Physical Interaction Between Prb and Cdk9/Cyclint2 Complex

Physical interaction between pRb and cdk9/cyclinT2 complex

Cristiano Simone1,2,5, Luigi Bagella1,3,5, Cristiana Bellan1,3 and Antonio Giordano*,4

1Department of Pathology, Anatomy and Cell Biology, Thomas Jeerson University, Philadelphia, Pennsylvania, PA 19107 USA; 2Department of Internal Medicine and Public Medicine, Division of Medical Genetics, University of Bari, Bari 70124 Italy; 3Institute of Pathologic Anatomy and Histology, University of Siena, Siena 53100 Italy; 4Sbarro Institute for Cancer Research and Molecular Medicine, Temple University, Philadelphia, Pennsylvania, PA 19122 USA

Cyclin-dependent kinase 9 (cdk9) is a multifunctional with higher levels found in terminally dierentiated cells, kinase with roles in dierent cellular pathways such as and its promoter activity parallels the protein levels (De transcriptional elongation, dierentiation and apoptosis. Luca et al., 1997; Bagella et al., 1998, 2000). The Cdk9/cyclin T diers functionally from other cdk/cyclin regulatory units of cdk9 are the T-family cyclins (T1, complexes that regulate cell cycle progression, but T2a and T2b) (Wei et al., 1998; Peng et al., 1998) and maintains structural anity with those complexes. In cyclin K (Edwards et al., 1998). The elevated levels of addition, previous reports have demonstrated that the cdk9 and its regulatory subunits in terminally dier- cdk9 complex is able to phosphorylate p56/pRb in vitro. entiated cells, together with the fact that cdk9/cyclin T In this report we show in vitro and in vivo interaction complexes are not cell cycle-regulated, distinguish cdk9 between cdk9/cyclinT2 and the protein product of the from the other cdks (MacLachlan et al., 1995; De Falco retinoblastoma gene (pRb) in human cell lines. The and Giordano, 1998). Moreover, unlike the other cdks, interaction involves the region composed of residues which regulate cell cycle progression and phosphorylate 129 ± 195 of cdk9, cyclinT2 (1 ± 642 aa) and the C- histone H1, cdk9 fails to phosphorylate H1 (Grana et terminal domain of pRb (835 ± 928 aa). We located the al., 1994). Cyclin T levels are not cell cycle-regulated minimal region of cdk9 phosphorylation on the C- and, for this reason, cdk9 kinase activity does not terminus of pRb, by identifying the residues between change during the dierent phases of the cell cycle. Cdk9 793 and 834. This region contains at least three proline- is instead implicated in the regulation of transcriptional directed serines (sp), S795, S807 and S811, which have elongation via phosphorylation of the carboxyl-terminal been reported to be phosphorylated in vivo and which domain (CTD) of RNA polymerase II (RNApolII) and could be targeted by the cdk9 complex. These data forms the positive transcription factor b (PTEF-b) with suggest that, in logarithmically growing cells, cdk9/ cyclin T (Dahmus, 1996; Marshall et al., 1996; Zhu et cyclin T2 and pRb are located in a nuclear multiprotein al., 1997; De Falco and Giordano, 2002). Kinase activity complex probably involved in transduction of cellular corresponding to cdk9 has been detected in the HIV Tat- signals to the basal transcription machinery and that one associated kinase (TAK) complex, where cdk9 is of these signals could be the cdk9 phosphorylation of required for Tat-dependent stimulation of transcrip- pRb. tional elongation (Yang et al., 1996; Zhu et al., 1997; Oncogene (2002) 21, 4158 ± 4165. doi:10.1038/sj.onc. Mancebo et al., 1997). CycT1 was the ®rst cyclin 1205511 discovered to associate with cdk9 to form a complex interacting with HIV-1-Tat protein in the TAK complex Keywords: cdk9; cyclin T2; pRb; phosphorylation (Wei et al., 1998). Human cycT1 stimulates Tat activation, while cycT2a and T2b fail to form a complex with Tat bound to the transactivation response RNA Introduction element (TAR) (Kwak et al., 1999; Wimmer et al., 1999). These data indicate functional dierences between Cyclin-dependent kinase 9 (cdk9) is a cdc2-related cycT1 and cycT2, even if cycT2 function remains less serine/threonine kinase that is isolated using degenerate understood. The catalytic activity of the cdk9 immuno- oligonucleotide primers derived from conserved regions complexes results only from cdk9 and it is abolished found in cdc2 and cdk2 (Grana et al., 1994). The cdk9 using a dominant negative form (kinase inactive mutant, gene is widely expressed in human and murine tissues, cdk9dn) (De Falco et al., 2000), which consists of a point mutation within the ATP-binding domain that changes the Asp to Asn at residue 167. *Correspondence: A Giordano, Sbarro institute for Cancer Research Previous studies have already demonstrated that and Molecular Medicine, College of Science and Technology, Temple cdk9 is able to phosphorylate p56/pRb (a deletion University, BioLife Science Bldg. Suite 333, 1900 N 12th Street, mutant maintaining the A/B pocket and the C-terminal Philadelphia, PA 19122, USA; E-mail: [email protected] domain of pRb, 379 ± 928 aa) in vitro (Grana et al., 5The ®rst two authors contributed equally to this study. Received 19 June 2001; revised 13 March 2002; accepted 21 March 1994; De Luca et al., 1997). Phosphopeptide analysis of 2002 p56/pRb after phosphorylation by cdk9, compared to cdk9/cyclinT2 binds pRb C Simone et al 4159 that after cdk2 and cdc2 phosphorylation, indicates ing the S/TP phosphorylation sites for cdk/cyclin that, at least in vitro, the three cdk complexes share complexes (Adams et al., 1999). In addition to RIL several target phosphoresidues, but cdk9 kinase activity (830 ± 2 aa), RVL (857 ± 9), KPLKKL (870 ± 5) and involves only serine residues (De Luca et al., 1997). KHL (889 ± 91) cdk/cyclin-binding domains (Adams et During preliminary studies of cdk9/cyclin T com- al., 1999), a new domain surrounding residue L901 was plexes, we performed immunoprecipitations (Ips) with found to be important for the interaction with the anity puri®ed anti-cdk9 antibody from nuclear cdk4/cyclin D1 complex (Pan et al., 2001). extracts of S35-labeled NIH3T3 cells. By comparing pRb has been identi®ed to interact with several the speci®c pattern of immunoprecipitation with an Ip cellular factors that in¯uence gene expression. Many of performed using pre-immune rabbit serum, we identi- these transcription factors, like E2F1, E2F2 and E2F3, ®ed several bands that could represent cdk9-interacting transcribe RNApolII-dependent genes. This is another proteins. We started to consider bands with predicted link between cdk9/cyclin T (P-TEFb) and pRb that molecular weights potentially corresponding to known suggests a possible functional/physical interaction proteins that may interact with cdk9. The predicted during gene transcription. protein structure anity with the other cdks prompted In this study, we demonstrate that cdk9/cycT2 binds us to consider of interest a band at 110 kD. Cdk4/ to pRb, involving residues 129 ± 195 of cdk9, the region cyclin D, cdk2/cyclin E and cdk1/cyclin A complexes of cycT2 comprising amino acids 1 ± 642 and the C- all bind and/or phosphorylate pRb during dierent terminal region of the retinoblastoma protein (835 ± phases of the cell cycle (Ezhevsky et al., 1997; 928) and that cdk9 complexes phosphorylate the pRb Hatakeyama et al., 1994; Lundberg and Weinberg, region spanning amino acids 793 ± 834. 1998; Pan et al., 2001). The retinoblastoma gene codes for a 105 kD nuclear protein that is regulated by phosphorylation. Depending on the amount of phos- Results phorylated residues, pRb shifts from an active hypophosphorylated state towards an inactive hyper- Cdk9 interacts in vitro with pRb through 129 ± 195 aa phosphorylated state (Mittnacht, 1998; Stiegler and Giordano, 2001). The basic structure of pRb consists To understand if the 110 kD band (Figure 1) of the N-terminal, the pocket region (spanning the A previously discussed is the protein product of the and B domains, separated by a spacer) and the C- retinoblastoma protein, we performed an in vitro GST terminal region. The N-terminal region is the least pull-down assay. To test whether a direct physical understood in its functional role. The central region, interaction between cdk9 and pRb occurs, we ®rst which folds into a pocket, oers a docking site for investigated if the proteins could interact in vitro. The several interacting proteins. Several residues within the in vitro translated (IVT) full-length cdk9 was well- pocket are responsible for the interaction with proteins precipitated by GST-pRb (379 ± 928), while no inter- containing a LXCXE docking site, such as E1A, E7, action was found with GST alone Figure 2d, lanes 5 SV40 LTag, HDACs and cyclin D (Whyte et al., 1988; and 6). To map the pRb binding site on the cdk9 DeCaprio et al., 1998; Lee et al., 1998; Magnaghi- protein, three deletion mutants, cdk9 (129 ± 372), cdk9 Jaulin et al., 1998; Ewen et al., 1993; Dowdy et al., 1993). The pocket region is also the binding site for other cellular factors lacking the LXCXE motif, such as E2F transcription factors (Stiegler and Giordano, 2001). Mutations in these pocket residues render pRb inactive or heavily impaired in controlling the cell cycle. The function to arrest the cell cycle is separate and independent from an intact LXCXE binding site, demonstrating that additional sequences besides the pocket are important for pRb function. The C-terminal region of pRb is involved in association with important cellular factors including E2F, Mdm2 and c-Abl (Qian et al., 1992; Xiao et al., 1995; Welch and Wang, 1993). The C-terminal region spanning residues 793 ± 928 is the smallest domain of pRb that is eciently phosphorylated by cdk4/cycD1, cdk2/cycE and cdk2/ cycA (Pan et al., 1998; Adams et al., 1999). Very recently, examination of the pRb C-terminus revealed that it contains sequence elements related to ZRXL, which is the E2F- and p21-conserved cyclin/cdk- Figure 1 Immunoprecipitations from nuclear extracts of S35- binding motif (Adams et al., 1999). These ®ndings labeled NIH3T3 cells. Immunoprecipitation (Ip) was performed with anity puri®ed anti-cdk9 antibody from nuclear extracts of separate the C-terminal region into two subdomains, S35-labeled NIH3T3 cells and compared to an Ip with pre- one, the putative cyclin/cdk-binding domain spanning immune rabbit serum (NRS). Bands corresponding to cdk9, cyclin residues 830 ± 928, and the other (780 ± 826 aa) contain- T and a band at 110 kD were indicated

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4160

Figure 2 Cdk9 interacts in vitro with pRb through the region corresponding to 129 ± 195 aa. (a) Summary of in vitro translated (IVT) S35-labeled cdk9 proteins and their ability to interact with GST-pRb (379 ± 928). (The PSTAIRE-like domain is referred to as (PITALRE)). (b) Summary of GST-fusion proteins and their ability to coprecipitate cdk9 (1 ± 372). (A: A domain; B: B domain; A- B: pocket domain; C: C-terminal domain). (c) IVT-cyclin T2 isoforms (a and b). (The two splice isoforms are identical in the 1 ± 642aa region. 1 ± 262: cyclin box region; 642 ± 663 for cycT2a and 642 ± 730 for cyclin T2b: C-terminal domain). (d) The interaction between GST-pRb (379 ± 928) and dierent IVT fragments of cdk9 was tested. GST alone was used as a negative control. The GST- fusion proteins were precipitated by glutathione-agarose anity chromatography and the interaction with the in vitro translated S35- labeled proteins was visualized by autoradiography

(218 ± 372) and cdk9 (1 ± 195) Figure 2a, lanes 8 and C706F), unable to interact through its pocket domain 12), were tested for their ability to interact with GST- (Magnaghi-Jaulin et al., 1998), could still bind the pRb (379 ± 928) in a pull-down assay. GST alone was cdk9/cyclin T2 complex. Under the same experimental used as a negative control. An interaction, comparable conditions, the GST-pRbC706F mutant was still able to that with the full-length cdk9, was detected with two to recruit both cdk9 and cyclin T2 (a and b), as the deleted forms, cdk9 (129 ± 372) and cdk9 (1 ± 195) wild type does Figure 3b). These data indicate that the Figure 2a), suggesting that the minimal binding region possible region of interaction could involve the C- involves amino acids 129 ± 195. terminus of pRb. To address this point, we tested three deletion mutants of pRb. IVT S35-labeled cdk9 and cyclin T2 (isoforms a and b) were tested with GST-pRb Minimal cdk9-binding region of pRb involves 835 ± 928 aa (793 ± 928), GST-pRb (768 ± 834) and GST-pRb (835 ± A similar experiment was performed to map the 928) Figure 3c ± e) in a pull-down assay, using GST minimal cdk9-binding region of pRb and to address alone as a negative control. Like GST-pRb (379 ± 928), if pRb was also able to interact with cyclin T2, which is GST-pRb (793 ± 928) and GST-pRb (835 ± 928) were not extensively characterized in the literature. IVT S35- able to precipitate cdk9/cycT2 proteins; the third labeled cdk9 and cyclin T2 (isoforms a and b) were deletion mutant, GST-pRb (768 ± 834), did not interact tested for their ability to interact with GST-pRb (379 ± with PTEF-b components Figure 3c ± e). 928) Figure 3a) in a pull-down assay, using GST alone These data indicate that the regions mediating the as a negative control. This experiment provided binding between cdk9/cycT2 and pRb encompass the evidence that either cdk9 or cyclin T2a (and T2b) C-terminal domain of pRb (835 ± 928 aa), cyclinT2 (1 ± could directly interact with pRb and that they could 642) and the central region (129 ± 195 aa) of cdk9 form a trimeric complex in vitro. Afterwards, we surrounding the ATP-binding kinase domain (see investigated whether a pRb mutant (379 ± 928, Figures 2 and 3).

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4161

Figure 3 Minimal cdk9/cycT2-binding region of pRb involves the region containing 835 ± 928 aa. (a) IVT S35-labeled proteins used in the GST pull-down experiments. (Lane 1: cdk9; lane 2: reticulocyte lysate; lane 2:cyclin T2a; lane 4: cyclin T2b). (b ± f) The GST- pRb fusion proteins indicated in Figure 2b were tested for their ability to coprecipitate IVT-cdk9, IVT-cycT2a and IVT-cycT2b. GST alone was used as a negative control. The GST-fusion proteins were precipitated by glutathione-agarose anity chromatography and the interaction with the in vitro translated S35-labeled proteins was visualized by autoradiography

Cdk9, cyclin T2 and pRb form a multimeric nuclear Cdk9 complexes phosphorylate pRb on the C-terminal complex in human cells domain To verify that the interaction described above was Previous reports indicate that p56/pRb is a good present in vivo, we performed a GST pull-down of substrate in vitro for the cdk9 complex (Grana et al., human nuclear cell extracts. GST-pRb was able to 1994; De Luca et al., 1997). Using the reported GST- co-precipitate cdk9 from nuclear extracts of Jurkat pRb fusion proteins as substrates Figure 2b), we and HeLa cells Figure 4a), while GST alone, used performed a kinase assay with immunoprecipitated as a negative control, was not. As a positive cdk9 complexes from HeLa nuclear extracts Figure 5) control, the same ®lter was blotted with anti- (pre-immune rabbit serum used as a negative control, HDAC1 antibody, revealing the interaction as well data not shown). Cdk9 complexes phosphorylated (data not shown). Increasing the time of the pRb (793 ± 928) as well as p56/pRb (379 ± 928), binding reaction from 2 h to overnight incubation, con®rming that, at least in vitro, this complex GST-pRb co-precipitated more cdk9, as was behaves the same as other cdk/cyclin complexes. demonstrated by Western blot with anity puri®ed Very interestingly, neither of the two deleted forms of anti-cdk9 antibody Figure 4a, compare lanes 2 and the pRb C-terminus, pRb (835 ± 928) and pRb (768 ± 4, and 7 and 9), while GST alone continued to 834), was phosphorylated. The other cdk/cyclin not interact with cdk9 Figure 4a, lanes 1, 3, 8, complexes are unable to phosphorylate the region and 10). 794 ± 829 in the absence of recognition motifs To con®rm the interaction, we performed Ips from contained between pRb residues 829 ± 928 (Adams et nuclear extracts of proliferating HeLa and Jurkat cells al., 1999). Our data suggest that this is true also for using anti-cdk9 anity puri®ed antibody. Western blot cdk9 complexes. In fact, cdk9/cyclin T2 binds pRb with anti-pRb antibody revealed the presence of the (835 ± 928), phosphorylates the C-terminal domain retinoblastoma gene product in association with cdk9 (793 ± 928), but fails to phosphorylate the two parts in the nucleus of human proliferating cells Figure 4b). that compose it. The region of pRb corresponding to Further analysis of the a-cdk9 antibody immunopreci- 793 ± 834 aa contains at least three proline-directed pitates revealed the presence of cdk9 and cycT2 (data serines (sp), S795, S807 and S811, which have been not shown). reported to be phosphorylated in vivo (Hollingsworth

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4162

Figure 4 Cdk9, cyclin T2 and pRb form a multimeric nuclear complex in human cells. (a) GST pull-down was performed with human nuclear cell extracts. GST-pRb (378 ± 928) was able to coprecipitate cdk9 from nuclear extracts of Jurkat and HeLa cells. The same ®lter was blotted with anti-HDAC1 antibody as a positive control (immunoblot not shown). GST alone was used as a negative control. (b) Jurkat and HeLa nuclear cell extracts were precleared and incubated with anity puri®ed anti-cdk9 and pre- immune serum (NRS) (used as a negative control). After extensive washes, the samples were resuspended in Laemmli buer and loaded on acrylamide gel. The associated proteins were detected by immunoblot by using anti-pRb, anti-cycT2 and anti-cdk9 antibodies (cdk9 and cycT2 immunonoblots are not shown)

the C-terminus of pRb to phosphorylate serine residues present between 793 and 834 aa.

Discussion

Cdk9 protein levels and kinase activity are high in terminally dierentiated cells, as are cyclin T family protein levels (De Luca et al., 1997; Bagella et al., 1998; Wei et al., 1998; Peng et al., 1998). PTEF-b kinase activity is constant throughout the cell cycle, depending on cdk9 and cyclin T protein levels, which do not change during the dierent phases (Grana et al., Figure 5 Cdk9 immunocomplexes phosphorylate pRb in vitro 1994). In addition, cdk9 complexes fail to phosphor- on the C-terminal domain. Ips were performed with anti-cdk9 in logarithmically growing HeLa cells. (Pre-immune rabbit serum ylate histone H1, but exert their kinase activity on the used as a negative control, data not shown). The immunocom- C-terminal domain of RNA polymerase II (Dahmus, plexes were extensively washed, incubated in kinase assay reaction 1996; Marshall et al., 1996; Zhu et al., 1997) and buer with 0.5 mg of the reported GST-fusion proteins and MyoD, a bHLH transcription factor part of the resolved on 13% gel Muscle Regulatory Factor (MRF) family (Simone et al., 2002; Simone and Giordano, 2001). Despite these et al., 1993) and could be targeted by cdk9 relevant functional dierences with the other cdk/cyclin complexes. From our data, we cannot exclude that complexes, cdk9 shares 41 ± 43% identity (61 ± 65% in the pRb amino acid sequence there are other similarity) with human cdc2, cdk2, cdk3, cdk5 and serines targeted by cdk9 complexes and that this 38% with cdk4 (Grana et al., 1994). Similarly, cyclin T phosphorylation has a speci®c role in vivo; in our has an amino-terminal cyclin box motif sharing 39% model, cdk9 complexes use the recognition sites of identity with the human cyclins and a carboxyl-

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4163 terminal PEST sequence (709 ± 726 aa), which is the hyperphosphorylation of the CTD of RNApolII, frequently found in G1 cyclins to regulate their allowing passage from the initiation to the elongation turnover by cellular ubiquitination and proteolytic phase of RNA transcription (Lis et al., 2000; pathways (Wei et al., 1998). Napolitano et al., 2000). The cdk9 phosphorylation In past years no functional reason has been found to of pRb could be another signal that allows conversion justify cdk9 phosphorylation of pRb in vitro, probably from an inactive complex into a fully active complex due to the complexity of an in vivo study of pRb that is ready to induce RNA transcription. phosphorylation and regulation. In this study, we The second point of interest is the involvement of characterize the physical interaction between cdk9, pRb during cellular dierentiation and in terminally cyclin T2 and pRb, demonstrating that the C-terminus dierentiated cells. Several pieces of evidence have of pRb (835 ± 928) directly interacts with the region implicated pRb as an essential cofactor during muscle surrounding the kinase domain of cdk9 (129 ± 195) and dierentiation. Muscle cells derived from pRb7/7 with both isoforms of cyclin T2 (a and b), suggesting mice fail to irreversibly exit the cell cycle (Schneider et that the region of interaction involves the common al., 1994), express reduced levels of late dierentiation sequence comprising 1 ± 642 aa Figure 2a ± c). In markers and display impaired fusion into multi- addition, cdk9 complexes phosphorylate the C-terminus nucleated myotubes (Novitch et al., 1996). Several of pRb (793 ± 928) in vitro and our data suggest that the hypotheses have been proposed to justify pRb phosphorylated region spans amino acids 793 ± 834 involvement in dierentiation, including a physical Figure 6). This evidence is intriguing because it con®rms binding with MyoD (Gu et al., 1993) and the inhibition the division of the pRb C-terminus into two subdo- of the anti-myogenic activity of E2F (Shin et al., 1995; mains. In fact, several groups have reported that pRb C- Corbeil et al., 1995; Puri et al., 1997). More recently, terminus (793 ± 928) could be separated into two pRb has been shown to promote functional synergism subdomains with speci®city for cdk/cyclin complexes. between MyoD and MEF2 protein, a coactivator of The ®rst region (793 ± 829) contains the cdk phosphor- speci®c gene transcription (Novitch et al., 1999). ylation sites and the second (829 ± 928) is the recogni- However, the molecular mechanisms through which tion/binding site for cdk/cyclin complexes Figure 6). pRb promotes myogenic transcription remain poorly This subdivision has been proven to be important for understood. We found that cdk9/cycT2 complex cdk2/cycE, cdk2/cycA and cdk4/cycD1 (Pan et al., 1998, activates MyoD-mediated transcription and that cdk9 2001; Adams et al., 1999). During the cell cycle, pRb enzymatic activity is necessary for the myogenic phosphorylation mediated by cdk/cyclin complexes is program. In fact, cells expressing the kinase-inactive required for the cell to progress through the dierent mutant of cdk9 (which behaves as a dominant phases. pRb shifts from a hypophosphorylated active negative) fail to dierentiate (Simone et al., manuscript form to a hyperphosphorylated inactive form and allows submitted). Immunoprecipitated cdk9 complexes from E2F transcription factors to be free from pRb control C2C12 mouse myoblasts induced to dierentiate have and bind to speci®c gene promoters. an increasing kinase activity on p56/pRb with a peak Several pieces of evidence might help to elucidate the of phosphorylation at 96 h of the myogenic program meaning of cdk9-mediated phosphorylation of pRb in (Bagella et al., 1998). During muscle dierentiation, vivo. First, pRb has been identi®ed to functionally pRb is present in the active hypophosphorylated form, interact with factors which in¯uence RNA polymerase especially due to down-regulation of cyclins A, E and II-dependent gene transcription (De Luca et al., 1998; D1 and the up-regulation of cdk inhibitors. On the Fanciulli et al., 2000). This important eect of pRb on other hand, MyoD is inactivated during the cell cycle RNApolII transcription could represent a functional by cdk/cyclin complexes through direct phosphoryla- link with PTEF-b. In fact, cdk9 complexes have been tion or physical binding (Puri and Sartorelli, 2000), characterized as transcriptional elongation factors while the kinase activity of cdk9 is a signal that triggers involved in transcription of speci®c genes (Lis et al., myogenic transcription (Simone and Giordano, 2002). 2000; Kanazawa et al., 2000; Foskett et al., 2001). It is possible that cdk9/cycT2 activity is involved in the Most likely, cdk9 complexes exert their action through basal phosphorylation of the retinoblastoma protein and that pRb and cdk9/cycT2 cooperate to support MyoD-mediated myogenic transcription. Future studies are awaited to explain the relevance of cdk9/ cycT2-pRb interaction and to clarify the importance of pRb phosphorylation in dierent pathways other than the cell cycle, ideally by the in vivo characterization of the phosphoresidues targeted by cdk/cyclin complexes.

Materials and methods

Cell lines Figure 6 C-terminal domain of pRb protein. The putative proline-directed serines and the RXL domains are in bold and Jurkat and HeLa cells were grown, respectively, in RPMI underlined 1640 and in DMEM supplemented with 10% FBS, L-

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4164 glutamine and antibiotics. All cell lines were obtained from determined by Bradford assay (Biorad, CA, USA), following ATCC. the manufacturer's instructions and by using BSA as a standard. GST-pRb (379 ± 928), GST-pRb (379 ± 928) C706F, GST- Plasmids pRb (793 ± 928), GST-pRb (768 ± 834) and GST-pRb (835 ± The constructs pcDNA3-cdk9wt-HATag expressing full- 928) were expressed in bacteria and puri®ed as described length wild type cdk9 were previously described (De Falco above (De Falco et al., 2000). Nuclear cell extracts were et al., 2000). The construct pcDNA3-cdk9wt-HATag was incubated with the reported GST fusion protein for 2 h and/ cleaved with HindIII or KpnI and the fragments were re- or overnight at 48C. Bond proteins were recovered by circularized with T4 ligase generating the construct pcDNA3- centrifugation at 14 000 r.p.m. for 30 s at 48C and washed cdk9 (129 ± 372)-HATag and pcDNA3-cdk9 (218 ± 372)- three times with Lysis Buer (50 mM Tris, 5 mM EDTA, HATag, respectively. The fragments of 582 bp obtained after 250 mM NaCl, 50 mM NaF, 0.1% Triton, 0.1 mM Na3VO4, cleavage of pcDNA3-cdk9wt-HATag with KpnI were sub- and 10 mg/ml aprotinin, leupeptin and phenylmethylsulpho- cloned in the KpnI site of pcDNA3 vector (Invitrogen) nyl ¯uoride (PMSF)). Immunoprecipitations were performed generating pcDNA3-cdk9 (1 ± 195). The constructs to gen- after preclearing the extracts with pre-immune rabbit serum. erate the GST-Rb fusion proteins GST-Rb (379 ± 928), GST- Anity puri®ed anti-cdk9 (1 : 50; De Falco et al., 2000) Rb (793 ± 928), GST-Rb (768 ± 834) and GST-Rb (835 ± 928) antibody incubations were performed overnight, at 48C, were obtained by PCR ampli®cation using, respectively, the followed by the addition of protein A-sepharose for 60 min, following couples of primers: GGATCCATGAACACTATC- rocking, at 48C. Beads were washed three times with Lysis CAA, GAGCTCTCATTTCTCTTCCTTG; GATCCCC- Buer and twice with Lysis Buer containing 400 mM NaCl, TAGTTCACCCTTAC, GAGCTCTCATTTCTCTTCCTTG; and loading buer (50 mM Tris/HCl pH 6.8, 2% SDS, 10% GATCCATTTTGCAGTATGCTTC, GAGCTCGATAC- glycerol) with 5% b-mercaptoethanol was added. The TAAGATTCTTG; GGATCCATTGGTGAATCATTCG, samples were resolved in 8 or 10% SDS-PAA gels and were GGATCCTCATTTCTCTTCCTTG. transferred to a Hybond-ECL nitrocellulose ®lter (Amersham The PCR products were cloned into pGEX 4T-1 or pGEX Life Science Inc.) at 48C and at 70 V for 2 h. 0.5% Ponceau 2T (Pharmacia) to obtain, respectively, pGEX-4T-1 Rb-D(1 ± Red was used to ensure equal transferring. The blots were 378), pGEX-4T-1 Rb-D(1 ± 792), pGEX-4T-1 Rb-D(1 ± 767, blocked with TBST containing 5% non-fat dry milk. Anti- 835 ± 928) and pGEX-2T Rb-D(1 ± 834). cdk9 (1 : 200), anti-cycT2 (1 : 2000; Peng et al., 1998) and anti- The construct pGEX-4T-1 Rb-C706F-D(1 ± 378) to gen- HDAC1 (1 : 200, Santa Cruz Biotechnology, CA, USA) erate GST-Rb (379 ± 928) C706F was performed using a polyclonal antibodies and anti-pRb (1 : 500, Pharmingen) QuickChange Site-Directed Mutagenesis Kit (Promega). The monoclonal antibody were used in TBST containing 5% non- following primers were used: GGACCAAATTATGAT- fat dry milk, according to the Western blot conditions GTTTTCCATGTATGGCATATG and CATATGCCATA- suggested by Santa Cruz (Santa Cruz Biotechnology, CA, CATGGAAAACATCATAATTTGGTCC. The constructs USA). Anti-rabbit and anti-mouse peroxidase conjugated expressing HA-cyclin T2a and HA-cyclin T2b were pre- (1 : 20000) (Amersham, IL, USA) and ECL detection system viously described (Peng et al., 1998). (NEN, Du Pont, MS, USA) were used for detection.

In vitro binding Kinase assay The TNT coupled reticulocyte kit was used for in vitro Cell extracts (200 mg) prepared in Lysis Buer were used for translation (Promega, WI, USA), according the manufac- immunoprecipitations with a polyclonal anti-cdk9 antibody turer's instructions. All the samples were labeled using 35S- (negative control: pre-immune rabbit serum). The immuno- Methionine (Amersham, IL, USA). The labeled samples were complexes were pulled down with protein A-sepharose and incubated with GST-fusion proteins, GST-pRb (379 ± 928) or washed three times with Lysis Buer and twice with Lysis GST-pRb (379 ± 928) C706F or GST-pRb (793 ± 928) or Buer containing 400 mM NaCl. The complexes were also GST-pRb (768 ± 834) or GST-pRb (835 ± 928), using GST equilibrated in kinase assay buer (minus ATP) (20 mM as a negative control, for 2 h at 48C, rocking, for in vitro HEPES pH 7.4, 10 mM Mg Acetate). The kinase assay was binding. These fusion proteins were precipitated by glu- performed in a volume of 20 ml, using 5 mCi/sample of g-ATP tathione-agarose anity chromatography and the immuno- (Amersham, IL, USA). 0.1 mg of GST alone, GST-pRb precipitates were washed extensively in CPA buer (20 mM (379 ± 928), GST-pRb (793 ± 928), GST-pRb (768 ± 834) and Tris-HCl pH 7.6, 250 mM NaCl, 5 mM MgCl2, 0.2 mM GST-pRb (835 ± 928) were added to the samples and EDTA, 10% glycerol, 0.2% NP-40) containing fresh incubated for 30 min at 308C. The reactions were stopped inhibitors and 1 mM DTT. Afterwards, the immunoprecipi- by adding 56 Laemmli Buer and the samples were resolved tates were resolved on 8 or 15% SDS ± PAGE and subjected on a 13% SDS ± PAGE and subjected to autoradiography. to autoradiography.

GST pull-down, immunoprecipitations and Western blot Abbreviations Jurkat and HeLa nuclear cell extracts were used for Western cdk, cyclin-dependent kinase; GST, glutathione S-transfer- blot and Ips. Nuclear extracts were obtained by lysing the ase; pRb, retinoblastoma protein cells ®rst in RSB Buer (10 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, phenylmethylsulphonyl ¯uoride (PMSF) and DTT); then, after centrifugation and three washes with RSB buer, the nuclei were lysed with Buer C ((20 mM HEPES, Acknowledgments We thank Marie Basso for her editorial assistance in the 0.2 mM EDTA, 420 mM NaCl, 1.5 mM MgCl2, 25% Glycerol, fresh aprotinin, leupeptin, DTT and phenylmethyl- preparation of the manuscript and Dr Gaia Gallo for her sulphonyl ¯uoride (PMSF)). The protein concentration was technical support. We thank Dr David Price for generously

Oncogene cdk9/cyclinT2 binds pRb C Simone et al 4165 providing reagents. This work was supported in part by Patologia Diagnostica Quantitativa' from the University grants from the Sbarro Institute for Cancer Research and of Siena. Finally, we thank Letizia Lavermicocca for her Molecular Medicine (to Dr Giordano). Drs Bellan and encouragement and support. We dedicate this work to the Bagella are supported by a `Dottorato di Ricerca in memory of Professor Angelo Carbonara.

References

Adams PD, Li X, Sellers WR, Baker KB, Leng X, Harper MacLachlan TK, Sang N and Giordano A. (1995) Crit. Rew. JW, Taya Y and Kaelin WG. (1999). Mol. Cell. Biol., 19, Eukariot. Gene Expr., 5, 127 ± 156. 1068 ± 1080. Magnaghi-Jaulin L, Groisman R, Naguibneva I, Robin P, Bagella L, MacLachlan TK, Buono RJ, Pisano MM, Lorain S, Le Villain JP, Troalen F, Trouche D and Harel- Giordano A and De Luca A. (1998). J. Cell. Physiol., Bellan A. (1998). Nature, 391, 601 ± 605. 177, 206 ± 213. Mancebo H, Lee G, Flygare J, Tomassini J, Luu P, Zhu Y, Bagella L, Stiegler P, De Luca A, Siracusa LD and Giordano Blau C, Hazuda D, Price D and Flores O. (1997). Genes A. (2000). J. Cell. Biochem., 78, 170 ± 178. Dev., 11, 2633 ± 2644. Corbeil H, Whyte P and Branton P. (1995). Oncogene, 11, MarshallN,PengJ,XieZandPriceD.(1996).J. Biol. 909 ± 920. Chem., 271, 27176 ± 27183. Dahmus ME. (1996). J. Biol. Chem., 271, 19009 ± 19012. Mittnacht S. (1998). Curr. Opin. Genet. Dev., 8, 21 ± 27. DeCaprio JA, Ludlow JW, Figge J, Shew JY, Huand CM, Napolitano G, Majello B, Licciardo P, Giordano A and Lee WH, Marsilio E, Paucha E and Livingston DM. Lania L. (2000). Gene, 254, 139 ± 145. (1998). Cell, 54, 257 ± 283. Novitch BG, Mulligan GJ, Jacks T and Lassar AB. (1996). J. De Falco G and Giordano A. (1998). J. Cell. Physiol., 177, Cell. Biol., 135, 441 ± 456. 501 ± 506. Novitch BG, Spicer DB, Kim PS, Cheung WL and Lassar De Falco G and Giordano A. (2002). Cancer Biology and AB. (1999). Curr. Biol., 9, 449 ± 459. Therapy, in press. Pan W, Sun T, Hoess RH and Grafstrom RH. (1998). De Falco G, Bagella L, Claudio PP, De Luca A., Fu Y, Carcinogenesis, 19, 765 ± 769. Calabretta B, Sala A and Giordano A. (2000). Oncogene, Pan W, Cox S, Hoess RH and Grafstrom RH. (2001). Cancer 19, 373 ± 379. Res., 61, 2885 ± 2891. De Luca A, Esposito V, Baldi A, Claudio PP, Fu Y, Caputi Peng J, Zhu Y, Milton JT and Price DH. (1998). Genes Dev., M, Pisano M, Baldi F and Giordano A. (1997). J. Cell. 12, 755 ± 762. Physiol., 172, 265 ± 273. Puri PL, Balsano C, Burgio V, Chirillo P, Natoli G, Ricci L, De Luca P, Majello B and Lania L. (1998). J. Cell Biochem., Mattei E, Graessmann A and Levrero M. (1997). 70, 281 ± 287. Oncogene, 14, 1171 ± 1184. Dowdy SF, Hinds PW, Louie K, Reed SI, Arnold A and Puri PL and Sartorelli V. (2000). J. Cell. Physiol., 185, 155 ± Weinberg R. (1993). Cell, 73, 499 ± 511. 173. Edwards MC, Wong C and Elledge SJ. (1998). Mol. Cell. Qian Y, Luckey C, Horton L, Esser M and Templeton DJ. Biol., 18, 4291 ± 4300. (1992). Mol. Cell. Biol., 12, 5363 ± 5372. Ezhevsky S, Naggahara H, Vocero-Akbani A, Gius D, Wei Schneider J, Gu W, Zhu L, Mahdavi V and Nadal-Ginard B. M and Dowdy S. (1997). Proc. Natl. Acad. Sci. USA, 94, (1994). Science, 264, 1467 ± 1471. 10699 ± 10704. Shin E, Shin A, Paulding C, Schahausen B and Yee A. Ewen ME, Sluss HK, Sherr CJ, Matsushime H, Kato J-Y (1995). Mol. Cell. Biol., 15, 2252 ± 2262. and Livingston. (1993). Cell, 73, 487 ± 497. Simone C and Giordano A. (2001). Frontiers in Bioscience, 6, Fanciulli M, Bruno T, Di Padova M, De Angelis R, Iezzi S, 1073 ± 1082. Iacobini C, Floridi A and Passananti C. (2000). FASEB J., Simone C, Stiegler P, Bagella L, Pucci B, Bellan C, De Falco 14, 904 ± 912. G, De Luca A, Guanti G, Puri PL and Giordano A. Foskett SM, Ghose R, Tang DN, Lewis DE and Rice AP. (2002). Oncogene, 21, 4137 ± 4148. (2001). J. Virol., 75, 1220 ± 1228. Stiegler P and Giordano A. (2001). Crit.Rev.Eukariot.Gene GranaX,DeLucaA,SangN,FuY,ClaudioPP,Rosenblatt Expr., 11, 59 ± 76. J, Morgan DO and Giordano A. (1994). Proc. Natl. Acad. Wei P, Gender ME, Fang SM, Fisher WH and Jones KA. Sci., 91, 3834 ± 3838. (1998). Cell, 92, 451 ± 462. Gu W, Schneider JW, Condorelli G, Kaushal S, Mahadavi S Welch PJ and Wang JYJ. (1993). Cell, 75, 779 ± 790. and Nadal-Ginard B. (1993). Cell, 72, 309 ± 324. Whyte P, Buchkovich KJ, Horowitz JM, Friend SH, Hatakeyama M, Brill J, Fink G and Weinberg R. (1994). Raybuck M, Weinberg RA and Harlow E. (1988). Nature, Genes Dev., 8, 1759 ± 1771. 334, 124 ± 129. Hollingsworth RE, Hensey CE and Lee W-H. (1993). Curr. Wimmer J, Fujinaga K, Taube R, Cujec TP, Zhu Y, Peng J, Opin. Cell. Biol., 3, 55 ± 62. Price DH and Peterlin BM. (1999). Virology, 255, 182 ± Kanazawa S, Okamoto T and Peterlin BM. (2000). 189. Immunity, 12, 61 ± 70. Xiao ZX, Chen J, Levine AJ, Modjtahedi N, Xing J, Sellers Kwak YT, Ivanov D, Guo J, Nee E and Gaynor RB. (1999). WR and Livingston DM. (1995). Nature, 375, 694 ± 698. J. Mol. Biol., 288, 57 ± 69. Yang X, Hermann HC and Rice AP. (1996). J. Virol., 70, Lee O-J, Russo AA and Pavletich NP. (1998). Nature, 391, 4576 ± 4584. 859 ± 865. ZhuY,Pe'eryT,PengJ,RamanathanY,MarshallN, Lis JT, Mason P, Peng J, Price DH and Werner J. (2000). MarshallT,AmendtB,MathewsMandPriceD.(1997). Genes Dev., 11, 2633 ± 2644. Genes Dev., 11, 2622 ± 2632. Lundberg AS and Weinberg RA. (1998). Mol. Cell. Biol., 18, 753 ± 761.

Oncogene