B Inhibition in a Mouse Model of Chronic Colitis1

The Journal of Immunology

Differential Expression of Inﬂammatory and Fibrogenic Genes and Their Regulation by NF-␬B Inhibition in a Mouse Model of Chronic Colitis1

Feng Wu and Shukti Chakravarti2

Fibrosis is a major complication of chronic inflammation, as seen in Crohn’s disease and ulcerative colitis, two forms of inflammatory bowel diseases. To elucidate inflammatory signals that regulate fibrosis, we investigated gene expression changes underlying chronic inflammation and fibrosis in trinitrobenzene sulfonic acid-induced murine colitis. Six weekly 2,4,6-trinitrobenzene sulfonic acid enemas were given to establish colitis and temporal gene expression patterns were obtained at 6-, 8-, 10-, and 12-wk time points. The 6-wk point, TNBS-w6, was the active, chronic inflammatory stage of the model marked by macrophage, neutrophil, and CD3؉ and CD4؉ T cell infiltrates in the colon, consistent with the idea that this model is T cell immune response driven. Proinflammatory genes Cxcl1, Ccl2, Il1b, Lcn2, Pla2g2a, Saa3, S100a9, Nos2, Reg2, and Reg3g, and profibrogenic extracellular matrix genes Col1a1, Col1a2, Col3a1, and Lum (lumican), encoding a collagen-associated proteoglycan, were up-regulated at the active/chronic inflammatory stages. Rectal administration of the NF-␬B p65 antisense oligonucleotide reduced but did not abrogate inflammation and fibrosis completely. The antisense oligonucleotide treatment reduced total NF-␬B by 60% and down- regulated most proinflammatory genes. However, Ccl2, a proinflammatory chemokine known to promote fibrosis, was not down- regulated. Among extracellular matrix gene expressions Lum was suppressed while Col1a1 and Col3a1 were not. Thus, effective treatment of fibrosis in inflammatory bowel disease may require early and complete blockade of NF-␬B with particular attention to specific proinflammatory and profibrogenic genes that remain active at low levels of NF-␬B. The Journal of Immunology, 2007, 179: 6988–7000.

ibrosis is a major complication of chronic inflammation, as innate immunity and acute phase response (8, 9). In IBD patients, the seen in Crohn’s disease and ulcerative colitis, two major lamina propria macrophages have increased NF-␬B p65 expression F forms of inflammatory bowel diseases (IBD).3 Crohn’s dis- and DNA-binding activity accompanied by an increased production ease in particular is prone to complications of fibrosis and stenosis (1, of IL-1, IL-6, and TNF-␣ (10). 2). The 2,4,6-trinitrobenzene sulfonic acid (TNBS) hapten, given as In the chronic TNBS-induce colitis model, we have further shown one or two enemas with ethanol as a carrier to disrupt epithelial in- that NF-␬B antisense oligonucleotide enemas, given each time with tegrity, induces acute inflammation and colitis in the mouse with the TNBS treatment, reduced the severity of disease in terms of body Crohn’s colitis-like transmural tissue damage (3–5). In an earlier weight loss and colonic inflammation as seen by histology (6). study, we modified the TNBS-induced colitis model by giving mul- Trichrome-stained histology of colon from TNBS-w8 mice treated tiple low doses of TNBS over a period of 6 wk that resulted in chronic with the NF-␬B antisense oligonucleotide indicated considerable re- inflammation and fibrotic changes in the colonic tissue that persisted duction in collagen deposition, with only 33% of the animals showing for at least 4 wk without additional TNBS administration (6). Neurath residual mild fibrosis. Another study of chronic TNBS-induced colitis et al. (7) showed that acute inflammation in the TNBS-induced colitis achieved increased inhibition of fibrosis using a deoxyoligonucleotide model could be abrogated by blocking NF-␬B p65 subunit expression that binds to the general NF-␬B-binding consensus sequence, deliv- with an antisense oligonucleotide targeted against the translation start ered directly into cells by encapsulating the oligonucleotide in a Sen- site. The NF-␬B transcription factor regulates the expression of a va- dai virus envelope (11). riety of genes that encode proinflammatory cytokines and proteins of In the current study, we explored the connection between chronic inflammation and fibrosis in the TNBS-induced colitis model with specific blockade of the p65 NF-␬B subunit. Gene Department of Medicine, Division of Gastroenterology, Johns Hopkins University School of Medicine, Baltimore, MD 21205 expression patterns of the colon were obtained at defined times from chronic inflammatory to late stages of the model. Our results Received for publication September 22, 2006. Accepted for publication August 17, 2007. show that high expression of inflammation-related genes at TNBS- The costs of publication of this article were defrayed in part by the payment of page w6, a stage with active and chronic inflammation, was followed by charges. This article must therefore be hereby marked advertisement in accordance their rapid decline. Profibrogenic extracellular matrix genes were with 18 U.S.C. Section 1734 solely to indicate this fact. also up-regulated at this stage, but their overexpression continued 1 This work was supported by National Institutes of Health Grant EY11654 and a Senior after inflammation had subsided. We further studied the amelio- Research Investigator Award from the Crohn’s and Colitis Foundation of America (to S.C.). rative effects of NF-␬B p65 inhibition on the expression of specific 2 Address correspondence and reprint requests to Dr. Shukti Chakravarti, Department of Medicine, Division of Gastroenterology, Johns Hopkins University School of Medicine, inflammation and fibrosis-related genes. 720 Rutland Avenue, Baltimore, MD 21205. E-mail address: [email protected] 3 Abbreviations used in this paper: IBD, inflammatory bowel disease; ECM, extra- Materials and Methods cellular matrix; qRT-PCR, quantitative RT-PCR; TNBS, 2,4,6,trinitrobenzene sul- Experimental colitis and NF-␬B blockade fonic acid; CT, cycle threshold. CD-1 outbred female mice, 10–12 wk old (Charles River Laboratories), Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 were maintained in a conventional animal housing facility at the Johns www.jimmunol.org The Journal of Immunology 6989

detected in the sample. The background signal was 76 Ϯ 7 arbitrary units. We compared saline-w6 with TNBS-w6 and saline-w10 with TNBS-w8, TNBS-w10, TNBS-w12, respectively. Compared with the saline control, the expression signal in the TNBS-treated groups was considered significantly different if 1) fold change was Ͼ2, 2) a difference in signal intensity of 100 arbitrary units or greater, and 3) received a “present call” in at least one array. The following web sites were used for functional annotation of novel genes, GeneCards (www.genecards.org/) (13) and National Center for Bio- technology Information (www.ncbi.nlm.nih.gov/entrez). FIGURE 1. Overview of a mouse model of TNBS-induced chronic colitis. Mice were given TNBS enemas weekly for 6 wk and sacrificed at Real-time quantitative RT-PCR (qRT-PCR) weeks 6, 8, 10, and 12 for histology, immunohistology, and isolation of To confirm the gene expression changes, RT-PCR were performed by us- total RNA for qRT-PCR and microarray gene expression profiling. ing a QuantiTect SYBR Green PCR Kit (Qiagen) with the following specific primers: Gapdh: forward 5Ј-TTGTCTCCTGCGACTTCA, reverse 5Ј- CCTGTTGCTGTAGCCGTATT; Il1b: forward 5Ј-GAATCTATACCTGT Hopkins University (Baltimore, MD) following animal protocols approved CCTGTG, reverse 5Ј-ACCGCTTTTCCATCTTCT; Cxcl1: forward 5Ј-AC by the Animal Use and Care Committee at Johns Hopkins University. The TGCACCCAAACCGAAGTC, reverse 5Ј-CAAGGGAGCTTCAGG-GTC chronic colitis model was developed by weekly enemas of TNBS (Sigma- AA; Col1a1: forward 5Ј-GTACTCCTGGTGCTGATG, reverse 5Ј-GAAG Aldrich) in 0.1 ml of 45% ethanol given once a week for 6 wk (6). For the CCTCTTTC-TCCTCTCTGA. Col3a1: forward 5Ј-CAGGTCCTAGAGG NF-␬B blockade, mice were treated intrarectally with 150 ␮g of an anti- AA-ACAGA, reverse 5Ј-TCACC-TCCAACTCCAACAATG; Lum: sense phosphorothioate oligonucleotide for the NF-␬B subunit p65 (5Ј- forward 5Ј-TCGAGCTTGAT-CTCTCCTAT, reverse 5Ј-TGGTCCCAGG GAAACAGATCGTCCATGGT-3Ј), or control oligonucleotide (5Ј- ATCTTACAGAA; Pla2g2a: forward 5Ј-CAAAGG-ATTCCCCCAAGGA Ј Ј Ј GTACTACTCTGAGCAAGGA-3 ) in 0.1 ml of dH2O 1 day before each T, reverse 5 -CTCCAGGCGCTTGTAGCAA; Saa3: forward 5 -CCTGG TNBS enema (7). Mice given saline enemas alone were used as controls. GCTGCTAAAGTC-ATCA, reverse 5Ј-TCTTGAGTCCTCTGCTCCATG Signs of colitis, diarrhea, rectal bleeding, weight loss, piloerection, lethargy TC; Reg2: forward 5Ј-AGGAGAGTGG-TACTACAGCTTCCAA, reverse and periorbital exudates were monitored as described previously (5). After 5Ј-CGACGGTTACTTTTAG-GGTCATG; Reg3g: forward 5Ј-GGTAACA the six TNBS enemas, mice were sacrificed 3 days (termed as TNBS-w6), GTGGCCAATATGTATGG, reverse 5Ј-ATCCACCTCTGTTGGGTTCA 2 wk (TNBS-w8), 4 wk (TNBS-w10), or 6 wk (TNBS-w12) later (see Fig. TAG; and Ccl2: forward 5Ј-CCCAATGAGTAGGCTGGAGA, reverse 5Ј- 1).The TNBS-w6 stage was considered to reflect active, chronic inflam- TCTGGACCCATTCCTT-CTTG. The cycles passing threshold (CT) were ⌬ mation and was selected as the first time point of the study. The saline recorded and relative expression level of a target gene ϭ 2 CT, where ⌬ ϭ Ϫ control groups were also sacrificed at week 6 (saline-w6), week 8, and CT CT of Gapdh CT of the target gene. week 10. The last two sets were pooled as saline-w10. Colon tissue sam- ples were collected at 4 Ϯ 0.5 cm from the anus and placed immediately Immunohistochemistry into 1) 4% formalin for histology, 2) TRIzol reagent (Invitrogen Life Tech- nologies) for total RNA isolation, and 3) T-PER Tissue Protein Extraction The ABC kit (Santa Cruz Biotechnology) was used for immunohistochem- Reagent (Pierce) for protein isolation. istry staining on formalin-fixed, paraffin-embedded colonic sections. Pri- mary Abs included: goat polyclonal anti-mouse S100A9 (1/250; Santa Gene expression microarray and data analysis Cruz Biotechnology), rabbit polyclonal anti-mouse lumican (10 ␮g/ml) (14), rabbit anti-human CD3 clone PSI, and mouse anti-human CD4 clone The Murine Genome_U74Av2 array chip (Affymetrix) containing 12,400 IF6 (Ventana Medical Systems). probe sets was used to detect 9,710 unique transcripts (based on LocusLink identification released in September 2004). We established seven microar- ELISA rays for mouse colons at TNBS-w6, TNBS-w8, TNBS-w10, TNBS-w12, saline-w6 (2 arrays), and saline-w10. The microarray procedures were Colon tissue homogenates were used to determine IL-1␤ (Invitrogen Life standard protocols provided by Affymetrix (www.affymetrix.com/ Technologies) and chemokine CXCL1 (R&D Systems) protein levels by support/technical/manual). ELISA. The sensitivity of the ELISA kits is Ͻ7 pg/ml. The concentration Briefly, equal amounts of total RNA (10 ␮g) were pooled per experi- of total protein for each sample was detected using the Bradford assay kit mental group and converted to cDNA followed by synthesizing biotin- (Bio-Rad) and equivalent amounts were used to measure cytokine level and labeled cRNA. The fragmented cRNA (10 ␮g/array) was hybridized to presented as a ratio of total protein per sample. An NF-␬B immunoassay kit MG-U74Av2 array. The hybridization images were first analyzed by Af- (BioSource International) was used to measure total NF-␬B in colonic fymetrix Microarray Suite version 5.0 software to assess hybridization protein extracts. quality and background and to obtain image files of hybridization intensity for each probe set. The raw dataset is available at the National Center for Biotechnology Information Gene Expression Omnibus (http://www.ncbi. Results nlm.nih.gov/geo) (accession no.GSE5864). Inflammation and fibrosis in TNBS-induced colitis as evidenced The DNA-Chip Analyzer software (dChip) (http://www.dchip.org/) (12) by histology was used to normalize all arrays and generate a model-based expression value (arbitrary unit) for each transcript. A “present” or “absent” call for Chronic colitis was established by six weekly enemas of TNBS as each transcript was defined according to whether the gene transcript was described earlier. The following time points were investigated

FIGURE 2. Course of inflammation and fibrosis. A, Sections of paraffin-embedded distal colons were stained with H&E. Mucosal ulcers (arrow) and significant infiltrations of inflammatory cells were evident in TNBS-w6 (white arrows). Inflamma- tion was markedly reduced by TNBS- w10 and TNBS-w12. B, Masson’s trichrome staining shows newly synthesized collagen deposits in the mucosa and submucosa from TNBS-w6 to TNBS-w12 (arrows). 6990 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

Table I. Genes differentially expressed in TNBS-induced colitis

Fold Change Accession Baseline Gene Symbol No. Intensity TNBS-w6 TNBS-w8 TNBS-w10 TNBS-w12

Up-regulated 3-Hydroxy-3-methylglutaryl-CoA reductase Hmgcr M62766 521 1.6 2.1 1.2 Ϫ1.2 ␤-Actin, cytoplasmic Actb M12481 3558 2.2 1.1 –1.1 2.0 Adenylate kinase 3␣-like AK3l1 AB020203 414 1.3 –1.1 1.7 2.6 ADP-ribosyltransferase 2a Art2a X52991 63 3.3 2.3 1.1 Ϫ1.1 Aldehyde dehydrogenase family 1, subfamily A3 Aldh1a3 AW050387 136 5.8 1.6 Ϫ1.1 1.0 Amylase 2, pancreatic Amy2 X02578 1 6665 16.8 1.2 85.3 Amyloid ␤ (A4) precursor protein-binding, family B, member Apbblip AF020313 180 2.4 1.7 1.4 1.1 1-interacting protein Annexin A1 Anxa1 AV003419 2440 2.3 1.8 1.3 1.2 Annexin A8 Anxa8 AJ002390 670 3.0 1.1 1.2 1.3 Anterior gradient 2 (Xenopus laevis) Agr2 AV062476 54 –2.1 2.6 –1.5 Ϫ3.1 Ag identiﬁed by mAb Ki-67 Mki67 X82786 282 3.1 2.2 1.1 1.1 Arginase 1, liver Arg1 U51805 29 53.1 2.0 1.2 Ϫ1.2 Arginase type II Arg2 AF032466 125 3.5 1.0 2.4 2.2 arginine-rich, mutated in early stage tumors Armet AW122364 1578 1.1 2.3 –1.2 Ϫ1.1 ATPase, Hϩ/Kϩ-transporting, ␣ polypeptide Atp4a U17282 1 245 1.0 1.0 1.0 B cell leukemia/lymphoma 2-related protein A1c Bcl2a1c U23778 420 2.9 1.3 1.2 1.1 Brain-abundant, membrane-attached signal protein 1 Basp1 AW124113 390 2.5 1.5 1.2 Ϫ1.0 Cadherin 5 Cdh5 AI853217 171 2.2 2.0 2.9 1.7 Carbonic anhydrase 3 Car3 AJ006474 440 2.6 1.6 1.3 Ϫ4.4 Carboxyl ester lipase Cel U37386 381 4.5 5.5 –1.2 Ϫ1.8 Catalase Cat M29394 535 1.0 –1.5 2.6 2.0 Cathepsin C Ctsc U74683 910 2.8 1.5 1.5 1.6 CD14 Ag Cd14 X13333 5259 2.6 1.2 1.5 1.5 CD53 Ag Cd53 X97227 447 3.0 2.2 1.7 1.6 CD79A Ag (Ig-associated ␣) Cd79a X13450 1821 1.7 –1.1 1.2 2.3 CEA-related cell adhesion molecule 10 Ceacam10 AV381191 1707 2.6 1.7 1.3 Ϫ1.3 Cerebellar degeneration-related 2 Cdr2 U88588 172 1.1 2.3 1.4 Ϫ1.0 Chemokine (CC motif) ligand 2 Ccl2 M19681 65 2.7 2.6 1.9 Ϫ1.1 Chemokine (CC motif) ligand 7 Ccl7 X70058 73 3.2 2.8 1.0 Ϫ1.8 Chemokine (CC motif) ligand 9 Ccl9 U49513 409 3.3 2.0 1.5 1.2 Chemokine (CC motif) receptor 5 Ccr5 AV370035 8 17.0 1.7 2.0 Ϫ3.1 Chemokine (CC) receptor 2 Ccr2 U56819 152 2.6 2.0 1.7 1.0 chemokine (CXC motif) ligand 1 Cxcl1 J04596 6 24.6 –1.4 2.4 Ϫ16.2 Chemokine (CXC motif) ligand 5 Cxcl5 U27267 42 27.7 2.6 1.1 Ϫ1.1 Chemokine (CXC motif) ligand 9 Cxcl9 M34815 119 4.9 1.6 2.0 Ϫ1.5 Chitinase 3-like 1 Chi3l1 X93035 20 6.8 1.9 2.1 Ϫ1.8 Chymase 2, mast cell Cma2 M57401 280 4.3 8.9 4.0 1.1 Complement component 1, q subcomponent, ␤ C1qb M22531 381 2.8 1.0 1.3 Ϫ1.2 Complement component 1, q subcomponent, ␥ C1qg X66295 1707 2.3 1.0 1.4 1.3 Complement component 3 C3 K02782 1216 3.9 2.4 1.7 1.3 Complement component 4-binding protein C4bp M17122 201 1.6 4.2 2.7 2.1 Complement component factor h Cfh M12660 182 4.4 1.7 2.8 2.4 Cyclin B1 Ccnb1 X64713 161 2.2 2.2 1.2 1.0 Cysteine-rich secretory protein 1 Crisp1 M92850 165 –2.1 1.1 2.3 1.4 Cytochrome P-450, 51 Cyp51 AW122260 1154 1.6 2.1 1.3 1.2 Decay-accelerating factor 1 Daf1 L41365 368 1.7 3.6 1.7 1.3 Defensin-related cryptdin 5 Defcr5 U12560 1213 –1.5 2.5 1.2 1.0 Desmoglein 2 Dsc2 AJ000328 523 –1.0 –1.3 1.2 2.5 Elastase 2 Ela2 X04573 454 5.4 7.1 –1.1 Ϫ1.9 eph receptor B3 Ephb3 Z49086 646 2.0 1.0 975.1 1368.9 Eukaryotic translation initiation factor 4E-binding Eif4ebp2 AI848377 64 –1.3 1.0 1.5 3.6 protein 2 Extracellular proteinase inhibitor Expi X93037 347 4.1 1.5 1.2 1.3 Glia maturation factor, ␥ Gmfg AA791012 797 1.5 2.2 1.4 1.2 Glucose-regulated protein Grp58 M73329 2829 1.3 2.3 1.1 Ϫ1.4 gp49B Lilrb4 U05265 60 3.0 1.3 1.3 Ϫ1.1 GTP cyclohydrolase 1 Gch1 L09737 164 2.4 2.4 –1.2 Ϫ1.2 Guanylate nucleotide-binding protein 2 Gbp2 AJ007970 1201 3.3 1.1 1.9 Ϫ1.2 Guanylate nucleotide-binding protein 3 Gbp3 AW047476 414 2.2 1.2 1.6 Ϫ1.3 Hemoglobin, ␤ adult major chain Hbb-b1 V00722 1008 –1.0 2.9 1.6 Ϫ1.6 Histocompatibility 2, class II Ag A, ␣ H2-Aa X52643 3473 3.1 –1.5 1.1 Ϫ2.1 Histocompatibility 2, class II Ag E, ␣ H2-Ea V00833 141 1.2 20.0 7.2 12.8 Homeo box D13 Hoxd13 X99291 225 1.2 –3.1 2.6 3.5 Ig H chain (␥ polypeptide) Ighg X67210 378 3.9 2.1 4.1 1.6 Ig H chain (V10 family) Igh-V10 Z70661 48 –1.8 1.8 3.4 1.4 Ig H chain 1a (serum IgG2a) Igh-1a J00475 199 2.1 3.6 3.2 Ϫ3.0 Ig H chain 4 (serum IgG1) Igh-4 V00793 53 10.3 51.8 70.8 6.1 Indoleamine-pyrrole 2,3-dioxygenase Indo M69109 70 5.2 –1.1 3.2 Ϫ1.3 Insulin-like growth factor-binding protein 5 Igfbp5 L12447 1113 3.2 1.1 1.3 Ϫ1.1 (Table continues) The Journal of Immunology 6991

Table 1. (Continued)

Fold Change Accession Baseline Gene Symbol No. Intensity TNBS-w6 TNBS-w8 TNBS-w10 TNBS-w12

IFN-activated gene 202B Ifi202b M31418 19 31.1 2.4 1.1 Ϫ1.3 IFN-activated gene 205 Ifi205 M74123 99 3.3 1.3 –1.2 1.5 IFN-␥-induced GTPase Igtp U53219 541 2.8 1.5 1.3 Ϫ1.4 IFB-␥-inducible protein Ifi47 M63630 146 5.9 1.7 1.7 Ϫ1.5 IFN-induced transmembrane protein 3 Ifitm3 AW125390 1849 2.3 1.2 1.5 1.2 IFN-inducible GTPase 1 Iigp1 AJ007971 383 4.3 1.9 3.5 1.1 IFN-␣-inducible protein G1p2 AV152244 59 3.4 2.3 –1.3 Ϫ2.1 IFN-␥-inducible protein 16 Ifi16 M31419 95 4.5 2.3 1.4 1.3 IFN-induced protein with tetratricopeptide repeat 1 Ifit1 U43084 134 5.4 2.6 1.1 Ϫ1.5 IFN-induced protein with tetratricopeptide repeat 2 Ifit2 U43085 286 4.4 1.6 1.3 Ϫ2.3 IL-1␤ Il1b M15131 76 6.9 1.5 1.6 Ϫ1.6 IL-1 receptor-like 1 Il1rl1 D13695 145 1.7 2.9 1.9 1.1 L1 cell adhesion molecule L1cam X12875 122 –1.3 –1.7 1.5 2.7 Laminin, ␣3 Lama3 X84014 548 2.2 –1.9 1.3 1.7 Leucine-rich ␣2-gp1 Lrg1 AW230891 193 2.7 1.4 –1.1 Ϫ1.6 Leukocyte-specific transcript 1 Lst1 U72644 260 2.9 1.2 1.5 Ϫ1.5 Lipocalin 2 Lcn2 X81627 23 5.9 1.8 5.1 4.2 Lumican Lum AF013262 838 2.1 1.5 2.0 2.0 Lymphocyte Ag 6 complex, locus A Ly6a X04653 11714 2.3 1.4 1.2 Ϫ1.1 Lymphocyte Ag 86 Ly86 AB007599 198 2.9 1.6 1.1 1.2 Lysozyme Lyzs X51547 1614 2.6 –1.1 –1.0 1.6 Lysyl oxidase Lox D10837 30 4.7 1.2 1.6 1.2 Malic enzyme, supernatant Mod1 J02652 332 1.0 3.3 1.7 Ϫ1.1 Mannose receptor, C-type 1 Mrc1 Z11974 152 2.5 1.1 1.6 1.5 MARCKS-like protein Mlp X61399 550 3.4 1.1 1.8 1.5 Mast cell protease 1 Mcpt1 X68803 178 7.0 10.1 5.4 Ϫ1.3 Mast cell protease 2 Mcpt2 J05177 150 24.9 20.4 10.2 Ϫ89.4 Matrix ␥-carboxyglutamate (gla) protein Mglap D00613 575 1.3 1.1 2.3 2.3 Matrix metalloproteinase 12 Mmp12 M82831 92 2.6 –1.5 1.2 Ϫ1.6 Matrix metalloproteinase 15 Mmp15 D86332 593 –1.1 –1.1 2.4 1.9 Membrane-spanning 4 domains, subfamily A, 6B Ms4a6b AI835093 15 8.9 2.0 1.6 1.4 NO synthase 2, inducible, macrophage Nos2 U43428 135 2.7 1.0 1.1 1.0 Nucleobindin 2 Nucb2 AJ222586 225 –1.0 2.3 –1.1 1.1 Oncostatin M receptor Osmr AB015978 186 2.6 1.5 1.7 1.3 Pancreatic lipase-related protein 1 Pnliprp1 AA674409 118 6.4 6.9 –1.2 Ϫ3.1 Pancreatitis-associated protein Pap D63359 552 12.0 8.3 10.7 Ϫ1.8 Ϫ Phospholipase A2, group IIA (platelets, synovial fluid) Pla2g2a X74266 1434 9.3 1.1 –1.7 6.4 Ϫ Phospholipase A2, group VII Pla2g7 U34277 564 2.4 1.3 1.2 1.1 Phospholipase A2, group XIIA Pla2g12a AI845798 82 –1.6 3.8 2.0 1.6 Procollagen, type I, ␣1 Col1a1 U03419 1726 2.4 2.2 1.8 Ϫ1.1 Procollagen, type I, ␣2 Col1a2 X58251 1176 2.3 1.6 1.3 Ϫ1.1 Procollagen, type III, ␣1 Col3a1 AV234303 862 2.2 2.2 1.5 1.1 Procollagen, type IV, ␣1 Col4a1 M15832 2603 2.1 1.6 1.5 Ϫ1.2 Protease, serine, 2 Prss2 X04574 1442 3.7 3.8 1.1 Ϫ1.2 Proteaseome (prosome, macropain) 28 subunit, 3 Psme3 AB007139 498 1.2 1.1 2.4 2.3 Protein tyrosine phosphatase, receptor type, C Ptprc M14343 145 2.5 2.1 1.5 1.5 Proteoglycan, secretory granule Prg M34603 1153 3.1 2.0 1.6 1.1 Pyruvate kinase liver and RBC Pklr D63764 144 1.1 1.8 2.6 2.1 Regenerating islet-derived 2 Reg2 D14011 2 442 2525 45.5 1.0 Regenerating islet-derived 3␥ Reg3g D63362 140 8.0 3.9 5.2 Ϫ2.0 Retinol-binding protein 1, cellular Rbp1 X60367 136 2.8 1.8 1.4 1.4 Retinol dehydrogenase 6 Rdh6 AF030513 186 –1.1 Ϫ1.1 1.8 2.8 Ribonuclease, RNase A family, 1 (pancreatic) Rnase1 X60103 11 38.8 13.4 –1.0 Ϫ42.6 Ribosomal protein S6 kinase, polypeptide 1 Rps6kb1 AW049356 147 1.2 1.3 1.4 2.6 RIKEN cDNA 4833420N02 gene Rnmtl1 AV298145 82 1.7 1.0 1.7 2.5 RNA guanyltransferase and 5Ј-phosphatase Rngtt AF025653 1311 –1.3 3.7 1.1 Ϫ1.8 S100 calcium-binding protein A8 (calgranulin A) S100a8 M83218 115 7.7 1.2 –1.2 Ϫ1.2 S100 calcium-binding protein A9 (calgranulin B) S100a9 M83219 48 11.9 1.2 –2.4 Ϫ1.8 Schlafen 4 Slfn4 AF099977 896 2.8 2.0 –1.1 1.5 Secreted phosphoprotein 1 Spp1 X13986 51 12.3 2.0 –1.0 Ϫ1.3 Secretory leukocyte protease inhibitor Slpi AV090497 1145 2.9 –1.1 1.3 1.4 Selenoprotein W, muscle 1 Sepw1 AF015284 296 1.7 244.3 911.4 1036.9 Serine (or cysteine) proteinase inhibitor, clade B, member 5 Serpinb5 U54705 326 2.1 1.2 1.3 1.1 Serum amyloid A3 Saa3 X03505 82 18.6 3.6 3.7 Ϫ1.4 Sex hormone-binding globulin Shbg U85644 196 1.0 –1.4 –1.3 2.8 Stat1 Stat1 U06924 142 2.1 1.7 1.6 1.1 SMC2 structural maintenance of chromosomes 2-like 1 Smc2l1 U42385 234 2.6 2.4 1.4 1.4 Solute carrier family 4 (anion exchanger), member 4 Slc4a4 AF020195 327 –1.2 1.5 1.5 2.2 Stearoyl-CoA desaturase 1 Scd1 M21285 1210 1.7 2.6 1.7 1.1 Stromal interaction molecule 1 Stim1 U47323 1123 1.1 2.5 1.6 1.3 Tachykinin 1 Tac1 D17584 294 2.5 1.0 1.5 1.4 T cell-specific GTPase Tgtp L38444 392 4.6 2.5 4.2 Ϫ1.2 (Table continues) 6992 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

Table 1. (Continued)

Fold Change Accession Baseline Gene Symbol No. Intensity TNBS-w6 TNBS-w8 TNBS-w10 TNBS-w12

Thrombomodulin Thbd X14432 167 1.4 2.1 3.0 2.4 Tissue inhibitor of metalloproteinase 1 Timp1 AV363716 25 1.1 11.4 118.6 1.0 Tripartite motif protein 30 Trim30 J03776 79 3.1 2.0 1.1 Ϫ1.2 Trypsin 3 Try3 AE000665 1 596 1044.1 1.0 1.0 Trypsin 4 Try4 AE000664 1452 6.8 5.3 –1.2 Ϫ1.5 TYRO protein tyrosine kinase-binding protein Tyrobp AF024637 690 2.9 –1.0 1.3 1.3 Ubiquitin D Ubd AL078630 222 4.3 1.6 3.4 1.3 Ubiquitin-speciﬁc protease 18 Usp18 AW047653 12 13.6 2.6 –1.8 Ϫ2.3 UDP-N-acetyl-␣-D-galactosamine:polypeptide Galnt3 AV055653 961 1.6 2.7 1.2 1.1 N-acetylgalactosaminyltransferase 3 Vascular cell adhesion molecule 1 Vcam1 M84487 353 2.5 1.6 1.1 1.3 Zinc ﬁnger protein 36, C3H type-like 2 Zfp36l2 M58564 109 –1.7 1.9 2.1 3.6 Down-regulated Adipsin Cfd X04673 447 1.8 1.1 –1.1 Ϫ2.6 Apolipoprotein B Apob AI787317 220 –1.6 –3.9 –1.8 1.2 Atonal homolog 1 (Drosophila) Atoh1 D43694 175 –2.1 –1.4 –1.1 Ϫ1.3 Bone ␥-carboxyglutamate protein 2 Bglap2 L24430 1503 1.0 –2.3 1.1 Ϫ1.2 Carboxylesterase 3 Ces3 AW226939 146 –6.2 –3.1 –1.1 1.6 Chloride channel calcium-activated 3 Clca3 AB017156 926 –2.9 2.8 2.1 Ϫ1.0 Choline kinase ␤ Chkb AB011000 476 –1.3 –2.4 –1.4 1.1 Cytochrome P-450, family 3, subfamily a, polypeptide 13 Cyp3a13 X63023 1591 –1.5 –2.3 –1.4 Ϫ2.0 Defensin related cryptdin 3 Defcr3 U02997 1001 –14.1 90.9 7.0 Ϫ1.2 Defensin-related sequence cryptdin peptide (paneth cells) Defcr-rs1 M33226 1205 –5.5 14.6 1.5 Ϫ1.7 Fatty acid-binding protein 2, intestinal Fabp2 M65034 3096 –2.8 1.4 –1.2 Ϫ1.4 Gelsolin Gsn J04953 6188 –2.4 –1.2 1.3 1.3 GST ␮2 Gstm2 J04696 4868 –2.8 3.1 1.4 Ϫ1.2 Histocompatibility 2, T region locus 3 H2-T3 X16217 1560 1.9 –1.7 –1.5 Ϫ2.6 Ig H chain (J558 family) Igh-6 L28059 1118 –2.7 –1.1 1.0 Ϫ1.2 Phosphoenolpyruvate carboxykinase 1, cytosolic Pck1 AF009605 209 –3.3 –1.1 1.1 1.2 RIKEN cDNA 2410012A13 gene Rprm AV354117 431 –2.8 1.3 1.5 Ϫ1.0 Scinderin Scin AV372912 4884 –2.5 1.5 1.3 1.0 Solute carrier family 1, member 1 Slc1a1 U73521 375 –2.2 1.2 1.4 1.4 Solute carrier family 20, member 1 Slc20a1 M73696 2874 –2.4 –1.4 –1.1 1.5 Solute carrier family 26 (sulfate transporter), member 2 Slc26a2 D42049 412 –1.7 –4.0 –1.1 1.6 Sulfotransferase family 1A, phenol-preferring, member 1 Sult1a1 L02331 1540 –3.2 –3.1 –1.0 1.4 Transcription factor CP2-like 1 Tcfcp2l1 AA575098 1695 –1.1 –1.8 –3.1 1.1 Transglutaminase 3, E polypeptide Tgm3 L10385 2155 –2.0 –4.7 1.4 2.9 EST IgM H chain variable region, partial cds L33937 139 –3.7 –1.2 –1.0 Ϫ1.8 Ig ␬-chain variable 8 AF045024 5615 –1.5 1.5 2.1 1.3 Endogenous retroviral sequence 4 Y12713 102 7.4 –5.1 –2.5 Ϫ3.6 RIKEN cDNA 2310061N23 gene AI158810 64 6.8 2.8 –1.3 Ϫ1.6 RIKEN cDNA 2610528A11 gene AA689670 4019 2.1 –1.4 1.2 1.2 Expressed sequence C85523 C85523 3317 2.6 1.2 1.1 1.1 Ig H chain variable region precursor (IgG1) X16740 2298 –2.3 1.0 –1.1 Ϫ1.4 Expressed sequence AA184423 AA184423 66 3.9 –2.0 –1.5 1.2 Expressed sequence AW112010 AA958903 3332 2.6 1.6 1.2 1.1 RIKEN cDNA 2210010C04 gene AE000663 71 40.5 13.2 1.01 Ϫ12.3 cDNA sequence BC052328 AW047237 242 2.4 1.6 1.6 1.6 MHC class I-H-2Kd homolog {deletion of exon 3} AI326621 492 2.4 –1.5 –1.0 Ϫ2.3 RIKEN cDNA 1600029D21 gene AI121305 1136 6.5 3.4 1.9 Ϫ1.5 Expression sequence X05546 X05546 254 3.4 –4.1 –2.5 Ϫ1.4 RIKEN cDNA 2200008D09 gene AA590358 871 6.4 6.9 –1.0 Ϫ1.5 RIKEN cDNA 0910001A06 gene AA981015 375 2.0 2.2 2.0 1.6 DNA segment, Chr 8, ERATO Doi 69 AA543502 32 1.3 1.2 3.7 1.1 DNA segment, Chr 12, ERATO Doi 123 C76770 639 1.2 2.1 2.9 2.2 Ig ␬-chain, partial cds, U30241 1981 –1.0 2.4 1.9 1.3 DNA segment, Chr 17, D6S56E 5 U69488 948 –1.0 3.4 1.2 1.8 RIKEN cDNA 6130401J04 gene AI845633 431 1.2 1.9 2.2 1.7 cDNA clone MGC:60818 AW209179 637 1.4 1.0 1.0 Ϫ3.3 RIKEN cDNA 1110015E22 gene AW045753 266 1.2 –1.6 1.2 Ϫ3.0 RIKEN cDNA 5730454B08 gene AA666669 547 1.0 1.2 1.2 2.9 Expression sequence U55617 602 –1.1 –1.1 –2.1 Ϫ2.2 RIKEN cDNA 8430408H12 gene AI852916 333 –1.2 –1.4 1.7 2.2 Expressed sequence AI506816 AI553553 344 1.3 –2.1 –1.6 Ϫ3.5 RIKEN cDNA 0610042C05 gene AW048828 370 1.0 2.8 3.8 3.1 RIKEN cDNA 1110001C20 gene AW121960 2087 –1.0 2.1 1.2 1.1 IgE H chain C region X01857 1150 –1.1 2.1 1.6 1.0 RIKEN cDNA 5730420B22 gene AI835776 748 –1.1 –1.0 2.0 2.3 Expressed sequence AA960558 AV335799 123 1.2 –1.5 –4.1 Ϫ1.8 Expression sequence M17327 M17327 4160 –1.2 –1.7 1.1 3.4 The Journal of Immunology 6993

FIGURE 3. Characterization of inflammatory cell infiltrates. A, Immunohistochemistry of S100A9 (MRP14) protein showing macrophages and neutrophils at TNBS- w6. Colonic sections were immunostained using a polyclonal anti-mouse S100A9/MRP14 Ab. This Ag is present in macrophages (TNBS-w6 inset) and neutrophils. Representative sections of each time point showed a high level of immunopositive inflammatory cells (arrows) at TNBS-w6 with a transmural pattern of inflammation. B and C, Paraffin-embedded sections were immunostained with anti-CD3 or anti-CD4 Ab to visualize CD3ϩ and CD4ϩ T cells, respectively, in TNBS-induced colitis. CD3ϩ and CD4ϩ T cells (arrows) increased in the submucosa and lamina propria of colonic sections from TNBS-w6 and TNBS-w8. Few immunopositive cells were present in the submucosa of the saline control. Bar, 50 ␮m.

here: TNBS-w6, 3 days after the sixth TNBS enema and TNBS- w8, TNBS-w10, and TNBS-w12 at weeks 8, 10, and 12 of the model, respectively (Fig. 1). Mice treated with TNBS enemas showed signs of diarrhea, fecal-occult blood, weight loss, piloerection, and lethargy, while 6 of 25 died within the first 6 wk due to severe colitis and weight loss. The signs of severe disease appeared after the third TNBS treatment and usually subsided within 1 wk and manifested briefly again after the next TNBS enema. The colon of the TNBS-w6 group showed hyperemia, edema, and hem- orrhage. By TNBS-w8, thickening of the colonic wall was evident. Macroscopic appearance of the colon at TNBS-w12 was similar to the saline group (data not shown). The progression of inflammation and fibrosis was examined over time by histology. Colonic sections stained with H&E showed active inflammation at TNBS- w6. By the next stage, TNBS-w8, inflammatory cell infiltrates were visibly reduced, with the recovery of almost normal tissue architecture by TNBS-w10 and TNBS-w12 (Fig. 2A). Adjacent colonic sections were stained with Masson’s trichrome to visualize newly synthesized collagen in fibrotic tissues. The patchy trichrome-positive staining of the lamina propria at TNBS-w6 indicated new collagen synthesis. This was replaced with a more regular, stronger staining of the mucosa and submucosa, increased fibroblasts and disorganized tissue architecture, indicative of fibrotic tissues at TNBS-w8 and TNBS-w10 (Fig. 2B). Trichrome- positive staining of collagen deposits was evident in the submucosa even at TNBS-w12, suggestive of persistent fibrosis after FIGURE 4. Temporal gene expression pattern during inflammation and inflammation had subsided. This is consistent with our previous fibrosis. Differentially expressed genes (175) were identified by comparing study where collagen staining was evident as late as TNBS-w10, each expression profile of the TNBS-treated group to that of the saline controls 4 wk after the last TNBS enema (6). (details in Materials and Methods). Genes expressed above mean (red), mean (black), and below mean (green) are as shown. Cluster A includes 105 genes Inflammatory infiltrates in TNBS-induced colitis up-regulated at TNBS-w6. One-half of these returned to baseline level by TNBS- w8, whereas 39 (25 plus 14) of 105 were overexpressed for a longer time. Clusters To characterize the inflammatory cells in inflamed colons of B–D show up-regulated genes at TNBS-w8, w10, and w12, respectively. Cluster TNBS-treated mice, colonic sections were immunostained for E includes 24 genes primarily down-regulated at TNBS-w6 and TNBS-w8, with S100A9 to visualize polymorphonuclear neutrophils and several recovering their expression levels by TNBS-w10 and TNBS-w12. 6994 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

FIGURE 5. Up-regulation of proinflammatory IL-1␤ and CXCL1 in TNBS-induced murine colitis. A, IL-1␤ mRNA was measured in colonic total RNA by semiquantitative RT-PCR and PCR products were visualized on a 2% aga- rose gel stained with ethidium bromide (M, molecular marker). A housekeeping gene Gapdh was used as an internal control. The RT-PCR results confirmed the microarray patterns showing up-regulation of IL-1␤ mRNA at TNBS-w6. B, IL-1␤ in colonic protein extracts was measured by ELISA. The data are presented as a ratio of IL-1␤:total protein. IL-1␤ was significantly increased in colons from TNBS-w6. C, Cxcl1 mRNA was quantified by real-time qRT- PCR normalized to Gapdh expression and presented as mean Ϯ 1 SD. The qRT-PCR results are in agreement with the microarray-identified overexpression at TNBS-w6. D, Cxcl1 in colonic protein extract was measured by ELISA. This chemokine was significantly increased in colons from TNBS-w6.

macrophages (Fig. 3A). S100A9 (calgranulin B, or MRP14) is a sion is shown in a heat map of above and below mean expression calcium-binding protein expressed in inflamed tissues by macro- of these genes (Fig. 4, clusters A–E). A subset of 69 genes up- phages and neutrophils (15). The microarray results (discussed regulated at TNBS-w6 showed a rapid decline in gene expression later) also indicated elevated S100a9 transcript at TNBS-w6. In an within 2 wk, at TNBS-w8. A majority of the genes from this group earlier study, the S100A9 gene was found to be overexpressed in related to inflammation (Ccl9, Ccr5, Cxcl1, Il1b, Nos2, Pla2g2a, colonic tissue of IBD patients (16, 17). We detected a massive Cd14, S100a8, S100a9), acute-phase immune response/Ag presen- increase in S100A9-positive macrophages and neutrophils in the tation (classical complement activation pathway genes C1qb, mucosa and submucosa at TNBS-w6. By TNBS-w8, these inflam- C1qg, histocompatibility class II Ag genes H2-Aa), and cell pro- matory infiltrates had decreased considerably (Fig. 3A). A large liferation (Stat1, Anxa). Interestingly, a second group of proinflam- body of research on IBD and animal models has shown that highly matory genes maintained elevated expression beyond TNBS-w6, ϩ ␥ polarized CD4 T cells producing IFN- with a Th1-type response into TNBS-w8 and TNBS-w10 (25 plus 14 genes from cluster A). are critical to chronic inflammation. Therefore, colonic sections of These include Ccl2, Ccl7, Cxcl5, Saa3, Pap, and Reg3 and may be control and TNBS-induced colitis mice were immunostained with important in maintaining chronic inflammation and fibrosis. Others anti-CD3 and anti-CD4 to determine whether T cells are present in from this late-induction group were related to microbial defense the chronic inflammatory stage of this model. CD3ϩ and CD4ϩ T (macrophage-expressed Tgtp encoding T cell-specific GTP-bind- cells were detected at TNBS-w6, as well as at TNBS-w8, in the ing protein, mast cell proteases, Mcpt1, Mcpt 2, Cma2), and cell lamina propria and in the submucosa (Fig. 3, B and C). Thus, proliferation (Ccnb1, Smc2l1, Mki67, Ptprc). macrophages and polymorphonuclear neutrophils that mark active inflammation declined by TNBS-w8, but influx of CD4ϩ T cells, Genes encoding proteins relating to fibrosis, collagen type I and indicative of adaptive immune response, was evident at TNBS-w6 III (Col1a1, Col1a2, Col3a1), and lysyl oxidase, required for and TNBS-w8. cross-linking newly synthesized collagen chains, were induced at the same time as the proinflammatory cytokine genes at TNBS-w6 Temporal gene expression pattern of TNBS-induced chronic (Fig. 4, cluster A). However, unlike the first tier of proinflam- colitis matory genes that was down-regulated by TNBS-w8, the ECM- To investigate gene activities during chronic inflammation and related genes continued above basal expression into TNBS-w8 healing of the colon, we obtained gene expression profiles of the and later (Table I). Another gene, Lum encoding a proteoglycan, mouse colon at TNBS-w6, TNBS-w8, TNBS-w10, and TNBS- lumican, known to bind collagen and to regulate fibril structure w12 and compared these with the saline controls. As compared (14, 18), was also expressed at high levels in TNBS-w6 (Fig. 4, with the saline control, there were 123, 72, 35, and 29 annotated cluster A and Table I). The expressions of selected proinflam- genes differentially expressed at TNBS-w6, TNBS-w8, TNBS- matory genes and ECM genes Col1a1, Col3a1, and Lum were w10, and TNBS-w12, respectively, comprising a total of 175 non- further investigated by qRT-PCR and immunohistology (pre- redundant genes (Table I). The sequential change in gene expres- sented later). The Journal of Immunology 6995

The heat map of differentially expressed genes revealed additional changes in expression that are relatively novel in the context of colitis. Genes involved in tissue remodeling (Eif4ebp2, Mmp15, Timp1), cell adhesion (Dsc2, L1cam), differentiation (Rdh16), and restoration of normal colonic functions were overexpressed later at TNBS-w10 and TNBS-w12 (Fig. 4, clusters C and D). Finally, a group of genes normally expressed at high levels in the resting healthy colon (Fig. 4, cluster E, saline controls), were down-regulated at TNBS-w6 and TNBS-w8. These include transport related genes, Slc1a1, Slc4a4, Slc20a1, Clca3, genes implicated in regulating cell shape and actin filament formation (Gsn, Scin), and posttranslational protein modification related to epithelial differentiation (Tgm3). Expression of many from this cluster was not restored to baseline, even at the latest TNBS-w12 stage (Table I). This suggests that although known inflammation-related genes re- sume normal expression late in the model, certain genes required for the restoration of tissue homeostasis do not recover or take much longer to do so.

Validation of microarray gene expression patterns The microarray results indicated elevated IL-1␤ transcript at TNBs-w6 and its decline by TNBS-w8. An increased amount of IL-1␤ mRNA was also detected by qRT-PCR at TNBS-w6 (Fig. 5A). ELISA indicated statistically significant overexpression of the cytokine at TNBS-w6 and TNBS-w8 (Fig. 5B). The chemokine ligand CXCL1, also known as GRO-␣, is a neutrophil chemoattractant, secreted by activated macrophages, and plays FIGURE 6. ECM in TNBS-induced colitis. A, Collagen (Col1a1, a key role in inflammatory responses. By microarray, Cxcl1 was Col3a1) and lumican (Lum) transcripts were measured by qRT-PCR on and # indicate ,ˆ ,ء .found to be up-regulated at TNBS-w6. qRT-PCR on total RNA colonic total RNA and normalized to Gapdh expression from individual TNBS-treated and control animals indicated p Յ 0.05 based on unpaired Student’s t test as compared with correspond- statistically significant high levels of the transcript and elevated ing saline controls, respectively. The Col1a1 and Col3a1 transcripts were levels of the chemokine ligand by ELISA at TNBS-w6 (Fig. 5, significantly elevated at TNBS-w6 and TNBS-w8. The Lum transcript was C and D). induced by TNBS-w6 and expressed above basal level into TNBS-w12. B, Collagen types I and III are known to be regulated differently The lumican protein was localized in colonic sections by immunohistochemistry using a polyclonal anti-mouse lumican Ab. The saline control in fibrosis (19–22). Our microarray profiles indicated overex- showed some lumican-immunopositive staining of the submucosa, indicat- Col1a1 Col3a1 pression of fibrillar collagen genes and during ing normal deposition of this protein in the ECM (arrow). At TNBS-w6 and active inflammation at TNBS-w6 and later at TNBS-w8. qRT- TNBS-w8, there was a marked increase in immunopositive staining of the PCR on colonic total RNA confirmed elevated transcripts of submucosa with additional staining of the mucosa (arrows). Thus, lumican Col1a1 and Col3a1 at TNBS-w6 and TNBS-w8 and return to was up-regulated at TNBS-w6 and w8, with expression maintained above basal levels by TNBS-w10 and TNBS-w12 (Fig. 6A). Lum was basal level for the duration of the study. also induced at TNBS-w6, and its expression remained elevated above basal level at TNBS-w10 and TNBS-w12 (Fig. 6A). Im- munohistochemistry of colonic sections further showed that and fibrosis, neither was completely abrogated by this method. there was a marked increase in lumican deposit in the mucosa Residual signs of inflammation and fibrosis in the NF-␬B blockade and submucosa of mice from the TNBS-w6, TNBS-w8, and group could be due to incomplete inhibition of NF-␬B. Therefore, TNBs-w10 groups (Fig. 6B). we determined the extent of NF-␬B inhibition after the antisense oligonucleotide treatment by ELISA measurements of total NF-␬B ␬ Effects of NF- B antisense treatment on inflammation and from colonic protein extracts. As expected, there was a significant fibrosis increase in total NF-␬B after inducing colitis with TNBS com- An antisense oligonucleotide against NF-␬B p65, administered as pared with that of saline-treated controls. The NF-␬B antisense rectal enemas, has been demonstrated to suppress acute inflamma- oligonucleotide treatment reduced total NF-␬B by 60% ( p Ͻ tion within the first 2 wk of TNBS-induced colitis (7). We further 0.05), while the control oligonucleotide had no such inhibitory showed that chronic inflammation and fibrosis in week 8 could be effect (Fig. 7C). inhibited significantly by administration of the antisense NF-␬B We next investigated how inflammatory and profibrogenic oligonucleotide during development of colitis (6). Examined at an genes responded to the NF-␬B inhibition. The microarray gene earlier time point in week 6 in the current study, we found mild expression patterns had indicated the presence of several proin- inflammation and fibrosis in 60% and moderate inflammation and flammatory genes, Cxcl1, Il1b, Pla2g2a, Saa3, Reg2, and Reg3g, fibrosis in 40% of the antisense NF-␬B-treated colitis group (Fig. that are also likely targets of NF-␬B regulation (23, 24). Quanti- 7A). The control oligonucleotide containing a scrambled sequence tative assessment of these transcripts in TNBS-induced colitis sub- of the NF-␬B antisense oligonucleotide had no beneficial effects. jected to the NF-␬B blockade treatment showed statistically sig- The influx of CD4ϩ T cells was also partially inhibited by the nificant suppression of gene expression (Fig. 8). The control NF-␬B blockade (Fig. 7B). Taken together, these results indicated oligonucleotide had little to no inhibitory effect. The microarray that although the NF-␬B blockade treatment reduced inflammation results had shown Ccl2 to be one of several proinflammatory genes 6996 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

FIGURE 7. Effects of NF-␬B p65 antisense oligonucleotide treatment on mouse colitis. A, Inflammation and fibrosis were scored at week 6 as described before (6). B, Reduced influx of CD4ϩ lymphocytes (arrows) in TNBS colitis treated with NF-␬B antisense oligonucleotide. C, Measure- ments of total NF-␬B in colonic pro- p Ͻ 0.05 ,ء .tein extracts by ELISA statistical significance based on unpaired Student’s t test.

with continued overexpression at later stages of chronic colitis. nohistology indicated a resolution of inflammation by TNBS- Ccl2 has recently been suggested to play a significant role in driv- w8, while low levels of fibrosis persisted as late as TNBS-w12, ing fibrosis (25). Therefore, we tested the expression of Ccl2 in 6 wk after the last TNBS treatment. Our temporal gene expres- mice with TNBS-induced colitis before and after the NF-␬B block- sion study provided a continuous view of proinflammatory and ade treatment (Fig. 8). Unlike the other proinflammatory genes profibrogenic changes as chronic inflammation shifted to fibro- tested, expression of Ccl2 was not suppressed effectively by partial sis. We further investigated the effects of suppressing inflam- inhibition of NF-␬B. mation on fibrosis by inhibiting NF-␬B. An antisense oligonu- ␬ To investigate the effects of NF- B antisense treatment on pro- cleotide directed against the NF-␬B p65 subunit given fibrogenic genes, we assayed for the expression of Col1a1, intrarectally reduced the total NF-␬B pool but did not lower it Col3a1, and Lum at TNBS-w6 and TNBS-w8 before and after to basal levels. Several proinflammatory genes were amenable ␬ treatment with NF- B antisense oligonucleotide (Fig. 9). All three to complete suppression at this reduced NF-␬B level, while oth- ECM genes had shown a modest increase in expression at ers were not. Furthermore, the fibrogenic collagen I and III TNBS-w6 and TNBS-w8. Partial inhibition of NF-␬B-blocked genes were not suppressed adequately at this level of NF-␬B Lum expression effectively, but Col1a1 and Col3a1 expression inhibition. was not inhibited by the NF-␬B blockade treatment. At TNBS-w6, the earliest time point of the study, the gene ex- Discussion pression profiles indicated up-regulation of cytokines, chemokines, growth factors, receptors, and transcription factors (Il1b, Il1rl1, A major complication of chronic transmural inflammation of the Ccl2, Ccl7, Ccl9, Ccr2, Ccr5, Cxcl1, Cxcl5, Cxcl9, Reg2, Reg3a, intestine is fibrostenosis as seen in Crohn’s disease (2). We and Stat1) that promoted cell growth and served as inflammatory investigated the connection between chronic inflammation and cell chemoattractants and inducers of stress response. Normal heal- fibrosis using a mouse model of chronic colitis, established by giving six weekly enemas of TNBS as described in our earlier ing is a self-limiting process where proinflammatory signals are ␣ study (6). We examined gene expression patterns in this model balanced by healing and tissue/ECM rebuilding signals. TNF- is ␤ from weeks 6–12, spanning a period of late active inflammation the proinflammatory cytokine prototype (27, 28), while TGF- is to chronic inflammation, fibrosis, resolution of inflammation, a key immunosuppressive anti-inflammatory cytokine/growth fac- and the beginning of normal homeostatic conditions. Another tor that has been shown to induce the profibrogenic myofibroblast recent study of the chronic colitis model described three phases phenotype in fibroblasts and fibrosis in experimental colitis models in the model, acute inflammation from 0 to 14 days, nonpro- (29–38). There was no measurable increase in TNF-␣ at the gressive inflammation lasting from days 14 to 35, and the last chronic inflammatory stage in TNBS-treated mice. Because phase as chronic inflammation from days 35 to 49 or weeks 5 to TNF-␣ is an early cytokine in the inflammation time scale, its 7 (26). By comparison, our study focused on chronic inflam- expression may be back to normal by TNBS-w6. This may also be mation (TNBS-w6) and healing investigated at 2-wk intervals the reason for not detecting TNF-␣ overexpression in earlier mi- (TNBS-w8, TNBS-w10, and TNBS-w12). Histology and immu- croarray studies of long-term IBD patients (16, 39). Fichtner-Feigl The Journal of Immunology 6997

FIGURE 8. Effects of NF-␬B p65 antisense oligonucleotide treatment on regulation of inflammation-related genes. The relative expression value of a gene was quantified by qRT-PCR and normalized to the expression of Gapdh from colonic total RNA at week 6. Gene symbols are Il1b: IL- 1␤, Cxcl11: chemokine (CXC motif) ligand 1; Pla2g2a: phospholipase A2, group IIA; Saa3: serum amyloid A3; Reg2: regenerating islet-derived 2; Reg3g: regenerating islet-derived 3␥; Ccl2: chemokine (CC motif) ligand 2. Statistical significance based on unpaired Student’s t test. Ccl2 expression was not suppressed by NF-␬B p65 antisense oligonucleotide treatment of TNBS-induced colitis.

(26) reported IL-13 as another cytokine that triggers TGF-␤1-de- might contribute to inflammation and fibrosis. A set of inflamma- pendent fibrosis in the TNBS-induced chronic colitis model exam- tion-related genes continued above mean expression into ined around the week 6 time point. Our microarray did not detect TNBS-w8 and beyond (Ccl2, Ccl7, Pap, Reg3g, Saa3). The Pap an increase in IL-13 mRNA and there are several possible expla- and Reg3g genes have now been consistently associated with IBD nations for this. Cytokine gene expressions can show subtle, tran- and chronic inflammation and may play a role in innate immune sient changes that may go undetected by microarray profiling. Fur- functions and bacterial colonization of the gut (42). Pap has been thermore, in the Fichtner-Feigl study (26), the cytokines were suggested to down-regulate NF-␬B and suppress proinflammatory detected in TNBS-treated mouse colonic lamina propria mononu- signals (43, 44). Whether these have profibrogenic influence re- clear cells simulated in culture with anti-CD3 Ab. The approaches mains to be seen. Saa3 encodes a serum amyloid factor and is followed by these studies (11, 26, 40) were quite different from recognized as an inflammation marker. Its high expression is main- our direct study of colonic tissue total RNA and protein. Nev- tained for almost 4 wk after the last TNBS treatment. Serum amy- ertheless, these different approaches complement each other in loid A factor binds ECM proteins and such ECM-SAA complexes their investigations of the initiation, development, and compli- have been suggested to regulate adhesion and activation of CD4ϩ cations of chronic colitis and fibrosis. Emerging concepts high- T lymphocytes (45). Continued expression of Saa3 is consistent light IL-23 as an early cytokine that ultimately leads to the with the idea that this mouse model of chronic colitis is T cell induction of IL-13- and IL-4-mediated Th2 responses and TGF- driven and ECM-bound serum amyloid A could be aiding fibro- ␤1-centered profibrogenic events (11, 26). Our differential gene genic changes in the tissue. We detected sustained expression of expression profiles are likely to reveal downstream targets reg- Ccl2 (Mcp1) and Ccl7 (Mcp3) in TNBS-w8 and Ccl2 even 4 wk ulated by these cytokines. later at TNBS-w10. These encode chemokine ligands, MCP-1/ An imbalance between proinflammatory and anti-inflammatory CCL2 and MCP-3/CCL7, also known as monocyte chemoattrac- signals is believed to underlie abnormal ECM buildup, tissue dis- tant proteins, which have been linked to recruitment of monocytes tortion, and fibrosis (2, 41). Thus, we asked whether in our chronic and lymphocytes in chronic inflammatory diseases. MCP-1/CCL2 colitis model there was sustained overexpression of genes that may promote abnormal recruitment of leukocytes and pulmonary 6998 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

FIGURE 9. Effects of NF-␬B p65 antisense oligonucleotide treatment on regulation of ECM genes. NF-␬B p65 blockade failed to down-regulate ﬁbro- sis-related procollagen type I, ␣1(Col1a1), and procollagen type III, ␣1(Col3a1) but down-regulated lumican (Lum). The relative expression values of Col1a1, Col3a1, and Lum were measured by qRT- PCR, normalized to the expression of Gapdh from colonic total RNA. Statistical signiﬁcance level was set at p Յ 0.05.

fibrosis. Increased MCP-3 has been associated with severity of may have a similar role in regulating inflammatory cell influx in systemic sclerosis and pulmonary fibrosis (46). A recent study has chronic colitis. shown Ccl2 to drive intestinal fibrosis in a mouse model, where Increased remodeling of the ECM has been suggested to keep intramural transfer of the Ccl2 gene by adenoviral vector injection fibrogenic collagen deposition in check. Accordingly, our earlier caused a transient increase in TGF-␤1 in the acute phase and in- study has shown that ulcerative colitis, less prone to fibrosis, ex- creased deposition of collagen in the colon (25). We speculated pressed a wider variety of matrix metalloproteinase (16). Our cur- that residual persistent fibrosis in TNBS-induced colitis that re- rent temporal gene expression pattern showed a massive overex- ceived the NF-␬B blockade treatment could be due to poor inhi- pression of Timp1, encoding a matrix metalloproteinase inhibitor bition of inflammatory genes. Among these, Ccl2, for example, at the later stages (11 and 118 times the basal level of expression could tip the balance toward fibrosis. Indeed, Ccl2 expression was in TNBS-w8 and TNBS-w10, respectively) that may be counter- ␬ not inhibited completely by NF- B blockade unlike many other productive to fibrosis-reducing remodeling of the ECM. Theiss et proinflammatory genes like Cxcl1, Il1b, Pla2g2a, Reg2, Reg3g, al. (55) have shown recently that TNF-␣, in conjunction with in- and Saa3 that were. sulin-like growth factor can induce Timp1 in myofibroblasts that Among fibrogenic ECM genes, Col1a1, Col1a2, and Col3a1 deposit fibrotic tissue in the submucosa. Finally, proteolytic encoding collagen types I and III were overexpressed at the same changes in the ECM may contribute to altered interactions of time as several inflammation mediators. Their expression at the the ECM with immune and nonimmune cells that affect fibrosis mRNA and protein levels continued after expression of inflamma- (56). In agreement with this idea is our observation that many tion-related genes had resumed basal levels. Earlier studies have genes encoding proteolytic enzymes, trypsin, lysozyme, mast also linked altered amounts of collagen I and III with fibrosis (38, cell proteases, elastases and serine proteases, were elevated in 47–49). Increase in the ECM protein lumican (Lum) in colitis was a novel finding. Lumican is a proteoglycan that in the stable mature TNBS-induced colitis. Increased proteolytic activity has also ECM is found in close association with collagen fibrils and ample been reported in IBD and considered to be a major cause of evidence supports its role in the regulation of the collagen fibril tissue damage (57, 58). structure (14, 50–52). The Lum transcript was elevated sharply at In summary, our study identified novel inflammation media- TNBS-w6 and remained up-regulated after collagen expression tors and ECM proteins in chronic colitis. These may play sig- had subsided. Immunohistology indicated increased presence of nificant roles in chronic inflammation and establishment of fi- the lumican protein in the submucosa. Distribution of lumican was brosis, providing potential targets for IBD therapy. Our study similar to the fibrillar collagens. We speculate that altered ratio of further suggests the presence of two groups of proinflammatory lumican:collagen may affect the assembly and architecture of the genes, one easily suppressed by partial NF-␬B inhibition, while newly deposited collagen. In addition to regulating collagen struc- a second, as indicated by Ccl2, may maintain high activity at ture, recent studies suggest regulation of cellular functions by lu- lower levels of NF-␬B. This raises the possibility that for ef- mican. Thus, in the injured cornea lumican plays a role in aiding fective treatment of inflammation and fibrosis early and com- inflammatory cell influx and cellular apoptosis as well (53, 54). It plete inhibition of NF-␬B may be necessary. However, NF-␬B The Journal of Immunology 6999

is also required for cell survival and other biologically benefi- GRO genes encoding cytokine functions. Proc. Natl. Acad. Sci. USA 87: cial events and the long-term effects of complete abrogation of 7732–7736. 24. Massa, P. E., X. Li, A. Hanidu, J. Siamas, M. Pariali, J. Pareja, A. G. Savitt, NF-␬B may be less than desirable. Therefore, effective thera- K. M. Catron, J. Li, and K. B. Marcu. 2005. Gene expression profiling in con- peutic regimens may be developed by partial inhibition of junction with physiological rescues of IKK␣-null cells with wild type or mutant ␬ IKK␣ reveals distinct classes of IKK␣/NF-␬B-dependent genes. J. Biol. Chem. NF- B accompanied with additional targeted inhibition of spe- 280: 14057–14069. cific proinflammatory signals. 25. Motomura, Y., W. I. Khan, R. T. El-Sharkawy, M. Verma-Gandhu, E. F. Verdu, J. Gauldie, and S. M. Collins. 2006. Induction of a fibrogenic response in mouse colon by overexpression of monocyte chemoattractant protein 1. Gut 55: Disclosures 662–670. The authors have no financial conflict of interest. 26. Fichtner-Feigl, S., I. J. Fuss, C. A. Young, T. Watanabe, E. K. Geissler, H. J. Schlitt, A. Kitani, and W. Strober. 2007. Induction of IL-13 triggers TGF- ␤1-dependent tissue fibrosis in chronic 2,4,6-trinitrobenzene sulfonic acid colitis. References J. Immunol. 178: 5859–5870. 1. Abreu, M. T., K. D. Taylor, Y. C. Lin, T. Hang, J. Gaiennie, C. J. Landers, 27. Holtmann, M. H., M. Schuchmann, G. Zeller, P. R. Galle, and M. F. Neurath. E. A. Vasiliauskas, L. Y. Kam, M. Rojany, K. A. Papadakis, et al. 2002. Muta- 2002. The emerging distinct role of TNF-receptor 2 (p80) signaling in chronic tions in NOD2 are associated with fibrostenosing disease in patients with Crohn’s inflammatory disorders. Arch. Immunol. Ther. Exp. 50: 279–288. disease. Gastroenterology 123: 679–688. 28. Marini, M., G. Bamias, J. Rivera-Nieves, C. A. Moskaluk, S. B. Hoang, 2. Van Assche, G., K. Geboes, and P. Rutgeerts. 2004. Medical therapy for Crohn’s W. G. Ross, T. T. Pizarro, and F. Cominelli. 2003. TNF-␣ neutralization ame- disease strictures. Inflamm. Bowel Dis. 10: 55–60. liorates the severity of murine Crohn’s-like ileitis by abrogation of intestinal 3. Appleyard, C. B., and J. L. Wallace. 1995. Reactivation of hapten-induced epithelial cell apoptosis. Proc. Natl. Acad. Sci. USA 100: 8366–8371. colitis and its prevention by anti-inflammatory drugs. Am. J. Physiol. 269: 29. Wahl, S. M., and W. Chen. 2003. TGF-␤: how tolerant can it be? Immunol. Res. G119–G125. 28: 167–179. 4. Elson, C. O., Y. Cong, S. Brandwein, C. T. Weaver, R. P. McCabe, 30. Jester, J. V., P. A. Barry-Lane, H. D. Cavanagh, and W. M. Petroll. 1996. In- M. Mahler, J. P. Sundberg, and E. H. Leiter. 1998. Experimental models to duction of ␣-smooth muscle actin expression and myofibroblast transformation in study molecular mechanisms underlying intestinal inflammation. Ann. NY cultured corneal keratocytes. Cornea 15: 505–516. Acad. Sci. 859: 85–95. 31. Schuppan, D., and Y. Porov. 2002. Hepatic fibrosis: from bench to bedside. 5. Neurath, M., I. Fuss, B. Kelsall, E. Stuber, and W. Strober. 1995. Antibodies to J. Gastroenterol. Hepatol. 17(Suppl. 3): S300–S305. interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 32. Shi, Y., J. E. O’Brien, Jr., A. Fard, and A. Zalewski. 1996. Transforming growth 182: 1281–1290. factor-␤ 1 expression and myofibroblast formation during arterial repair. Arte- 6. Lawrance, I. C., F. Wu, A. Z. Leite, J. Willis, G. A. West, C. Fiocchi, and rioscler. Thromb. Vasc. Biol. 16: 1298–1305. S. Chakravarti. 2003. A murine model of chronic inflammation-induced in- 33. Gressner, A. M. 1996. Transdifferentiation of hepatic stellate cells (Ito cells) to testinal fibrosis down-regulated by antisense NF-␬B. Gastroenterology 125: myofibroblasts: a key event in hepatic fibrogenesis. Kidney Int. Suppl. 54: 1750–1761. S39–S45. 7. Neurath, M. F., S. Pettersson, K. H. Meyer zum Buschenfelde, and W. Strober. 34. Masur, S. K., H. S. Dewal, T. T. Dinh, I. Erenburg, and S. Petridou. 1996. 1996. Local administration of antisense phosphorothioate oligonucleotides to the Myofibroblasts differentiate from fibroblasts when plated at low density. Proc. ␬ p65 subunit of NF- B abrogates established experimental colitis in mice. Nat. Natl. Acad. Sci. USA 93: 4219–4223. Med. 2: 998–1004. 35. Desmouliere, A., A. Geinoz, F. Gabbiani, and G. Gabbiani. 1993. Transforming ␬ 8. Baeuerle, P. A., and D. Baltimore. 1996. NF- B: ten years after. Cell 87: 13–20. growth factor-␤1 induces ␣-smooth muscle actin expression in granulation tissue ␬ 9. Lenardo, M. J., and D. Baltimore. 1989. NF- B: a pleiotropic mediator of in- myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. ducible and tissue-specific gene control. Cell 58: 227–229. 122: 103–111. 10. Neurath, M. F., I. Fuss, G. Schurmann, S. Pettersson, K. Arnold, 36. Bachem, M. G., K. M. Sell, R. Melchior, J. Kropf, T. Eller, and A. M. Gressner. H. Muller-Lobeck, W. Strober, C. Herfarth, and K. H. Buschenfelde. 1998. Cy- ␣ ␣ ␤ ␬ 1993. Tumor necrosis factor (TNF ) and transforming growth factor 1 (TGF tokine gene transcription by NF- B family members in patients with inflamma- ␤1) stimulate fibronectin synthesis and the transdifferentiation of fat-storing cells tory bowel disease. Ann. NY Acad. Sci. 859: 149–159. in the rat liver into myofibroblasts. Virchows Arch. B Cell Pathol. Incl. Mol. 11. Fichtner-Feigl, S., I. J. Fuss, J. C. Preiss, W. Strober, and A. Kitani. 2005. Treat- Pathol. 63: 123–130. ment of murine Th1- and Th2-mediated inflammatory bowel disease with NF-␬B 37. Graham, M. F., G. R. Bryson, and R. F. Diegelmann. 1990. Transforming growth decoy oligonucleotides. J. Clin. Invest. 115: 3057–3071. factor ␤1 selectively augments collagen synthesis by human intestinal smooth 12. Li, C., and W. H. Wong. 2001. Model-based analysis of oligonucleotide arrays: muscle cells. Gastroenterology 99: 447–453. expression index computation and outlier detection. Proc. Natl. Acad. Sci. USA 38. Vallance, B. A., M. I. Gunawan, B. Hewlett, P. Bercik, C. Van Kampen, 98: 31–36. F. Galeazzi, P. J. Sime, J. Gauldie, and S. M. Collins. 2005. TGF-␤1 gene 13. Rebhan, M., V. Chalifa-Caspi, J. Prilusky, and D. Lancet. 1997. GeneCards: transfer to the mouse colon leads to intestinal fibrosis. Am. J. Physiol. 289: Encyclopedia for Genes, Proteins and Diseases. Weizmann Institute of Science, G116–G128. Bioinformatics Unit and Genome Center, Rehovot, Israel. 39. Dieckgraefe, B. K., W. F. Stenson, J. R. Korzenik, P. E. Swanson, and 14. Chakravarti, S., T. Magnuson, J. H. Lass, K. J. Jepsen, C. LaMantia, and C. A. Harrington. 2000. Analysis of mucosal gene expression in inflammatory H. Carroll. 1998. Lumican regulates collagen fibril assembly: skin fragility and bowel disease by parallel oligonucleotide arrays. Physiol. Genomics 4: 1–11. corneal opacity in the absence of lumican. J. Cell Biol. 141: 1277–1286. 40. Fichtner-Feigl, S., W. Strober, K. Kawakami, R. K. Puri, and A. Kitani. 2006. 15. Nacken, W., J. Roth, C. Sorg, and C. Kerkhoff. 2003. S100A9/S100A8: Myeloid ␣ ␤ representatives of the S100 protein family as prominent players in innate immu- IL-13 signaling through the IL-13 2 receptor is involved in induction of TGF- 1 nity. Microsc. Res. Tech. 60: 569–580. production and fibrosis. Nat. Med. 12: 99–106. 16. Lawrance, I. C., C. Fiocchi, and S. Chakravarti. 2001. Ulcerative colitis and 41. Pucilowska, J. B., K. L. Williams, and P. K. Lund. 2000. Fibrogenesis, IV: fi- Crohn’s disease: distinctive gene expression profiles and novel susceptibility can- brosis and inflammatory bowel disease, cellular mediators and animal models. didate genes. Hum. Mol. Genet. 10: 445–456. Am. J. Physiol. 279: G653–G659. 17. Wu, F., T. Dassopoulos, L. Cope, A. Maitra, S. R. Brant, M. L. Harris, 42. Dieckgraefe, B. K., D. L. Crimmins, V. Landt, C. Houchen, S. Anant, T. M. Bayless, G. Parmigiani, and S. Chakravarti. 2007. Genome-wide gene R. Porche-Sorbet, and J. H. Ladenson. 2002. Expression of the regenerating gene ␣ expression differences in Crohn’s disease and ulcerative colitis from endoscopic family in inflammatory bowel disease mucosa: Reg I upregulation, processing, pinch biopsies: insights into distinctive pathogenesis. Inflamm. Bowel Dis. 13: and antiapoptotic activity. J. Investig. Med. 50: 421–434. 807–821. 43. Gironella, M., J. L. Iovanna, M. Sans, F. Gil, M. Penalva, D. Closa, R. Miquel, 18. Chakravarti, S., R. L. Stallings, N. SundarRaj, P. K. Cornuet, and J. R. Hassell. J. M. Pique, and J. Panes. 2005. Anti-inflammatory effects of pancreatitis asso- 1995. Primary structure of human lumican (keratan sulfate proteoglycan) and ciated protein in inflammatory bowel disease. Gut 54: 1244–1253. localization of the gene (LUM) to chromosome 12q21.3-q22. Genomics 27: 44. Keilbaugh, S. A., M. E. Shin, R. F. Banchereau, L. D. McVay, N. Boyko, 481–488. D. Artis, J. J. Cebra, and G. D. Wu. 2005. Activation of RegIII␤/␥ and interferon 19. Matthes, H., H. Herbst, D. Schuppan, A. Stallmach, S. Milani, H. Stein, and ␥ expression in the intestinal tract of SCID mice: an innate response to bacterial E. Reicken. 1992. Cellular localization of procollagen gene transcripts in inflam- colonisation of the gut. Gut 54: 623–629. matory bowel disease. Gastroenterology 102: 431–442. 45. Preciado-Patt, L., D. Levartowsky, M. Prass, R. Hershkoviz, O. Lider, and 20. Stallmach, A., D. Schuppan, H. H. Riese, H. Matthes, and E. O. Riecken. 1992. M. Fridkin. 1994. Inhibition of cell adhesion to glycoproteins of the extra- Increased collagen type III synthesis by fibroblasts isolated from strictures of cellular matrix by peptides corresponding to serum amyloid A: toward un- patients with Crohn’s disease. Gastroenterology 102: 1920–1929. derstanding the physiological role of an enigmatic protein. Eur. J. Biochem. 21. Owens, M. W., and M. B. Grisham. 1993. Cytokines increase proliferation of 223: 35–42. human intestinal smooth muscle cells: possible role in inflammation-induced 46. Yanaba, K., K. Komura, M. Kodera, T. Matsushita, M. Hasegawa, K. Takehara, stricture formation. Inflammation 17: 481–487. and S. Sato. 2006. Serum levels of monocyte chemotactic protein-3/CCL7 are 22. Lawrance, I. C., L. Maxwell, and W. Doe. 2001. Inflammation location, but not raised in patients with systemic sclerosis: association with extent of skin sclerosis type, determines the increase in TGF-␤1 and IGF-1 expression and collagen and severity of pulmonary fibrosis. Ann. Rheum. Dis. 65: 124–126. deposition in IBD intestine. Inflamm. Bowel Dis. 7: 16–26. 47. Graham, M. F., R. F. Diegelmann, C. O. Elson, W. J. Lindblad, N. Gotschalk, 23. Haskill, S., A. Peace, J. Morris, S. Sporn, A. Anisowicz, S. Lee, T. Smith, S. Gay, and R. Gay. 1988. Collagen content and types in the intestinal strictures G. Martin, P. Ralph, and R. Sager. 1990. Identification of three related human of Crohn’s disease. Gastroenterology 94: 257–265. 7000 INFLAMMATION AND FIBROSIS IN MURINE COLITIS

48. Graham, M. F., A. Willey, J. Adams, and R. F. Diegelmann. 1995. Corticoste- 53. Vij, N., L. Roberts, S. Joyce, and S. Chakravarti. 2005. Lumican regulates corneal roids increase procollagen gene expression, synthesis, and secretion by human inflammatory responses by modulating Fas-Fas ligand signaling. Invest. Ophthal- intestinal smooth muscle cells. Gastroenterology 109: 1454–1461. mol. Visual Sci. 46: 88–95. 49. Graham, M. F., D. E. Drucker, R. F. Diegelmann, and C. O. Elson. 1987. Col- 54. Vij, N., L. Roberts, S. Joyce, and S. Chakravarti. 2004. Lumican suppresses cell lagen synthesis by human intestinal smooth muscle cells in culture. Gastroen- proliferation and aids Fas-Fas ligand mediated apoptosis: implications in the cor- terology 92: 400–405. nea. Exp. Eye Res. 78: 957–971. 55. Theiss, A. L., J. G. Simmons, C. Jobin, and P. K. Lund. 2005. Tumor necrosis 50. Rada, J. A., P. K. Cornuet, and J. H. Hassell. 1993. Regulation of corneal col- factor (TNF) ␣ increases collagen accumulation and proliferation in intestinal lagen fibrillogenesis in vitro by corneal keratan sulfate proteoglycan (lumican) myofibroblasts via TNF receptor 2. J. Biol. Chem. 280: 36099–36109. and decorin core proteins. Exp. Eye Res. 56: 635–648. 56. Pender, S. L., P. Lionetti, S. H. Murch, N. Wathan, and T. T. MacDonald. 1996. 51. Jepsen, K. J., F. Wu, J. H. Peragallo, J. Paul, L. Roberts, Y. Ezura, A. Oldberg, Proteolytic degradation of intestinal mucosal extracellular matrix after lamina D. E. Birk, and S. Chakravarti. 2002. A syndrome of joint laxity and impaired propria T cell activation. Gut 39: 284–290. tendon integrity in lumican- and fibromodulin-deficient mice. J. Biol. Chem. 277: 57. MacDonald, T. T., and S. L. Pender. 1998. Proteolytic enzymes in inflammatory 35532–35540. bowel disease. Inflamm. Bowel Dis. 4: 157–164. 52. Ezura, Y., S. Chakravarti, A. Oldberg, I. Chervoneva, and D. E. Birk. 2000. 58. Pender, S. L., S. P. Tickle, A. J. Docherty, D. Howie, N. C. Wathen, and Differential expression of lumican and fibromodulin regulate collagen fibrillo- T. T. MacDonald. 1997. A major role for matrix metalloproteinases in T cell genesis in developing mouse tendons. J. Cell Biol. 151: 779–788. injury in the gut. J. Immunol. 158: 1582–1590.