DOCSLIB.ORG

Genome-Wide Screen Reveals WNT11, a Non-Canonical WNT Gene, As a Direct Target of ETS Transcription Factor ERG

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Screen Reveals WNT11, a Non-Canonical WNT Gene, As a Direct Target of ETS Transcription Factor ERG Oncogene (2011) 30, 2044–2056 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE Genome-wide screen reveals WNT11, a non-canonical WNT gene, as a direct target of ETS transcription factor ERG LH Mochmann1, J Bock1, J Ortiz-Ta´nchez1, C Schlee1, A Bohne1, K Neumann2, WK Hofmann3, E Thiel1 and CD Baldus1 1Department of Hematology and Oncology, Charite´, Campus Benjamin Franklin, Berlin, Germany; 2Institute for Biometrics and Clinical Epidemiology, Charite´, Campus Mitte, Berlin, Germany and 3Department of Hematology and Oncology, University Hospital Mannheim, Mannheim, Germany E26 transforming sequence-related gene (ERG) is a current therapies in acute leukemia patients with poor transcription factor involved in normal hematopoiesis prognosis characterized by high ERG mRNA expression. and is dysregulated in leukemia. ERG mRNA over- Oncogene (2011) 30, 2044–2056; doi:10.1038/onc.2010.582; expression was associated with poor prognosis in a subset published online 17 January 2011 of patients with T-cell acute lymphoblastic leukemia (T-ALL) and acute myeloid leukemia (AML). Herein, a Keywords: ETS-related gene (ERG); WNT11; acute genome-wide screen of ERG target genes was conducted leukemia; ERG target genes; 6-bromoindirubin-3-oxime by chromatin immunoprecipitation-on-chip (ChIP-chip) in (BIO); morphological transformation Jurkat cells. In this screen, 342 significant annotated genes were derived from this global approach. Notably, ERG-enriched targets included WNT signaling genes: WNT11, WNT2, WNT9A, CCND1 and FZD7. Further- more, chromatin immunoprecipitation (ChIP) of normal Introduction and primary leukemia bone marrow material also confirmed WNT11 as a target of ERG in six of seven The erythroblastosis virus E26 transforming sequence patient samples. A larger sampling of patient diagnostic (ETS) encodes the ETS-related gene (ERG) that has an material revealed that ERG and WNT11 mRNA were co- important physiological role in hematopoiesis (Loughran expressed in 80% of AML (n ¼ 30) and 40% in T-ALL et al., 2008), angiogenesis (Birdsey et al., 2008), vascular (n ¼ 30) bone marrow samples. Small interfering RNA (Ellett et al., 2009) and bone development (Iwamoto (siRNA)-mediated knockdown of ERG confirmed down- et al., 2007). ERG belongs to the highly conserved ETS transcription factor family that is defined by the ETS regulation of WNT11 transcripts. Conversely, in a tet-on 0 0 ERG-inducible assay, WNT11 transcripts were co- DNA-binding motif 5 -GGA(A/T)-3 (Sharrocks, 2001; stimulated. A WNT pathway agonist, 6-bromoindirubin- Wei et al., 2010). In hematopoietic development, ERG 3-oxime (BIO), was used to determine the effect of cell has long been postulated to function during early stages growth on the ERG-inducible cells. The addition of BIO of T-cell development as its mRNA abundance peaks resulted in an ERG-dependent proliferative growth and diminishes as cells undergo T-lineage commitment advantage over ERG-uninduced cells. Finally, ERG (Anderson et al., 1999). In addition, ectopic ERG induction prompted morphological transformation where- expression was shown to induce megakaryocytic differ- by round unpolarized K562 cells developed elongated entiation in human K562 cells (Rainis et al., 2005) and protrusions and became polarized. This morphological in hematopoietic progenitors ERG promotes expansion transformation could effectively be inhibited with BIO of megakaryocytes (Stankiewicz and Crispino, 2009). and with siRNA knockdown of WNT11. In conclusion, ERG function was further characterized by Loughran ERG transcriptional networks in leukemia converge on et al. in heterozygous mice harboring a missense muta- WNT signaling targets. Specifically, WNT11 emerged as tion that phenotypically displayed mild cytopenia in a direct target of ERG. Potent ERG induction promoted the B-cell compartment and notably had a reduction morphological transformation through WNT11 signals. of progenitor cells by 50%. Furthermore, homozygosity The findings in this study unravel new ERG-directed for the same mutation failed to establish definitive hemato- molecular signals that may contribute to the resistance of poiesis at the embryonic stage. Thus, normal ERG function was necessary to establish and maintain hematopoiesis. ERG dysregulation has been reported in solid tumors and hematological malignancies. Three fusion proteins Correspondence: Dr CD Baldus, Department of Hematology and composed of ERG with TMPRSS2 (Tomlins et al., Oncology, Charite´, Campus Benjamin Franklin, Hindenburgdamm 30, 2005; Klezovitch et al., 2008), EWS (Sorensen et al., 12203 Berlin, Germany. E-mail: [email protected] 1994) or TLS (Kong et al., 1997) create oncogenic Received 14 July 2010; revised 2 November 2010; accepted 23 November proteins. The most frequent chromosomal fusion in 2010; published online 17 January 2011 prostate cancer consists of the 50-untranslated region of ERG genome-wide screen in acute leukemia LH Mochmann et al 2045 TMPRSS2 fused with 30-end ERG. This fusion has ChIP (C20) and with double (C20 and C17) precipitat- multiple variants, of which two of the most common ing antibodies for increased accessibility to multiple variants are associated with poor outcome (Narod et al., ERG epitopes (refer to Materials and methods for a 2008). In leukemia, ERG overexpression is also believed detailed description). Each ChIP with single and double to contribute to the molecular pathogenesis in a sub- precipitating antibodies was carried out in duplicate. set of T-cell acute lymphoblastic leukemia (T-ALL) and The in vivo assay allowed for the enrichment and acute myeloid leukemia (AML) patients. High ERG identification of ERG-bound DNA sequences that were expressers were associated with an inferior clinical subsequently hybridized to a high-resolution human outcome (Marcucci et al., 2005; Baldus et al., 2006). promoter chip. Duplicate ChIP-chips 1 and 3 (single- The pathogenesis of ERG was also observed in antibody ChIP) resulted in 13 070 and 4405 signifi- sublethally irradiated mice transplanted with ERG cant peaks, respectively. Duplicate ChIP-chips 2 and 4 transduced progenitor cells, whereby megakaryoblastic (double-antibody ChIP) resulted in 11 227 and 6630 leukemia developed (Salek-Ardakani et al., 2009). Thus, significant peaks, respectively. As expected, many several clinical and experimental studies indicate that significant peaks were detected at individual gene ERG contributes to the pathogenesis in cancer and promoters, which yielded 1683, 3066, 1304 and 973 leukemia; however, the underlying biological mechan- single genes, in ChIP-chips 1–4, respectively. Pooled isms are not yet fully understood. gene sets from ChIP-chips 1 and 3 are denoted as ChIP- To unravel the molecular function of ERG in acute chip I and pooled gene sets from ChIP-chips 2 and 4 are leukemia, we have conducted a genome-wide screen of denoted as ChIP-chip II. Finally, only overlapping genes ERG target genes. Chromatin immunoprecipitation- from ChIP-chips I and II were combined to condense on-chip (ChIP-chip) analyses of ERG candidate target the significant candidate gene pool to 342 gene annota- genes revealed that ERG may participate in a broader tions (Table 1). DAVID Functional Annotation Tool spectrum of biological signaling than previously des- (Laboratory of Immunopathogenesis and Bioinfor- cribed. ERG loss and gain of function experiments matics, Frederick, MD, USA) was used to characterize directly affected WNT11, a non-canonical WNT path- biological themes (Table 2). Statistically enriched gene way gene. Moreover, a proliferative growth advantage ontology categories suggest a broad functional role for was observed when ERG-induced cells were treated ERG that included developmental processes, multi- with WNT agonist 6-bromoindirubin-3-oxime (BIO) cellular processes, biological adhesion and biological and a glycogen synthase-3b (GSK-3b) inhibitor. Finally, regulation (P-value o0.05). Furthermore, ERG candi- co-expression of ERG and WNT11 stimulated morpho- date genes subjected to Ingenuity Pathway Analyses logical transformation of round hematopoietic cells to revealed an overlap of enriched WNT target genes in polarized cells with protrusions upon ERG induction. In several key developmental pathways (Table 3). addition, the elongation process of ERG-induced cells was effectively inhibited by the addition of BIO and with small interfering RNA (siRNA)-mediated knockdown Validation of enriched promoter regions and selection of WNT11. These findings show that in human leukemia of ERG target genes WNT11 is a direct target of ERG and highlight a role Based on the gene’s described relevance to hemato- for ERG in the WNT signaling pathway. poiesis and leukemia in the scientific literature (versus a random calculated approach), 24 of the 342 enriched promoter regions were selected for further examination. MATCH algorithm was used to determine the signifi- Results cance and location of conserved ETS-binding motif (5-GGAA/T-3) in each of the 24 putative promoter Genome-wide screen of ERG candidate genes regions up to 2 kb from the transcription start site (TSS) ERG transcriptional networks in leukemia are un- (Table 4 and Supplementary Table 1). In all, 17 of 24 known. Thus, in order to construct ERG-related selected targets were confirmed by quantitative PCR, networks, a genome-wide screen by ChIP-chip was with at least twofold enrichment relative to total chro- conducted in a human T-cell leukemia line, Jurkat. ChIP matin
Load more

Recommended publications
  • Dedifferentiation by Adenovirus E1A Due to Inactivation of Hippo Pathway Effectors YAP and TAZ
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Dedifferentiation by adenovirus E1A due to inactivation of Hippo pathway effectors YAP and TAZ Nathan R. Zemke, Dawei Gou, and Arnold J. Berk Molecular Biology Institute, University of California at Los Angeles, Los Angeles, California 90095, USA Adenovirus transformed cells have a dedifferentiated phenotype. Eliminating E1A in transformed human embryonic kidney cells derepressed ∼2600 genes, generating a gene expression profile closely resembling mesenchymal stem cells (MSCs). This was associated with a dramatic change in cell morphology from one with scant cytoplasm and a globular nucleus to one with increased cytoplasm, extensive actin stress fibers, and actomyosin-dependent flat- tening against the substratum. E1A-induced hypoacetylation at histone H3 Lys27 and Lys18 (H3K27/18) was reversed. Most of the increase in H3K27/18ac was in enhancers near TEAD transcription factors bound by Hippo signaling-regulated coactivators YAP and TAZ. E1A causes YAP/TAZ cytoplasmic sequestration. After eliminating E1A, YAP/TAZ were transported into nuclei, where they associated with poised enhancers with DNA-bound TEAD4 and H3K4me1. This activation of YAP/TAZ required RHO family GTPase signaling and caused histone acetylation by p300/CBP, chromatin remodeling, and cohesin loading to establish MSC-associated enhancers and then superenhancers. Consistent results were also observed in primary rat embryo kidney cells, human fibroblasts, and human respiratory tract epithelial cells. These results together with earlier studies suggest that YAP/TAZ function in a developmental checkpoint controlled by signaling from the actin cytoskeleton that prevents differ- entiation of a progenitor cell until it is in the correct cellular and tissue environment.
    [Show full text]
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • Genome-Wide Analysis of Transcriptional Bursting-Induced Noise in Mammalian Cells
    bioRxiv preprint doi: https://doi.org/10.1101/736207; this version posted August 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Genome-wide analysis of transcriptional bursting-induced noise in mammalian cells Authors: Hiroshi Ochiai1*, Tetsutaro Hayashi2, Mana Umeda2, Mika Yoshimura2, Akihito Harada3, Yukiko Shimizu4, Kenta Nakano4, Noriko Saitoh5, Hiroshi Kimura6, Zhe Liu7, Takashi Yamamoto1, Tadashi Okamura4,8, Yasuyuki Ohkawa3, Itoshi Nikaido2,9* Affiliations: 1Graduate School of Integrated Sciences for Life, Hiroshima University, Higashi-Hiroshima, Hiroshima, 739-0046, Japan 2Laboratory for Bioinformatics Research, RIKEN BDR, Wako, Saitama, 351-0198, Japan 3Division of Transcriptomics, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Fukuoka, 812-0054, Japan 4Department of Animal Medicine, National Center for Global Health and Medicine (NCGM), Tokyo, 812-0054, Japan 5Division of Cancer Biology, The Cancer Institute of JFCR, Tokyo, 135-8550, Japan 6Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Kanagawa, 226-8503, Japan 7Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA, 20147, USA 8Section of Animal Models, Department of Infectious Diseases, National Center for Global Health and Medicine (NCGM), Tokyo, 812-0054, Japan 9Bioinformatics Course, Master’s/Doctoral Program in Life Science Innovation (T-LSI), School of Integrative and Global Majors (SIGMA), University of Tsukuba, Wako, 351-0198, Japan *Corresponding authors Corresponding authors e-mail addresses Hiroshi Ochiai, [email protected] Itoshi Nikaido, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/736207; this version posted August 15, 2019.
    [Show full text]
  • EGFR Confers Exquisite Specificity of Wnt9a-Fzd9b Signaling in Hematopoietic Stem Cell Development
    bioRxiv preprint doi: https://doi.org/10.1101/387043; this version posted August 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Grainger, et al, 2018 EGFR confers exquisite specificity of Wnt9a-Fzd9b signaling in hematopoietic stem cell development Stephanie Grainger1, Nicole Nguyen1, Jenna Richter1,2, Jordan Setayesh1, Brianna Lonquich1, Chet Huan Oon1, Jacob M. Wozniak2,3,4, Rocio Barahona1, Caramai N. Kamei5, Jack Houston1,2, Marvic Carrillo-Terrazas3,4, Iain A. Drummond5,6, David Gonzalez3.4, Karl Willert#,¥,1, and David Traver¥,1,7. ¥co-corresponding authors: [email protected]; [email protected] #Lead contact 1Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, 92037, USA. 2Biomedical Sciences Graduate Program, University of California, San Diego, La Jolla, California, 92037, USA. 3Skaggs School of Pharmacy and Pharmaceutical Science, University of California, San Diego, La Jolla, California, 92093, USA. 4Department of Pharmacology, University of California, San Diego, La Jolla, California, 92092 5Massachusetts General Hospital Nephrology Division, Charlestown, Massachusetts, 02129, USA. 6Harvard Medical School, Department of Genetics, Boston MA 02115 7Section of Cell and Developmental Biology, University of California, San Diego, La Jolla, California, 92037, USA. Running title: A mechanism for Wnt-Fzd specificity in hematopoietic stem cells Keywords: hematopoietic stem cell (HSC), Wnt, Wnt9a, human, zebrafish, Fzd, Fzd9b, FZD9, EGFR, APEX2 1 bioRxiv preprint doi: https://doi.org/10.1101/387043; this version posted August 7, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Understanding the Role of the Chromosome 15Q25.1 in COPD Through Epigenetics and Transcriptomics
    European Journal of Human Genetics (2018) 26:709–722 https://doi.org/10.1038/s41431-017-0089-8 ARTICLE Understanding the role of the chromosome 15q25.1 in COPD through epigenetics and transcriptomics 1 1,2 1,3,4 5,6 5,6 Ivana Nedeljkovic ● Elena Carnero-Montoro ● Lies Lahousse ● Diana A. van der Plaat ● Kim de Jong ● 5,6 5,7 6 8 9 10 Judith M. Vonk ● Cleo C. van Diemen ● Alen Faiz ● Maarten van den Berge ● Ma’en Obeidat ● Yohan Bossé ● 11 1,12 12 1 David C. Nickle ● BIOS Consortium ● Andre G. Uitterlinden ● Joyce J. B. van Meurs ● Bruno C. H. Stricker ● 1,4,13 6,8 5,6 1 1 Guy G. Brusselle ● Dirkje S. Postma ● H. Marike Boezen ● Cornelia M. van Duijn ● Najaf Amin Received: 14 March 2017 / Revised: 6 November 2017 / Accepted: 19 December 2017 / Published online: 8 February 2018 © The Author(s) 2018. This article is published with open access Abstract Chronic obstructive pulmonary disease (COPD) is a major health burden in adults and cigarette smoking is considered the most important environmental risk factor of COPD. Chromosome 15q25.1 locus is associated with both COPD and smoking. Our study aims at understanding the mechanism underlying the association of chromosome 15q25.1 with COPD through epigenetic and transcriptional variation in a population-based setting. To assess if COPD-associated variants in 1234567890();,: 15q25.1 are methylation quantitative trait loci, epigenome-wide association analysis of four genetic variants, previously associated with COPD (P < 5 × 10−8) in the 15q25.1 locus (rs12914385:C>T-CHRNA3, rs8034191:T>C-HYKK, rs13180: C>T-IREB2 and rs8042238:C>T-IREB2), was performed in the Rotterdam study (n = 1489).
    [Show full text]
  • WNT11-Conditioned Medium Promotes Angiogenesis Through the Activation of Non-Canonical WNT-PKC-JNK Signaling Pathway
    G C A T T A C G G C A T genes Article WNT11-Conditioned Medium Promotes Angiogenesis through the Activation of Non-Canonical WNT-PKC-JNK Signaling Pathway § Jingcai Wang y, Min Gong z, Shi Zuo , Jie Xu, Chris Paul, Hongxia Li k, Min Liu, Yi-Gang Wang, Muhammad Ashraf ¶ and Meifeng Xu * Department of Pathology and Laboratory Medicine, University of Cincinnati Medical Center, Cincinnati, OH 45267, USA; [email protected] (J.W.); [email protected] (M.G.); [email protected] (S.Z.); [email protected] (J.X.); [email protected] (C.P.); [email protected] (H.L.); [email protected] (M.L.); [email protected] (Y.-G.W.); [email protected] (M.A.) * Correspondence: [email protected] Current address: Department of Pathology and Laboratory Medicine, Nationwide Children’s Hospital, y Columbus, OH 43205, USA. Current Address: Department of Neonatology, Children’s Hospital of Soochow University, z Suzhou 215025, Jiangsu, China. § Current Address: Department of Hepatobiliary Surgery, The Affiliated Hospital of Guizhou Medical University, Guiyang 550025, Guizhou, China. Current Address: Department of Cardiology, The First Affiliated Hospital of Soochow University, k Suzhou 215006, Jiangsu, China. ¶ Current Address: Department of Medicine, Cardiology, Medical College of Georgia, Augusta University, Augusta, GA 30912, USA. Received: 10 August 2020; Accepted: 26 October 2020; Published: 29 October 2020 Abstract: Background: We demonstrated that the transduction of Wnt11 into mesenchymal stem cells (MSCs) (MSCWnt11) promotes these cells differentiation into cardiac phenotypes. In the present study, we investigated the paracrine effects of MSCWnt11 on cardiac function and angiogenesis.
    [Show full text]
  • The GATA2 Transcription Factor Negatively Regulates the Proliferation of Neuronal Progenitors
    RESEARCH ARTICLE 2155 Development 133, 2155-2165 (2006) doi:10.1242/dev.02377 The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors Abeer El Wakil*, Cédric Francius*,†, Annie Wolff, Jocelyne Pleau-Varet† and Jeannette Nardelli†,§ Postmitotic neurons are produced from a pool of cycling progenitors in an orderly fashion that requires proper spatial and temporal coordination of proliferation, fate determination, differentiation and morphogenesis. This probably relies on complex interplay between mechanisms that control cell cycle, specification and differentiation. In this respect, we have studied the possible implication of GATA2, a transcription factor that is involved in several neuronal specification pathways, in the control of the proliferation of neural progenitors in the embryonic spinal cord. Using gain- and loss-of-function manipulations, we have shown that Gata2 can drive neural progenitors out of the cycle and, to some extent, into differentiation. This correlates with the control of cyclin D1 transcription and of the expression of the p27/Kip1 protein. Interestingly, this functional aspect is not only associated with silencing of the Notch pathway but also appears to be independent of proneural function. Consistently, GATA2 also controls the proliferation capacity of mouse embryonic neuroepithelial cells in culture. Indeed, Gata2 inactivation enhances the proliferation rate in these cells. By contrast, GATA2 overexpression is sufficient to force such cells and neuroblastoma cells to stop dividing but not to drive either type of cell into differentiation. Furthermore, a non-cell autonomous effect of Gata2 expression was observed in vivo as well as in vitro. Hence, our data have provided evidence for the ability of Gata2 to inhibit the proliferation of neural progenitors, and they further suggest that, in this regard, Gata2 can operate independently of neuronal differentiation.
    [Show full text]
  • Dual Regulation of Planar Polarization by Secreted Wnts and Vangl2 in the Developing Mouse Cochlea Elvis Huarcaya Najarro1, Jennifer Huang1, Adrian Jacobo2, Lee A
    © 2020. Published by The Company of Biologists Ltd | Development (2020) 147, dev191981. doi:10.1242/dev.191981 RESEARCH ARTICLE Dual regulation of planar polarization by secreted Wnts and Vangl2 in the developing mouse cochlea Elvis Huarcaya Najarro1, Jennifer Huang1, Adrian Jacobo2, Lee A. Quiruz1, Nicolas Grillet1 and Alan G. Cheng1,* ABSTRACT on the other. Flamingo (Fmi/Celsr1, Fmi/Celsr2 and Fmi/Celsr3) is Planar cell polarity (PCP) proteins localize asymmetrically to instruct present on both poles of the cell. Defective PCP signaling cell polarity within the tissue plane, with defects leading to deformities represented by a lack of polarized PCP components leads to of the limbs, neural tube and inner ear. Wnt proteins are evolutionarily congenital heart and tracheal abnormalities, skeletal dysplasia, conserved polarity cues, yet Wnt mutants display variable PCP neural tube defects as well as cochlear deformities (Butler and defects; thus, how Wnts regulate PCP remains unresolved. Here, we Wallingford, 2017; White et al., 2018). Despite their crucial roles, have used the developing cochlea as a model system to show that our understanding of upstream signals orchestrating PCP signaling secreted Wnts regulate PCP through polarizing a specific subset of is rather limited. PCP proteins. Conditional deletion of Wntless or porcupine, both of Wnt proteins have been implicated as upstream polarity cues for which are essential for secretion of Wnts, caused misrotated sensory PCP signaling. For example, limb morphogenesis in mice requires a cells and shortened cochlea – both hallmarks of PCP defects. gradient of Wnt5a, which has been reported to act as an instructive Wntless-deficient cochleae lacked the polarized PCP components cue to establish PCP (Gao et al., 2018, 2011).
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Wnt11 Regulates Cardiac Chamber Development and Disease During Perinatal Maturation
    Wnt11 regulates cardiac chamber development and disease during perinatal maturation Marlin Touma, … , Brian Reemtsen, Yibin Wang JCI Insight. 2017;2(17):e94904. https://doi.org/10.1172/jci.insight.94904. Research Article Cardiology Genetics Ventricular chamber growth and development during perinatal circulatory transition is critical for functional adaptation of the heart. However, the chamber-specific programs of neonatal heart growth are poorly understood. We used integrated systems genomic and functional biology analyses of the perinatal chamber specific transcriptome and we identified Wnt11 as a prominent regulator of chamber-specific proliferation. Importantly, downregulation of Wnt11 expression was associated with cyanotic congenital heart defect (CHD) phenotypes and correlated with O2 saturation levels in hypoxemic infants with Tetralogy of Fallot (TOF). Perinatal hypoxia treatment in mice suppressed Wnt11 expression and induced myocyte proliferation more robustly in the right ventricle, modulating Rb1 protein activity. Wnt11 inactivation was sufficient to induce myocyte proliferation in perinatal mouse hearts and reduced Rb1 protein and phosphorylation in neonatal cardiomyocytes. Finally, downregulated Wnt11 in hypoxemic TOF infantile hearts was associated with Rb1 suppression and induction of proliferation markers. This study revealed a previously uncharacterized function of Wnt11-mediated signaling as an important player in programming the chamber-specific growth of the neonatal heart. This function influences the chamber-specific development and pathogenesis in response to hypoxia and cyanotic CHDs. Defining the underlying regulatory mechanism may yield chamber-specific therapies for infants born with CHDs. Find the latest version: https://jci.me/94904/pdf RESEARCH ARTICLE Wnt11 regulates cardiac chamber development and disease during perinatal maturation Marlin Touma,1,2 Xuedong Kang,1,2 Fuying Gao,3 Yan Zhao,1,2 Ashley A.
    [Show full text]
  • WNT Signalling in Prostate Cancer
    WNT signalling in prostate cancer Virginia Murillo-Garzón1 and Robert Kypta1,2 1Cell Biology and Stem Cells Unit, CIC bioGUNE, Building 801A, Bizkaia Technology Park, Derio 48160, Spain 2Department of Surgery and Cancer, Imperial College London, Du Cane Road, London W12 0NN, UK Biographies: Robert Kypta is a Principal Investigator at CIC bioGUNE, a Centre of Excellence Severo Ochoa near Bilbao, and a Lecturer in Prostate Cancer at Imperial College London. His research interests focus on hoW extracellular signals control cell fate during prostate cancer progression and neuronal differentiation. Virginia Murillo Garzón is a PhD student at CIC bioGUNE, a Centre of Excellence Severo Ochoa near Bilbao. She has BSc in Biotechnology from the University of Salamanca and a Masters in Regenerative Biomedicine from the University of Granada. Her PhD is on Wnt receptor signalling in prostate cancer. 1 Abstract Genome sequencing and gene expression analyses of prostate tumours have highlighted the potential importance of genetic and epigenetic changes observed in WNT signalling pathWay components in prostate tumours, particularly in the development of castration-resistant prostate cancer. WNT signalling is also important in the prostate tumour microenvironment, Where WNT proteins secreted by the tumour stroma promote therapy resistance, and in prostate cancer stem or progenitor cells, Where WNT-b-catenin signals promote self-reneWal or expansion. Preclinical studies have demonstrated the potential of inhibitors that target WNT-receptor complexes at the membrane or that block the interaction of b-catenin with LEF1 and the androgen receptor, in preventing prostate cancer progression. Some Wnt signalling inhibitors are in Phase I trials, but they have yet to be tested in patients With prostate cancer.
    [Show full text]