibodies history Clinical synopsis Other laboratory data anti-Sc1 Allo Schmidt et al.2 1962 Mrs. N.S. Sc:–1,2 25 F Caucasian HDFN anti-D Multiparous, after 1st baby with Impossible to distinguish role of anti-Sc1 in presence of anti-D. HDFN. Kaye et al.77 1990 Sc:–1,2 28 F Indian No HDFN Excluded all except G2, 1st was uncomplicated with Neonate with 3+ DAT, eluted anti-Sc1, but Hgb = 13.5 g/dL and no HDFN. Mother B, R1r; IgG3 subclass; steady rise in ADCC despite constant titer throughout pregnancy; 9 weeks postpartum ADCC E and Lu(a) negative Ab screen. infant B, rr; husband Sc:1,–2. increased ×4 and titer doubled (16 to 32). Auto Tregellas et al.78 1979 Sc:1, –2 49 Healthy blood donor. Antibody demonstrated in serum, not in plasma, suggesting autoantibody is only seen when it reacts with a coagulation factor; IgG3; very weak DAT (both IgG and C3b), weak anti-Sc1 eluted. McDowell et al.79 1986 Case 1 Sc:1,–2 Hemolytic anemia 3+ DAT and anti-Sc1 in IAT. Eluates by heat, ether, and glycine acid were nonreactive, but xylene eluate showed anti-Sc1. McDowell et al.79 1986 Case 2 Sc:1,–2 Hemolytic anemia 4 units RBC transfused earlier. Transient Sc antigen weakening: serum from initial presentation reacted 3+ with patient’s RBCs 2 years later. (1+, but 3+ 2 years later) Owen et al.80 1992 Sc:1,–2 10 months F West Indies Hemolytic anemia Sudden-onset jaundice, pallor, fever with hepatomegaly, Hgb = 4.1 g/dL. AIHA diagnosed, DAT+ (IgG and C3d), elevated unconjugated bilirubin, reduced haptoglobin, hemoglobinuria. DAT negative with treated with steroids and IVIG, transfusion, urgent splenectomy. Transfusion-dependent for follow-up. Serum and eluate demonstrated anti-Sc1. 4 weeks, then steroids stopped 7 months after splenectomy. Ramsey and 2010 Sc:1 20 F Caucasian Hemolytic anemia, 15 units RBC 3 years earlier Hodgkin disease in remission, presented with 3 weeks of fatigue, 2-day Hgb decrease (9.1 Ab screen 1–2+ in all cells (anti-Sc1 identified). DAT– (hospital), w+ (ref. lab; negative eluate). Posttransfusion Williams81 acute hemolysis during chemotherapy, previously to 5.7 g/dL). Gross hematuria and Tbili = 5.5 mg/dL during 3 units RBC transfusion. Hgb = 9.2 g/dL. Anti-Sc1 reacted w+ to patient’s cells. Genotyped SC1/SC1. Patient group O–. negative Ab screen. Auto vs. Allo Steane et al.82 1982 Case 2: pt 22 M Caucasian Not reported. Evans-like syndrome with anemia during a lung infection, 2 years of hospitalizations, Reported DAT+ , but “presence of an antibody in his plasma which reacted with all erythrocytes tested except his not resolved C.D. steroids, splenectomy, immune suppressants. Transfused safely after 16 plasma exchanges. own.” Antibody undetectable after the 9th exchange, but it reappeared, then disappeared after 4 more exchanges. anti-Sc2 Allo Anderson et al.3 1963 Mr. Char. Sc:1,–2 50 M Caucasian DSTR vs. DHTR 3 units RBC transfused 2 weeks Carcinoma of the stomach, pretransfusion antibody screen positive. Hemolysis could be the Whether the patient was hemolyzing and thus required the pretransfusion testing is not stated; therefore, we cannot earlier. reason for the 2nd blood request, but this is not stated. distinguish a DSTR from a DHTR as described in this paper. Seyfried et al.6 1966 Four donors Healthy donors iatrogenically immunized for anti-D production. DeMarco et al.83 1995 Sc:1,–2 29 F Caucasian HDFN Negative maternal G0, no transfusion history. Jaundice in infant (Tbili = 14.3 mg/dL) on DOL2, postphototherapy discharged Hct = 45%, Maternal serum 3+ against paternal RBCs (titer of 64) and Sc:–1,2 RBCs; Paternal RBCs Sc:1,2. Neonate cord blood Ab screen DOL20 Tbili = 6.5 mg/dL, Hct 17.3% with pallor, tachypnea, tachycardia; transfused 45 mL; DAT macroscopically + IgG; Neonate peripheral venous blood 2+; Readmission on DOL20 DAT 2+ (polyspec, IgG, and Hct 4 months later = 36.3% Mother B+; infant B-. C3); Eluate + on paternal and Sc:1,–2 RBCs. anti-Sc3 Allo McCreary et al.16 1973 Sc:–1,–2 F Likiep Atoll, Marshall Transfused 7 months earlier Preoperative testing. Antibody dropped to below detectable levels shortly after discovery. Islands without difficulty. Nason et al.17 1980 Sc:–1,–2 67 M Caucasian DSTR Transfused 4 years earlier Preoperative positive antibody screen for metastatic carcinoma surgery. Not transfused Negative DAT, did not adsorb anti-Sc1 or anti-Sc2. without incident. owing to deteriorating clinical condition and lack of compatible blood. Woodfield et al.19 1986 Sc:–1,–2 4 F Papua New Guinea Many transfusions. Thalassemic with new IgG Ab, mother used as only available donor (also Sc:–1,–2). Patient Antibody was undetectable after splenectomy and not stimulated by use of XM-compatible blood. underwent splenectomy. Auto Peloquin et al.84 1989 Case 1 weak Sc1 and 64 Hemolytic anemia Lymphoma patient with severe anemia; 5 units incompatible RBCs transfused without DAT weak with IgG and C3d, eluates negative. Antibody disappeared within 70 days. Sc3 difficulty. Peloquin et al.84 1989 Case 2 weak Sc1 and 54 Hemolytic anemia 4 units RBCs transfused earlier. Hodgkin disease, CHF, moderate anemia; 6 units incompatible blood transfused without DAT 3+ with C3d, negative with IgG, eluate negative. Serum antibody weaker after transfusion; additional follow-up Sc3 difficulty. not possible. anti-Sc4 Allo Rausen et al.20 1967 Family 1 –Rd Sc:–4 (Rd+) F Russian Jewish HDFN “Newborn with hemolytic 2 children Rd+, both had HDFN; 1 child Rd–, did not have HDFN. Presumably very mild HDFN, as case detected by “routine anti-globulin testing of cord blood.” (anti-Rd) disease” in 1st and 3rd children. Rausen et al.20 1967 Family 2 –Fl Sc:–4 (Rd+) F African American HDFN severe “Newborn with hemolytic 10 children in pedigree: 5 Rd– with no HDFN; 1st 3 Rd+ without HDFN, last 2 Rd+ with disease” in 7th and 9th children. HDFN (1st of these requiring exchange transfusion). Rausen et al.20 1967 Family 3 –Ha Sc:–4 (Rd+) F Northern European HDFN “Newborn with hemolytic 4 children in family: 1 Rd– with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN. In the same pedigree, Rd– grandmother of HDN proband had 2 children, 1st Rd+ and 2nd Rd–, neither had HDFN. disease” in 4th child. Rausen et al.20 1967 Family 4 –We Sc:–4 (Rd+) F Native American HDFN 4 children in family: 1 Rd– with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN. Rausen et al.20 1967 Family –5 Gr Sc:–4 (Rd+) F German Jewish or HDFN 5 children in family: 3 Rd– with no HDFN; 1 stillborn (3rd in birth order) followed by 1 Rd+ No description of pathology of the stillborn fetus. Scotch-Irish with HDFN. Lundsgaard and 1968 Mrs. J.P. Sc:–4 (Rd+) 47 F DSTR: No clinical Had a 9-year-old child. Moderately strong DAT (polyspecific and IgG-eluate showed anti-Rd), weakened with time. Patient is O+; 2 weeks after transfusion, strongly reactive antibody screen at new hospital. Her child’s RBCs do not Jensen21 evidence of 2 units blood transfused during Negative Ab screen preoperatively. react with patient’s posttransfusion plasma. hemolysis gynecologic operation. Lundsgaard and 1968 Mr. L.C. Sc:–4 (Rd+) 55 M Never transfused or hospitalized. Preoperative positive antibody screen for atoxic goiter surgery. Considered as a “naturally Jensen21 occurring antibody.” Winn et al.85 1976 19 M Caucasian DSTR: No clinical anti-Vw Negative DAT, negative Ab screen 11 units RBC on 3 dates for gunshot wound surgery (7/5, 7/17, and 8/5). 1 unit found anti-Vw accounts for incompatible RT crossmatch. evidence of before transfusion. incompatible on crossmatch (RT, 37°C, and AHG) but screening RBCs still negative. hemolysis anti-Sc5 Allo Devine et al.18 1988 Case 3 Sc:1,–2 65 M Irish and English DSTR anti-C 3 units RBC 3 years earlier. 1 week after transfusion of 3 units RBC, Ab screen showed new anti-Jkb and a high- Serum reacted with all cells except Sc:–1,–2, autologous, and the patient’s sibling (phenotype Sc:1,–2). Identity of (anti-STAR) and Skradski anti-e frequency antigen. DAT–, patient eventually diagnosed with lymphoma and transfused with antigen discovered with molecular testing years afterward. et al.35 anti-Jkb autologous units. anti-Sc6 Allo Devine et al.18 1988 Case 1 Sc:1,–2 76 M German DSTR 3 units RBC 12 years earlier; 3 Preoperative positive Ab screen for revision of right total hip arthroplasty, procedure Identity of antigen discovered with molecular testing years afterward. (anti-SCER) units RBC 6 years earlier. delayed until autologous units could be collected. anti-Sc7 Allo Devine et al.18 1988 Case 2 Sc:1,–2 50 M German, English, and DHTR anti-D 3 units RBC 8 years earlier; 12 days after transfusion of 2 units RBC after orthopedic surgery, patient had decrease in Eluate reacted with all cells except Sc:–1,–2. Antibody no longer detected within 9 months. Identity of antigen (anti-SCAN) Native American 2 units RBC 3 years earlier. hematocrit, pretransfusion Ab screen positive, weakly DAT+ (IgG and C3). discovered with molecular testing years afterward. Ab = antibody; ADCC = antibody-dependent cell-mediated cytotoxicity; AHG = antihuman globulin; AIHA = autoimmune hemolytic anemia; CHF = congestive heart failure; DAT = direct antiglobulin test; DHTR = delayed hemolytic transfusion reaction; DOL = day of life; DSTR = delayed serologic transfusion reaction;

52 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a Review

Table 3. Published reports of antibodies to antigens in the Scianna blood group system

Allo or Case Scianna Age Important Other Transfusion/pregnancy Antibody auto? Authors Year identifier phenotype (years) Sex Ethnicity reactions? antibodies history Clinical synopsis Other laboratory data anti-Sc1 Allo Schmidt et al.2 1962 Mrs. N.S. Sc:–1,2 25 F Caucasian HDFN anti-D Multiparous, after 1st baby with Impossible to distinguish role of anti-Sc1 in presence of anti-D. HDFN. Kaye et al.77 1990 Sc:–1,2 28 F Indian No HDFN Excluded all except G2, 1st was uncomplicated with Neonate with 3+ DAT, eluted anti-Sc1, but Hgb = 13.5 g/dL and no HDFN. Mother B, R1r; IgG3 subclass; steady rise in ADCC despite constant titer throughout pregnancy; 9 weeks postpartum ADCC E and Lu(a) negative Ab screen. infant B, rr; husband Sc:1,–2. increased ×4 and titer doubled (16 to 32). Auto Tregellas et al.78 1979 Sc:1, –2 49 Healthy blood donor. Antibody demonstrated in serum, not in plasma, suggesting autoantibody is only seen when it reacts with a coagulation factor; IgG3; very weak DAT (both IgG and C3b), weak anti-Sc1 eluted. McDowell et al.79 1986 Case 1 Sc:1,–2 Hemolytic anemia 3+ DAT and anti-Sc1 in IAT. Eluates by heat, ether, and glycine acid were nonreactive, but xylene eluate showed anti-Sc1. McDowell et al.79 1986 Case 2 Sc:1,–2 Hemolytic anemia 4 units RBC transfused earlier. Transient Sc antigen weakening: serum from initial presentation reacted 3+ with patient’s RBCs 2 years later. (1+, but 3+ 2 years later) Owen et al.80 1992 Sc:1,–2 10 months F West Indies Hemolytic anemia Sudden-onset jaundice, pallor, fever with hepatomegaly, Hgb = 4.1 g/dL. AIHA diagnosed, DAT+ (IgG and C3d), elevated unconjugated bilirubin, reduced haptoglobin, hemoglobinuria. DAT negative with treated with steroids and IVIG, transfusion, urgent splenectomy. Transfusion-dependent for follow-up. Serum and eluate demonstrated anti-Sc1. 4 weeks, then steroids stopped 7 months after splenectomy. Ramsey and 2010 Sc:1 20 F Caucasian Hemolytic anemia, 15 units RBC 3 years earlier Hodgkin disease in remission, presented with 3 weeks of fatigue, 2-day Hgb decrease (9.1 Ab screen 1–2+ in all cells (anti-Sc1 identified). DAT– (hospital), w+ (ref. lab; negative eluate). Posttransfusion Williams81 acute hemolysis during chemotherapy, previously to 5.7 g/dL). Gross hematuria and Tbili = 5.5 mg/dL during 3 units RBC transfusion. Hgb = 9.2 g/dL. Anti-Sc1 reacted w+ to patient’s cells. Genotyped SC1/SC1. Patient group O–. negative Ab screen. Auto vs. Allo Steane et al.82 1982 Case 2: pt 22 M Caucasian Not reported. Evans-like syndrome with anemia during a lung infection, 2 years of hospitalizations, Reported DAT+ , but “presence of an antibody in his plasma which reacted with all erythrocytes tested except his not resolved C.D. steroids, splenectomy, immune suppressants. Transfused safely after 16 plasma exchanges. own.” Antibody undetectable after the 9th exchange, but it reappeared, then disappeared after 4 more exchanges. anti-Sc2 Allo Anderson et al.3 1963 Mr. Char. Sc:1,–2 50 M Caucasian DSTR vs. DHTR 3 units RBC transfused 2 weeks Carcinoma of the stomach, pretransfusion antibody screen positive. Hemolysis could be the Whether the patient was hemolyzing and thus required the pretransfusion testing is not stated; therefore, we cannot earlier. reason for the 2nd blood request, but this is not stated. distinguish a DSTR from a DHTR as described in this paper. Seyfried et al.6 1966 Four donors Healthy donors iatrogenically immunized for anti-D production. DeMarco et al.83 1995 Sc:1,–2 29 F Caucasian HDFN Negative maternal G0, no transfusion history. Jaundice in infant (Tbili = 14.3 mg/dL) on DOL2, postphototherapy discharged Hct = 45%, Maternal serum 3+ against paternal RBCs (titer of 64) and Sc:–1,2 RBCs; Paternal RBCs Sc:1,2. Neonate cord blood Ab screen DOL20 Tbili = 6.5 mg/dL, Hct 17.3% with pallor, tachypnea, tachycardia; transfused 45 mL; DAT macroscopically + IgG; Neonate peripheral venous blood 2+; Readmission on DOL20 DAT 2+ (polyspec, IgG, and Hct 4 months later = 36.3% Mother B+; infant B-. C3); Eluate + on paternal and Sc:1,–2 RBCs. anti-Sc3 Allo McCreary et al.16 1973 Sc:–1,–2 F Likiep Atoll, Marshall Transfused 7 months earlier Preoperative testing. Antibody dropped to below detectable levels shortly after discovery. Islands without difficulty. Nason et al.17 1980 Sc:–1,–2 67 M Caucasian DSTR Transfused 4 years earlier Preoperative positive antibody screen for metastatic carcinoma surgery. Not transfused Negative DAT, did not adsorb anti-Sc1 or anti-Sc2. without incident. owing to deteriorating clinical condition and lack of compatible blood. Woodfield et al.19 1986 Sc:–1,–2 4 F Papua New Guinea Many transfusions. Thalassemic with new IgG Ab, mother used as only available donor (also Sc:–1,–2). Patient Antibody was undetectable after splenectomy and not stimulated by use of XM-compatible blood. underwent splenectomy. Auto Peloquin et al.84 1989 Case 1 weak Sc1 and 64 Hemolytic anemia Lymphoma patient with severe anemia; 5 units incompatible RBCs transfused without DAT weak with IgG and C3d, eluates negative. Antibody disappeared within 70 days. Sc3 difficulty. Peloquin et al.84 1989 Case 2 weak Sc1 and 54 Hemolytic anemia 4 units RBCs transfused earlier. Hodgkin disease, CHF, moderate anemia; 6 units incompatible blood transfused without DAT 3+ with C3d, negative with IgG, eluate negative. Serum antibody weaker after transfusion; additional follow-up Sc3 difficulty. not possible. anti-Sc4 Allo Rausen et al.20 1967 Family 1 –Rd Sc:–4 (Rd+) F Russian Jewish HDFN “Newborn with hemolytic 2 children Rd+, both had HDFN; 1 child Rd–, did not have HDFN. Presumably very mild HDFN, as case detected by “routine anti-globulin testing of cord blood.” (anti-Rd) disease” in 1st and 3rd children. Rausen et al.20 1967 Family 2 –Fl Sc:–4 (Rd+) F African American HDFN severe “Newborn with hemolytic 10 children in pedigree: 5 Rd– with no HDFN; 1st 3 Rd+ without HDFN, last 2 Rd+ with disease” in 7th and 9th children. HDFN (1st of these requiring exchange transfusion). Rausen et al.20 1967 Family 3 –Ha Sc:–4 (Rd+) F Northern European HDFN “Newborn with hemolytic 4 children in family: 1 Rd– with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN. In the same pedigree, Rd– grandmother of HDN proband had 2 children, 1st Rd+ and 2nd Rd–, neither had HDFN. disease” in 4th child. Rausen et al.20 1967 Family 4 –We Sc:–4 (Rd+) F Native American HDFN 4 children in family: 1 Rd– with no HDFN; 1st 2 Rd+ without HDFN, last 1 Rd+ with HDFN. Rausen et al.20 1967 Family –5 Gr Sc:–4 (Rd+) F German Jewish or HDFN 5 children in family: 3 Rd– with no HDFN; 1 stillborn (3rd in birth order) followed by 1 Rd+ No description of pathology of the stillborn fetus. Scotch-Irish with HDFN. Lundsgaard and 1968 Mrs. J.P. Sc:–4 (Rd+) 47 F DSTR: No clinical Had a 9-year-old child. Moderately strong DAT (polyspecific and IgG-eluate showed anti-Rd), weakened with time. Patient is O+; 2 weeks after transfusion, strongly reactive antibody screen at new hospital. Her child’s RBCs do not Jensen21 evidence of 2 units blood transfused during Negative Ab screen preoperatively. react with patient’s posttransfusion plasma. hemolysis gynecologic operation. Lundsgaard and 1968 Mr. L.C. Sc:–4 (Rd+) 55 M Never transfused or hospitalized. Preoperative positive antibody screen for atoxic goiter surgery. Considered as a “naturally Jensen21 occurring antibody.” Winn et al.85 1976 19 M Caucasian DSTR: No clinical anti-Vw Negative DAT, negative Ab screen 11 units RBC on 3 dates for gunshot wound surgery (7/5, 7/17, and 8/5). 1 unit found anti-Vw accounts for incompatible RT crossmatch. evidence of before transfusion. incompatible on crossmatch (RT, 37°C, and AHG) but screening RBCs still negative. hemolysis anti-Sc5 Allo Devine et al.18 1988 Case 3 Sc:1,–2 65 M Irish and English DSTR anti-C 3 units RBC 3 years earlier. 1 week after transfusion of 3 units RBC, Ab screen showed new anti-Jkb and a high- Serum reacted with all cells except Sc:–1,–2, autologous, and the patient’s sibling (phenotype Sc:1,–2). Identity of (anti-STAR) and Skradski anti-e frequency antigen. DAT–, patient eventually diagnosed with lymphoma and transfused with antigen discovered with molecular testing years afterward. et al.35 anti-Jkb autologous units. anti-Sc6 Allo Devine et al.18 1988 Case 1 Sc:1,–2 76 M German DSTR 3 units RBC 12 years earlier; 3 Preoperative positive Ab screen for revision of right total hip arthroplasty, procedure Identity of antigen discovered with molecular testing years afterward. (anti-SCER) units RBC 6 years earlier. delayed until autologous units could be collected. anti-Sc7 Allo Devine et al.18 1988 Case 2 Sc:1,–2 50 M German, English, and DHTR anti-D 3 units RBC 8 years earlier; 12 days after transfusion of 2 units RBC after orthopedic surgery, patient had decrease in Eluate reacted with all cells except Sc:–1,–2. Antibody no longer detected within 9 months. Identity of antigen (anti-SCAN) Native American 2 units RBC 3 years earlier. hematocrit, pretransfusion Ab screen positive, weakly DAT+ (IgG and C3). discovered with molecular testing years afterward. Hct = hematocrit; HDFN = hemolytic disease of the fetus and newborn; Hgb = hemoglobin; IAT = indirect antiglobulin test; IgG = immunoglobulin G; IVIG = intravenous immunoglobulin; RBCs = red blood cells; RT = room temperature; Tbili = total bilirubin; XM = crossmatch.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 53 P.A.R. Brunker and W.A. Flegel

to SC system antigens are of clinical importance remains diagnosis to routine high-throughput donor testing.90,91 unresolved because these antibodies are not routinely Although the rate of implementation of these technologies characterized, especially if they are detected along with varies among nations92 and local transfusion services,93 it is other, better-understood alloantibodies that can account expanding.94 The transfusion community should move these for a clinical presentation. procedures from potentially inaccessible research laboratories to standard clinical practice.95 For optimal performance of On the Detection of SC System Antibodies in Routine such an approach toward personalized medicine, ideally all Pretransfusion Testing donors and all recipients should be evaluated at a molecular The most important obstacle to understanding the level. Economic barriers to this strategy are falling as high- clinical consequences of transfusing across SC antigens is throughput and multiplexed assays are achieved, because that serologic reagents to simply define these antigens in the incremental cost of adding a handful of additional SNPs both patients and test RBCs have not been widely available. when designing a DNA microarray is negligible. Consequently, As they do for the Dombrock blood group system,88 molecular testing strategies are shifting from decisions about molecular approaches help resolve these situations. It which variants to include in a genotyping system that force the has been estimated that approximately 13 percent of the prioritization of well-studied variants already known to have transfused population are immunologic responders capable medical importance, to finding effective platforms to analyze of creating alloantibodies,89 but unless RBC reagents with data derived from genotyping as many known variants as SC antigens are included in the routine laboratory workup, possible, regardless of their allele frequencies or uncertain these antibodies may go unnoticed. It is also problematic clinical effects. if an antibody to one of the high-prevalence SC antigens is The most compelling reason to genotype SC variants in in fact detected because the mere presence of the antibody greater depth, both by increasing the number of donors and does not necessarily correspond to clinical importance. patients and also by including more variants regardless of Such a qualitative assay is insufficient. The quantitative their prevalence, is that such data are necessary to clarify characterization of the antibody, such as by titer, has the presently ambiguous role of SC in clinical transfusion only been performed in a few SC antibody cases, and we practice. At the same time, valuable data for research into recommend that this parameter be more routinely evaluated ERMAP biology are accrued without added costs. Inclusion in cases of possible hemolysis caused by antibodies in the SC of the SC*01 to SC*07 alleles in high-throughput assays system and in most other blood group systems. Especially would be a move in the right direction, and in cases of because HDFN has been reported, establishing a better unresolved serology, a referral to the molecular laboratory understanding of antibody potency as detected by the titer for an in-depth investigation may be desirable. By using would help inform practice guidelines. a high-throughput genetic test to determine the potential An economic and rational approach would be for alloimmunization by a variant homozygote, we can the routine use of recombinant SC protein during collect such genetic data almost for free. The pursuit of pretransfusion testing before titration to effectively screen alloantibodies in such variant homozygous patients is only for antibodies present above a threshold titer.87 In a feasible strategy to achieve complete resolution of all this way, nuisance antibodies (akin to the low-titer cold alloantibodies in a posttransfusion sample submitted as a autoantibodies detected before routine testing at higher transfusion reaction investigation. Consequently, knowing temperatures) would fall under the radar as desired and these genetic data gives us the opportunity to better define precious laboratory resources would not be spent working which antibodies are of clinical importance. up these most likely incidental findings. Only higher titer antibodies would be detected, focusing the laboratory Conclusion investigation on cases more likely to be of consequence to the patient. If these laboratory techniques do lead to the The SC story is an excellent example of the essential increased identification of SC system alloantibodies, the roles that classical genetics played in the original physical medical importance of respecting them in a particular mapping of a blood group system and is an exceptional patient’s transfusion recommendation remains debatable. illustration of transfusion laboratories that were in the right place at the right time to finally identify the responsible Should We Genotype for SC Alleles? locus in the era of whole genome analysis. Parsing out the The integration of molecular diagnostics with trans- meaning of global polymorphism frequency distributions fusion medicine has been a slow, but steady, process, with in light of founder effects or selection pressures would be applications ranging from individual patient prenatal a useful adjunct to in vitro studies of transcript utilization

54 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

14. Lewis M, Kaita H, Giblett ER, Anderson JE. Data on and protein expression and function. The continued chromosome 1 loci Fy, PGM1, Sc, UMPK, Rh, PGD, and study of ERMAP homologues, such as the BTNL family of ENO1: two-point lods, R:NR counts, multipoint information, proteins in general, and their physiologic interactions in and map. Cytogenet Cell Genet 1978;22:392–5. other species, such as the B30.2-containing bloodthirsty 15. Noades JE, Corney G, Cook PJ, et al. The Scianna blood gene in Antarctic icefishes, is a promising avenue to explore group lies distal to uridine monophosphate kinase on fundamental insights into erythropoiesis. Investigators chromosome 1p. Ann Hum Genet 1979;43:121–32. in transfusion medicine are uniquely poised not only to 16. McCreary J, Vogler AL, Sabo B, Eckstein EG, Smith TR. Another minus-minus phenotype: Bu(a-)Sm-, two examples carry out this work but also to lead the way toward a more in one family [abstract]. Transfusion 1973;13:350. comprehensive understanding of the “lucky 13th” blood 17. Nason SG, Vengelen-Tyler V, Cohen N, Best M, Quirk J. A group, SC, making us the lucky ones indeed. high incidence antibody (anti-Sc3) in the serum of a Sc:-1,-2 patient. Transfusion 1980;20:531–5. Acknowledgment 18. Devine P, Dawson FE, Motschman TL, et al. Serologic evidence that Scianna null (Sc:-1,-2) red cells lack multiple We gratefully acknowledge Professor Guillaume high-frequency antigens. Transfusion 1988;28:346–9. Lecointre for kindly providing the photograph of blood 19. Woodfield DG, Giles C, Poole J, Oraka R, Tolanu T. A further null phenotype (Sc-1-2) in Papua New Guinea [Abstract]. from the Antarctic icefish (Fig. 5). 21st Congress of the Int Soc Haem and 19th Congress of the ISBT, Sydney, Australia, May 1986; 651. References 20. Rausen AR, Rosenfield RE, Alter AA, et al. A “new” infrequent red cell antigen, Rd (radin). Transfusion 1967;7:336–42. 1. Wagner FF, Poole J, Flegel WA. Scianna antigens including Rd are expressed by ERMAP. Blood 2003;101:752–7. 21. Lundsgaard A, Jensen KG. Two new examples of anti-Rd. A preliminary report on the frequency of the Rd (Radin) 2. Schmidt RP, Griffitts JJ, Northman FF. A new antibody, antigen in the Danish population. Vox Sang 1968;14:452–7. anti-Sm, reacting with a high incidence antigen. Transfusion 1962;2:338–40. 22. Lewis M, Kaita H. Genetic linkage between the Radin and Rh blood group loci. Vox Sang 1979;37:286–9. 3. Anderson C, Hunter J, Zipursky A, Lewis M, Chown B. An antibody defining a new blood group antigen, Bu-a. 23. Lewis M, Kaita H, Philipps S, et al. The position of the Radin Transfusion 1963;3:30–3. blood group locus in relation to other chromosome l loci. 4. Lewis M, Chown B, Schmidt RP, Griffitts JJ. A possible Ann Hum Genet 1980;44(Pt 2):179–84. relationship between the blood group antigens Sm and 24. Spring FA, Herron R, Rowe G. An erythrocyte glycoprotein Bu-a. Am J Hum Genet 1964;16:254–5. of apparent Mr 60,000 expresses the Sc1 and Sc2 antigens. 5. Lewis M, Chown B, Kaita H, Philipps S. Further Vox Sang 1990;58:122–5. observations on the blood group antigen Bu-a. Am J Hum 25. Spring FA. Characterization of blood-group-active Genet 1964;16:256–60. erythrocyte membrane glycoproteins with human antiseras. 6. Seyfried H, Frankowska K, Giles CM. Further examples Transfus Med 1993;3:167–78. of anti-bu-a found in immunized donors. Vox Sang 1966; 26. Su YY, Gordon CT, Ye TZ, Perkins AC, Chui DH. Human 11:512–16. ERMAP: an erythroid adhesion/receptor transmembrane 7. Lewis M, Chown B, Kaita H. On the blood group antigens protein. Blood Cells Mol Dis 2001;27:938–49. Bua and Sm. Transfusion 1967;7:92–4. 27. Xu H, Foltz L, Sha Y, et al. Cloning and characterization of 8. Giles CM, Bevan B, Hughes RM. A family showing human erythroid membrane-associated protein, human independent segregation of Bua and Ytb. Vox Sang 1970; ERMAP. Genomics 2001;76:2–4. 18:265–6. 28. Ensembl entry for ERMAP, number ENSG00000164010 9. Rowe GP. A second family showing independent segregation 2010. http://www.ensembl.org/Homo_sapiens/Location/ of Sc 2(Bua) and Ytb. Vox Sang 1986;50:191. View?db=core;r=1:43276635-43326634. Accessed July 14, 10. Lewis M, Kaita H, Chown B. Scianna blood group system. 2010. Vox Sang 1974;27:261–4. 29. Entrez Gene entry for ERMAP. http://www.ncbi.nlm.nih. 11. Lewis M, Kaita H, Chown B. Genetic linkage between the gov/gene/114625. Accessed July 14, 2010. human blood group loci Rh and Sc (Scianna). Am J Hum 30. Havana entry for ERMAP, transcript numbers Genet 1976;28:619–20. OTTHUMT00000020180 through OTTHUMT 12. Lewis M, Kaita H, Côté GB, Chown B, Giblett ER, Anderson 00000020184 2010. http://vega.sanger.ac.uk/Homo_ JA. Chromosome 1: lods on linkage among eight loci: Do, sapiens/Gene/Summary?g=OTTHUMG00000007619. ENO1, Fy, PGM1, Rh, UMPK, Sc, and PGD. Birth Defects Accessed July 14, 2010. Orig Artic Ser 1976;12:322–5. 31. Ensembl Transcript View, ERMAP’s 5 listed transcripts 13. Lewis M, Kaita H, Chown B. Relative positions of 2010. http://www.ensembl.org/Homo_sapiens/Gene/Su chromosome 1 loci Fy, PGM1, Sc, UMPK, Rh, PGD and mmary?db=core;g=ENSG00000164010;r=1:43276635- ENO1 in man. Can J Genet Cytol 1977;19:695–709. 43326634;t=ENST00000470938. Accessed July 14, 2010.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 55 P.A.R. Brunker and W.A. Flegel

32. Fuchisawa A, Lomas-Francis C, Hue-Roye K, Reid ME. The 50. Rhodes DA, Stammers M, Malcherek G, Beck S, Trowsdale polymorphism nt 76 in exon 2 of SC is more frequent in J. The cluster of BTN genes in the extended major whites than in blacks. Immunohematology 2009;25:18–19. histocompatibility complex. Genomics 2001;71:351–62. 33. Hashmi G, Shariff T, Zhang Y, et al. Determination of 24 51. Robenek H, Hofnagel O, Buers I, et al. Butyrophilin minor red blood cell antigens for more than 2000 blood controls milk fat globule secretion. Proc Natl Acad Sci U S A donors by high-throughput DNA analysis [published 2006;103:10385–90. correction appears in Transfusion 2007;47:952]. 52. Smith IA, Knezevic BR, Ammann JU, et al. BTN1A1, the Transfusion 2007;47:736–47. mammary gland butyrophilin, and BTN2A2 are both 34. Ribeiro KR, Guarnieri MH, da Costa DC, Costa FF, inhibitors of T cell activation. J Immunol 2010;184: Pellegrino J Jr, Castilho L. DNA array analysis for red 3514–25. blood cell antigens facilitates the transfusion support with 53. Valentonyte R, Hampe J, Huse K, et al. Sarcoidosis is antigen-matched blood in patients with sickle cell disease. associated with a truncating splice site mutation in BTNL2 Vox Sang 2009;97:147–52. [published correction appears in Nat Genet 2005;37:652]. 35. Skradski KJ, McCreary J, Sabo B, Polesky HF. An antibody Nat Genet 2005;37:357–64. against a high frequency antigen absent on red cells of 54. Arnett HA, Escobar SS, Viney JL. Regulation of the Scianna:-2,-2 phenotype [abstract]. Transfusion 1982 costimulation in the era of butyrophilins. Cytokine 2009; (22):406. 46:370–5. 36. Hue-Roye K, Chaudhuri A, Velliquette RW, et al. STAR: a 55. Nguyen T, Liu XK, Zhang Y, Dong C. BTNL2, a butyrophilin- novel high-prevalence antigen in the Scianna blood group like molecule that functions to inhibit T cell activation. J system. Transfusion 2005;45:245–7. Immunol 2006;176:7354–60. 37. Flegel WA, Chen Q, Reid ME, et al. SCER and SCAN: two 56. Meyer M, Gaudieri S, Rhodes DA, Trowsdale J. Cluster of novel high-prevalence antigens in the Scianna blood group TRIM genes in the human MHC class I region sharing the system. Transfusion 2005;45:1940–4. B30.2 domain. Tissue Antigens 2003;61:63–71. 57. Vernet C, Boretto J, Mattei MG, et al. Evolutionary study of 38. Smigielski EM, Sirotkin K, Ward M, Sherry ST. dbSNP: a multigenic families mapping close to the human MHC class database of single nucleotide polymorphisms. Nucleic Acids I region. J Mol Evol 1993;37:600–12. Res 2000;28:352–5. 58. Jack LJ, Mather IH. Cloning and analysis of cDNA encoding 39. The International HapMap Project Homepage 2010. http:// bovine butyrophilin, an apical glycoprotein expressed in hapmap.ncbi.nlm.nih.gov/. Accessed July 14, 2010. mammary tissue and secreted in association with the milk- 40. Stephan W. Genetic hitchhiking versus background fat globule membrane during lactation. J Biol Chem 1990; selection: the controversy and its implications. Philos Trans 265:14481–6. R Soc Lond B Biol Sci 2010;365:1245–53. 59. Tazi-Ahnini R, Henry J, Offer C, Bouissou-Bouchouata 41. Williams AF, Barclay AN. The immunoglobulin super- C, Mather IH, Pontarotti P. Cloning, localization, and family—domains for cell surface recognition. Annu Rev structure of new members of the butyrophilin gene family in Immunol 1988;6:381–405. the juxta-telomeric region of the major histocompatibility 42. Cannon JP. Plasticity of the immunoglobulin domain in the complex. Immunogenetics 1997;47:55–63. evolution of immunity. Integr Comp Biol 2009;49:187–96. 60. Weinert C, Grütter C, Roschitzki-Voser H, Mittl PR, 43. Harpaz Y, Chothia C. Many of the immunoglobulin Grütter MG. The crystal structure of human pyrin b30.2 superfamily domains in cell adhesion molecules and surface domain: implications for mutations associated with familial receptors belong to a new structural set which is close to Mediterranean fever. J Mol Biol 2009;394:226–36. that containing variable domains. J Mol Biol 1994;238: 61. Woo JS, Imm JH, Min CK, Kim KJ, Cha SS, Oh BH. 528–39. Structural and functional insights into the B30.2/SPRY 44. Aricescu AR, Jones EY. Immunoglobulin superfamily cell domain. EMBO J 2006;25:1353–63. adhesion molecules: zippers and signals. Curr Opin Cell Biol 62. Woo JS, Suh HY, Park SY, Oh BH. Structural basis for 2007;19:543–50. protein recognition by B30.2/SPRY domains. Mol Cell 2006;24:967–76. 45. Peggs KS, Allison JP. Co-stimulatory pathways in lymphocyte regulation: the immunoglobulin superfamily. 63. Jeong J, Rao AU, Xu J, et al. The PRY/SPRY/B30.2 Br J Haematol 2005;130:809–24. domain of butyrophilin 1A1 (BTN1A1) binds to xanthine oxidoreductase: implications for the function of BTN1A1 in 46. Vogel C, Chothia C. Protein family expansions and biological the mammary gland and other tissues. J Biol Chem 2009; complexity. PLoS Comput Biol 2006;2:e48. 284:22444–56. 47. Simon TL, Dzik WH, Snyder EL, Stowell CP, Strauss RG, 64. Garofalo F, Pellegrino D, Amelio D, Tota B. The Antarctic eds. Rossi’s Principles of Transfusion Medicine. 3rd ed. hemoglobinless icefish, fifty five years later: a unique Philadelphia, PA: Lippincott Williams & Wilkins, 2002. cardiocirculatory interplay of disaptation and phenotypic 48. Sharpe AH, Freeman GJ. The B7-CD28 superfamily. Nat plasticity. Comp Biochem Physiol A Mol Integr Physiol Rev Immunol 2002;2:116–26. 2009;154:10–28. 49. Mather IH, Jack LJ. A review of the molecular and cellular 65. Yergeau DA, Cornell CN, Parker SK, Zhou Y, Detrich HW biology of butyrophilin, the major protein of bovine milk fat 3rd. bloodthirsty, an RBCC/TRIM gene required for globule membrane. J Dairy Sci 1993;76:3832–50. erythropoiesis in zebrafish. Dev Biol 2005;283:97–112.

56 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Scianna blood group system: a review

66. Ye TZ, Gordon CT, Lai YH, et al. Ermap, a gene coding for 82. Steane EA, Sheehan RG, Brooks BD, Frenkel EP. a novel erythroid specific adhesion/receptor membrane Therapeutic plasmapheresis in patients with antibodies to protein. Gene 2000;242:337–45. high-frequency red cell antigens. Prog Clin Biol Res 1982; 67. Kuriyan MA, Oyen RE, Marsh WL. Demonstration of Diego 106:347–53. (Dib) and Scianna (Scl) antigens on phagocytic leukocytes 83. DeMarco M, Uhl L, Fields L, Pacini D, Gorlin JB, Kruskall of the blood. Transfusion 1978;18:361–4. MS. Hemolytic disease of the newborn due to the Scianna 68. Rojewski MT, Schrezenmeier H, Flegel WA. Tissue antibody, anti-Sc2. Transfusion 1995;35:58–60. distribution of blood group membrane proteins beyond red 84. Peloquin P, Moulds M, Keenan J, Kennedy M. Anti-Sc3 cells: evidence from cDNA libraries. Transfus Apher Sci as an apparent autoantibody in two patients [abstract]. 2006;35:71–82. Transfusion 1989;29(Suppl):49S. 69. He XR, He YY, Chen Y, Ye TZ. Expression of human ERMAP 85. Winn LC, Eska PL, Grindon AJ. Anti-Rd (Radin) following gene in fetal tissues [in Chinese]. Zhongguo Shi Yan Xue Ye the transfusion of a Radin positive unit of blood. Transfusion Xue Za Zhi 2006;14:972–5. 1976;16:351–2. 70. Zhang XH, Ye TZ, Hu B, Si WZ. Quantification of human 86. Wagner FF, Frohmajer A, Ladewig B, et al. Weak D alleles ERMAP by using real-time FQ-PCR [in Chinese]. Zhongguo express distinct phenotypes. Blood 2000;95:2699–708. Shi Yan Xue Ye Xue Za Zhi 2005;13:154–7. 87. Seltsam A, Grueger D, Blasczyk R, Flegel WA. Easy 71. He YY, Zhang XH, Ye TZ, Wu ZL. Study on the expression identification of antibodies to high-prevalence Scianna of human ERMAP gene in erythropoietic and macrophage antigens and detection of admixed alloantibodies using differentiation of K562 cells [in Chinese]. Zhongguo Shi Yan soluble recombinant Scianna protein. Transfusion 2009; Xue Ye Xue Za Zhi 2005;13:553–6. 49:2090–6. 72. He YY, Zhang XH, Ye TZ, Wu ZL. Expression of human 88. Reid ME. Complexities of the Dombrock blood group system ERMAP gene in different cell lines [in Chinese]. Zhongguo revealed. Transfusion 2005;45(2 Suppl):92S–9S. Shi Yan Xue Ye Xue Za Zhi 2005;13:819–22. 89. Higgins JM, Sloan SR. Stochastic modeling of human RBC 73. Liang JF, Chen Y, Ye TZ, et al. Effects of human ERMAP- alloimmunization: evidence for a distinct population of siRNA on erythroid differentiation of K562 cells induced by immunologic responders. Blood 2008;112:2546–53. Ara-C [in Chinese]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 90. Reid ME. Transfusion in the age of molecular diagnostics. 2009;17:49–53. Hematology Am Soc Hematol Educ Program 2009:171–7. 74. Lin LD, He XR, Ye TZ, et al. Expression of human ERMAP 91. Veldhuisen B, van der Schoot CE, de Haas M. Blood gene in umbilical cord blood mononuclear cells during group genotyping: from patient to high-throughput donor differentiation and development towards erythroid screening. Vox Sang 2009;97:198–206. lineage [in Chinese]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 92. Flegel WA. Blood group genotyping in Germany. Transfusion 2008;16:328–32. 2007;47(1 Suppl):47S–53S. 75. Reid ME, Lomas-Francis C. The blood group antigen 93. Hillyer CD, Shaz BH, Winkler AM, Reid M. Integrating factsbook. 2nd ed. San Diego, CA: Academic Press; 2004. molecular technologies for red blood cell typing and 76. Velliquette RW. Review: the Scianna blood group system. compatibility testing into blood centers and transfusion Immunohematology 2005;21:70–6. services. Transfus Med Rev 2008;22:117–32. 77. Kaye T, Williams EM, Garner SF, Leak MR, Lumley H. Anti- 94. Garraty G, Reid M, Westhoff C, eds. A Workshop on Sc1 in pregnancy. Transfusion 1990;30:439–40. Methods in Molecular Immunohematology. Transfusion 78. Tregellas WM, Holub MP, Moulds JJ, Lacey PA. An example 2010;47:1S–100S. of autoanti-Sc1 demonstrable in serum but not in plasma 95. Denomme GA, Flegel WA. Applying molecular immuno- [abstract]. Transfusion 1979;19:650. hematology discoveries to standards of practice in blood 79. McDowell MA, Stocker I, Nance S, Garratty G. Auto anti-Sc1 banks: now is the time. Transfusion 2008;48:2461–75. associated with autoimmune hemolytic anemia [abstract]. Transfusion 1986;26:578. Patricia A.R. Brunker, MD, DPhil, and Willy A. Flegel, 80. Owen I, Chowdhury V, Reid ME, Poole J, Marsh JC, Hows JM. Autoimmune hemolytic anemia associated with anti- MD (corresponding author), Laboratory Services Section, Sc1. Transfusion 1992;32:173–6. Department of Transfusion Medicine, Clinical Center, National 81. Ramsey G, Williams LM. Autoimmune hemolytic Institutes of Health, Bethesda, MD 20892. anemia with auto-anti-Sc1, weakened Sc:1 antigen, and superimposed transfusion-associated acute hemolysis [abstract]. Transfusion 2010;50(2S):156A.

Immunohematology is on the Web! Important Notice About Manuscripts for www.redcross.org/immunohematology Immunohematology For more information, send an e-mail to Please e-mail all manuscripts to [email protected] [email protected]

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 57 Ca s e R e p o r t Possible suppression of fetal erythropoiesis by the Kell blood group antibody anti-Kpa

M. Tuson, K. Hue-Roye, K. Koval, S. Imlay, R. Desai, G. Garg, E. Kazem, D. Stockman, J. Hamilton, and M.E. Reid

Antibodies to antigens in the Kell blood group system are usually proliferation of K+ erythroid progenitors was inhibited by immunoglobulin G, and, notoriously, anti-K, anti-k, and anti-Kpa anti-K, and suggested that the K glycoprotein plays a role in can cause severe hemolytic transfusion reactions, as well as severe erythropoiesis.5 hemolytic disease of the fetus and newborn (HDFN). It has been Cases of HDFN involving antibodies to other antigens shown that the titer of anti-K does not correlate with the severity of HDFN because, in addition to immune destruction of red in the Kell system of antibodies are rare. We retrospectively blood cells (RBCs), anti-K causes suppression of erythropoiesis report a case of HDFN in twins of a mother whose serum in the fetus, which can result in severe anemia. We report a case contained anti-Kpa. The Kp(a+) twin was anemic, and the a involving anti-Kp in which one twin was anemic and the other Kp(a–) twin was not. was not. Standard hemagglutination and polymerase chain reaction (PCR)-based tests were used. At delivery, anti-Kpa was identified in serum from the mother and twin A, and in the eluate Case History prepared from the baby’s RBCs. PCR-based assays showed twin A (boy) was KEL*841T/C (KEL*03/KEL*04), which is predicted A 31-year-old gravida 3, para 2 woman with a history to encode Kp(a+b+). Twin B (girl) was K EL*841C/C (K EL*04/ of a negative antibody screen delivered ABO-identical, Rh- K EL*04), which is predicted to encode Kp(a–b+). We describe compatible fraternal twins at full term (37 weeks’ gestation). the first reported case of probable suppression of erythropoiesis The mother had two previous pregnancies delivered by attributable to anti-Kpa. One twin born to a woman whose serum contained anti-Kpa experienced HDFN while the other did not. cesarean section; no problems were noted in the medical Based on DNA analysis, the predicted blood type of the affected record. At delivery, the cord hemoglobin (Hb) for twin A twin was Kp(a+b+) and that of the unaffected twin was Kp(a–b+). (male) was 10.2 g/dL and for twin B (female) was 17.0 g/dL. The laboratory findings and clinical course of the affected twin Unfortunately, there were no cord bilirubin or reticulocyte were consistent with suppression of erythropoiesis in addition counts done for either twin. to immune RBC destruction. Immunohematology 2011;27: 58–60. Because of anemia, shortly after birth twin A received a single-aliquot RBC transfusion that was compatible with Key words: erythropoiesis—suppression, Kell blood the maternal serum. On day 1, he received an additional group system, hemolytic disease of the newborn, Kpa single-aliquot transfusion with RBCs and was discharged on day 5 with a Hb of 15.1 g/dL and an absolute reticulocyte The first antigen in the Kell blood group system, K, was count of 0.16 × 109/L (normal range of 0.125–0.325 × discovered in 1946 as the result of hemolytic disease of the 109/L). Transfusion was again required on day 25 when the newborn. The system now includes 31 antigens. Antibodies Hb reached a nadir of 7.5 g/dL with a decreased absolute to K, k, Kpa, Kpb, Kpc, Jsa, and Jsb are the most clinically reticulocyte count of 0.007 m/μL. Additional transfusions important.1 Next to anti-A, anti-B, and anti-D, anti-K is were given on days 30 and 39 to maintain a Hb level above the most common immune RBC antibody.2 Antibodies to 9.0 g/dL. After transfusion of two aliquots on day 39, the antigens in the Kell blood group system are usually IgG, Hb of twin A was 9.6 g/dL and on day 43 and 52 it was 9.3 and, notoriously, anti-K, anti-k, and anti-Kpa cause severe g/dL and 9.5 g/dL, respectively. Two weeks later the Hb was hemolytic transfusion reactions, as well as severe hemolytic 10.3 g/dL, and 6 months later it was 12.6 g/dL. The infant’s disease of the fetus and newborn (HDFN).3,4 bilirubin peaked at 5 mg/dL on day 1 and fell steadily during It is well known that the titer of anti-K does not correlate the monitoring period. White blood cell and platelet counts with the severity of HDFN; indeed, severe HDFN caused remained normal. by anti-K has been associated with lower antibody titers, bilirubin levels, and reticulocytosis than has hemolytic Materials and Methods disease of the newborn caused by anti-D.2,3 The anemia seen in these infants is caused by a combination of immune Hemagglutination destruction and suppression of erythropoiesis in the Standard hemagglutination tests were used throughout. fetus.5,6 Vaughan et al. demonstrated experimentally that The cord blood samples were tested by tube method for

58 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Suppression of fetal erythropoiesis by anti-Kpa

Table 1. Results of hemagglutination tests ABO, Rh, and direct antiglobulin test (DAT). The maternal and paternal samples were tested by MTS gel cards (Ortho Mother Twin A Twin B Father Clinical Diagnostics, Raritan, NJ). ABO/Rh A + A + A + A + DAT Not tested 4+ 0 Not tested Polymerase Chain Reaction–Restriction Fragment IAT with Not tested Not tested Compatible Incompatible Length Polymorphism Analysis for KEL*0 3 / KEL*04 maternal serum Genomic DNA was isolated from epithelial cells Other studies Anti-Kpa Anti-Kpa in Kp(a+) captured by the buccal swabs obtained from the twins serum and eluate using a DNA kit (QIAamp DNA Blood Mini Kit, QIAGEN, DNA from Not tested KEL*03/ KEL*04/ Not tested Inc., Valencia, CA). Exon 8 of KEL was amplified using buccal smear KEL*04 KEL*04 a forward oligonucleotide primer (Life Technologies, Inc., Gaithersburg, MD) designed within exon 8 DAT = direct antiglobulin test; IAT = indirect antiglobulin test. (TACCTGACTTACCTGAATCAGCTGGGAACC) and a reverse oligonucleotide primer designed at the 3′ end of Based on DNA analysis, the predicted blood type of the exon 8 and into intron 8 (tcttctggcccccagttccaggcacCATGA). affected twin was Kp(a+b+) and that of the unaffected twin Five microliters of DNA per reaction was amplified by 5 was Kp(a–b+). The laboratory findings and clinical course units of Taq DNA polymerase (HotStarTaq, QIAGEN Inc., of the affected twin were consistent with suppression of Valencia, CA) in a 50-μL reaction mixture containing erythropoiesis in addition to immune RBC destruction. The

2.5 mM MgCl2, 1 × PCR buffer, 0.2 mM dNTPs, and 100 steadily declining bilirubin levels concurrent with a declining ng of forward and reverse primer. The PCR amplification hemoglobin level and decreased absolute reticulocyte was achieved in 35 cycles with a final extension time of 10 count provide supportive evidence for this interpretation. minutes, using 62°C as the annealing temperature. The It is possible that the change in the reticulocyte count was PCR 202-bp products were digested using the restriction induced, or exacerbated, by transfusion. Although this was enzyme NlaIII. A restriction enzyme site for this restriction a retrospective study and not all data were available to us, it enzyme is present in the K EL*03 variant (841T) but not in is worth documenting, especially because one twin was an the wild-type (841C). antigen-negative twin and served as a control. Antigens in the Kell blood group system appear on Results erythroid progenitor cells early in erythropoiesis.7,8 Because erythroid progenitor cells do not contain hemoglobin, Hemagglutination immune destruction of these cells by anti-Kpa could At the time of delivery, anti-Kpa was identified in the explain the absence of hyperbilirubinemia in our patient. maternal serum. No other unexpected antibodies were The restriction of Kell messenger RNA and protein to present in the maternal serum. Tests using the serum erythroid precursors explains why white blood cell and from twin A and an eluate prepared from his RBCs also platelet counts remained normal in the affected twin.9,10 contained anti-Kpa (Table 1). Antibody testing on days 25, The anemia of the affected twin resolved after 3 months, 30, and 39 demonstrated the persistence of anti-Kpa in the and his Hb has remained within the normal range. Twin B baby’s serum. had no postdelivery complications and provides a biologic control for factors other than maternal alloantibody as a Polymerase Chain Reaction–Restriction Fragment cause of the anemia. Although anti-K is most commonly Length Polymorphism Analysis for KEL*0 3 / KEL*04 associated with erythropoietic suppression, twin A shows Twin A (boy) was KEL*841T/C (KEL*03/KEL*04), that antibodies to other antigens in the Kell blood group which is predicted to encode Kp(a+b+). Twin B (girl) was system can also have this capability. KEL*841C/C (KEL*04/KEL*04), which is predicted to encode Kp(a–b+). Acknowledgments

Conclusions We thank Yaddanapudi Ravindranath, MD, for follow- up information after the twins were discharged from We describe the first reported case of possible the hospital and Robert Ratner for help in preparing the suppression of erythropoiesis attributable to anti-Kpa. One manuscript. twin born to a woman whose serum contained anti-Kpa experienced HDFN and anemia, while the other did not.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 59 M. Tuson et al.

References 8. Daniels G, Green C. Expression of red cell surface antigens during erythropoiesis. Vox Sang 2000;78(Suppl 2):149–53. 1. Reid ME, Lomas-Francis C. Blood Group Antigens and Antibodies: A guide to clinical relevance and technical tips. 9. Jaber A, Loirat MJ, Willem C, Bloy C, Cartron JP, Blanchard New York, NY: Star Bright Books, 2007. D. Characterization of murine monoclonal antibodies directed against the Kell blood group glycoprotein. Br J 2. Klein HG, Anstee DJ. Mollison’s blood transfusion in clinical Haematol 1991;79:311–15. medicine. 11th ed. Oxford: Wiley-Blackwell, 2006. 10. McGinniss MH, Dean A. Expression of red cell antigens by 3. Roback JD, Combs MR, Grossman BJ, et al. Technical K562 human leukemia cells before and after induction of manual. 16th ed. Bethesda, MD: American Association of hemoglobin synthesis by hemin. Transfusion 1985;25:105– Blood Banks, 2008. 9. 4. Costamagna L, Barbarini M, Viarengo GL, Pagani A, Isernia D, Salvaneschi L. A case of hemolytic disease of the newborn due to anti-Kpa. Immunohematology 1997;13:61–2. Michelle Tuson, MT(ASCP)SBB, Trinity Health, Farmington Hills, 5. Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray MI; Kim Hue-Roye, BSc, Laboratory of Immunochemistry, New NA, Roberts IA. Inhibition of erythroid progenitor cells by York Blood Center, New York, NY; Karen Koval, MT, Sherwin anti-Kell antibodies in fetal alloimmune anemia. N Engl J Imlay, MD, Rajendra Desai, MD, Gayatri Garg, MD, and Esam Med 1998;338:798–803. Kazem, MD, St. Joseph Mercy Hospital—Oakland, Pontiac, MI; 6. Daniels G, Hadley A, Green CA. Causes of fetal anemia in Diane Stockman, MT(ASCP), and Janis S. Hamilton, MT(ASCP) hemolytic disease due to anti-K. Transfusion 2003;43:115– SBB, American Red Cross, Southeastern Michigan Region, 16. Detroit, MI; and Marion E. Reid, PhD (corresponding author), 7. Southcott MJG, Tanner MJ, Anstee DJ. The expression of Laboratory of Immunochemistry, New York Blood Center, 310 human blood group antigens during erythropoiesis in a cell East 67th Street, New York, NY 10065. culture system. Blood 1999;93:4425–35.

Attention: SBB and BB Students

You are eligible for a free 1-year subscription to For information concerning the National Reference Immunohematology. Laboratory for Blood Group Serology, including the American Ask your education supervisor to submit the name and Rare Donor Program, contact Sandra Nance, by phone at complete address for each student and the inclusive dates (215) 451-4362, by fax at (215) 451-2538, or by e-mail at [email protected] of the training period to [email protected]

Notice to Readers Attention: State Blood Bank Meeting Organizers All articles published, including communications and book reviews, reflect the opinions of the authors and do not If you are planning a state meeting and would like copies necessarily reflect the official policy of the American Red of Immunohematology for distribution, please send request, Cross. 4 months in advance, to [email protected]

60 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 R e p o r t Challenging dogma: group A donors as “universal plasma” donors in massive transfusion protocols

E.J. Isaak, K.M. Tchorz, N. Lang, L. Kalal, C. Slapak, G. Khalife, D. Smith, and M.C. McCarthy

The use of massive transfusion protocols (MTPs) in hemolytic reactions occurred, the suspected components trauma patients presenting with near-exsanguinating contained plasma from group O donors.8,23,24 After careful injuries has increased in the past several years. This is review of these case reports, no patient belonging to group largely a result of the increasing evidence suggesting that B or group AB was found to have experienced a hemolytic transfusion of blood components in ratios more closely event after transfusion with group A plasma. Third, and approximating the composition of whole blood may reduce most interestingly, it appears that correlations between mortality.1–4 Inherent in the design of these protocols these hemolytic episodes and agglutinin titers exist.17,25–27 is the necessity for the timely transfusion of plasma. If the level of anti-A and anti-B agglutinin titers could Unfortunately, the need for plasma often precedes the be quantified in compatible but nonidentical plasma units, determination of blood group. perhaps a novel approach to a plasma substitution could Group AB plasma is commonly used in MTP when be made for MTPs. For example, if group AB plasma is the patient’s blood type has not yet been determined. The not available or is in short supply from local blood bank foundation for this practice is rooted in the theory that sources, it may be feasible and preferable to use group A group AB plasma is “universal” because of the absence of plasma. Because approximately 15 percent of the North anti-A and anti-B hemagglutinins. Likewise, it is analogous American population are group B or group AB, the use of to the belief that group O red blood cells (RBCs) are group A plasma is already acceptable for approximately 85 universal and may be transfused to all patients, regardless percent of the general population. Published experience of blood type. This universal blood component practice from different institutions indicates that transfusion of 300 continues to this day, based on concerns that infusion of to 500 mL of incompatible plasma in 1 day and transfusion incompatible plasma may produce hemolysis, a potentially of 1 L of incompatible plasma in 1 week have been practiced fatal complication. Unfortunately, in the United States the without significant clinical sequelae in adult patients. In availability of group AB plasma is limited because only 4 addition, many institutions use a critical titer of 64 or higher percent of all blood donors in North America are group as the cutoff when saline solution is used for labeling a unit AB.5 Therefore, plasma from group AB donors may not be as “high-titer.”24 Therefore, it would be logical to conclude available in sufficient quantities to satisfy the requirements that it may be safe to transfuse 1 L of group A plasma to a for an MTP in all trauma settings. group B or group AB patient as long as the anti-B agglutinin Historically, this risk of hemolysis has outweighed titer is less than 16. concerns about the potential risks associated with The goal of this study is to identify acceptable group A compatible but nonidentical plasma. Although experience plasma units that could theoretically be safely transfused as in populations receiving apheresis platelets has proved that universal plasma to any patient during MTP. To determine the concern about intravascular hemolysis is warranted,6–18 concept feasibility, we propose classifying group A plasma the belief that group AB plasma is universal plasma has donors into those with low titers (LT) of anti-B agglutinins been repeatedly challenged in several patient populations, (≤ 64 but > 16) and those with very low titers (VLT) of anti-B including those undergoing cardiac surgery,19 receiving agglutinins (≤ 16). In the trauma setting, while a blood treatment for hematologic malignancies,20 or receiving group determination is being performed, it may be possible stem cell transplants.21 For patients in whom a hemolytic to transfuse more than 1 unit of group A plasma during the reaction may occur, there are three important observations initial MTP shipments if group AB plasma is unavailable. to consider. First, minor incompatibilities appear to be Group A plasma meeting these specifications could be rare events, with one study suggesting an incidence of 1 in used to supplement the group AB plasma inventory in the 9000.22 Second, in these anecdotal case reports in which treatment of trauma patients requiring MTP. The solution

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 61 E.J. Isaak et al.

proposed in this pilot study assumes established criteria reactivity were analyzed for correlation with age, sex, and supported by the currently documented literature. history of pregnancy. Statistical analysis with the Pearson chi-square test was then used to determine any correlation Materials and Methods between the patterns and age. Significance was determined at α = 0.05. Fresh plasma (less than 48 hours old) was obtained from the pilot tubes of 100 consecutive group A blood Results donors during December 2008. All donors consented to research-related activities as part of the general consent Among the 100 plasma samples, seven different procedure at the Community Blood Center/Community patterns of reactivity were noted. Sixty three percent of Tissue Services (CBC/CTS), Dayton, Ohio, and all were donor samples were negative at a titer of 64 both at room eligible donors based on an approved donor health temperature and at 37°C. These donor samples can be questionnaire. These documents were reviewed by the classified as LT. Fifteen percent of donor samples were Food and Drug Administration and are on file at the Center negative at titers of 64 and 16 both at room temperature for Biologics Evaluation and Research as required by the and at 37°C and can be classified as VLT (Table 1). Code of Federal Regulations. Demographic data including sex, age, and history of previous pregnancy were recorded Table 1. Donor sample demographic data and agglutinin titer from the information on the questionnaire. Mean age, Male: The plasma from each of these donors was diluted with N y (range) female Pregnancies RT(VLT) RT(LT) 37°C(VLT) 37°C(LT) 0.85 percent saline solution (Blood Bank Saline, Fisher 23 39 4:19 13/19 + + + + Scientific USA, Pittsburgh, PA) to prepare dilutions of 1:16 (17–75) (1 part plasma and 15 parts saline) and 1:64 (1 part plasma 11 47 7:4 4/4 + – + + (19–71) and 63 parts saline) in sufficient quantities for testing. A 39 51 19:20 15/20 + – + – freshly collected random group B donor unit was selected (20–72) as the testing RBCs. The group B RBCs were washed and 5 48 2:3 3/3 – – + – prepared as a 4% concentration in saline. One drop of the (43–51) 4% group B RBCs was added to 0.2 mL of each of the 1:16 3 53 0:3 3/3 + + + – dilutions of the group A plasmas and mixed well at room (50–56) temperature (27°C). The mixtures were centrifuged and 4 53 4:0 0/0 + – – – (46–59) read macroscopically for agglutination; reactions were 15 54 8:7 7/7 – – – – recorded as either negative (no agglutination observed) (38–77) or positive (any macroscopic agglutination observed, regardless of strength). All tubes were then transferred LT = low titer ≤ 64; RT = room temperature 27°C; VLT = very low titer ≤ 16. to a 37°C dry heat incubator and were allowed to incubate for 30 minutes. The tubes were again centrifuged and read Although low titers and very low titers occur in both macroscopically for agglutination with the same criteria sexes and across all age ranges, some general patterns do used for recording as negative or positive. emerge. The three most commonly observed patterns of Similarly, one drop of the 4% group B RBCs was reactivity are (1) positivity at titers of 16 and 64 at room added to 0.2 mL of each of the 1:64 dilutions of the group temperature and 37°C (pattern A), (2) positivity at a titer of A plasmas and mixed well at room temperature. These 16 at room temperature and 37°C but negativity at a titer of mixtures were also centrifuged and read macroscopically 64 at both temperatures (pattern B), and (3) negativity at for agglutination, and recorded as either negative or both titers at both temperatures (pattern C). positive using the criteria previously established. All tubes The ratio of men to women within pattern A is 4:19; were then transferred to a 37°C dry heat incubator and the ratio is more evenly balanced within patterns B and C. were allowed to incubate for 30 minutes. The tubes were The relationship of these three patterns of reactivity with centrifuged and read macroscopically for agglutination, regard to age is noted in Table 2. There is a statistically and recorded as either negative or positive using the criteria significant difference (p < 0.029) in the prevalence of previously established. patterns A and C in donors younger than 50 years of age All dilutions and testing were performed by one of compared with donors who are older than 50 years. Pattern two experienced CBC/CTS immunohematology reference A is more common in younger donors, whereas pattern C is laboratory technologists. The resulting patterns of more common in older donors.

62 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Group A as universal plasma donors in massive transfusion protocols

Table 2. Donor sample age group with agglutinin titer pattern association Multiple reviews in the published literature have provided details about the anecdotal cases in which a Pattern minor incompatibility has resulted in a serious adverse Age Group A B C Total outcome. The overwhelming majority of these cases involve < 50 years Count 17 18 5 40 group O plasma transfused to a group A patient, although % within age group 42.5% 45.0% 12.5% 100.0% there are sporadic instances in which group O plasma was ≥ 50 years Count 6 21 10 37 transfused to a group B patient.8,23,24 The reports warn % within age group 16.2% 56.8% 27.0 % 100.0% that the issue may be underreported and that physicians Total Count 23 39 15 77 should be vigilant when transfusing incompatible plasma. % within age group 29.9% 50.6% 19.5% 100.0% Nonetheless, the preponderance of the published clinical experience seems to indicate that the transfusion of incompatible group A plasma appears to be safe. Despite the lack of a reported problem with the Discussion transfusion of group A plasma to either a group B or a group AB patient, additional factors support using group A The results of this laboratory study demonstrate that plasma. There appears to be a correlation between adverse evaluation of anti-B agglutinin titers in group A plasma as clinical consequences and high ABO agglutinin titers, which VLT may serve to identify acceptable group A plasma units provides an avenue for interventions to deal with the issue of that may be substituted in MTP when blood type has not yet the rare but potentially significant minor incompatibilities. been determined. Some transfusion services are identifying agglutinin titers As the demand for plasma resuscitation increases, before issuing platelet components containing incompatible transfusion services are developing algorithms for plasma.23,26 Evaluation of anti-B agglutinin titers in group maintaining an inventory of thawed plasma. Because of the A plasma may serve to identify acceptable group A plasma relative scarcity of group AB plasma, in general, it is simply units that could theoretically be safely transfused to any not practical to maintain thawed group AB plasma. This patient. In determining these titers, the laboratory method translates into a delay in plasma distribution because the is important, and various laboratories have used tube process of obtaining a blood bank specimen, determining agglutination, gel technology, or microtiter plates in these a blood type, and issuing the plasma can be challenging. determinations.30 In our pilot study, agglutination titers In addition, group AB plasma may involve additional risks were determined using tube agglutination, and the titers because of the formation of circulating immune complexes,28 we used as thresholds were based on relatively conservative especially when transfused to group O patients. In fact, in values from reports in the platelet literature in which one large study mortality was increased whenever type- tube agglutination was used. A recent review containing compatible but not type-specific plasma was transfused. an extensive summary of hemolytic reactions associated However, statistical significance was reached only when with minor incompatibility in patients transfused with group AB plasma was given to group O patients, and in platelets indicated that the range of titers fell between 128 this case when more than five units of group AB plasma as a minimum in saline up to 32,000 using antiglobulin were transfused to a group O patient, the relative risk of reagent.24 The rationale for the use of titers in our study was increased mortality was 1.26 (p = 0.004).29 Thus, even if to base our proposed solution on conservative assumptions group AB plasma were available in sufficient amounts, it with the use of available platelet transfusion data. It may might not be ideal. A possible solution to this dilemma is turn out that these assumptions are overly conservative. to identify a type of plasma that is present in abundance Another element that is important in the laboratory and can be safely transfused to any trauma patient, at least method is the choice of RBCs used to perform the titer. up to a certain volume, thus allowing sufficient time for a We used RBCs from a random group B whole blood donor. blood group determination to be made. Group A plasma Because of variation in antigen sites in group A RBCs, titers is relatively abundant, and because nearly 85 percent of are best performed using blended pools of group A RBCs; trauma patients are group A or group O, they can safely it is not clear that the same issue exists in group B RBCs, receive group A plasma. For the 15 percent of patients for although further investigation of this open question may be whom the transfusion of group A plasma creates a minor warranted. incompatibility, published experience has demonstrated In the preceding paragraph, the conservative that reactions caused by minor incompatibilities are assumptions are as follows: (1) group A plasma will be extremely rare. statistically compatible with 85 percent of patients, (2)

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 63 E.J. Isaak et al.

minor incompatibilities are extremely rare, (3) there has transfuse the initial MTP shipment of four RBC units and been no reported case of a minor reaction with group A four plasma units (essentially equivalent to 1 L of plasma) plasma in either a group B or group AB patient, (4) serious would provide transfusion services with ample time to adverse reactions can be associated with certain threshold determine blood type and then issue the appropriate type- agglutinin levels, and (5) conservative values from evidence- specific blood components. When handled in this fashion, based publications were used to set an acceptable agglutinin group AB plasma may remain frozen and only be thawed titer threshold level. Based on these assumptions, our study for use in those patients with group AB blood. showed that 63 percent of our donors could safely donate one unit of incompatible plasma and that 15 percent could References safely donate up to 1 L of incompatible plasma to any patient. 1. Borgman MA, Spinella PC, Perkins JG, et al. The ratio of Furthermore, we found that the VLT donors are more blood products transfused affects mortality in patients common in donors older than 50 years of age. Therefore, receiving massive transfusions at a combat support hospital. a possible recruitment strategy in our donor population J Trauma 2007;63:805–13. would involve screening donors older than 50 years of age 2. Bormanis J. Development of a massive transfusion protocol. to establish a dedicated group of VLT donors for MTP. Transfus Apher Sci 2008;38:57–63. With regard to the limitations of this pilot study, there 3. Gonzalez EA, Moore FA, Holcomb JB, et al. Fresh frozen plasma should be given earlier to patients requiring massive are several. First, the donor sample size is only 100. This transfusion. J Trauma 2007;62:112–19. number was selected because the purpose of the study 4. Huber-Wagner S, Qvick M, Mussack T, et al. Massive blood was merely to test for feasibility of the proposed approach. transfusion and outcome in 1062 polytrauma patients: a Second, the donor population is a midwest population, prospective study based on the Trauma Registry of the and therefore these results may not extrapolate to other German Trauma Society. Vox Sang 2007;92:69–78. donor populations. The determinants of agglutinin 5. Roback JD, Combs MR, Grossman BJ, et al (eds). Technical manual. 16th ed. Arlington, VA: American Association of levels appear to be largely determined by geography and Blood Banks, 2008. 31,32 environmental factors, and one study of populations in 6. McLeod BC, Sassetti RJ, Weens JH, Vaithianathan T. Asia found higher agglutinin levels in donors older than Haemolytic transfusion reaction due to ABO incompatible 50 years of age.33 Although it is well known that immune plasma in a platelet concentrate. Scand J Haematol 1982; function deteriorates with increasing age, this population 28:193–6. had increased agglutinin titers. Our results of a midwest 7. Larsson LG, Welsh VJ, Ladd DJ. Acute intravascular hemolysis secondary to out-of-group platelet transfusion. North American population demonstrated the opposite. Transfusion 2000;40:902–6. Surprisingly, our population showed titer levels that appear 8. McManigal S, Sims KL. Intravascular hemolysis secondary to be independent of history of pregnancy. The significance to ABO incompatible platelet products. An underrecognized of these findings remains to be determined. transfusion reaction. Am J Clin Pathol 1999;111:202–6. Because populations of blood donors will have different 9. Murphy MF, Hook S, Waters AH, et al. Acute haemolysis patterns of agglutinin titers based on ethnicity and age, after ABO-incompatible platelet transfusions. Lancet 1990; 335:974–5. select blood centers could develop specific recruitment 10. Pierce RN, Reich LM, Mayer K. Hemolysis following platelet strategies to provide these VLT universal plasma products transfusions from ABO-incompatible donors. Transfusion to meet local and regional needs. Finally, and most 1985;25:60–2. importantly, this new concept of VLT group A plasma as 11. Sadani DT, Urbaniak SJ, Bruce M, Tighe JE. Repeat ABO- universal plasma in MTP has not been studied in trauma incompatible platelet transfusions leading to haemolytic patients requiring MTP and will require thoughtful study transfusion reaction. Transfus Med 2006;16:375–9. design to test the hypothesis. 12. Sapatnekar S, Sharma G, Downes KA, Wiersma S, McGrath C, Yomtovían R. Acute hemolytic transfusion reaction in a pediatric patient following transfusion of apheresis Conclusions platelets. J Clin Apher 2005;20:225–9. 13. Oztürk A, Türken O, Sayan O, Atasoyu EM. Acute The results of this study suggest a fresh perspective intravascular hemolysis due to ABO-incompatible platelet on resuscitation in trauma patients. When a massively transfusion. Acta Haematol 2003;110:211–12. injured trauma patient arrives at the trauma center, it is 14. Barjas-Castro ML, Locatelli MF, Carvalho MA, Gilli SO, Castro V. Severe immune haemolysis in a group A recipient theoretically possible to initiate MTP with thawed VLT of a group O red blood cell unit. Transfus Med 2003;13: group A plasma instead of thawed group AB plasma. 239–41. Because MTP suggests a ratio of one RBC unit to one plasma unit during acute hemorrhage, the time required to

64 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Group A as universal plasma donors in massive transfusion protocols

15. Chow MP, Yung CH, Hu HY, Tzeng CH. Hemolysis after 28. Heal JM, Masel D, Rowe JM, Blumberg N. Circulating ABO-incompatible platelet transfusions. Zhonghua Yi Xue immune complexes involving the ABO system after platelet Za Zhi (Taipei) 1991;48:131–4. transfusion. Br J Haematol 1993;85:566–72. 16. Ferguson DJ. Acute intravascular hemolysis after a platelet 29. Shanwell A, Andersson TM, Rostgaard K, et al. Post- transfusion. CMAJ 1988;138:523–4. transfusion mortality among recipients of ABO-compatible 17. Harris SB, Josephson CD, Kost CB, Hillyer CD. Nonfatal but non-identical plasma. Vox Sang 2009;96:316–23. intravascular hemolysis in a pediatric patient after 30. Cooling LL, Downs TA, Butch SH, Davenport RD. Anti-A transfusion of a platelet unit with high-titer anti-A. and anti-B titers in pooled group O platelets are comparable Transfusion 2007;47:1412–17. to apheresis platelets. Transfusion 2008;48:2106–13. 18. Valbonesi M, De Luigi MC, Lercari G, et al. Acute 31. Redman M, Malde R, Contreras M. Comparison of IgM intravascular hemolysis in two patients transfused with and IgG anti-A and anti-B levels in Asian, Caucasian and dry-platelet units obtained from the same ABO incompatible Negro donors in the North West Thames Region. Vox Sang donor. Int J Artif Organs 2000;23:642–6. 1990;59:89–91. 19. Blumberg N, Heal JM, Hicks GL Jr, Risher WH. Association 32. Toy PT, Reid ME, Papenfus L, Yeap HH, Black D. Prevalence of ABO-mismatched platelet transfusions with morbidity of ABO maternal-infant incompatibility in Asians, Blacks, and mortality in cardiac surgery. Transfusion 2001;41: Hispanics and Caucasians. Vox Sang 1988;54:181–3. 790–3. 33. Mazda T, Yabe R, NaThalang O, Thammavong T, Tadokoro 20. Heal JM, Kenmotsu N, Rowe JM, Blumberg N. A possible K. Differences in ABO antibody levels among blood donors: survival advantage in adults with acute leukemia receiving a comparison between past and present Japanese, Laotian, ABO-identical platelet transfusions. Am J Hematol 1994;45: and Thai populations. Immunohematology 2007;23:38–41. 189–90. 21. Heal JM, Liesveld JL, Phillips GL, Blumberg N. What would Edahn J. Isaak, MD, FACP, Director of Transfusion Medicine, Karl Landsteiner do? the ABO blood group and stem cell transplantation. Bone Marrow Transplant 2005;36:747–55. Staten Island University Hospital, Staten Island, NY; Kathryn M. Tchorz, MD, FACS (corresponding author), Associate Professor, 22. Mair B, Benson K. Evaluation of changes in hemoglobin levels associated with ABO-incompatible plasma in Department of Surgery-Division of Trauma/Critical Care, apheresis platelets. Transfusion 1998;38:51–5. Wright State University-Boonshoft School of Medicine, Miami 23. Fung MK, Downes KA, Shulman IA. Transfusion of Valley Hospital, One Wyoming Street, 7th Floor CHE Building, platelets containing ABO-incompatible plasma: a survey of Dayton, OH 45409; Nancy Lang, SBB, Immunohematology 3156 North American laboratories. Arch Pathol Lab Med Reference Technologist, Lawrence Kalal, MT, Immunohematol- 2007;131:909–16. ogy Reference Technologist, Colleen Slapak, MS, Transfusion 24. Cooling L. ABO and platelet transfusion therapy. Safety Director, Ghada Khalife, MD, Medical Director, David Immunohematology 2007;23:20–33. Smith, MD, CEO, Community Blood Center/Community Tissue 25. Eder AF, Chambers LA. Noninfectious complications of Services, Dayton, OH; and Mary C. McCarthy, MD, FACS, blood transfusion. Arch Pathol Lab Med 2007;131:708–18. Professor, Department of Surgery, Chief, Trauma/Critical Care, 26. Josephson CD, Mullis NC, Van Demark C, Hillyer CD. Wright State University-Boonshoft School of Medicine, Miami Significant numbers of apheresis-derived group O platelet Valley Hospital, Dayton, OH. units have “high-titer” anti-A/A,B: implications for transfusion policy. Transfusion 2004;44:805–8. 27. Reesink HW, van der Hart M, van Loghem JJ. Evaluation of a simple method for determination of IgG titre anti-A or -B in cases of possible ABO blood group incompatibility. Vox Sang 1972;22:397–407.

Manuscripts The editorial staff of Immunohematology welcomes manuscripts issues are the first weeks in November, February, May, and pertaining to blood group serology and education for consideration August, respectively. For instructions for scientific articles, case for publication. We are especially interested in case reports, reports, and review articles, see Instructions for Authors in every papers on platelet and white cell serology, scientific articles issue of Immunohematology or on the Web at www.redcross.org/ covering original investigations, and papers on new methods for immunohematology. Include fax and phone numbers and use in the blood bank. Deadlines for receipt of manuscripts for e-mail address with all manuscripts and correspondence. consideration for the March, June, September, and December E-mail all manuscripts to [email protected]

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 65 R e p o r t Prevalence of RHD*DOL and RHCE*ce(818T) in two populations

C. Halter Hipsky, D.C. da Costa, R. Omoto, A. Zanette, L. Castilho, and M.E. Reid

The alleles RHCE*ceBI (RHCE*ce 48C, 712G, 818T, 1132G) changes occur in other alleles.2 In analyzing DNA from and RHCE*ceSM (RHCE*ce 48C, 712G, 818T) encode the low- samples known to be STEM+ or DAK+, it was revealed prevalence Rh antigen STEM. These alleles frequently travel in that these variant RHCE are usually in cis to RHD*DOL or cis with RHD*DOL. To estimate the frequency of these alleles, we RHD*DOL-2 (Fig. 1B).3 We tested more than 700 samples tested a total of more than 700 samples in two populations. Blood samples were obtained from patients with sickle cell disease in New York and in Brazil to estimate the frequency of and from blood donors of African descent. DNA extractions and R HCE*ce818C>T and to investigate RHD in these samples. analyses were performed by standard methods. In the United States, none of 70 patient samples had the RHCE*818 nucleotide change. Two of 220 donors (frequency of 0.009) were heterozygous for RHCE*818C/T (RHCE*ceBI). One of these samples had RHD/RHD*DOL and the other had RHD/RHD*DOL-2. In these A. RHCE alleles 290 samples, no other RHD*DOL alleles were found. In Brazil, 1 of 244 patients with sickle cell disease (frequency of 0.004) and 1 of 171 donors (frequency of 0.006) were heterozygous for RHCE*818C/T (RHCE*ceBI). Testing of more than 500 additional samples from people of African descent, selected because they had a diverse range of common and variant RHCE alleles, did not reveal a sample with RHD*DOL or RHD/RHD*DOL-2 in the absence of RHCE*ce(818T). Although the numbers are small, our study shows that in the United States, the frequency of RHCE*818T is 0.007 (2 in 290 samples) and in Brazil it is 0.004 (2 in 515 samples). The four RHCE*818T alleles were RHCE*ceBI. Immunohematology 2011;27:66–67.

Key words: blood groups, Rh alleles, low-prevalence antigens, population study B. RHD alleles

The low-prevalence Rh antigen STEM (RH49) was reported in 1993. The antigen was serologically shown to be associated with an altered e phenotype because approximately 65 percent of hrS– and 30 percent of hrB– red blood cells (RBCs) from South African donors were reported to be STEM+. STEM has a variable expression, which is an inherited characteristic. Anti-STEM has induced mild hemolytic disease of the fetus and newborn.1 Owing to the paucity of anti-STEM and typed RBCs, little further work has been done and no other serologic reports have appeared in the literature. The STEM antigen is encoded by two RHCE alleles: Figure 1. Diagram of selected RHCE (A) and RHD (B) alleles. The RHCE*ceBI (RHCE*ce 48C, 712G, 818T, 1132G) and 10 exons are numbered. Nucleotide changes are indicated in italics RHCE*ceSM (RHCE*ce 48C, 712G, 818T) (Fig. 1A). The and amino acids are given in parentheses below the exon in which nucleotide (nt) 818C>T change is believed to be associated they are found. Changes from the wild-type nucleotides and amino acids are written in bold. with expression of STEM, because the other nucleotide

66 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Prevalence of RHD*DOL and RHDCE*ce(818T)

Materials and Methods (RHCE*ceBI) is 0.007 (2 in 290 samples; 580 alleles), and in Brazil it is 0.004 (2 in 415 samples; 830 alleles). Blood samples were obtained from patients with sickle Our findings show that RHCE*818T, which encodes the cell disease and from blood donors who self-identified as STEM antigen, is not as rare as previously thought. This being of African descent. Genomic DNA was isolated from raises the question as to whether anti-STEM is also more the whole blood samples using the QIAamp DNA Blood prevalent but not identified. In the cohort of samples tested, Mini Kit (QIAGEN, Inc., Valencia, CA). Initial screening of the RHD*DOL or RHD*DOL-2 alleles were in cis with the samples was carried out by sequencing RHCE- and RHD- RHCE*ce(818T) allele; no RHD*DOL or RHD*DOL-2 was reverse transcriptase–polymerase chain reaction (PCR) found in the absence of RHCE*ce(818T). products, as described previously,4 or analyzing RHCE*818 and RHCE*1132 by standard PCR products generated with Acknowledgments genomic DNA using RHCE-specific primers, followed by restriction fragment length polymorphism (RFLP) using, This study was supported in part by grant NIH respectively, MwoI and Tsp45I restriction enzymes. HL091030 (CHH, MER) and INCTS-CNPQ/MCT/FAPESP Genomic DNA was amplified using RHD-specific primers (LC). We thank Robert Ratner for help in preparing this flanking exon 4 and exon 8, and products were submitted manuscript. for sequencing to determine the presence of RHD*DOL (nt 509T>C in exon 4) and RHD*DOL-2 (nt 509T>C in exon 4 References and nt 1132C>G in exon 8). PCR products were sequenced 1. Marais I, Moores P, Smart E, Martell R. STEM, a new in both directions. low-frequency Rh antigen associated with the e-variant phenotypes hrS-(Rh: -18, -19) and hrB-(Rh: -31, -34). Results Transfus Med 1993;3:35–41. 2. Halter-Hipsky C, Hue-Roye K, Coghlan G, Lomas-Francis In the United States, none of 70 patient samples had C, Reid ME. Two alleles with RHCE*nt818C>T change encode the low prevalence Rh antigen STEM [abstract]. the RHCE*818 nucleotide change. Two of 220 donors Blood 2009;114(Suppl):1226–7. (frequency of 0.009) were heterozygous for RHCE*818C/T. 3. Halter Hipsky C, Hue-Roye K, Lomas-Francis C, Reid ME. Both samples had the change at RHCE*ce1132C>G and, RHD*DOL travels with RHCE*ce(818C>T), which encodes thus, are RHCE*ceBI. One sample had RHD/RHD*DOL a partial e, hrS–, hrB+, STEM+ phenotype [abstract]. and the other had RHD/RHD*DOL-2. No homozygous Transfusion 2010;50(Suppl):48A. RHCE*818T sample was found. In these 290 samples, no 4. Halter Hipsky C, Lomas-Francis C, Fuchisawa A, et al. RHCE*ceCF encodes partial c and partial e but not CELO, an other RHD*DOL alleles were found. antigen antithetical to Crawford. Transfusion 2011;51:25-31 In Brazil, 1 of 244 patients with sickle cell disease (frequency of 0.004) and 1 of 171 donors (frequency of Christine Halter Hipsky, Laboratory of Immunochemistry, New 0.006) were heterozygous for RHCE*818C/T and for York Blood Center, New York, NY; Daiane Cobianchi da Costa, RHCE*ce1132C/G and, thus, are also RHCE*ceBI. The MS, Ricardo Omoto, MS, Angela Zanette, MD, Lilian Castilho, samples were not analyzed for RHD. PhD, Hemocentro-Unicamp-Campinas-Brazil, Campinas, Taking the combined data, 4 samples in a total of 705 SP, Brazil; and Marion E. Reid, PhD (corresponding author), tested had RHCE*818C/T (all 4 were RHCE*ceBI), which Laboratory of Immunochemistry, New York Blood Center, 310 gives an allele frequency of 0.006. East 67th Street, New York, NY 10065.

Conclusions

Although the numbers are small, our study shows that in the United States, the frequency of RHCE*818T

For information concerning Immunohematology or the Notice to Readers Immunohematology Methods and Procedures manual, Immunohematology is printed on acid-free paper. contact us by e-mail at [email protected]

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 67 R e v i e w XG: the forgotten blood group system

N.C. Johnson

The XG blood group system is best known for its contributions Two decades after the first example of anti-Xga was to the fields of genetics and chromosome mapping. This system reported, Goodfellow and Tippett observed a mouse a comprises two antigens, Xg and CD99, that are not antithetical monoclonal antibody, 12E7, which recognized another but that demonstrate a unique phenotypic relationship. XG is determinant that appeared to be controlled by a gene also located on the tip of the short arm of the X chromosome with 7 exons 1 to 3 present in the pseudoautosomal region of the X found on the X chromosome. This gene, MIC2, is located (and Y) chromosome(s) and exons 4 to 10 located only on the in the pseudoautosomal region of both the X and the Y X chromosome. Xga demonstrates a clear X-linked pattern of chromosomes and encodes CD99. CD99 is an adhesion inheritance. MIC2, the gene encoding the CD99 antigen, is found molecule,5,8 and high levels are associated with some in the pseudoautosomal region of both the X and Y chromosomes. types of cancer. Xga and CD99 enjoy a unique phenotypic Anti-Xga is comparatively rare, and only two examples of anti- CD99 have ever been identified. Alloanti-Xga is considered relationship, which will be discussed in further detail in clinically insignificant; only one example of autoanti-Xga has been the Genetics and Inheritance section. Fourteen years later, reported, but it resulted in severe hemolytic anemia. Insufficient in 1995, Uchikawa et al. reported the only examples of data exist to determine the clinical significance of anti-CD99. alloanti-CD99, detected in two unrelated, healthy Japanese Linkage of XG to several X-borne genes encoding inherited blood donors.2 CD99, became part of the XG blood group disorders has been demonstrated. CD99 is an adhesion molecule, system officially in 2000 when it was confirmed thatMIC2 and high levels are associated with some types of cancer. 4 Immunohematology 2011;27:68–71. and XG are adjacent, homologous genes. Because of its location in the pseudoautosomal boundary Key Words: Xga, X-linked, CD99, XG, MIC2, PBDX, 12E7, region of the sex chromosome, study of the inheritance of Lyonization, qualitative polymorphism, pseudoautosomal Xga has helped to define the mechanisms responsible for Turner, Klinefelter, and other syndromes resulting from an History abnormal number of sex chromosomes. Sex chromosome aneuploidies are commonly associated with infertility. The XG blood group system is not revered for its antigens and antibodies, but is instead respected for its Nomenclature contributions to the fields of genetics and chromosome mapping. XG is the first, and so far the only, blood group The XG blood group system has been assigned the system to be assigned to the X chromosome.1 There are ISBT symbol and number XG and 012, respectively. The only two antigens in the system: Xga and CD99. Xga may be ISBT terminology for the two antigens in the system, Xga expressed only on red blood cells (RBCs), whereas CD99 is and CD99, is listed in Table 1. No antithetical counterpart expressed on many tissue cells. Anti-Xga can be naturally to the Xga antigen has been discovered, so the failure of occurring and is not considered clinically significant. Only RBCs to react with anti-Xga defines the silent allele, Xg, or two examples of alloanti-CD99 have ever been reported; its an absence of Xga. clinical significance is unknown.2 The first example of anti-Xga was reported in 1961 in Table 1. Nomenclature the serum of a man who had been multiply transfused for Xga CD99 3 severe nosebleeds as a result of familial telangiectasia. ISBT symbol XG1 XG2 a Shortly thereafter, in 1962, Mann et al. characterized Xg ISBT number 012001 012002 as originating from a locus on the X chromosome.1 Xga is named after the X chromosome and Grand Rapids, where the first-reported patient to have the antibody (Mr. And) was Genetics and Inheritance treated.4 It was later discovered that PBDX, a gene found to span the pseudoautosomal boundary on the X chromosome, Xga is inherited as an X-linked, dominant trait, and is the gene that encodes Xga (see Molecular Basis section).5 the pattern of inheritance is as expected for an X-borne The function of the Xga protein is not known.6 characteristic.1,8 If Xga is present, it is expressed on RBCs.

68 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 XG blood group system: a review

The Xg(a+) phenotype is found in 88.7 percent of females Table 3. Relationship of Xga, Yga, and CD99 and 65.6 percent of males. (Table 2.) Females can have a Females Xg(a+) CD99 high a a a a single (Xg /Xg) or a double dose (Xg /Xg ) of Xg . Having Xg(a+w) CD99 high a only one X chromosome, males can be hemizygous for Xg Xg(a–) CD99 low (Xga/Y) or be Xg/Y and not express the antigen at all.6 Males Xg(a+) CD99 high

a Table 2. Phenotype prevalence and genotype frequencies Xg(a–) Yg CD99 high Xg(a–) Yg CD99 low Male (%) Female (%) Phenotype Xg(a+) 65.6 88.7 The presence of YG has been substantiated by family 17 a Xg(a–) 34.4 11.3 studies, but to date, there has been no Yg antigen Genotype identified. It is important to note that MIC2 is responsible Xga/Xga 0.434 for expression of CD99 on all tissue cells, but XG and YG Xga/Xg 0.450 create the CD99 quantitative polymorphism observed on 8 Xg/Xg 0.116 RBCs. Xga/Xg 0.656 Molecular Basis Xg/Xg 0.344

Sex chromosomes have two genetically distinct regions: Lyonization is a process by which one X chromosome sex chromosome–specific sequences and pseudoautosomal is inactivated early in somatic cell development in XX sequences. Pseudoautosomal refers to a structurally females.9 The process is random in each cell, ensuring homologous region on sex chromosomes, the function that all genes on the two X chromosomes are found at the of which is to facilitate pairing during male meiosis.8 XG phenotypic level. By studying RBCs of Xga/Xg women it can spans the pseudoautosomal boundary between the two be shown that all cells carry Xga, proving that Xga is not regions of the X chromosome at Xp22.3; exons 1 to 3 are subject to inactivation or Lyonization. XG was the first X located in the pseudoautosomal region (PAR) and exons 4 chromosome locus proven to escape this process.10 It was to 10 are found in the sex chromosome–specific region.4–6 later shown that MIC2 is not subject to Lyonization either.11 MIC2, the closest neighbor to XG, is located in the PAR at New Guineans, Australian aborigines, Navajo Indians, position Xp22.2. An identical copy of MIC2 is found in the and Sardinians are reported to have the highest prevalence PAR region of the Y chromosome at Yp11.2.4 Almost half of Xga. On the other hand, native Taiwanese; Chinese in (48%) of the predicted amino acid sequences of XG and Singapore, Hong Kong, Taiwan, and Hakka; and Malays in MIC2 are identical.18 Singapore are observed to have the lowest incidence.3,12–14 Interestingly, Asian populations with a higher prevalence of Biochemistry Xg(a–) phenotypes do not have a higher incidence of anti- Xga.6 Immunoblotting of immunoprecipitates confirmed that Using monoclonal antibodies, it has been shown that CD99 and Xga antigens are located on different structures, CD99 is present on all tissue cells tested15; however, the later confirmed to be sialoglycoproteins.18,19 CD99 and Xga expression of the adhesion molecule on RBCs is unique. are associated in the membrane, possibly in the form of a CD99 is expressed at different levels on RBCs, and this heterodimer.7,18 expression is directly related to the presence or absence of The RBC membrane molecule expressing Xga was first Xga .16 In females, the Xg(a–) phenotype is always associated identified in 1989 by Herron and Smith, by immunoblotting with low expression of CD99. (Table 3.) Curiously, among and electropheresis.19 Several years later, Petty and Tippett Xg(a–) males, 74 percent are high expressors of CD99.17 used immunoblotting and immunoprecipitation to show that To explain this quantitative polymorphism, Goodfellow Xga is carried on a broad band of apparent molecular weight and Tippett proposed the existence of a locus on the Y 24.5 to 29.5 kDa, consisting of a darkly stained component chromosome, YG, analogous to XG on the X chromosome. at 24.5 kDa and a more diffusely stained component Like XG, YG would have two alleles, Yga and Yg. In Xg(a–) between 26.5 and 29.5 kDa.18 No bands are observed with males, the presence of Yga would result in high expression protease-treated cells, and the apparent molecular weight of CD99, and the absence of Yga (Yg) would result in low of Xga is decreased after treatment with neuraminidase, expression of CD99.7,16 suggesting that Xga resides on a sialoglycoprotein.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 69 N.C. Johnson

Xga is sensitive to treatment with ficin, papain, trypsin, examples of anti-Xga have been shown to fix complement.1 bromelin, α-chymotrypsin, and pronase, and is resistant to The only reported example of autoanti-Xga was found in sialidase, 0.2 M dithiothreitol (DTT), neuraminidase, and a pregnant woman. The antibody appears to have caused 2-aminoethylisothiouronium bromide.4,13,20 The effects of significant hemolytic anemia, but the possibility that the acid are unknown. The expression of the antigen decreases hemolytic anemia was exacerbated by the pregnancy was as the RBC ages and it has been shown by indirect not ruled out.25 radioimmunoassay to have an in vivo half-life of 47 days.21 As a result of the sex-related frequency differences of Early experiments using a microcomplement fixation Xga, it is expected that men would make more examples of method and indirect radioimmunoassay suggested that anti-Xga. Although this is true, it is striking that greater Xga might be present on other cell lines and tissues,22 but than 85 percent of antibody makers are men when the subsequent testing was unable to duplicate these results. incidence of the Xg(a–) phenotype is only 23 percent higher XG is expressed on hematopoietic tissues8 and is strongly in men than in women. It has been postulated, although expressed as mRNA in fibroblasts.20 not studied, that this higher than expected prevalence Apart from humans, the only animals found to have of anti-Xga in men may be associated with the expression Xga on their RBCs are one species of gibbons. Of 52 gibbons of CD99.6 tested, 30 percent of males and 53 percent of females were The first example of anti-CD99 ever made was a mouse Xg(a+). Chimpanzees (67); gorillas (2); orangutans (20); monoclonal antibody called 12E7, which was generated to another species of gibbons (5); various monkeys, including screen for antigen differences in human acute lymphocytic 60 baboons; and a few nonprimates, including mice and leukemia.26 The only two examples of anti-CD99 ever dogs, were all Xg(a–).3,4 detected were found in two unrelated, healthy Japanese Monoclonal anti-CD99 identify a protein of apparent blood donors. One antibody was reported to react with molecular weight of 32 kDa.5,8 Immunoblotting and variable strength with different RBC samples. The second immunoprecipitate studies suggest the CD99 protein is blood donor had a history of pregnancy. One of the two composed of two polypeptides, a 32-kDa surface compo- siblings of the second blood donor was determined to be nent, and a 30-kDa intracellular polypeptide.18 CD99 CD99 negative also.2 The antibodies were determined to is sensitive to treatment with trypsin, α-chymotrypsin, be IgG in nature and reacted optimally by the IAT.5 It is ficin, papain, and pronase15 and, like Xga, is carried on a not known whether the antibodies were capable of binding sialoglycoprotein. CD99 is resistant to 0.2 M DTT and is complement. usually resistant to neuraminidase treatment; results vary with sialidase treatment. Clinical Significance CD99 is present on all human cell types and tissues tested.15 High levels of CD99 are a tumor marker in Ewing Alloanti-Xga has never been reported to cause sarcoma, some neuroectodermal tumors, lymphoblastic hemolytic disease of the fetus or newborn or a hemolytic lymphoma, and acute lymphoblastic leukemia.8 CD99 was transfusion reaction.4 One patient received six units of not detected on the RBCs or peripheral blood lymphocytes antigen-positive blood with no signs of a reaction.27 A of 10 gibbons, regardless of their Xga phenotype. CD99 chromium survival study on another patient showed normal was detected on RBCs and fibroblasts of chimpanzees and survival of Xg(a+) RBCs and no posttransfusion increase gorillas, but not of orangutans or any of the other mammals in antibody strength.28 One male Japanese patient had a tested.23 slight temperature elevation and exhibited urticaria when transfused with Xg(a+) blood. Subsequent transfusions Antibodies in the System with Xg(a–) blood were tolerated with no symptoms.29 The one example of autoanti-Xga reported was Anti-Xga is comparatively rare; most immunohema- identified in a pregnant female. The antibody was IgG in tologists will never see anti-Xga in their careers. When nature, activated complement, and caused severe hemolytic identified, it is usually found as a lone antibody specificity. anemia. The infant was Xg(a+) and demonstrated a strongly Some examples of anti-Xga are naturally occurring, yet positive direct antiglobulin test at birth, and anti-Xga was are more frequently IgG than IgM.4 Optimal methods for eluted from the infant’s cells. The clinical course was identification include room temperature incubation (even remarkable only for a mild rise in bilirubin after birth.25 when they are IgG in composition3), indirect antiglobulin Because the only two examples of anti-CD99 were test (IAT), and capillary testing.4 One IAT-reactive anti- found in healthy blood donors, information on the clinical Xga was shown to have IgG1 and IgG2 subclasses.24 Some significance of this antibody is not known.

70 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 XG blood group system: a review

13. Siniscalco M, Filippi G, Latte B, et al. Failure to detect XG is linked to genes responsible for several genetic linkage between Xg and other X-borne loci in Sardinians. 3,4 disorders. Ichthyosis is a disorder in which the skin Ann Hum Genet 1966;29:231–52. resembles scales on a fish. Ocular albinism is unique in that 14. Simmons RT. X-linked blood groups, Xg, in Australian only the eyes lack pigment. Retinoschisis is a sex-linked Aborigines and New Guineans. Nature 1970;227:1363. 15. Goodfellow P. Expression of the 12E7 antigen is controlled form of macular degeneration affecting only men. High independently by genes on the human X and Y chromosomes. levels of CD99 have been reported in Ewing sarcoma, some Differentiation 1983;23(Suppl):S35–9. neuroectodermal tumors, lymphoblastic lymphoma, and 16. Goodfellow PN, Tippett P. A human quantitative poly- acute lymphoblastic leukemia.8 morphism related to Xg blood groups. Nature 1981;289: 404–5. 17. Tippett P, Shaw M-A, Green CA, Daniels GL. The 12E7 red Summary and Future Perspectives cell quantitative polymorphism: control by the Y-borne locus, Yg. Ann Hum Genet 1986;50(Pt 4):339–47. The XG blood group system is most important for the 18. Petty AC, Tippett P. Investigation of the biochemical a insight it has provided into the study and understanding of relationship of the blood group antigens Xg and CD99 (12E7 antigen) on red cells. Vox Sang 1995;69:231–5. meiotic errors that lead to sex chromosome aneuploidies. As 19. Herron R, Smith GA. Identification and immunochemical the roles of Xga and CD99 become more clearly delineated, characterization of the human erythrocyte membrane knowledge of the forgotten blood group system may aid in glycoproteins that carry the Xga antigen. Biochem J 1989; the development of cures for certain genetic disorders and 262:369–71. 20. Ellis NA, Ye T-Z, Patton S, German J, Goodfellow PN, Weller types of cancers. P. Cloning of PBDX, and MIC2-related gene that spans the pseudoautosomal boundary on chromosome Xp. Nat Genet References 1994;6:394–400. 21. Campana T, Szabo P, Piomelli S, Siniscalco M. The Xga 1. Mann JD, Cahan A, Gelb AG, et al. A sex-linked blood group. antigen on red cells and fibroblasts. Cytogenet Cell Genet Lancet 1962;1:8–10. 1978;22:524–6. 2. Uchikawa M, Tsuneyama H, Tadokoro K, Juji T, Yamada 22. Fellous M, Bengtsson B, Finnegan D, Bodmer WF. Expression M, Maeda Y. An alloantibody to 12E7 antigen detected in 2 of the Xga antigen on cells in culture and its segregation in healthy donors [abstract]. Transfusion 1995;35:23S. somatic cell hybrids. Ann Hum Genet 1974;37:421–30. 3. Race RR, Sanger R. The Xg blood groups. In: Blood groups 23. Shaw MA, Tippet P, Delhanty JD, Andrews M, Goodfellow in man. 6th ed. Oxford, PA: Blackwell Scientific Publication, P. Expression of Xg and the 12E7 antigen in primates. J 1975:578–635. Immunogenet 1985;12:115–18. 4. Reid ME, Lomas-Francis C. The blood group antigen 24. Devenish A, Burslem MF, Morris R, Contreras M. Serologic factsbook. 2nd ed. San Diego, CA: Academic Press, 2004: characteristics of a further example of anti-Xga in North 338–43. London blood donors. Transfusion 1986;26:426–7. 5. Ellis N, Tippett P, Petty A, et al. PBDX is the XG blood group 25. Yokoyama M, McCoy JE Jr. Further studies on auto-anti- gene. Nat Genet 1994;8:285–90. Xga antibody. Vox Sang 1967;13:15–17. 6. Issitt PD, Anstee DJ. Applied blood group serology. 4th ed. 26. Levy R, Dilley J, Fox RI, Warnke R. A human thymus- Durham, NC: Montgomery Scientific Publications, 1998. leukemia antigen defined by hybridoma monoclonal 7. Daniels G. Xg blood group system. In: Human blood groups. antibodies. Proc Natl Acad Sci U S A 1979;76:6552–6. 2nd ed. Malden, MA: Blackwell Science, 2002:374–86. 27. Cook IA, Polley MJ, Mollison PL. A second example of anti- 8. Tippett P, Ellis NA. The Xg blood group system: a review. Xga. Lancet 1963;1:857–9. Transfus Med Rev 1998;12:233–57. 28. Sausais L, Krevans JR, Townes AS. Characteristics of a third 9. Lyon MF. Gene action in the X-chromosome of the mouse example of anti-Xga [abstract]. Transfusion 1964;4:312. (Mus musculus L.). Nature 1961;190:372–3. 29. Azar PM, Saji H, Yamanaka R, Hosoi T. Anti-Xga suspected 10. Lawler SD, Sanger R. Xg blood-groups and clonal-origin of causing a transfusion reaction. Transfusion 1982;22: theory of chronic myeloid leukaemia. Lancet 1970;1:584–5. 340–1. 11. Goodfellow P, Pym B, Mohandas T, Shapiro LJ. The cell surface antigen locus, MIC2X, escapes X-inactivation. Am J Nanette C. Johnson, MT(ASCP)SBB, Director, Immunohematol- Hum Genet 1984;36:777–82. 12. Dewey WJ, Mann JD. Xg blood group frequencies in some ogy Reference Laboratory, Greater Chesapeake and Potomac further populations. J Med Genet 1967;4:12–15. Region, 4700 Mt. Hope Drive, Baltimore, MD 21215.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 71 C o m m u n i c at i o n

Erratum Vo l . 27, N o. 1, 2011, p p. 14, 16, a n d 18 Red blood cell phenotype matching for various ethnic groups The author has informed the editors of Immunohematology that there is an error on pages 14, 16, and 18. The running head should appear as K.S.W. Badjie et al.

Free Classified Ads and Announcements

Immunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.) without charge. Deadlines for receipt of these items are as follows:

Deadlines 1st week in January for the March issue 1st week in July for the September issue 1st week in April for the June issue 1st week in October for the December issue

E-mail or fax information to [email protected] or phone (215) 451-2538

72 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 A n n o u n c e m e n t s

Monoclonal antibodies available at no charge: Specialist in Blood Bank (SBB) Program The New York Blood Center has developed a wide range of The Department of Transfusion Medicine, National monoclonal antibodies (both murine and humanized) that Institutes of Health, is accepting applications for its 1-year are useful for donor screening and for typing RBCs with a Specialist in Blood Bank Technology Program. Students are positive DAT. These include anti-A1, -M, -s, -U, -D, -Rh17, federal employees who work 32 hours/week. This program -K, -k, -Kpa, -Jsb, -Fya, -Fy3, -Fy6, -Wrb, -Xga, -CD99, -Dob, introduces students to all areas of transfusion medicine -H, -Ge2, -Ge3, -CD55 (both SCR2/3 and SCR4), -Oka, -I, including reference serology, cell processing, HLA, and and anti-CD59. Most of the antibodies are murine IgG and infectious disease testing. Students also design and require the use of anti-mouse IgG for detection (Anti-K, conduct a research project. NIH is an Equal Opportunity a -k, and -Kp ). Some are directly agglutinating (Anti-A1, -M, Organization. Application deadline is December 31, 2011, -Wrb, and -Rh17) and a few have been humanized into the for the July 2012 class. See www.cc.nih.gov/dtm > education IgM isoform (Anti-Jsb). The antibodies are available at no for brochure and application. For further information charge to anyone who requests them. Please visit our Web contact Karen M. Byrne at (301) 451-8645 or KByrne@ site for a complete list of available monoclonal antibodies mail.cc.nih.gov and the procedure for obtaining them.

For additional information, contact: Gregory Halverson, New York Blood Center, 310 East 67th Street, New York, NY 10021/e-mail: [email protected], phone: (212) 570-3026, FAX: (212) 737-4935, or visit the Web site at www.nybloodcenter.org >research >laboratories >immunochemistry >current list of monoclonal antibodies available.

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 73 Announcements, cont.

74 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 A dv e r t i s e m e n t s

Masters (MSc) in Transfusion and Transplantation Sciences at The University of Bristol, England

Applications are invited from medical or science graduates for the Master of Science (MSc) degree in Transfusion and Transplantation Sciences at the University of Bristol. The course starts in October 2011 and will last for 1 year. A part-time option lasting 2 or 3 years is also available. There may also be opportunities to continue studies for PhD or MD following the MSc. The syllabus is organized jointly by The Bristol Institute for Transfusion Sciences and the University of Bristol, Department of Pathology and Microbiology. It includes: • Scientific principles of transfusion and transplantation • Clinical applications of these principles • Practical techniques in transfusion and transplantation • Principles of study design and biostatistics • An original research project

Application can also be made for Diploma in Transfusion and Transplantation Science or a Certificate in Transfusion and Transplantation Science.

The course is accredited by the Institute of Biomedical Sciences.

Further information can be obtained from the Web site: http://ibgrl.blood.co.uk/MSc/MscHome.htm

For further details and application forms please contact:

Dr Patricia Denning-Kendall University of Bristol Paul O’Gorman Lifeline Centre Department of Pathology and Microbiology Southmead Hospital Westbury-on-Trym, Bristol BS10 5NB, England Fax +44 1179 595 342, Telephone +44 1779 595 455, e-mail: [email protected].

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 75 Advertisements, cont.

National Platelet Serology Reference Laboratory National Neutrophil Serology Reference Laboratory

Diagnostic testing for: Our laboratory specializes in granulocyte antibody detection • Neonatal alloimmune thrombocytopenia (NAIT) and granulocyte antigen typing. • Posttransfusion purpura (PTP) • Refractoriness to platelet transfusion Indications for granulocyte serology testing • Heparin-induced thrombocytopenia (HIT) include: • Alloimmune idiopathic thrombocytopenia purpura (AITP) • Alloimmune neonatal neutropenia (ANN) Medical consultation available • Autoimmune neutropenia (AIN) Test methods: • Transfusion-related acute lung injury (TRALI) • GTI systems tests Methodologies employed: — detection of glycoprotein-specific platelet antibodies • Granulocyte agglutination (GA) — detection of heparin-induced antibodies (PF4 ELISA) • Platelet suspension immunofluorescence test (PSIFT) • Granulocyte immunofluorescence by flow cytometry (GIF) • Solid phase red cell adherence (SPRCA) assay • Monoclonal antibody immobilization of neutrophil antigens • Monoclonal immobilization of platelet antigens (MAIPA) (MAINA) • Molecular analysis for HPA-1a/1b TRALI investigations also include: For further information, contact: • HLA (PRA) Class I and Class II antibody detection Platelet Serology Laboratory (215) 451-4205 For further information, contact: Janet Demcoe (215) 451-4914 Neutrophil Serology Laboratory (651) 291-6797 [email protected] Sandra Nance (215) 451-4362 Randy Schuller (651) 291-6758 [email protected] [email protected]

American Red Cross Biomedical Services American Red Cross Biomedical Services Musser Blood Center Neutrophil Serology Laboratory 700 Spring Garden Street 100 South Robert Street Philadelphia, PA 19123-3594 CLIA licensed St. Paul, MN 55107 CLIA licensed

76 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Advertisements, cont.

Reference and Consultation Services IgA/Anti-IgA Testing

Antibody identification and problem resolution IgA and anti-IgA testing are available to do the

HLA-A, B, C, and DR typing following:

HLA-disease association typing • Identify IgA-deficient patients • Investigate anaphylactic reactions Paternity testing/DNA • Confirm IgA-deficient donors Our ELISA for IgA detects protein to 0.05 mg/dL. For information, contact:

Mehdizadeh Kashi For additional information contact:

at (503) 280-0210 Janet Demcoe at (215) 451-4914,

or e-mail: or write to: [email protected],

Tissue Typing Laboratory or write to: American Red Cross Biomedical Services American Red Cross Biomedical Services

Pacific Northwest Region Musser Blood Center 700 Spring Garden Street 3131 North Vancouver Philadelphia, PA 19123-3594 Portland, OR 97227 ATTN: Janet Demcoe CLIA licensed, ASHI accredited CLIA licensed

National Reference Laboratory Donor IgA Screening for Blood Group Serology • Effective tool for screening large volumes of donors Immunohematology Reference Laboratory • Gel diffusion test that has a 15-year proven track record: AABB, ARC, New York State, and CLIA licensed 24-hour phone number: Approximately 90 percent of all donors identified as (215) 451-4901 IgA deficient by this method are confirmed by the more Fax: sensitive testing methods (215) 451-2538

American Rare Donor Program For additional information : 24-hour phone number: (215) 451-4900 Kathy Kaherl Fax: at (860) 678-2764 (215) 451-2538 [email protected] e-mail: Immunohematology [email protected] Phone, business hours: (215) 451-4902 or write to: Fax: (215) 451-2538 Reference Laboratory [email protected] American Red Cross Biomedical Services Quality Control of Cryoprecipitated–AHF Connecticut Region Phone, business hours: 209 Farmington Ave. (215) 451-4903 Farmington, CT 06032 Fax: (215) 451-2538 CLIA licensed

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 77 Advertisements, cont.

Becoming a Specialist in Blood Banking (SBB)

What is a certified Specialist in Blood Banking (SBB)? • Someone with educational and work experience qualifications that successfully passes the American Society for Clinical Pathology (ASCP) board of certification (BOC) examination for the Specialist in Blood Banking. • This person will have advanced knowledge, skills, and abilities in the field of transfusion medicine and blood banking.

Individuals who have an SBB certification serve in many areas of transfusion medicine: • Serve as regulatory, technical, procedural, and research advisors • Perform and direct administrative functions • Develop, validate, implement, and perform laboratory procedures • Analyze quality issues preparing and implementing corrective actions to prevent and document nonconformances • Design and present educational programs • Provide technical and scientific training in transfusion medicine • Conduct research in transfusion medicine

Who are SBBs? Supervisors of Transfusion Services Executives and Managers of Blood Centers LIS Coordinators Educators Supervisors of Reference Laboratories Research Scientists Consumer Safety Officers Quality Assurance Officers Technical Representatives Reference Lab Specialists

Why become an SBB? Professional growth Job placement Job satisfaction Career advancement

How does one become an SBB? CAAHEP-accredited SBB Technology program or grandfather the exam based on ASCP education and experience criteria. Fact: In recent years, a greater percentage of individuals who graduate from CAAHEP-accredited programs pass the SBB exam compared to individuals who grandfather the exam. The BEST route for obtaining an SBB certification is to attend a CAAHEP-accredited Specialist in Blood Bank Technology Program. Which approach are you more compatible with?

Contact the following programs for more information: Additional information can be found by visiting the following Web sites: www.ascp.org, www.caahep.org, and www.aabb.org

Onsite or Program Contact Name Phone Contact Email Contact Website Online Program

Walter Reed Army Medical Center William Turcan 202-782-6210 [email protected] www.militaryblood.dod.mil/fellow Onsite American Red Cross, Southern California Region Michael Coover 909-859-7496 [email protected] none Onsite ARC-Central OH Region Joanne Kosanke 614-253-2740 x 2270 [email protected] none Onsite Blood Center of Wisconsin Lynne LeMense 414-937-6403 [email protected] www.bcw.edu Onsite Community Blood Center/CTS Dayton, Ohio Nancy Lang 937-461-3293 [email protected] www.cbccts.org/education/sbb.html Online Gulf Coast School of Blood Bank Technology Clare Wong 713-791-6201 [email protected] http://giveblood.org/index.php?page=sbb-distance-program Online Hoxworth Blood Center/University of Cincinnati Susan Wilkinson 513-558-1275 [email protected] www.hoxworth.org Onsite [email protected] Indiana Blood Center Jayanna Slayten 317-916-5186 [email protected] www.indianablood.org Online Johns Hopkins Hospital Lorraine Blagg 410-502-9584 [email protected] http://pathology.jhu.edu/department/divisions/tranfusion/ Onsite sbb2.cfm Medical Center of Louisiana Karen Kirkley 504-903-3954 [email protected] none Onsite NIH Clinical Center Department of Transfusion Medicine Karen Byrne 301-496-8335 [email protected] www.cc.nih.gov/dtm/research/sbb.html Onsite Rush University Veronica Lewis 312-942-2402 [email protected] www.rushu.rush.edu/catalog/acadprograms/chs/cls/ Online clssbbcert.html Transfusion Medicine Academic Center at Florida Blood Marjorie Doty 727-568-5433 x 1514 [email protected] www.fbsblood.org Online Services University Health System and Affiliates, San Antonio Linda Myers 210-731-5526 [email protected] www.sbbofsa.org Onsite University of Texas Medical Branch at Galveston Janet Vincent 409-772-3055 [email protected] www.utmb.edu/sbb Online University of Texas SW Medical Center LeAnne Hutson 214-648-1780 [email protected] http://utsouthwestern.edu/mls Online Revised August 2009

78 IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 Immunohematology Journal of Blood Group Serology and Education Instructions for Authors

I. GENERAL INSTRUCTIONS c. Place explanation in footnotes (sequence: *, †, ‡, §, ¶, **, ††). Before submitting a manuscript, consult current issues of 8. Figures Immunohematology for style. Double-space throughout the manuscript. a. Figures can be submitted either by e-mail or as photographs Number the pages consecutively in the upper right-hand corner, beginning (5ʺ×7ʺ glossy). with the title page. b. Place caption for a figure on a separate page (e.g. Fig. 1 Results II. SCIENTIFIC ARTICLE, REVIEW, OR CASE REPORT WITH of...), ending with a period. If figure is submitted as a glossy, LITERATURE REVIEW place first author’s name and figure number on back of each A. Each component of the manuscript must start on a new page in the glossy submitted. following order: c. When plotting points on a figure, use the following symbols if 1. Title page possible: l l s s n n. 2. Abstract 9. Author information 3. Text a. List first name, middle initial, last name, highest degree, 4. Acknowledgments 5. References position held, institution and department, and complete address 6. Author information (including ZIP code) for all authors. List country when applicable. 7. Tables III. EDUCATIONAL FORUM 8. Figures A. All submitted manuscripts should be approximately 2000 to 2500 words B. Preparation of manuscript 1. Title page with pertinent references. Submissions may include: a. Full title of manuscript with only first letter of first word 1. An immunohematologic case that illustrates a sound investigative capitalized (bold title) approach with clinical correlation, reflecting appropriate b. Initials and last name of each author (no degrees; all CAPS), e.g., collaboration to sharpen problem solving skills M.T. JONES, J.H. BROWN, AND S.R. SMITH 2. Annotated conference proceedings c. Running title of ≤40 characters, including spaces d. Three to ten key words B. Preparation of manuscript 2. Abstract 1. Title page a. One paragraph, no longer than 300 words a. Capitalize first word of title. b. Purpose, methods, findings, and conclusion of study b. Initials and last name of each author (no degrees; all CAPs) 3. Key words 2. Text a. List under abstract a. Case should be written as progressive disclosure and may 4. Text (serial pages): Most manuscripts can usually, but not necessarily, be divided into sections (as described below). Survey include the following headings, as appropriate results and review papers may need individualized sections i. Clinical Case Presentation: Clinical information and a. Introduction — Purpose and rationale for study, including differential diagnosis pertinent background references ii. Immunohematologic Evaluation and Results: Serology and b. Case Report (if indicated by study) — Clinical and/or hematologic molecular testing data and background serology/molecular iii. Interpretation: Include interpretation of laboratory results, c. Materials and Methods — Selection and number of subjects, correlating with clinical findings samples, items, etc. studied and description of appropriate controls, procedures, methods, equipment, reagents, etc. iv. Recommended Therapy: Include both transfusion and Equipment and reagents should be identified in parentheses by nontransfusion-based therapies model or lot and manufacturer’s name, city, and state. Do not v. Discussion: Brief review of literature with unique features of use patient’s names or hospital numbers. this case d. Results — Presentation of concise and sequential results, vi. Reference: Limited to those directly pertinent referring to pertinent tables and/or figures, if applicable vii. Author information (see II.B.9.) e. Discussion — Implication and limitations of the study, links to viii. Tables (see II.B.7.) other studies; if appropriate, link conclusions to purpose of study as stated in introduction IV. LETTER TO THE EDITOR 5. Acknowledgments: Acknowledge those who have made substantial contributions to the study, including secretarial assistance; list any A. Preparation grants. 1. Heading (To the Editor) 6. References 2. Title (first word capitalized) a. In text, use superscript, Arabic numbers. 3. Text (written in letter [paragraph] format) b. Number references consecutively in the order they occur in the 4. Author(s) (type flush right; for first author: name, degree, institution, text. address [including city, state, Zip code and country]; for other 7. Tables a. Head each with a brief title; capitalize the first letter of first word authors: name, degree, institution, city and state) (e.g., Table 1. Results of . . .) use no punctuation at the end of 5. References (limited to ten) the title. 6. Table or figure (limited to one) b. Use short headings for each column needed and capitalize first letter of first word. Omit vertical lines. Send all manuscripts by e-mail to [email protected]

IMMUNOHEMATOLOGY, Volume 27, Number 2, 2011 79

Blood Group Antigens & Antibodies A guide to clinical relevance & technical tips by Marion E. Reid & Christine Lomas-Francis This compact “pocketbook” from the authors of the Blood Group Antigen FactsBook is a must for anyone who is involved in the laboratory or bedside care of patients with blood group alloantibodies. The book contains clinical and technical information about the nearly 300 ISBT recognized blood group antigens and their corresponding antibodies. The information is listed in alphabetical order for ease of finding—even in the middle of the night. Included in the book is information relating to: • Clinical significance of antibodies in transfusion and HDN. • Number of compatible donors that would be expected Ordering Information to be found in testing 100 donors. Variations in different The book, which costs $25, can be ethnic groups are given. ordered in two ways: • Characteristics of the antibodies and optimal technique(s) • Order online from the publisher for their detection. at: www.sbbpocketbook.com • Technical tips to aid their identification. • Order from the authors, who • Whether the antibody has been found as an autoantibody. will sign the book. Send a check, made payable to “New York Blood Center” and indicate “Pocket Pocketbook Education Fund book” on the memo line, to: The authors are using royalties generated from the sale of this pocketbook for educational purposes to mentor people Marion Reid in the joys of immunohematology as a career. They will Laboratory of Immunochemistry accomplish this in the following ways: New York Blood Center • Sponsor workshops, seminars, and lectures 310 East 67th Street • Sponsor students to attend a meeting New York, NY 10065 • Provide copies of the pocketbook Please include the recipient’s (See www.sbbpocketbook.com for details to apply for funds) complete mailing address. FIRST CLASS U.S. POSTAGE PAID SOUTHERN MD Musser Blood Center PERMIT NO. 4144 700 Spring Garden Street Philadelphia, PA 19123-3594

(Place Label Here)