DOCSLIB.ORG

B Inhibition in a Mouse Model of Chronic Colitis1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
B Inhibition in a Mouse Model of Chronic Colitis1 The Journal of Immunology Differential Expression of Inflammatory and Fibrogenic Genes and Their Regulation by NF-␬B Inhibition in a Mouse Model of Chronic Colitis1 Feng Wu and Shukti Chakravarti2 Fibrosis is a major complication of chronic inflammation, as seen in Crohn’s disease and ulcerative colitis, two forms of inflam- matory bowel diseases. To elucidate inflammatory signals that regulate fibrosis, we investigated gene expression changes under- lying chronic inflammation and fibrosis in trinitrobenzene sulfonic acid-induced murine colitis. Six weekly 2,4,6-trinitrobenzene sulfonic acid enemas were given to establish colitis and temporal gene expression patterns were obtained at 6-, 8-, 10-, and 12-wk time points. The 6-wk point, TNBS-w6, was the active, chronic inflammatory stage of the model marked by macrophage, neu- trophil, and CD3؉ and CD4؉ T cell infiltrates in the colon, consistent with the idea that this model is T cell immune response driven. Proinflammatory genes Cxcl1, Ccl2, Il1b, Lcn2, Pla2g2a, Saa3, S100a9, Nos2, Reg2, and Reg3g, and profibrogenic extra- cellular matrix genes Col1a1, Col1a2, Col3a1, and Lum (lumican), encoding a collagen-associated proteoglycan, were up-regulated at the active/chronic inflammatory stages. Rectal administration of the NF-␬B p65 antisense oligonucleotide reduced but did not abrogate inflammation and fibrosis completely. The antisense oligonucleotide treatment reduced total NF-␬B by 60% and down- regulated most proinflammatory genes. However, Ccl2, a proinflammatory chemokine known to promote fibrosis, was not down- regulated. Among extracellular matrix gene expressions Lum was suppressed while Col1a1 and Col3a1 were not. Thus, effective treatment of fibrosis in inflammatory bowel disease may require early and complete blockade of NF-␬B with particular attention to specific proinflammatory and profibrogenic genes that remain active at low levels of NF-␬B. The Journal of Immunology, 2007, 179: 6988–7000. ibrosis is a major complication of chronic inflammation, as innate immunity and acute phase response (8, 9). In IBD patients, the seen in Crohn’s disease and ulcerative colitis, two major lamina propria macrophages have increased NF-␬B p65 expression F forms of inflammatory bowel diseases (IBD).3 Crohn’s dis- and DNA-binding activity accompanied by an increased production ease in particular is prone to complications of fibrosis and stenosis (1, of IL-1, IL-6, and TNF-␣ (10). 2). The 2,4,6-trinitrobenzene sulfonic acid (TNBS) hapten, given as In the chronic TNBS-induce colitis model, we have further shown one or two enemas with ethanol as a carrier to disrupt epithelial in- that NF-␬B antisense oligonucleotide enemas, given each time with tegrity, induces acute inflammation and colitis in the mouse with the TNBS treatment, reduced the severity of disease in terms of body Crohn’s colitis-like transmural tissue damage (3–5). In an earlier weight loss and colonic inflammation as seen by histology (6). study, we modified the TNBS-induced colitis model by giving mul- Trichrome-stained histology of colon from TNBS-w8 mice treated tiple low doses of TNBS over a period of 6 wk that resulted in chronic with the NF-␬B antisense oligonucleotide indicated considerable re- inflammation and fibrotic changes in the colonic tissue that persisted duction in collagen deposition, with only 33% of the animals showing for at least 4 wk without additional TNBS administration (6). Neurath residual mild fibrosis. Another study of chronic TNBS-induced colitis et al. (7) showed that acute inflammation in the TNBS-induced colitis achieved increased inhibition of fibrosis using a deoxyoligonucleotide model could be abrogated by blocking NF-␬B p65 subunit expression that binds to the general NF-␬B-binding consensus sequence, deliv- with an antisense oligonucleotide targeted against the translation start ered directly into cells by encapsulating the oligonucleotide in a Sen- site. The NF-␬B transcription factor regulates the expression of a va- dai virus envelope (11). riety of genes that encode proinflammatory cytokines and proteins of In the current study, we explored the connection between chronic inflammation and fibrosis in the TNBS-induced colitis model with specific blockade of the p65 NF-␬B subunit. Gene Department of Medicine, Division of Gastroenterology, Johns Hopkins University School of Medicine, Baltimore, MD 21205 expression patterns of the colon were obtained at defined times from chronic inflammatory to late stages of the model. Our results Received for publication September 22, 2006. Accepted for publication August 17, 2007. show that high expression of inflammation-related genes at TNBS- The costs of publication of this article were defrayed in part by the payment of page w6, a stage with active and chronic inflammation, was followed by charges. This article must therefore be hereby marked advertisement in accordance their rapid decline. Profibrogenic extracellular matrix genes were with 18 U.S.C. Section 1734 solely to indicate this fact. also up-regulated at this stage, but their overexpression continued 1 This work was supported by National Institutes of Health Grant EY11654 and a Senior after inflammation had subsided. We further studied the amelio- Research Investigator Award from the Crohn’s and Colitis Foundation of America (to S.C.). rative effects of NF-␬B p65 inhibition on the expression of specific 2 Address correspondence and reprint requests to Dr. Shukti Chakravarti, Department of Medicine, Division of Gastroenterology, Johns Hopkins University School of Medicine, inflammation and fibrosis-related genes. 720 Rutland Avenue, Baltimore, MD 21205. E-mail address: [email protected] 3 Abbreviations used in this paper: IBD, inflammatory bowel disease; ECM, extra- Materials and Methods cellular matrix; qRT-PCR, quantitative RT-PCR; TNBS, 2,4,6,trinitrobenzene sul- Experimental colitis and NF-␬B blockade fonic acid; CT, cycle threshold. CD-1 outbred female mice, 10–12 wk old (Charles River Laboratories), Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 were maintained in a conventional animal housing facility at the Johns www.jimmunol.org The Journal of Immunology 6989 detected in the sample. The background signal was 76 Ϯ 7 arbitrary units. We compared saline-w6 with TNBS-w6 and saline-w10 with TNBS-w8, TNBS-w10, TNBS-w12, respectively. Compared with the saline control, the expression signal in the TNBS-treated groups was considered signifi- cantly different if 1) fold change was Ͼ2, 2) a difference in signal intensity of 100 arbitrary units or greater, and 3) received a “present call” in at least one array. The following web sites were used for functional annotation of novel genes, GeneCards (www.genecards.org/) (13) and National Center for Bio- technology Information (www.ncbi.nlm.nih.gov/entrez). FIGURE 1. Overview of a mouse model of TNBS-induced chronic co- litis. Mice were given TNBS enemas weekly for 6 wk and sacrificed at Real-time quantitative RT-PCR (qRT-PCR) weeks 6, 8, 10, and 12 for histology, immunohistology, and isolation of To confirm the gene expression changes, RT-PCR were performed by us- total RNA for qRT-PCR and microarray gene expression profiling. ing a QuantiTect SYBR Green PCR Kit (Qiagen) with the following spe- cific primers: Gapdh: forward 5Ј-TTGTCTCCTGCGACTTCA, reverse 5Ј- CCTGTTGCTGTAGCCGTATT; Il1b: forward 5Ј-GAATCTATACCTGT Hopkins University (Baltimore, MD) following animal protocols approved CCTGTG, reverse 5Ј-ACCGCTTTTCCATCTTCT; Cxcl1: forward 5Ј-AC by the Animal Use and Care Committee at Johns Hopkins University. The TGCACCCAAACCGAAGTC, reverse 5Ј-CAAGGGAGCTTCAGG-GTC chronic colitis model was developed by weekly enemas of TNBS (Sigma- AA; Col1a1: forward 5Ј-GTACTCCTGGTGCTGATG, reverse 5Ј-GAAG Aldrich) in 0.1 ml of 45% ethanol given once a week for 6 wk (6). For the CCTCTTTC-TCCTCTCTGA. Col3a1: forward 5Ј-CAGGTCCTAGAGG NF-␬B blockade, mice were treated intrarectally with 150 ␮g of an anti- AA-ACAGA, reverse 5Ј-TCACC-TCCAACTCCAACAATG; Lum: sense phosphorothioate oligonucleotide for the NF-␬B subunit p65 (5Ј- forward 5Ј-TCGAGCTTGAT-CTCTCCTAT, reverse 5Ј-TGGTCCCAGG GAAACAGATCGTCCATGGT-3Ј), or control oligonucleotide (5Ј- ATCTTACAGAA; Pla2g2a: forward 5Ј-CAAAGG-ATTCCCCCAAGGA Ј Ј Ј GTACTACTCTGAGCAAGGA-3 ) in 0.1 ml of dH2O 1 day before each T, reverse 5 -CTCCAGGCGCTTGTAGCAA; Saa3: forward 5 -CCTGG TNBS enema (7). Mice given saline enemas alone were used as controls. GCTGCTAAAGTC-ATCA, reverse 5Ј-TCTTGAGTCCTCTGCTCCATG Signs of colitis, diarrhea, rectal bleeding, weight loss, piloerection, lethargy TC; Reg2: forward 5Ј-AGGAGAGTGG-TACTACAGCTTCCAA, reverse and periorbital exudates were monitored as described previously (5). After 5Ј-CGACGGTTACTTTTAG-GGTCATG; Reg3g: forward 5Ј-GGTAACA the six TNBS enemas, mice were sacrificed 3 days (termed as TNBS-w6), GTGGCCAATATGTATGG, reverse 5Ј-ATCCACCTCTGTTGGGTTCA 2 wk (TNBS-w8), 4 wk (TNBS-w10), or 6 wk (TNBS-w12) later (see Fig. TAG; and Ccl2: forward 5Ј-CCCAATGAGTAGGCTGGAGA, reverse 5Ј- 1).The TNBS-w6 stage was considered to reflect active, chronic inflam- TCTGGACCCATTCCTT-CTTG. The cycles passing threshold (CT) were ⌬ mation and was selected as the first time point of the study. The saline recorded and relative expression level of a target gene ϭ 2 CT, where ⌬ ϭ Ϫ control groups were also sacrificed at week 6 (saline-w6), week 8, and CT CT of Gapdh CT of the target gene. week 10. The last two sets were pooled as saline-w10. Colon tissue sam- ples were collected at 4 Ϯ 0.5 cm from the anus and placed immediately Immunohistochemistry into 1) 4% formalin for histology, 2) TRIzol reagent (Invitrogen Life Tech- nologies) for total RNA isolation, and 3) T-PER Tissue Protein Extraction The ABC kit (Santa Cruz Biotechnology) was used for immunohistochem- Reagent (Pierce) for protein isolation. istry staining on formalin-fixed, paraffin-embedded colonic sections. Pri- mary Abs included: goat polyclonal anti-mouse S100A9 (1/250; Santa Gene expression microarray and data analysis Cruz Biotechnology), rabbit polyclonal anti-mouse lumican (10 ␮g/ml) (14), rabbit anti-human CD3 clone PSI, and mouse anti-human CD4 clone The Murine Genome_U74Av2 array chip (Affymetrix) containing 12,400 IF6 (Ventana Medical Systems).
Load more

Recommended publications
  • AGR2, an Endoplasmic Reticulum Protein, Is Secreted Into the Gastrointestinal Mucus
    AGR2, an Endoplasmic Reticulum Protein, Is Secreted into the Gastrointestinal Mucus Joakim H. Bergstro¨ m1, Katarina A. Berg1, Ana M. Rodrı´guez-Pin˜ eiro1,Ba¨rbel Stecher2, Malin E. V. Johansson1, Gunnar C. Hansson1* 1 Department of Medical Biochemistry, University of Gothenburg, Gothenburg, Sweden, 2 Max von Pettenkofer Institute for Hygiene and Medical Microbiology, LMU Munich, Munich, Germany Abstract The MUC2 mucin is the major constituent of the two mucus layers in colon. Mice lacking the disulfide isomerase-like protein Agr2 have been shown to be more susceptible to colon inflammation. The Agr22/2 mice have less filled goblet cells and were now shown to have a poorly developed inner colon mucus layer. We could not show AGR2 covalently bound to recombinant MUC2 N- and C-termini as have previously been suggested. We found relatively high concentrations of Agr2 in secreted mucus throughout the murine gastrointestinal tract, suggesting that Agr2 may play extracellular roles. In tissue culture (CHO-K1) cells, AGR2 is normally not secreted. Replacement of the single Cys in AGR2 with Ser (C81S) allowed secretion, suggesting that modification of this Cys might provide a mechanism for circumventing the KTEL endoplasmic reticulum retention signal. In conclusion, these results suggest that AGR2 has both intracellular and extracellular effects in the intestine. Citation: Bergstro¨m JH, Berg KA, Rodrı´guez-Pin˜eiro AM, Stecher B, Johansson MEV, et al. (2014) AGR2, an Endoplasmic Reticulum Protein, Is Secreted into the Gastrointestinal Mucus. PLoS ONE 9(8): e104186. doi:10.1371/journal.pone.0104186 Editor: Jean-Luc Desseyn, Inserm, France Received March 16, 2014; Accepted July 11, 2014; Published August 11, 2014 This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose.
    [Show full text]
  • Uterine Double-Conditional Inactivation of Smad2 and Smad3 in Mice Causes Endometrial Dysregulation, Infertility, and Uterine Cancer
    Uterine double-conditional inactivation of Smad2 and Smad3 in mice causes endometrial dysregulation, infertility, and uterine cancer Maya Krisemana,b, Diana Monsivaisa,c, Julio Agnoa, Ramya P. Masanda, Chad J. Creightond,e, and Martin M. Matzuka,c,f,g,h,1 aDepartment of Pathology and Immunology, Baylor College of Medicine, Houston, TX 77030; bReproductive Endocrinology and Infertility, Baylor College of Medicine/Texas Children’s Hospital Women’s Pavilion, Houston, TX 77030; cCenter for Drug Discovery, Baylor College of Medicine, Houston, TX 77030; dDepartment of Medicine, Baylor College of Medicine, Houston, TX 77030; eDan L. Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX 77030; fDepartment of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; gDepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030; and hDepartment of Pharmacology and Chemical Biology, Baylor College of Medicine, Houston, TX 77030 Contributed by Martin M. Matzuk, December 6, 2018 (sent for review April 30, 2018; reviewed by Milan K. Bagchi and Thomas E. Spencer) SMAD2 and SMAD3 are downstream proteins in the transforming in endometrial function. Notably, members of the transforming growth factor-β (TGF β) signaling pathway that translocate signals growth factor β (TGF β) family are involved in many cellular from the cell membrane to the nucleus, bind DNA, and control the processes and serve as principal regulators of numerous biological expression of target genes. While SMAD2/3 have important roles functions, including female reproduction. Previous studies have in the ovary, we do not fully understand the roles of SMAD2/3 in shown the TGF β family to have key roles in ovarian folliculo- the uterus and their implications in the reproductive system.
    [Show full text]
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • IMGT-ONTOLOGY and IMGT Databases, Tools and Web
    Molecular Immunology 40 (2004) 647–660 Review IMGT-ONTOLOGY and IMGT databases, tools and Web resources for immunogenetics and immunoinformatics Marie-Paule Lefranc a,b,∗ a Laboratoire d’ImmunoGénétique Moléculaire, LIGM, Institut de Génétique Humaine IGH, Université Montpellier II, UPR CNRS 1142, 141 rue de la Cardonille, 34396 Montpellier Cedex 5, France b Institut Universitaire de France, France Received 18 June 2003; received in revised form 2 September 2003; accepted 16 September 2003 Abstract The international ImMunoGeneTics information system® (IMGT; http://imgt.cines.fr), is a high quality integrated information system specialized in immunoglobulins (IG), T cell receptors (TR), major histocompatibility complex (MHC), and related proteins of the immune system (RPI) of human and other vertebrates, created in 1989, by the Laboratoire d’ImmunoGénétique Moléculaire (LIGM; Université Montpellier II and CNRS) at Montpellier, France. IMGT provides a common access to standardized data which include nucleotide and protein sequences, oligonucleotide primers, gene maps, genetic polymorphisms, specificities, 2D and 3D structures. IMGT consists of several sequence databases (IMGT/LIGM-DB, IMGT/MHC-DB, IMGT/PRIMER-DB), one genome database (IMGT/GENE-DB) and one 3D structure database (IMGT/3Dstructure-DB), interactive tools for sequence analysis (IMGT/V-QUEST, IMGT/JunctionAnalysis, IMGT/PhyloGene, IMGT/Allele-Align), for genome analysis (IMGT/GeneSearch, IMGT/GeneView, IMGT/LocusView) and for 3D struc- ture analysis (IMGT/StructuralQuery), and
    [Show full text]
  • Injury by Mechanical Ventilation Gene Transcription and Promotion Of
    Modulation of Lipopolysaccharide-Induced Gene Transcription and Promotion of Lung Injury by Mechanical Ventilation This information is current as William A. Altemeier, Gustavo Matute-Bello, Sina A. of September 29, 2021. Gharib, Robb W. Glenny, Thomas R. Martin and W. Conrad Liles J Immunol 2005; 175:3369-3376; ; doi: 10.4049/jimmunol.175.5.3369 http://www.jimmunol.org/content/175/5/3369 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2005/08/23/175.5.3369.DC1 Material http://www.jimmunol.org/ References This article cites 37 articles, 7 of which you can access for free at: http://www.jimmunol.org/content/175/5/3369.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Modulation of Lipopolysaccharide-Induced Gene Transcription and Promotion of Lung Injury by Mechanical Ventilation1 William A.
    [Show full text]
  • Genetics of Cell Surface Receptors for Bioactive Polypeptides
    Proc. Nati. Acad. Sci. USA Vol. 77, No. 6, pp. 3600-3604, June 1980 Genetics Genetics of cell surface receptors for bioactive polypeptides: Binding of epidermal growth factor is associated with the presence of human chromosome 7 in human-mouse cell hybrids (hormone/gene mapping/gene regulation) NOBUYOSHI SHIMIZU, M. ALI BEHZADIAN, AND YOSHIKO SHIMIZU Department of Cellular and Developmental Biology, University of Arizona, Tucson, Arizona 85721 Communicated by Frank H. Ruddle, March 24, 1980 ABSTRACT Mouse A9 cells, L-cell-derived mutants defi- Although recent work has identified the EGF receptor as a cient in hypoxanthine phosphoribosyltransferase (HPRT; glycoprotein with subunit structure (6-8), little is known about IMP:pyrophosphate Ihosphoribosyltransferase, EC 2.4.2.8) were its genetics and biosynthesis. By an application of somatic cell foun to e incapable of binding 25I-labeled epidermal growth factor (EGF) to the cell surface. The A9 cells were fused with genetics we have been studying the genetic and molecular basis human diploid fibroblasts (WI-38) possessing EGF-binding of receptor-mediated mitogenic action of EGF (9). In this report ability, and human-mouse cell hybrids (TA series) were isolated we present the evidence for the dominance of EGF-binding after hypoxanthine/aminopterin/thymidine/ouabain selection. ability and its linkage with human chromosome 7 based on Analyses of isozyme markers and chromosomes of four repre- analysis of human-mouse cell hybrids. sentative clones of TA hybrids indicated that the expression of EGF-binding ability is correlated with the presence of human chromosome 7 or 19. Four subclones were isolated from an MATERIALS AND METHODS EGF-binding-positive line, TA4, and segregation of EGF- Cell Lines.
    [Show full text]
  • A Cell Line P53 Mutation Type UM
    A Cell line p53 mutation Type UM-SCC 1 wt UM-SCC5 Exon 5, 157 GTC --> TTC Missense mutation by transversion (Valine --> Phenylalanine UM-SCC6 wt UM-SCC9 wt UM-SCC11A wt UM-SCC11B Exon 7, 242 TGC --> TCC Missense mutation by transversion (Cysteine --> Serine) UM-SCC22A Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC22B Exon 6, 220 TAT --> TGT Missense mutation by transition (Tyrosine --> Cysteine) UM-SCC38 Exon 5, 132 AAG --> AAT Missense mutation by transversion (Lysine --> Asparagine) UM-SCC46 Exon 8, 278 CCT --> CGT Missense mutation by transversion (Proline --> Alanine) B 1 Supplementary Methods Cell Lines and Cell Culture A panel of ten established HNSCC cell lines from the University of Michigan series (UM-SCC) was obtained from Dr. T. E. Carey at the University of Michigan, Ann Arbor, MI. The UM-SCC cell lines were derived from eight patients with SCC of the upper aerodigestive tract (supplemental Table 1). Patient age at tumor diagnosis ranged from 37 to 72 years. The cell lines selected were obtained from patients with stage I-IV tumors, distributed among oral, pharyngeal and laryngeal sites. All the patients had aggressive disease, with early recurrence and death within two years of therapy. Cell lines established from single isolates of a patient specimen are designated by a numeric designation, and where isolates from two time points or anatomical sites were obtained, the designation includes an alphabetical suffix (i.e., "A" or "B"). The cell lines were maintained in Eagle's minimal essential media supplemented with 10% fetal bovine serum and penicillin/streptomycin.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • Study of Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in Biomedicine
    Journal of Developmental Biology Review Study of Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in Biomedicine Eleonora N. Grigoryan Kol’tsov Institute of Developmental Biology, Russian Academy of Sciences, 119334 Moscow, Russia; [email protected]; Tel.: +7-(499)-1350052 Abstract: The review considers the molecular, cellular, organismal, and ontogenetic properties of Urodela that exhibit the highest regenerative abilities among tetrapods. The genome specifics and the expression of genes associated with cell plasticity are analyzed. The simplification of tissue structure is shown using the examples of the sensory retina and brain in mature Urodela. Cells of these and some other tissues are ready to initiate proliferation and manifest the plasticity of their phenotype as well as the correct integration into the pre-existing or de novo forming tissue structure. Without excluding other factors that determine regeneration, the pedomorphosis and juvenile properties, identified on different levels of Urodele amphibians, are assumed to be the main explanation for their high regenerative abilities. These properties, being fundamental for tissue regeneration, have been lost by amniotes. Experiments aimed at mammalian cell rejuvenation currently use various approaches. They include, in particular, methods that use secretomes from regenerating tissues of caudate amphibians and fish for inducing regenerative responses of cells. Such an approach, along with those developed on the basis of knowledge about the molecular and genetic nature and age dependence of regeneration, may become one more step in the development of regenerative medicine Citation: Grigoryan, E.N. Study of Keywords: salamanders; juvenile state; tissue regeneration; extracts; microvesicles; cell rejuvenation Natural Longlife Juvenility and Tissue Regeneration in Caudate Amphibians and Potential Application of Resulting Data in 1.
    [Show full text]
  • LST1 Sirna (M): Sc-149136
    SANTA CRUZ BIOTECHNOLOGY, INC. LST1 siRNA (m): sc-149136 BACKGROUND APPLICATIONS LST1 (leukocyte-specific transcript 1), also known as B144, is a 97 amino acid LST1 siRNA (m) is recommended for the inhibition of LST1 expression in protein single-pass membrane protein. LST1 may play a role in modulating mouse cells. immune responses, as well as dendritic cell maturation. LST1 has also been found to induce morphological changes, including microspikes and filopodia, SUPPORT REAGENTS when overexpressed in a variety of cell types. Localized to the endomembrane For optimal siRNA transfection efficiency, Santa Cruz Biotechnology’s system, LST1 is expressed as nine isoforms produced by alternative splicing. siRNA Transfection Reagent: sc-29528 (0.3 ml), siRNA Transfection Medium: Isoform 1, also designated LST1A, and isoform 2, also designated LST1C, sc-36868 (20 ml) and siRNA Dilution Buffer: sc-29527 (1.5 ml) are recom- γ have inhibitory effects on lymphocyte proliferation. Induced by IFN- , LST1 mended. Control siRNAs or Fluorescein Conjugated Control siRNAs are is expressed in adult lung, thymus, placenta, kidney and tonsil and fetal liver, available as 10 µM in 66 µl. Each contain a scrambled sequence that will spleen and brain. not lead to the specific degradation of any known cellular mRNA. Fluorescein Conjugated Control siRNAs include: sc-36869, sc-44239, sc-44240 and REFERENCES sc-44241. Control siRNAs include: sc-37007, sc-44230, sc-44231, sc-44232, 1. Neville, M.J. and Campbell, R.D. 1997. Alternative splicing of the LST1 gene sc-44233, sc-44234, sc-44235, sc-44236, sc-44237 and sc-44238. located in the major histocompatibility complex on human chromosome 6.
    [Show full text]
  • 4E-BP2 / EIF4EBP2 Antibody (Aa99-120) Rabbit Polyclonal Antibody Catalog # ALS12947
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 4E-BP2 / EIF4EBP2 Antibody (aa99-120) Rabbit Polyclonal Antibody Catalog # ALS12947 Specification 4E-BP2 / EIF4EBP2 Antibody (aa99-120) - Product Information Application IHC Primary Accession Q13542 Reactivity Human, Mouse, Rat, Pig, Bovine, Dog Host Rabbit Clonality Polyclonal Calculated MW 13kDa KDa 4E-BP2 / EIF4EBP2 Antibody (aa99-120) - Additional Information Anti-EIF4EBP2 / 4EBP2 antibody IHC of Gene ID 1979 human pancreas. Other Names Eukaryotic translation initiation factor 4E-BP2 / EIF4EBP2 Antibody (aa99-120) - 4E-binding protein 2, 4E-BP2, eIF4E-binding Background protein 2, EIF4EBP2 Regulates eIF4E activity by preventing its Target/Specificity assembly into the eIF4F complex. Mediates the Detects 17 and 20 kD proteins, regulation of protein translation by hormones, corresponding to the apparent molecular growth factors and other stimuli that signal mass of PHAS-II and its phosphorylated through the MAP kinase pathway. state on SDS-PAGE immunoblots. 4E-BP2 / EIF4EBP2 Antibody (aa99-120) - Reconstitution & Storage References Short term 4°C, long term aliquot and store at -20°C, avoid freeze thaw cycles. For Pause A.,et al.Nature 371:762-767(1994). maximum product recovery, after thawing, Kalnine N.,et al.Submitted (MAY-2003) to the centrifuge the product vial before removing cap. EMBL/GenBank/DDBJ databases. Dephoure N.,et al.Proc. Natl. Acad. Sci. U.S.A. Precautions 105:10762-10767(2008). 4E-BP2 / EIF4EBP2 Antibody (aa99-120) is Gauci S.,et al.Anal. Chem. for research use only and not for use in 81:4493-4501(2009). diagnostic or therapeutic procedures.
    [Show full text]