USO08092998B2

(12) United States Patent (10) Patent No.: US 8,092,998 B2 Stuhlmiller et al. (45) Date of Patent: Jan. 10, 2012

(54) BOMARKERS PREDCTIVE OF THE 2007/0172475 A1 7/2007 Matheus et al. RESPONSIVENESS TO TNFO INHIBITORS IN 2007/0172897 A1 7/2007 Maksymowych et al. 2007. O184045 A1 8, 2007 Doctor et al. AUTOIMMUNE DISORDERS 2007/0202051 A1 8/2007 Schusching 2007/0202104 A1 8/2007 Banerjee et al. (75) Inventors: Bruno Stuhlmiller, Berlin (DE): 2007/0237831 A1 10/2007 Sung et al. 2007,0269.463 A1 11/2007 Donavan Gerd-Reudiger Burmester, Berlin (DE) 2007,0292442 A1 12/2007 Wan et al. 2008.0118496 A1 5/2008 Medich et al. (73) Assignee: Abbott Laboratories, Abbott Park, IL 2008. O1313.74 A1 6/2008 Medich et al. (US) 2008. O166348 A1 7/2008 Kupper et al. 2008.0193466 A1 8/2008 Banerjee et al. 2008/0227136 A1 9, 2008 Pla et al. (*) Notice: Subject to any disclaimer, the term of this 2008/0311043 A1 12/2008 Hoffman et al. patent is extended or adjusted under 35 2009/0028794 A1 1/2009 Medich et al. U.S.C. 154(b) by 5 days. 2009/0110679 A1 4/2009 Li et al. 2009/O123378 A1 5/2009 Wong et al. (21) Appl. No.: 12/130,373 2009, O1485.13 A1 6/2009 Fraunhofer et al. (Continued) (22) Filed: May 30, 2008 FOREIGN PATENT DOCUMENTS (65) Prior Publication Data EP 1795610 A1 * 6, 2007 US 2009/OO17472 A1 Jan. 15, 2009 (Continued) Related U.S. Application Data OTHER PUBLICATIONS (60) Provisional application No. 60/932,888, filed on May Asli, Bouchira et al., “Inhibition of Tumor Necrosis Factor O and 31, 2007. Ankylosing Spondyiltis.” N. Engl. J. Med., vol. 348(4):359-361 (2003). Int. C. Boeger, C.A. et al., “Treatment of ankylosing spondylitis with (51) infliximab.” Ann. Rheum. Dis... vol. 60(12): 1159-1160 (2001). CI2O I/68 (2006.01) Brandt, Janet al., “Successful Short Term Treatment of Severe Undif GOIN33/53 (2006.01) ferentiated Spondyloarthropathy with the Anti-Tumor Necrosis Fac (52) U.S. Cl...... 435/6.1; 435/7.1 tor-O. Monoclonal Antibody lnfliximab.” The Journal of Rheumatol Field of Classification Search ...... None ogy, vol. 29(1):118-122 (2002). (58) Brandt, Jan et al., “Successful Treatment of Active Ankylosing See application file for complete search history. Spondylitis with the Anti-tumor Necrosis Factor O. Monoclonal Anti body lnfliximab.” Arthritis & Rheumatism, vol. 43(6): 1346-1352 (56) References Cited (2000). Braun, J. et al., “Anti-TNFO: a new dimension in the U.S. PATENT DOCUMENTS pharmacotherapy of the spondyloarthropathies?” Ann. Rheum. Dis. 6,090,382 A 7/2000 Salfeld et al. vol. 59(6):404–407 (2000). 6,258,562 B1 7/2001 Salfeld et al. 6,506,607 B1 1/2003 Shyjan (Continued) 6,509,015 B1 1/2003 Salfeld et al. 6,607,879 B1 8, 2003 Cocks et al. Primary Examiner — James Martinell 7,223,394 B2 5, 2007 Salfeld et al. (74) Attorney, Agent, or Firm — McCarter & English, LLP: 7,541,031 B2 6, 2009 Salfeld et al. Cristin Howley Cowles; Deborah L. Nagle 7,588,761 B2 9, 2009 Salfeld et al. 2003, OO12786 A1 1/2003 Teoh et al. (57) ABSTRACT 2003.0161828 A1 8/2003 Abdelghany et al. 2003/0206898 A1 11/2003 Fischkoff et al. The invention provides methods for predicting responsive 2003/0219438 A1 11/2003 Salfeld et al. ness to TNFC. inhibitors in a subject suffering from an autoim 2003/0235585 A1 12/2003 Fischkoff 2004.0009172 A1 1/2004 Fischkoffet al. mune disorder, such as rheumatoid arthritis. The methods 2004/0033228 A1 2, 2004 Krause et al. involve assaying for expression of one or more biomarkers in 2004/O126372 A1 7/2004 Banerjee et al. the subject that are predictive of responsiveness to TNFC. 2004/O126373 A1 7/2004 Banerjee et al. inhibitors. A preferred biomarker of the invention is CD11c. 2004/O131614 A1 7/2004 Banerjee et al. The methods can further comprise selecting a treatment regi 2004/O136989 A1 7/2004 Banerjee et al. men with a TNFC. inhibitor in an autoimmune disorder sub 2004/O136990 A1 7/2004 Banerjee et al. ject based upon expression of the biomarker(s) in the Subject. 2004/O136991 A1 7/2004 Banerjee et al. 2004/O151722 A1 8/2004 Banerjee et al. The methods can further comprise administering a TNFC. 2004O1661 11 A1 8/2004 Kaymakcalan et al. inhibitor to the subject according to the selected treatment 2004/0219142 A1 11/2004 Banerjee et al. regimen. Kits that include means for measuring expression of 2006,0009385 A1 1/2006 Hoffman et al. one or more biomarkers that are predictive of responsiveness 2006, 0083741 A1 4/2006 Hoffman et al. to TNFC. inhibitors for an autoimmune disorder are also pro 2006, O149042 A1 7/2006 Konstantinov vided. Methods of preparing and using databases, and com 2006, O153846 A1 7/2006 Krause et al. 2006/0216707 A1* 9, 2006 Stuhlmuller et al...... 435/6 puter program products therefore, for selecting an autoim 2006/02694.79 A1 11, 2006 Colton et al. mune disorder subject for treatment with a TNFC. inhibitor 2007/0041905 A1 2/2007 Hoffman et al. are also provided. 2007/007 1747 A1 3/2007 Hoffman et al. 2007/0081996 A1 4/2007 Hoffman et al. 42 Claims, 3 Drawing Sheets US 8,092.998 B2 Page 2

U.S. PATENT DOCUMENTS Emery, Paul et al., “Changes in PRO-MMP-1 in Relation to Standard 2009. O155205 A1 6, 2009 Salfeld et al. Measures of Disease Activity Over a 6Months Treatment Period with 2009,0280065 A1 11, 2009 Willian et al. Adalimumab (D2E7) in Rheumatoid Arthritis.” Arthritis Rheum., 2010.0034823 A1 2/2010 Borhani et al. vol. 44(Suppl.):S215, No. 976 (2001). 2010.0040604 A1 2/2010 Salfeld et al. Furst, D. et al., “TNF Blockade by the Fully Human Monoclonal 2010, 0160894 A1 6/2010 Julian et al. Antibody Adalimumab (D2E7) in the Armada Trial Results in FOREIGN PATENT DOCUMENTS Decrease in Serum Matrix Metalloproteinase (MMP) Levels Along with Impressive Clinical Improvement in Refractory RA Patients.” WO WO972.91.31 8, 1997 WO WO-2004/O16809 A1 * 2, 2004 Arthritis Rheum., vol. 44(9 Suppl.):S215, No. 975 (2001). WO WO 20060925.30 9, 2006 Garnero, Patrick et al., “Association of Baseline Levels of Urinary WO WO 2008028044 3, 2008 Glucosyl-Galactosyl-Pyridinoline and Type II Collagen C-Telopeptide With Progression of Joint Destruction in Patients With OTHER PUBLICATIONS Early Rheumatoid Arthritis.” Arthritis & Rheumatism, vol. 46(1):21 Braun, J. et al., “Anti-tumour necrosis factor Otherapy for ankylosing 30 (2002). spondylitis: international experience.” Ann. Rheum. Dis... vol. Gorman, Jennifer D. et al., “Treatment of Ankylosing Spondylitis by 61(Suppl. III):iii.51-iii60 (2002). Inhibition of Tumor Necrosis Factor C.” The New England Journal of Braun, J. et al., “Biologic therapies in the spondyloarthritis: new Medicine, vol. 346(18): 1349-1356 (2002). opportunities, new challenges.” Curr: Opin. Rheumatol., vol. 15:394 Hawley, Peter et al., “Evaluation of an ELISA Assay for the Simul 407 (2003). taneous Detection of HIV-1 Antibodies and Hepatitis B Surface Anti Braun, J. et al., “International ASAS consensus statement for the use gen.” VII International Conference on Aids, Abstracts vol. II, p. 345, of anti-tumour necrosis factor agents in patients with ankylosing No. W.C.3196 (1991). spondylitis.” Ann. Rheum. Dis... vol. 62:817-824 (2003). Horneff, G. et al., “TNF-C. antagonists for the treatment of juvenile Braun, Jürgen et al., “New treatment options in onset spondyloarthritides.” Clin. Exp. Rheumatol., vol. 20(Suppl. spondyloarthropathies: increasing evidence for significant efficacy of 28):S137-S142 (2002). anti-tumor necrosis factor therapy,” Current Opinion in Rheumatol Kaiser, M.J. et al., “Efficacy of infliximab (Remicade(R) in the treat ogy, vol. 13:245-249 (2001). ment of spondyloarthropathies. Two case reports.' Joint Bone Spine, Braun, Juergen et al., “Novel approaches in the treatment of ankylos vol. 68:525-527 (2001). ing spondylitis and other spondyloarthritides. Expert Opin. Investig. KeySZer, G. et al., “Circulating levels of matrix metalloproteinases Drugs, vol. 12(7): 1097-1109 (2003). MMP-3 and MMP-1, tissue inhibitor of metalloproteinases 1 (TIMP Braun, J. et al., “Persistent clinical response to the anti-TNFO anti 1), and MMP-1/TIMP-1 complex in rheumatoid disease. Correlation body infliximab in patients with ankylosing spondylitis over 3 years.” with clinical activity of rheumatoid arthritis versus other Surrogate Rheumatology, vol. 44:670-676 (2005). markers.” J. Rheumatol., vol. 26(2):251-258 (1999). Braun, Juergen et al., “Therapy of ankylosing spondylitis and other MacCallum, Robert M. et al., “Antibody-antigen Interactions: Con spondyloarthritides: established medical treatment, anti-TNF-C. tact Analysis and Binding Site Topography.” J. Mol. Biol., vol. therapy and other novel approaches.” Arthritis Res., vol. 4:307-321 262:732-745 (1996). (2002). Maini R et al., “Infliximab (chimeric anti-tumour necrosis factor Braun, J. et al., “Treatment of active ankylosing spondylitis with alpha monoclonal antibody) versus placebo in rheumatoid arthritis infliximab: a randomised controlled multicentre trial.” Lancet, vol. patients receiving concomitant methotrexate: a randomised phase III 359:1187-1193 (2002). trial.” The Lancet, vol. 354: 1932-39 (1999). Breban, M. et al., “Efficacy of infliximab in refractory ankylosing Maksymowych, Walter P. et al., “Canadian Rheumatology Associa spondylitis: results of a six-month open-label study, Rheumatology, tion Consensus on the Use of Anti-Tumor Necrosis Factor-O. Directed vol. 41: 1280-1285 (2002). Therapies in the Treatment of Spondyloarthritis.” The Journal of Briot, K. et al., “Body weight, body composition, and bone turnover Rheumatology, vol. 30(6): 1356-1363 (2003). changes in patients with spondyloarthropathy receiving anti-tumour Maksymowych, Walter Petal. “Etanercept Exerts Beneficial Effects necrosis factor O treatment.” Ann. Rheum. Dis., vol. 64: 1137-1140 on Articular Cartilage Biomarkers of Degradation and Turnover in (2005). Patients with Ankylosing Spondylitis.” J. Rheumatol., vol. 32: 1911 Casset, Florence et al., “A peptide mimetic of an anti-CD4 1917 (2005). monoclonal antibody by rational design. Biochemical and Biophysi Maksymowych, Walter P. et al., “Infliximab in Ankylosing cal Research Communications, vol. 307: 198-205 (2003). Spondylitis: A Prospective Observational Inception Cohort Analysis Cherouvim, E.P. et al., “Infliximab Therapy for Patients With Active of Efficacy and Safety.” J. Rheumatol., vol. 29.959-965 (2002). and Refractory Spondyloarthropathies at the Dose of 3 mg/kg.” J. Marzo-Ortega, Helena et al., “Inhibition of Tumor Necrosis Factor C. Clin. Rheumatol., vol. 10:162-168 (2004). and Ankylosing Spondylitis.” The New England Journal of Medicine, Choi, Kang-Seuk et al., “Monoclonal antibody-based competitive vol. 348(4):359-360; author reply 360-361 (2003). ELISA for simultaneous detection of rinderpest virus and peste des Ogilvie, A.L.J. et al., “Treatment of psoriatic arthritis with antitumor petits ruminants virus antibodies.” Veterinary Microbiology, vol. necrosis factor-O antibody clears skin lesions of psoriasis resistant to 96:1-16 (2003). treatment with mexotrexate.” British Journal of Dermatology, vol. Davis, J.C. Jr. et al., “New therapies for ankylosing spondylitis: 144:587-589 (2001). etanercept, thalidomide, adn pamidronate.” Rheum. Dis. Clin. North Paul, William E., Fundamental Immunology, Third Edition, pp. 292 Am... vol. 29(3):481-494 (2003). 295 (1993). Dayer, Jean-Michel et al., “Anti-TNF-C. Therapy for Ankylosing Pham, T. et al., “Initiation of biological agents in patients with Spondylitis, a Specific or Nonspecific Treatment?” N. Engl. J. Med. ankylosing spondylitis: results of a Delphi study by the ASAS vol. 346(18): 1399-1400 (2002). Group.” Ann. Rheum. Dis... vol. 62:812-816 (2003). De Keyser, Filip et al., “Anti-TNF-alpha therapy in ankylosing Reimold, Andreas M., "New Indications for Treatment of Chronic spondylitis.” Cytokine, vol. 33:294-298 (2006). Inflammation by TNF-C. Blockade.” The American Journal of the den Broeder, A.A. et al., “Long term anti-tumour necrosis factor O. Medical Sciences, vol. 325(2):75-92 (2003). monotherapy in rheumatoid arthritis: effect on radiological course Ribbens, C. et al., “Increased matrix metalloproteinase-3 serum lev and prognostic value of markers of cartilage turnover and endothelial els in rheumatic diseases: relationship with synovitis and steroid activation.” Ann. Rheum. Dis... vol. 61:311-318 (2002). treatment.” Ann. Rheum. Dis... vol. 61:161-166 (2002). Dernis, E. et al., “Infliximab in spondylarthropathy—Influence on Rudikoff, Stuartet al., “Single amino acid substitution altering anti bone density.” Clin. Exp. Rheumatol., vol. 200Suppl. 28):S185-S186 gen-binding specificity.” Proc. Natl. Acad. Sci. USA, vol. 79:1979 (2002). 1983 (1982). US 8,092.998 B2 Page 3

Schnarr, S. et al., “Anti-tumour necrosis factor (TNF)-O, therapy in International Search Report for Application No. PCT/US06/42564, undifferentiated sponsyloarthropathy.” Clin. Res. Rheumatol., vol. dated Nov. 14, 2008. 20(Suppl. 28):S126-S129 (2002). International Search Report for Application No. PCT/US08/06912, Sieper, J. et al., “New treatment options in ankylosing spondylitis: a dated Nov. 13, 2008. Database Geo (online) “Expression profiling in RA disease pre and role for anti-TNFO, therapy.” Ann. Rheum. Dis... vol. 60:iii.58-iii.61 post anti-TNF treatment.” NCBI; Apr. 16, 2007. (2001). Lequerre et al., “Gene profiling in white blood cells predicts Smith, David Lloyd et al., “Ibuprofen in psoriatic arthritis.” Arthritis infliximab responsiveness in rheumatoid arthritis.” Arthritis Reseach Rheum., vol. 23(8):961-962 (2005). & Therapy 8(4):R105 (2006). Stokes, David G. et al., "Potential of Tumor Necrosis Factor Neutral Lindberget al., “Effect of Infliximab on mRNA expressionprofiles in ization Strategies in Rheumatologic Disorders Other Than Rheuma synovial tissue of rheumatoid arthritispatients.” Arthritis Research & toid Arthritis.” Semin. Arthritis Rheum., vol. 33:1-18 (2003). Therapyl 8(6):R179 (2006). Stone, Millicent et al., “Clinical and Imaging Correlates of Response Bobbio-Pallavicini et al., “High IgA rheumatoid factor levels are to Treatment with Infliximab in Patients with Ankylosing associate with poor clinical response to tumour necrosis factor alpha Spondylitis.” J. Rheumatol., vol. 28:1605-1614 (2001). inhibitors in rheumatoid arthritis.” Ann Rheum Dis 66(3):302-307 Van den Bosch, Filip et al., “Crohn's disease associated with (2007). spondyloarthropathy: effect of TNF-C. blockade with infliximab on Lequerre et al., “Autoantibodies, metalloproteinases and bone mark articular symptoms.” The Lancet, vol. 356:1821-1822 (2000). ers in rheumatoid arthritis patents are unable to predict their Yang, Chunhua et al., "Serum Levels of Matrix Metalloproteinase 3 responses to infliximab.” Rheumatol. 46(3):446-453 (2007). and Macrophage Colony-Stimulating Factor 1 Correlate With Dis Balanescu et al., “Early and late effect of infliximab on circulating ease Activity in Ankylosing Spondylitis.” Arthritis & Rheumatism, dendritic cells phenotype in rheumatoid arthritis patients.” Interna vol. 51(5):691-699 (2004). tional J of Clinical Pharmacy Researchl 25(1):9-18 (2005). Zou, J.X. et al., “Immunological basis for the use of TNFO-blocking Hernandez et al., “influence of anti-TNF therapy on monocye gene agents in ankylosing spondylitis and immunological changes during expression in rheumatoid arthritis' Annals of the Rheaumatic Dis treatment.” Clin. Exp. Rheumatol., vol. 20(Suppl. 28): S34-S37 eases, and Annual European Congress of Rheumatology 62(Suppl. (2002). 1): 180 (2003). European Search Report for Application No. 06849865.8, dated Oct. 29, 2008. * cited by examiner U.S. Patent Jan. 10, 2012 Sheet 1 of 3 US 8,092,998 B2

O O O O O O O OO CO S GN ym (HOldWo OpeZeuou) OOO uOSSeudxe % U.S. Patent Jan. 10, 2012 Sheet 2 of 3 US 8,092,998 B2

i

O O O O O O O OO O N ON V (HOWS OpeZeuou) OLLOO uOSseudxe % U.S. Patent Jan. 10, 2012 Sheet 3 of 3 US 8,092,998 B2

i

O O O O O O O OO CO. N. CN y (HOWs) Opezieuou) OOO uOSSeudxe 96 US 8,092,998 B2 1. 2 BOMARKERS PREDCTIVE OF THE responsiveness to a TNFC. inhibitor in patients having RESPONSIVENESS TO TNFO INHIBITORS IN autoimmune disorders, such as rheumatoid arthritis patients, AUTOIMMUNE DISORDERS are of particular interest.

RELATED APPLICATIONS SUMMARY OF THE INVENTION This application claims the benefit of priority to U.S. pro This invention provides methods and compositions for pre visional patent application No. 60/932,888 filed on May 31, dicting responsiveness to a TNFC. inhibitor in a subject hav 2007 The contents of the above-mentioned priority applica ing an autoimmune disorder. Such as rheumatoid arthritis, 10 based on the discovery that the expression patterns of particu tion is hereby incorporated by reference in its entirety lar biomarkers in the subject correlate with responsiveness to a TNFC. inhibitor. Using microarray analysis of monocytes BACKGROUND OF THE INVENTION from representative rheumatoid arthritis (RA) patients treated Autoimmune disorders are a significant and widespread with an anti-TNFC. monoclonal antibody, 82 differentially 15 expressed genes predictive of responsiveness to TNFC. inhibi medical problem. For example, rheumatoid arthritis (RA) is tor treatment were identified by pairwise comparisons an autoimmune disease affecting more than two million between future RA responders and future RA non-responders people in the United States. RA causes chronic inflammation to anti-TNFC. therapy. Furthermore, hierarchical clustering of the joints and typically is a progressive illness that has the and TaqMan(R)-PCR of RA responders/non-responders pre potential to cause joint destruction and functional disability. treatment identified one gene of particular interest, CD11c, The cause of rheumatoid arthritis is unknown, although which was fully predictive of future response to anti-TNFC. genetic predisposition, infectious agents and environmental treatment. factors have all been implicated in the etiology of the disease. Accordingly, in one aspect, the invention pertains to a In active RA, symptoms can include fatigue, lack of appetite, method for predicting responsiveness to a TNFC. inhibitor in low grade fever, muscle and joint aches and stiffness. Also 25 a subject having an autoimmune disorder (e.g., rheumatoid during disease flare ups, joints frequently become red, Swol arthritis). The method comprises: (i) assaying the Subject for len, painful and tender, due to inflammation of the synovium. expression of one or more biomarkers predictive of respon Furthermore, since RA is a systemic disease, inflammation siveness to a TNFC. inhibitor in an autoimmune disorder, and can affect organs and areas of the body other than the joints, (ii) predicting responsiveness of the subject to the TNFC. including glands of the eyes and mouth, the lung lining, the 30 inhibitor based on expression of the one or more biomarkers pericardium, and blood vessels. in the subject, wherein the one or more biomarkers is encoded Traditional treatments for the management of RA and other by a nucleic acid molecule comprising a nucleotide sequence autoimmune disorders include fast acting “first line drugs' selected from the group consisting of SEQ ID NO: 1-82 and slower acting 'second line drugs.” The first line drugs (corresponding to the sequences set forth in Table 9) 35 Within SEQID NOs: 1-82, certain genes were found to be reduce pain and inflammation. Example of Such first line upregulated in RA responders to TNFC. inhibitors. Accord drugs include aspirin, naproxen, ibuprofen etodolac and other ingly, in one embodiment, the one or more biomarkers is nonsteroidal anti-inflammatory drugs (NSAIDs), as well as encoded by a nucleic acid molecule comprising a nucleotide corticosteroids, given orally or injected directly into tissues sequence selected from the group consisting of SEQID NOs: and joints. The second line drugs promote disease remission 40 6, 7, 10, 15-17, 19, 22, 24, 27, 31, 34-39, 43-47,49, 51,54,55, and prevent progressivejoint destruction and are also referred 57, 59, 61, 62, 64, 70, 75, 79 and 82 (corresponding to to as disease-modifying anti-rheumatic drugs or DMARDS. sequences from Table 9 that are increased in 280% of Examples of second line drugs include gold, hydrochloro responders vs. non-responders). More preferably, the one or quine, aZulfidine and immunosuppressive agents, such as more biomarkers is encoded by a nucleic acid molecule com methotrexate, azathioprine, cyclophosphamide, chloram 45 prising a nucleotide sequence selected from the group con bucil and cyclosporine. Many of these drugs, however, can sisting of SEQID NOs: 31,37, 44, 47, 62 and 70 (correspond have detrimental side-effects. Thus, additional therapies for ing to sequences from Table 9 that are increased in 290% of rheumatoid arthritis and other autoimmune disorders have responders vs. non-responders). Even more preferably, the been sought. one or more biomarkers is encoded by a nucleic acid molecule More recently, biological therapies have been applied to 50 comprising the nucleotide sequence of SEQID NO: 44. (cor the treatment of autoimmune disorders such as rheumatoid responding to CD11c, from Table 9, which is increased in arthritis. For example, three TNFC. inhibitors, REMI 100% of responders vs. non-responders). In each of these CADETM (infliximab), a chimeric anti-TNFC. mAb, embodiments, increased expression of the one or more biom ENBRELTM (etanercept), a TNFR-Ig Fc fusion protein, and arkers is predictive of responsiveness of the subject to a TNFC. HUMIRATM (adalimumab), a human anti-TNFC. mAb, have 55 inhibitor. been approved by the FDA for treatment of rheumatoid arthri Within SEQID NOs: 1-82, certain genes were found to be tis. While such biologic therapies have demonstrated success downregulated in RA responders to TNFC. inhibitors. in the treatment of rheumatoid arthritis and other autoimmune Accordingly, in one embodiment, the one or more biomarkers disorders, not all subjects treated respond, or respond well, to is encoded by a nucleic acid molecule comprising a nucle a TNFO inhibitor. The use of TNFO inhibitors such as TNFC. 60 otide sequence selected from the group consisting of SEQID inhibitors typically is more expensive than traditional treat NOs: 1-5,8,9, 11-14, 18, 20, 21, 23, 25, 26, 28-30, 32, 33, ments and usually requires administration by injection, 40-42, 48, 50, 52,53,56,58, 60, 63, 65-69, 71-74, 76-78, 80 which, at least for certain agents, may require that the patient and 81. (corresponding to sequences from Table 9 that are visit a medical office on a frequent basis. Thus, it would be decreased in 280% of responders vs. non-responders). More very helpful to predict in advance of treatment whether a 65 preferably, the one or more biomarkers is encoded by a rheumatoid arthritis patient is likely to be responsive to treat nucleic acid molecule comprising a nucleotide sequence ment with a TNFC. inhibitor. Accordingly, ways for predicting selected from the group consisting of SEQID NOs: 11, 29. US 8,092,998 B2 3 4 65, 73 and 74 (corresponding to sequences from Table 9 that receptor, beta (Genbank Accession No. NM 001557): Plate are decreased in 290% of responders vs. non-responders). let factor 4 variant 1 (Genbank Accession No. NM 002620): Even more preferably, the one or more biomarkers is encoded Poly(A) binding protein interacting protein 1 (Genbank by a nucleic acid molecule comprising the nucleotide Accession No. NM 006451); ATP-binding cassette, sub sequence of SEQID NO: 11 or SEQID NO: 74 (correspond 5 family C (CFTR/MRP), member 3 (Genbank Accession No. ing to sequences from Table 9 that are decreased in 100% of NM 003786); Actinin, alpha 1 (Genbank Accession No. responders vs. non-responders). In each of these embodi NM 001102); NAD kinase (Genbank Accession No. ments, decreased expression of the one or more biomarkers is NM 023018); Platelet/endothelial cell adhesion molecule predictive of responsiveness of the subject to a TNFC. inhibi (CD31 antigen) (Genbank Accession No. NM 000442); tOr. 10 Esterase D/formylglutathione hydrolase (Genbank Acces In another aspect, the invention provides a method for sion No. NM 001984); Chromosome 20 open reading frame predicting responsiveness to a TNFC. inhibitor in a subject 111 (Genbank Accession No. NM 016470); Sterol-C4-me having an autoimmune disorder, the method comprising: (i) thyl oxidase-like (Genbank Accession NoS. assaying the Subject for expression of one or more biomarkers NM 001017369, NM 006745); PIM-1 oncogene (Gen predictive of responsiveness to a TNFC. inhibitor in an 15 bank Accession No. NM 002648); GATA binding protein 2 autoimmune disorder, and (ii) predicting responsiveness of (Genbank Accession No. NM 032638); Cathepsin Z (Gen the subject to the TNFC. inhibitor based on expression of the bank Accession No. NM 001336); Integrin alpha-X (anti one or more biomarkers in the subject, wherein the one or gen CD11c) (Genbank Accession No. NM 000887); Lectin, more biomarkers is selected from the group consisting of galactoside-binding, soluble, 8 (galectin 8) (Genbank Acces Aquaporin 3 (Genbank Accession No. NM 004925); Simi sion Nos. NM 006499, NM 201545); CD86 antigen lar to ribosomal protein S24, clone MGC:8595 (Genbank (CD28 antigen ligand 2. B7-2 antigen) (Genbank Accession Accession No. NM 033022); Transmembrane emp24 Nos. NM 006889, NM 175862): Interleukin 8 (Genbank domain trafficking protein 2 (Genbank Accession No. Accession No. NM 000584); Fc fragment of IgE, high affin NM 006815; Superoxide dismutase 1, soluble (amyotrophic ity I, receptor for alpha polypeptide (Genbank Accession No. lateral sclerosis 1 (Genbank Accession No. NM 000454): 25 NM 002001); Actin, gamma 1 (Genbank Accession No. Calmodulin 1 (phosphorylase kinase, delta) (Genbank Acces NM 001614); KIAA0746 protein (Genbank Accession No. sion No. NM 006888); Guanine nucleotide binding protein NM 015187); Glucosamine (N-acetyl)-6-sulfatase (Sanfil (G protein), beta polypeptide 1 (Genbank Accession No. ippo disease IIID) (Genbank Accession No. NM 002076): NM 002074); Prothymosin, alpha (gene sequence 28) (Gen Transcription factor 4 (Genbank Accession Nos. BF592782, bank Accession No. NM 002823); Homo sapiens isocitrate 30 CR6 12521); Major histocompatibility complex, class II, DQ dehydrogenase 1 (NADP+) soluble (IDH1) (Genbank Acces alpha 1 (Genbank Accession Nos. NM 002122, sion No. NM 005896); Tumor protein D52 (Genbank NM 020056); Cell division cycle 2-like 6 (CDK8-like) Accession Nos. NM 001025252, NM 001025253, (Genbank Accession No. NM 015076); Major histocompat NM 005079); Early growth response 1 (Genbank Accession ibility complex, class II, DQ beta 1 (Genbank Accession No. No. NM 001964); Homo sapiens predicted osteoblast pro 35 XM 942240); Phospholipase C-like 2 (Genbank Accession tein (GS3786) (Genbank Accession Nos. NM 014888, No. NM 015184); Coagulation factor II (thrombin) recep M 00104.0020); Cytochrome c oxidase subunit VIIb (Gen tor-like 1 (Genbank Accession No. NM 00:5242): TM2 ank Accession No. NM 001866); CUG triplet repeat, RNA domain containing 1 (Genbank Accession No. inding protein 2 (Genbank Accession No. NM 001025077, NM 032027); Splicing factor 3b, subunit 1, 155 kDa (Gen M 001025076, NM 006561): Ubiquinol-cytochrome c 40 bank Accession No. NM 012433); SUB1 homolog (S. cer eductase hinge protein (Genbank Accession No. evisiae) (Genbank Accession No. NM 006713); MRNA; M 006004); Homos sapiens leptin receptor gene-related cDNA DKFZp56400862 (Genbank Accession No. rotein (HSOBRGRP) (Genbank Accession No. AI278204); Amyloid beta (A4) precursor protein (peptidase M 017526); Wiskott-Aldrich syndrome protein interact nexin-II, Alzheimer disease) (Genbank Accession Nos. s g protein (Genbank Accession Nos. NM 001077269, 45 NM 201413, NM 000484, NM 201414); Cytochrome M 003387); CD97 antigen (Genbank Accession Nos. b-5 (Genbank Accession Nos. NM 001914, NM 148923): M 001025160, NM 001784, NM 078.481); Glutamate Cold autoinflammatory syndrome 1 (Genbank Accession No. ysteine ligase, catalytic subunit (Genbank Accession No. NM 183395); Neugrin, neurite outgrowth associated (Gen M 001498); Crystallin, Zeta (quinone reductase) (Gen bank Accession Nos. NM 016645, NM 001033088): ank Accession No. NM 001889); Rap guanine nucleotide 50 Ribosomal protein S26, 40S ribosomal protein (Genbank xchange factor (GEF) 2 (Genbank Accession No. Accession No. XM 94.1927); CCR4-NOT transcription M 014247); Ataxin 1 (Genbank Accession No. complex, subunit 6 (Genbank Accession No. NM 015455); N M 000332); Adaptor-related protein complex 1, sigma 2 Ubiquinol-cytochrome c reductase complex (7.2 kD) (Gen subunit (Genbank Accession No. NM 003916); Ectonucle bank Accession Nos. NM 013387, NM 001003684): otide pyrophosphatase/phosphodiesterase 4 (Genbank 55 Hepatocellular carcinoma-associated antigen 112 (Genbank Accession No. NM 014936); Desmocollin 2 (Genbank Accession No. NM 018487); Kruppel-like factor 11 (Gen Accession Nos. NM 024422, NM 004949); MAL, T-cell bank Accession No. XM 001 129527); GGAbinding partner differentiation protein (Genbank Accession Nos. (Genbank Accession No. NM 018318); Cornichonhomolog NM 002371, NM 022438, NM 022439, NM 022440); 4 (Drosophila) (Genbank Accession No. NM 01418.4): Glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylman 60 Hypothetical protein FLJ21616 (Genbank Accession No. nosamine kinase (Genbank Accession No. NM 005476): NM 024567); Homo sapiens hypothetical protein Chemokine (C-C motif) ligand 3 (Genbank Accession Nos. FLJ10134 (Genbank Accession No. NM 018004); Nuclear NM 001001437, NM 021006); Carboxypeptidase A3 prelamin A recognition factor (Genbank Accession Nos. (Genbank Accession No. NM 001870); Charcot-Leyden NM 012336, NM 0010386.18); Erythroblast membrane crystal protein (Genbank Accession No. NM 001828); 65 associated protein (Genbank Accession Nos. NM 018538, NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1.7 NM 001017922); LR8 protein (Genbank Accession No. kDa (Genbank Accession No. NM 004.545); Interleukin 8 NM 014020); Likely ortholog of mouse limb-bud and heart US 8,092,998 B2 5 6 gene (LBH) (Genbank Accession No. NM 030915): Calmin (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase; (calponin-like, transmembrane) (Genbank Accession No. Carboxypeptidase A3; Charcot-Leyden crystal protein; NM 024734); Chromosome 14 open reading frame 156 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1.7 (Genbank Accession No. NM 03.1210); Guanine nucleotide kDa. Platelet factor 4 variant 1; Poly(A) binding protein inter binding protein (G protein) alpha 12 (Genbank Accession No. acting protein 1: Sterol-C4-methyl oxidase-like; PIM-1 onco NM 007353); and SRY (sex determining region Y)-box 18 gene; GATA binding protein 2; Fc fragment of IgE, high (Genbank Accession No. NR 003287) (corresponding to affinity I, receptor for; alpha polypeptide; KIAA0746 protein; biomarkers listed in Table 9). Transcription factor 4: Major histocompatibility complex, Within the above-listed biomarkers, certain genes were class II, DQ alpha 1: Phospholipase C-like 2: TM2 domain found to be upregulated in RA responders to TNFC. inhibitors. 10 containing 1: SUB1 homolog (S. cerevisiae): Cytochrome Accordingly, in one embodiment, the one or more biomarkers b-5; Neugrin, neurite outgrowth associated; Ribosomal pro is selected from the group consisting of Guanine nucleotide tein S26, 40S ribosomal protein; CCR4-NOT transcription binding protein (G protein), beta polypeptide 1: Prothymosin, complex, Subunit 6: Ubiquinol-cytochrome c reductase com alpha (gene sequence 28); Early growth response 1 Homo plex (7.2 kD); Hepatocellular carcinoma-associated antigen sapiens leptin receptor gene-related protein (HSOBRGRP): 15 112: GGA binding partner; Cornichon homolog 4 (Droso Wiskott-Aldrich syndrome protein interacting protein: CD97 phila); Hypothetical protein FLJ21616; Homo sapiens hypo antigen; Crystallin, Zeta (quinone reductase); Adaptor-related thetical protein FLJ10134; Erythroblast membrane-associ protein complex 1, sigma 2 subunit; Desmocollin 2: Chemok ated protein; LR8 protein; Likely ortholog of mouse limb-bud ine (C-C motif) ligand 3; Interleukin 8 receptor, beta; ATP and heart gene (LBH); Chromosome 14 open reading frame binding cassette, sub-family C (CFTR/MRP), member 3: 156; and Guanine nucleotide binding protein (G protein) Actinin, alpha 1: NAD kinase; Platelet/endothelial cell adhe alpha 12 (corresponding to biomarkers from Table 9 that are sion molecule (CD31 antigen); Esterase D/formylglutathione decreased in 280% of responders vs. non-responders). More hydrolase; Chromosome 20 open reading frame 111; Cathe preferably, the one or more biomarkers is selected from the psin Z:. Integrin alpha-X (antigen CD 11c); Lectin, galacto group consisting of Homo sapiens predicted osteoblast pro side-binding, soluble, 8 (galectin 8); CD86 antigen (CD28 25 tein (GS3786); Charcot-Leyden crystal protein; Neugrin, antigen ligand 2. B7-2 antigen); Interleukin 8: Actin, gamma neurite outgrowth associated; Hypothetical protein 1: Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease FLJ21616; and Homo sapiens hypothetical protein FLJ10134 IIID); Cell division cycle 2-like 6 (CDK8-like); Major histo (corresponding to biomarkers from Table 9 that are decreased compatibility complex, class II, DQ beta 1; Coagulation fac in 290% of responders vs. non-responders). Even more pref tor II (thrombin) receptor-like 1: Splicing factor 3b, subunit 1, 30 erably, the one or more biomarkers is Homo sapiens predicted 155 kDa; MRNA, cDNA DKFZp56400862: Amyloid beta osteoblast protein (GS3786) or Homo sapiens hypothetical (A4) precursor protein (peptidase nexin-II, Alzheimer dis protein FLJ10134 (corresponding to biomarkers from Table 9 ease); Cold autoinflammatory syndrome 1: Kruppel-like fac that are decreased in 100% of responders vs. non-respond tor 11, Nuclear prelaminA recognition factor, Calmin (calpo ers). In each of these embodiments, decreased expression of nin-like, transmembrane); and SRY (sex determining region 35 the one or more biomarkers is predictive of responsiveness of Y)-box 18 (corresponding to biomarkers from Table 9 that are the subject to a TNFC. inhibitor. increased in >80% of responders vs. non-responders). More In yet another aspect, the invention provides a method for preferably, the one or more biomarkers is selected from the predicting responsiveness to a TNFC. inhibitor in a subject group consisting of Interleukin 8 receptor, beta; Platelet/en having an autoimmune disorder, the method comprising: (i) dothelial cell adhesion molecule (CD31 antigen); Integrin 40 assaying the Subject for increased expression of a biomarker, alpha-X (antigen CD11c); Interleukin 8: Amyloid beta (A4) which biomarker is CD11c, and (ii) predicting responsive precursor protein (peptidase nexin-II, Alzheimer disease); ness of the subject to the TNFC. inhibitor based on increased and Kruppel-like factor 11 (corresponding to biomarkers expression of CD11c in the subject. from Table 9 that are increased in >90% of responders vs. In yet another aspect, the invention provides a method for non-responders). Even more preferably, the one or more 45 predicting responsiveness to a TNFC. inhibitor, which TNFC. biomarkers is Integrin alpha-X (antigen CD11c) (correspond inhibitor is adalimumab, in a Subject having an autoimmune ing to a biomarker from Table 9 that is increased in 100% of disorder, the method comprising: (i) assaying the Subject for responders vs. non-responders). In each of these embodi expression of one or more biomarkers predictive of respon ments, increased expression of the one or more biomarkers is siveness to adalimumab in an autoimmune disorder, and (ii) predictive of responsiveness of the subject to a TNFalpha. 50 predicting responsiveness of the Subject to adalimumab based inhibitor. on expression of the one or more biomarkers in the Subject. Within the above-listed biomarkers, certain genes were Preferably, the one or more biomarkers is encoded by a found to be downregulated in RA responders to TNFC. inhibi nucleic acid molecule comprising a nucleotide sequence tors. Accordingly, in one embodiment, the one or more biom selected from the group consisting of SEQ ID NO: 1-82 arkers is selected from the group consisting of Aquaporin 3: 55 (corresponding to biomarkers set forth in Table 9). Similar to ribosomal protein S24, clone MGC:8595: Trans In one embodiment of the methods of the invention, a membrane emp24 domain trafficking protein 2; Superoxide sample from the subject is assayed for expression of mRNA dismutase 1, Soluble (amyotrophic lateral Sclerosis 1: Calm encoding the one or more biomarkers. In another embodiment odulin 1 (phosphorylase kinase, delta); Homo sapiens isoci of the methods of the invention, a sample from the subject is trate dehydrogenase 1 (NADP+) soluble (IDH1); Tumor pro 60 assayed for protein expression of the one or more biomarkers. tein D52; Homo sapiens predicted osteoblast protein In one embodiment, the methods of the invention further (GS3786): Cytochrome c oxidase subunit VIIb: CUG triplet comprise selecting a treatment regimen with the TNFC. repeat, RNA binding protein 2: Ubiquinol-cytochrome c inhibitor based upon expression of the one or more biomar reductase hinge protein; Glutamate-cysteine ligase, catalytic kers in the subject. In another embodiment, the methods of the Subunit; Rap guanine nucleotide exchange factor (GEF)2; 65 invention further comprise administering the TNFC. inhibitor Ataxin 1; Ectonucleotide pyrophosphatase/phosphodi to the Subject according to the treatment regimen Such that esterase 4: MAL, T-cell differentiation protein; Glucosamine autoimmune disorder is inhibited in the subject. US 8,092,998 B2 7 8 A preferred TNFC. inhibitor of the invention is an anti sequence of SEQ ID NO: 44 (CD11c). In each of these tumor necrosis factor-alpha (TNFC) antibody, or antigen embodiments, the instructions for use of the kit instruct that binding portion thereof. The anti-TNFC. antibody, or antigen increased expression of the one or more biomarkers is pre binding portion thereof, can be, for example, a humanized dictive of responsiveness of the subject to a TNFC. inhibitor. antibody, a chimericantibody or a multivalent antibody. For In another embodiment of the kit, the one or more biom example, the anti-TNFC. antibody, or antigen-binding portion arkers is encoded by a nucleic acid molecule comprising a thereof, can be infliximab or golimumab. In another embodi nucleotide sequence selected from the group consisting of ment, the anti-TNFC. antibody, or antigen-binding portion SEQID NOs: 1-5,8,9, 11-14, 18, 20, 21, 23, 25, 26, 28-30, thereof, is a human antibody. For example, the anti-TNFC. 32, 33, 40-42, 48, 50, 52, 53, 56, 58, 60, 63, 65-69, 71-74, antibody, or antigen-binding portion thereof, can be an iso 10 76-78, 80 and 81, more preferably the one or more biomarkers lated human antibody that dissociates from human TNFC. is encoded by a nucleic acid molecule comprising a nucle with a K of 1x10 M or less and a K rate constant of otide sequence selected from the group consisting of SEQID 1x10s' or less, both determined by surface plasmon reso NOs: 11, 29, 65, 73 and 74, even more preferably the one or nance, and neutralizes human TNFC. cytotoxicity in a stan more biomarkers is encoded by a nucleic acid molecule com dard in vitro L929 assay with an ICso of 1x107M or less. In 15 prising the nucleotide sequence of SEQID NO: 11 or SEQID another embodiment, the anti-TNFC. antibody, or antigen NO: 74. In each of these embodiments, the instructions for binding portion thereof, is an isolated human antibody with use of the kit instruct that decreased expression of the one or the following characteristics: more biomarkers is predictive of responsiveness of the sub a) dissociates from human TNFC. with a K-rate constant ject to a TNFC. inhibitor. of 1x10s' or less, as determined by surface plasmon reso In one embodiment of the kit, the means for measuring nance, expression in the Subject of one or more biomarkers predic b) has a light chain CDR3 domain comprising the amino tive of responsiveness to a TNFC. inhibitor in an autoimmune acid sequence of SEQID NO:305, or modified from SEQID disorder comprises a nucleic acid preparation Sufficient to NO: 305 by a single alanine substitution at position 1, 4, 5, 7 detect expression of mRNA encoding the biomarker in a or 8 or by one to five conservative amino acid substitutions at 25 sample from the subject. In another embodiment of the kit, the positions 1, 3, 4, 6, 7, 8 and/or 9: means for measuring expression in the Subject of one or more c) has a heavy chain CDR3 domain comprising the amino biomarkers predictive of responsiveness to a TNFC. inhibitor acid sequence of SEQID NO:306, or modified from SEQID in an autoimmune disorder comprises an antibody prepara NO: 306 by a single alanine substitution at position 2, 3, 4, 5, tion sufficient to detect protein expression of the biomarker in 6, 8, 9, 10 or 11 or by one to five conservative amino acid 30 a sample from the Subject. The kit can further comprise a substitutions at positions 2, 3, 4, 5, 6, 8, 9, 10, 11 and/or 12. TNFC. inhibitor for treating the autoimmune disorder in the In another embodiment, the anti-TNFC. antibody, or anti subject. gen-binding portion thereof, is an isolated human antibody In another aspect, the invention pertains to methods of with a light chain variable region (LCVR) comprising the monitoring an autoimmune disorder (e.g., RA) in a subject amino acid sequence of SEQID NO:303 and a heavy chain 35 having the autoimmune disorder (e.g., RA). These methods variable region (HCVR) comprising the amino acid sequence are based, at least in part, on microarray analysis of mono of SEQ ID NO: 304. In yet another embodiment, the anti cytes from representative rheumatoid arthritis (RA) patients TNFC. antibody, or antigen-binding portion thereof, is adali treated with an anti-TNFC. monoclonal antibody, including (i) mumab. Yet another example of a TNFC. inhibitor is etaner hierarchical clustering with the genes resulting from a simul cept. 40 taneous comparison between RA versus ND and RA respond Preferably, in the methods of the invention, the subject is a ers pre- versus post-anti-TNFC. therapy, (ii) prediction analy human. sis of microarrays (PAM); and (iii) hierarchical clustering In another aspect, the invention pertains to a kit for pre based on the comparison between RA responders and non dicting responsiveness to a TNFC. inhibitor in a subject hav responders post-treatment. ing an autoimmune disorder (e.g., rheumatoid arthritis). The 45 Accordingly, in another aspect, the invention provides a kit comprises: method of monitoring an autoimmune disorder in a subject a) means for isolating monocytes; having the autoimmune disorder, the method comprising: b) means for measuring expression in the Subject of one or assaying the Subject for expression of one or more biomark more biomarkers predictive of responsiveness to a TNFC. ers, wherein the one or more biomarkers is encoded by a inhibitor in an autoimmune disorder; 50 nucleic acid molecule comprising a nucleotide sequence c) means for measuring expression of at least one house selected from the group consisting of SEQ ID NO: 83-133 keeping gene; and (corresponding to biomarkers set forth in Table 3), thereby d) instructions for use of the kit to predicting responsive monitoring the autoimmune disorder in the Subject. ness to a TNFC. inhibitor in a Subject having an autoimmune In another aspect, the invention provides a method of moni disorder, wherein the one or more biomarkers is encoded by a 55 toring an autoimmune disorder in a subject having the nucleic acid molecule comprising a nucleotide sequence autoimmune disorder, the method comprising: assaying the selected from the group consisting of SEQID NO: 1-82. subject for expression of one or more biomarkers, wherein the In one embodiment of the kit, the one or more biomarkers one or more biomarkers is encoded by a nucleic acid molecule is encoded by a nucleic acid molecule comprising a nucle comprising a nucleotide sequence selected from the group otide sequence selected from the group consisting of SEQID 60 consisting of SEQID NO: 134-177, 110, 112, 118, 123 and NOs: 6, 7, 10, 15-17, 19, 22, 24, 27, 31, 34-39, 43-47,49, 51, 131 (corresponding to biomarkers set forth in Table 4), 54, 55, 57, 59, 61, 62, 64, 70, 75, 79 and 82, more preferably thereby monitoring the autoimmune disorder in the Subject. the one or more biomarkers is encoded by a nucleic acid In one embodiment, preferably the one or more biomarkers is molecule comprising a nucleotide sequence selected from the encoded by a nucleic acid molecule comprising a nucleotide group consisting of SEQID NOs: 31, 37, 44, 47, 62 and 70, 65 sequence selected from the group consisting of SEQID NO: even more preferably the one or more biomarkers is encoded 134-150, 112, 118 and 131 (upregulated biomarkers from by a nucleic acid molecule comprising the nucleotide Table 4), wherein expression of the one or more biomarkers is US 8,092,998 B2 10 increased in the Subject. In another embodiment, the one or Subjects having an autoimmune disorder; and storing the more biomarkers is encoded by a nucleic acid molecule com biomarker expression pattern from each Subject Such that the prising a nucleotide sequence selected from the group con biomarker expression pattern is associated with an identifier sisting of SEQID NO: 151-177, 110 and 123 (downregulated of the subject, wherein the biomarker expression pattern biomarkers from Table 4), wherein expression of the one or reports expression in the Subject of one or more biomarkers more biomarkers is decreased in the Subject. encoded by a nucleic acid molecule comprising a nucleotide In another aspect, the invention provides a method of moni sequence selected from the group consisting of SEQID NO: toring an autoimmune disorder in a subject having the 1-82. The identifier of the subject can be, for example, a autoimmune disorder, the method comprising: assaying the numerical identifier coded to an identity of the subject. In a subject for expression of one or more biomarkers, wherein the 10 one or more biomarkers is encoded by a nucleic acid molecule preferred embodiment, the method further comprises receiv comprising a nucleotide sequence selected from the group ing, in the computer system, one or more treatment regimens consisting of SEQID NO:178-292.91 and 97 (corresponding for treatment of the autoimmune disorder in a Subject Such to biomarkers set forth in Table 5), thereby monitoring the that the treatment regimen is associated with the biomarker autoimmune disorder in the Subject. In one embodiment, the 15 expression pattern of the subject and the identifier of the one or more biomarkers is encoded by a nucleic acid molecule Subject. comprising a nucleotide sequence selected from the group The invention also pertains to a computer program product consisting of SEQID NO: 178-185; 187-200, 202,203, 205 containing executable instructions that when executed cause 207: 211, 213, 214, 216, 220, 221, 226, 228, 229, 231, 232, a processor to perform operations comprising: receiving, in a 234, 235, 238-247, 249, 250, 253, 262-265, 268-282 and computer system, a biomarker expression pattern of a subject 285-288 (upregulated biomarkers from Table 5), wherein at one or more biomarkers predictive of responsiveness to a expression of the one or more biomarkers is increased in the TNFC. inhibitor in an autoimmune disorder; and storing the Subject. In another embodiment, the one or more biomarkers biomarker expression pattern Such that the biomarker expres is encoded by a nucleic acid molecule comprising a nucle sion pattern is associated with an identifier of the Subject, otide sequence selected from the group consisting of SEQID 25 wherein the biomarker expression pattern reports expression NO: 186, 201, 204, 208,209, 91,210, 212,97, 215, 217-219, in the subject of one or more biomarkers encoded by a nucleic 222-225, 227, 230, 233,236, 237, 248, 251, 252, 254-261, acid molecule comprising a nucleotide sequence selected 266, 267, 283, 284 and 289-292 (downregulated biomarkers from the group consisting of SEQIDNO: 1-82. The computer from Table 5), wherein expression of the one or more biom program can further cause the processor to performan opera arkers is decreased in the Subject. 30 tion comprising: receiving, in the computer system, a treat In another aspect, the invention provides a method of moni ment regimen for treatment of the autoimmune disorder in the toring an autoimmune disorder in a subject having the subject such that the treatment regimen is associated with the autoimmune disorder, the method comprising: assaying the biomarker expression pattern of the subject and the identifier subject for expression of one or more biomarkers, wherein the of the subject. one or more biomarkers is encoded by a nucleic acid molecule 35 In yet another aspect, the invention pertains to a method of comprising a nucleotide sequence selected from the group selecting an autoimmune disorder Subject for treatment with consisting of SEQID NO: 87.97, 101, 293, 92,272,93, 107, a TNFC. inhibitor, the method comprising: (i) identifying, in a 108, 121 and 123 (corresponding to pre-treatment biomarkers database comprising a plurality of autoimmune disorder Sub set forth in Table 6), and wherein the subject is monitored jects, a Subject whose database entry is associated with a prior to treatment with a TNFC. inhibitor, thereby monitoring 40 biomarker expression pattern that is predictive of responsive the autoimmune disorder in the Subject. ness to treatment with a TNFC. inhibitor, and (ii) selecting the In another aspect, the invention provides a method of moni subject for treatment with a TNFC. inhibitor, wherein the toring an autoimmune disorder in a subject having the biomarker expression pattern reports expression in the Sub autoimmune disorder the method comprising: assaying the ject of one or more biomarkers encoded by a nucleic acid subject for expression of one or more biomarkers, wherein the 45 molecule comprising a nucleotide sequence selected from the one or more biomarkers is encoded by a nucleic acid molecule group consisting of SEQID NO: 1-82. The method can fur comprising a nucleotide sequence selected from the group ther comprise selecting a treatment regimen by identifying, in consisting of SEQID NO: 290, 209, 98, 112, 116, 121, 130, the database, a treatment regimen that has been associated 155, 92, 289. 216 and 131 (corresponding to post-treatment with the biomarker expression pattern of the subject and with biomarkers set forth in Table 6), and wherein the subject is 50 an identifier of the subject. monitored after treatment with a TNFC. inhibitor, thereby The invention also pertains to a computer program product monitoring the autoimmune disorder in the Subject. containing executable instructions that when executed cause In yet another aspect, the invention provides a method of a processor to perform operations comprising: (i) identifying, monitoring an autoimmune disorder in a Subject having the in a database including a plurality of autoimmune disorder autoimmune disorder, the method comprising: assaying the 55 Subjects associated with biomarker expression patterns, a subject for expression of one or more biomarkers, wherein the Subject that is associated with a biomarker expression pattern one or more biomarkers is encoded by a nucleic acid molecule that is predictive of responsiveness to treatment with a TNFC. comprising a nucleotide sequence selected from the group inhibitor; and (ii) outputting the identified Subject as a subject consisting of SEQID NO: 97,102,29,294,295,91, 131,290, to be treated with a TNFC. inhibitor; wherein the biomarker 100, 134,296,297,298,299, 136, 174 and 300 (correspond 60 expression pattern reports expression in the Subject of one or ing to biomarkers set forth in Table 7), thereby monitoring the more biomarkers encoded by a nucleic acid molecule com autoimmune disorder in the Subject. prising a nucleotide sequence selected from the group con In yet another aspect, the invention pertains to a method of sisting of SEQID NO: 1-82. In one embodiment, the com building a database for use in selecting a subject having an puter program further causes the processor to perform an autoimmune disorder (e.g., R.A) for treatment with a TNFC. 65 operation comprising outputting a treatment regimen that is inhibitor. The method comprises: receiving, in a computer associated with the subject to be treated with the TNFC. system, biomarker expression patterns from a plurality of inhibitor. US 8,092,998 B2 11 12 BRIEF DESCRIPTION OF THE DRAWINGS kers can be assessed in RA subjects for which TNFC. inhibitor therapy is being considered, or subjects Suffering from other FIG. 1 is a bar graph showing the results of experiments autoimmune disorders amenable to TNFC. inhibitor therapy, validating the predictive gene CD11c by quantitative real to thereby predict responsiveness of the subject to such time PCR. mRNA expression was compared in monocytes therapy and/or to aid in the selection of an appropriate treat from normal donors (n=16), as well as future responders and ment regimen. future non-responders to therapy with anti-TNFC. (RA Furthermore, additional patterns of biomarker expression CTNF: filled circles ; 15 responders and 12 non-responders) were identified by (i) hierarchical clustering with the genes or to combination therapy with anti-TNFO/methotrexate resulting from a simultaneous comparison between RA Ver (RA-CTNF/MTX; empty circles o. 7 responders and 9 non 10 sus ND and RA responders pre- versus post-anti-TNFC. responders) The expression of CD11c is expressed as the therapy; (ii) prediction analysis of microarrays; and (iii) hier means-Estandard error of the mean normalized to that of the archical clustering based on the comparison between RA house keeping gene glycerol-aldehyd-3-phosphate dehydro responders and non-responders post-treatment. Accordingly, genase (GAPDH: % expression). Except for 1 RA patient the biomarker expression patterns described herein also can with a borderline ACR response of 30 and a CD11c mRNA 15 be using in monitoring an autoimmune disorder in a Subject, level directly at the distinction threshold (who was therefore e.g., monitoring the responsiveness of the Subject to a par classified as a false negative), the threshold level (40%) ticular therapy or assisting in the diagnosis or prognosis of the almost fully distinguished future responders from nonre autoimmune disorder (e.g., RA) in the Subject. sponders (100% specificity, 94% sensitivity, and 96% In order that the present invention may be more readily power). The threshold level to distinguish future responders understood, certain terms are first defined. Additional defini from non-responders is indicated by a broken line (- - - ); * tions are set forth throughout the detailed description. PsO.05, ** Ps0.01 as compared to normal donors: The term “predicting responsiveness to a TNFC. inhibitor, +++Ps0.005 as compared to future responders to anti-TNFC. as used herein, is intended to refer to an ability to assess the therapy. likelihood that treatment of a subject with a TNFC. inhibitor FIG. 2 is a graph showing the correlation between the 25 will or will not be effective in (e.g., provide a measurable mRNA expression of predictive CD11c in pre-treatment RA benefit to) the Subject. In particular, Such an ability to assess patients and their individual future ACR response (continu the likelihood that treatment will or will not be effective ous ACR score). The horizontal and vertical broken lines typically is exercised before treatment with the TNFC. inhibi indicate the thresholds for the separation between RA-re tor is begun in the subject. However, it is also possible that sponders and RA-non-responders, both in terms of the pre 30 such an ability to assess the likelihood that treatment will or treatment CD11c mRNA levels (40%) and their ACR will not be effective can be exercised after treatment has response (continuous ACR scores 30). Responders (continu begun but before an indicator of effectiveness (e.g., an indi ous American College of Rheumatology ACR score 240; cator of measurable benefit) has been observed in the subject. clustered as ND) and non-responders to anti-TNF therapy The term "TNFC. inhibitor” as used herein is intended to (continuous ACR score s30; clustered as RA) were defined 35 encompass agents including proteins, antibodies, antibody according to the criteria of the ACR. fragments, fusion proteins (e.g., Ig fusion proteins or Fc FIG. 3 is a graph showing the correlation between the fusion proteins), multivalent binding proteins (e.g., DVD Ig), mRNA expression of predictive CD11c in pre-treatment RA Small molecule TNFC. antagonists and similar naturally- or patients and their individual future strict ACR response in the nonnaturally-occurring molecules, and/or recombinant and/ following conventional used steps: 20%, 2.20%, 250%, and 40 or engineered forms thereof, that, directly or indirectly, inhib 2.70% (continuous ACR score). its TNFO activity, such as by inhibiting interaction of TNFC. with a cell surface receptor for TNFC., inhibiting TNFC. pro DETAILED DESCRIPTION OF THE INVENTION tein production, inhibiting TNFC. gene expression, inhibiting TNFC. secretion from cells, inhibiting TNFC. receptor signal This invention provides methods for predicting respon 45 ing or any other means resulting in decreased TNFC. activity siveness to a TNFC. inhibitor in a subject suffering from an in a subject. The term “TNFC. inhibitor also includes agents autoimmune disorder, and methods for selecting a treatment which interfere with TNFC. activity. Examples of TNFC. regimen with a TNFC. inhibitor, based on expression of par inhibitors include etanercept (ENBRELTM, Amgen), inflix ticular biomarkers in the subject to be treated. The invention imab (REMICADETM, Johnson and Johnson), human anti is based, at least in part, on the observation that altered expres 50 TNF monoclonal antibody adalimumab (D2E7/HUMIRATM, sion of particular biomarkers in a Subject Suffering from Abbott Laboratories), CDP 571 (Celltech), and CDP 870 rheumatoid arthritis is associated with increased or decreased (Celltech), as well as other compounds which inhibit TNFC. responsiveness to therapy with a TNFC. inhibitor. Microarray activity, such that when administered to a subject Suffering analysis, hierarchical clustering and TaqMan(R)-PCR analysis from or at risk of suffering from a disorder in which TNFC. were used to examine normal donors (NA) and rheumatoid 55 activity is detrimental (e.g., R.A), the disorder is treated. The arthritis (RA) patients, who were categorized as being term also includes each of the anti-TNFC. human antibodies responsive to treatment with an anti-TNFC. antibody (RA and antibody portions described herein as well as those responders) or nonresponsive to treatment with an anti-TNFC. described in U.S. Pat. Nos. 6,090,382; 6,258,562: 6,509,015, antibody (RA nonresponders). A panel of 82 genes were and in U.S. patent application Ser. No. 09/801,185 (U.S. identified whose expression was altered (upregulated or 60 Publication No. 20030092059) and Ser. No. 10/302,356 (U.S. downregulated) in patients identified as either future RA Publication No. 20030219438), each incorporated by refer responders or future RA nonresponders, demonstrating the ence herein. ability of these genes to act as biomarkers for predicting The term “antibody' as referred to herein includes whole responsiveness to TNFC. inhibitor treatment. In particular, antibodies and any antigen binding fragment (i.e., “antigen one gene, encoding the antigen CD11c, was identified as fully 65 binding portion') or single chains thereof. An “antibody” predicting the future response to anti-TNFC. treatment. refers to a glycoprotein comprising at least two heavy (H) Accordingly, the expression pattern of one or more biomar chains and two light (L) chains inter-connected by disulfide US 8,092,998 B2 13 14 bonds, or an antigen binding portion thereof. Each heavy joined, using recombinant methods, by a synthetic linker that chain is comprised of a heavy chain variable region (abbre enables them to be made as a single protein chain in which the viated herein as V) and a heavy chain constant region. The V, and V regions pair to form monovalent molecules heavy chain constant region is comprised of three domains, (known as single chain Fv (scFV); see e.g., Bird et al. (1988) C1, C2 and Cs. Each light chain is comprised of a light Science 242:423-426; and Huston et al. (1988) Proc. Natl. chain variable region (abbreviated herein as V) and a light Acad. Sci. USA 85:5879-5883). Such single chain antibodies chain constant region. The light chain constant region is com are also intended to be encompassed within the term “anti prised of one domain, C. The V and V regions can be gen-binding portion of an antibody. These antibody frag further subdivided into regions of hypervariability, termed ments are obtained using conventional techniques known to complementarity determining regions (CDR), interspersed 10 those with skill in the art, and the fragments are screened for with regions that are more conserved, termed framework utility in the same manner as are intact antibodies. regions (FR). Each V and V, is composed of three CDRs and The terms “monoclonal antibody' or “monoclonal anti four FRS, arranged from amino-terminus to carboxy-termi body composition' as used herein refer to a preparation of nus in the following order: FR1, CDR1, FR2, CDR2, FR3, antibody molecules of single molecular composition. A CDR3, FR4. The variable regions of the heavy and light 15 monoclonal antibody composition displays a single binding chains contain a binding domain that interacts with an anti specificity and affinity for a particular epitope. gen. The constant regions of the antibodies may mediate the The terms "chimeric antibody' or “chimeric monoclonal binding of the immunoglobulin to host tissues or factors, antibody' are intended to refer to antibodies in which the including various cells of the immune system (e.g., effector variable region sequences are derived from one species and cells) and the first component (Cld) of the classical comple the constant region sequences are derived from another spe ment system. cies, such as an antibody in which the variable region The term “antibody' is also intended to encompass dual sequences are derived from a mouse antibody and the con specific antibodies and bispecific antibodies. The term “dual stant region sequences are derived from a human antibody. specific antibody', as used herein, refers to full-length anti Such "chimeric antibodies' can be prepared by standard bodies that can bind two different antigens (or epitopes) in 25 recombinant technology well established in the art. For each of its two binding arms (a pair of HC/LC) (see e.g., PCT example, a nucleic acid encoding a V region from a mouse publication WOO2/02773). Accordingly a dual-specific bind antibody can be operatively linked to a nucleic acid encoding ing protein has two identical antigenbinding arms, with iden the heavy chain constant regions from a human antibody and, tical specificity and identical CDR sequences, and is bi-valent likewise, a nucleic acid encoding a V region from a mouse for each antigen it binds to. The term “bispecific antibody', as 30 antibody can be operatively linked to a nucleic acid encoding used herein, refers to full-length antibodies that are generated the light chain constant region from a human antibody. by quadroma technology (see Milstein, C. and A. C. Cuello The terms “humanized antibody” or “humanized mono (1983) Nature, 305:537-40), by chemical conjugation of two clonal antibody are intended to refer to antibodies in which different mAbs (see Staerz, U. D., et al. (1985) Nature 314: CDR sequences derived from the germline of a non-human 628–31), or by knob-into-hole or similar approaches which 35 mammalian species, such as a mouse, have been grafted onto introduces mutations in the Fc region (see Holliger, P., T. human framework sequences. Additional framework region Prospero, and G. Winter (1993) Proc. Natl. Acad. Sci. USA modifications may be made within the human framework 90:6444-8), resulting in multiple different immunogloblin sequences. Such “humanized antibodies' can be prepared by species of which only one is the functional bispecific anti standard recombinant technology well established in the art. body. By molecular function, a bispecific antibody binds one 40 For example, nucleic acids encoding the CDR1, CD2 and antigen (or epitope) on one of its two binding arms (one pair CDR3 regions from a V region of a mouse antibody can be of HC/LC), and binds a different antigen (or epitope) on its operatively linked to nucleic acids encoding the FR1, FR2, second arm (a different pair of HC/LC). By this definition, a FR3 and FR4 regions of a human V region, and the entire bispecific antibody has two distinct antigen binding arms (in “CDR-grafted V region can be operatively linked to nucleic both specificity and CDR sequences), and is mono-valent for 45 acid encoding the heavy chain constant regions from a human each antigen it binds to. Thus, when used herein, a “bispe antibody. Likewise, nucleic acids encoding the CDR1, CD2 cific' antibody of the invention has one binding arm that is and CDR3 regions from a V, region of a mouse antibody can specific for an epitope of TNFC. and a second binding arm that be operatively linked to nucleic acids encoding the FR1, FR2, is specific for a different antigen or epitope. FR3 and FR4 regions of a human V, region, and the entire The term “antigen-binding portion of an antibody (or 50 “CDR-grafted'V, region can be operatively linked to nucleic simply “antibody portion'), as used herein, refers to one or acid encoding the light chain constant region from a human more fragments of an antibody that retain the ability to spe antibody. cifically bind to an antigen. It has been shown that the antigen The term “human antibody', as used herein, is intended to binding function of an antibody can be performed by frag refer to antibodies having variable regions in which both the ments of a full-length antibody. Examples of binding 55 framework and CDR regions are derived from human germ fragments encompassed within the term “antigen-binding line immunoglobulin sequences. Furthermore, if the antibody portion' of an antibody include (i) a Fab fragment, a monova contains a constant region, the constant region also is derived lent fragment consisting of the V, V, C, and C domains: from human germline immunoglobulin sequences. Human (ii) a F(ab')2 fragment, a bivalent fragment comprising two antibodies may include amino acid residues not encoded by Fab fragments linked by a disulfide bridge at the hinge region; 60 human germline immunoglobulin sequences (e.g., mutations (iii) a Fd fragment consisting of the V and C. domains; (iv) introduced by random or site-specific mutagenesis in vitro or a FV fragment consisting of the V, and V. domains of a single by Somatic mutation in vivo). arm of an antibody, (v) a dAb fragment (Ward et al., (1989) The term “human monoclonal antibody” refers to antibod Nature 341:544-546), which consists of a V. domain; and ies displaying a single binding specificity which have variable (vi) an isolated complementarity determining region (CDR). 65 regions in which both the framework and CDR regions are Furthermore, although the two domains of the Fv fragment, derived from human germline immunoglobulin sequences. V, and V, are coded for by separate genes, they can be Human monoclonal antibodies can be produced by a hybri US 8,092,998 B2 15 16 doma which includes a B cell obtained from a transgenic antigen binding per antigen binding site. DVD binding pro nonhuman animal, e.g., a transgenic mouse, having a genome teins and methods of making DVD binding proteins are dis comprising a human heavy chain transgene and a light chain closed in US. Publication No. 20070071675, the entire con transgene fused to an immortalized cell. The term "human tents of which are specifically incorporated herein by monoclonal antibody', as used herein, also includes all reference. human antibodies that are prepared, expressed, created or As used herein, the term “biomarker is intended to encom isolated by recombinant means. Such as (a) antibodies iso pass a Substance that is used as an indicator of a biologic State lated from an animal (e.g., a mouse) that is transgenic or and includes genes (and nucleotide sequences of such genes), transchromosomal for human immunoglobulin genes or a mRNAs (and nucleotide sequences of such mRNAs) and hybridoma prepared therefrom, (b) antibodies isolated from a 10 host cell transformed to express the human antibody, e.g., proteins (and amino acid sequences of Such proteins). A from a transfectoma, (c) antibodies isolated from a recombi “biomarker expression pattern' is intended to refer to a quan nant, combinatorial human antibody library, and (d) antibod titative or qualitative Summary of the expression of one or ies prepared, expressed, created or isolated by any other more biomarkers in a Subject, such as in comparison to a standard or a control. means that involve splicing of human immunoglobulin gene 15 sequences to other DNA sequences. Such recombinant The terms “increased' or “increased expression' and human antibodies have variable regions in which the frame “decreased' or “decreased expression, with respect to the work and CDR regions are derived from human germline expression pattern of a biomarker(s), are used hereinas mean immunoglobulin sequences. Such recombinant human anti ing that the level of expression is increased or decreased bodies, however, can be subjected to in vitro mutagenesis (or, relative to a constant basal level of expression of a household, when an animal transgenic for human Ig sequences is used, in or housekeeping, gene, whose expression level does not sig Vivo Somatic mutagenesis) and thus the amino acid sequences nificantly vary under different conditions. A nonlimiting of the V and V, regions of the recombinant antibodies are example of Such a household, or housekeeping, gene is sequences that, while derived from and related to human GAPDH. Other suitable household, or housekeeping, gene germline V and V sequences, may not naturally exist within 25 are well-established in the art. the human antibody germline repertoire in vivo. As used herein, the term “CD11c refers to a protein having The terms “Ig fusion protein’ and “Fc fusion protein’ are a full-length amino acid sequence as set forth at Genbank intended to refer to a recombinant, composite protein com Accession No. NP 000878 (also shown as SEQID NO:302) prising a polypeptide of interest operatively linked to a con and encoded by a full-length nucleotide sequence as set forth stant region portion of immunoglobulin, typically the hinge, 30 at Genbank Accession No. NM 000887 (also shown as SEQ CH and CH domains of heavy chain constant region, more ID NO:301). CD11c is also known in the art as CD11C, typically the human IgG1 hinge, CH and CH domains. The CD11c antigen, Integrin alpha X, complement component 3 polypeptide of interest operatively linked to the Fc portion receptor 4 subunit, ITGAX, LeuM5, Integrin alpha Xprecur can be, for example, a full-length protein or only a portion of Sor, Leukocyte adhesion glycoprotein p150.p95 alpha chain, a full-length protein, such as one or more extracellular 35 and Leukocyte adhesion receptor p150 subunit, which terms domains of a protein, e.g., one or more extracellular domains may be used interchangeably herein to refer to CD11c. of a cell-surface protein. Such “Ig fusion proteins’ can be As used herein, the term 'Affymetrix ID' refers to a prepared by standard recombinant technology well estab numerical identifier that corresponds to a sequence entry in an lished in the art. For example, a nucleic acid encoding the Affymetrix database, which entry includes the sequence as polypeptide of interest can be operatively linked to a nucleic 40 well as additional information relating to the sequence and acid encoding the hinge, CH and CH domains of a heavy corresponding protein. The sequence entries, and additional chain constant region. information in the entries, for each Affymetrix ID are publicly The term “multivalent binding protein', as a form of TNFC. available (e.g., by entering the Affymetrix ID number into the inhibitor, is used in this specification to denote a binding Affymetrix database search engine, e.g., at https://www.af protein comprising two or more antigen binding sites. 45 fymetrix.com/analysis/netaffx/index.affix). All sequence Examples of multivalent binding proteins include dual vari entries (such as Genbank Accession numbers), and additional able domain (DVD) binding proteins. The multivalent bind information provided for each entry, corresponding to each of ing protein is preferably engineered to have three or more the Affymetrix ID numbers disclosed herein are hereby spe antigen binding sites, and is generally not a naturally occur cifically incorporated by reference in their entirety. ring antibody. A multivalent binding protein also can be a 50 As used herein, the term “subject' includes humans, and “multispecific binding protein.” The term “multi specific non-human animals amenable to TNFC. inhibitor therapy, binding protein’ refers to a binding protein capable of bind e.g., preferably mammals, such as non-human primates, ing two or more related or unrelated targets (wherein, with sheep, dogs, cats, horses and cows. respect to this specification at least one of the targets is As used herein, the term “autoimmune disorder subject' or TNFC). Dual variable domain (DVD) binding proteins, as 55 “AD subject' is intended to refer to a subject (e.g., human used herein, are binding proteins that comprise two or more patient) Suffering from an autoimmune disorder. antigen binding sites and are tetravalent or multivalent bind As used herein, the term "rheumatoid arthritis subject' or ing proteins. Such DVDs may be monospecific, i.e., capable “RA subject' is intended to refer to a subject (e.g., human of binding one antigen (e.g., TNFC) or multispecific, i.e., patient) Suffering from rheumatoid arthritis. capable of binding two or more antigens (e.g., TNFC. and one 60 As used herein, the term “treatment regimen” is intended to or more other antigens). DVD binding proteins comprising refer to one or more parameters selected for the treatment of two heavy chain DVD polypeptides and two light chain DVD a subject, e.g., with a TNFC. inhibitor, which parameters can polypeptides are referred to as “DVD Ig. Each half of a DVD include, but are not necessarily limited to, the type of agent Ig comprises a heavy chain DVD polypeptide, and a light chosen for administration, the dosage, the formulation, the chain DVD polypeptide, and two antigen binding sites. Each 65 route of administration and the frequency of administration. binding site comprises a heavy chain variable domain and a Various aspects of the invention are described in further light chain variable domain with a total of 6 CDRs involved in detail in the following subsections. US 8,092,998 B2 17 18 Prediction of Responsiveness to a TNFC. Inhibitor for sion can be based, for example, on the level of expression in Autoimmune Disorders previously established TNFC. inhibitor non-responder RA In one aspect, the invention pertains to a method for pre Subjects). dicting responsiveness to a TNFC. inhibitor in a subject hav In another preferred embodiment, the one or more biom ing an autoimmune disorder. Such as rheumatoid arthritis. arkers is encoded by a nucleic acid molecule comprising a Typically, the method comprises (i) assaying the Subject for nucleotide sequence selected from the group consisting of the expression of one or more biomarkers predictive of SEQID NOs: 1-5,8,9, 11-14, 18, 20, 21, 23, 25, 26, 28-30, responsiveness to a TNFC. inhibitor in an autoimmune disor 32, 33, 40-42, 48, 50, 52, 53, 56, 58, 60, 63, 65-69, 71-74, der, and (ii) predicting responsiveness of the Subject to the 76-78, 80 and 81 (corresponding to sequences from Table 9 10 that are decreased in 280% of responders vs. non-respond TNFC. inhibitor based on expression of the one or more biom ers). More preferably, the one or more biomarkers is encoded arkers in the subject. As used herein, the term “one or more by a nucleic acid molecule comprising a nucleotide sequence biomarkers' is intended to mean that at least one biomarker in selected from the group consisting of SEQID NOs: 11, 29. a disclosed list of biomarkers is assayed and, in various 65, 73 and 74 (corresponding to sequences from Table 9 that embodiments, more than one biomarker set forth in the list 15 are decreased in 290% of responders vs. non-responders). may be assayed, such as two, three, four, five, ten, twenty, Even more preferably, the one or more biomarkers is encoded thirty, forty, fifty, more than fifty, or all the biomarkers in the by a nucleic acid molecule comprising the nucleotide list may be assayed. sequence of SEQID NO: 11 or SEQID NO: 74 (correspond Predicting responsiveness of the subject to the TNFC. ing to sequences from Table 9 that are decreased in 100% of inhibitor “based on expression of the one or more biomarkers responders vs. non-responders). In each of these embodi in the subject' typically involves comparing the level, or ments, decreased expression of the one or more biomarkers is pattern, of expression of the one or more biomarkers in the predictive of responsiveness of the subject to a TNFC. inhibi Subject to a known standard or control (which known stan tor (e.g., decreased expression relative to a standard or control dard or control may be derived from, for example, a normal level of expression, which standard or control level of expres subject, a pre-established TNFC. inhibitor responder or a pre 25 sion can be based, for example, on the level of expression in established TNFC. inhibitor non-responder). In a preferred previously established TNFC. inhibitor non-responder RA embodiment, the level of expression of the biomarker(s) is Subjects). measured in parallel with measurement of the level of expres In another aspect, the invention provides a method for sion of one or more “housekeeping genes, such as GAPDH, predicting responsiveness to a TNFC. inhibitor in a subject 30 having an autoimmune disorder, the method comprising: (i) whose expression level is not altered by the autoimmune assaying the Subject for expression of one or more biomarkers disorder. The level of expression of the biomarker(s) is deter predictive of responsiveness to a TNFC. inhibitor in the mined to be “increased' or “decreased’ relative to a constant autoimmune disorder, and (ii) predicting responsiveness of basal level of expression of the housekeeping gene. Examples the subject to the TNFC. inhibitor based on expression of the of suitable housekeeping genes, such as GAPDH, that can be 35 one or more biomarkers in the subject, wherein the one or used for comparison purposes are well known in the art. more biomarkers is selected from the group consisting of Preferably, the one or more biomarkers is encoded by a Aquaporin 3 (Genbank Accession No. NM 004925); Simi nucleic acid molecule comprising a nucleotide sequence lar to ribosomal protein S24, clone MGC:8595 (Genbank selected from the group consisting of SEQ ID NO: 1-82 Accession No. NM 033022); Transmembrane emp24 (corresponding to sequences of the biomarkers set forth in 40 domain trafficking protein 2 (Genbank Accession No. Table 9). Thus, at least one of the biomarkers encoded by a NM 006815; Superoxide dismutase 1, soluble (amyotrophic nucleic acid molecule comprising a nucleotide sequence lateral sclerosis 1 (Genbank Accession No. NM 000454): selected from the group consisting of SEQ ID NO: 1-82 is Calmodulin 1 (phosphorylase kinase, delta) (Genbank Acces assayed and, in various embodiments, for example, two, sion No. NM 006888); Guanine nucleotide binding protein three, four, five, ten, twenty, thirty, forty, fifty, more than fifty, 45 (G protein), beta polypeptide 1 (Genbank Accession No. or all the biomarkers in the list may be assayed. NM 002074); Prothymosin, alpha (gene sequence 28) (Gen In a preferred embodiment, the one or more biomarkers is bank Accession No. NM 002823); Homo sapiens isocitrate encoded by a nucleic acid molecule comprising a nucleotide dehydrogenase 1 (NADP+) soluble (IDH1) (Genbank Acces sequence selected from the group consisting of SEQID NOs: sion No. NM 005896); Tumor protein D52 (Genbank 6, 7, 10, 15-17, 19, 22, 24, 27, 31, 34-39, 43-47,49, 51,54,55, 50 Accession Nos. NM 001025252, NM 001025253, 57, 59, 61, 62, 64, 70, 75, 79 and 82 (corresponding to NM 005079); Early growth response 1 (Genbank Accession sequences from Table 9 that are increased in 280% of No. NM 001964); Homo sapiens predicted osteoblast pro responders vs. non-responders). More preferably, the one or tein (GS3786) (Genbank Accession Nos. NM 014888, more biomarkers is encoded by a nucleic acid molecule com NM 00104.0020); Cytochrome c oxidase subunit VIIb (Gen prising a nucleotide sequence selected from the group con 55 bank Accession No. NM 001866); CUG triplet repeat, RNA sisting of SEQID NOs: 31,37, 44, 47,62 and 70 (correspond binding protein 2 (Genbank Accession No. NM 001025077, ing to sequences from Table 9 that are increased in 290% of NM 001025076, NM 006561): Ubiquinol-cytochrome c responders vs. non-responders). Even more preferably, at eductase hinge protein (Genbank Accession No. least one of the biomarkers to be assayed is encoded by a S. M 006004); Homos sapiens leptin receptor gene-related nucleic acid molecule comprising the nucleotide sequence of 60 rotein (HSOBRGRP) (Genbank Accession No. SEQ ID NO: 44 (corresponding to the biomarker CD11c. M 017526); Wiskott-Aldrich syndrome protein interact which, as set forthin Table 9, is increased in 100% of respond g protein (Genbank Accession Nos. NM 001077269, ers vs. non-responders). In each of these embodiments, M 003387); CD97 antigen (Genbank Accession Nos. increased expression of the one or more biomarkers is pre M 001025160, NM 001784, NM 078.481); Glutamate dictive of responsiveness of the subject to a TNFC. inhibitor 65 ysteine ligase, catalytic Subunit (Genbank Accession No. (e.g., increased expression relative to a standard or control N M 001498); Crystallin, Zeta (quinone reductase) (Gen level of expression, which standard or control level of expres bank Accession No. NM 001889); Rap guanine nucleotide US 8,092,998 B2 19 20 exchange factor (GEF) 2 (Genbank Accession No. sion No. XM 94.1927); CCR4-NOT transcription complex, NM 014247); Ataxin 1 (Genbank Accession No. subunit 6 (Genbank Accession No. NM 015455); NM 000332); Adaptor-related protein complex 1, sigma 2 Ubiquinol-cytochrome c reductase complex (7.2 kD) (Gen subunit (Genbank Accession No. NM 003916); Ectonucle bank Accession Nos. NM 013387, NM 001003684): otide pyrophosphatase/phosphodiesterase 4 (Genbank Hepatocellular carcinoma-associated antigen 112 (Genbank Accession No. NM 014936); Desmocollin 2 (Genbank Accession No. NM 018487); Kruppel-like factor 11 (Gen Accession Nos. NM 024422, NM 004949); MAL, T-cell bank Accession No. XM 001 129527); GGAbinding partner differentiation protein (Genbank Accession Nos. (Genbank Accession No. NM 018318); Cornichonhomolog NM 002371, NM 022438, NM 022439, NM 022440); 4 (Drosophila) (Genbank Accession No. NM 01418.4): Glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylman 10 Hypothetical protein FLJ21616 (Genbank Accession No. nosamine kinase (Genbank Accession No. NM 005476): Chemokine (C-C motif) ligand 3 (Genbank Accession Nos. NM 024567); Homo sapiens hypothetical protein FLJ1134 NM 001001437, NM 021006); Carboxypeptidase A3 (Genbank Accession No. NM 018004); Nuclear prelamin A (Genbank Accession No. NM 001870); Charcot-Leyden recognition factor (Genbank Accession Nos. NM 012336, crystal protein (Genbank Accession No. NM 001828); 15 NM 0010386.18); Erythroblast membrane-associated pro NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1.7 tein (Genbank Accession Nos. NM 018538, kDa (Genbank Accession No. NM 004.545); Interleukin 8 M 001017922); LR8 protein (Genbank Accession No. receptor, beta (Genbank Accession No. NM 001557): Plate M 014020); Likely ortholog of mouse limb-bud and heart let factor 4 variant 1 (Genbank Accession No. NM 002620): ene (LBH) (Genbank Accession No. NM 030915); Calmin Poly(A) binding protein interacting protein 1 (Genbank calponin-like, transmembrane) (Genbank Accession No. Accession No. NM 006451); ATP-binding cassette, sub M 024734); Chromosome 14 open reading frame 156 family C (CFTR/MRP), member 3 (Genbank Accession No. Genbank Accession No. NM 03.1210); Guanine nucleotide NM 003786); Actinin, alpha 1 (Genbank Accession No. S inding protein (G protein) alpha 12 (Genbank Accession No. NM 001102); NAD kinase (Genbank Accession No. NM 007353); and SRY (sex determining region Y)-box 18 NM 023018); Platelet/endothelial cell adhesion molecule 25 (Genbank Accession No. NR 003287) (corresponding to (CD31 antigen) (Genbank Accession No. NM 000442); biomarkers listed in Table 9). Esterase D/formylglutathione hydrolase (Genbank Acces In a preferred embodiment, the one or more biomarkers is sion No. NM 001984); Chromosome 20 open reading frame selected from the group consisting of Guanine nucleotide 111 (Genbank Accession No. NM 016470); Sterol-C4-me binding protein (G protein), beta polypeptide 1: Prothymosin, thyl oxidase-like (Genbank Accession NoS. 30 alpha (gene sequence 28); Early growth response 1: Homos NM 001017369, NM 006745); PIM-1 oncogene (Gen sapiens leptin receptor gene-related protein (HSOBRGRP): bank Accession No. NM 002648); GATA binding protein 2 Wiskott-Aldrich syndrome protein interacting protein: CD97 (Genbank Accession No. NM 032638); Cathepsin Z (Gen antigen; Crystallin, Zeta (quinone reductase); Adaptor-related bank Accession No. NM 001336); Integrin alpha-X (anti protein complex 1, Sigma 2 subunit; Desmocollin 2: Chemok gen CD11c) (Genbank Accession No. NM 000887); Lectin, 35 ine (C-C motif) ligand 3; Interleukin 8 receptor, beta; ATP galactoside-binding, soluble, 8 (galectin 8) (Genbank Acces binding cassette, sub-family C(CFTR/MRP), member 3: sion Nos. NM 006499, NM 201545); CD86 antigen Actinin, alpha 1: NAD kinase; Platelet/endothelial cell adhe (CD28 antigen ligand 2. B7-2 antigen) (Genbank Accession sion molecule (CD31 antigen); Esterase D/formylglutathione Nos. NM 006889, NM 175862): Interleukin 8 (Genbank hydrolase; Chromosome 20 open reading frame 111; Cathe Accession No. NM 000584); Fc fragment of IgE, high affin 40 psin Z; Integrin alpha-X (antigen CD11c); Lectin, galacto ity I, receptor for alpha polypeptide (Genbank Accession No. side-binding, soluble, 8 (galectin 8); CD86 antigen (CD28 NM 002001); Actin, gamma 1 (Genbank Accession No. antigen ligand 2. B7-2 antigen); Interleukin 8: Actin, gamma NM 001614); KIAA0746 protein (Genbank Accession No. 1: Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease NM 015187); Glucosamine (N-acetyl)-6-sulfatase (Sanfil IIID); Cell division cycle 2-like 6 (CDK8-like); Major histo ippo disease IIID) (Genbank Accession No. NM 002076): 45 compatibility complex, class II, DQ beta 1; Coagulation fac Transcription factor 4 (Genbank Accession Nos. BF592782, tor II (thrombin) receptor-like 1: Splicing factor 3b, subunit 1, CR6 12521); Major histocompatibility complex, class II, DQ 155 kDa; MRNA, cDNA DKFZp56400862: Amyloid beta alpha 1 (Genbank Accession Nos. NM 002122, (A4) precursor protein (peptidase nexin-II, Alzheimer dis NM 020056); Cell division cycle 2-like 6 (CDK8-like) ease); Cold autoinflammatory syndrome 1: Kruppel-like fac (Genbank Accession No. NM 015076); Major histocompat 50 tor 11, Nuclear prelaminA recognition factor, Calmin (calpo ibility complex, class II, DQ beta 1 (Genbank Accession No. nin-like, transmembrane); and SRY (Sex determining region XM 942240); Phospholipase C-like 2 (Genbank Accession Y)-box 18 (corresponding to biomarkers listed in Table 9 that No. NM 015184); Coagulation factor II (thrombin) recep are increased in 280% of responders vs. non-responders). tor-like 1 (Genbank Accession No. NM 00:5242): TM2 More preferably, the one or more biomarkers is selected from domain containing 1 (Genbank Accession No. 55 the group consisting of Interleukin 8 receptor, beta; Platelet/ NM 032027); Splicing factor 3b, subunit 1, 155 kDa (Gen endothelial cell adhesion molecule (CD31 antigen); Integrin bank Accession No. NM 012433): SUB1 homolog (S. cer alpha-X (antigen CD11c); Interleukin 8: Amyloid beta (A4) evisiae) (Genbank Accession No. NM 006713); MRNA; precursor protein (peptidase nexin-II, Alzheimer disease); cDNA DKFZp56400862 (Genbank Accession No. and Kruppel-like factor 11 (corresponding to biomarkers AI278204); Amyloid beta (A4) precursor protein (peptidase 60 listed in Table 9 that are increased in 290% of responders vs. nexin-II, Alzheimer disease) (Genbank Accession Nos. non-responders). Even more preferably, at least one of the NM 201413, NM 000484, NM 201414); Cytochrome biomarkers is Integrin alpha-X (antigen CD11c) (correspond b-5 (Genbank Accession Nos. NM 001914, NM 148923): ing to a biomarker listed in Table 9 that is increased in 100% Cold autoinflammatory syndrome 1 (Genbank Accession No. of responders vs. non-responders). In each of the embodi NM 183395); Neugrin, neurite outgrowth associated (Gen 65 ments, increased expression of the one or more biomarkers is bank Accession Nos. NM-016645, NM 001033088); Ribo predictive of responsiveness of the subject to a TNFC. inhibi somal protein S26, 40S ribosomal protein (Genbank Acces tOr. US 8,092,998 B2 21 22 In another preferred embodiment, the one or more biom a nucleotide sequence selected from the group consisting of arkers is selected from the group consisting of Aquaporin 3: SEQID NO: 1-82 (or selected from the group consisting of Similar to ribosomal protein S24, clone MGC:8595: Trans the biomarkers set forth in Table 9). In more preferred membrane emp24 domain trafficking protein 2; Superoxide embodiments, the subsets of sequences within SEQID NO: dismutase 1, Soluble (amyotrophic lateral Sclerosis 1: Calm 1-82 that are either increased or decreased, as set forth in odulin 1 (phosphorylase kinase, delta); Homo sapiens isoci detail above, can be assayed. trate dehydrogenase 1 (NADP+) soluble (IDH1); Tumor pro In the methods of the invention for predicting responsive tein D52; Homo sapiens predicted osteoblast protein ness to a TNFC. inhibitor in a Subject having an autoimmune (GS3786): Cytochrome c oxidase subunit VIIb: CUG triplet disorder, the expression of one or more biomarkers predictive repeat, RNA binding protein 2: Ubiquinol-cytochrome c 10 of responsiveness to a TNFC. inhibitor in the autoimmune reductase hinge protein; Glutamate-cysteine ligase, catalytic disorder can be assayed in the Subject using techniques well Subunit; Rap guanine nucleotide exchange factor (GEF)2; established in the art. In a preferred embodiment, the expres Ataxin 1; Ectonucleotide pyrophosphatase/phosphodi sion of the one or more biomarkers in the Subject is assayed by esterase 4: MAL, T-cell differentiation protein; Glucosamine obtaining an mRNA sample from the Subject (e.g., isolated (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase; 15 from peripheral blood mononuclear cells, by standard meth Carboxypeptidase A3; Charcot-Leyden crystal protein; ods) and detecting the expression of mRNA(s) encoding the NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1.7 one or more biomarkers in the mRNA sample using standard kDa. Platelet factor 4 variant 1; Poly(A) binding protein inter molecular biology techniques, such as PCR analysis. A pre acting protein 1: Sterol-C4-methyl oxidase-like; PIM-1 onco ferred method of PCR analysis is revers transcriptase-poly gene; GATA binding protein 2; Fc fragment of IgE, high merase chain reaction (RT-PCR). Other suitable systems for affinity I, receptor for; alpha polypeptide; KIAA0746 protein; mRNA sample analysis include microarray analysis (e.g., Transcription factor 4: Major histocompatibility complex, using Affymetrix's microarray system or Illumina’s BeadAr class II, DQ alpha 1: Phospholipase C-like 2: TM2 domain ray Technology). containing 1: SUB1 homolog (S. cerevisiae): Cytochrome Additionally or alternatively, in certain situations it may be b-5; Neugrin, neurite outgrowth associated; Ribosomal pro 25 possible to assay for the expression of one or more biomark tein S26, 40S ribosomal protein; CCR4-NOT transcription ers at the protein level, using a detection reagent that detects complex, Subunit 6: Ubiquinol-cytochrome c reductase com the protein product encoded by the mRNA of the plex (7.2 kD); Hepatocellular carcinoma-associated antigen biomarker(s). For example, if an antibody reagent is available 112: GGA binding partner; Cornichon homolog 4 (Droso that binds specifically to the biomarker protein product to be phila); Hypothetical protein FLJ21616; Homo sapiens hypo 30 detected, and not to other proteins, then such an antibody thetical protein FLJ10134; Erythroblast membrane-associ reagent can be used to detect the expression of the biomarker ated protein; LR8 protein; Likely ortholog of mouse limb-bud of interest in a cellular sample from the subject, or a prepa and heart gene (LBH); Chromosome 14 open reading frame ration derived from the cellular sample, using standard anti 156; and Guanine nucleotide binding protein (G protein) body-based techniques known in the art, such as FACS analy alpha 12 (corresponding to biomarkers listed in Table 9 that 35 sis, ELISA and the like. are decreased in 280% of responders vs. non-responders). It will be readily understood by the ordinarily skilled arti More preferably, the one or more biomarkers is selected from san that essentially any technical means established in the art the group consisting of Homo sapiens predicted osteoblast for detecting biomarkers, at either the nucleic acid or protein protein (GS3786); Charcot-Leyden crystal protein; Neugrin, level, can be adapted to detection of the biomarkers discussed neurite outgrowth associated; Hypothetical protein 40 herein and applied in the methods of the current invention for FLJ21616; and Homo sapiens hypothetical protein FLJ10134 predicting responsiveness to a TNFC. inhibitor in a subject (corresponding to biomarkers listed in Table 9 that are having an autoimmune disorder. decreased in 290% of responders vs. non-responders). Even The biomarkers described herein were originally identified more preferably, the one or more biomarkers is Homo sapiens in patients having rheumatoid arthritis (see the Examples) predicted osteoblast protein (GS3786) or Homo sapiens 45 and thus a particularly preferred autoimmune disorder in hypothetical protein FLJ10134 (corresponding to biomarkers which to apply the methods of the invention is rheumatoid listed in Table 9 that are decreased in 100% of responders vs. arthritis. The mechanism of action of the TNFC. pathway, non-responders). In each of these embodiments, decreased however, is thought to be common to a large number of expression of the one or more biomarkers is predictive of autoimmune disorders and TNFC. inhibitors have been shown responsiveness of the subject to a TNFC. inhibitor. 50 to be effective therapy in a variety of different autoimmune In a particularly preferred aspect, the invention provides a disorders. Accordingly, the method of the invention for pre method for predicting responsiveness to a TNFC. inhibitor in dicting responsiveness to a TNFC. inhibitor can be applied to a Subject having an autoimmune disorder the method com essentially any autoimmune disorder in which TNFC. inhibi prising: (i) assaying the Subject for increased expression of a tortherapy is applied. Other preferred autoimmune disorders biomarker, which biomarker is CD11c, and (ii) predicting 55 include Crohn's disease, ulcerative colitis, psoriasis, psoriatic responsiveness of the subject to the TNFC. inhibitor based on arthritis, juvenile arthritis and ankylosing spondilitis, Other increased expression of CD11c in the subject. non-limiting examples of autoimmune disorders include In yet another particularly preferred embodiment, the autoimmune diabetes, multiple Sclerosis, systemic lupus invention provides a method for predicting responsiveness to erythematosus, rheumatoid spondylitis, gouty arthritis, a TNFC. inhibitor, which TNFC. inhibitor is adalimumab, in a 60 allergy, autoimmune uveitis, nephrotic syndrome, multisys Subject having an autoimmune disorder the method compris tem autoimmune diseases, autoimmune hearing loss, adult ing: (i) assaying the Subject for expression of one or more respiratory distress syndrome, shock lung, chronic pulmo biomarkers predictive of responsiveness to adalimumab in nary inflammatory disease, pulmonary sarcoidosis, pulmo the autoimmune disorder, and (ii) predicting responsiveness nary fibrosis, silicosis, idiopathic interstitial lung disease, of the subject to adalimumab based on expression of the one 65 chronic obstructive pulmonary disease, asthma, restenosis, or more biomarkers in the subject. Preferably, the one or more spondyloarthropathies, Reiter's syndrome, autoimmune biomarkers is encoded by a nucleic acid molecule comprising hepatitis, inflammatory skin disorders, vasculitis of large ves US 8,092,998 B2 23 24 sels, medium vessels or Small vessels, endometriosis, pros ise; Fc fragment of IgE, high affinity I, receptor for; gamma tatitis and Sjogren's syndrome. polypeptide; UDP-N-acetyl-alpha-D-galactosamine: Biomarkers for Monitoring an Autoimmune Disorder in a polypeptide N-acetylgalactosaminyltransferase 1: Hypo Subject thetical protein FLJ1259; APEX nuclease (multifunctional In another aspect, the invention provides methods of moni DNA repair enzyme)1; Geranylgeranyl diphosphate synthase toring an autoimmune disorder in a subject having the 1: Down syndrome critical region gene 5: Calpain 7: Major autoimmune disorder based on biomarker expression patterns histocompatibility complex, class II, DP alpha 1: Brix established using microarray analysis of for example, RA domain containing 5: Chromosome 21 open reading frame Subjects vs. normal donors, RA Subjects vs. RA Subjects 59; Tumor necrosis factor (ligand) superfamily, member 10; treated with a TNFC. inhibitor and/or RA subjects treated with 10 Chromosome 10 open reading frame 86; CD1D antigen, d a TNFC. inhibitor vs. RA responders to TNFC. inhibitors. In polypeptide; Ewing sarcoma breakpoint region 1: Ribonu these monitoring methods, the Subject is assayed for expres clease P40 kDa subunit; PHD finger protein 20; Thioredoxin sion of one or more biomarkers (using techniques, for interacting protein, Ubiquinol-cytochrome c reductase core example, as described in the previous section), thereby moni protein II: Hypothetical protein FLJ22662; Preimplantation toring the autoimmune disorder in the Subject. 15 protein 3: DKFZP564G2022 protein; Dipeptidase 2: Hemo In one embodiment of the monitoring method, the one or globin, alpha 1, alpha 2: Frequently rearranged in advanced more biomarkers is encoded by a nucleic acid molecule com T-cell lymphomas; DEAD (Asp-Glu-Ala-Asp) box polypep prising a nucleotide sequence selected from the group con tide 48; Tumor necrosis factor, alpha-induced protein 2: sisting of SEQID NO: 83-133 (or the biomarkers set forth by Nucleophosmin (nucleolar phosphoprotein B23, numatrin); name in Table 3, namely V-maf musculoaponeurotic fibrosa Interleukin 13 receptor, alpha 1: Leukocyte specific transcript rcoma oncogene homolog F. Diphtheria toxin receptor 1, LST1: CGI-121 protein: RAS p21 protein activator 4/hy (DTR); DEAH (Asp-Glu-Ala-His) box polypeptide 15; pothetical protein FLJ21767; Cathepsin S; CD63 antigen Ribonucleotide reductase M2 polypeptide; Solute carrier (melanoma 1 antigen); JTV1 gene; KIAA0174: Thrombo family 6, member 8; 6-phosphofructo-2-kinase/fructose-2,6- spondin 1: Hypothetical protein LOC54103: Interferon regu biphosphatase 3: Ferrochelatase (protoporphyria); Nuclear 25 latory factor 1; and SEC 11-like 1 (S. cerevisiae)). factor, interleukin 3 regulated: Thrombomodulin; Major his More preferably, the one or more biomarkers is encoded by tocompatibility complex, class II, DM beta; Forkhead box a nucleic acid molecule comprising a nucleotide sequence O3A, Hemoglobin, gamma A, gamma G. Synuclein, alpha selected from the group consisting of SEQID NO: 134-150, (non A4 component of amyloid precursor); Hemoglobin, 112, 118 (or the biomarkers set forth by name in Table 4 as gamma A; Amphiregulin (Schwannoma-derived growth fac 30 being upregulated, namely Uncharacterized hypothalamus tor); Lipoyltransferase 1: Solute carrier family 4, anion protein HT007: Dual specificity phosphatase 22: Proteasome exchanger, member 1; S100 calcium binding protein A 12 (prosome, macropain) subunit, beta type, 7: Membrane-span (calgranulin C); Keratin 1 (epidermolytic hyperkeratosis); ning 4-domains, subfamily A, member 4: DKFZP434C171 Carbonic anhydrase I: CD1C antigen, c polypeptide; Tumor protein; Protein phosphatase 1, catalytic Subunit, beta iso necrosis factor, alpha-induced protein 6: Ribonuclease, 35 form; Splicing factor, arginine/serine-rich 5; Sorting nexin RNase A family, 2: Hemoglobin, delta; Transferrin receptor 11: Farnesyltransferase, CAAX box, alpha; Peroxisomal (p90, CD71); Ring finger protein 10; Chromosome 1 open D3.D2-enoyl-CoA isomerise: Fc fragment of IgE, high affin reading frame 63; Hemoglobin, alpha 1, alpha 2: CD69 anti ity I, receptor for; gamma polypeptide; UDP-N-acetyl-alpha gen (p60, early T-cell activation antigen; APEX nuclease D-galactosamine:polypeptide N-acetylgalactosaminyltrans (multifunctional DNA repair enzyme)1; Membrane-span 40 ferase 1: Hypothetical protein FLJ11259; APEX nuclease ning 4-domains, subfamily A, member 3: Heat shock 70 kDa (multifunctional DNA repair enzyme) 1: Geranylgeranyl protein 8: Hypothetical protein MGC12760; GABA(A) diphosphate synthase 1: Down syndrome critical region gene receptor-associated protein like 1, like 3: Aminolevulinate, 5; Calpain 7: Major histocompatibility complex, class II, DP delta-, synthase 2; Major histocompatibility complex, class alpha 1: Brix domain containing 5; and Chromosome 21 open II, DP alpha 1: MorfA family associated protein 1-like 1: 45 reading frame 59), wherein expression of the one or more Aldehyde dehydrogenase 1 family, member A1: Forminbind biomarkers is increased in the Subject. ing protein 4; Zinc finger protein 24 (KOX 17); Hypothetical Additionally or alternatively, more preferably the one or protein LOC54103: Selenium binding protein 1; Hematopoi more biomarkers is encoded by a nucleic acid molecule com etically expressed homeobox; Major histocompatibility com prising a nucleotide sequence selected from the group con plex, class II, DM alpha; Eukaryotic translation initiation 50 sisting of SEQID NO: 151-177, 110 and 123 (or the biom factor 2-alpha kinase 1: Ankyrin repeat domain 49; Hypo arkers set forth by name in Table 4 as being downregulated, thetical protein FLJ20701; Zinc finger protein 331; Mem namely Tumor necrosis factor (ligand) Superfamily, member brane-spanning 4-domains, Subfamily A, member 4: Tensin 10; Chromosome 10 open reading frame 86; CD1D antigen, 1; and Family with sequence similarity 46, member A, respec d polypeptide; Ewing sarcoma breakpoint region 1: Ribonu tively). 55 clease P40 kDa subunit; PHD finger protein 20; Thioredoxin In another embodiment of the monitoring method, the one interacting protein, Ubiquinol-cytochrome c reductase core or more biomarkers is encoded by a nucleic acid molecule protein II: Hypothetical protein FLJ22662; Preimplantation comprising a nucleotide sequence selected from the group protein 3: DKFZP564G2022 protein; Dipeptidase 2: Hemo consisting of SEQID NO: 134-177, 110, 112, 118, 123 and globin, alpha 1, alpha 2: Frequently rearranged in advanced 131 (or the biomarkers set forth by name in Table 4, namely 60 T-cell lymphomas; DEAD (Asp-Glu-Ala-Asp) box polypep Uncharacterized hypothalamus protein HT007: Dual speci tide 48; Tumor necrosis factor, alpha-induced protein 2: ficity phosphatase 22; Proteasome (prosome, macropain) Nucleophosmin (nucleolar phosphoprotein B23, numatrin); Subunit, beta type, 7: Membrane-spanning 4-domains, Sub Interleukin 13 receptor, alpha 1: Leukocyte specific transcript family A, member 4: DKFZP434C171 protein: Protein phos 1, LST1: CGI-121 protein: RAS p21 protein activator 4/hy phatase 1, catalytic Subunit, beta isoform; Splicing factor, 65 pothetical protein FLJ21767; Cathepsin S; CD63 antigen arginine/serine-rich 5; Sorting nexin 11, Farnesyltransferase, (melanoma 1 antigen); JTV1 gene; KIAA0174: Thrombo CAAXbox, alpha; Peroxisomal D3.D2-enoyl-CoA isomer spondin 1: Hypothetical protein LOC54103: Interferon regu US 8,092,998 B2 25 26 latory factor 1; and SEC 11-like 1 (S. cerevisiae), wherein ated p67 homolog mRNA, complete cds: Human mRNA for expression of the one or more biomarkers is decreased in the hCREM (cyclic AMP-responsive element modulator) type 2 Subject. protein, complete cds: Apurinic endonuclease (APE) mRNA, In yet another embodiment of the monitoring method, the complete cds./PROD-apurinic endonuclease; TATA box one or more biomarkers is encoded by a nucleic acid molecule binding protein (TBP)-associated factor, RNA polymerase II, comprising a nucleotide sequence selected from the group D, 100 kD; Human mRNA for ZFM1 protein alternatively consisting of SEQID NO: 178-292, 91 and 97 (or the biom spliced product, complete cds./PROD=ZFM 1 protein, alter arkers set forth by name in Table 5, namely HLA-Bassociated natively spliced product; Trachea cellular apoptosis Suscep transcript-1 (D6S81E); Interleukin enhancer binding factor 2, tibility protein (CSE1) mRNA, complete cds; Similar to 45 kD (ILF2); Isolate Liv chaperone protein HSP90 beta 10 eukaryotic translation initiation factor 3, subunit 8 (110 kD), (HSP90BETA) mRNA: Lysyl-tRNA synthetase mRNA, clone MGC:8693, mRNA, complete cds; GABA-A receptor complete cas; nuclear gene for mitochondrial product; alter associated protein mRNA, complete cds./PROD-GABA-A natively spliced; Tryptophanyl-tRNA synthetase (WARS); receptor-associated protein; Human (clone 2-5) Synuclein Profilin 1 (PFN1), mRNA: Seryl-tRNA synthetase (SARS): (NACP) mRNA, complete cds; Human putative ribosomal Similar to KIAA1007 protein, clone MGC:692, mRNA, com 15 protein S1 mRNA; Aldehyde dehydrogenase 1, soluble plete cds; CD59 antigen p 18-20 (antigen identified by mono (ALDH1), mRNA/PROD=aldehyde dehydrogenase 1, clonal antibodies 16.3A5, EJ16, E.J30, EL32 and G344); soluble: Homo sapiens mRNA for KIAA 1057 protein, partial Homo sapiens KIAA0064 gene product (KIAAO064), cds; RBP 1-like protein; Ring finger protein 4: KIAAO197 mRNA; Chromosome segregation 1 (yeast homolog)-like protein: Homo sapiens mRNA, cDNA DKFZp586F1323 (CSE1L), mRNA: Protein phosphatase 1, regulatory subunit (from clone DKFZp586F1323); Homo sapiens mRNA: 7 (PPP1R7), mRNA: DEADH (Asp-Glu-Ala-AspHis) box cDNA DKFZp564I052 (from clone DKFZp564I052); Homo polypeptide 1 (DDX1), mRNA: Threonyl-tRNA synthetase sapiens mRNA for Hmob33 protein, 3 untranslated region; (TARS), mRNA: Deadbox protein 15 mRNA, complete cds: Homo sapiens mRNA, cDNA DKFZp586F1019 (from clone SRY (sex determining region Y)-box 4/DEF=Human DNA DKFZp586F1019); partial cds: Myosin, light polypeptide 4, sequence from clone RP3-322L4 on chromosome 6; Galac 25 alkali; atrial, embryonic; H. sapiens novel gene from PAC tosidase, beta 1 (GLB1), mRNA; ATP-binding cassette, sub 117P20, chromosome 1: Homo sapiens clone 24582 mRNA family E (OABP), member 1: NADH dehydrogenase sequence: Heterogeneous nuclear ribonucleoprotein Hl (H): (ubiquinone) 1 alpha subcomplex, 6 (14 kD, B14) Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase (NDUFA6), mRNA: Pericentriolar material 1 (PCM1), activation protein, epsilon polypeptide; Cyclin T2; cDNA: mRNA: Excision repair cross-complementing rodent repair 30 FLJ23227 fis, clone CAE00645, highly similar to AF052138: deficiency, complementation group 3 (ERCC3), mRNA: Hypothetical protein FLJ12619; C-terminal binding protein KIAA0907 protein (KIAA0907), mRNA: v-crk avian sar 1: SEC22, vesicle trafficking protein (S. cerevisiae)-like 1: coma virus CT10 oncogene homolog: 6-phosphofructo-2- Hemoglobin, alpha 1: Homo sapiens clone 24659 mRNA kinasefructose-2,6-biphosphatase 3 (PFKFB3), mRNA./ sequence/DEF=Homo sapiens clone 24659 mRNA PROD-6-phosphofructo-2-kinase-fructose-2,6- 35 sequence; Calcium channel, Voltage-dependent, PQ type, biphosphatase 3: KIAA0766 gene product (KIAA0766), alpha 1A subunit; H. sapiens SMA5 mRNA. H. sapiens HEX mRNA: N-acetylgalactosaminidase, alpha- (NAGA), gene encoding homeobox related protein; Mitogen-activated mRNA: Protein tyrosine phosphatase, non-receptor type sub protein kinase kinase kinase 4: Serine palmitoyltransferase strate 1 (PTPNS1), mRNA; Crystallin, Zeta (quinone reduc (LCB2) mRNA, partial cds; KIAA0971 protein/DEF=Homo tase) (CRYZ), mRNA; KIAA0429 gene product 40 sapiens cDNA FLJ11495 fis, clone HEMBA1001950, highly (KIAA0429), mRNA: SET domain, bifurcated 1 (SETDB1), similar to Homo sapiens mRNA for KIAA0971 protein; mRNA, NADH dehydrogenase (ubiquinone) 1 beta subcom ESTs, Hs. 97109; ESTs, Weakly similar to ALU7 HUMAN plex, 3 (12 kD, B12) (NDUFB3), mRNA; Diphtheria toxin ALU: DEAD-box protein abstrakt (ABS), mRNA: receptor (DTR): Thrombomodulin (THBD), mRNA: Protein KIAA1513 protein (KIAA1513), mRNA; Cell division pro phosphatase 1A (formerly 2C), magnesium-dependent, alpha 45 tein Fts.J (FJH1), mRNA; F-box only protein 3 (FBXO3), isoform (PPM1A), mRNA: CD37 antigen (CD37), mRNA: mRNA: Purinergic receptor (family A group 5) (P2Y5), Hemoglobin, gamma G (HBG2), mRNA: Protein phos mRNA: Integral inner nuclear membrane protein (MAN1), phatase 1D magnesium-dependent, delta isoform (PPM1D), mRNA. Fanconi anemia, complementation group F mRNA: Hematopoietically expressed homeobox (HHEX), (FANCF), mRNA: Hypothetical protein FLJ12820 mRNA; Amphiregulin (schwannoma-derived growth factor) 50 (FLJ12820), mRNA: Hypothetical protein FLJ13119 (AREG), mRNA: Early growth response 2 (Krox-20 (Droso (FLJ13119), mRNA: Hypothetical protein FLJ20189 phila) homolog) (EGR2), mRNA; 2,5-oligoadenylate syn (FLJ20189), mRNA: Hypothetical protein FLJ20701 thetase 1 (40-46 kD) (OAS1), transcript variant E 16, mRNA: (FLJ20701), mRNA: Homo sapiens chromosome 12 open Early growth response 3 (EGR3), mRNA./PROD—early reading frame 5 (C12ORF5), mRNA: Hypothetical protein growth response 3: Homo sapiens MD-2 protein (MD-2), 55 FLJ22555 (FLJ22555), mRNA: Hypothetical protein mRNA: Homo sapiens MAX dimerization protein (MAD), FLJ1110 (FLJ11110), mRNA: CGI-12 protein (LOC51001), mRNA: DKFZP586A011 protein (DKFZP586A011), mRNA. Triggering receptor expressed on myeloid cells 1 mRNA; 78 kDa gastrin-binding protein mRNA, complete (TREM1), mRNA: betaGlcNAc beta 1,4-galactosyltrans cds: Transferrin receptor (p90, CD71), clone MGC:3151, ferase. polypeptide 5: PNAS-25 mRNA, complete cds.; mRNA, complete cds; Homo sapiens mRNA, cDNA 60 Homo sapiens mRNA for FLJ00043 protein, partial cds: DKFZp564N1272 (from clone DKFZp564N1272): complete Homo sapiens cDNA: FLJ21737 fis, clone COLF3396: cds; GABA-A receptor-associated protein like 1 Homo sapiens cDNA FLJ13399 fis, clone PLACE 1001395/ (GABARAPL1) mRNA, complete cds; Translocation protein DEF=Homo sapiens cDNA FLJ13399 fis, clone 1; Homo sapiens clone 016b03 My027 protein mRNA, com PLACE 1001395; Novel MAFF (v-maf musculoaponeurotic plete cds; Protein kinase-related oncogene (PIM1 mRNA, 65 fibrosarcoma (avian) oncogene family, protein F) LIKE pro complete cds; MADS box transcription enhancer factor 2, tein; Heparin-binding EGF-like growth factor mRNA, com polypeptide C (myocyte enhancer factor 2C), eIF-2-associ plete cds; E. coli 7,8-diamino-pelargonic acid (bioA), biotin US 8,092,998 B2 27 28 synthetase (bioB), 7-keto-8-amino-pelargonic acid syn PAC 117P20, chromosome 1: Homo sapiens clone 24582 thetase (bioF), bioC protein, and dethiobiotin synthetase mRNA sequence; Cyclin T2. H. sapiens HEX gene encoding (bioD), complete cds: Escherichia coli/REF=J04423/DEFE homeobox related protein; Mitogen-activated protein kinase coli bioC protein corresponding to nucleotides 4609-4883 of kinase kinase 4: Serine palmitoyltransferase (LCB2) mRNA, J04423/LEN=777 (-5 and -3 represent transcript regions 5 5 partial cds; KIAA0971 protein/DEF-Homo sapiens cloNA prime and 3 prime respectively)). FLJ11495 fis, clone HEMBA1001950, highly similar to More preferably, the one or more biomarkers is encoded by Homo sapiens mRNA for KIAA0971 protein: DEAD-box a nucleic acid molecule comprising a nucleotide sequence protein abstrakt (ABS), mRNA; KIAA1513 protein selected from the group consisting of SEQID NO: 178-185: (KIAA1513), mRNA: Cell division protein Fts.J (FJH1), 187-200, 202, 203, 205-207: 211, 213, 214, 216, 220, 221, 10 mRNA; F-box only protein 3 (FBXO3), mRNA: Purinergic 226, 228, 229, 231, 232, 234, 235, 238-247, 249, 250, 253, receptor (family A group 5) (P2Y5), mRNA: Integral inner 262-265,268-282 and 285-288 (or the biomarkers set forth by nuclear membrane protein (MAN1), mRNA: Fanconi ane name in Table 5 as being upregulated, namely HLA-B asso mia, complementation group F (FANCF), mRNA: Hypo ciated transcript-1 (D6S81E); Interleukin enhancer binding thetical protein FLJ12820 (FLJ12820), mRNA: Hypothetical factor 2, 45 kD (ILF2); Isolate Liv chaperone protein HSP90 15 protein FLJ13119 (FLJ13119), mRNA: Hypothetical protein beta (HSP90BETA) mRNA: Lysyl-tRNA synthetase mRNA, FLJ20189 (FLJ20189), mRNA: Hypothetical protein complete cas; nuclear gene for mitochondrial product; alter FLJ20701 (FLJ20701), mRNA: Homo sapiens chromosome natively spliced; Tryptophanyl-tRNA synthetase (WARS); 12 open reading frame 5 (C12ORF5), mRNA: Hypothetical Profilin 1 (PFN1), mRNA: Seryl-tRNA synthetase (SARS): protein FLJ22555 (FLJ22555), mRNA: Hypothetical protein Similar to KIAA1007 protein, clone MGC:692, mRNA, com FLJ11110 (FLJ11110), mRNA: CGI-12 protein plete cds; Homo sapiens KIAA0064 gene product (LOC51001), mRNA: PNAS-25 mRNA, complete cds.: (KIAAO064), mRNA; Chromosome segregation 1 (yeast Homo sapiens mRNA for FLJ00043 protein, partial cds: homolog)-like (CSE1L), mRNA; Protein phosphatase 1, Homo sapiens cDNA: FLJ21737 fis, clone COLF3396: regulatory subunit 7 (PPP1R7), mRNA: DEADH (Asp-Glu Homo sapiens cDNA FLJ13399 fis, clone PLACE 1001395/ Ala-AspHis) box polypeptide 1 (DDX1), mRNA: Threonyl 25 DEF=Homo sapiens cDNA FLJ13399 fis, clone tRNA synthetase (TARS), mRNA: Dead box protein 15 PLACE 1001395), wherein expression of the one or more mRNA, complete cds; SRY (sex determining region Y)-box biomarkers is increased in the Subject. 4/DEF=Human DNA sequence from clone RP3-322L4 on Additionally or alternatively, more preferably the one or chromosome 6; Galactosidase, beta 1 (GLB1), mRNA; ATP more biomarkers is encoded by a nucleic acid molecule com binding cassette, sub-family E (OABP), member 1: NADH 30 prising a nucleotide sequence selected from the group con dehydrogenase (ubiquinone) 1 alpha Subcomplex, 6 (14 kD. sisting of SEQID NO: 186, 201, 204, 208,209, 91,210, 212, B14) (NDUFA6), mRNA: Pericentriolar material 1 (PCM1), 97,215, 217-219,222-225,227,230,233,236,237,248,251, mRNA: Excision repair cross-complementing rodent repair 252,254-261,266, 267,283, 284 and 289-292 (or the biom deficiency, complementation group 3 (ERCC3), mRNA: arkers set forth by name in Table 5 as being down-regulated, KIAA0907 protein (KIAA0907), mRNA: v-crk avian sar 35 namely CD59 antigen p 18-20 (antigen identified by mono coma virus CT10 oncogene homolog; KIAA0766 gene prod clonal antibodies 16.3A5, EJ16, E.J30, EL32 and G344); uct (KIAA0766), mRNA: N-acetylgalactosaminidase, alpha 6-phosphofructo-2-kinasefructose-2,6-biphosphatase 3 (NAGA), mRNA; Crystallin, Zeta (quinone reductase) (PFKFB3), mRNA./PROD-6-phosphofructo-2-kinase-fruc (CRYZ), mRNA; KIAA0429 gene product (KIAA0429), tose-2,6-biphosphatase 3: Protein tyrosine phosphatase, non mRNA: SET domain, bifurcated 1 (SETDB1), mRNA: CD37 40 receptor type substrate 1 (PTPNS1), mRNA: NADH dehy antigen (CD37), mRNA: Protein phosphatase 1D magne drogenase (ubiquinone) 1 beta subcomplex, 3 (12 kD, B12) sium-dependent, delta isoform (PPM1D), mRNA: Hemato (NDUFB3), mRNA; Diphtheria toxin receptor (DTR): poietically expressed homeobox (HHEX), mRNA; 2,5-oli Thrombomodulin (THEBD), mRNA: Protein phosphatase 1A goadenylate synthetase 1 (40-46 kD) (OAS1), transcript (formerly 2C), magnesium-dependent, alpha isoform variant E16, mRNA: DKFZP586A011 protein 45 (PPM1A), mRNA: Hemoglobin, gamma G (HBG2), mRNA: (DKFZP586A011), mRNA: 78 kDa gastrin-binding protein Amphiregulin (Schwannoma-derived growth factor) mRNA, complete cds; Homo sapiens clone 016b03 My027 (AREG), mRNA: Early growth response 2 (Krox-20 (Droso protein mRNA, complete cds; MADS box transcription phila) homolog) (EGR2), mRNA: Early growth response 3 enhancer factor 2, polypeptide C (myocyte enhancer factor (EGR3), mRNA./PROD—early growth response 3: Homo 2C); elF-2-associated p67 homolog mRNA, complete cds: 50 sapiens MD-2 protein (MD-2), mRNA: Homo sapiens MAX Apurinic endonuclease (APE) mRNA, complete cds./ dimerization protein (MAD), mRNA: Transferrin receptor PROD-apurinic endonuclease; TATA box binding protein (p90, CD71), clone MGC:3151, mRNA, complete cds; Homo (TBP)-associated factor, RNA polymerase II, D, 100 kD; sapiens mRNA, cDNA DKFZp564N1272 (from clone Trachea cellular apoptosis susceptibility protein (CSE 1) DKFZp564N1272); complete cds; GABA-A receptor-asso mRNA, complete cds; Similar to eukaryotic translation ini 55 ciated protein like 1 (GABARAPL1) mRNA, complete cds: tiation factor 3, subunit 8 (110 kD), clone MGC:8693, Translocation protein 1; Protein kinase-related oncogene mRNA, complete cds; Human putative ribosomal protein S1 (PIM1) mRNA, complete cds: Human mRNA for hCREM mRNA; Aldehyde dehydrogenase 1, soluble (ALDH1), (cyclic AMP-responsive element modulator) type 2 protein, mRNA./PROD-aldehyde dehydrogenase 1, soluble: Homo complete cds: Human mRNA for ZFM1 protein alternatively sapiens mRNA for KIAA 1057 protein, partial cds; RBP1 60 spliced product, complete cds./PROD=ZFM 1 protein, alter like protein; Ring finger protein 4; KIAAO 197 protein; Homo natively spliced product; GABA-A receptor-associated pro sapiens mRNA, cDNA DKFZp586F1323 (from clone tein mRNA, complete cds./PROD-GABA-A receptor-asso DKFZp586F1323); Homo sapiens mRNA, cDNA ciated protein; Human (clone 2-5) synuclein (NACP) mRNA, DKFZp564I052 (from clone DKFZp564I052); Homo sapi complete cds, Myosin, light polypeptide 4, alkali; atrial, ens mRNA for Hmob33 protein, 3 untranslated region; Homo 65 embryonic: Heterogeneous nuclear ribonucleoprotein H1 sapiens mRNA, cDNA DKFZp586F1019 (from clone (H); Tyrosine 3-monooxygenase/tryptophan 5-monooxyge DKFZp586F1019); partial cds; H. sapiens novel gene from nase activation protein, epsilon polypeptide; cDNA: US 8,092,998 B2 29 30 FLJ23227 fis, clone CAE00645, highly similar to AF052138: which TNFC. inhibitor therapy is applied, including the Hypothetical protein FLJ12619; C-terminal binding protein autoimmune disorders listed in the previous section. 1: SEC22, vesicle trafficking protein (S. cerevisiae)-like 1; Selection and Use of Treatment Regimens with TNFC. Inhibi Hemoglobin, alpha 1: Homo sapiens clone 24659 mRNA tOrs sequence/DEF-Homo sapiens clone 24659 mRNA Given the observation that the expression pattern of par sequence; Calcium channel, Voltage-dependent, PQ type, ticular biomarkers in an autoimmune disorder Subject influ alpha 1A subunit; H. sapiens SMA5 mRNA: ESTs, ences the responsiveness of the subject to a TNFC. inhibitor, Hs. 97109; ESTs, Weakly similar to ALU7 HUMAN ALU: one can select an appropriate treatment regimen for the Sub Triggering receptor expressed on myeloid cells 1 (TREM1). ject based on the expression of one or more biomarkers in the mRNA: betaGlcNAc beta 1,4-galactosyltransferase. 10 Subject. Accordingly, in one embodiment, the above-de polypeptide 5: Novel MAFF (V-maf musculoaponeurotic fib scribed method for predicting the responsiveness to a TNFC. rosarcoma (avian) oncogene family, protein F) LIKE protein; inhibitor in a Subject having an autoimmune disorder further Heparin-binding EGF-like growth factor mRNA, complete comprises selecting a treatment regimen with the TNFC. cds; E. coli 7,8-diamino-pelargonic acid (bioA), biotin Syn inhibitor based upon expression of the one or more biomar thetase (bioB), 7-keto-8-amino-pelargonic acid synthetase 15 kers in the subject. In another aspect, the method still further (bioF), bioC protein, and dethiobiotin synthetase (biol)), comprises administering the TNFC. inhibitor to the subject complete cds: Escherichia coli/REF=J04423/DEF=E coli according to the treatment regimen Such that the autoimmune bioC protein corresponding to nucleotides 4609-4883 of disorder is inhibited in the subject. J04423/LEN=777 (-5 and -3 represent transcript regions 5 In another embodiment, the invention provides a method prime and 3 prime respectively)), wherein expression of the for selecting a treatment regimen for therapy with a TNFC. one or more biomarkers is decreased in the Subject. inhibitor in a Subject having an autoimmune disorder, the In yet another embodiment of the monitoring method, the method comprising: one or more biomarkers is encoded by a nucleic acid molecule assaying the Subject for expression of one or more biom comprising a nucleotide sequence selected from the group arkers predictive of responsiveness to a TNFC. inhibitor for consisting of SEQID NO: 87.97, 101, 293, 92,272,93, 107, 25 treatment of the autoimmune disorder, and 108, 121 and 123 (or the biomarkers set forth by name in selecting a treatment regimen with a TNFC. inhibitor based Table 6 as pre-treatment biomarkers, namely Solute carrier upon expression of the one or more biomarkers in the Subject. family 6; Amphiregulin; Keratin 1; Hemoglobin, alpha 1: In yet another embodiment, the invention provides a MHC-II, DM beta; Purinergic receptor P2Y, G-protein method of treating a subject having an autoimmune disorder coupled 5; Forkhead box O3A: Transferrin receptor (p90, 30 with a TNFC. inhibitor, the method comprising: CD71); Ring finger protein 10; Forminbinding protein 4; and assaying the Subject for expression of one or more biom Hypothetical protein LOC54103), wherein the subject is arkers predictive of responsiveness to a TNFC. inhibitor for monitored prior to treatment with a TNFC. inhibitor. treatment of the autoimmune disorder, In yet another embodiment of the monitoring method, the selecting a treatment regimen with a TNFC. inhibitor based one or more biomarkers is encoded by a nucleic acid molecule 35 upon expression of the one or more biomarkers in the Subject; comprising a nucleotide sequence selected from the group and consisting of SEQID NO: 290, 209, 98, 112, 116, 121, 130, administering the TNFC. inhibitor according to the treat 155, 92, 289, 216 and 131 (or the biomarkers set forth by ment regimen such that the Subject is treated for the autoim name in Table 6 as post-treatment biomarkers, namely Diph mune disorder. teria toxin receptor; Heparin-binding EGF-like growth fac 40 The treatment regimen that is selected typically includes at tor; Lipoyltransferase 1: APEX nuclease (multifunct. DNA least one of the following parameters and more typically repair enzyme)1; GABA(A) receptor-associated protein like includes many or all of the following parameters: the type of 1/3; Formin binding protein 4; Zinc finger protein 331; Ribo agent chosen for administration, the dosage, the formulation, nuclease P 40 kDa subunit; MHC class II, DM beta; V-maf the route of administration and/or the frequency of adminis fibrosarc. oncogene homolog F (avian); 2.5'-oligoadenylate 45 tration. synthetase 1, 40/46 kDa, and Membrane-spanning 4-do Particularly preferred TNFC. inhibitors are biologic agents mains, Subfam. A memb. 4), wherein the Subject is monitored that have been approved by the FDA for use in humans in the after treatment with a TNFC. inhibitor. treatment of rheumatoid arthritis, which agents include adali In yet another embodiment of the monitoring method, the mumab (HUMIRATM), infliximab (REMICADETM) and one or more biomarkers is encoded by a nucleic acid molecule 50 etanercept (ENBRELTM), most preferably adalimumab (HU comprising a nucleotide sequence selected from the group MIRATM). consisting of SEQID NO: 97,102,29,294,295,91, 131,290, In one embodiment, the TNFC. inhibitor is an anti-tumor 100, 134, 296, 297, 298, 299, 136, 174 and 300 (or the necrosis factor-alpha (TNFC) antibody, or antigen-binding biomarkers set forth by name in Table 7, namely Amphiregu portion thereof. For example, the anti-TNFC. antibody, or lin; Carbonic anhydrase 1: Charcot-Leyden crystal protein; 55 antigen-binding portion thereof, can be a humanized anti Clusterin C; Tumor necrosis factor alpha induced protein 6: body, a chimericantibody or a multivalent antibody. Thrombomodulin; Membrane-spanning 4-domains, Subfam In another embodiment, the anti-TNFC. antibody, or anti ily A, member 4: Diptheria toxin receptor, S100 calcium gen-binding portion thereof, is a human antibody, preferably binding protein A1: Uncharacterized hypothalamus protein a human antibody, or antigen-binding portion thereof, that HT007: MHC-class-II; HLA-DRalpha: Hypothetical protein 60 binds to human TNFC. with high affinity and a low off rate, LOC54103; Tumor necrosis factor alpha; Interleukin 1 beta; and has a high neutralizing capacity. Preferably, the human Proteasome subunit beta type 7 precursor; and Protein antibodies are recombinant, neutralizing human anti-hTNFC. KIAA0174; Microsomal signal peptidase 18 kDa subunit). antibodies. The most preferred recombinant, neutralizing A preferred autoimmune disorder in which to apply the antibody used in the method of the invention is referred to methods of the invention for monitoring an autoimmune dis 65 herein as adalimumab, also referred to as HUMIRAR) or order is rheumatoid arthritis. However, the monitoring meth D2E7 (the amino acid sequence of the adalimumab VL region ods can be applied to essentially any autoimmune disorder in is shown in SEQID NO:303; the amino acid sequence of the US 8,092,998 B2 31 32 adalimumab VH region is shown in SEQID NO: 304). The the adalimumab VL and VHCDR3 domains to substitutions properties of D2E7 (adalimumab; HumiraR) have been by alanine, substitution of otheramino acids within the CDR3 described in Salfeld et al., U.S. Pat. Nos. 6,090,382, 6,258, domains may be possible while still retaining the low off rate 562, and 6,509,015, which are each incorporated by reference constant of the antibody, in particular Substitutions with con herein. servative amino acids. Preferably, no more than one to five Other examples of TNFC. antibodies include chimeric and conservative amino acid Substitutions are made within the humanized murine anti-hTNFC. antibodies which have under adalimumab VL and/or VHCDR3 domains. More preferably, gone clinical testing for treatment of rheumatoid arthritis (see no more than one to three conservative amino acid substitu e.g., Elliott et al. (1994) Lancet 344:1125-1127; Elliot et al. tions are made within the adalimumab VL and/or VHCDR3 (1994) Lancet 344:1105-11 10: Rankin et al. (1995) Br. J. 10 domains. Additionally, conservative amino acid Substitutions Rheumatol. 34:334-342). In another embodiment, the TNFC. should not be made at amino acid positions critical for bind antibody used in the invention is infliximab (Remicade(R), ing to hTNFC. Positions 2 and 5 of the adalimumab VLCDR3 Johnson and Johnson; described in U.S. Pat. No. 5,656,272, and positions 1 and 7 of the adalimumab VHCDR3 appear to incorporated by reference herein), CDP571 (a humanized be critical for interaction with hTNFC. and thus, conservative monoclonal anti-TNF-alpha IgG4 antibody), CDP 870 (a 15 amino acid substitutions preferably are not made at these humanized monoclonal anti-TNF-alpha antibody fragment), positions (although analanine Substitution at position 5 of the an anti-TNF dAb (Peptech), and CNTO 148 (golimumab: adalimumab VL CDR3 is acceptable, as described above) Medarex and Centocor, see also WO 02/12502). (see U.S. Pat. No. 6,090,382). In one embodiment, the TNFC. inhibitors used in the meth Accordingly, in another embodiment, the antibody or anti ods of the invention include adalimumab antibodies and anti gen-binding portion thereofpreferably contains the following body portions, adalimumab-related antibodies and antibody characteristics: portions, adalimumab-related DVD-Igor dual specific anti a) dissociates from human TNFC. with a K-rate constant bodies, and other human antibodies and antibody portions of 1x10s or less, as determined by surface plasmon reso with equivalent properties to adalimumab, Such as high affin nance, ity binding to hTNFC. with low dissociation kinetics and high 25 b) has a light chain CDR3 domain comprising the amino neutralizing capacity. In one embodiment, a treatment regi acid sequence of SEQID NO:305, or modified from SEQID men of the invention provides treatment with an isolated NO: 305 by a single alanine substitution at position 1, 4, 5, 7 human antibody, or an antigen-binding portion thereof, that or 8 or by one to five conservative amino acid substitutions at dissociates from human TNFC. with a K, of 1x10 Morless positions 1, 3, 4, 6, 7, 8 and/or 9: and a K-rate constant of 1x1 Os' or less, both determined 30 c) has a heavy chain CDR3 domain comprising the amino by Surface plasmon resonance, and neutralizes human TNFC. acid sequence of SEQID NO:306, or modified from SEQID cytotoxicity in a standard in vitro L929 assay with an ICs of NO: 306 by a single alanine substitution at position 2, 3, 4, 5, 1x107M or less. More preferably, the isolated human anti 6, 8, 9, 10 or 11 or by one to five conservative amino acid body, or antigen-binding portion thereof, dissociates from substitutions at positions 2, 3, 4, 5, 6, 8, 9, 10, 11 and/or 12. human TNFC. with a K of 5x10's or less, or even more 35 More preferably, the antibody, or antigen-binding portion preferably, with a K of 1 x10's or less. More preferably, thereof, dissociates from human TNFC. with a K of the isolated human antibody, or antigen-binding portion 5x10's or less. Even more preferably, the antibody, or thereof, neutralizes human TNFC. cytotoxicity in a standard in antigen-binding portion thereof, dissociates from human vitro L929 assay with an ICso of 1x10 Morless, even more TNFC. with a K of 1x10's or less. preferably with an ICs of 1x10 M or less and still more 40 In yet another embodiment, the antibody or antigen-bind preferably with an ICso of 1x10" Morless. In a preferred ing portion thereof preferably contains a light chain variable embodiment, the antibody is an isolated human recombinant region (LCVR) having a CDR3 domain comprising the amino antibody, or an antigen-binding portion thereof. acid sequence of SEQID NO:305, or modified from SEQID It is well known in the art that antibody heavy and light NO: 305 by a single alanine substitution at position 1, 4, 5, 7 chain CDR3 domains play an important role in the binding 45 or 8, and with a heavy chain variable region (HCVR) having specificity/affinity of an antibody for an antigen. Accord a CDR3 domain comprising the amino acid sequence of SEQ ingly, in another aspect, the TNFC. inhibitor used in the treat ID NO: 306, or modified from SEQID NO: 306 by a single ment method of the invention is a human anti-TNFC. antibody alanine substitution at position 2, 3, 4, 5, 6, 8, 9, 10 or 11. that has slow dissociation kinetics for association with Preferably, the LCVR further has a CDR2 domain comprising hTNFC. and that has light and heavy chain CDR3 domains 50 the amino acid sequence of SEQID NO: 307 (i.e., the adali that structurally are identical to or related to those of adali mumab VL CDR2) and the HCVR further has a CDR2 mumab. Position 9 of the adalimumab VL CDR3 can be domain comprising the amino acid sequence of SEQID NO: occupied by Ala or Thr without substantially affecting the 308 (i.e., the adalimumab VHCDR2). Even more preferably, K. Accordingly, a consensus motif for the adalimumab VL the LCVR further has CDR1 domain comprising the amino CDR3 comprises the amino acid sequence: Q-R-Y-N-R-A-P- 55 acid sequence of SEQID NO:309 (i.e., the adalimumab VL Y-(T/A) (SEQ ID NO:305). Additionally, position 12 of the CDR1) and the HCVR has a CDR1 domain comprising the adalimumab VHCDR3 can be occupied by Tyr or ASn, with amino acid sequence of SEQ ID NO: 310 (i.e., the adali out substantially affecting the K. Accordingly, a consensus mumab VHCDR1). The framework regions for VL prefer motif for the adalimumab VH CDR3 comprises the amino ably are from the VI human germline family, more prefer acid sequence:V-S-Y-L-S-T-A-S-S-L-D-(Y/N) (SEQID NO: 60 ably from the A20 human germline Vk gene and most 306). Moreover, as demonstrated in Example 2 of U.S. Pat. preferably from the adalimumab VL framework sequences No. 6,090,382, the CDR3 domain of the adalimumab heavy shown in FIGS. 1A and 1B of U.S. Pat. No. 6,090,382. The and light chains is amenable to Substitution with a single framework regions for VH preferably are from the V3 alanine residue (at position 1, 4, 5, 7 or 8 within the VLCDR3 human germline family, more preferably from the DP-31 or at position 2, 3, 4, 5, 6,8,9, 10 or 11 within the VHCDR3) 65 human germline VH gene and most preferably from the adali without substantially affecting the K Still further, the mumab VH framework sequences shown in FIGS. 2A and 2B skilled artisan will appreciate that, given the amenability of of U.S. Pat. No. 6,090,382. US 8,092,998 B2 33 34 Accordingly, in another embodiment, the antibody or anti An antibody or antibody portion of the invention can be gen-binding portion thereof preferably contains a light chain derivatized or linked to another functional molecule (e.g., variable region (LCVR) comprising the amino acid sequence another peptide or protein). Accordingly, the antibodies and of SEQID NO:303 (i.e., the adalimumab VL) and a heavy antibody portions of the invention are intended to include chain variable region (HCVR) comprising the amino acid 5 derivatized and otherwise modified forms of the anti-TNFC. sequence of SEQID NO: 304 (i.e., the adalimumab VH). In antibodies described herein, including immunoadhesion mol certain embodiments, the antibody comprises a heavy chain ecules. For example, an antibody or antibody portion of the constant region, Such as an IgG1, IgG2, IgG3, IgG4, IgA, IgE, invention can be functionally linked (by chemical coupling, IgM or Igld constant region. Preferably, the heavy chain con stant region is an IgG1 heavy chain constant region oran IgG4 10 genetic fusion, noncovalent association or otherwise) to one heavy chain constant region. Furthermore, the antibody can or more other molecular entities, such as another antibody comprise a light chain constant region, either a kappa light (e.g., a bispecific antibody or a diabody), a detectable agent, chain constant region or a lambda light chain constant region. a cytotoxic agent, a pharmaceutical agent, and/or a protein or Preferably, the antibody comprises a kappa light chain con peptide that can mediate associate of the antibody orantibody stant region. Alternatively, the antibody portion can be, for 15 portion with another molecule (such as a streptavidin core example, a Fab fragment or a single chain Fv fragment. region or a polyhistidine tag). In other embodiments, the TNFC. inhibitor of the invention One type of derivatized antibody is produced by crosslink is etanercept (described in WO 91/03553 and WO 09/406, ing two or more antibodies (of the same type or of different 476), infliximab (described in U.S. Pat. No. 5,656.272), types, e.g., to create bispecific antibodies). Suitable CDP571 (a humanized monoclonal anti-TNF-alpha IgG4 20 crosslinkers include those that are heterobifunctional, having antibody), CDP870 (a humanized monoclonal anti-TNF two distinctly reactive groups separated by an appropriate alpha antibody fragment), D2E7 (a human anti-TNF mAb), spacer (e.g., m-maleimidobenzoyl-N-hydroxysuccinimide soluble TNF receptor Type I, or a pegylated soluble TNF ester) or homobifunctional (e.g., disuccinimidyl Suberate). receptor Type I (PEGs TNF-R1). Such linkers are available from Pierce Chemical Company, The TNFC. antibody of the invention can be modified. In 25 Rockford, Ill. some embodiments, the TNFC. antibody or antigen binding Useful detectable agents with which an antibody or anti fragments thereof, is chemically modified to provide a body portion of the invention may be derivatized include desired effect. For example, pegylation of antibodies and fluorescent compounds. Exemplary fluorescent detectable antibody fragments of the invention may be carried out by any agents include fluorescein, fluorescein isothiocyanate, of the pegylation reactions known in the art, as described, for 30 rhodamine, 5-dimethylamine-1-napthalenesulfonyl chloride, example, in the following references: Focus on Growth Fac phycoerythrin and the like. An antibody may also be deriva tors 3:4-10 (1992); EP 0 154316; and EP 0401384 (each of tized with detectable enzymes, such as alkaline phosphatase, which is incorporated by reference herein in its entirety). horseradish peroxidase, glucose oxidase and the like. When Preferably, the pegylation is carried out via an acylation reac an antibody is derivatized with a detectable enzyme, it is tion or an alkylation reaction with a reactive polyethylene 35 detected by adding additional reagents that the enzyme uses glycol molecule (or an analogous reactive water-soluble to produce a detectable reaction product. For example, when polymer). A preferred water-soluble polymer for pegylation the detectable agent horseradish peroxidase is present, the of the antibodies and antibody fragments of the invention is addition of hydrogen peroxide and diaminobenzidine leads to polyethylene glycol (PEG). As used herein, “polyethylene a colored reaction product, which is detectable. An antibody glycol is meant to encompass any of the forms of PEG that 40 may also be derivatized with biotin, and detected through have been used to derivatize other proteins. Such as mono indirect measurement of avidin or streptavidin binding. (C1 ClO) alkoxy- or aryloxy-polyethylene glycol. Selection of the particular parameters of the treatment regi Methods for preparing pegylated antibodies and antibody men can be based on known treatment parameters for the fragments of the invention will generally comprise the steps TNFC. inhibitor previously established in the art. For of (a) reacting the antibody or antibody fragment with poly- 45 example, a non-limiting example of a treatment regimen for ethylene glycol, Such as a reactive ester or aldehyde derivative adalimumab (HUMIRATM) is 40 mg every other week by of PEG, under conditions whereby the antibody or antibody Subcutaneous injection. A non-limiting example of a treat fragment becomes attached to one or more PEG groups, and ment regimen for etanercept (ENBRELTM) is 50 mg/week by (b) obtaining the reaction products. It will be apparent to one Subcutaneous injection. A non-limiting example of a treat of ordinary skill in the art to select the optimal reaction 50 ment regimen for infliximab (REMICADETM) is 3 mg/kg by conditions or the acylation reactions based on known param intravenous infusion at weeks 0, 2 and 6, then every 8 weeks. eters and the desired result. A treatment regimen can include administration of the TNFC. In yet another embodiment of the invention, TNFC. anti inhibitor alone or can include combination of the TNFC. bodies or fragments thereof can be altered wherein the con inhibitor with other therapeutic agents, such as methotrexate stant region of the antibody is modified to reduce at least one 55 (e.g., 10-20 mg/week) or prednisolone (e.g., 10 mg/week). constant region-mediated biological effector function relative Other suitable treatment regimens for the TNFC. inhibitors to an unmodified antibody. To modify an antibody of the discussed herein will be readily apparent to the ordinarily invention such that it exhibits reduced binding to the Fc skilled artisan based on prior studies of preferred administra receptor, the immunoglobulin constant region segment of the tion parameters for the TNFC. inhibitor. antibody can be mutated at particular regions necessary for Fc 60 For administration to a subject, a TNFC. inhibitor typically receptor (FcR) interactions (see e.g., Canfield, S.M. and S. L. is formulated into a pharmaceutical composition containing Morrison (1991).J. Exp. Med. 173:1483-1491; and Lund, J. et the TNFC. inhibitor and a pharmaceutically acceptable car al. (1991) J. Immunol. 147:2657-2662). Reduction in FcR rier. Therapeutic compositions typically must be sterile and binding ability of the antibody may also reduce other effector stable under the conditions of manufacture and storage. Phar functions which rely on FcR interactions, such as opSoniza- 65 maceutical compositions also can be administered in combi tion and phagocytosis and antigen-dependent cellular cyto nation therapy, i.e., combined with other agents, such as other toxicity. TNFC. inhibitors and/or other therapeutic agents, such as US 8,092,998 B2 35 36 traditional therapeutic agents for the treatment of autoim dispersion. The use of such media and agents for pharmaceu mune disorders, such as rheumatoid arthritis. tically active Substances is known in the art. Except insofar as As used herein, “pharmaceutically acceptable carrier' any conventional media or agent is incompatible with the includes any and all solvents, dispersion media, coatings, active compound, use thereof in the pharmaceutical compo antibacterial and antifungal agents, isotonic and absorption sitions of the invention is contemplated. Supplementary delaying agents, and the like that are physiologically compat active compounds can also be incorporated into the compo ible. Preferably, the carrier is suitable for intravenous, intra sitions. muscular, Subcutaneous, parenteral, spinal or epidermal A TNFC. inhibitor of the present invention can be admin administration (e.g., by injection or infusion). Depending on istered via one or more routes of administration using one or the route of administration, the active compound may be 10 more of a variety of methods known in the art. As will be coated in a material to protect the compound from the action appreciated by the skilled artisan, the route and/or mode of of acids and other natural conditions that may inactivate the administration will vary depending upon the desired results. compound. A preferred route of administration, particularly for antibody The pharmaceutical compositions may include one or agents, is by intravenous injection or infusion. Other pre more pharmaceutically acceptable salts. A "pharmaceutically 15 ferred routes of administration include intramuscular, intra acceptable salt” refers to a salt that retains the desired bio dermal, intraperitoneal, Subcutaneous, spinal or other logical activity of the parent compound and does not impart parenteral routes of administration, for example by injection any undesired toxicological effects (see e.g., Berge, S. M., et or infusion. The phrase “parenteral administration” as used al. (1977) J. Pharm. Sci. 66:1-19). Examples of such salts herein means modes of administration other than enteral and include acid addition salts and base addition salts. Acid addi topical administration, usually by injection, and includes, tion salts include those derived from nontoxic inorganic without limitation, intravenous, intramuscular, intraarterial, acids, such as hydrochloric, nitric, phosphoric, Sulfuric, intrathecal, intracapsular, intraorbital, intracardiac, intrader hydrobromic, hydroiodic, phosphorous and the like, as well mal, intraperitoneal, transtracheal, Subcutaneous, Subcuticu as from nontoxic organic acids such as aliphatic mono- and lar, intraarticular, Subcapsular, Subarachnoid, intraspinal, epi dicarboxylic acids, phenyl-substituted alkanoic acids, 25 dural and intrasternal injection and infusion. Alternatively, a hydroxy alkanoic acids, aromatic acids, aliphatic and aro TNFC. inhibitor of the invention can be administered via a matic sulfonic acids and the like. Base addition salts include non-parenteral route. Such as a topical, epidermal or mucosal those derived from alkaline earth metals, such as Sodium, route of administration, for example, intranasally, orally, potassium, magnesium, calcium and the like, as well as from vaginally, rectally, Sublingually or topically. nontoxic organic amines, such as N,N'-dibenzylethylenedi 30 In a preferred embodiment, the subject to be treated with amine, N-methylglucamine, chloroprocaine, choline, dietha the TNFC. inhibitor is a human subject. nolamine, ethylenediamine, procaine and the like. A preferred autoimmune disorder in which to apply the A pharmaceutical composition also may include a pharma methods of the invention for selecting and using a treatment ceutically acceptable anti-oxidant. Examples of pharmaceu regimen is rheumatoid arthritis. However, these methods can tically acceptable antioxidants include: (1) water soluble anti 35 be applied to essentially any autoimmune disorder in which oxidants, such as ascorbic acid, cysteine hydrochloride, TNFC. inhibitor therapy is applied, including the autoimmune sodium bisulfate, sodium metabisulfite, sodium sulfite and disorders listed in the previous sections the like; (2) oil-soluble antioxidants, such as ascorbyl palmi Kits of the Invention tate, butylated hydroxyanisole (BHA), butylated hydroxy In another aspect, the invention pertains to kits for carrying toluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and 40 out the methods of the invention. For example, in one embodi the like; and (3) metal chelating agents, such as citric acid, ment, the invention provides a kit for predicting responsive ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric ness to a TNFC. inhibitor in a Subject having an autoimmune acid, phosphoric acid, and the like. disorder. In one embodiment, the kit comprises: Examples of suitable aqueous and nonaqueous carriers that a) means for isolating monocytes; may be employed in the pharmaceutical compositions 45 b) means for measuring expression in the Subject of one or include water, ethanol, polyols (such as glycerol, propylene more biomarkers predictive of responsiveness to a TNFC. glycol, polyethylene glycol, and the like), and Suitable mix inhibitor in an autoimmune disorder; tures thereof, vegetable oils, such as olive oil, and injectable c) means for measuring expression of at least one house organic esters, such as ethyl oleate. Proper fluidity can be keeping gene; and maintained, for example, by the use of coating materials, such 50 d) instructions for use of the kit to predicting responsive as lecithin, by the maintenance of the required particle size in ness to a TNFC. inhibitor in a Subject having an autoimmune the case of dispersions, and by the use of Surfactants. disorder, wherein the one or more biomarkers is encoded by a These compositions may also contain adjuvants such as nucleic acid molecule comprising a nucleotide sequence preservatives, wetting agents, emulsifying agents and dis selected from the group consisting of SEQID NO: 1-82 (or persing agents. Prevention of presence of microorganisms 55 the biomarkers set forth by name in Table 9, as described may be ensured both by sterilization procedures and by the above) inclusion of various antibacterial and antifungal agents, for In one embodiment of the kit, the one or more biomarkers example, paraben, chlorobutanol, phenol Sorbic acid, and the is encoded by a nucleic acid molecule comprising a nucle like. It may also be desirable to include isotonic agents. Such otide sequence selected from the group consisting of SEQID as Sugars, Sodium chloride, and the like into the compositions. 60 NOs: 6, 7, 10, 15-17, 19, 22, 24, 27, 31, 34-39, 43-47,49, 51, In addition, prolonged absorption of the injectable pharma 54, 55,57, 59, 61, 62, 64, 70, 75,79 and 82 (or the biomarkers ceutical form may be brought about by the inclusion of agents set forth by name in Table 9 as being increased in 280% of which delay absorption Such as aluminum monostearate and responders vs. non-responders, as described above), more gelatin. preferably the one or more biomarkers is encoded by a nucleic Pharmaceutically acceptable carriers include sterile aque 65 acid molecule comprising a nucleotide sequence selected ous Solutions or dispersions and sterile powders for the from the group consisting of SEQID NOs: 31, 37, 44, 47, 62 extemporaneous preparation of sterile injectable solutions or and 70 (or the biomarkers set forth by name in Table 9 as being US 8,092,998 B2 37 38 increased in 290% of responders vs. non-responders, as instructions instruct that expression of the one or more biom described above), and even more preferably at least one of the arkers is decreased in the Subject. biomarkers is encoded by a nucleic acid molecule comprising In yet another embodiment of the kit, the one or more the nucleotide sequence of SEQ ID NO: 44 (or the CD11c biomarkers is encoded by a nucleic acid molecule comprising biomarkers set forth by name in Table 9 as being increased in a nucleotide sequence selected from the group consisting of 100% of responders vs. non-responders). In each of these SEQID NO: 87.97, 101, 293, 92,272,93, 107, 108, 121 and embodiments, preferably the instructions for use of the kit 123 (or the biomarkers set forth by name in Table 6 as pre instruct that increased expression of the one or more biomar treatment biomarkers, as described above), wherein the kers is predictive of responsiveness of the subject to a TNFC. instructions instruct that the Subject is monitored prior to inhibitor. 10 treatment with a TNFC. inhibitor. In yet another embodiment In another embodiment of the kit, the one or more biom of the kit, the one or more biomarkers is encoded by a nucleic arkers is encoded by a nucleic acid molecule comprising a acid molecule comprising a nucleotide sequence selected nucleotide sequence selected from the group consisting of from the group consisting of SEQID NO: 290, 209, 98, 112, SEQID NOs: 1-5,8,9, 11-14, 18, 20, 21, 23, 25, 26, 28-30, 116, 121, 130, 155,92, 289, 216 and 131 (or the biomarkers 32, 33, 40-42, 48, 50, 52, 53, 56, 58, 60, 63, 65-69, 71-74, 15 set forth by name in Table 6 as post-treatment biomarkers, as 76-78, 80 and 81 (or the biomarkers set forth by name in Table described above), wherein the instructions instruct that the 9 as being decreased in 280% of responders vs. non-respond subject is monitored after treatment with a TNFC. inhibitor. ers, as described above), more preferably the one or more In yet another embodiment of the kit, the one or more biomarkers is encoded by a nucleic acid molecule comprising biomarkers is encoded by a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 11, 29, 65, 73 and 74 (or the biomarkers set SEQID NO: 97, 102, 29, 294, 295, 91, 131, 290, 100, 134, forth by name in Table 9 as being decreased in 290% of 296,297, 298, 299, 136, 174 and 300 (or the biomarkers set responders vs. non-responders, as described above), and even forth by name in Table 7, as described above). more preferably the one or more biomarkers is encoded by a In a preferred embodiment, the means for measuring nucleic acid molecule comprising the nucleotide sequence of 25 expression in the Subject of the one or more biomarkers SEQ ID NO: 11 or SEQ ID NO: 74 (or the biomarkers set predictive of responsiveness to a TNFC. inhibitor in an forth by name in Table 9 as being decreased in 100% of autoimmune disorder comprises a nucleic acid preparation responders vs. non-responders, as described above). In each sufficient to detect expression of mRNA encoding the one or of these embodiments, preferably the instructions for use of more biomarkers in a sample from the Subject, such as a the kit instruct that decreased expression of the one or more 30 peripheral blood mononuclear cell sample from which biomarkers is predictive of responsiveness of the subject to a mRNA is obtained by standard methods. This nucleic acid TNFO inhibitor. preparation includes at least one, and may include more than In another embodiment of the kit, the one or more biom one, nucleic acid probe or primer, the sequence(s) of which is arkers is encoded by a nucleic acid molecule comprising a designed such that the nucleic acid preparation can detect the nucleotide sequence selected from the group consisting of 35 expression of mRNA encoding the biomarker(s) of interest in SEQ ID NO: 83-133 (or the biomarkers set forth by name in the sample from the Subject. A preferred nucleic acid prepa Table 3, as described above). ration includes two or more PCR primers that allow for PCR In yet another embodiment of the kit, the one or more amplification of a segment of the mRNA encoding the biom biomarkers is encoded by a nucleic acid molecule comprising arker(s) of interest. In a particularly preferred embodiment, a nucleotide sequence selected from the group consisting of 40 the kit comprises a nucleic acid preparation Sufficient to SEQ ID NO: 134-177, 110, 112, 118, 123 and 131 (or the detect expression of CD11c mRNA in a sample from the biomarkers set forth by name in Table 4, as described above), Subject. more preferably SEQ ID NO: 134-150, 112, 118 (or the Alternatively, the means for detecting expression in the biomarkers set forth by name in Table 4 as being upregulated, subject of one or more biomarkers predictive of responsive as described above), wherein the instructions instruct that 45 ness to a TNFC. inhibitor in an autoimmune disorder can expression of the one or more biomarkers is increased in the comprise a reagent that detects the gene product of the mRNA subject, and/or more preferably SEQ ID NO: 151-177, 110 encoding the biomarker(s) of interest Sufficient to distinguish and 123 (or the biomarkers set forth by name in Table 4 as it from other gene products in a sample from the Subject. A being downregulated, as described above), wherein the non-limiting example of Such a reagent is a monoclonal anti instructions instruct that expression of the one or more biom 50 body preparation (comprising one or more monoclonal anti arkers is decreased in the Subject. bodies) sufficient to detect protein expression of the biomar In yet another embodiment of the kit, the one or more ker(s) of interest in a sample from the Subject, such as a biomarkers is encoded by a nucleic acid molecule comprising peripheral blood mononuclear cell sample. In a particularly a nucleotide sequence selected from the group consisting of preferred embodiment, the kit comprises a monoclonal anti SEQID NO: 178-292.91 and 97 (or the biomarkers set forth 55 body preparation sufficient to detect expression of CD11c by name in Table 5, as described above), more preferably protein in a sample from the Subject. SEQID NO:178-185; 187-200,202,203,205-207:211,213, The means for measuring expression of the one or more 214, 216, 220, 221, 226, 228, 229, 231, 232, 234, 235, 238 biomarkers can also include, for example, buffers or other 247, 249, 250, 253, 262-265, 268-282 and 285-288 (or the reagents for use in an assay for evaluating biomarker expres biomarkers set forth by name in Table 5 as being upregulated, 60 sion (e.g., at either the mRNA or protein level). The instruc as described above), wherein the instructions instruct that tions can be, for example, printed instructions for performing expression of the one or more biomarkers is increased in the the assay for evaluating the expression of the one or more subject, and/or more preferably SEQID NO: 186, 201, 204, biomarkers. 208,209, 91,210, 212,97, 215, 217-219, 222-225, 227, 230, In a preferred embodiment, the means for measuring 233,236,237,248,251,252,254-261,266,267,283,284 and 65 expression of at least one housekeeping gene comprises a 289-292 (or the biomarkers set forth by name in Table 5 as nucleic acid preparation Sufficient to detect expression of being downregulated, as described above), wherein the mRNA of the housekeeping gene (e.g., GAPDH) in a sample US 8,092,998 B2 39 40 from the Subject, Such as a peripheral blood mononuclear cell of the subject and the identifier of the subject. A user can enter sample from which mRNA is obtained by standard methods. the Subject's biomarker expression pattern, and optionally the This nucleic acid preparation includes at least one, and may Subject's treatment regimen(s), into the computer system. include more than one, nucleic acid probe or primer, the Alternatively, the Subject's biomarker expression pattern can sequence(s) of which is designed Such that the nucleic acid be received directly from equipment used in determining the preparation can detect the expression of mRNA of the house expression of one or more biomarkers in a sample from the keeping gene(s) in the sample from the Subject. A preferred Subject. nucleic acid preparation includes two or more PCR primers In another aspect, the invention provides a computer pro that allow for PCR amplification of a segment of the mRNA gram product useful for building a database for use in select of the housekeeping gene(s). Alternatively, the means for 10 detecting expression in the Subject of at least one housekeep ing or monitoring an autoimmune disorder Subject for treat ing gene can comprise a reagent that detects the gene product ment with a TNFC. inhibitor. The computer program can of housekeeping gene Sufficient to distinguish it from other contain executable instructions that when executed cause a gene products in a sample from the Subject. A non-limiting processor to perform operations comprising: receiving, in a example of such a reagent is a monoclonal antibody prepara 15 computer system, a biomarker expression pattern of a subject tion (comprising one or more monoclonal antibodies) suffi at one or more biomarkers predictive of responsiveness to a cient to detect protein expression of housekeeping gene prod TNFC. inhibitor in an autoimmune disorder; and storing the uct in a sample from the Subject, Such as a peripheral blood biomarker expression pattern Such that the biomarker expres mononuclear cell sample. sion pattern is associated with an identifier of the Subject, The means for isolating monocytes can comprise one or wherein the biomarker expression pattern reports expression more reagents that can be used to separate monocytes from in the subject of one or more biomarkers encoded by a nucleic other cell types in a sample of peripheral blood mononuclear acid molecule comprising a nucleotide sequence selected cells, for example by positive selection of the monocytes or from the group consisting of SEQID NO: 1-82 (or the biom by negative selection in which all other cell types other than arkers set forth by name in Table 9, as described above). monocytes are removed. In one embodiment, a reagent that 25 Optionally, the computer program can further cause the pro binds CD14 on monocytes (e.g., an anti-CD14 antibody) is cessor to perform an operation comprising: receiving, in the included in the kit as means to isolate monocytes via positive computer system, a treatment regimen for treatment of an selection. Alternatively, in another embodiment, reagents autoimmune disorder in the Subject such that the treatment such as those commercially available in the Monocyte Isola regimen is associated with the biomarker expression pattern tion Kit II (Miltenyi Biotec, Auburn, Calif.) can be used for 30 of the subject and the identifier of the subject. negative selection, in which non-monocytes (T cells, B cells, In another aspect, the invention provides a method of NK cells, dendritic cells, basophils) are indirectly magneti selecting an autoimmune disorder subject for a treatment with cally labeled using a cocktail of biotin-conjugated antibodies a TNFC. inhibitor. The method can comprise: (i) identifying, against CD3, CD7, CD16, CD19, CD56, CD123 and CD235a in a database comprising a plurality of autoimmune disorder (Glycophorin A), as well as anti-biotin MicroBeads, and then 35 Subjects, a Subject whose database entry is associated with a highly pure unlabeled monocytes are obtained by depletion of biomarker expression pattern that is predictive of responsive the magnetically labeled cells. ness to treatment with a TNFC. inhibitor, and (ii) selecting the In another embodiment, the kit can further comprise a subject for treatment with a TNFC. inhibitor, wherein the TNFC. inhibitor for treating an autoimmune disorder in the biomarker expression pattern reports expression in the Sub subject. Preferred TNFC. inhibitors for use in the kit include 40 ject of one or more biomarkers encoded by a nucleic acid the TNFC. inhibitors described in detail above with respect to molecule comprising a nucleotide sequence selected from the treatment regimens, in particular anti-TNFC. antibodies Such group consisting of SEQID NO: 1-82 (or the biomarkers set as adalimumab, infliximab and/or golimumab, and/or Ig forth by name in Table 9, as described above). The method can fusion proteins such as etanercept. further comprise selecting a treatment regimen by identify Preferably, the kit is designed for use with a human subject. 45 ing, in the database, a treatment regimen that has been asso Databases and Computer Programs ciated with the biomarker expression pattern of the subject In another aspect, the invention pertains to methods of and with an identifier of the subject. building a database for use in selecting an autoimmune dis In yet another aspect, the invention provides a computer order subject for treatment with a TNFC. inhibitor, or for use program product useful for identifying and/or selecting a in selecting or monitoring a treatment regimen in an autoim 50 subject for treatment with a TNFC. inhibitor. The computer mune disorder Subject. The method can comprise receiving, program can contain executable instructions that when in a computer system, biomarker expression patterns from a executed cause a processor to perform operations compris plurality of Subjects having an autoimmune disorder, and ing: (i) identifying, in a database including a plurality of storing the biomarker expression pattern from each subject autoimmune disorder Subjects associated with biomarker Such that the biomarker expression pattern is associated with 55 expression patterns, a Subject that is associated with a biom an identifier of the subject, wherein the biomarker expression arker expression pattern that is predictive of responsiveness to pattern reports expression in the Subject of one or more biom treatment with a TNFC. inhibitor; and (ii) outputting the iden arkers encoded by a nucleic acid molecule comprising a tified subject as a subject to be treated with a TNFC. inhibitor; nucleotide sequence selected from the group consisting of wherein the biomarker expression pattern reports expression SEQ ID NO: 1-82 (or the biomarkers set forth by name in 60 in the subject of one or more biomarkers encoded by a nucleic Table 9, as described above). The identifier of the subject can acid molecule comprising a nucleotide sequence selected be, for example, the name of the Subject or a numerical or from the group consisting of SEQID NO: 1-82 (or the biom symbolic identifier coded to the identity of the subject. The arkers set forth by name in Table 9, as described above). The method can further comprise receiving, in the computer sys computer program can further cause the processor to perform tem, one or more treatment regimens for treatment of an 65 an operation comprising outputting a treatment regimen that autoimmune disorder in a subject Such that the treatment is associated with the subject to be treated with the TNFC. regimen is associated with the biomarker expression pattern inhibitor. US 8,092,998 B2 41 42 In one embodiment of the above-described methods and above), more preferably SEQID NO:178-185; 187-200,202, computer program, the one or more biomarkers is encoded by 203, 205-207: 211, 213, 214, 216, 220, 221, 226, 228, 229, a nucleic acid molecule comprising a nucleotide sequence 231, 232, 234, 235, 238-247, 249, 250, 253, 262-265, 268 selected from the group consisting of SEQID NOS: 6, 7, 10. 282 and 285-288 (or the biomarkers set forth by name in Table 15-17, 19, 22, 24, 27, 31, 34-39, 43-47,49,51,54, 55, 57, 59, 5 as having increased expression, as described above), 61, 62, 64, 70, 75, 79 and 82 (or the biomarkers set forth by wherein expression of the one or more biomarkers is name in Table 9 as being increased in 280% of responders vs. increased in the subject, and/or more preferably SEQID NO: non-responders, as described above), more preferably the one 186, 201, 204, 208, 209, 91, 210, 212, 97, 215, 217-219, or more biomarkers is encoded by a nucleic acid molecule 222-225, 227, 230, 233, 236, 237, 248, 251, 252, 254-261, comprising a nucleotide sequence selected from the group 10 266, 267, 283, 284 and 289-292 (or the biomarkers set forth consisting of SEQID NOs: 31, 37, 44, 47, 62 and 70 (or the by name in Table 5 as having decreased expression, as biomarkers set forth by name in Table 9 as being increased in described above), wherein expression of the one or more 2.90% of responders vs. non-responders, as described biomarkers is decreased in the Subject. above), and even more preferably at least one of the biomar In yet another embodiment of the above-described meth kers is encoded by a nucleic acid molecule comprising the 15 ods and/or computer programs, the biomarker expression nucleotide sequence of SEQ ID NO: 44 (or the biomarker, pattern(s) can be for one or more biomarkers selected from CD11c antigen, set forth by name in Table 9 as being the group consisting of SEQIDNO: 87.97, 101,293, 92,272, increased in 100% of responders vs. non-responders, as 93, 107, 108, 121 and 123 (or the biomarkers set forth by described above). In each of these embodiments, increased name in Table 6 as pre-treatment biomarkers, as described expression of the one or more biomarkers is predictive of above), wherein the subject is monitored prior to treatment responsiveness of the subject to a TNFC. inhibitor. with a TNFC. inhibitor. In yet another embodiment of the In another embodiment of the above-described methods above-described methods and/or computer programs, the and computer programs, the one or more biomarkers is biomarker expression pattern(s) can be for one or more biom encoded by a nucleic acid molecule comprising a nucleotide arkers selected from the group consisting of SEQIDNO: 290, sequence selected from the group consisting of SEQID NOs: 25 209,98, 112, 116, 121, 130, 155,92,289,216 and 131 (or the 1-5,8,9, 11-14, 18, 20, 21, 23, 25, 26, 28-30, 32, 33, 40-42, biomarkers set forth by name in Table 6 as post-treatment 48, 50, 52,53,56,58, 60, 63, 65-69, 71-74, 76-78, 80 and 81 biomarkers, as described above), wherein the subject is moni (or the biomarkers set forth by name in Table 9 as being tored after treatment with a TNFC. inhibitor. decreased in 280% of responders vs. non-responders, as In yet another embodiment of the above-described meth described above), more preferably the one or more biomark 30 ods and/or computer programs, the biomarker expression ers is encoded by a nucleic acid molecule comprising a nucle pattern(s) can be for one or more biomarkers selected from otide sequence selected from the group consisting of SEQID the group consisting of SEQIDNO: 97,102,29,294,295,91, NOs: 11, 29, 65, 73 and 74 (or the biomarkers set forth by 131,290, 100, 134,296,297,298,299, 136, 174 and 300 (or name in Table 9 as being decreased in 290% of responders the biomarkers set forth by name in Table 7, as described vs. non-responders, as described above), and even more pref 35 above). erably the one or more biomarkers is encoded by a nucleic Computer systems and database software well established acid molecule comprising the nucleotide sequence of SEQID in the art can be adapted for use in the methods and computer NO: 11 or SEQ ID NO: 74 (or the biomarkers set forth by program products of the invention for building and searching name in Table 9 as being decreased in 100% of responders vs. a database for use in selecting or monitoring a treatment non-responders, as described above). In each of these 40 regimen for a Subject having an autoimmune disorder or for embodiments, decreased expression of the one or more biom selecting a particular autoimmune disorder Subject for treat arkers is predictive of responsiveness of the subject to a TNFC. ment with a TNFO inhibitor. inhibitor. The present invention is further illustrated by the following In another embodiment of the above-described methods examples which should not be construed as further limiting. and/or computer programs, the biomarker expression 45 The contents of all references, patents and published patent pattern(s) can be for one or more biomarkers selected from applications cited throughout this application are expressly the group consisting of SEQID NO: 83-133 (or the biomar incorporated herein by reference in their entirety. kers set forth by name in Table 3, as described above). In yet another embodiment of the above-described meth EXAMPLES ods and/or computer programs, the biomarker expression 50 pattern(s) can be for one or more biomarkers selected from Example 1 the group consisting of SEQID NO: 134-177, 110, 112, 118, 123 and 131 (or the biomarkers set forth by name in Table 4, Materials and Methodologies as described above), more preferably SEQID NO: 134-150, 112, 118 (or the biomarkers set forth by name in Table 4 as 55 In this example, the materials and methodologies used in having increased expression, as described above), wherein the Subsequent Examples are described. expression of the one or more biomarkers is increased in the Patients subject, and/or more preferably SEQ ID NO: 151-177, 110 Purified monocytes (MO) derived from a total of 84 RA and 123 (or the biomarkers set forth by name in Table 4 as patients were used. The clinical data for the RA patients, pre having decreased expression, as described above), wherein 60 and post-anti-TNFC. treatment, is summarized in Table 1. All expression of the one or more biomarkers is decreased in the patients fulfilled the revised American College of Rheuma Subject. tology (ACR) criteria (Arnett, F. C. et al. (1988) Arthritis In yet another embodiment of the above-described meth Rheum. 31:315-324). Patients were defined as responders ods and/or computer programs, the biomarker expression (2continuous ACR score 40) or non-responders (scontinu pattern(s) can be for one or more biomarkers selected from 65 ous ACR score 30) to anti-TNFC. monotherapy, MTX mono the group consisting of SEQID NO: 178–292, 91 and 97 (or therapy or combination therapy. In order to account for a the biomarkers set forth by name in Table 5, as described gradual transition from clinical responders to non-responders US 8,092,998 B2 43 44 to therapy, a continuous ACR response evaluation was per Bioinformatic Analysis of Differentially Expressed Genes in formed by applying the ACR criteria, but by defining 10% ND and RA Patients Pre- and Post Anti-TNFC. Treatment response steps instead of the usual 20, 50, and 70% steps. This All GeneChips were analyzed for signal calculation and was also done to allow more detailed analyses of the correla pairwise comparisons using the GCOS1.4 software package tion between the ACR response and the mRNA expression with standard settings provided by Affymetrix R. Scaling was levels of the predictive marker CD11c. performed to a target value of 150 and normalization was set For Affymetrix(R) microarray analysis, MO samples from 7 to “1”. Pairwise comparison data were grouped to generate a RA patients (RA1-RA7; all females) undergoing the Abbott percentage level of increased and decreased comparisons. DE011 trial were used (ReACT; monoclonal antibody Adali Fold-changes were calculated from the mean of the SLR 10 values in pairwise comparisons. Filtering was performed on mumab(R). In this multicenter, double-blinded study patients the basis of “increased/decreased comparisons with a per received Adalimumab(R) (20 mg weekly or 40 mg biweekly) centage cutoff as indicated in the results. For hierarchical in the outpatient Rheumatology Clinic of the Charité Univer clustering, the software tool “Gene Expression Similarity sity Hospital in Berlin, Germany, for a total of 2 years. Non Investigation Suite' (Genesis: Sturn, A. et al. (2002) Bioin steroidal anti-inflammatory drugs and 10 mg prednisolone 15 formatics 18:207-208: http://genome.tugraz.at/Software/ equivalent per week were allowed in addition to the anti Genesis Center.html) was applied using normalized signal TNFC. therapy. For TaqMan(R) real-time PCR, 26 patients intensities, Pearson distance correlation, and complete link (RA8-RA84 from the Abbott DE013 trial were used (AT age clustering. Prediction analysis was performed using the TRACT). In this study Adalimumab(R), methotrexate (MTX; PAM software (http://www.bioconductor.org; Khan, J. et al. 10-20 mg/week) or a combination of both therapeutics was (2001) Nat. Med. 7:673-679). applied. Data Sets of Publication The mean time interval between the two MO samples The complete ASCI-file datasets have been deposited in the (blood sampling before and during therapy) was 9.4+1.8 microarray GEO database (http://www.ncbi.nlm.nih.gov/ months (meantSEM, range 4-13.5 months), the mean age geo/). 50.3+3.9 years (range 39-70), and the mean disease duration 25 Taq Man(R) RealTime PCR 18.6+5.3 years (range 4-38). As controls, healthy individuals Real-time PCR(RT-PC) was performed using a TaqMan(R) were recruited (n=7; 6 females, 1 male; mean age 36.1+7.4 7500 system and pre-designed TaqMan(R) low density gene years). RA patients RA1-RA84 were recruited from the expression primers (Applied Biosystems; Foster City, Calif., Rheumatology Clinic of the Charité University Clinic, the USA) or, in the case of CD11c, the primer Hs01015072 g1 30 (commercially available from Applied Biosystems) in a Bio Rheumaklinik of the Charité in Berlin-Buch, and from the Radio RealTime PCR system (Icycler; Bio-Rad; München, Schlossparklinik in Berlin. Germany). The housekeeping gene GAPDH was used for Separation of Peripheral Blood Mononuclear Cells, Purifica normalization of the cDNA content. Quantification was per tion of Monocytes, RNA. Isolation formed using the SDS 2.2.0 software (Applied Biosystems); Peripheral blood (30 to 35 ml) was obtained by venopunc 35 results were expressed as relative quantities of the logarithm ture, immediately stored in heparin-containing vacutainers of the AAACT values (logRQ), as the relative quantity of (Beckton-Dickinson, Rutherford, N.J., USA), and cooled to expression (RQ; fold-change in comparison to normal donor 4° C. Blood samples were subjected to a Ficoll-Hypaque expression), or as the '% expression as normalized to GAPDH. gradient (d=1.077 g/ml. Biochrom, Berlin, Germany). To Literature-Associated Pathway Analysis. Using Ingenuity enrich MO, negative selection magnetic cell sorting (MACS: 40 Gene ontology and gene interaction analyses were Miltenyi; Bergisch Gladbach, Germany) was subsequently executed using the Ingenuity(R) Pathway analysis tool v. 4.0 applied. Successful purification of MO (purity of 83-90%; (Ingenuity, Redwood City, Calif., USA; Jenssen, T. K. et al. 1.3-3.2x10 MO/patient) was validated by FACS analysis (2001) Nat. Genet. 28:21-28: http://www.ingenuity.com). using CD14 and CD45 antibodies (Beckman-Coulter, Highest scoring neighborhood analysis of literature-based Krefeld, Germany). In all cases, purified MO showed >98% 45 gene connections was performed by comparing up- and Vitality using propidiumiodide staining (Pharmingen, San downregulated genes in anti-TNFC. responders and non-re Diego, Calif., USA). MO preparation was performed at 4°C. sponders (pre- and post-treatment). Significantly regulated After purification, MO were lysed in RLT lysis buffer and genes in both comparisons were merged from the networks 1 total RNA was isolated using the RNeasy mini elute kit (Qui to 5, complemented by transcription factors and finally over agen, Düsseldorf, Germany; yield 1.5-3.2 g/sample). Quan 50 layed with their relative expression values. tification and quality control of RNA was performed at 260/ Expression-Based Pathway Analysis Using Kyoto Encyclo 280 nm using a Bioanalyzer 2100 unit (Agilent, Palo Alto, pedia of Genes and Genomes (KEGG) Calif., USA). The KEGG pathway analysis (Kanehisa, M. and Bork, P. RNA Amplification and Labeling (2003) Nat. Genet. 33:305-310) was performed using For target synthesis, 500 ng of total RNA were amplified 55 selected genes from the comparison of microarray data in using the standard protocol of the manufacturer (Affyme responders and non-responders either pre- or post-treatment trix R, Palo Alto, Calif., USA) and the Megascript kit (Am with anti-TNFC. Upregulated genes and downregulated bion, (Cambridgeshire, UK). genes within the illustrated pathways were color-coded in a Biotin-Labeling of cFNA and Gene-Chip Hybridization gradient fashion (SLR 0.5 to 21.5). A total of 4 pathways out Biotinylated cRNA target was generated from amplified 60 of the 8 most highly ranked pathways were selected for illus cRNAs using the Bioarray high-yield transcription kit (Enzo, tration. New York, N.Y., USA). Samples were hybridized to Affyme Statistical Analysis trix R test and HG-U133A GeneChip arrays. The non-parametric Mann-Whitney U test was applied to Following washing and staining, arrays were scanned analyze differences between data from RA patients and nor twice at 3 um resolution using a confocal scanner with an 65 mal donors, from untreated and anti-TNFO-treated RA argon laser instrument (Agilent(R) G2500A GeneArray Scan patients, and from responders and non-responders to anti ner; Agilent, Calif., USA). TNFC.-therapy. Correlation analyses between experimental US 8,092,998 B2 45 46 and clinical/laboratory parameters of the patients were per i.e., the highest similarity among individuals), followed by formed using the Pearson test and the software SPSS 13.0TM pre-treatment RA patients (0.14), and anti-TNFO-treated RA (SPSS Inc., Chicago, Ill., USA). For the U test, statistically patients (0.42). significant differences were accepted for Ps0.05; for corre Identification of responderS/non-responders was also con lation analyses, the acceptance level was reduced to Ps().01 firmed by hierarchical clustering of RA patients post-treat to account for multiple comparisons. ment. A total of 117 genes differentially expressed in RA responders versus RA non-responders was identified in post Example 2 anti-TNFC. therapy samples, which showed an increase or decrease in 100% of the respective pair-wise comparisons Clinical and Laboratory Assessments for R A Patients 10 (total of 10 comparisons). The 117 genes identified in this and Normal Donors analysis are Summarized in Table 5, three of which genes overlap with the genes summarized in Table 3. Hierarchical Two of the seven anti-TNFC.-treated RA patients used for clustering with these genes resulted in precise (100%) clas microarray analysis, i.e., patients RA4 and RA6, were non sification of responders and non-responders to therapy. 15 A number of the differentially-expressed genes showed responders to therapy according to the ACR improvement highly significant correlations with clinical or laboratory criteria (scontinuous ACR 30 score). In general, this was parameters pre- and/or post-anti-TNFC. treatment, indicating also reflected in the respective percent-reduction of other a potential clinical relevance of the genes and contributing to clinical parameters of local or systemic inflammation. The the selection of genes for validation with TaqMan(R) real-time group of seven RA patients employed for microarray analysis RT-PCR. These genes are summarized in Table 6. in the present study constituted a representative RA cohort, as demonstrated by well-known correlations among clinical Example 4 parameters pre- and post-anti-TNFC. treatment, as Summa rized in Table 2. Real-Time RT-PCR Validation of Genes The identification of patients RA4 and RA6 as non-re 25 Differentiating Responders and Non-Responders sponders was also confirmed by hierarchical clustering of clinical parameters. Sixteen genes with a likely pathogenetic importance in RA (and 6 control genes) from AffymetriX(R) gene expression Example 3 profiling were selected for validation by TaqMan(R) real-time 30 RT-PCR (n=10 anti-TNFo-treated RA patients prior to Gene Expression Profiling and therapy; n=14ND). The RT-PCR results confirmed the results Analysis—Differential Gene Expression in of Affymetrix R gene expression profiling for 17 of 22 genes Responders Versus Non-Responders to (approx. 77%), Summarized in Table 7. This applied to genes Anti-TNFC.-Therapy regarded as differentially expressed in RA versus ND by 35 Affymetrix R analysis (decreased: <-70%; increased: >70%) and to equally expressed control genes. By real-time RT A total of 119 differentially-expressed genes was identified PCR, 18 genes showed significantly differential expression by comparing RA and normal donors (ND; n=7 each; total of (ps0.000 for 7 genes; ps0.041 for the remaining) in MO 49 comparisons). Hierarchical clustering of ND, as well as from RA patients responding to anti-TNFC. therapy versus RA patients pre- and post-treatment with these genes also 40 ND, including genes 10 upregulated in RA (Amphiregulin, identified 5 responders and 2 non-responders (RAantiTNF4 Charcot-Leyden crystal protein, TNFC-induced protein 6, and RAantiTNF6). thrombomodulin, membrane-spanning 4-domains, Subfam In order to select therapeutically relevant genes, a subpopu ily A member 4, S100 calcium binding protein A1, TNFC. lation of 51 differentially-expressed genes was then identified IL-1B, lipoyltransferase 1, and interferon regulatory protein by the simultaneous comparison between RA Versus normal 45 1), as well as 8 genes downregulated in RA (Uncharacterized donors (ND; total of 49 comparisons) and RA responders hypothalamus protein HTO07, MHC class II HLA-DR-alpha, (n=5) pre- versus post-anti-TNFC. therapy (25 comparisons). hypothetical protein LOC54103, proteasome subunit beta These genes showed an increase or decrease of the signal log type 7 precursor, protein KIAA0174, microsomal signal pep ratio (SLR; between -4.36 and 4.61) in >70% of the pair-wise tidase 18 kDa subunit, ring Zinc finger protein 361, and pro comparisons between RA and ND. These genes are Summa 50 tein phosphatase 1, catalytic subunit, beta isoform). However, rized in Table 3. the expression for these genes showed no significant differ Hierarchical clustering with these genes resulted in precise ences for the direct comparison between RA responders and (100%) classification of ND, RA patients pre-treatment, and non-responders to anti-TNFC. therapy. clinically-defined responders (2 continuous ACR score 40; The potential clinical relevance of some of the differen clustered as ND) or non-responders (scontinuous ACR score 55 tially expressed genes is underlined by a significant correla 30; clustered as RA; note RAantiTNF4 and RAantiTNF6). tion with the ACR response at different time points during This was confirmed by Supervised pattern discovery using anti-TNFC. therapy, as summarized in Table 8. prediction analysis of microarrays (PAM analysis)ata thresh Validation of the 22 selected genes by TaqMan(R) real-time old value of 4.3 in order to minimize the misclassification RT-PCR confirmed the results of Affymetrix R gene expres error. Table 4 summarizes the results of the PAM analysis, 60 sion profiling for 17 of 22 genes (approx. 77% true positives showing 49 selected genes, five of them overlapping with or negatives), in accordance with the rates reported in other genes listed in Table 3. In this case, both non-responders gene expression studies and therefore underlining the validity (RAantiTNF4 and RAantiTNF6) were classified as RA of the present data. The 18 genes showing significantly dif patients, whereas the responders, RAantiTNF1-3, RAan ferential expression in MO from RA patients responding to tiTNF5, and RAantiTNF7, were classified either as normals 65 anti-TNFC. therapy versus ND included several genes with a or as anti-TNFC.-treated RA patients. Notably, ND showed likely pathogenetic importance in RA (e.g., amphiregulin, the lowest misclassification error at the threshold value (0.00: TNFC.-induced protein 6, thrombomodulin, membrane-span US 8,092,998 B2 47 48 ning 4-domains, subfamily A—member 4, S100 calcium to a differential importance of the CD11c mRNA expression binding protein A1, TNFO, IL-1B, lipoyltransferase 1, inter for the anti-TNFC. and MTX components. feron regulatory protein 1, MHC class II HLA-DR-alpha). Of the 3 genes identified by pairwise comparison between RA responders and RA non-responders prior to treatment at Example 5 the level of 100% (and confirmed by TaqMan(R) real-time RT-PCR), the antigen CD11c appears of particular interest, Gene Expression Profiling and since it is expressed on the surface of human MO (and other Analysis—Differential Gene Expression in cells of the myelomonocytic lineage, e.g. dendritic cells), and Responders versus Non-Responders Prior to since it has known functions in inflammatory reactions (e.g., Anti-TNFC.-Therapy (Predictive Genes) 10 as the complement receptor 4) and cell adhesion. Using a threshold of 280% for the pairwise comparisons The validity of CD11c as a predictive biomarker is further between future RA responders and future RA non-responders underlined by a significant correlation (r=0.651, P=<0.0001, prior to anti-TNFC. therapy, a total of 82 predictive genes was n=27) between the CD11c expression prior to therapy and the identified (11 genes for a threshold of 290%; 3 genes for 15 future percentage of the ACR response, illustrated in the 100%). These genes are summarized in Table 9. The latter graph of FIG. 2. group (100%) consisted of 2 known proteins (Homo sapiens Except for 1 RA patient with a borderline ACR response of predicted osteoblast protein (GS3786): integrin alpha-X (an 30 and a CD11c mRNA level directly at the distinction thresh tigen CD11c) and an unknown protein (Homo sapiens hypo old (who was therefore classified as a false negative), the thetical protein FLJ10134). In particular the antigen CD11c threshold level (40%) almost fully distinguished future appears highly interesting, since it is a surface molecule on responders from nonresponders (100% specificity, 94% sen human MO (and other cells of the myelomonocytic lineage), sitivity, and 96% power). This clear separation was lost in the and since it has known inflammatory functions. Hierarchical case of combination therapy with anti-TNF/methotrexate clustering with the selected genes resulted again in precise (MTX), possibly owing to a differential importance of the (100%) predictive classification of future responders and 25 CD11c mRNA expression for the anti-TNF and MTX treat non-responders to therapy. Marginal co-clustering of the ment components. This was further underlined by the fact patient RA5 with the non-responders RA4 and RA6 at the that: i) future responders to MTX monotherapy did not sig threshold values 80% and 100% possibly identified RA5 as a nificantly differ in their CD11c mRNA expression level from weak responder, as also indicated by a marginal position in future nonresponders to MTX monotherapy; and ii) there was the hierarchical clustering of clinical parameters. 30 no significant correlation between the future ACR response of Interestingly, future responders to anti-TNFC.-therapy RApatients treated with MTX monotherapy and their CD11c (when directly compared to non-responders) showed a pat mRNA expression (data not shown). tern shift from the recently described inflammatory MO to Strikingly, this was true not only for the continuous ACR resident MO subsets (Gordon, S. etal. (2005) Nat. Immunol. score, but also for the clinically applied, discrete ACR crite 5:953-963) both prior to therapy and post-treatment. 35 18. Although most of the individual molecules showed an iden A significant correlation (r–0.656, P=<0.0001, n=27) was tical pattern shift in both pre-treatment and post-treatment observed between CD11c expression and the future percent comparisons, in particular the activating (CD16a,b) and age of strict ACR response, illustrated in the graph in FIG. 3. inhibiting Fcy-receptors (CD32) displayed an opposite This finding complements and expands previous reports on behavior. This pattern shift was observed despite the fact that 40 the identification of molecules capable of predicting a future all pre-treatment or post-treatment comparisons between RA response to anti-TNFC. therapy (Lequerre, T. et al. (2006) patients (all, future responders, future non-responders) and Arthritis Res. Ther. 8:R105: Toh, M. L. et al. (2006) Arthritis ND indicated a dominance of inflammatory MO in the Rheum. 54:2109-2118). respective RA groups. Post-treatment, strikingly, responders to anti-TNFC.-therapy became barely distinguishable from 45 Example 7 ND in contrast to non-responders, which still showed a clear inflammatory predominance. These results indicate that Ingenuity(R) Pathway Analysis successful anti-TNFC.-therapy acts by blocking TNFO signal ing via TNFC.-receptors 1 and 2 and by Subsequent induction Ingenuity(R) pathway analysis of the genes in Tables 3 and of a major change in the composition of pro-inflammatory 50 5 indicated a director indirect influence of anti-TNFC. therapy and other MO subsets. on several molecules thought to be relevant for the pathogen esis and/or severity of RA, e.g., HLA-DMA/B (Morel, J. et al. Example 6 (2004) Ann. Rheum. Dis. 63:1581-1586), CD69 (Marzio, R. et al. (1999) Immunopharmacol. Immunotoxicol. 2:565-582) Real-Time RT-PCR Validation of Predictive CD11c 55 thrombomodulin (Cobankara, V. et al. (2004) Clin. Rheuma tol. 23:430-434), membrane-spanning 4-domains, Subfamily TaqMan(R) real-time RT-PCR confirmed the discrimination A member 4 (Fujikado, N. et al. (2006) Arthritis Res. Ther. of future RA responders (n=15) from future nonresponders 8:1-13), and forkhead box O3a (Jonsson, H. et al. (2005) Nat. (n=12) to anti-TNF monotherapy (at the level of continuous Med. 11:666-671). The present approach, therefore, repre ACR score s30) on the basis of their CD11c mRNA expres 60 sents a powerful tool to identify gene regulation patterns sion in monocytes. applicable for diagnosis, as well as for therapy stratification TaqMan(R) real-time RT-PCR confirmed the separation of and monitoring in rheumatic diseases, in particular in view of future RA responders in 55 from future non-responders n=12 the fact that blood MO are much more easily available than to anti-TNFC. monotherapy on the basis of their CD11c synovial tissue samples. This is further supported by the fact mRNA expression in MO. The results are summarized in the 65 that a high number of individual genes show significant cor bar graph of FIG.1. This clear separation was lost in the case relations with clinical parameters in RA patients pre- and/or of combination therapy with anti-TNFC/MTX, possibly due post-anti-TNFC. treatment (see Table 6). US 8,092,998 B2 49 50 Pairwise comparison between RA responders and RA non nuclear factor NF-KB 1 NFKB1; for the remaining abbre responders prior to treatment yielded a number of genes Suit viations see the respective gene cards http://www.genecard able for the prediction of a future response to anti-TNFC. s.org/index.shtml). These molecules were differentially therapy (82 genes for a threshold of 280%; 11 genes for expressed between RA responders and RA non-responders either pre-treatment or post-treatment and in Some cases even 2.90%; 3 genes for 100%; summarized in Table 9), resulting inverted their expression upon anti-TNFC.-therapy (see inter in exact classification of future responders and non-respond leukin-8 receptor beta IL8RBI, Amyloid-beta A4 precursor ers upon hierarchical clustering. Using all genes differentially APP; overexpressed in RA responders pre-treatment and expressed in the above comparison at a threshold level of 70% underexpressed post-treatment). Similar opposite variations (256 pre-treatment; 1295 post-treatment) for Ingenuity(R) in transcript levels between RA responders and RA non pathway analysis, the differences between responders and 10 responders have recently been reported when comparing non-responders either pre-treatment or post-treatment were baseline to 3-month results (Lequerre, T. et al. (2006) Arthri concentrated in the functional gene ontology terms cellular tis Res. Ther. 8:R105). movement, haematological system development, immune Most strikingly, the transcription of TNFC. itself, as well response, cell-to-cell signaling and interaction, as well as 15 the transcription of members of the subsequent NFKB-path immunological disease. way (NFKB1 and inhibitor of NF-KBIKBKBI), was upregu In particular, numerous relevant mediators were identified: lated in RA responders post-treatment. This previously unre i) pro-inflammatory cytokines (e.g., interleukin-8 IL8. ported finding at first sight questions the central pro chemokine (C-C motif) ligand 5 ICCL5), chemokine (C-X-C inflammatory role of TNFC. in RA. However, several caveats motif) ligand 5 CXCL5, and chemokine (C-X-C motif) should be considered: i) The mRNA expression levels of ligand 10 ICXCL 10); ii) pro-destructive enzymes (e.g., TNFC. measured in the present study may not be proportional matrix metalloproteinase 9 MMP9); iii) adhesion mol to the levels of circulating TNFC. protein and/or bioactivity, ecules and Fcy-receptors (galectin-8 LGALS8. integrin the latter apparently predictive of the clinical response to alpha-X ITGAX) or CD11c, Fc-gamma receptor IIb TNFC. inhibition (Marotte, H. etal. (2005) Arthritis Res. Ther. FCGR2B or CD32, CD86 CD86 and platelet/endothelial 25 7:R149-155); ii) TNFC, in addition to its well-established cell adhesion molecule 1 PECAM1 or CD31); iv) signal pro-inflammatory properties, may also exhibit phase-depen transduction molecules (e.g., protein kinase BAKT1, apo dent immunosuppressive properties (Kassiotis, G. et al. ptosis regulator Bcl-2 BCL2, p21-activated protein kinase 1 (2001).J. Exp. Med. 193:427-434). PAK1); and v) transcription factors (e.g., Mad-related pro Several interesting pathways with potential importance for tein 2 SMAD2, interferon regulatory factor 1 IRF1, c-myb 30 the mechanisms underlying susceptibility to anti-TNFC.- MYB), early growth response protein 1 EGR1, signal therapy were identified by KEGG pathway analysis; includ transducer and activator of transcription 1 STAT1, and ing Apotosis and the MAPK pathways.

US 8,092,998 B2 59 60 TABLE 2 TABLE 2-continued Correlations among clinical parameters (Pearson correlation test; Correlations among clinical parameters (Pearson correlation test; pre- and post-anti-TNFC treatment pre- and post-anti-TNFC treatment r-value p-value 5 r-value p-value Morning stiffness Swollen joint count 28 O.718 O.004 DAS 28/Swollen joint count 68 O.878 O.OOO Morning stiffness Swollen joint count 68 O664 O.O10 DAS 28, Painful joint count 28 O660 O.O10 Swollen joint count 28/Swollen joint count 68 O.990 O.OOO VAS (physician)/Swollen joint count 68 O.672 O.OO8 Painful joint count 28/Painful joint count 68 O.794 O.OO1 VAS (physician)/Painful joint count 28 O.697 O.OO6 ESRCRP O.854 O.OOO 10 VAS (physician)/DAS 28 O.790 O.OO1 ESR/VAS (physician) O.764 O.OO1 ESRiDAS 28 O.813 O.OOO Different clinical parameters showed correlations in RA patients pre- and post anti-TNFo CRP/Morning stiffness 0.733 O.OO3 treatmentESR = erythrocyte (n = 14 in sedimentation all cases), rate; CRPSwollen joint count 28 O.762 O.OO2 CRP = C-reactive protein; CRPSwollen joint count 68 O.728 O.OO3 DAS 28 = disease activity score (28 joints); and CRPDAS 28 O.786 O.OO1 15 VAS (physician) = visual analogue score (physican's global assessment) DAS 28/Swollen joint count 28 O891 O.OOO

US 8,092,998 B2 65 66 TABLE 4 Genes differentially regulated in peripheral blood monocytes of both RA patients versus normal donors and RA patients pre- versus post-anti-TNFC therapy (PAM analysis Affymetrix ID Gene title RA score 221622 s a Uncharacterized hypothalamus protein HT007 O.74OS 218845 a. Dual specificity phosphatase 22 O6694 200786 a Proteasome (prosome, macropain) subunit, beta type, 7 0.5297 219607 s a Membrane-spanning 4-domains, subfamily A, member 4 O4449 212886 a DKFZP434C171 protein O.2690 201407 s a Protein phosphatase 1, catalytic subunit, beta isoform O.2653 212266 s a Splicing factor, arginine?serine-rich 5 0.1771 53912 at Sorting nexin 11 0.1277 200090 a Farnesyltransferase, CAAXbox, alpha O.1167 218025 s a Peroxisomal D3.D2-enoyl-CoA isomerase O.1032 204232 a Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide O.O993 201722 s a UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 O.0942 218627 a Hypothetical protein FLJ11259 O.O841 210027 s a APEX nuclease (multifunctional DNA repair enzyme) 1 O.O817 202322 s a Geranylgeranyl diphosphate synthase 1 O.0646 221689 s a Down syndrome critical region gene 5 O.0549 203356 a Calpain 7 0.0535 211991 s a Major histocompatibility complex, class II, DP alpha 1 O.OS15 218462 a Brix domain containing 5 O.O378 218123 a Chromosome 21 open reading frame 59 O.0173 214329 X at Tumor necrosis factor (ligand) Superfamily, member 10 -OOO25 219067 s a Chromosome 10 open reading frame 86 -OOO46 205789 a CD1D antigen, d polypeptide -0.01.04 209214 S a Ewing sarcoma breakpoint region 1 -0.01.11 213427 a Ribonuclease P 40 kDa subunit -O.O471 209422 at 206567 s at PHD finger protein 20 -0.0480-0.0698 201010 s a Thioredoxin interacting protein -O.O52O 200883 a Ubiquinol-cytochrome c reductase core protein II -O.O521 218454 a Hypothetical protein FLJ22662 -O.O544 20291.8 s a Preimplantation protein 3 -O.O574 212204 a DKFZP564G2022 protein -O.O698 219452 a Dipeptidase 2 -O.O8OO 209458 x at Hemoglobin, alpha 1, alpha 2 -O.O809 219889 a Frequently rearranged in advanced T-cell lymphomas -O.O832 201303 a DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 -O.O836 20251.0 s at Tumor necrosis factor, alpha-induced protein 2 -O.O872 221923 s at NucleophoSmin (nucleolar phosphoprotein B23, numatrin) -O.O902 201887 a interleukin 13 receptor, alpha 1 -01075 211582 X at Leukocyte specific transcript 1, LST1 -O-1193 219030 a. CGI-121 protein -O.1259 212706 a RAS p21 protein activator 4 hypothetical protein FLJ21767 -01393 202902 s at Cathepsin S -0.1644 200663 a CD63 antigen (melanoma 1 antigen) -O.1764 202138 X at 209971 x at JTV1 gene -0.1950-0.2868 200851 s at KIAAO174 -O.2019 201109 s at Thrombospondin 1 -O2O79 213142 X at Hypothetical protein LOCS4103 -O.2285 202531 at interferon regulatory factor 1 -O-2904 216274 s at SEC11-like 1 (S. cerevisiae) -0.6.951 Positive RA scores indicate genes overexpressed in RA, negative RA scores indicate those underexpressed in RA. PAM = Prediction analysis of microarrays; bold and underlined letters indicate genes overlapping with the 51 genes identified by Affymetrix R gene expression profiling and analysis (see Table 3).

TABLE 5 Genes differentially regulated in RA-anti-TNFC responders versus RA-anti-TNFC. non-responders (postanti-TNFC thera

Increased Decreased Fold Affymetrix ID (%) (%) Gene title change SLR 200041 s at 1OO O HLA-B associated transcript-1 (D6S81E) 2.53 1.34 200052 s at 1OO O Interleukin enhancer binding factor 2, 45 kD (ILF2) 3.73 1.90 200064 at 1OO O Isolate Liv chaperone protein HSP90 beta (HSP90BETA) mRNA 2.66 1.41 200079 s at 1OO O Lysyl-tRNA synthetase mRNA, complete cols; nuclear gene for mitochondrial product; 2.16 1.11 alternatively spliced 200629 at 1OO O Tryptophanyl-tRNA synthetase (WARS) 2.14 1.10 200634 at 1OO O Profilin 1 (PFN1), mRNA 2.16 1.11 200802 at 1OO O Seryl-tRNA synthetase (SARS) 2.20 1.14 2008.60 s at 1OO O Similar to KIAA1007 protein, clone MGC: 692, mRNA, complete cols 2.11 1.08 200983 X at O 100 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, E.J30, -2.43 -1.28 EL32 and G344) 200991 s at 1OO O Homo sapiens KIAAO064 gene product (KIAAO064), mRNA 2.71 1.44 US 8,092,998 B2 67 68 TABLE 5-continued Genes differentially regulated in RA-anti-TNFC responders versus RA-anti-TNFC. non-responders (postanti-TNFC thera

Increased Decreased Fold Affymetrix ID (%) (%) Gene title change SLR 201112 s at OO O Chromosome segregation 1 (yeast homolog)-like (CSE1L), mRNA 2.01 O1 201214 S at OO O Protein phosphatase 1, regulatory subunit 7 (PPP1R7), mRNA 2.17 .12 201241 at OO O DEADH (Asp-Glu-Ala-Asphis) box polypeptide 1 (DDX1), mRNA 2.30 2O 201263 at OO O Threonyl-tRNA synthetase (TARS), mRNA 2.14 1O 201386 s at OO O Dead box protein 15 mRNA, complete cols 2.22 1S 201417 at OO O SRY (sex determining region Y)-box 4/DEF = Human DNA sequence from clone 3.18 .67 RP3-322L4 on chromosome 6 201576 s at OO O Galactosidase, beta 1 (GLB1), mRNA 2.OO OO 201872 s at OO O ATP-binding cassette, Sub-family E (OABP), member 1 2.28 19 201892 s at OO O NADH dehydrogenase (ubiquinone) 1 alpha Subcomplex, 6 (14 kD, B14) (NDUFA6), mRNA 2.19 13 202174 s at OO O Pericentriolar material 1 (PCM1), mRNA 2.08 O6 202176 a OO O Excision repair cross-complementing rodent repair deficiency, complementation group 3 2.93 55 (ERCC3), mRNA 202220 a OO O KIAAO907 protein (KIAAO907), mRNA 2.39 26 202225 a. OO O v-crkavian sarcoma virus CT10 oncogene homolog 2.10 O7 202464 S at O OO 6-phosphofructo-2-kinasefructose-2,6-biphosphatase 3 (PFKFB3), -3.25 -1.70 mRNA. PROD = 6-phosphofructo-2-kinase-fructose-2,6-biphosphatase 3 202545 a. OO O KIAA.0766 gene product (KIAA.0766), mRNA 138 0.46 202838 a OO O N-acetylgalactosaminidase, alpha-(NAGA), mRNA 1.82 O.86 202896 s at O OO Protein tyrosine phosphatase, non-receptor type substrate 1 (PTPNS1), mRNA -2.00 -1.00 202950 a OO O Crystallin, Zeta (quinone reductase) (CRYZ), mRNA 2.51 .33 203037 S at OO O KIAA.0429 gene product (KIAA.0429), mRNA 2.41 27 203155 a. OO O SET domain, bifurcated 1 (SETDB1), mRNA 4.23 2.08 203371 s at O OO NADH dehydrogenase (ubiquinone) 1 beta Subcomplex, 3 (12 kD, B12) (NDUFB3), mRNA -2.13 -1.09 203821 a O OO Diphtheria toxin receptor (DTR) -3.63 -1.86 203887 s at O 00 Thrombomodulin (THBD), mRNA -2.75 -1.46 203966 s at O OO Protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform (PPM1A), -2.73 -1.45 mRNA 2041.92 a 1OO O CD37 antigen (CD37), mRNA 3.66 87 204419 x at O OO Hemoglobin, gamma G (HBG2), mRNA -5.50 -2.46 204566 a 1OO O Protein phosphatase 1D magnesium-dependent, delta isoform (PPM1D), mRNA 2.OO OO 204689 a 1OO O Hematopoietically expressed homeobox (HHEX), mRNA 2.04 O3 205239 a O OO Amphiregulin (schwannoma-derived growth factor) (AREG), mRNA -3.38 -1.04 205249 a O OO Early growth response 2 (Krox-20 (Drosophila) homolog) (EGR2), mRNA -2.55 - 1.35 205552 s at 1OO O 2,5-oligoadenylate synthetase 1 (40-46 kD) (OAS1), transcript variant E 16, mRNA 2.08 O6 206115 a. O OO Early growth response 3 (EGR3), mRNA. PROD = early growth response 3 -6.54 -2.71 206584 a O 00 Homo sapiens MD-2 protein (MD-2), mRNA -2.16 -1.11 206877 a O 00 Homo sapiens MAX dimerization protein (MAD), mRNA -392 - 1.97 207170 s a 1OO O DKFZP586A011 protein (DKFZP586 AO11), mRNA 2.20 .14 208.631 s a 1OO O 78 kDa gastrin-binding protein mRNA, complete cols 2.04 O3 208.691 a O OO Transferrin receptor (p90, CD71), clone MGC: 3151, mRNA, complete cols -2.30 -1.20 2088.68 s a O OO Homo sapiens mRNA, cDNA DKFZp564N1272 (from clone DKFZp564N1272): -3.18 -1.67 complete cols 208869 s a O OO GABA-A receptor-associated protein like 1 (GABARAPL1) -3.29 -1.72 mRNA, complete cols 208942 s a O OO Translocation protein 1 -2.93 - 155 209092 s a 1OO O Homo sapiens clone 016b03 MyO27 protein mRNA, complete cols 2.07 OS 209193 at O OO Protein kinase-related oncogene (PIM1) mRNA, complete cols -2.51 -1.33 209200 at 1OO O MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) 2.48 31 2098.61 s a 1OO O eIF-2-associated pé7 homolog mRNA, complete cols 2.55 35 209967 s a O OO Human mRNA for hCREM (cyclic AMP-responsive element modulator) type 2 protein, -3.07 -1.62 complete cols 210027 s a 1OO O Apurinic endonuclease (APE) mRNA, complete cols. PROD = apurinic endonuclease 2.23 16 21.0053 at 1OO O TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100 kD 2.23 16 210172 at O OO Human mRNA for ZFM1 protein alternatively spliced product, complete cols. PROD = -2.16 -1.11 ZFM1 protein, alternatively spliced product 210766 s a 1OO O Trachea cellular apoptosis susceptibility protein (CSE1) mRNA, complete cols 2.28 19 210949 s a 1OO O Similar to eukaryotic translation initiation factor 3, subunit 8 (110 kD), clone MGC: 2.53 34 8693, mRNA, complete cols 211458 s a O 100 GABA-A receptor-associated protein mRNA, complete cols. PROD = GABA-A -3.18 -1.67 receptor-associated protein 211546 X at O 100 Human (clone 2-5) Synuclein (NACP) mRNA, complete cols -4.92 -2.30 212199 at 1OO O Human putative ribosomal protein S1 mRNA 2.22 1S 212224 at 1OO O Aldehyde dehydrogenase 1, soluble (ALDH1), mRNA. PROD = aldehyde dehydrogenase 3.18 .67 1, soluble 212388 at 1OO O Homo sapiens mRNA for KIAA1057 protein, partial cds 3.10 63 212591 at 1OO O RBP1-like protein 2.03 O2 212696 s at 1OO O Ring finger protein 4 3.05 61 212709 at 1OO O KIAAO197 protein 2.10 O7 212714 at 1OO O Homo sapiens mRNA; cDNA DKFZp586F1323 (from clone DKFZp586F1323) 2.13 O9 212893 at 1OO O Homo sapiens mRNA; cDNA DKFZp564I052 (from clone DKFZp564IO52) 2.01 O1 212989 at 1OO O Homo sapiens mRNA for Hmob33 protein, 3 untranslated region 2.25 17 213410 at 1OO O Homo sapiens mRNA; cDNA DKFZp586F1019 (from clone DKFZp586F1019); partial cols 2.53 34 213515 X at O 100 Myosin, light polypeptide 4, alkali; atrial, embryonic -4.69 -2.23 213528 at 1OO O H. sapiens novel gene from PAC 117 P20, chromosome 1 2.87 52 US 8,092,998 B2 69 70 TABLE 5-continued

Genes differentially regulated in RA-anti-TNFC responders versus RA-anti-TNFC. non-responders (post anti-TNFC therapy)

Increased Decreased Fold Affymetrix ID (%) (%) Gene title change SLR

213604 at 1OO O Homo sapiens clone 24582 mRNA sequence 2.07 OS 213619 at O OO Heterogeneous nuclear ribonucleoprotein H1 (H) -2.48 -1.31 213655 at O OO Tyrosine 3-monooxygenase? tryptophan 5-monooxygenase activation protein, -3.03 -1.60 epsilon polypeptide 213743 at 1OO O Cyclin T2 2.08 O6 21378.8 s at O OO cDNA: FLJ23227 fis, clone CAEOO645, highly similar to AFO52138 -2.20 -1.14 213872 at O OO Hypothetical protein FLJ12619 -4.29 -2.1 213979 s at O OO C-terminal binding protein 1 -4.41 -2.14 214257 s at O OO SEC22, vesicle trafficking protein (S. cerevisiae)-like 1 -2.97 -1.57 214414 X at O OO Hemoglobin, alpha 1 -2.04 -1.03 214696 at O 00 Homo sapiens clone 24659 mRNA sequence (DEF = Homo sapiens clone 24659 -2.93 - 155 mRNA sequence 214933 at O OO Calcium channel, voltage-dependent, PQ type, alpha 1A Subunit -2.17 -1.12 215043 s at O OO H. sapiens SMA5 mRNA -4.08 -2.03 215933 s at 1OO O H. Sapiens HEX gene encoding homeobox related protein 2.17 .12 216199 s at 1OO O Mitogen-activated protein kinase kinase kinase 4 2.77 47 216202 s at 1OO O Serine palmitoyltransferase (LCB2) mRNA, partial cols 2.75 46 216996 s at 1OO O KIAAO971 protein /DEF = Homo sapiens cDNA FLJ11495 fis, clone HEMBA100 1950, 2.20 .14 highly similar to Homo sapiens mRNA for KIAAO971 protein 217554 a O 100 ESTs, Hs. 97109 -3.63 -1.86 217682 a O 100 ESTs, Weakly similar to ALU7 HUMAN ALU -3.01 - 1.59 217840 a OO O DEAD-box protein abstrakt (ABS), mRNA 2.39 26 218229 s at OO O KIAA1513 protein (KIAA1513), mRNA 2.07 OS 218356 a OO O Cell division protein Fts (FJH1), mRNA 2.20 .14 218432 a OO O F-box only protein 3 (FBXO3), mRNA 2.16 .11 218589 a OO O Purinergic receptor (family A group 5) (P2Y5), mRNA 2.68 42 218604 a OO O integral inner nuclear membrane protein (MAN1), mRNA 2.04 O3 218689 a OO O Fanconi anemia, complementation group F (FANCF), mRNA 8.94 3.16 218889 a OO O Hypothetical protein FLJ12820 (FLJ12820), mRNA 2.01 O1 218973 a OO O Hypothetical protein FLJ13119 (FLJ13119), mRNA 2.07 OS 219069 a OO O Hypothetical protein FLJ20189 (FLJ20189), mRNA 2.23 16 219093 a OO O Hypothetical protein FLJ20701 (FLJ20701), mRNA 3.32 73 219099 a OO O Homo sapiens chromosome 12 open reading frame 5 (C12ORF5), mRNA 2.13 O9 219176 a OO O Hypothetical protein FLJ22555 (FLJ22555), mRNA 2.13 O9 219243 a OO O Hypothetical protein FLJ11110 (FLJ11110), mRNA 2.07 OS 219363 s at OO O CGI-12 protein (LOC51001), mRNA 2.31 .21 219434 a O 100 Triggering receptor expressed on myeloid cells 1 (TREM1), mRNA -4.35 -2.12 221485 a O 100 betaGlcNAc beta 14-galactosyltransferase. polypeptide 5 -2.71 -1.44 221652 s at OO O PNAS-25 mRNA, complete cols. 2.55 35 221755 a. OO O Homo sapiens mRNA for FLJO0043 protein, partial cols 3.44 O9 221970 s at OO O Homo sapiens cDNA: FLJ21737 fis, clone COLF3396 2.41 27 222127 s at O.1 O Homo sapiens cDNA FLJ13399 fis, clone PLACE 1001395 (DEF = Homo sapiens 2.31 .21 cDNA FLJ13399 fis, clone PLACE1001395 36711 at O 100 Novel MAFF (v-maf musculoaponeurotic fibrosarcoma (avian) oncogene family, protein F) -3.54 -1.16 LIKE protein 38037 at O 100 Heparin-binding EGF-like growth factor mRNA, complete cols -3.63 -1.86 AFFX-BioB- O 100 E. coi 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), -4.69 -2.58 M at 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cols AFFX-r2- O 100 Escherichia coii REF = JO4423 (DEF = Ecoli bioC protein corresponding to -4.22 -1.86 Ec-bioC-3 at nucleotides 4609-4883 of J04423 (LEN = 777 (-5 and -3 represent transcript regions 5 prime and 3 prime respectively)

The listed genes (n = 117) show differential expression in 100% of the pairwise comparisons; bold and underlined letters indicate genes overlapping with the 51 genes identified by Affymetrix (R) gene expression profiling and analysis (see Table 3) US 8,092,998 B2 71 72 TABLE 6 Correlations between clinical parameters and differentially expressed genes (Pearson correlation test; pre- and post-anti-TNFC. treatment; n = 7 for all; bold letters identify genes occurring twice, bold and italics letters identify genes occurring a 3 times Affymetrix ID Gene title r-value p-value Pre-anti-TNFC. treatment

Leuko 202219 at Solute carrier family 6 0.901 0.006 : 205239 at Amphiregulin 0.879 0.009 Thromb? 205900- at Keratin 1 0.923 0.003 * Monof 204018 x at Hemoglobin, alpha 1 -O.908 0.005 ** GPT. 203932– at MHC-II, DM beta -0.912 0.004 218589 s at Purinergic receptor P2Y, G-protein coupled 5 -0.919 0.003 ** Hbf 205900- at Keratin 1 -0.944 0.001 MoStiff, 202219 at Solute carrier family 6 0.893 0.007 203932– at MHC-II, DM beta -0898 0.006 : 204131 s at Forkhead box O3A O.917 0.004 ** 205239 at Amphiregulin 0.954 0.001 207332 S at Transferrin receptor (p90, CD71) O.926 0.003 ** 208.632 at Ring finger protein 10 O.913 0.004 ** DisDuri 212232 at Formin binding protein 4 0.955 0.001 ** 213142 X at Hypothetical protein LOC54103 0.877 0.009 ** Post-anti-TNFC. treatment ESR; 38037 at 92 3t 203821 at Heparin-binding EGF-like growth factor 92 3t 20557 at Lipoyltransferase 1 -89 6t 210027 s at APEX nuclease (autifunct DNA repair enzyme)1 -.944 et 211458 s at GABA(A) receptor-associated proteins like A3 947 et 212232 at Formin binding proteins 4 -9 7tet 219228 at Zinc finger protein 331 O894 0.007 ** CRPF 38037 at 9. et 203821 at Heparin-binding EGF-like growth factor 1963 et 20557 at Lipoyltransferase 1 -.946 et 210027 s at APEX nuclease (autifunct DNA repair enzyme)1 -9 et 211458 s at GABA(A) receptor-associated proteins like A3 94. et 212232 at 9. See 20557 at -934 O2et 212232 at -92 3t Granulo 213427 at Ribonuclease P 40 kDa subunit -0.875 0.010 ** Hbf 38037 at -93 2 203821 at Heparin-binding EGF-like growth factor -94 et 203932 at MHC class II, DM beta O.885 0.008 ** 210027 s at APEX nuclease (autifunct DNA repair enzyme)1 97. et 211458 s at GABA(A) receptor-associated proteins like A3 -9 et Dis act 36711 at V-maffibrosarc. oncogene homolog F (avian) 0.932 0.002 205552 s at 2',5'-oligoadenylate synthetase 1, 40.46 kDa -0.951 0.001 211458 s at GABA(A) receptor-associated proteins like A3 96. 6t 212232 at Formin binding proteins 4 -9 6t DAS28 3611 V-maffibrosarc. oncogene homolog F (avian) 0.940 0.002 205552 s at 2',5'-oligoadenylate synthetase 1, 40.46 kDa -0898 0.006 : 20557 at Lipoyltransferase 1 937 2 211458 s at GABA(A) receptor-associated proteins like A3 97 6t 212232 at Formin binding proteins 4 -973 et Sw28 219607 s at Membrane-spanning 4-domains, subfam. A memb. 4 O.931 0.002 ** GPT = glutamate pyruvic transferase; Hb = haemoglobin; MoStiff = Morning stiffness (minutes); DisDur = Disease duration (years); ESR = erythrocyte sedimentation rate; CRP = C-reactive protein; DAS 28 = disease activity score (28 joints); Sw= number of swollen joints (28 joints)

US 8,092,998 B2 75 76 TABLE 8 Correlations between TaqMan PCR results and the ACR response in anti-TNFC-treated RA patients Gene description Time point Gene title Applera ID r-value p l CA1 w 12 Carbonic anhydrase 1 Hs00266139 m1 O642 O.O45 10 CA1 w 26 O.962 O.OOO 9 CLC w 4 Charcot-Leyden crystal protein Hs00171342 m1 O.766 0.027 8 THEBD w 4 Thrombomodulin Hs00264920 S1 O.766 0.027 8 THEBS1 w 26 Thrombospondin 1 HsOO170236 m1 -0.710 0.032 9 IRF1 w 4 Interferon regulatory factor 1 HsOO233698 m1 O.778 O.O23 8

TABLE 9 Genes differentially regulated in RA-anti-TNFC responders versus RA-anti-TNFC. non-responders (pre-anti-TNFC therapy: predictive genes

Increased Decreased Fold Affymetrix ID Gene title (%) (%) Change SLR 39248 at Aquaporin 3 10 8O -4.6 -2.19 200061 s a Similar to ribosomal protein S24, clone MGC: 8595 O 80 -1.39 -0.47 200087 s a Transmembrane emp24 domain trafficking protein 2 O 80 -1.6 -0.63 200642 a. Superoxide dismutase 1, soluble (amyotrophic lateral Sclerosis 1 O 80 -1.8 -0.84 200655 s a Calmodulin 1 (phosphorylase kinase, delta) O 80 -1.5 -0.59 200745 s a Guanine nucleotide binding protein (G protein), beta polypeptide 1 80 O .6 O.66 200772 X at Prothymosin, alpha (gene sequence 28) 80 O 7 0.75 201193 a Homo sapiens isocitrate dehydrogenase 1 (NADP+) soluble (IDH1) O 80 -1.4 -0.49 201690 s a Tumor protein D52 O 80 -3.3 -1.73 201693 s a Early growth response 1 80 O 3.1 1.61 201889 a Homo sapiens predicted osteoblast protein (GS3786) O -1.7 -0.74 202110 a Cytochrome c oxidase subunit VIIb O 80 -1.6 -0.64 202157 s a CUG triplet repeat, RNA binding protein 2 O 80 -1.6 -0.64 202233 s a Ubiquinol-cytochrome c reductase hinge protein O 80 -1.7 -0.74 202378 s a Homos Spaiens leptin receptor gene-related protein (HSOBRGRP) 80 2O 1S O.20 202664 a Wiskott-Aldrich syndrome protein interacting protein 80 O .9 O.91 20291.0 s a CD97 antigen 80 10 .6 O.70 202922 a. Glutamate-cysteine ligase, catalytic subunit O 80 -2.3 -1.17 202950 a Crystallin, Zeta (quinone reductase) 80 O 2.2 1.16 203097 s a Rap guanine nucleotide exchange factor (GEF) 2 2O 80 -1.3 -0.38 203231 s a Ataxin 1 O 80 -8.2 -3.03 203300 x at Adaptor-related protein complex 1, sigma 2 subunit 80 2O .9 O.89 204160 s a Ectonucleotide pyrophosphatase/phosphodiesterase 4 10 80 -2.4 -1.27 204750 s a Desmocollin 2 80 O 12.9 3.69 204777 s a MAL, T-cell differentiation protein 10 80 -2.6 -1.39 205042 at Glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase O 80 -19 -0.95 205114 s a Chemokine (C-C motif) ligand 3 80 O 2.0 O.96 205624 at Carboxypeptidase A3 O 80 -4.0 -2.00 206207 at Charcot-Leyden crystal protein O 9. -4.9 -2.29 206790 s a NADH dehydrogenase (ubiquinone) 1 beta Subcomplex, 1, 7kDa O 80 -1.5 -0.61 207008 at interleukin 8 receptor, beta 9. O 4.0 2.00 207815 at Platelet factor 4 variant 1 2O 80 -2.4 -1.28 208051 s a Poly(A) binding protein interacting protein 1 O 80 -1.6 -0.68 2081.61 s a ATP-binding cassette, Sub-family C (CFTR/MRP), member 3 80 O 4.3 2.10 208.637 X at Actinin, alpha 1 80 O 2.4 1.24 208918 s a NAD kinase 80 O 5 O.S9 208982 at Platelettendothelial cell adhesion molecule (CD31 antigen) 9. O .6 O.71 209009 at Esterase D formylglutathione hydrolase 80 2O 5 O.S4 209020 at Chromosome 20 open reading frame 111 80 2O 5 O.S4 209146 at Sterol-C4-methyl oxidase-like O 80 -1.9 -O.89 209193 at PIM-1 oncogene 10 80 -2.3 -1.19 209710 at GATA binding protein 2 2O 80 -3.5 -1.81 210042 s at Cathepsin Z 80 2O .9 O.94 210184 at Integris alpha-K?as?igers CD11c) O 2.3 122 210732 s at Lectin, galactoside-binding, soluble, 8 (galectin 8) 80 O 2.4 1.23 210895 s at CD86 antigen (CD28 antigen ligand 2, B7-2 antigen) 80 10 .9 O.92 211506 s at interleukin 8 9. O 3.2 1.67 211734 S. at Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide O 80 -5.0 -2.31 211995 X at Actin, gamma 1 80 O .4 O46 212314 at KIAAO746 protein 10 80 -1.7 -0.73 212335 at Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) 80 O 5 O.S4 212386 at Transcription factor 4 O 80 -2.5 -1.29 212671 s at Major histocompatibility complex, class II, DQ alpha 1 10 80 -3.3 -1.72 212897 at Cell division cycle 2-like 6 (CDK8-like) 80 O 8 O.83 212999 X at Major histocompatibility complex, class II, DQ beta 1 80 2O 8 O.88 213309 at Phospholipase C-like 2 O 80 -1.9 -0.9 213506 at Coagulation factor II (thrombin) receptor-like 1 80 O 2.4 1.23 213883 s at TM2 domain containing 1 10 80 -1.4 -0.46 US 8,092,998 B2 77 78 TABLE 9-continued Genes differentially regulated in RA-anti-TNFC responders versus RA-anti-TNFC. non-responders (pre-anti-TNFC therapy: predictive genes

Increased Decreased Fold Affymetrix ID Gene title (%) (%) Change SLR 214305 s a Splicing factor 3b, Subunit 1, 155 kDa 80 2O .5 O.62 214512 s a SUB1 homolog (S. cerevisiae) O 80 -1.7 -0.76 214807 at MRNA, cDNA DKFZp564OO862 80 10 7 0.79 214953 s a Amyloid beta (A4) precursor protein (peptidase nexin-II, 9. O 9 O.93 Alzheimer disease) 215726 s a Cytochrome b-5 O 80 -2.1 -1.08 216016 at Cold autoinflammatory syndrome 1 80 O 6.1 2.60 217722 s a Neugrin, neurite outgrowth associated O 9. -1.9 -0.91 217753 S a Ribosomal protein S26,40S ribosomal protein 10 80 -2.9 -1.51 217970 s a CCR4-NOT transcription complex, subunit 6 O 80 -1.9 -0.91 218190 s a Ubiquinol-cytochrome c reductase complex (7.2 kD) O 80 -2.0 -1.03 218345 at Hepatocellular carcinoma-associated antigen 112 10 80 -39 -1.95 218486 at Kruppel-like factor 11 9. O 2.1 1.06 218545 at GGA binding partner O 80 -1.6 -0.67 218728 is a Cornichon homolog 4 (Drosophila) O 80 -1.8 -0.84 219269 at Hypothetical protein FLJ21616 O 90 -2.1 -1.06 219410 at Homo Sagpiers po?thetical proteins L34 O -4.7 -2.33 2198.62 s a Nuclear prelamin A recognition factor 80 O .5 O.62 219905 at Erythroblast membrane-associated protein O 80 -1.8 -0.85 220532 s a LR8 protein 10 80 -5.2 -2.39 221011 s a Likely ortholog of mouse limb-bud and heart gene (LBH) O 80 -2.8 -1.47 221042 s a Calmin (calponin-like, transmembrane) 80 O 9 O.89 221434 S a Chromosome 14 open reading frame 156 O 80 -1.7 -0.72 221737 at Guanine nucleotide binding protein (G protein) alpha 12 10 80 -2.0 - 1.96 AFFX-M27830 5 at SRY (sex determining region Y)-box 18 8O O 4.3 2.09 The criterion for gene selection (total of 82) was the percentage of pairwise comparisons between future RA responders and future RA non-responders to anti-TNFo. therapy showing an increase or decrease for the fold-changeSignalILogRatio prior to therapy; bold letters indicate apercentage of 80% for the pairwise comparisons (total of 10), bold and italic letters 90%. bold, italic, and underlined letters 100%, in the latter case, also the gene names are shown in bold, italic, and underlined letters,

SEQUENCE LISTING

<16O is NUMBER OF SEO ID NOS: 31 O

<210s, SEQ ID NO 1 &211s LENGTH: 279 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (279) <223> OTHER INFORMATION: AffymetrixID: 392.48 at <4 OOs, SEQUENCE: 1 Cttctacagg Cttittgggala gtagggtgga tigtggg tagg gctgggagga giggggccaca 6 O gcttaggittt ggagct Ctgg atgtacatac ataagtagga gcagtgggac gtgtttctgt 12 O

Cataatgcag gcatgaaggg toggagtgaag ticaggtoata agttt catgt ttgcttttgt 18O tttgttttgt ttittaatgta totagcagat gttacagtct tagggat.ccg ggatgggaga 24 O c cccactitta gaaagggit cq t cact cottt aatcc tota 279

<210s, SEQ ID NO 2 &211s LENGTH: 483 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (483) <223> OTHER INFORMATION: AffymetrixID: 2OOO61 s at <4 OOs, SEQUENCE: 2 agat.cgc.cat catgaacgac accqtaacta t cogcactag aaagttcatg accaa.ccgac 6 O tact tcagag gaaacaaatg gt cattgatg tcc tt caccc cq99aaggcg acagtgcct a 12 O

US 8,092,998 B2 83 84 - Continued

O CATION: (266 ) ... (267) OT HER IN FORMAT ON: n is o FEATURE: NA E misc feature A. (278 ) ... (278) E FORMAT ON: n is o E A.T E misc feature A. (285 ) ... (285) E FORMAT ON: n is o T E misc feature A. (292 ) ... (293) E FORMAT ON: n is o T E misc feature A. (295 ) ... (295) E FORMAT ON: n is o T E misc feature A. (297 ) ... (297) E FORMAT ON: n is o T E misc feature A. (299 ) ... (299) E FORMAT ON: n is o T E misc feature A. (3 O7 ) ... (3 O7) E FORMAT ON: n is o T E misc feature A. (315 ) ... (315) E FORMAT ON: n is o T E misc feature A. (327 ) ... (327) E FORMAT ON: n is o T E misc feature A. ON (334 ) ... (334) E FORMAT ON: n is o T E misc feature A. (347 ) ... (347) E FORMAT ON: n is o T E misc feature A. (353 ) ... (353) E FORMAT ON: n is o T E misc feature A (360 ) ... (360) E FORMAT ON: n is o T E misc feature A (362 ) ... (362) E FORMAT ON: n is o T E misc feature A (37 ) ... (371) E ON: n is o T E feature A (376 ) ... (376) E FORMAT ON: n is o T E feature A (382 ) ... (382) E FORMAT ON: n is o T E misc feature A (389 ) ... (389) E FORMAT ON: n is o E A.T E misc feature CA I ON (394 ) ... (394) ER IN FORMAT ON: n is 9. o FEATURE: NA E/KEY: misc feature US 8,092,998 B2 85 86 - Continued <222s. LOCATION: (403) ... (403) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (410 ... (410) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (415 ... (415) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (421) ... (421) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (426 ... (426) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (429 ... (4.29) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (434) ... (434) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (477 ... (4.77) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (507 ... (507) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (540) 223 OTHER INFORMAT ON: AffymetrixID: 2OOf72 x at

<4 OO > SEQUENCE: 7 gaaaagcc at ctittgcattg t to ct catcc. gnoctcc ttg citcngcc.gca gcc.gc.ct cog 6 O cc.gc.gc.gc.ct cct cogcc.gc cgcggactnc cggcagctitt atcgc.ca.gag tcc ct galact 12 O citcgctttct ttittaatccc Cntgcatcgg at Caccggcg tgc.cccacca tgtcagacgc 18O agcc.gtagac accagctc.cg aaatcaCCaC Caaggactta aaggaga aga aggaagttgt 24 O ggaagaggca gaalanatgga agaganncC c cctdctnaa cgggnaatgc tnananant 3OO gaggaanaat giggnagCag gaggctingac aatngaggta gacgaangaa ganggaagan 360 anggtgggga nggaangagg anggaggana gaangalaggt gantggtgan ggaangagga ntggangant gaangatgag gaagctgagt Cagctacggg Caagcgggca gctgaangat gatgaggatg acgatgtcga taccaangaa gCagalagacic gacgaggatg act agacagc 54 O

<210s, SEQ ID NO 8 &211s LENGTH: 492 &212s. TYPE: DNA &213s ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (492) <223> OTHER INFORMATION: AffymetrixID: 2O1193 at <4 OOs, SEQUENCE: 8 tagccacagt attgct coct aaaatatgca taaagtagaa att cact gcc ttococt cost 6 O gtcCatgacc ttgggcacag ggaagttctg gtgtcat aga tat cocqttt tgttgagg tag 12 O agctgtgcat taaacttgca Catgactgga acgaagtatg agtgcaactic aaatgtgttg 18O aagatactgc agt catttitt gtaaagacct tgctgaatgt titccaataga ctaaatactg 24 O tittaggcc.gc aggagagttt ggaatccgga ataaatacta Cctggagtict tgtccitctoc 3OO US 8,092,998 B2 87 - Continued atttitt ct ct ttcticcitcct ggcctggcct gaat attata citactictaaa tag catattt 360 catccaagtg caataatgta agctgaatct tttittgg act tctgctggcc tdttittattt 42O cittittatata aatgtgattt ct cagaaatt gat attaaac act at cittat cittct cotga 48O actgttgatt tt 492

SEO ID NO 9 LENGTH: 391 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (391) OTHER INFORMATION: AffymetrixID: 201690 s at SEQUENCE: 9 atgatact.gt agaacctgtc. tcc tactittgaaaactgaat gtcagggct g agtgaat caa 6 O agtgtctaga catatttgca tagaggccaa got attctat tctaataact gct tact caa 12 O cactaccacc ttitt cott at actgtatatg attatggcct acaatgttgt atttgttatt 18O tattaaattg tdattgttitt attattgttt atgccaaatgttaactgcca agcttggagt 24 O gacctaaag.c attittittaaa agcatggcta gatt tacttic agtataaatt atct tatgaa 3OO aaccaaattt taaaagccac aggtgttgat tdttataaaa taa catgct g c cattcttga 360 ttgctagagt ttttgttagt actittggatg c 391

SEQ ID NO 10 LENGTH: 5O1 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) . . (501) OTHER INFORMATION: AffymetrixID: 201693 s at SEQUENCE: 1.O gggctttcgg acatgacagc aacct tttct CCC aggacaa ttgaaatttg ctaaagggaa 6 O aggggaaaga aagggaaaag ggagaaaaag aaacacalaga gacttaaagg acaggaggag 12 O gagatggcca taggagagga gggttcct ct taggit cagat ggaggttct C agagccalagt 18O cctic cct citc tactggagtg gaaggtotat tdgccaacaa toctittctgc ccact tcc cc 24 O titc.cccaatt act atticcict ttgactitcag ctgcc tdaaa cagc.catgtc. caagttcttic 3OO acct citat co aaagaactitg atttgcatgg attittggata aat catttica gitat catct c 360 catcatatgc ctdacc cctt gct coct tca atgctagaaa atcgagttgg caaaatgggg 42O tittgggcc cc ticagagcc ct gcc ct gcacc cittgtacagt gtctgtgcca toggattt cqt 48O ttitt cittggg gtact cittga t 5O1

SEQ ID NO 11 LENGTH: 489 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (489) OTHER INFORMATION: AffymetrixID: 2O1889 at

SEQUENCE: 11 ttgaccc.caa atgactitt at accca attct acataaaaat atagaagat c tat ctitttitt 6 O tgttacct tc agatgttcac taaataactic agtttittaag cagaagttitt cagggcatta 12 O US 8,092,998 B2 89 90 - Continued aatatatgtt gtg tatgaag tat citcaaac tdgaacataa atttagtgat caaactgc.ca 18O ttcacagtgt aaggcago ac ttaaattt cq aacctaaagt ttagatgcat td tataaaaa 24 O aacctaaaag cagtatctgt tatttagctg taalaccalagt toggaagctat t cqgataatt 3OO t cittaaat at tdatgaactt toggagtactg tttct tcctt caaactgaat gtaattaatt 360 catgaataaa tdcaccittat atgtttaaac aatctttgta tacttittggg atttittggtg 42O cittatatgct aaatca catt cagcatgtgt attittgacat ttaaaatact tcc ct caatt 48O ctgtaaatt 489

SEQ ID NO 12 LENGTH: 409 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (409) OTHER INFORMATION: AffymetrixID: 202110 at

SEQUENCE: 12 t cagct cact tca aggg tac Citgaagcgaa ttggcaccala agcagcagct gtattgcc.gc 6 O agttctagot to acct tcac gatgtttic cc ttggtcaaaa gcgcactaaa totgtc.t.c caa 12 O gttctgaagca ttcagdaaac aatggcaagg cagagcc acc agaaacgtac acctgattitt 18O catgacaaat acggtaatgc tigt attagct agtggagcca ctittctgitat tdttacatgg 24 O acatatgtag caacacaagt cqgaatagaa tigaacctgt CCC ctgttgg cagagtt acc 3OO ccalaaggaat ggaggaatca gtaat catcc cagctggtgt aataatgaat ttittaaaaa 360 acagct cata attgatgcca aattaaag.ca citgtgtaccc attaagata 4O9

SEQ ID NO 13 LENGTH: 511 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) . . (511) OTHER INFORMATION: AffymetrixID: 202157 s at

SEQUENCE: 13 tgtggcaaaa acgtttctitt cittatttittt ttcttitt colt aaaacagact togaaagtatt 6 O atacagggat tdcattctt C ccggit cact ggtaacaata gcaatatgtg tcc agggaca 12 O cagaatgttg gtttctaa.ca gac tact tcc aaaaacagtt tdagaaaaaa actgtctgat 18O tittaagttctic tagaggtotg taatagtttt tacatttitt.c aggcagtgta aagtttitttg 24 O ataaggcc at tittaggtggc ticactittct c attaagatat atatatagaa ccacttitttg 3OO tagattagta taagaaaaat atttaccctg ttittggggga aatgctacct atttgtgtca 360 ccttittgctgaact cacagt tag acaatcc atggtttaat gcacatgaaa ttacctatat 42O tittatact.gt ttcaatgtac aggagaaagg ttact.gitaaa citgtgttatgttggtgcttic 48O tgtgaattaa gttgttggttt cat catgagt c 511

SEQ ID NO 14 LENGTH: 48O TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (480) OTHER INFORMATION: AffymetrixID: 202233 s at US 8,092,998 B2 91 92 - Continued

<4 OOs, SEQUENCE: 14 gctctgttgaatctagaac cgtagccaga Catgggactg gaggacgagc aaaagatgct 6 O taccgaatcc ggagat.cctg aggaggagga agaggalagag gagga attag tggat.ccc.ct 12 O aacaac agtg agaga.gcaat gcgagcagtt ggagaaatgt gtaaaggccC gggagcggct 18O agagct ctgt gatgagcgtg att cotct cq at Cacataca gaagaggatt gCacggagga 24 O gctic tittgac ttcttgcatg cgagggacca ttgcgtggcc Cacaaactict ttaacaactt. 3OO gaaataaatgttggactta agttgcaccc cagt citt cat Catctgggca t cagaatatt 360 t cct tatggit tttggatgta c catttgttt cittatttgttg taactgtaag ttcaCat Caa

Cct catgggt ttggcttgag gctgg tagct tctatgtaat tcqcaatgat to Catctaaa. 48O

<210s, SEQ ID NO 15 &211s LENGTH: 556 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (556) <223> OTHER INFORMATION: AffymetrixID: 202378 s at

<4 OOs, SEQUENCE: 15 acatgtgcac atgcggcatt ttactatogaa atttaatatg ctgggitttitt taatacctitt 6 O atatat catgttcactittaa gaaag acttic atalagtagga gatgagttitt attct cagoa 12 O aatagacctd toaaatttag attatgttac tcaaattatg ttacttgttt ggctgttcat 18O gtag to acgg to tct Caga aaatatatta acgcagt citt gtaggcagct gccaccittat 24 O gcagtgcatc gaalaccttitt gCttggggat gtgcttggag aggcagataa cgctgaagca 3OO ggcctic to at gacccaggaa gatcc ct citt tgttgttgtag tccatgctat 360 taaaagtgtg gcc cacagac Caagagcctic alacattt CCt agagc ctitat tagaaatgca gaatctgaag ccc cactctg gacccaggac attittgatga gatccalaagg agttgtatgc acatgaaagt ttgaga agca t catcataga gaagtaalaca toacaccCaa citt cott at c 54 O titt.ccagtgg ctaaac 556

<210s, SEQ ID NO 16 &211s LENGTH: 529 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (75). (75) <223> OTHER INFORMATION: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (529) <223> OTHER INFORMATION: AffymetrixID: 2O2 664 at <4 OOs, SEQUENCE: 16 gaaatcagag Cttacatgtg tgtttitttta talacatttitc. agataaatgt attcaacatg 6 O taatacagta ttittna catt cacct citt at tittatattga aatgt attac agt attaaaa 12 O cticagtgttc agtatttatt t cactatogca ttittatttag taaaa.gc.ca.g gagaaatgtt 18O taatccaatig gtgcct tact ttgttgattta aaagaaatca act t t t t t t t atgtctaagt 24 O agtagattat ttgcatattt gtaaaaactg ttaggtottt at attittaala gtgtaatacc 3OO agttttgtta ttt tagtagc agaaatggga tgattgttaa agttc.cccaa aaatgttggc 360 atgaaattaa tttitt.ccctic cittatagt ca aggaccgtag aggaagaaaa act t t t t t t t US 8,092,998 B2 93 - Continued catat catgc act attaaa cagacacatt ttgct atctg togt catcagg at agtgtaag 48O tgg tagggta gagact accc tagaCatctg. Catctttgta agittagc.ca 529

<210s, SEQ ID NO 17 &211s LENGTH: 478 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (478) <223> OTHER INFORMATION: AffymetrixID: 20291.0 s at <4 OOs, SEQUENCE: 17 ctgtggccac agcagotttg tacacgaaga ccatc catcc ticcictitcgtc. caccacticta 6 O Ctcc ct coac cct Coctocc tdatc.ccgtg to caccagg agggagtggc agctatagt c 12 O tggcaccalaa gtcCaggaca CCC agtgggg tagt cqga gcc actggit C Ctgctgctgg 18O

Ctgcct ct ct gct coacctt gtgacccagg gtgggga cag gggctggc.cc agggctgcaa. 24 O tgcagcatgt tocctggca Cctgtggcca gtact cqgga Cagactalagg gcgcttgtc.c 3OO catcCtggac tttitcct ct c atgtc.tttgc tigcagaactgaagagactag gcgctggggc 360 t cagct tccc ticttaa.gcta agactgatgt cagaggc.ccc atggc gaggc ccCttggggc 42O

Cactgcctgaggcticacggit acagaggcct gcc ctgcctg gcc.gggcagg aggttctic 478

<210s, SEQ ID NO 18 &211s LENGTH: 276 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (57) . . (57) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (276) <223> OTHER INFORMATION: AffymetrixID: 2O2922 at

<4 OOs, SEQUENCE: 18 aaaaatggcg ttcttct citt gtggcctgtt attctgattig citgctgtata cagttting to 6 O actic tittagt ttt tagttaa goatactgat agactitt cott ctaaaagcca ttcactic cag 12 O attittacctg giggaat attc tacatact.gc titactitt citc tataaaactic atcaataaat 18O catgaaaggc actgagttitt gtaaatcagg accctaaatgtttaattgta aataagttt c 24 O agataattat tatagotttg cqttgaagtt tdttgt 276

<210s, SEQ ID NO 19 &211s LENGTH: 486 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (486) <223> OTHER INFORMATION: AffymetrixID: 2O2950 at <4 OOs, SEQUENCE: 19 taacatgtta gttgtcattt ggcatgagtg togcattccag taatt cittaa ttgat atttg 6 O attaatticca tacctittgat taaaacatgc tagttcaaaa taagactgct cagtttccaa 12 O gggttittcaa goctacttac ctittataaag gttctictagt citctgattag ccatgactgt 18O attggactitt gaacatttitc togalactaaaa acctic tatto taalactaatc. tcatttggat 24 O gtgtaagt ct tttgtaaagg caagaataaa taatat coag gacaattitat tagttittctic 3OO US 8,092,998 B2 95 96 - Continued agtattitt co caaat attag aatatt tact tcattattgg ttggctgcca atgaccc cat 360 atgttctgtg agaatagtag ctittatctitt gatataatac atagt ct coa aataggtaat 42O actitcgcaat tdattagatt ttcagagtag atttagagtt atctgtttitt ctogtgaggg 48O toaaat 486

<210s, SEQ ID NO 2 O &211s LENGTH: 539 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (539) <223> OTHER INFORMATION: AffymetrixID: 203097 s at <4 OOs, SEQUENCE: 2O titt.ccattaa attcagotga t catattgat cagtagataa acgtaaatag cittcaaattit 6 O taaaagtgga attgcagtgt tttitt cactg tat caaacaa tdt cagtgct ttatttaata 12 O attct cittct gitat catggc atttgtctac ttgct tatta cattgtcaat tatgcatttg 18O taattittaca totaatatgc attatttgcc agttt tatta tataggctat gigacct catg 24 O tgcatataga aagacagaaa totagcticta ccacaagttg cacaaatgtt atctaag cat 3OO talagtaattig tagalacatag gactgctaat Ctcagttcgc tictgttgatgt Caagtgcaga 360 atgtacaatt aactggtgat titcct catac ttittgatact acttgtacct g tatgtctitt 42O tagaaagaca ttggtggagt ctdtatcc ct tttgt attitt taatacaata attgtacata 48O ttggittatat ttttgttgaa gatgg tagaa atgtact atgtttatgcttic tacatccag 539

<210s, SEQ ID NO 21 &211s LENGTH: 444 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (444) <223> OTHER INFORMATION: AffymetrixID: 203231 s at <4 OOs, SEQUENCE: 21 tgcaccaggt gaaaac aggg C cagoagact c catggcc.ca attcggttt C titcggtggtg 6 O atgtgaaagg agagaattac acttittttitt tttittaagtg gcgtggaggc ctittgct tcc 12 O acatttgttt tta acccaga atttctgaaa tagagaattit aagaacacat caagtaataa 18O atatacagag aatatactitt tittataaag.c acatgcatct gctattgttgt tdggttggitt 24 O t cct ct ctitt tocacggaca gtgttgttgtt totgg catag ggaaact coa aacaacttgc 3OO acacct ctac tocqgagctg agatttcttt tacatagatg acct cqcttic aaatacgitta 360 cct tactgat gataggat.ct tttcttgtag cactatacct tdtgggaatt tttittittaaa 42O tgtacacctg atttgagaag Ctga 444

<210s, SEQ ID NO 22 &211s LENGTH: 526 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (526) <223> OTHER INFORMATION: AffymetrixID: 203300 x at <4 OOs, SEQUENCE: 22 gaacttgttc aga.ccgttitt agcacggalaa Cctaaaatgt gcagct tcct tagtggcga 6 O US 8,092,998 B2 97 98 - Continued gatctgaaga ttgtttacaa aagatatgct agtctgtatt tttgctgtgc tattgaggat 12 O caggacaatgaactaattac cct ggaaata attcatcgtt atgtggaatt acttgacaag 18O tattitcggca gtgtctgtga act agatat c atctittaatt ttgagaaggc titattittatt 24 O ttggatgagt ttcttittggg aggggaagtt Caggaaa.cat C caagaaaaa tdt CCttaaa 3OO gcaattgagc aggctgat ct actgcaggag gaagctgaaa CCC cacgtag titt Cttgaa 360 gaaattggac tdacataact citcct coctt gttgatgact tcttgtggca titt cacacac 42O tgtagatggit cacticc ctitc atgtc catgt tagct catgg togtaagatga tigt cittgtca 48O gtattact.gt tttgctaagc cqctt cattc atgcc tacac aattitt 526

<210s, SEQ ID NO 23 &211s LENGTH: 502 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (112) ... (112) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (2OO) ... (2 OO) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (502) <223> OTHER INFORMATION: AffymetrixID: 20416O is at

<4 OOs, SEQUENCE: 23 ttgttggttgttgagaggcat tittcaaac cc tdtataaata atc catgctg ttggit cataa 6 O gttaactgta ttaagaacag taaaataaat aaaaaccaat agtactaatt trngctittaaa 12 O aaaatttcta atttittitt ca cataaaacaa titatic ctaaa gottaatagt tdatcgaaac 18O agaataatag aaaaattic tin ctittaatttic cattaaaaag caaatagcat tdacacattt 24 O aaagctttitc atttaaagta gtggatgttt ttgaagitatic taaaatagta gcagaatatt 3OO titat acttgg toctitgcaat gigtgtgagtt ttaatgattig cattatcgtg attggtggitt 360 atgagttt ca gaaatctata cittggcatcc aact catgag toggattittat ataggatgga 42O acaggaaggt atgtcc tdtc agitat cittaa ccc.tttcaac aagacattta cct atttgtc 48O titt cottacg ttct caaaat at 5O2

<210s, SEQ ID NO 24 &211s LENGTH: 244 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (244) <223> OTHER INFORMATION: AffymetrixID: 204750 s at <4 OOs, SEQUENCE: 24 gaccct cqcg at cittaat at ttgc.cagtga tigcctgcaaa aatgtgacat tacatgttcc 6 O

Ctccaaacta gatgcc.gaga aacttgttgg tagagittaac Citgaaagagt gctitt acagc 12 O tgcaaatcta att cattcaa gtgat cotga citt coaaatt ttggaggatg gttcagticta 18O tacaacaaat act attct at tdtcct cqga gaagagaagt tttaccatat tactitt.ccaa 24 O

Cact 244

<210s, SEQ ID NO 25 LENGTH: SO4

US 8,092,998 B2 103 104 - Continued

<210s, SEQ ID NO 31 &211s LENGTH: 453 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (453) <223> OTHER INFORMATION: AffymetrixID: 207008 at <4 OOs, SEQUENCE: 31 acctaacgaa gitat cott ca gcc tdaaaga gaatgaagt act catacat gttacaacac 6 O ggacga acct tdaaaactitt atgctaagtgaaataagcca gacat caa.ca gataaatagt 12 O titatgatt CC acctacatga ggtactgaga gtgaacaaat ttacagaga C agaaagcaga 18O acagtgatta C cagggactg aggggagggg agcatgggala gtgacggttt aatgggcaca 24 O gggtttatgt ttaggatgtt gaaaaagttctgcagataaa Cagtagtgat agttgtaccg 3OO caatgtgact taatgccact aaattgacac ttaaaaatgg tittaaatggit caattttgtt 360 atgtatattt tatat caatt taaaaaaaaa cct gagc.ccc aaaagg tatt ttaat cacca 42O aggctgatta aaccalaggct agaaccacct gcc 453

<210s, SEQ ID NO 32 &211s LENGTH: 385 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (385) <223> OTHER INFORMATION: AffymetrixID: 2O7815 at

<4 OOs, SEQUENCE: 32 Caagcc ctgc tigtacaagaa aat cattaag galacatttgg agagittagct act agctgcc 6 O taagtgtgca ctittcaatct aactgtgaaa gaatc.ttctg atgtttgtat tat cott citt 12 O at attatatt aacaaaataa atcaagttgt gigtatagt ca atc tatttct taataatact 18O gcaaaaataa tdctgacaca toacaattitc at attittaaa attitccagaa ttittaa.gcaa. 24 O aaag cattat gaaggaaggc titggtttaat aaagacitgat tttgttcagt gttatatgtt 3OO agctgataca tatttgttca tttatgtgat tdcagtactt tatagctaca tatttacctt 360 gaatgttaca attagcttgc caata 385

<210s, SEQ ID NO 33 &211s LENGTH: 491 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (491) <223> OTHER INFORMATION: AffymetrixID: 2O8051s at <4 OOs, SEQUENCE: 33 gaactic ccag ctaaacaacc aag actt cac tdaagattta t t c caattct agaattgttc 6 O tttittt tatt ttt tatttitt toaactgact aactt catta cct taaagcc tagaacatta 12 O ttctgctitta tittatatggc titt ct caatt ttattttgta gcatgggttgaatcgaactt 18O tttact agag aattitt acta gat atttgtc attcaagttt to atctgctt tataattgat 24 O acaccittgag gigt cacttitt ctaatactitt tacctataat gtgg taccca cct cago ccc 3OO taataaataa tatttittacc ctaatgtcaa atc.tttitt.cc caggctaact aaaaactgtg 360 tacaaaagga ttgcttgtaa atatgcatgt aaatagttct gttaataacc cactgttitta 42O

US 8,092,998 B2 113 114 - Continued

<210s, SEQ ID NO 46 &211s LENGTH: 398 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (398) <223> OTHER INFORMATION: AffymetrixID: 210895 s at <4 OOs, SEQUENCE: 46 gtgtacataa atttgacctg. citcatctata cacggittacc cagaacctaa gaagatgagt 6 O gttittgctaa gaaccaagaa ttcaactato gag tatgatg g tattatgca gaaatct caa 12 O gataatgtca cagaactgta coacgtttico atcagcttgt ctdttt catt ccctgatgtt 18O acgagcaata taccatctt ctd tatt ctd gaaactgaca agacgcggct tittat cittca 24 O c ctittct cita tagagcttga gqaccct cag cct cocc cag accacattcc ttggattaca 3OO gctgtactitc caa.cagtt at tatatgtgtg atggittittct gtctaattct atggaaatgg 360 aagaagaaga agcggcct cq Caact ctitat aaatgtgg 398

<210s, SEQ ID NO 47 &211s LENGTH: 216 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (216) <223> OTHER INFORMATION: AffymetrixID: 211506 s at

<4 OOs, SEQUENCE: 47 gtgttgaaggit gcagttittgc Caaggagtgc taaagaactt agatgtcagt gcatalaagac 6 O at actic caaa cct titccacc ccaaattitat caaagaactg agagtgattg agagtgg acc 12 O acactg.cgcc alacacagaaa ttattgtaaa gotttctgat ggaagagagc tictgtctgga 18O

CCC caaggaa aactgggtgc agagggttgt ggagaa 216

<210s, SEQ ID NO 48 &211s LENGTH: 378 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (378) <223> OTHER INFORMATION: AffymetrixID: 211734 s at <4 OOs, SEQUENCE: 48 acat ct coat tacaaatgcc acagttgaag acagtggaac ctact actgt acgggcaaag 6 O tgtggcagct ggactatgag tictgagcc cc ticaac attac titaataaaa gct cogcgtg 12 O agaagtactg gctacaattt tittatcc.cat tdttggtggit gattctgttt gctgtggaca 18O caggattatt tat citcaact cagcagoagg to acatttct cittgaagatt aagagaacca 24 O ggaaaggctt cagacittctgaac ccacatc ctaagccaaa ccc caaaaac aactgatata 3OO attact caag aaatatttgc aac attagtt tttitt coagc at cagcaatt gctact caat 360 tgtcaaacac agcttgca 378

<210s, SEQ ID NO 49 &211s LENGTH: 529 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature

US 8,092,998 B2 117 118 - Continued tgttittagag aaggaaattic aaaaaatgtt gta actgaaa gcactgttga atatgggitat 42O cggctttctt titt cactittg act cittaa.ca ttatcagtica act tccacat taatg 47s

<210s, SEQ ID NO 52 &211s LENGTH: 179 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (179) <223> OTHER INFORMATION: AffymetrixID: 212386 at <4 OOs, SEQUENCE: 52 gagatttacc atgitat cagt gcc toggcttt ttgttataaa gctttgtttgttctagtgctic 6 O ttittgctata aaatagacitg tag tacaccc tag taggaaa aaaaaaaaac taaatttaaa 12 O aataaaaaat at atttggct tatttitt.cgc aggagcaatic ctitttatacc atgaatatt 179

<210s, SEQ ID NO 53 &211s LENGTH: 295 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (114) . . (114) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (224) ... (224) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (295) <223> OTHER INFORMATION: AffymetrixID: 212671 is at

<4 OOs, SEQUENCE: 53 accalatgagg ttcCtgaggt cacagtgttt t ccaagttctic ccgtgacact gggtcagcc C 6 O aacaccct catctgtc.ttgt gigacaa.catc titt cotcctg togg to aacat cacntggctg 12 O agcaatgggc act cagt cac agaaggtgtt t ctgagacca gct tcct ct C Caagagtgat 18O catt cottct tcaagat cag ttacct cacc titcct coctt citgntgatga gattitatgac 24 O tgcaaggtgg agcactgggg cctggatgag cct cttctga aac actggga gcctg 295

<210s, SEQ ID NO 54 &211s LENGTH: 565 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (134) . . (134) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (565) <223> OTHER INFORMATION: AffymetrixID: 212897 at

<4 OOs, SEQUENCE: 54 aaggagacct ttgaagcttt ttgagggcaa actttacctt ttggtc.ccc aaatgatggc 6 O atttct ctitt gaaatttatt agatactgtt atgtc.ccc.ca aggg tacagg aggggcatcc 12 O Ctcagcct at gggnaacacic caaactagga ggggittattg acaggaagga atgaatccala 18O gtgaaggctt t ctgct Cttic gtgttacalaa C cagttt cag agittagctitt Ctggggaggit 24 O gtgttgtttgt gaaaggaatt Caagttgttgc aggacagatg agctcaaggit aaggtagctt 3OO tggcagcagg gctgat act a tigaggctgaa acaatcc titg tatgaagta gat catgcag 360 US 8,092,998 B2 119 120 - Continued tgacatacaa agaccalagga titatgtatat ttittatat ct ctdtggittitt gaaactittag tact tagaat tittggc ctitc tgcact actic titttgct citt acgaacataa tdgact citta agaatggaaa gggatgacat ttacctatgt gtgctgcctic attcc tiggtg aagcaactgc 54 O tacttgttct c tatgcct ct aaaat 565

<210s, SEQ ID NO 55 &211s LENGTH: 358 &212s. TYPE: DNA &213s ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (61). . (61) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (95). ... (95) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1OO) ... (100) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (182) ... (182) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (189) ... (189) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (218 ... (218) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (227) ... (227) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (229) ... (229) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (244) ... (244) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (258 ... (258) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (261) ... (261) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (27 ... (271) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (302) ... (3 O2) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (313) ... (313) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (324.) ... (324.) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (331) ... (331) 223 OTHER INFORMAT ON: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature US 8,092,998 B2 121 122 - Continued <222s. LOCATION: (1) ... (358) <223> OTHER INFORMATION: AffymetrixID: 212999 x at <4 OO > SEQUENCE: 55 Cactgcagaa talaggaaca t cc ctitgagg tacc cagoc aacctgtggc Cagaaggagg 6 O nttgtacctt gaaaagacac taaagcatt ttggingtgtin alagta agggit gggcagagga 12 O ggtagaaaat caattcaatt gtc.gcatcat t catggttct ttaat attga tigcticagtgc 18O antggcctna gaatat coca gcct citcttctggitttgntg agtgctintnt aagtaag cat 24 O ggtinga attgtttgggginca natatagtga niccittggtca Ctggtgttt C aaa cattctg 3OO gnaagt caca tonatcaaga atantttitta nttittaagaa agcataacca gcaataaa 358

<210s, SEQ ID NO 56 &211s LENGTH: 441 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (441) <223> OTHER INFORMATION: AffymetrixID: 213309 at <4 OOs, SEQUENCE: 56 gtatgtagca atcctg.cgtg toga aggcaaa taalactic titt aac aggcaat tatattgctg 6 O gccaaaatat gctatatttg tatacaaaga cattctaact cagttccagt atgaagaaag 12 O attatt cact ctagotccac tdagaaac at titt cotaagt gaaaacaatt tottaagatg 18O gaaatggatt ggattgtcaa attattattt attggagaaa aaaacct gat citacacattt 24 O ttactitat at ggggttgcca gag totctgg gttctagatg attittggtgg catgcttgct 3OO gagg cataat tactaaagag aatgtaagtg gacgggttcc Ctgaatc.ccc ggggt ccttg 360 gaga.gc.catc gaggagaatgtcaattgga citgaagctcc Ctggctgaag atacatgcc.g 42O agticagdaca tdgtagaga t 441

<210s, SEQ ID NO 57 &211s LENGTH: 431 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (178) ... (178) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (431) <223> OTHER INFORMATION: AffymetrixID: 213506 at

<4 OO > SEQUENCE: 57 gcacacagag atttgagaac cattgttctgaatgctgctt C catttgaca aagtgcc.gtg 6 O ataatttittgaaaagagaag caaacaatgg tdt ct cittitt atgttcagot tataatgaaa 12 O tctgtttgtt gacittattag gactittgaat tatttctitta tta accct ct gagttittingt 18O atgt attatt attaaagaaa aatgcaatca ggattittaaa catgitaaata caaattttgt 24 O ataacttittg atgactitcag togaaattitt.c agg tagt ctog agtaatagat tdttittgc.ca 3OO cittagaatag catttgccac titag tattitt aaaaaataat tdttggagta tittattgtca 360 gttttgttca cittgttat ct aatacaaaat tataaagcct tcagagggitt toggaccacat 42O citctittggaa a 431

<210s, SEQ ID NO 58 &211s LENGTH: 251 US 8,092,998 B2 123 124 - Continued

&212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (251) <223> OTHER INFORMATION: AffymetrixID: 213883 s at <4 OOs, SEQUENCE: 58 agagaactitc tagtgtatgg atttaaagat ttct citttitt catt catata ccattt tatg 6 O agttctgt at aattittttgt gigttitttgtt ttgttgagtt aaagtatatt attgtgagat 12 O ttatttaata ggact tcc tt togaaagctgt ataatagtgt ttct cqggct tctgtcticta 18O tgagagatag cittatt actic tdatact citt taatcttitta caaaggcaag ttgcc acttg 24 O toattitttgt t 251

<210s, SEQ ID NO 59 &211s LENGTH: 332 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (332) <223> OTHER INFORMATION: AffymetrixID: 214305 s at

<4 OO > SEQUENCE: 59 gttctgaccc ctdgaaagac accaattggc acaccagcca tdaacatggc taccc ctact 6 O cCaggit caca taatgagtat gactic ctgaa cagct tcagg Cttggcggtg ggaaagagaa 12 O attgatgaga gaaatcgc.cc actittctgat gagga attag atgctatgtt CCC agaagga 18O tataagg tact tcctic ct co agctggittat gttcc tatto gaact coagc ticgaaagctg 24 O acagct actic caacac ctitt gggtgg tatg actggitttcc acatgcaaac tdaagat cqa 3OO actatgaaaa gtgttaatga C cago Catct gg 332

<210s, SEQ ID NO 60 &211s LENGTH: 241 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (32) ... (32) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (241) <223> OTHER INFORMATION: AffymetrixID: 21451.2 s at

<4 OOs, SEQUENCE: 60 gaccalagagg gtgttctgact gctagagc.cg anciaag.cga tigcct aaatc aaaggaactt 6 O gttt Cttcaa got cttctgg cagtgattct gacagtgagg ttgacaaaaa gttaaagagg 12 O aaaaagcaag ttgctic Caga aaaacctgta aagaaacaaa agaCaggtga gactt.cgaga 18O gccCtgtcat Cttctaalaca gag cagcago agcagagatg atalacatgtt t cagattggg 24 O a. 241

<210s, SEQ ID NO 61 &211s LENGTH: 436 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (156) ... (156) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature US 8,092,998 B2 125 126 - Continued <222s. LOCATION: (244) ... (244) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (250 ... (252) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (254) ... (254) 223 OTHER INFORMAT ON: n is a C 9. or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (264) ... (264) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (3O4) ... (3O4) 223 OTHER INFORMAT ON: n is a C 9. or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (306) ... (306) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (321) ... (321) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (338) ... (338) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (356) ... (356) 223 OTHER INFORMAT ON: n is a C, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (436) 223 OTHER INFORMAT ON: AffymetrixID: 214807 at

<4 OOs, SEQUENCE: 61 tott catt co acgaga attt tgatttittaa cagcagt ct c tictttittctic agcattgcaa. 6 O atatatatgt atatatacat t catgaccaa agitat cqctt act gaccatg cagctgtaaa 12 O ccttctgtgc citat caaaca aatacatago atgaanctaa ttittagaagt tt catggggg 18O aattittaggg gaaagtataa acctaagagt gagtgaatgg agatgattica tigaaaaaaa 24 O aaanaaaaan innanatgtgc tatnaggcag agittattaac ttcttittagt togttgtttga 3OO gatngngttctgct cittgtt incccaggctg gagtgcantg gcgtgat Ct c gtctcinctgc 360 aacctic cqcc ticc caggttc aag.cgatt ct Cctgc.cccag Ctactittgga ggctgaagtg talagagttgc titgagc 436

<210s, SEQ ID NO 62 &211s LENGTH: 448 &212s. TYPE: DNA &213s ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (448) <223> OTHER INFORMATION: AffymetrixID: 214953 S at

<4 OOs, SEQUENCE: 62 atagattctic ticcitgattat ttatcaCata gcc ccttagc cagttgtata ttatt cittgt 6 O ggtttgttgac cca attalagt cc tact titac atatgctitta agaatcgatg ggggatgctt 12 O

Catgtgaacg tdggagttca gctgcttct c ttgcc taagt att cott to c tgat cactat 18O gcattittaaa gttaaacatt tittaagtatt t cagatgctt tagagagatt titt tt to cat 24 O gactgcattt tactgtacag attgctgctt ctgctatatt tgttgatatag gaattalaga.g 3OO gatacacacg tttgtttctt titatgtgcac acattaggca ttgagacttic 360

US 8,092,998 B2 133 134 - Continued

22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (541) <223> OTHER INFORMATION: AffymetrixID: 218545 at

<4 OOs, SEQUENCE: 71 agcatggatt toaacat cac ttatttatct gtataattgg aaataaaa.ca ccgatatgat 6 O agagaatcat tcc.ggcatta cct aacct ct tctgcagttg gatctatgta ttitt cattgg 12 O tctactgaaa acgaacaata caattaaaag cactaaagat tattatatta attcaactitt 18O gatctgatat at cacttaaa citaaaggggt gtgttgttggtg tatgcttgtt toc tatttct 24 O gctic tittaaa gatactittga atcaataaaa ccattagt ct acaaatcaaa ttgttgaactt 3OO aatctotaga aagagaatat aacticago catttataggaa tittaggttca agtacaggat 360 atatgaaatc ttitt cocagt attt cagaat gtact taatt cacaggcagg atgcttcaat 42O gcaaaatcat gaatatttitt aattcaaaac taaaatgtca ttaatatgta totatgcaaa 48O tgttittatct tattittctga aatgcatcta ctitt catggg citttgtacgt ttctgagatt 54 O t 541

<210s, SEQ ID NO 72 &211s LENGTH: 160 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (160) <223> OTHER INFORMATION: AffymetrixID: 21872.8 s at

<4 OOs, SEQUENCE: 72 at atcgatac attatggtgc cgagtggtaa catgggagtg tttgatccala Cagaaataca 6 O

Caatcgaggg cagctgaagt cacacatgaa agaa.gc.catg at Caagcttg gtttcCactt 12 O gctctgctitc tt catgitatic tittatagitat gat cittagot 16 O

<210s, SEQ ID NO 73 &211s LENGTH: 461 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (461) <223> OTHER INFORMATION: AffymetrixID: 219269 at

<4 OO > SEQUENCE: 73 aggctagaaa at Cttgctgc ticcgt.cttag catt C calaga gagtgct tcc agg tatttag 6 O atagoc ct ca gttct caaat attagactac gtgtaaaatc ttggg tacct ttagatt citt 12 O gtaacactag totgtact co cittitt cottc cccaagactgataggatgca agctgaggit c 18O gtggcacagg aatgacagac accatttggg gagtatic cac agagt caaag galacact aga 24 O atc.cccacct cagcgtgagg ataattgatt to cagotgca ataagcc.gtg cct cattata 3OO gccacactgt ggctagatta tactt Ctttg ggtgctgtgc taagaatgtc. aatggaaaaa 360 gcc.gat ct ca gattttgttt gaagittaa.ca togcctgacac agacatcct t t cotct caca 42O agctgttgttga cittagtagat aaaatact.gc cittctgcctt t 461

<210s, SEQ ID NO 74 &211s LENGTH: 563 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature

US 8,092,998 B2 141 142 - Continued <222s. LOCATION: (43) . . (44) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (53) . . (53) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (62) . . (62) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (70) . . (70) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (74) . . (74) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (86).. (86) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (113) . . (113) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (124) . . (124) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (127) . . (127) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (142) ... (142) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (148) ... (148) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (171) ... (4 6 5) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (535) <223> OTHER INFORMATION: AffymetrixID: 36711 at

<4 OOs, SEQUENCE: 83 ttgcacggat ctaagttatt citccc.cagcc agagc.ccging citinnctgctic ccingggaaaa 6 O gntgg.cgtan tdgnoctgag ctgggnttta tattittatat citgcaaataa atnac attitt 12 O atcntanatt tagggaaag.c cngagagnaa caacaaaaaa totttaa.gcc nnnnn.nnnnn 18O

...... 24 O

...... 3OO

...... 360

...... nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnntattg cccggct cot agaatttatt tattitcct ga cittacago aa gogagittatc gtc.ttctgta ttittg 535

<210s, SEQ ID NO 84 &211s LENGTH: 494 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (124) . . (124) <223> OTHER INFORMATION: n is a C, g, or t US 8,092,998 B2 143 144 - Continued

22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (184) . . (184) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (237) ... (262) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (447) ... (4 64) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (494) <223> OTHER INFORMATION: AffymetrixID: 38037 at

<4 OOs, SEQUENCE: 84 c cactic tatg agttgg actt cagtc.ttgcc tagg.cgattt tdt citaccat ttgttgttittg 6 O aaag.cccaag gtgctgatgt caaagtgtaa cagatat cag togt ct coccg tdtcct citcc 12 O ctgnolaagtic ticagaagagg ttgggct tcc atgcc togtag ctitt.cctggit coct caccc.c 18O cating.ccc.ca gg.cccacago gtgggaactic actitt coctit gtgtcaagac atttctnnnn 24 O nnnn.nnnnnn nnnnnn.nnnn innact coatg Caggggt cag ticagoagag gacagtctgg 3OO agaagg tatt agcaaa.gcaa aaggctgaga aggaacaggg aac attggag Ctgactgttc 360 ttggta actg attacctgcc aattgctacc gagaaggttg gaggtgggga aggctttgta 42O taatcc cacc cacct cacca aaacgannnn nnnnnnnnnn nnnngtcct t t ctdgaagtt 48O tctggtgcca ttt c 494

<210s, SEQ ID NO 85 &211s LENGTH: 492 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (492) <223> OTHER INFORMATION: AffymetrixID: 201386 s at

<4 OOs, SEQUENCE: 85 ggagat catc tdacactgct gaacgt.ctac catgcttitta aacaaaatca tdaatcggitt 6 O cagtggtgtt atgacaactt cattalactac aggtocc tiga tigt cc.gcaga caatgitacgc 12 O cago agctat citcgaattat gigacagattit aatttgcctic gtcgaagtac tdactttaca 18O agcagggact attatattaa tataagaaaa gotttggitta Ctggg tattt tatgcaggtg 24 O gCacatttag aacgaac agg gcatt actta actgtgaaag atalaccaggt ggttcagttg 3OO catc.cct cita citgttcttga ccacaaacct gaatgggtgc tittataatga gtttgttcta 360 acaacaaaga attacatc.cg gaCatgtaca gat at Caagc Cagaatggitt ggtgaaaatt 42O gcc cct caat attatgacat gag caattt C C Cacagtgtg aagcaaagag acagttggac 48O cgcatcattg cc 492

<210s, SEQ ID NO 86 &211s LENGTH: 378 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (378) <223> OTHER INFORMATION: AffymetrixID: 2O1890 at <4 OOs, SEQUENCE: 86 gctactittga attaatctgc Ctt tatgttt gggagaagaa agctgagaca ttgcatgaaa 6 O

US 8,092,998 B2 151 152 - Continued

SEO ID NO 95 LENGTH: 309 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (309) OTHER INFORMATION: AffymetrixID: 204467 s at SEQUENCE: 95

Ctcggaattic cctgaa.gcaa cactgccaga agtgttgttitt gg tatgcact ggttcct taa 6 O gtggctgtga ttaattattgaaagtggggt gttgaagacic ccaac tact a ttgtagagtg 12 O gtct atttct cocttcaatic ctdtcaatgt ttgctittatg tattittgggg aactgttgtt 18O tgatgtgitat gtgtttataa ttgttataca tttittaattig agccttittat taaCatatat 24 O tgttatttitt gtc.t.cgaaat aatttitt tag ttaaaatcta ttttgttctga tattggtgtg 3OO aatgctgta 309

<210s, SEQ ID NO 96 &211s LENGTH: 521 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (521) <223> OTHER INFORMATION: AffymetrixID: 204848 x at

<4 OOs, SEQUENCE: 96 acactic gott ctdgaacgtc tdagattatc aataagcticc tag to cagac gcc atgggit C 6 O attt cacaga ggaggacaag gct actatica caa.gc.ctgtggggcaaggtg aatgtggaag 12 O atgctggagg agaaac cctg ggaaggct Co tttgtcta cc catggacc cagaggttct 18O ttgacagott toggcaacctg. tcc totgcct c togcc at cat giggcaac ccc aaagttcaagg 24 O

Cacatggcaa galaggtgctg act tccttgg gagatgc.cat aaa.gc acctg gatgat citca 3OO agggcaccitt toccagctg agtgaactgc actgttgacaa gctgcatgtg gatcctgaga 360 acttcaagct c ct gggaaat gtgctggtga ccgttittggc aatccatttic ggcaaagaat t caccc.ctgaggtgcaggct tcc tigcaga agatggtgac to agtggCC agtgc cctgt cctic cagata ccactgagcc ticttgcc.cat gattcagagc t 521

SEO ID NO 97 LENGTH: 472 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (472) OTHER INFORMATION: AffymetrixID: 2O5239 at SEQUENCE: 97 atttcaaaat ttctgcattc acggagaatg caaatatata gag cacctgg aag cagtaac 6 O atgcaaatgt cagcaagaat attitcggtga acggtgtggg gaaaagt cca tgaaaactica 12 O cago atgatt gacagtagtt tat caaaaat tdcattagca gccatagctg c ctittatgtc 18O tgctgttgatc ct cacagotg ttgctgtt at tacagtic cag cittagaagac aatacgt cag 24 O gaaatatgaa ggagaa.gctg aggaacga aa gaaactt.cga Caagagaatg gaaatgtaca 3OO tgctatagca taactgaaga taaaattaca ggatat caca ttggagt cac tgccaagtica 360 tagc cataaa tdatgagt cq gtcct ctitt c cagtggat.ca taaga caatg gaccotttitt

US 8,092,998 B2 155 156 - Continued cc cattacca cacccacaaa gag taggtag ct citctgaag gctttitt acc cagcaatgtc 360 ct 362

<210s, SEQ ID NO 101 &211s LENGTH: 416 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (416) <223> OTHER INFORMATION: AffymetrixID: 205900 at <4 OOs, SEQUENCE: 101 t caagt cct c tdtggcagt t c cagcgtga ggtttgtttic taccactitat tcc.ggagtaa 6 O ccagataaag agatgc cct c tdttt catta gctictagttc. tcc cc cagoa toactaacaa 12 O atatgcttgg caagaccgag gtcgatttgt CCC agcCtta ccggaga aaa gagctatggit 18O tagttacact agct catcct attic.ccc.cag ct ctittctitt totgctgttt cocaatgaag 24 O ttitt cagat.c agtggcaatc. tcagttcc ct tcc tatgacc ctdctttgtt ctitt.ccc.gag 3OO aaac agttca gcagtgacca ccacccacat gacatttcaa gcaccaccitt aagccago.ca 360 gagtaggacc agittagacct agggtgtgga cagct cottg Catcttalaca Ctgtgc 416

<210s, SEQ ID NO 102 &211s LENGTH: 560 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (560) <223> OTHER INFORMATION: AffymetrixID: 205950 s at <4 OOs, SEQUENCE: 102 gag.ccc catt cacaaattitt gaccc ct cta citctic ct tcc titcatcc ct g gatttctgga 6 O cctaccctgg ct citctgact catcct cotc tittatgagag togtaacttgg atcatctgta 12 O aggaga.gcat cagtgtcagc ticagagcagc tiggcacalatt C cqcagcctt Ctatcaaatg 18O ttgaaggtga taacgctgtc. cc catgcagc acaacaa.ccg cccaa.cccala cct Ctgaagg 24 O gcagaacagt gagagctt cattttgatgat tctgagaaga aacttgtcct tcc to aagaa 3OO cacagocctg cittctgacat aatccagtta aaataataat ttittaagaaa taaatttatt 360 t caat attag caagacagca togc ctitcaaa totaatctgta aaactaagaa acttaaattit 42O tagttcttac togcttaattic aaataataat tagtaagcta gcaaatagta atctgtaagc 48O ataagctitat cittaaattica agtttagttt gagga attct ttaaaattac aactaagtga 54 O tttgtatgtc. tatttitttitc 560

<210s, SEQ ID NO 103 &211s LENGTH: 447 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (447) <223> OTHER INFORMATION: AffymetrixID: 2O5987 at <4 OOs, SEQUENCE: 103 Ccagctgttg Ctggitttgtc atgcct Cogg Cttct accca aag cctgttt gggtgacatg 6 O gatgcggaat galacaggagc aactgggcac taalacatggit gat attcttic ctaatgctga 12 O tgggacatgg tat citt Cagg tdatcctgga ggtggcatct gaggagcctg. Ctggcctgtc. 18O

US 8,092,998 B2 169 170 - Continued ggc.cggagaa aggaaaagac attat caggg cctggaaagt Ctctt coagt t catcagggit ag 482

SEQ ID NO 120 LENGTH: 419 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (249) ... (249) OTHER INFORMATION: n is a, c, g, or t FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (419) OTHER INFORMATION: AffymetrixID: 212224 at

SEQUENCE: 12O acagtgttct Ctaatgttac agatgagatg cgcattgcca aagaggagat ttittggacca 6 O gtgcagcaaa t catgaagtt taaatctitta gatgacgtga t caaaagagc aaacaatact 12 O ttctatggct tat cagoagg agtgtttacc aaaga cattgataaag.c cat aacaatcto C 18O tctgct ctgc aggcaggaac agtgtgggtgaattgctatg gcgtggtaag tgcc.cagtgc 24 O

CCCtttggint gggattcaag atgtctggaa atggaagaga actgggaga.g tacggitttcc 3OO atgaatatac agaggit caaa acagt cacag tdaaaatcto tcagaagaac t cataaagaa 360 aatacaagag toggagagaag ct cittcaata gctaa.gcatc. tcc ttacagt Cactaat at 419

SEQ ID NO 121 LENGTH: 343 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (343) OTHER INFORMATION: AffymetrixID: 212232 at SEQUENCE: 121 agaaggcago totgcattct accttgcttg actggaattig totgaagctt tittctggcct 6 O cittittct cita gtcggccacc cct galagtgc tigaggtotaa gtggitttacc tcgtgctgat 12 O agatggccac act ctittaga gtagttctica taagttctag aactggtagc tcqgt cqttt 18O cgcacactag gtggcataca ggcagcagca ggtgttcata t ccttgattit tgaga atttic 24 O c cct caagta totggcagta aatacaacaa gacactictat g tattaatgt ctic cattgtc 3OO ttaa.ccctgt to caaaacaa aattcacctic ctittctittat gtg 343

SEQ ID NO 122 LENGTH 427 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (209) ... (209) OTHER INFORMATION: n is a, c, g, or t FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (427) OTHER INFORMATION: AffymetrixID: 212534 at

SEQUENCE: 122 gtggattgtt totatic cctt acctgctitt c tattgggitta totgtggata tattgtttitt 6 O atttgttcag catctoctitc cc catcttct ggtaacacaa cctittattta tttgttgggga 12 O acct attic cc ttggct tag gtgagcatgt gaccaggcct ggcct Cotgagtc.ccacagc 18O

US 8,092,998 B2 173 174 - Continued

&212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (37) . . (37) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (.437) ... (437) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (452) ... (452) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (501) <223> OTHER INFORMATION: AffymetrixID: 215933 is at

<4 OOs, SEQUENCE: 125 ggacagttcc ttgat Caga ggcaagattit gcc Cagngaa Cagaataaag gtgct tctitt 6 O ggatagct ct caatgttcgc cct cocctgc ctic cc aggaa gaccttgaat cagagatttic 12 O agaggattct gat Caggaag tacattga gggcgataaa agctattitta atgctggatg 18O atgaccactg gcattggcat gttcagaaaa citggatt tag gaataatgtt ttgct acaga 24 O aaatctt cat agaagaactg gaaggctata taagaaaggg aat caattct c togg tattot 3OO ggaaac ctaa aaatatttgg togcactgctic aattaacaaa cct acatgga gacct taatt 360 ttgacittaac aaatagittta totactgctic titaggttgtt ttgataaagt gacattatag 42O tgattaaatt ctitt concitt taaaaaaa.ca gntagtggitt tt cactattt ataaatagga 48O ccttcttgaa cqacttittct g 5O1

<210s, SEQ ID NO 126 &211s LENGTH: 424 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (424) <223> OTHER INFORMATION: AffymetrixID: 217478 s at <4 OOs, SEQUENCE: 126 ctgttttgtc. agtaatct ct tcc cacccat gctgacagtgaactggcagc at catt.ccgt. 6 O CCCtgtggaa ggatttgggc Ctact tttgt Ctcagctgtc gatggactica gct tccaggc 12 O cittittcttac ttaaactitca caccagaacc ttctgacatt ttct c ct gca ttgttgactica 18O cgaaattgac cqctacacag caattgccta ttggg taccc cqqaacgcac tocctic aga 24 O tctgctggag aatgtgctgt gtggcgtggc Ctttggcctg ggtgtgctgg gcatcatcgt. 3OO gggcattgtt ct catcatct act tccggaa gocttgctica gigtgactgat tct tccagac 360 cagagtttga tigc.cagoagc titcggc.catc caaacagagg atgct cagat ttct cacatc 42O ctgc 424

<210s, SEQ ID NO 127 &211s LENGTH: 53 O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (530) <223> OTHER INFORMATION: AffymetrixID: 217736 s at <4 OOs, SEQUENCE: 127 tctgtctggit citt cotctag aaggttctac cqcagaaatt gatgtgtgct c cctd.ccctic 6 O

US 8,092,998 B2 183 184 - Continued atat cqtctt togaaaatgtt aaattgagaa acctgttaac ttacatttta tognattggca 18O cattgt atta ct tactgcaa gagatatttic attitt cagoa cagtgcaaaa gttctittaaa 24 O atgcatatgt cittitttittct aattic.cgttt tdttittaaag cacattittaa atgtagttitt 3OO ct catttagt aaaagt 316

<210s, SEQ ID NO 139 &211s LENGTH: 525 &212s. TYPE: DNA &213s ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (525) <223> OTHER INFORMATION: AffymetrixID: 212266 s at <4 OOs, SEQUENCE: 139 gttgagtttg cct ctitatgg tgacittaaag aatgctattg aaaaactitt C taaaggaa 6 O ataaatggga gaaaaataaa attaattgaa ggcagcaaaa ggcacagtag gtcaagaagc 12 O aggit ct cat ccc.ggaccag aagttcct ct aggtotcgta gcc gatc.ccg titc.ccgtagt 18O cgcaaatctt acago.cgg to aagaa.gcagg agcaggagcc ggagc.cggag caagt ccc.gt 24 O tctgttagta ggit citcc.cgt. gcc tagaag agc.ca.gaaac gtggttcttic aagtagatct 3OO aagttct coag Catctgtgga tcgc.cagagg tcc.cggit coc gat calaggt c Cagat cagtt 360 gacagtggca attaaactgt aaataacttg CCCtgggggc Ctttittittaa aaaacaaaaa.

CCaCaaaaat it cocaaac Ca tacttgctaa aaattctggit aagtatgtgc titt totgtgg gggtgggatt tdgaaggggg gttgggttgg gctggat atc tttgt 525

<210s, SEQ ID NO 140 &211s LENGTH: 581 &212s. TYPE: DNA &213s ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (72). (74) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (239 ... (253) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (268 ... (268) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (270 ... (305) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (3O8 ... (308) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (446 ... (526) 223 OTHER INFORMAT ON: n is a 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (581) 223 OTHER INFORMAT ON: AffymetrixID: 53912 at

<4 OOs, SEQUENCE: 140 acaatgaggc attctgtc.ct c ct gctgcca ttctt catct c cactgagag ccagagctgg 6 O taggagc.cga ginnincoacag gcattctgca ttgct ct act Cttaggtttgttgttgttgttgat 12 O cct tcc cct c cct gtc.gc.cc act cotcc ct c ct ctdgcta t cotaccct g totgtgggct 18O

US 8,092,998 B2 187 188 - Continued

<4 OOs, SEQUENCE: 143 cgat ct coag cccaagatga titc.ca.gcagt gigt cittgctic titact cottt tdgttgaaca 6 O agcagcggcc ctgggaga.gc ct cagctctg ctatat cct gatgc catcc titttctgta 12 O tggaattgtc ct caccct co totactgtcg actgaagatc caagtgcgaa aggcagotat 18O alaccagct at gagaaatcag atggtgttta cacgggcctg agcaccagga accaggagac 24 O ttacgagact ctgaag catg agaalaccacc acagtagctt tagaatagat gcggit catat 3OO tottctittgg cittctggttct tccago'cct catggttggc at cacatatg cctdcatgcc 360 attalacacca gctggc ccta ccc.ctataat gatcc tdtgt cctaaattaa tatacaccag 42O tggttcct co tocctgttaa agactaatgc ticagatgctg tttacggata tittatattot 48O agt ct cactic ticttgtc.cca ccc.ttcttct citt coccatt cccaact coa gctaaaatat 54 O

<210s, SEQ ID NO 144 &211s LENGTH: 559 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) . . (559) <223> OTHER INFORMATION: AffymetrixID: 201722 s at

<4 OOs, SEQUENCE: 144 attttgttitt catctgttgat agt catggat gcttittattt to cittggggit gctgaaattg 6 O agctgaaaaa aaaaggct ct ttgaatatag ttittaatttic tict ctacagt tttittttgtt 12 O tggtttgtgg gctgttggaa ttgtaattitt taattgcctt ctaaaaaatg gaaatttaac 18O aatgtctgat ct cagotgaa caaattagat gttt cagttg ct cittgggtc. aactggctta 24 O cagatttaca totgcacaca cacacaaatt tottat caca ttitt.cgactt citt cacttga 3OO cctaactgat tatgcgaaat acccaagatt catgctactg taccacagat ttgttitt cac 360 agcaataaat citt cagttct gttgtttatg attcc actta acaaaaggcc tdcagaagtg 42O attt attatt toggg tatttg gagataatac atttgatggit tttittggaaa acctttittca 48O citccatactic agatatgctt cattgttcaaa tdcat attta gattagatta ttgaattgta 54 O atgtttat cit gctgcttitt 559

<210s, SEQ ID NO 145 &211s LENGTH: 453 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (453) <223> OTHER INFORMATION: AffymetrixID: 218627 at

<4 OOs, SEQUENCE: 145 taat catttic tdggttcact gcgact cact gtag togctgg ggat.ccc cct totaacactg 6 O gaactgaaag gcagtgatga aagctatgtc. aag catt cat tattotgaag aggaggagaa 12 O atgccacata cct titcc.cat gigg acctgtg gtggaatgaa to catacttic togcct cactt 18O cgagcagact tttgttct cq gogct cotca catggagtt to atgct tca ttitt cacatc 24 O t citctgcaca attagattgg gagct cottg agggcagagt acgtgccitta atctittatct 3OO ttgtaatgcc acaatgaaca gagtgcct Co ttacactg. taggagctta agaaatactic 360 actgaatgca taatgaatgaatgaacaaa taaggaatg act aaggatgtttgtagt c 42O tataatatagaatgggattt actctgctitt acc 453