Identification of Phosphoproteins Involved in Sperm

IDENTIFICATION OF PHOSPHOPROTEINS INVOLVED IN SPERM

MATURATION AND FERTILITY.

A dissertation submitted

to Kent State University in partial

fulfillment of the requirements for the

degree of Doctor of Philosophy

Suranjana Goswami

August 2018

Except for previously published materials

Dissertation written by

Suranjana Goswami

B.Sc., University of Calcutta, India, 2009

M.Sc., University of Calcutta, India 2011

Ph.D., Kent State University, USA, 2018

Approved by

Dr. Srinivasan Vijayaraghavan , Chair, Doctoral Dissertation Committee

Dr. Douglas W. Kline , Members, Doctoral Dissertation Committee

Dr. Gary Koshi ,

Dr. Sanjaya Abeysirigunawardena ,

Dr. Andrew Jasnow ,

Accepted by

Dr. Laura G. Leff , Chair, Department of Biological Sciences

Dr. James L. Blank , Dean, College of Arts and Sciences

TABLE OF CONTENTS ...... iii

LIST OF FIGURES ...... v

LIST OF TABLES ...... viii

ABBREVIATIONS ...... ix

DEDICATION ...... xi

ACKNOWLEDGEMENTS ...... xii

CHAPTERS ...... 1

I: Introduction… ...... 1

1.1 Anatomy of testis ...... 1

1.2 Spermatogenesis ...... 5

1.3 Spermatozoon Structure ...... 7

1.4 Sperm Head ...... 9

1.5 Sperm Flagellum ...... 10

1.6 Epididymal sperm maturation and motility initiation ...... 11

1.7 Protein Kinases...... 13

1.8 Sperm Protein Kinase A ...... 17

1.9 sAC and sperm ...... 18

1.10 Protein Phosphatase ...... 20

1.11 Protein phosphatase 1 ...... 21

1.12 The PP1 isoforms PP1γ1 and PP1γ2...... 23

1.13 Role of PP1γ2 in testis ...... 24

1.14 PP1γ2 in sperm motility & epididymal sperm maturation ...... 26

iii

1.15 The regulators PPP1R2, PPP1R11 and PPP1R7 in sperm ...... 27

1.16 Sperm Gsk3a ...... 28

1.17 Phospho-proteome ...... 30

1.18 Aims ...... 33

II: Materials and methods...... 34

III: Aim 1 ...... 49

Rationale ...... 49

Result ...... 52

Summary ...... 67

Discussion… ...... 67

IV: Aim 2 ...... 69

Rationale ...... 69

Result ...... 70

Summary ...... 78

Rationale ...... 79

Result ...... 80

Summary ...... 111

Discussion ...... 112

REFERENCES ...... 116

iv LIST OF FIGURES

Figure 1. Structure of testis and seminiferous tubules ...... 2

Figure 2. Spermatogenesis ...... 6

Figure 3. Sperm structure ...... 8

Figure 4. Sperm head ...... 10

Figure 5. Flagellar axoneme ...... 11

Figure 6. Structure of epididymis ...... 12

Figure 7. Structure of Protein kinase ...... 15

Figure 8. Activation of PKA ...... 17

Figure 9. Structure of Adenylate cyclase ...... 19

Figure 10. PP1γ ...... 24

Figure 11. Expression of PP1 ...... 25

Figure 12. GSK3 ...... 29

Figure 13. Analog sensitive PKA ...... 52

Figure 14. PNBM tagged PKA substrate shown in western blot ...... 53

Figure 15. Affinity purification using iodoacetyl beads ...... 54

Figure 16. Coomassie stained gel of BSA and PPP1R2 ...... 57

Figure 17. Western blot and SDS-PAGE of the test sample ...... 60

Figure 18. Localization of MCT2 and basigin ...... 64

Figure 19. Cloning of Ppp1r36 ...... 71

Figure 20. Northern blot analysis of PPP1R36 in tissues ...... 72

Figure 21. Ppp1r36 is expressed in two different forms ...... 73

Figure 22. mRNA analysis of PPP1R36 in developmental testis ...... 74

v Figure 23. PPP1R36 isoform characterization...... 75

Figure 24. Co-localization of PP1g2 and PPP1R36 in morphologically

normal mouse spermatozoa ...... 77

Figure 25. Northern blot analysis of PP1γ2 binding partners in tissues ...... 81

Figure 26. Ppp1r2 expression in tissues...... 84

Figure 27. Ppp1r11 expression in tissues...... 85

Figure 28. Ppp1r7 expression in tissues...... 86

Figure 29. mRNA analysis of PP1γ2 testis enriched binding

partners in developmental testis ...... 88

Figure 30. Protein analysis of PP1γ2 testis enriched binding

partners in different mouse tissues...... 90

Figure 31. Distribution of PP1γ2 and its binding partners within testis ...... 92

Figure 32. Distribution of PP1γ2 testis enriched binding partners

in soluble and insoluble fraction of sperm lysate ...... 93

Figure 33. Co-localization of PP1g2 and PPP1R2, PPP1R7 and

PPP1R11 in morphologically normal mouse spermatozoa ...... 95

Figure 34. PP1g2 binds with PPP1R2, PPP1R11 and PPP1R7 in testis ...... 97

Figure 35. Binding of PP1g2 with PPP1R2 ...... 99

Figure 36. Binding difference of PPP1R7 with PP1g2 in caput

and caudal epididymis ...... 100

Figure 37. Binding PPP1R11 with PP1g2 in caput and caudal epididymis ...... 101

Figure 38. Differential binding of PP1γ2 to PPP1R2, PPP1R7 and

PPP1R11 in bull caput and caudal epididymal sperm ...... 103

vi Figure 39.Immunoprecipitation on sAC and Gsk3α KO mice ...... 105

Figure 40. The inhibitors are differentially phosphorylated in

caput and caudal epididymis ...... 108

Figure 41. Schematic diagram of how PP1y2 is regulated by its inhibitors

in sperm during its transition from caput to caudal epididymis...... 110

vii LIST OF TABLES

Table 1. PP1 regulators ...... 22

Table 2. List of antibodies used… ...... 44

Table 3. Phospho-peptide identified in LC/MS analysis (iodoacetyl beads) ...... 56

Table 4. The modified peptides of PPP1R2 identified in LC-MS/MS run ...... 59

Table 5. PKA phosphorylated substrates ...... 61

Table 6. Summary of mRNA and protein expression of

PPP1R2, PPP1R7, PPP1R11 overlaps with PP1γ2 ...... 99

Table 7. Summarization of binding status of PP1γ2 with its inhibitors

in wild type, Gsk3α ko and sAC ko mice caudal and caput sperm extract ...... 109

viii Abbreviations

PP1y2 Protein phosphatase gamma 2

PPP1R2(I2) Protein phosphatase 1 regulatory inhibitor subunit 2

PPP1R11(I3) Protein phosphatase 1 regulatory inhibitor subunit 11

PPP1R7(sds22) Protein phosphatase 1 regulatory inhibitor subunit 7

GSK3 Glycogen synthase kinase

AKAP A-kinase anchoring protein

Pgk2 Phosphoglycerate kinase 2 sAC Soluble adenylate cyclase

PKA Protein kinase A cAMP Cyclic adenosine monophosphate

BSA Bovine serum albumin cAMP 3’,5’-Cyclic adenosine monophosphate cDNA Complementary DNA

EDTA Ethylenediaminetetraacetic acid

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PFA Paraformaldehyde

RT-PCR Reverse transcriptase PCR

SDS Sodium dodecyl sulphate

SDS-PAGE SDS polyacrylamide gel electrophoresis

Ser Serine

ix TBS Tris buffered saline

TCA Trichloro acetic acid

Thr Threonine

TPCK Tosyl phenylalanyl chloromethyl ketone

TTBS Tween tris buffered saline

Tyr Tyrosine

SSC Saline-sodium citrate buffer

MOPS 3-(N-morpholino)propanesulfonic acid

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

DRP-1 dynamin related protein-1

“This thesis is dedicated to my parents and my

teachers” For their endless love and

encouragement.

xi Acknowledgements

It is a pleasure to thank the many people who made this thesis possible.

Special mention goes to my enthusiastic supervisor, Dr. Srinivasan Vijayaraghavan. My PhD has been an amazing experience and I thank Dr. VJ wholeheartedly, not only for his tremendous academic support, but also for giving me so many wonderful opportunities. With his enthusiasm, his inspiration, and his great efforts to explain things clearly and simply, he helped to make lab work fun for me. Throughout my thesis-writing period, he provided encouragement, sound advice, good teaching, and lots of good ideas. I could not have imagined having a better advisor and mentor for my Ph.D. study.

Similar, profound gratitude goes to Dr. Douglas Kline, who has been a truly dedicated mentor. I am particularly indebted to Dr. Kline for teaching me microscopy and his constant support during my work here.

I would also like to thank Dr. Gary Koski for his insightful comments and for their insightful comments and encouragement, but also for the hard question which incented me to widen my knowledge.

I would also like to thank Dr. Sanjaya Abeysirigunawardena for his thoughtful comments and suggestion for my research work. I am also grateful to Dr. Aaron Jasnow for taking out his valuable time and agreeing to serve as my graduate representative.

I want to thank all my lab mates for helping me finish my thesis work. Among all I owe a great deal of appreciation and gratitude to Rahul. He has helped me through my thesis work by encouraging me and stimulating me with valuable comments. It was fun working with him before the deadlines during our course work and lab assignments. We have learned and failed together. He has been a brother to me for last six years and helped me through all the tough time

xii both academically and personally. I couldn’t have got anyone better than him as my lab mate. He made our stay in Kent State University fun filled with some wonderful happy memories.

I am indebted to my many young friends for providing a stimulating and fun filled environment.

Special thanks go to Sohini for her constant support and dedication. I can see the good shape of my thesis because of her help and suggestions in formatting the entire thesis. I wish to thank

Monica for her love, care and keeping me cheerful. I also want to thank Manasi for her support.

I would also like to extend huge, warm thanks to my friend Heather, Josh and my nephew

Aiden for their constant love and support.

I am especially grateful to my Ma (mother) and Baba (father) who supported me emotionally and financially. I always knew that you believed in me and wanted the best for me. Thank you for teaching me that my job in life was to learn, to be happy, and to know and understand myself; only then could I know and understand others. They have encouraged me throughout my life and supported all my decisions. I would like to thank my grandparents who always believed in me and provided their sincere encouragement and inspiration throughout my life. I would like to thank all my family members for their support.

Last but not the least I want to thank my husband Subhadip. He was always beside me during the happy and hard moments to push me and motivate me. I know it was a tough journey, but I couldn’t have done it without him.

xiii

Chapter I INTRODUCTION

1.1 Anatomy of Testis.

Seminiferous tubules feed into the rete testis (Figure 1A) and then the epididymis, sperm production and development take place inside this network. The interstitial space between the tubules have blood and lymphatic vessels. Clusters of Leydig cells are present in the interstitial space which produce testosterone. The peritubular myoid cells (PTM) surrounds the seminiferous tubules (Figure 1B) and their contraction forces the sperm to get released from the tubules to rete testis to epididymis. Inside the seminiferous tubules Sertoli cells are found in the epithelial basement membrane and they extend to the lumen (Figure 1C). All the germ cells are found near the basement membrane and close to the Sertoli cells while support germ cell renewal. Sertoli cells also provide nourishment to the differentiating germ cells. All the Sertoli cells together form the blood-testis barrier near the base of the seminiferous tubules and prevents entry of molecules less than 1kDa. This specialized barrier created by the Sertoli cells provides a defined protected microenvironment for development of the germ cells (Figure 1D)(1).

1 A.

2 C.

Figure 1: (A) Structure of testis; showing the seminiferous tubules to rete testis to epididymis.

(B) Diagrammatic cross-section of two seminiferous tubules and different stages of cells. Sertoli cells are at the basement of the tubules and the Leydig cells are in the interstitial space.

Spermatozoa are shown in the lumen of the tubule. (C) Cross- section of a seminiferous tubules from wild type mice. (D) Diagram showing a single Sertoli cell and its association with the germ cell.

4 1.2 Spermatogenesis.

Spermatogenesis is a highly organized and regulated process in post pubertal mammals where millions of sperm are produced. The process is dependent on the presence of self-renewing spermatogonial stem cells (SSCs). Differentiation of SSCs give rise to spermatogonia which are amplified by mitotic divisions, followed by meiotic divisions and finally spermiogenesis to form mature spermatozoa. Sertoli cells are present at the base of the seminiferous tubules. Adjacent to them are SSCs. Sertoli cells are thought to be involved in self-renewal and differentiation of the

SSCs. The SSCs and spermatogonia beginning to undergo differentiation are found within a niche formed by adjacent Sertoli cells and the blood-testis barrier. Spermatocytes formed from the spermatogonia by meiosis move past the blood-testis barrier towards the lumen.

Spermatocytes differentiate into spermatids which morph into spermatozoa (2, 3).

The SSCs [also termed as AS (S= stem)] are rare, comprising 0.03% of the germ cells in mouse testis. They are evenly distributed along the base of the seminiferous tubules, having a large nuclear to cytoplasmic ratio. An AS cell either undergoes division completing cytokinesis to form two daughter cells or it produces two spermatogonia which are connected by a cytoplasmic bridge and then form four spermatogonia in the next division. These spermatogonia are termed as Apr (Apaired) or Aal (Aaligned) respectively. AS , Apr and Aal are termed together as Aundifferentiated because they are stem- and progenitor-spermatogonia. As soon as AS is transformed to Apr or

Aal4 it is committed to differentiate and ultimately form spermatozoa. Successive divisions produce 8, 16 or sometimes as many as 32 Aal spermatogonia. The development of these cells is synchronized because the cells are connected by cytoplasmic bridges which facilitate exchange of protein and mRNA.

Figure 2: Schematic diagram of spermatogenesis in mouse. It takes about 35 days to complete one cycle of spermatogenesis to produce mature sperm in mouse.

Differentiation of Aal to A1 spermatogonia takes place at specific intervals which define twelve different stages of seminiferous tubules completing one full cycle. In mouse each cycle of the seminiferous tubules takes 8.6 days and four cycles are required for differentiation of A1 spermatogonia to mature sperm. Sperm formation from a pool of undifferentiated progenitors cell takes ~35 days. The twelve different stages are easily distinguishable by distinct association

6 of A1 spermatogonia, spermatocytes, spermatids and sperm (Figure 2). Differentiation of A1 spermatogonia happens in stage VIII of the seminiferous tubules. Stage VIII can is marked by reduced expression of stem cell markers such as GFRa1 and increased expression of protein markers of differentiation.

Clone of Aal16 spermatogonia in stage VII differentiates to 16 A1 spermatogonia in stage VIII

-amplifying mitotic divisions to produce 32 A2 spermatogonia in stage IX to 64 A3 spermatogonia in stage XI to 128 A4 spermatogonia in stage I to 256 intermediate spermatogonia in stage II to 512 B spermatogonia in stage IV to 1024 preleptotene spermatocytes in stage VI. In theory 4096 haploid spermatids should be formed but the actual yield of sperm is 80% less than what is expected because of the apoptosis that occurs in A2-A4 spermatogonia in rodents.

1.3 Spermatozoon Structure:

The end product of spermatogenesis is the spermatozoon (Figure 3). Spermatozoa, which are terminally differentiated cells, are transcriptionally and translationally silent. Spermatozoa consist of three distinct parts - (i) head, (ii) connecting piece and (iii) flagellum

End piece

Principal piece Head Mid piece

Figure 3: Immunocytochemistry of wild type sperm cells show the distinct part of the spermatozoon. The head is stained blue in color. The white portion along with the outer red border surrounding it in the head is known as the acrosome (overlap of red green and blue fluorescence. The mid piece is red in color and the principal piece is stained yellow the end piece is red in color. The antibodies used to stain the spermatozoa are DRP-1 and phospho-DRP-1 which incidentally help in defining the parts of the sperm structures. The secondary antibody used against the DRP-1 is Cyanine3 (fluorescent red dye) and for Phospho-DRP-1 is alexa fluor

488(green fluorescent dye). The blue color (Hoechst dye) represent the nucleus(condensed chromatin).Yellow color is observed when both the dyes colocalize.

8 1.4 Sperm Head

Structurally sperm head can be divided into anterior acrosome, equatorial segment and post- acrosomal region. The acrosome contains hydrolytic enzymes, which are released during fertilization. Rupture of the acrosome during fertilization is call the acrosome reaction, an event essential for fertilization. The equatorial segment is thought to contain proteins necessary for sperm-egg binding. The nucleus enclosed in the entire head, contains the haploid fraternal DNA which is delivered to the egg during fertilization. The chromatin in the sperm head is highly condensed and consists of protamines and histones bound to the condensed DNA. Most of the histones are replaced by protamines during differentiation of round spermatids (Figure 4).

Histones remaining in the DNA are thought to be regulatory regions with epigenetic marks affecting gene expression in the fertilized egg and during spermatid development (4, 5).

Protamines and histones are also thought to stabilize and protect the chromatin during the journey of sperm to the egg.

Figure 4: Schematic diagram show regions of the mouse head.

1.5 Sperm Flagellum:

Sperm flagellum can be divided into connecting piece, mid piece, principal piece and end piece.

Axoneme, mitochondrial sheath, the outer dense fibers and the fibrous sheath make up the structural parts of the flagellum (Figure 5). The axoneme consists of 9+2 microtubules that extends from connecting piece to the end piece(6-8). In the mid-piece the axonemal microtubule

10 is surrounded by outer dense fiber and by the mitochondrial sheath. In the principal piece the axoneme is surrounded by outer dense fibers and the fibrous sheath(6, 7). The end piece lacking both the outer dense fibers and fibrous sheath has only the axonemal microtubules under the plasma membrane(1).

Figure 5: Schematic diagram showing axonemal 9+2 microtubular arrangement.

1.6 Epididymal sperm maturation and motility initiation:

After spermatogenesis sperm are released into the lumen of the seminiferous tubules and then pass through a long-coiled tubule called the epididymis(9). In humans the length of the tubule is

6 meters and sperm take about 12 days to traverse the entire epididymis. The average time taken

11 by sperm to pass through the epididymis in different mammalian species is ~10 days(5, 10). The epididymis is broadly divided into three parts (Figure 6A and 6B): Caput (head), Corpus (Body) and Cauda (tail). Each of these parts are divided into smaller lobules by connective tissue septa which provides septa-specific micro-environments the composition of which are regulated by androgens.

Figure 6: Illustration show the compartmentalization of mouse(A) and Human(B) epididymis.

Maturation of spermatozoa during the passage through the epididymis is required for the acquisition of sperm motility and the ability to fertilize eggs. Sperm isolated from the rete-testis of mouse are either immotile or they show weak twitching motions. Sperm from caput epididymis show circular or no forward motion at all. Sperm isolated from caudal epididymis show vigorous forward motion and can bind and fertilize eggs. Motility changes are also accompanied by reshaping of the acrosome and movement and removal of the cytoplasmic droplet and other changes to the plasma membrane. Following ejaculation, sperm undergo hyperactivation in the female reproductive tract - a motility transition that is required for sperm

12 to penetrate the egg (3). Both epididymal initiation of sperm motility and hyperactivation are essential for male fertility.

The capacity for motility already exists in testicular sperm: motility can be induced in demembranated testicular and caput epididymal sperm in the presence of ATP, cAMP, appropriate calcium levels and pH (4-7). Considerable progress has been made in understanding of how sperm cAMP, calcium and pH change (8-13). It is known that cAMP acts through a protein kinase (PKA) without which sperm are submotile and infertile (14). We also know that high protein phosphatase activity limits PKA action (15, 16). Despite this body of knowledge, we still do not understand, in biochemical terms, how sperm acquire motility in the epididymis and how motility is altered in the female reproductive tract. Part of the reason for this limitation is because we did not know the identities and roles of all the signaling enzymes involved during this process of terminal differentiation. In the second aim of my research I have explored the role of the phosphatase PP1γ2 and its inhibitors PPP1R2, PPP1R11 and PPP1R7 in epididymal sperm maturation.

1.7 Protein Kinases

Protein kinases represent ~2% of the proteins in eukaryotes. Their importance is emphasized by the fact that many aspects of cell regulation are controlled by protein phosphorylation.

Phosphorylation of proteins have roles in many cellular processes like differentiation, motility and membrane transport. Protein kinases can be broadly divided into two different kinds based on the residues they phosphorylate: serine/threonine kinases (PKA, Akt, Cdk2 etc.) and tyrosine kinases (insulin receptor kinase, EGFR, Csk etc.). Approximately 518 protein kinases are found in the human genome: 478 of them share similar structures. Protein kinases are two lobed enzymes: the N-terminal lobe and the larger C-terminal lobe. The N-terminal lobe has an α-helix

13 (αC) and five stranded anti-parallel β sheets (β1- β5) whereas the C-terminal lobe has seven α- helices (αD- αI) and four short β (β6- β9) strands. β5 of the N-lobe connects with the αD of the

C-lobe by a polypeptide segment. A loop N-terminal to this region between αC and β4 is anchored in the C-lobe. ATP normally binds in the cleft between the two lobes and its binding is coordinated by the amino acid residues present in the N-lobe. The nucleotide binding loop is found between the β1 and β2. The β3 loop consists of conserved lysine residues which helps in accommodation of the α and β phosphate group of ATP. This lysine is oriented for phosphate binding by a salt bridge with the conserved glutamic acid residue in the αC. The C-terminal loop has the activation segment, a region 20-35 residues located between the conserved DFG motif and APE motif. During active state of the kinase the C-helix press against the N-terminal lobe and the aspartate of the DFG motif chelates with Mg2+ ion to place the ATP substrate. While in inactive state the chelation is lost and the phenylalanine of the DFG motif is turned towards the

ATP binding pocket. Protein Kinases transfer the phosphoryl group from the γ-phosphate of ATP to the hydroxyl group of serine, threonine or tyrosine residues in protein substrates (Figure 7).

Figure 7: (A) X-ray crystal structure of PKA bound with ATP showing N-lobe and C-lobe. (B)

Diagrammatic representation of 5 different pockets of PKA. (C) 2D projection of the ATP binding site viewed down the axis from the N-terminal lobe to the C-terminal lobe. The positions conserved in >70% of the 469 kinases are listed in the right column (adopted from Kinase selectivity potential for inhibitors targeting the ATP binding site: a network analysis. License

ID# 4373800428569, 4373800584505).

16 1.8 Sperm Protein Kinase A.

The protein kinase (PKA) is an enzyme activated by cyclic AMP (Figure 8). The PKA holoenzyme, which is catalytically inactive, consists of two regulatory subunits and two catalytic subunits. The enzyme is activated when cAMP binds to the regulatory subunits releasing the active catalytic subunits. There are two major isoforms of R subunits, RIα and RIIα and there are five different catalytic subunits. The Cα has two forms, CαI is ubiquitously expressed while the second, CαII, is testis and sperm specific (11). RIα is expressed throughout the germ cell development whereas expression of RIIα becomes significant in the later stages of spermatogenesis(12). The catalytic subunit follows a similar expression pattern where the CαI is expressed in the early germ cell development and CαII in the later stages of germ cell development.

Figure 8: Schematic diagram of Protein Kinase A and its activation by cAMP.

17 The enzyme PKA has an indispensable role in mammalian spermatozoa. Targeted disruption of the PKA catalytic subunit Cα2 resulted in normal sperm development but the mice are infertile

(12-14).Seminiferous tubule of the KO mice appeared normal and had densely packed sperms indicating that disruption of the PKACα2 did not hamper sperm production. Sperm lacking Cα2 cannot fertilize eggs in vivo or in vitro. Elevation of cyclic AMP activates PKA during motility initiation and during fertilization. The requirement for PKA is well established, while how PKA acts to regulate sperm motility and is still not known. A full understanding of sperm PKA action is also limited by the lack of knowledge of the protein substrates of PKA. One of my aims in the thesis is to use chemical-genetic (described later) and other approaches to identify PKA substrates in sperm

1.9 Soluble Adenylate Cyclase (sAC) in Sperm

Cyclic adenosine monophosphate (cAMP) plays a significant role as a second messenger in several cellular signaling mechanisms. Cyclic AMP is generated by adenylyl cyclase (AC) from

ATP. Nine forms of AC are found in somatic cells. They are membrane bound with two seven transmembrane segments (Figure 9). The different isoforms of the enzymes are regulated by G proteins in response to hormones and other activators. The adenylyl cyclase (sAC) responsible for sperm cAMP is not membrane bound, but is soluble and found in the cytoplasm (15).

Mammalian sAC has two heterologous catalytic domains at the N-terminal domain. The catalytic subunit is linked by a linker sequence. The rest of the C-terminal region consists of autoinhibitory region canonical P-loop, potential heme-binding domain, and leucine zipper- like sequence, which are the regulatory domains. The amino acid sequence of the two catalytic domains of sAC bears more similarity with the primitive cyanobacteria rather than

18 transmembrane adenylate cyclase(15). This soluble adenylate cyclase is insensitive to G- proteins but is uniquely activated by bicarbonate.

In mice with a targeted deletion of sAC(16, 17) sperm numbers and morphology were normal, but mutant males were infertile. Sperm lacking sAC when treated with permeable cAMP in vitro were able to fertilize eggs. Thus, cAMP and PKA are essential for sperm function and fertility(18).

Figure 9: Schematic diagram of trans-membrane adenylate cyclase and Soluble Adenylate

Cyclase (sAC).

19 1.10 Protein Phosphatase

There are more than 500 protein kinases in human genome two third of which are serine/threonine kinases. On the other hand, there are only about 150 protein phosphatases of which fewer than 40 are serine/threonine phosphatases(19). It is interesting that in a cell the ratio of serine/threonine kinase to phosphates is 6:1, but still the cells can successfully dephosphorylate several proteins phosphorylated by different kinases. Reversible phosphorylation is one of the most common means of regulation of basic cell function. Protein phosphorylation is not only required for cell cycle regulation, transcription or protein translation but also for several cellular processes. Aberrant protein phosphorylation can cause many diseases like cancer or infertility. It is important that we gain a comprehensive knowledge of both protein phosphatases and protein kinases.

Serine /threonine phosphatases (PSPs) are the enzymes responsible for the removal of phosphate group from serine and threonine residues of the target protein. Phosphorylation or dephosphorylation, can either activate or deactivate the target protein. The current classification of PSPs is based on the amino acid sequence of the catalytic subunits and the metal ion requirement for catalytic activity. PSPs can be divided into three families of which phosphoprotein phosphatase (PPP) include the Mg2+/Mn2+ dependent protein phosphates (PPM).

Members of the PPP family are found in all eukaryotic organism: PP1, PP2A and PP2B are three of the members of the PPP serine threonine phosphate family. Protein phosphatase 1 (PP1) regulates several cellular processes. Its interaction has been established with more than fifty different regulatory subunits. These interacting proteins regulate catalytic activity, substrate specificity and intracellular localization of the enzyme.

20 1.11 Protein phosphatase1

The serine/threonine phosphatase PP1 isoforms in most eukaryotes are encoded by multiple genes.. The four isoforms of PP1 are PP1a, PP1b, PP1γ1and PP1γ2. The two isoforms, PP1γ1 and PP1γ2, are alternatively spliced transcripts of a single gene, Ppp1cc. PP1γ2, is present only in mammals. The four PP1 isoforms bear 90 % of similarity in their amino acid sequence and have overlapping substrate specificity. All somatic cells express PP1a, PP1b and PP1γ1. In vitro catalytic activity and substrate phosphorylation of all the PP1 isoforms are indistinguishable.

Targeted disruption of PP1b is embryonic lethal whereas there is no observable phenotype with the loss of PP1a. Tissue specific deletion of PP1b showed its role in cardiac contractility and muscle development (20). Except for PP1b in most scenarios, the PP1 isoforms are interchangeable and functionally equivalent. The phosphatase PP1 regulated by its differential binding to regulatory proteins. Starting with Inhibitor 1 and Inhibitor 2, the heat stable regulators first identified during the seventies, more than 100 PP1 regulatory proteins are now known. Regulation and localization of the enzyme occurs through reversible phosphorylation of the inhibitors. Inhibitor I1 when phosphorylated is a potent inhibitor of PP1 phosphorylated whereas inhibitor I2 inhibits the enzyme when it is not phosphorylated. A list of some of the regulatory subunits of PP1 identified is shown below (Table 1)(21).

21 Table 1: The table includes list of Protein phosphatase 1 regulatory subunits identified in mammals. The proteins marked in red box are those studied in this thesis(adapted with permission from Journal of Cell Science- http://jcs.biologists.org/content/115/2/241).

1.12 The PP1 isoforms PP1γ1 and PP1γ2

The isoforms PP1γ1 and PP1γ2 are translated from alternatively spliced mRNAs derived from a single gene (Ppp1cc) (Figure 10). The PP1γ (Ppp1cc) gene, spanning 16.91 kb on mouse chromosome 5, is composed of eight exons. The transcript for PP1γ2 lacks intron 7 resulting in a

22 amino acid C-terminal tail from exon 8 whereas PP1γ1 has an 8 amino acid sequence derived from an extended exon 7. The PP1γ2 protein is 39 kDa whereas PP1γ1 is 36 kDa easily distinguished by specific antibodies. PP1γ1 is ubiquitous whereas PP1γ2 is testis specific

(Figure 11A). PP1γ1 is present in Sertoli cells while PP1γ2 is predominant in developing male germ cells and it is the only isoform found in mammalian spermatozoa (Figure 11C). PP1γ2 is

23 absent in birds and amphibians. Non-mammalian species like Xenopus, sea urchin contain PP1γ1 or PP1a in sperm.

Figure 10: Schematic diagram of PP1γ2 and PP1γ1. PP1γ2 has 8 exons whereas in PP1γ1 there are 7 exons and retains a part of intron 7 and the rest from intron 7 is 3’UTR.

1.13 Role of PP1γ2 in testis.

The levels of PP1γ1, PP1a and PP1b do not change during testis development. The expression of

Ppp1ca and Ppp1cc1 isoforms are similar and are expressed from day 5 to day 10 in postnatal developing testis when only Sertoli cells and developing germ cells are predominant. The appearance of PP1γ2 mRNA coincides with the appearance of early pachytene spermatocytes

(Figure 11B). Its expression increases during postnatal testis development coinciding with the onset of spermatogenesis.

24 A. C.

Figure 11: (A)Northern blot analysis of Ppp1cc1 and Ppp1cc2 in different tissues show that

Ppp1cc1 is expressed in basal amounts in all tissues but Ppp1cc2 is highly expressed in testis.

(B) Northern blot analysis of post-natal developing testis shows that Ppp1cc1 and Ppp1ca is expressed in from day 5 to day 10 but Ppp1cc2 expression increases from day 15 and is the only

PP1 isoform expressed in adult testis in high amounts. (C) Western blot analysis of PP1γ1 PP1γ2 andPP1a show that testis extracts has all the PP1isoforms, but sperm extracts have only PP1γ2

(20) (Adapted from Selective Ablation of Ppp1cc Gene in Testicular Germ Cells Causes Oligo-

Teratozoospermia and Infertility in Mice License ID# 4373811045955).

25 PP1γ1 and PP1γ2 expression was eliminated by targeted disruption of the Ppp1cc gene (22). This disruption results in defects in the final stages of spermatogenesis and the knock out males are infertile. Ppp1cc KO female mice were fertile.

Epididymal sections from Ppp1cc KO mice showed little or no spermatozoa in the lumen. Few sperm which were found in the testes of Ppp1cc KO mouse showed structural deformities. It appears that spermiogenesis is impaired. This defect could, in principle be due to loss of either

PP1γ1 or PP1γ2 or both. We have now shown that replacement of transgenically expressed

PP1γ2 in the null mice fully restores spermatogenesis and male fertility (23, 24). We also showed that selective loss of PP1γ2 in testis using a conditional KO strategy phenocopies the global KO mice. Thus transcription of PPP1cc gene producing PP1γ2 is required only in developing spermatocytes and spermatids for normal male fertility.

1.14 PP1γ2 in sperm motility and epididymal sperm maturation.

The role of PP1γ2 in mature sperm motility and epididymal sperm maturation was discovered in

1996 (25). It is now known that PP1γ2 is required both in testis and sperm. Spermatozoa from mouse, rat, hamster, bull, nonhuman primate, and human contain PP1γ2 (26). The activity of

PP1γ2 is considerably higher in immotile caput compared to caudal sperm suggesting that a reduction PP1 activity is associated with active motility. PP1 inhibitors calyculin-A or okadaic acid can initiate motility in immotile caput sperm. Also, high phosphatase activity in caput sperm keeps motility in check. This reduced PP1γ2 activity during epididymal sperm maturation is a significant part of the biochemical mechanism involved in the development and regulation of sperm motility. Our task was then to identify potential protein regulators of PP1γ2. We found

26 that PPP1R2(Inhibitor-2), PPP1R11(Inhibitor-3), PPP1R7(sds22) and 14-3-3 are four of the regulators of PP1γ2 in sperm (27-29).

1.15 The regulators PPP1R2(I-2), PPP1R11(I-3), PPP1R7(sds22) and PPP1R36 in sperm.

Purification from rabbit skeletal muscle eluted two fractions of heat stable proteins, Inhibitor-

1(PPP1R1) and Inhibitor -2(PPP1R2) (30, 31). PPP1R2 is hydrophilic and highly acidic and it migrates anomalously on SDS-PAGE migrating at 35kDa rather than at 23kDa predicted by its amino acid sequence. PPP1R1 is a potent inhibitor of PP1 when it is phosphorylated whereas

PPP1R2 inhibits PP1 activity only in its dephosphorylated form. PP1 is inactive when associated with PPP1R2. However, it can be activated in the presence of Mg-ATP and a protein called FA.

This FA was later identified as glycogen synthase kinase-3 (GSK-3) and was shown to phosphorylate PPP1R2 leading to activation of PP1. The association of I2 in sperm along with identification of GSK3 was first suggested by our lab (31). While biochemical assays showed the presence of PPP1R2-like inhibitor in sperm, its presence was difficult to confirm due to the lack of reliable antibodies that could be used to detect the protein in bovine and mouse sperm extracts.

Another heat stable inhibitor of PP1 is PPP1R11 (32). Like PPP1R2, PP1R11 inhibits PP1 in its dephosphorylated form (32). It is also hydrophilic with acidic amino acids and it migrates anomalously in SDS-PAGE. PPP1R11 was discovered as a PP1-binding protein by yeast two- hybrid screening (32). Ppp1r11 gene is within the t-complex (33) and this region is associated with sperm function and infertility. Northern blot analyses showed a transcript, highly expressed in testis, smaller in size compared to the ubiquitous message (27, 34).

27 PPP1R7, identified as a PP1 binding protein in Schizosaccharomyces pombe has important role in mitosis (35, 36). An ortholog of PPP1R7 was identified in Caenorhabditis elegans (37) later. A homologue of PPP1R7 was discovered in Saccharomyces cerevisiae (38). Ubiquitously expressed orthologues of this yeast protein have been found in several organisms including mammals (38-41). With the variation of phospho-protein substrate used in the assay PPP1R7 can inhibit or activate PP1 catalytic activity (35, 38). We discovered PPP1R11 is a PP1γ2 binding protein in sperm (27). A trimeric complex of PP1γ2, PPP1R7, and PPP1R11 was found in extracts of bovine testis and caudal epididymal spermatozoa (27). The proteins I2, I3 and sds22 play an essential role in mitosis. These three proteins are evolutionarily ancient and are highly conserved. We expected that mammal-specific sperm PP1γ2 may be regulated by sperm specific proteins. When instead, the sperm and mammal specific phosphatase PP1γ2 is regulated by these three ancient and ubiquitous inhibitors. In our recent study we have identified another PP1 binding inhibitor called PPP1R36. In Aim 2 of my thesis first part I have characterized PPP1R36 and in the second part I have studied how PP1γ2 activity is regulated by its inhibitors and how their binding changes during passage of sperm through the epididymis.

1.16 Sperm GSK3a

The enzyme GSK3, a serine/threonine protein kinase, acquired its name because it phosphorylates glycogen synthase at site 3. GSK3 has since been found to be a component of many cellular processes (25, 42, 43). In addition to insulin action a wide array of functions attributed to GSK3 include, control of cell survival and apoptosis, embryonic development,

Wnt/β-catenin signaling, and growth factor action(44-47). It also has a role in bipolar disorders and Alzheimer’s disease(48-50). In mammals, GSK3 is ubiquitous and is expressed as two

28 isoforms, GSK3α and GSK3β, encoded by two genes (Figure 12). The catalytic domains of the two isoforms are 98% identical while their N- and C- termini are distinctive(46).

Figure 12: Schematic diagram of Mammalian Gsk3α and Gsk3β.

A unique characteristic of GSK3 is that, in most cases, it phosphorylates its substrates only if they are pre-phosphorylated (or primed) (51-53). Thus, two sets of protein kinases can be integrated to regulate the actions of GSK3: those that directly phosphorylate GSK3 and those that prime its substrate. Sometimes a single protein kinase can serve both functions: for example, PKA is capable of phosphorylating GSK3 and priming GSK3 substrates. The fact that

GSK3 is constitutively active suggests that its substrates are held in their inactive form in the resting state of a cell. Many GSK3 substrates, like transcription factors, which are inactive when phosphorylated, are activated when GSK3 is inhibited. Thus, phosphorylation can occur at multiple sites which can either inhibit or activate the function of a target protein. We identified

29 GSK3 as an enzyme responsible for activation of sperm PP1γ2 (31, 54). Both α and β isoforms of GSK3 are present in sperm. Immotile caput sperm contain four-fold higher GSK3 activity than motile caudal epididymal sperm. Phosphorylation of GSK3 significantly increases in sperm during their passage through the epididymis (55). Motility stimulation or initiation with compounds that activate PKA or inhibit protein phosphatase is accompanied by increases in

GSK3 serine phosphorylation (55, 56). These data lead to the first suggestion that GSK3 may be part of biochemical mechanisms involved in epididymal maturation and sperm motility. Recent studies from our lab show that male mice with a global Gsk3a KO and conditional Gsk3a KO in testis are infertile. Females are normal and fertile(57, 58). The KO mice produces sperm with altered motility and sperm display characteristic consistent with the possibility that the epididymal sperm maturation is hampered. Because GSK3 and PP1γ2 activities are interrelated I also examined how the phosphorylation and association of regulators to PP1γ2 is altered in sperm from GSK3 KO mice (31).

1.17 Sperm Phospho-proteome.

When sperm are released into the seminiferous tubules they appear morphologically mature but functionally inactive. As sperm moves through the epididymis it eventually gains its functional competence. Sperm acquire characteristics necessary for capacitation and fertilization. During this time the spermatozoa are transcriptionally and translationally silent. Functional maturation of sperm is due to post-translational modification of existing proteins rather than synthesis of new proteins. One of the most common post-translational modification includes protein phosphorylation. So, to understand the biochemical basis of sperm maturation it is essential to identify changes phosphorylation changes of proteins during passage of sperm through the

30 epididymis. Several studies have been done to identify differences in phosphoproteins between caput and caudal epididymal sperm. One of the goals was to use different enrichment methods in wild type sperm and sperm lacking a protein kinase (PKA, GSK3a) or phosphatase

(Calcineurin).

The common method of enriching a protein sample is either by 2D gel gel electrophoresis or by immunoprecipitation. These two are effective methods but recently more specific enrichment strategies have evolved for identification of phospho-proteins. We used metal-based affinity enrichment IMAC (immobilized metal affinity chromatography) and MOAC (metal oxide affinity chromatography). In IMAC enrichment the column is made up of positive ions like Fe3+,

Ga3+, Zr3+.These transition metal cations have very high affinity for negatively charged phosphate groups. Substrates like magnetic beads or silica beads are used for chelation of these cations which enables selective binding of the phosphopeptide over nonphosphorylated peptide.

In MOAC technique Titanium oxide (TiOx) is used. This metal oxide matrix has high affinity for

2- the oxygen in phosphoryl (PO3 ) groups. Both IMAC and MOAC lead to enrichment of phosphopeptides with phosphoserine (pSer), phosphothreonine (pThr) and phosphotyrosine

(pTyr). We have used IMAC columns for phospho-enrichment followed by western blot the determine changes in phosphorylation of PPP1R2, PPP1R11and PPP1R7 in caput and caudal epididymal sperm. Studies are also in progress to identify the phosphoproteins in sperm from

GSK3a KO, Calcineurin KO mice.

Chemical genetic approach:

A major stumbling block phospho protein research is the inability to identify protein substrates of a specific protein kinase. A chemical genetic approach has been developed to identify protein substrates of specific protein kinases. Shokat and colleagues at UCSF developed a novel

31 approach to identify immediate substrates of kinases and to enable kinase inhibition by highly selective, cell-permeable, small molecule inhibitors (59, 60). In this approach the ATP-binding pocket in a selected kinase is genetically modified to generate mutant enzyme that can, in addition to ATP, also utilize specific ATP analogs (59, 61). The mutation involves replacing a conserved amino acid with a bulky side chain with a smaller residue (alanine or glycine) creates a “gap” or an enlarged ATP binding pocket (62). The engineered ‘‘gap’’, located in the active site of the enzyme where the N6 amino group on the purine moiety of ATP is positioned, allows binding of not only ATP but also structurally modified ATP analogs with substitutions at the N6 position, such as N6-(benzyl)-ATP (63). Only the analog-sensitive mutant (as-mutant) kinase, but not the wild type kinase, can use N6-substituted ATP analogs as phosphate donors.

Therefore, only substrates of the as-mutant kinase are labeled by the ATP analogs. This chemical genetic approach has been used to identify protein substrates of several kinases: JNK (64), v-Src

(65), ERK2 (66), cdk1 (67), Raf-1 (68), and cdk7 (69). It should be emphasized that analog- sensitive mutations do not affect catalytic activity and substrate specificity of the kinase. The engineered as-mutants also acquire unique and specific sensitivity to novel kinase inhibitors, such as (4-amino-1-ter-butyl-3-(p-methylphenyl) pyrazolol [3,4-d] pyrimidine) (1Na-PP1) (70,

71). Recent studies have employed this approach to generate “inducible kinase-knockout mice”

(72-74) where the activities and functions of Ca2+/calmodulin-dependent protein kinase IIa

(CAMKIIa), neurotrophin receptor tyrosine kinases (TrkA, TrkB, TrkC), and cJun NH2-terminal kinase 2 (JNK2) were selectively and temporally manipulated in vivo. I have used this chemical genetic approach to identify the substrates of sperm protein kinase A (PKA).

32 My dissertation has two aims.

1.18 AIMS

AIM 1: Identification of PKA phosphorylated substrates.

This aim is to identify protein substrates of Protein Kinase A in sperm by using a chemical genetic approach.

AIM 2: How PP1γ2 is regulated by its binding proteins.

Aim 2.1: Identification and Characterization of PPP1R36, a PP1γ2 regulator.

In this aim I have cloned and characterized a new regulator of sperm PP1γ2 – PPP1R36.

Aim 2.2: Role of PPP1R2, PPP1R11 and PPP1R7 in epididymal sperm maturation.

In this aim I studied how these three regulators, PPP1R2, PPP1R11 and PPP1R7, are expressed along with PP1γ2 in testis and how they are involved in regulating PP1γ2 activity during passage of sperm from the caput to caudal epididymis. I also determined how the phosphorylation status of the regulators change in caput compared to caudal epididymal sperm.

Chapter II MATERIALS AND METHODS

Ethics Statement

Balb/c and C57BL/6 mice used in this study were acquired from Jackson Laboratory and were housed and used at the Kent State University animal facility. Housing and handling were in accordance with the Kent State Institutional Animal Care and Use Committee.

Mouse Genomic DNA isolation:

Ear punches was suspended in lysis buffer (25 mM NaOH and 2 mM EDTA, pH 12.0 in ddH2O) was denatured for 1 hour at 95°C.It was then neutralized using neutralizing buffer (40mM Tris-

HCl, pH 5.0 in ddH2O). The DNA was then used for PCR analysis.

Materials and methods for aim I:

Chemicals and reagents:

1 M tris 2-carboxyethyl phosphine (TCEP, Sigma-Aldrich), 1 M Dithiothreitol (DTT, Amresco),

Iodoacetyl Agarose Beads (Pierce), 200 mM HEPES(Sigma-Aldrich), 50% Acetonitrile

(Amresco) 50% 20 mM HEPES, Ziptips (Aligent Technologies), Small disposable column

(Isolute SPE Accessories Double Fritted Column 120–1021- A), 5 M NaCl (Fisher Scientific),

5% Formic acid(Sigma Aldrich), 50% Acetonitrile: 50% H2O, 0.1 % TFA(Sigma-Aldrich) 50 %

Acetonitrile H20, 0.1 % TFA H20,1mg/ml Oxone pH 3.5(Sigma-Aldrich). Dynabeads Protein

G(Invitrogen), N6-(benzyl)-ATP(Biolog),p-Nitrobenzyl mesylate/PNBM(Abcam),Guanosine 5’- triphosphate sodium salt hydrate/GTP(Sigma Aldrich),1-Naphthyl PP1(Tocris),8-Bromo-cAMP sodium salt(Tocris), Anti-Thiophosphate ester antibody [51-8] (abcam92570), Anti-

35 Thiophosphate ester antibody [51-8] (ab133473), Amicon Ultra-0.5ml 3K ultracel Centrifugal filter units(Millipore), Siliconized microcentrifuge tubes.

Cell lysate preparation

Analog sensitive mutant PKA homozygous mice were euthanized. sperm was collected from the caudal epididymis and vas deferens. The contents of the vas deferens were gently squeezed out using forceps into a Petri dish containing 1X phosphate buffer saline (PBS) and transferred to a

1.5 ml microcentrifuge tube using a cut pipette tip. The caudal epididymis was punctured using a needle and the contents were gently squeezed into 1X PBS. The epididymis was kept in 1X PBS for 20 minutes to allow the sperm to swim out. The sperm suspension was collected using a cut pipette tip and pooled with the sperm from the vas deferens. The sperm suspension was washed twice in 1X PBS, centrifuged 400 x g at 4 °C and resuspended in an appropriate volume of homogenization buffer (containing PMSF, TPCK, Sodium Fluoride, Sodium orthovenadate, benzamidine ) and sonicated. After sonication, it was spun-down at 16,000 x g for 15 minutes at

4 °C. The supernatant was collected for further analysis.

Kinase activity of sperm protein

Sperm supernatant collected were quantified using DC Assay Kit (Bio-Rad) after 10 % trichloroacetic acid precipitation and the pellet resuspended in 0.1 N NaOH. Bovine serum albumin standards were subjected to the same treatment (Sigma Aldrich). The assay was performed per the manufacturer’s instructions. For the Kinase assay the protein extract (50ug of protein per reaction used) was incubated with Mg+2, GTP, Benzyl-ATP-gS in all the tubes.

According to the experiment performed,1Na-PP1 or cAMP was added additionally to the tubes and the reactions are incubated for 45 mins at 37C water bath. After that PNBM is added and

36 incubated for 2 hours in dark at room temperature. To stop the reaction 6X Laemmli sample buffer is added and boiled for 5 mins.

Western Blot analysis and Coomassie staining:

To determine whether the kinase assay and PNBM alkylation worked or not, protein sample boiled with 6X lammli buffer is electrophoretically separated on 12 % gels. One of the gel is fixed with fixing solution (50% ethanol, 10 % acetic acid) for 30 mins, followed by washing

3 times with miliQ for 10 mins per wash. The gel is stained with coomassie for 4 to 5 hrs by shaking and destaning is done in water for 5 hours or overnight. The other gel is transferred on to a polyvinylidene difluoride (PVDF) membrane (Millipore) and blocked in 5 % non-fat dry milk in 1X TTBS (Tris buffer saline with 0.1 % Tween-20) for one hour. Following blocking, membrane was incubated with anti-thiophosphate ester [51-8] antibody (1:5000) diluted in 5 % non-fat dry milk in 1X TTBS overnight at 4 °C on an orbital shaker. The following day, membrane was rinsed in 1X TTBS and incubated with anti-rabbit secondary antibody conjugated with horseradish-peroxidase in 5 % non-fat dry milk in 1X TTBS for 1 hour at room temperature. The membrane was rinsed twice with 1X TTBS for 10 minutes and developed using a “homemade” enhanced chemiluminescence (ECL) reagent. The images were captured using the Fujifilm Darkbox LAS-3000 (Fuji).

37 Covalent column capture of PKA phosphorylated substrates:

After the kinase assay the thiophosphorylated, phosphorylated and other proteins are trypsin digested (1:50-1:10 ratio by weight) in presence of 2M urea and 1M TCEP and incubated at 37C for overnight. The sample is then acidified with 0.1% TFA (as final concentration) and passed through c-18 Sep Pak column. The peptides are eluted with 0.1% TFA (trifluroacetic acid) in

50% acetonitrile. The pH of trypsin digested Labelled peptides is adjusted by adding 200mM of

HEPES (pH 7.0) to a final concentration of 20mM of HEPES (15 ul of 200mM HEPES pH 7.0,

10ul of H2O, 75ul of acetonitrile and 50ul of digested peptides). The iodoacetyle beads slurry is washed and blocked with BSA and finally added to the labelled substrate and incubated in the dark with gentle rocking for 12 to 16 hours at 22C.Next day the iodoacetyl beads are washed and finally Oxone(1mg/ml) is used to elute out the bound substrate and send for LC/MS sequencing.

Immunoprecipitation of benzyl ATP tagged proteins.

After the Kinase assay the phosphorylated substrates were treated with PNBM to alkylate the labelled substrate to form thio-phosphate ester. Before immunoprecipitation with the thiophosphate ester antibody it is necessary to remove unincorporated free PNBM from the reaction mixture. The sample is run through Centrifugal filter units (centricon) to reduce the concentration of free PNBM. The PNBM tagged protein is then incubated overnight at 4C with the thiophosphate ester antibody. Next the mixture is added to the Dyna Protein-G beads

(Invitrogen) for 2 hrs at 4C. The beads were washed 4 times with 1X TTBS. The beads were boiled with 1X sample buffer followed by SDS-PAGE and western blot.

38 Mass Spectrometry

For the protein digestion, SDS gels stained with Coomassie blue were washed/destained in 50% ethanol and 5% acetic acid. Bands from the gel were isolated for identification. The gel pieces were then dehydrated in acetonitrile and dried in a Speed-vac. In-gel proteolytic digestion using trypsin was accomplished by adding 5 µL of 20 ng/µL trypsin in 50 mM ammonium bicarbonate and incubating overnight digestion at room temperature to achieve complete digestion. The peptides were extracted from the gel in two aliquots of 30µL 50% acetonitrile with 5% formic acid. These extracts were combined and evaporated to <10 µL in Speedvac and then resuspended in 1% acetic acid to make up a final volume of ~30 µL for LC-MS analysis. The LC-MS system was a Dionex Ultimate 3000 nano-flow HPLC interfacing with a Finnigan Orbitrap LTQ Elite hybrid ion trap mass spectrometer system. The HPLC system used an Acclaim PepMap 100 precolum (75 µm x 2 cm, C18, 3 µm, 100 A) followed by an Acclaim PepMap RSLC analytical column (75 µm x 15 cm, C18, 2 µm, 100 A). Five µl of the extracst were injected and the peptides eluted from the column by an acetonitrile 0.1% formic acid gradient at a flow rate of 0.3

µL/min were introduced into the source of the mass spectrometer online. The micro-electrospray ion source is operated at 2.5 kV. The digest was analyzed using the data dependent multitask capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in successive instrument scans. The data was analyzed by searching the mouse UniProtKB protein database with the search program sequest (Dr. Belinda Willard assisted in performing mass spectrometry,

Cleveland Clinic proteomic core facility).

39 Materials and methods for aim II:

RNA extraction, cDNA preparation and Cloning

Approximately 100 mg of different tissues were homogenized in 1 ml of TRI reagent (Sigma

Aldrich) and total RNA was extracted using manufacturer’s instructions. For complementary

DNA (cDNA), 1 µg of total testis RNA was prepared using QuantiTect Reverse Transcription

Kit (Qiagen). The transcripts for testis specific isoforms were isolated using reverse transcription

PCR. The PCR products for Ppp1r36 (FW 5’ CGCTCGAGATGGTCAAGAGTGAGGCCAGT

TC 3’/ RV 5’ GCGAATTCATTATTTAGG GCAGGTGCTTGGCG 3’) was cloned in pRSET A

(Invitrogen), and sent to the Genomics Core at Lerner Research Institute for sequencing. For developmental studies, total RNA was extracted from mouse testis at different days’ post-partum

(dpp). Testis at 3-6 dpp mainly contain Sertoli cell and undifferentiated spermatogonial stem cells. During 7-10 dpp, spermatogonial stem cells undergo mitosis in testis and during 10-14 dpp type B spermatogonia differentiate to form primary spermatocytes and meiosis I starts. At 15-19 dpp meiosis II begins and secondary spermatocytes are formed. Haploid post-meiotic round spermatids are formed at 18-22 dpp and mature spermatozoa are present in the testis around 25-

30 dpp.

Spermatid cDNA library was purchased from ATCC. The transcripts for testis specific isoforms were amplified using reverse transcription PCR. The PCR products for Ppp1r2, Ppp1r11 and

Ppp1r7 were subcloned into pGEM-T Easy cloning vector (Promega) and sent to the Genomics

Core at Lerner Research Institute for nucleotide sequencing.

40 Primers used to generate cDNA probes for Northern blot analysis.

Ppp1r2 probe was generated as a ~750 bp restriction digested (XhoI and BamHI) fragment from the plasmid harboring the entire human I‐2 coding sequence in pBluescript SK II backbone (in house). Probe for Ppp1r11 was restriction digested as a ~1.6 kb fragment from the pGEX‐4T‐2 vector harboring the full length Ppp1r11 cDNA (27). A probe of length 1091 bp spanning the entire coding sequence Ppp1r7 was amplified from the cDNA clone (ATCC#

MGC‐19201) using the primer pair 5’‐CTCGAGGCCAATATGGCGGCAGAG‐3’ and 5’-

CTCAAGCTTAGGGCTCAGAACCTGACGTA‐3’.

Northern blot analysis

Total RNA (20 or 25 µg) of each sample was mixed with 3 volumes of Northern Max

Formaldehyde loading dye (Ambion) and then was incubated at 65 °C water bath for 15 minutes.

The samples are then centrifuged briefly and of ethidium bromide (10-50 µg/ml) was added and loaded in the denaturing formaldehyde agarose gel. Samples were electrophoretically separated on a 1.5 % agarose/0.66 M formaldehyde gel in 1X MOPS buffer at 70 volts for 4-5 hours.

Following separation, RNA was immobilized on positively charged Hybond-XL nylon membrane (GE Healthcare) by capillary transfer in 10 X saline sodium citrate buffer (SSC).

Transfer was allowed for 16-18 hours overnight, followed by baking at 85 °C for 2 hours in vacuum oven. Membrane was prehybridized in 10 ml of Ultrahyb ultrasensitive hybridization buffer (Ambion) in a hybridization bottle at 42 °C for one hour. Probes were labeled by random labeling using 32P-dCTP (MP Biomed) and the Rediprime nick translation kit (GE Healthcare) and finally purified using Illustra NICKTM columns (GE Healthcare), following manufacturer’s protocol. The purified radiolabeled probes were diluted in 10 ml of Ultrahyb ultrasensitive

41 hybridization buffer and added to the blot in a hybridization bottle. The blot was then incubated overnight at 42 °C. After hybridization, the blot was washed twice in wash buffer I (1 % SSC,

0.1 % SDS), twice in wash buffer II (0.5 % SSC, 1 % SDS) and twice in wash buffer III (0.1 %

SSC, 1 % SDS). All the washes were carried out at 42 °C for 5 minutes. After washing, the membrane was wrapped in saran wrap and exposed to phosphor-imager screen (Molecular

Dynamics) and developed in a Typhoon scanner (GE Healthcare). For tissue Northern blots, pre- made mouse tissue blots were bought from Zyagen. The integrity of the blotted RNA (20µg per lane) is tested by beta actin specific probe and it is also standardized by the presence of 28s and

18s RNA. Full-length cDNA of the inhibitors was used as probes.

Protein extract preparation

Mice tissues were homogenized in 2X homogenization buffer (20mM Tris-HCl pH 7.0, 1 mM EDTA, 1 mM EGTA, 10 mM Benzamidine, 1 mM PMSF, 0.1 mM of TPCK and 0.1 % 2- mercaptoethanol) for 15 seconds with a minute interval on ice using a homogenizer and spun- down at 16,000 x g for 15 minutes at 4 °C. The supernatant was collected for further analysis.

Mouse sperm was collected from the caudal epididymis and vas deferens. The contents of the vas deferens were gently squeezed out using forceps into a Petri dish containing 1X phosphate buffer saline (PBS) and transferred to a 1.5 ml microcentrifuge tube using a cut pipette tip. The caudal epididymis was punctured using a needle and the contents were gently squeezed into 1X PBS.

The epididymis was kept in 1X PBS for 20 minutes to allow the sperm to swim out. The sperm suspension was collected using a cut pipette tip and pooled, if required, with the sperm from the vas deferens. The sperm suspension was washed twice in 1X PBS, centrifuged 400 x g at 4 °C

42 and resuspended in an appropriate volume of homogenization buffer and sonicated. After sonication, it was spun-down at 16,000 x g for 15 minutes at 4 °C. The supernatant was collected for further analysis. For developmental studies protein was extracted from mouse testis at different dpp. When needed, heat stable protein extracts were also prepared by heating at 95 °C for 5 min, followed by centrifugation at 16,000 x g and posterior collection of the supernatant.

Mature bull testis were obtained from a local commercial slaughter house. Spermatozoa were isolated from caput and caudal epididymis as previously described. Sperm isolates were washed twice in 1X PBS, pH 7.0. Sperm pellets were adjusted to a volume of 1.25 x 108 by resuspension in homogenization buffer with protease inhibitors (HB+; 10 mM Tris [pH 7.2] containing 1 mM

EDTA, 1 mM EGTA, 10 mM benzamidine-HCl, 1 mM PMSF, 0.1 mM TPCK, 0.1% 2- mercaptoethanol and 1 mM sodium orthovanadate). The sperm suspension was sonicated on ice with three 10-sec bursts (level three) of a Microson ultrasonic cell disruptor (Misonix Inc.). The suspension was then centrifuged at 16,000 x g for 20 minutes at 4°C. The supernatants were used for the immunoprecipitation experiments.

43 Antibodies

Table 2: List of antibodies used.

Western blot analysis

Protein extracts were quantified using DC Assay Kit (Bio-Rad) after 10 % trichloroacetic acid precipitation and the pellet resuspended in 0.1 N NaOH. Bovine serum albumin standards were subjected to the same treatment (Sigma Aldrich). The assay was performed according to the manufacturer instructions. Protein extracts were boiled in Laemmli sample buffer,

44 electrophoretically separated on 12 % gels and transferred on to a polyvinylidene difluoride

(PVDF) membrane (Millipore) and blocked in 5 % non-fat dry milk in 1X TTBS (Tris buffer saline with 0.1 % Tween-20) for one hour. Following blocking, membrane was incubated with the appropriate primary antibody diluted in 5 % non-fat dry milk in 1X TTBS overnight at 4 °C on an orbital shaker. The following day, membrane was rinsed in 1X TTBS and incubated with the appropriate secondary antibody conjugated with horseradish-peroxidase in 5 % non-fat dry milk in 1X TTBS for 1 hour at room temperature. The membrane was rinsed twice with 1X

TTBS for 10 minutes and developed using a “homemade” enhanced chemiluminescence (ECL) reagent. The images were captured using the Fujifilm Darkbox LAS-3000 (Fuji).

Immunofluorescence of isolated sperm

Caudal epididymal spermatozoa were isolated in 1X PBS. The cells were fixed in 4% paraformaldehyde, EM grade (Electron Microscopy Sciences) in 1X PBS at 4 °C for 20 minutes.

The sperm suspension was then treated with 0.2% Triton-X (5 minutes) for permeabilization.

After the fixation step, sperm were attached to poly-L-lysine-coated slides. To remove excess paraformaldehyde, the samples were washed three times with 1X TTBS. 1X TTBS supplemented with 5% normal goat serum was used as blocking solution and samples were incubated at room temperature for 3 hours followed by incubation with first primary antibody (1:200) diluted in 5% blocking buffer overnight at 4 °C in a moist chamber. Anti-PPP1R2 (1:200), anti-PPP1R7

(1:200), anti-PPP1R11 (1:200) were used as the first primary antibodies. Following day, samples were washed with 1X TTBS and then incubated with Alexa Fluor 488 conjugated anti- rabbit secondary antibody (Jackson Immunoresearch) for a 1 hour and 30 mins at room temperature in dark. All the samples were washed twice with 1X TTBS. The slides were then

45 incubated with rabbit serum for 30 mins to saturate open binding sites on the first secondary antibody with IgG so that they cannot capture the second primary antibody. The slides were then washed again with 1X TTBS and incubated with unconjugated Fab antibody (Jackson

Immunoresearch) for 45 mins. This step is done to cover the rabbit IgG so that it doesn’t bind to the second secondary antibody. The wash step with 1X TTBS is repeated. All the slides were then incubated with second primary antibody Anti-PP1g2 (1:200) and kept in dark moist chamber overnight. Next day the slides were washed in 1X TTBS and incubated with Cyanine 3 conjugated anti- rabbit second secondary antibody (Jackson Immunoresearch) for 2 hours. Slides were then washed and incubated with Hoechst dye for 10 mins. Finally, samples were washed 3 times with 1X TTBS and mounted in slides using the mounting media Prolong Diamond

Antifade (ThermoFisher Scientific). All the slides were examined under a fluorescence microscope (Olympus 81).

Immunofluorescence labelling testis sections

Testis from WT mice were collected and fixed in 4% paraformaldehyde in PBS at 4°C for 6 hrs.

The fixed testes were transferred to 75% ethanol and dehydrated, permeabilized, and embedded in paraffin using a Shandon Tissue Processor (Thermo Electron Corp.Waltham, MA, USA).

Multiple 5 µm-thick sections of the whole testis were attached to poly-L-lysine-coated slides, deparaffinized, and rehydrated using a standard procedure. Antigen retrieval was performed using 1XAntigen Retrieval Citra Solution (BioGenex, San Ramon, CA, USA). Sections immersed in Citra solution were microwaved 3 times for 2 minutes, with a cooling period of 1 minute between each heating cycle. Slides were incubated for 1 hour at room temperature in a blocking solution containing 5% normal goat serum (Jackson Immuno-research laboratories,

46 West Grove PA) in PBS. Slides were then incubated with primary antibodies for PP1γ2,

PPP1R11, PPP1R2, PPP1R7 (1:200) overnight at 4°C. Slides were washed three times with 1X

PBS and incubated with the appropriate secondary antibody (1∶250) conjugated with Cy3 or

Alexa-fluor (Jackson Immunoresearch laboratories, West Grove PA) for 2 hours at room temperature. The slides were washed five times with PBS. Nuclei were labeled with Hoechst dye

(Thermo Scientific Pierce, Oregon, and USA). The slides were mounted with Prolong Diamond

Antifade Mountant (Thermo Scientific Pierce, Oregon, USA) mounting media, and examined using a Fluo View 500 Confocal Fluorescence Microscope (Olympus, Melville, NY, USA).

Immunoprecipitation

Crude lysates of testis and sperm from mouse or bull were incubated for 2 hours at 4 °C with

Protein G-Sepharose 4 Fast Flow beads (GE Healthcare) which were washed once with distilled water and twice with homogenization buffer (20mM Tris-HCl pH 7.0, 1 mM EDTA, 1 mM

EGTA, 10 mM Benzamidine, 1 mM PMSF, 0.1 mM of TPCK and 0.1 % 2-mercaptoethanol). It was then spun down at 10,000 x g for 1 minute and the supernatant was incubated with 5 µg of the appropriate antibody or diluted rabbit pre-immune serum as a negative control, overnight with gentle rocking at 4 °C. Following day, Protein G-Sepharose 4 Fast Flow beads (GE

Healthcare) were washed once with distilled water and twice with 1X TTBS. Each extract/antibody solution was incubated with the beads by rocking for 2 hours at 4 °C. After incubation, the beads were washed five times with 1X TTBS. After washing, the beads were resuspended in 2X SDS reducing sample buffer (6 % SDS, 25 mM Tris-HCl pH 6.5, 50 mM

DTT, 10 % glycerol and bromophenol blue), boiled for 10 minutes and centrifuged at 10,000 × g for 10 minutes. Supernatants were separated by SDS-PAGE, followed by Western blot analysis.

47 Phosphoprotein Enrichment from bull caput and caudal sperm

Phosphoprotein enrichment was carried out as per the manufacturer’s protocol using Pro Q

Diamond Phospho- enrichment Kit (Invitrogen, cat no. P33361). Bovine caput and caudal sperm were collected in TBS. It was then washed three times with TBS for 10 mins at 700g. Sperm pellet was resuspended in lysis buffer supplemented with endonuclease, protease inhibitors and sodium orthovandate. Samples were sonicated thrice at 30% amplitude for 10 seconds. Protein estimation was carried out using modified BCA method as mentioned earlier. Enrichment columns were prepared by adding 200µl of ethanol to wet the column. 1 ml of resin was added to each column. Resin was washed twice with 1 ml of D/W and in the mean while 1 mg of samples were diluted with wash buffer to get the final concentration of 0.1mg/ml. Columns were equilibrated by passing 1ml of wash buffer twice. Diluted samples were passed through the column and flow through was collected. Columns were washed with 1ml of wash buffer thrice and phosphoproteins were eluted by passing 250µl elution buffer five times. Eluted phosphoproteins and flow through were concentrated using 3kDa M.W.C.F. and buffer exchange was performed to 25mm Tris and 0.25% CHAPS. Methanol- chloroform precipitation was carried out and air-dried pellet was reconstituted in 6X gel loading buffer and was subjected to western blot analysis

Chapter III AIM 1

Rationale

The crucial roles of cAMP and PKA in sperm are known. Understanding how cAMP acts to sustain sperm motility and fertility require identification of the protein substrates of PKA.

Advances in proteomic and phospho-proteomic techniques have resulted in the identification of several sperm phospho-proteins (75-80). Several studies have also identified sperm phosphoproteome including comparisons of phosphorylation status of sperm proteins occurring during epididymal maturation and capacitation(75). However, the specific substrates of sperm protein kinase A or other kinases and phosphatases have not been identified, expect by indirect means and with use of pharmacological inhibitors. Work in Drs. Stan McKnight and Kevin Shokat’s laboratories generated as-mutant-PKA(62, 81) which when expressed in cells exhibited the predicted analog sensitive inhibition while retaining all the functional properties of the wild type enzyme(62, 81). This was followed by generation of knock-in mice where the as-mutant PKA replaced the endogenous wild type allele. The knock-in mice expressing the mutant enzyme are normal (81) and fertile. Sperm from these mice were sensitive to kinase inhibitor analogs.

Sperm capacitation, hyperactivation, and protein tyrosine phosphorylation were suppressed by the inhibitor analogs. We obtained the analog-sensitive PKA knock-in mice from Dr. McKnight

(University of Washington, Seattle)

49 The goal of this aim is to use the as-PKA mutant mice to identify protein substrates of PKA in sperm. As-mutant PKA (81)is generated by a mutation at the ATP binding pocket of PKA was developed (59, 61, 62, 82): A point mutation at the Cα subunit at its 120th position(Figure 13A) a more bulky methionine is (which is present in the wild type PKA as shown in Figure 1B) replaced by less bulky amino acid like glycine or alanine(63). The N6 amino group on the purine moiety of ATP which usually sits in the engineered gap now also allows for binding of structurally modified labelled-ATP analogs [N6-(benzyl)-ATP-γS] with substitution attached at the N6 position(81, 83). All the following experiments were done using caudal sperm from homozygous analog sensitive PKA mutant mice. Sperm from these mice will contain the as mutant PKA instead of the wild type PKA. Following labeling of substrates with N6- (benzyl)-

ATP-γS, the thio-phosphate group on the polypeptides is alkylated by para-nitrobenzylmesylate

(PNBM) to create an epitope that can be detected by specific antibodies to the thio-phosphate ester (Figure 13B). The tagged substrates can be isolated by immunoprecipitation or identification following purification by column chromatography.

50 A.

Thioethers

Unlabeled Phosphate

51 Figure 13: (A) Schematic diagram showing ATP binding pocket of PKA from the surface. ATP is bound to the WT PKA. At the 120th position lies the methionine (bulky amino acid group) and act as a gatekeeper in wild type PKA. When mutated to smaller amino acids like alanine/glycine the pocket size increases allowing efficient binding of modified ATP (N6-Benzyl ATP analogs)(Adapted from “Protein kinases: evolution of dynamic regulatory proteins” License ID#

4398840589718).(B)Procedure for affinity tagging proteins phosphorylated by the ATP analogue. The analogue sensitive-kinase containing the engineered catalytic site (in blue) recognizes the N6-(benzyl)- ATP-γS its substrates. Only the as-mutant, but not wild type kinases (in brown), can use N6- substituted ATP analogs as phosphate donors. In the second step, alkylation with PNBM forms thio-phosphate esters and thioethers. Esterified as-kinase substrates, but not thio-ethers arising from thiol groups in proteins, are recognized by the phosphate ester specific antibodies.

Results

Validation of the use of as-mutant mice to label PKA protein substrates.

In preliminary experiments we showed that several putative PKA substrates in sperm extracts from as-mutant PKA (+m/+m), but not WT mice, are labeled with N6-(benzyl)-ATPγS and

PNBM (Figure 3). Analog labeling was high in extracts of sperm from as-mutant (+m/+m) mice

(Figure 3). Seven bands show increased labeling in the presence of cAMP and a decrease in the presence of the as-mutant PKA inhibitor 1Na, suggesting they are likely substrates for PKA.

Difference in labeling intensities in the presence or absence of cAMP or 1Na is more marked here than in Fig. 4A. Faint labeling seen in WT sperm extracts is due to low levels (~5%) of

ATP-γS present in the N6-(benzyl)- ATPγS preparation. Low levels of labeling remaining in the presence of 1Na is due to incomplete inhibition of as- PKA. The next step is to isolate the tagged proteins for identification by mass spectroscopy (Figure 14). 52 We used two approaches for isolation of the protein substrates of PKA:

1. Affinity purification using iodoacetyl beads. (Figure 15)

2. Immunoprecipitation by thio-phosphate ester antibody. (Figure 13B)

A description of the techniques is described below.

Figure 14: (A) Sperm extracts from wild type (WT) or as-mutant PKA homozygous (+m/+m) mice were incubated with cAMP and N6-benzyl-ATP with or without the as-mutant PKA and

PKA inhibitors, 1Na and H89. Following the kinase reaction (PNBM) para–nitrobenzylmesylate was added. Western blots of the extracts were analyzed with thio-phosphate ester antibodies. Blots were developed for PP1γ2 to show equal protein loading. (B) Extracts used in lanes 3 in (A) were resolved in SDS-PAGE again, adjacent to each other, to better illustrate bands labeled in as-mutant PKA compared to WT sperm.

53 1. Covalent capture of thiophosphorylated proteins

Sperm extracts containing 50ug protein were labelled with N6-(benzyl)-ATP-γS. The thiophosphorylated proteins were trypsin digested to generate thiophosphate labelled peptides. The peptides were then passed through iodoacetyl beads. The thiol containing peptides should bind to the iodoacety tagged agarose beads and the unbound peptides are washed out as flow through.

After elution with 1mg/ml of oxone (pH 3.5), the eluates were cleaned using ziptips and send for

LC/MS run at the core facility at Cleveland Clinic. Oxone oxidizes the sulphur in the thiophosohate ester to sulfoxide. Peptides linked with a thio-phosphate ester bond with the beads are released by spontaneous hydrolysis whereas cysteine thioethers are retained in the resin(82).

Figure 15: Schematic diagram showing covalent "capture and release" method for rapid purification of analog labeled proteins. Following ATP analog phosphorylation proteins are trypsin digested. Thiol- and thio-phosphate containing peptides are captured on iodoacetyl agarose beads.(Adapted from “Covalent capture of kinase-specific phosphopeptides reveals

Cdk1-cyclin B substrates”)

54 Hydrolysis releases only thio-phosphate containing peptides; hydrolysis converts thio-phosphate groups into phosphate groups. Purified phospho-peptides can then have identified by MS.

In our first experiment, disappointingly we identified only one phosphorylated peptide which was present both in my test and control sample. In the second experiment (Table 2) we identified two phosphorylated substrates present only in the test but not control sample. Myosin 9 was found phosphorylated and the phosphorylation was found in the serine residue. Membrane- associated progesterone receptor component-2 was the other phosphorylated peptide identified in the test sample.

Table 3: Phospho-peptides identified in LC/MS analysis.

The yield of phospho-peptides from this procedure was unexpectedly low. The reason for this is not due to lack of ATP analog labeling. We confirmed the presence of thiophosphate moiety in the protein by PNBM alkalization. Despite thiophosphate labeling why there was a low yield of peptides is not known. We suspect that the multistep iodoacetyl capture procedure to isolate labelled peptides is not efficient and possibly led to the isolation of only the abundant proteins.

We did not pursue this approach further and decided to use the immunoprecipitation approach.

55 Identification of PNBM tags using the control proteins BSA and PPP1R2

Before proceeding further, we were advised by Dr. Belinda Willard of the Lerner Institute protein sequencing facility to first determine using control proteins whether we can identify

PNBM modification by MS. We used two different control samples. The first control sample was

BSA which contains a number of cysteine residues that is amenable to PNBM tagging. BSA was treated with TCEP to reduce the disulfide bonds and then tagged with PNBM (Figure 16 lane 3).

In this procedure there was no need for protein kinase because the thiol groups in the protein were used for PNBM tagging. For the second control we used the protein inhibitor 2(PPP1R2) which is a known substrate for GSK3. Thio phosphorylation of PPP1R2 by GSK3 (both recombinant proteins) was accomplished using ATP-γS followed by alkylation with

PNBM(Figure 16 lane 2). Another control sample was run simultaneously which had PPP1R2 and GSK3 but not ATP-γS (Figure 16 lane 1).

After the alkylation the samples were subjected to western blot analysis following SDS-PAGE

(Figure 16). Bands on SDS page corresponding to western blots staining with the PNBM antibodies were cut and sent for MS analysis. These bands were digested with trypsin/chymotrysin and analyzed by LC-MS/MS analysis. The peptide data base was searched with the expected modifications: mass increases of 135.03148 for PNBM on cysteine and

230.9747 for PNBM on a thiophosphate.

Figure 16: After kinase assay the samples (PPP1R2 and BSA) where run on a gel. Coomassie stained gel shows the PPP1R2 band at 32kDa as expected on the left side. There are 3 bands in that area which suggests phosphorylated PPP1R2, so the whole area was cut for analysis. On the right-side lane, BSA is at 55kDa which was cut and checked for modification.

PNBM modification was detected in BSA sample. A total of 59 peptides from BSA containing a cysteine residue with the PNBM modification were identified (table not shown). Three phosphopeptides corresponding to PPP1R2 one of which contained the PNBM modification (Table 4).

57 This ATP-γS-PNBM modified peptide, TSAASATPγS-PNBMPPVVPSAEQPRPIVEEELSK corresponds to modification at site S23.

Table 4: The modified peptides of PPP1R2 identified in the LC-MS/MS run.

For PPP1R2 we identified only one PNBM modified peptide and the other two were phosphorylated peptides (Table 3). No phosphorylated PPP1R2 peptide was identified in the control sample (Figure 16 lane 1). It should be noted that the peptide identified with the PNBM modification (site S23) was also identified as a phosphorylated peptide at the same site. These data led us to believe that the PNBM tag may be lost during LC-MS/MS. The PNBM tag was retained in the sulfhydryl groups of cysteine in BSA but not in the thio phosphate PNBM tag in

PPP1R2. Why the PNBM tag was lost during MS from thiophosphate but not from cysteine is not known.

2. Immunoprecipitation of PKA substrates with anti-thiophosphate ester antibody

Sperms extracts from PKA as-mutant homozygous mice were subject to the kinase assay with benzyl tagged ATP followed by PNBM alkylation as previously described. The tagged proteins are then affinity purified by thiophosphate ester antibody. Protein contains several functional groups and can react with PNBM. It has been reported previously that PNBM does not modify alcohol, amine or carboxylic acid functional groups. However, PNBM can alkylate cysteine residues as we demonstrated with BSA. The immunoprecipitation by the thio-ester antibody is specific for the PNBM phospho-tag. The immunoprecipitated samples were run on SDS-Page and then sent for sequencing. The coomassie labeled bands (Figure 17) that correspond to the

Western blot stained with the thioester antibody were used for identification by MS. A total of

964 unique proteins were identified in these samples: 30 of these were phospho-peptides. The list of phospho peptides identified only the test but not the control sample is shown in Table 4.

Control Test

Figure 17: Test sample was run on a SDS-Page gel and stained with Coomassie and all the bands within the rectangular box were cut out of MS protein sequencing following trypsin digestion. A western blot is shown of the same sample which was used for analysis.

60 Table 5: List of phosphor-peptides and the corresponding proteins identified in the sample following isolation of PNB modified proteins by immunoprecipitation.

61 The phospho-proteins identified include A-kinase anchor protein 110 kDa , Calcium-binding tyrosine phosphorylation-regulated protein, Calnexin, Fibrous sheath CABYR-binding protein,

Isoform 2 of A-kinase anchor protein 4, Izumo sperm-egg fusion protein 1, progesterone receptor membrane component 1, and Protein phosphatase 1 regulatory subunit 7 which have implication in sperm function. As expected with the control labelling described with PPP1R2 we did not find any PNBM modified peptide. However, we believe that the peptides shown in the table are

PNBM modified peptides from as mutant PKA labelled protein in sperm extracts. A description of the known roles of a subset of the proteins follows.

AKAP3 (previously known as AKAP 110) and AKAP4 (previously known as AKAP 84):

Both sperm AKAP3(AKAP 110) and AKAP4 as a putative PKA substrates. AKAPs are highly expressed in testis. A-kinase anchoring proteins (AKAPs) are scaffolding proteins which bind to the regulatory subunit of PKA. Binding of AKAP to PKA helps in localization to distinct regions within a cell. It has been shown that when a synthetic peptide (Ht31) (84)which has structural similarity with the RII binding domain of AKAP3, inhibits sperm motility and fertility.

Immunocytochemical studied showed that AKAP3(85) is present both in head and principle piece and hence interact with regulatory subunit of PKA (84, 85). AKAP4 (86)is expressed mainly in the fibrous sheath surrounding the principle piece of a sperm. The discovery AKAPs that bind PKA are themselves substrates of PKA is novel. How PKA phosphorylation affects the scaffolding functions of AKAP3 and AKAP4 remains to be determined.

62 Fibrous sheath CABYR-binding protein(FSCB): FSCB is a testis and sperm specific protein present in the fibrous sheath of mouse flagellum. It has been previously shown that FSCB is a substrate of PKA thus validating our results. Mass spectrometric analysis have shown that there are seven sites for serine/threonine phosphorylation two of which were phosphorylated by PKA

(87). Identification of this PKA substrate protein by as mutant PKA labeling is a validation of this approach.

Basigin and Slc16a7 (MCT2): Basigin (BSG, EMMPIRIN) is a glycoprotein present in spermatozoa and is expressed during spermatogenesis. It is primarily located in the principal piece in immature caput epididymal spermatozoa. However, it moves to the middle piece of mature caudal epididymal spermatozoa (88, 89). Basigin is involved in cell-cell interactions and is also needed for the completion of spermatogenesis. Basigin is essential for sperm function and it is thought to bind to mono carboxylate transporter (MCT) in the sperm midpiece.

Monocarboxylate transporter (MCT), responsible for the transport of lactate and other monocarboxylates via the cell membrane, is abundant in the testes and sperm(90-94). Expression of MCT2 in the sperm flagellum requires co-expression with basigin. MCT2 colocalizes with basigin during epididymal sperm maturation process. It is expressed in principal piece in caput and midpiece in mature caudal spermatozoa. A representative ICC is shown below (Figure 18).

These changes in location could be due to a change in their phosphorylation status mediated by

PKA. The possibility that basigin and MCT2 are substrates of PKA is a significant finding because PKA along with other kinases and phosphatase plays an important role in epididymal sperm maturation (see Aim 2). Phosphorylation of the MCT2 and basigin (95) may not only be required for their movement to the midpiece plasma membrane domain but also for the activation

63 of energy metabolism along with motility development that occurs during epididymal sperm maturation.

Figure 18: Caput (A)and caudal (B) sperm from WT mice was stained with antibodies to basigin and MCT2. In caput sperm both basigin and MCT2 are in the principle piece whereas in the caudal are found in the midpiece.

64 IZUMO sperm egg function protein 1: IZUMO belongs to an immunoglobulin superfamily of type I membrane proteins. It consists of one extracellular immunoglobulin (Ig) domain and one N-terminal domain. IZUMO superfamily consists of four proteins, coded with numbers 1 to 4. All four IZUMO proteins show a significant homology in the N-terminal domain, which is also known as “IZUMO domain”. IZUMO1, 2 and 3 are transmembrane proteins and exclusively expressed in the testis. Whereas, IZUMO4 is soluble and expressed in the testis along with other tissues (96). The IZUMO1 is essential for sperm-egg fusion. IZUMO1 staining is observed on the acrosomal cap, equatorial and whole head. The localization of

IZUMO 1 changes during acrosome reaction. IZUMO1 relocates during acrosome reaction from the anterior part of the sperm head to the sites on the sperm where fusion to the egg occurs. Izumo−/− mice show no developmental abnormalities. Izumo−/− males were sterile despite normal mating behavior. Sperm from Izumo−/− mice can penetrate the zona pelucida layer but fail to fuse with eggs. Our discovery that Izumo could be a substrate of PKA should lead to an understanding of how the ability of sperm to bind and fuse to eggs develops in sperm.

Phosphoglycerate kinase 2 (Pgk2): Studies with both mouse and human sperm indicate that glycolysis produces a significant fraction of the ATP required for fertilization. Phosphoglycerate kinase 2 (PGK2), an isozyme catalyzes the first ATP-generating step in the glycolytic pathway.

Ubiquitously expressed phosphoglycerate kinase 1 (PGK1) isozyme is replaced by PGK2 in testis and sperm. Targeted disruption of Pgk2 KO severely impairs male fertility. Motility and

ATP levels were significantly reduced in sperm lacking PGK2(97). The suggestion that PGK2 is

65 a substrate for PKA implies that its activity and therefore sperm ATP production could be regulated by PKA.

Pyruvate dehydrogenase E1 component subunit alpha: Pyruvate dehydrogenase A (PDHA2) normally present in mitochondria is tyrosine phosphorylated and is present in the fibrous sheath of the sperm principle piece. PDHA2 is also co-localized with AKAP4 in fibrous sheath. The exact role of the PDHA2 in the flagellum is not known. The discovery that PDHA2 is a substrate of PKA suggests that ATP generation is regulated PKA as described above for

PGK2(98).

Progesterone receptor membrane component 1: Progesterone is present in the uterine fluid and binds to the progesterone receptor present on the plasma membrane of sperm. Progesterone triggers an increase(99) of intracellular free calcium levels during capacitation lead to sperm hyperactivation and acrosome reaction. Progesterone receptor KO mice are infertile. My study suggests the possibility that regulation of progesterone mediate calcium influx during sperm capacitation and hyperactivation could be regulated by PKA. As described above in the introduction section PKA is essential for in sperm hyperactivation and fertilization.

66 Summary

Identification of substrates phosphorylated by PKA during sperm maturation and activation described in Aim 1, is the first step in understanding how PKA acts in sperm. Some of these proteins are involved in sperm maturation, metabolism, and fertilization. Direct approaches should follow with antibodies against phosphorylated and non-phosphorylated forms of the proteins and using demembranated sperm (intact cell) motility reactivation models resulting in the long-needed advance in our understanding of how cAMP and PKA act in sperm.

3.2 Discussion

A major obstacle in identifying protein kinase substrates is that phospho-proteins in sperm and other cells are usually the result of phosphorylation by more than one kinase. A chemical genetics approach where phosphorylation by a genetically modified protein kinase phosphorylates its substrate overcomes this limitation. We used PKA as-mutant mice to identify substrates of sperm PKA. It is likely that phosphorylation of some of the PKA substrates in the as-mutant mice may have occurred during sperm maturation in the epididymis, so some of the proteins will be prephosphorylated.To overcome this, we are now interested in making double

KO mice (PKA as-mutant knock-in on sAC null background). In the double mutant mice all

PKA substrates will be unphosphorylated because the as-mutant PKA will be inactive due to the lack of sperm cAMP. ATP analog labeling of proteins in extracts of sperm from these double mutant mice will permit identification of all potential substrates of PKA. We will be using the immunoprecipitation technique to identify the modified peptide and determine new PKA substrates along with the ones already identified.

67 This study will then be followed by validation of the identified PKA substrates. We will have to use recombinant proteins to determine that they are phosphorylated at stoichiometric levels by

PKA in vitro. Phospho site-specific antibodies for the proteins identified in Aim 1, if available, will be used to determine how phosphorylation of the PKA substrates changes during epididymal sperm maturation or during activation with bicarbonate.

We can also use the chemical genetics approach to determine changes in PKA mediated phosphorylation in intact sperm. The idea behind this approach is that pre-phosphorylated proteins will not be labeled during incubation of the extracts with the ATP analog, therefore bands corresponding to these proteins will be absent in western blots developed with analog specific antibodies. The identities of the pre-phosphorylated proteins can be determined by comparing these blots to the blots from the double mutant mice (AS mutant mice in a sAC null background) where all the PKA substrates will be phosphorylated by the ATP analog. Extracts prepared from sperm at different stages of maturation or sperm activated prior to extract preparation should contain different subsets of pre-phosphorylated PKA substrates. ATP analog labeling in extracts from immotile caput and motile caudal epididymal sperm and in extracts from motile sperm before and after activation with bicarbonate known to promote capacitation, will enable us to identify proteins phosphorylated endogenously by PKA in sperm. Similarly, differences in ATP analog labeling before and after treatment of sperm from double mutant mice with cell permeable cAMP analogues will permit identification of proteins phosphorylated by cAMP in intact sperm. These data will provide additional validation, albeit indirect, that proteins phosphorylated by PKA in vitro are substrates phosphorylated in vivo.

Chapter IV AIM 2

Rationale

Phosphoprotein phosphatase 1 is a serine /threonine phosphatase when first discovered was found to be inhibited by the heat stable, acid-stable inhibitory protein I (I-1) and inhibitor protein-2 (I-2). Since then several PP1 inhibitors have identified experimentally and by bioinformatic analysis. I have discussed in aim 2.2 the three inhibitors, PPP1R2, PPP1R7, and

PPP1R11, we had identified in sperm. In this study I describe discovery of a fourth PP1γ2 regulatory protein in sperm – PPP1R36.

69 Results

Cloning and sequencing of Ppp1r36

The protein PPP1R36 (C14orf50) is one of the 2000 ciliary proteins (100). This protein was also identified using an in silico bioinformatics analysis as a potential interacting partner and inhibitor of PP1(101). Tissue expression profile NCBI EST database shows that PPP1R36 is highly expressed in testis. This suggested that PPP1R36 could be present in sperm.

We made cDNA from testis by reverse transcription of total RNA PCR amplification with primers (Fw:5’- ATGGTCAAGAGTGAGGCCATGTTC-3’ and Rv: 5’-

AAACTTGACGTCATCCAGC-3’) for PPP1R36. The primers had overhangs for XhoI and

EcoRI (Figure 19A) to permit cloning into the PRSET-A plasmid. Sequencing of the cDNA from the colonies showed that testis may contain two different forms of Ppp1r36. The transcript described in the Ensemble data shows that Pppr36 has 11 exons. The two isoforms we identified should arise due to the presence or absence of exon 3 in the transcripts (Figure 19B).

70 A.

Figure 19: (A) pRSETA backbone showing the cloning sites for PPP1R36 using Xho1 and

EcoR1 using Forward 5’ ATGGTCAAGAGTGAGGCCATGTTC 3’ and Reverse primer as 5’

AAACTTGACGTCATCCAGC-3’. (B) Schematic Diagram showing two different transcript forms of PPP1R36. The Ppp1r36 testis specific isoform contains 11 exons, whereas the short isoform lacks exon 3 completely.

71 Ppp1r36 is highly expressed in testis compared to other organs.

Northern blot analysis from several the mouse tissues using a full-length cDNA as a probe showed that Ppp1r36 is highly expressed in testis. This message in testis is 1.8 kb in size (Figure

20). The photo image process emphasizes the large expression. To determine which of the two- isoform predicted by reverse transcription and cloning described above we used specific internal primers for each of the two transcripts form in RT PCR. Both the transcript forms are present in testis: the longer transcript (the transcript containing exon 3) is highly expressed in testis compared to other tissues. The shorter transcript (lacking exon 3) is abundant in heart and lung.

To confirm this observation, we used specific primers for the two forms in qPCR of RNA from different organs. The longer and shorter isoforms are expected to show bands at 300bp and

200bp kb, respectively. Results of the RT-PCR show that the longer form is present in high amounts in testis with considerably lower levels in lung and brain (Figure 21A). The shorter transcript form is predominant in heart and lung with low levels in testis. Next, we used qPCR to further confirm that the longer transcript form is highly expressed in testis compared to other tissues (Figure 21B)

72 Figure 20: mRNA analysis of PPP1R36 in tissues. Northern blot analysis of total RNA from mouse tissues probed with the whole Ppp1r36 message shows high expression unique message in testis at around 1.8 kb. Equal amounts were loaded in each lane.

Figure 21: (A) Reverse transcription PCR (Fw: 5’-ATGGTCAAGAGTGAGGCCATGTTC-3’ and Rv: 5’-AAACTTGACGTCATCCAGC-3’) showing the presence of two forms in different organs. The size difference is due to the absence of exon 3 in the shorter form. (B) Quantitative

PCR showing the expression of the testis specific (long form) Ppp1R36 is present in testis. The results are represented as fold-change after normalizing the Ppp1r36 mRNA levels with Gapdh internal control. These data are representative of three independent experiments and error bars represent SE. The data was normalized making testis as 1.

73 Expression of Ppp1r36 in postnatal developing testis.

Next we wanted to determine the temporal expression pattern in developing testis. RNA was prepared from day10, 15, 20 and 25 postnatal developing mouse testis. RT-PCR of RNA from developing mouse testis shows that Ppp1r36 was expressed at increasing levels starting from day

10 possibly coinciding with the onset of spermatogenesis (Figure 22A). This observation was confirmed by qPCR which shows that expression of Ppp1r36 begins from 15-day postpartum testis. (Figure 22B). Thus the temporal expression pattern of Ppp1r36 is similar to the expression of Ppp1r2, Ppp1r7, Ppp1r11 shown in aim 2.2 (Figure 29).

Figure 22: mRNA analysis of PPP1R36 in developmental testis. (A) PCR amplification with

Ppp1r36 primers shows presence of Ppp1r36 and its increase post-meiotically. (B) qRT-PCR

74 showing increase in Ppp1r36 mRNA levels in postnatal developing testis. The results are represented as fold-change after normalizing the Ppp1r36 mRNA levels with Gapdh internal control. These data are representative of three independent experiments in triplicates, and error bars represent SE.

Characterization of PPP1R36 antibody and its presence in sperm and testis.

Further studies on PPP1R36 require antibodies against the protein. Commercial antibodies for

PPP1R36 were not available. We generated antibodies against an epitope spanning from 372-393 with the amino acid sequence EENTKPSGRSSSIVETNNTKIQ. The antibody reacted well against the recombinant proteins 50 kDa and 45 kDa corresponding to the longer and shorter isoforms. (Figure 23A). In western blot of testis and sperm extracts a band at around ~47 kDa is observed (Figure 23A) which likely corresponds to longer isoform. PPP1R36 is present in the insoluble fraction of sperm extracts (Figure 23B).

B. A.

47 kDa

Figure 23: PPP1R36 isoform characterization. (A) PPP1R36 antibody validation by Western blot in the presence of two recombinant His-proteins (RecProtein) obtained from two different

75 colonies that were sequenced as the longer and shorter forms of PPP1R36. (B) Western blot analysis shows the presence of PPP1R36 in testis and sperm.

PP1γ2 co-localizes with PPP1R36.

Next, we determined localization of PP1γ2 and PPP1R36 in sperm. As seen in (Figure 24B)

PP1γ2 is present along the entire length of the flagellum, in the mid- and principal pieces, and neck. In the head, staining is intense in the acrosome region and in the equatorial segment. For

PPP1R36, it is expressed in the whole head including acrosomal and post acrosomal region. It is predominantly expressed in mid piece of the sperm (Figure 24C). A control slide shows lack of staining when secondary antibody alone was used. Hoechst stain was used to label DNA in the sperm head.

The antibodies we had developed use in the western blots and ICC shown above was of low affinity and could not be used for immunoprecipitation. Moreover, the efficacy of the antibodies declined during storage at -80 C. We tried to generate antibodies against another epitope in

PPPR36: amino acids 11~ 30 with the following sequence PEFYSRRKQFVGQSSTRLDQ.

Unfortunately, this antibody was worse than the first, failing to recognize the protein in sperm and testis. We are now planning to produce antibodies against the N- or C- terminus portions of

PPP1R36.

Figure 24: Similar distribution of PP1g2 and PPP1R36 in morphologically normal mouse spermatozoa. Mouse spermatozoa were labeled with fluorescence conjugated secondary antibody as negative control (A) rabbit anti-PP1g2 (B)rabbit anti-PPP1R36 (C). Specific secondary antibodies conjugated with Cyanine 3 fluorophores, were used. To identify the

77 nucleus, a Hoechst dye (blue) was used. Merged pictures show that PPP1R36, is localized in mouse spermatozoa head region as well as in the mid piece and principle piece just like PP1g2.

Summary

We have successfully cloned the Ppp1r36 and identified two forms. Northern blot and qPCR showed that Ppp1r36 transcript is highly expressed in testis compared to other organs. Antibody against this protein initially identified its presence in testis and sperm and recognized recombinant protein. PPP1R36 also colocalizes with PP1g2 in sperm indicating that proximity to

PP1g2 is a requirement for its function as a regulator. The reactivity of the antibody was poor and the affinity of the antibody to recognize proteins declined during storage. Attempts to produce other antibodies are being planned. We expect that future studies should show that this regulator has a role in controlling the catalytic activity of PP1g2 in the insoluble structures of the flagellum: perhaps the axoneme.

Chapter IV AIM 2*

Rationale

The serine/threonine protein phosphatase 1 (PP1) inhibitors PPP1R2, PPP1R7 and

PPP1R11, are potential regulators of PP1g2 in sperm. In this aim, I studied these inhibitors, to determine their spatial and temporal expression in testis and their regulatory functions in sperm.

My goals were:

 Determine how these inhibitors, ubiquitous in somatic cells, are expressed in testis.

 We also wanted to see whether they are expressed in the same spatio-temporal

manner as PP1g2 in testis.

 Determine how localization of the inhibitors compare to the localization of PP1g2

in testis and sperm.

 Determine whether these three regulators play a role in controlling PP1g2 catalytic

activity during epididymal sperm maturation in wild type mice.

 Because male mice lacking Gsk3α and sAC are infertile due to impaired motility

we also determined the status of PP1g2 and its regulators in mutant sperm.

 Finally, we determined the phosphorylation status of these regulators in caput and

caudal epididymal sperm.

79 Results

Expression of PPP1R2, PPP1R11, and PPP1R7 in testis.

The three inhibitors of the protein phosphatase PP1, PPP1R2, PPP1R11, and PPP1R7 (also known as inhibitors I2, I3, and sds22) are found in a wide range of organisms and tissues. The levels of protein regulators are expected to match levels of the phosphatase to prevent unregulated catalytic activity of the enzyme. We therefore expect that these three proteins should be expressed in testis at significant levels compared to other tissues. We determined levels of transcripts for these proteins in testis compared to other tissues. We used northern blot analysis of RNA from different mouse tissues probed with cDNA corresponding to the coding sequences of PPP1R2, PPP1R11 or PPP1R7.

A transcript for Ppp1r2, around 0.9 kb, is present almost exclusively in testis (Figure

25A). In addition, a 1.4 kb mRNA also predominant in testis, is present in lower amounts in other tissues. A band at 2.4 kb is present in relatively low levels in all tissues. For Ppp1r11

(Figure 25B) northern blot analysis showed that mRNA species at 0.6 kb is present at remarkably high levels in testis compared to other tissues. A band at 1.5 kb was present at relatively low levels in all tissues. Tissue blot probed with Ppp1r7 cDNA showed a unique message size of

~0.9 kb abundant in testis compared to other tissues (Figure 25C). Thus overall, unique message sizes for all the three proteins were present in significantly high levels in testis compared to other tissues.

Figure 25. Northern blot analysis of PP1γ2 binding partners in tissues. (A) Northern Blot analysis of total RNA (25 µg) from mouse tissues shows a ̴ 0.9 kb unique Ppp1r2 (I2) message in testis which is different from the ubiquitous 1.4 kb message. (B) Northern blot analysis of total

RNA (25 µg) from mouse tissues shows abundant expression of 0.6 kb message of Ppp1r11 (I3) in testis apart from the ubiquitously expressed Ppp1r11 message (1.5 kb). (C) Northern blot analysis of total RNA (25 µg) demonstrating the specific expression of a unique message for

Ppp1r7 (sds22) in testis. Equal amounts were loaded in each lane of the blot.

81 Basis for the expression of Ppp1r2, Ppp1r11 and Ppp1r7 at unique sizes in testis compared to other tissues.

Recent annotation of the mouse gene Ppp1r2 in Ensmble and NCBI databases suggest that isoforms of PPP1R2 could arise due to alternate splicing. The ubiquitously expressed Ppp1r2 mRNA with its 206 amino acid residues arises from 6 exons with the 6th exon also contributing to the 3’-UTR of the transcript. An alternate message is thought to exist due to the retention of the intron 5 as an extended exon, resulting in an mRNA that is expected to encode a protein of

195 amino acids in length. This predicted isoform would have a short 3 amino C-terminus replacing the 14 amino acid C-terminus in the well characterized somatic PPP1R2). Evidence for the sequence and translation of this putative alternate message is lacking and so we hypothesized that this alternate message encoding the 195 amino acid PPP1R2 could represent the 0.9 kb seen in northern blots of mouse testis RNA (Figure 25A). Nucleotide sequencing following RT of testis RNA confirmed the annotation predicted in the Ensembl database for the PPP1R2 isoform which is 195 amino acids in length compared to the ubiquitously expressed 206 amino acid proteins.

Annotation for Ppp1r11 in the Ensembl mouse genome database predicts two alternatively spliced mRNA variants. One of these mRNAs corresponds to the previously reported ubiquitous

PPP1R11 form whereas the second transcript would encode an alternate isoform. These transcripts, varying at their extreme 5’-ends, are thought to arise due to the use of two alternate transcription start sites . According to this in silico prediction, the novel isoform for Ppp1r11 is transcribed from an internal transcription start site residing within intron 1. This alternate transcript should result in a unique 5’-UTR and a N-terminus derived from exon 1b while the

82 remaining portion of the transcripts would be identical. The predicted protein resulting from this

PPP1R11 isoform has 120 amino acids which is shorter than the previously characterized form

(131 amino acids). Reverse transcription PCR (Figure 28A) and qRT-PCR (Figure 28B)show that the ubiquitous form is present in all tissues analyzed and that the alternate form is present only in testis. To further confirm the identity of the 0.6 kb mRNA, we amplified and sequenced it from testis cDNA using specific primers. Sequencing confirmed that this was the unique transcript at 0.6kb expressed in testis.

Ppp1r7 is also expressed as unique isoform in testis. To fully characterize the message for this unique isoform of PPP1R7 in testis we next undertook PCR amplification of cDNA obtained from a mouse spermatid-enriched library. Sequencing showed that the unique isoform resulted from a truncation of exon 10 and the inclusion of an additional exon 11 to form a unique 3’-

UTR. This putative message should encode a novel PPP1R7 protein with a unique C-terminus different from the PPP1R7 ubiquitous in somatic cells.

Based on these determinations of the testis expressed transcripts for the proteins we designed specific primers (materials and methods) which will amplify both the testis expressed and ubiquitous forms from RNA in testis by RT-PCR and qPCR. For Ppp1r2 the primers specific for ubiquitous form showed a band at 190 bp (Figure 26A) and is present in testis as well as in other tissues like liver and brain. RT-PCR with testis specific primers a band was only seen in testis at 120bp(Figure 26A).This was confirmed by using that same primer for qPCR(Figure

26B) which conclusively showed that the testis specific form is highly expressed in testis.

Similar experiments for Ppp1r11 shows band at (393bp) (Figure 27A) and for Ppp1r7 a band at

(176bp)(Figure 28A) both of which correspond to the ubiquitous forms for the proteins present in all tissues including testis. However RT-PCR with testis specific primers showed bands only in

83 testis for both Ppp1r11(360 bp)(Figure 27A)) and Ppp1r7(248 bp)(Figure 28A).This RT PCR data was also confirmed by qPCR analysis (Figure 27B and Figure 28B) which show that the two proteins similar to PPP1R2 are expressed at high levels in testis.

Figure 26: Ppp1r2 expression in tissues. (A) PCR amplification of Ppp1r2 in different tissues (testis, liver, kidney, brain) show that with same reverse primer but using different forward primers The amplification shows the presence of both transcripts in testis but the alternate spliced form is specific from testis whereas the other is present in all other tissues.

(B) Quantitative PCR showing the expression of the testis specific Ppp1r2 is present in testis.

The results are represented as fold-change after normalizing the Ppp1r2 mRNA levels with

Gapdh internal control. These data are representative of three independent experiments and error bars represent SE.

Figure 27: Ppp1R11 expression in tissues. (A) PCR amplification of Ppp1r11 in different tissues (testis, liver, kidney, heart, brain) show that with same reverse primer (5’-

GTGCTGCATAGGTCCTGGAGGA-3’) but using different forward primers for exon 1A (5’-

GAGACAGGGGCCGGGATA-3’) or exon 1B (5’-ATGGAATGGGTGCGTGTTAAAGC-3’).

The amplification shows the presence of both transcripts in testis but the alternate spliced form is specific from testis whereas the other is present in all other tissues. (B) Quantitative PCR showing the expression of the testis specific Ppp1r11 is present in testis. The results are represented as fold-change after normalizing the Ppp1r11 mRNA levels with Gapdh internal control. These data are representative of three independent experiments and error bars represent

SE.

Figure 28: Ppp1r7 expression in tissues. PCR amplification was done to show that with specific primers we could detect the ubiquitous (A) Pppp1r7 form in liver brain kidney along with testis but the testis specific form (B) was only detected in testis. (A) For the ubiquitous form forward and reverse primers were 5’CAGGAGTCTGGAGACCGTGTAC3’ and

5’GTGGCTGGGAAGTTCTTTTGAG 3’ respectively. (B) For testis specific for the forward and the reverse primers were 5’GAATATCAGCCATCTGACAGAAC 3’ and5’GACATCAAGGGAAGTCAGAGCC 3’ respectively.

86 Expression of the inhibitors in postnatal developing testis

To determine the stage of spermatogenesis at which the message for the Ppp1r2 was expressed, total RNA was prepared from postnatal developing mouse testis. Northern blot analysis showed that the 0.9 kb Ppp1r2 message starts increasing from day 21 coinciding with the appearance of round spermatids and reaching a maximum in adult testis (Figure 29A).

Northern blot shows that the 0.6 kb mRNA for Ppp1r11 (Figure 29B) is first detected between days 15-20 of postnatal testis which corresponds with emergence of early/mid pachytene spermatocytes and round spermatids.

The message level further increases in day 30 postnatal testis, when elongating spermatids are formed, and remains elevated in adult testis. For Ppp1r7 the 0.9 kb mRNA was detected starting from day 7 and with the progressive development of the testis the levels of this mRNA significantly increased particularly after days 15-20, reaching a maximum in the adult mice

(Figure 29C) (Table 6).

Figure 29: mRNA analysis of PP1γ2 testis enriched binding partners in developmental testis. (A) Total RNA (25 µg) extracted from developing testis was also subjected to Northern blot analysis and showed a steady expression of both 2.4 kb and 1.4 kb ubiquitous Ppp1r2 messages but showed a gradual increase of the ~0.9 kb testis specific isoform from day 20 to adult testis. The 1.4 kb message levels also increase markedly post-meiotically in elongating spermatids and remains elevated in adult testis. Equal amounts were loaded in each lane. (B)

Northern blot analysis of testis total RNA (25 µg) demonstrating the developmental expression of Ppp1r11 isoforms when probed with the whole cDNA of Ppp1r11. The testis-specific isoform of Ppp1r11 is highly expressed post-meiotically. Equal amounts were loaded in each lane (C)

Northern blot analysis of testis total RNA (25 µg) demonstrating the developmental expression of Ppp1r7 alternate isoform when probed with whole cDNA of Ppp1r7. The alternate isoform of

Ppp1r7 is highly expressed post-meiotically. Equal amounts were loaded in each lane.

88 Protein expression of PP1 inhibitors in testis.

Following determination of the expression of the messages we ascertained the protein levels of the PP1 inhibitor. Definitive identification of PPP1R2 protein has so far been hampered by the lack of an appropriate antibody. An antibody raised against internal amino acids of

PPP1R2 (135REKKRQFEMKRKLH148) while reacting against recombinant PPP1R2 due to low affinity was unable to detect heat stable PPP1R2 in testis and sperm extracts. We next generated a C-terminus antibody for PPP1R2 (STTSDHLQHKSQSS)(102, 103). This antibody recognized recombinant PPP1R2 (Materials and Methods) and PPP1R2 in a panel of tissues, the protein being most abundant in testis compared to other tissues (Figure 30A). It is known that PPP1R2 migrates anomalously in SDS gel electrophoresis at 32 kDa compared to its calculated molecular weight of 23 kDa, due to its hydrophilicity and acidity (102, 103). The inhibitor PPP1R2 is heat stable. A further test of the antibody is its ability to detect the protein in heat stable sperm extracts. Indeed, the antibodies were able to recognize the protein in heat stable tissue extracts

(Figure 30B) at a position identical to the bands seen whole tissue extracts (Figure 30A).

The presence of PPP1R7 and PPP1R11 proteins is documented in bovine but not mouse sperm . We have well characterized antibodies for these proteins. The antibodies were generated against conserved amino acid sequence segments and thus should be able to recognize the proteins in other species including mice. A western blot of extracts from various mouse tissues shows that PPP1R11 is highly expressed in mouse testis seen at a molecular weight around 26 kDa (Figure 30C). PPP1R11, which is hydrophilic and rich in amino acid residues, is known to migrate anomalously at 26 kDa while its calculated molecular weight is 15 kDa. Similar to

PPP1R11, the western blot of whole tissue extracts probed for PPP1R7 shows two bands around

43 kDa with highest amounts in brain but at significant levels in testis (Figure 30D). The two

89 bands for PPP1R7 were also seen in bovine testis and sperm extracts [22]. The basis for the doublet bands for PPP1R7 is not known but could be due to phosphorylation.

Figure 30: Protein analysis of PP1γ2 testis enriched binding partners in different mouse tissues. Western blots using the new C-terminus PPP1R2 antibody in (A) whole protein extracts and in (B) heat stable extracts of brain, heart, lung, kidney and testis. Both blots show the

PPP1R2 (I2) protein at 32 kDa position and that it is heat stable. (C) Western blots developed with PPP1R11 (I3) and (D) PPP1R7 (sds22) antibodies in brain, heart, lung, kidney and testis both with whole protein extracts show bands at 26 kDa and 43 kDa, respectively.

90 Localization of PP1γ2 and its inhibitors in testis.

Data above show that transcript and protein levels for the three PP1 regulatory proteins are high in testis compared to other tissues. Next, we examined localization of the proteins compared to

PP1γ2 in testis sections. Immunohistological analyses of testis sections show that expression of

PP1γ2 (Figure 31A) starts from spermatocyte onwards in differentiating germ cells and it is present also in mature spermatozoa. PPP1R11(Figure 31C) and PPP1R2 (Figure 31B) are predominantly expressed in the cytoplasm of mature spermatids to mature spermatozoa.

Expression of PPP1R7 (Figure 31D) appears to be uniform from spermatogonia to mature spermatozoa. My data verifies previously documented expression patterns for PPP1R11 and

PPP1R7 in mouse testis(27, 28). Here I show for the first time that PPP1R2 is also expressed in manner like the PPP1R11. Thus, all the three inhibitors are present at the same or overlapping locations and expressed at the same post-natal development times as PP1γ2.

Figure 31: Distribution of PP1γ2 and its binding partners within testis.

Immunohistochemistry of wild type testis section show PP1γ2 (A) expression from secondary spermatocytes cytoplasm, spermatids and mature spermatozoa. PPP1R2 (B) and PPP1R11(C) is expressed in round spermatids and mature spermatozoa where as PPP1R7 (D) is expressed throughout the cytoplasm of primary spermatocyte secondary spermatocyte round spermatid and mature spermatozoa. Cyanine3 was used as secondary antibody to visualize the proteins. Hoechst dye was used to stain the nucleus

92 Presence and localization of PPP1R2, PPP1R7, and PPP1R11.

We have previously documented the presence of PPP1R11 and PPP1R7, in bovine sperm (27).

The presence of the inhibitor PPP1R2 in sperm was inferred based on the effect of GSK3 in increasing PP1 catalytic activity in sperm extracts(104). My objective here was to determine the presence of the three regulators in mouse sperm. Figure 32 shows that PPP1R2, PPP1R7 and

PPP1R11 are present in caudal epididymal sperm. The proteins are predominantly present in the soluble fraction of sperm extracts with relatively low levels in the insoluble pellet fraction.

Figure 32: Distribution of PP1γ2 testis enriched binding partners in soluble and insoluble fraction of sperm lysate. Western blot analysis to determine the supernatant vs pellet distribution of PPP1R2, PPP1R11 and PPP1R7 in sperm. (A, B,C) After sonication, PPP1R2

PPP1R11 and PPP1R7 are present mostly in supernatant fractions of sperm extracts.

Immunofluorescence was used to determine intra sperm localization of PP1γ2 and its regulators

PPP1R2, PPP1R11 and PPP1R7. We used monovalent Fab fragment for blocking and for double labeling primary antibodies from the same host species. As seen in Figure 33 B, C, D PP1γ2

(Cyanine 3) is present along the entire length of the flagellum, in the mid- and principal pieces, and neck. In the head, staining is intense in the acrosome region and in the equatorial segment.

PPP1R11 and PPP1R7 co-localizes with PP1γ2 in acrosome region but PPP1R2 is present in the entire head region except acrosome. The inhibitors are present along the entire flagellum, although PPP1R2 and PPP1R11 seems to be more prominent in the mid- and principal pieces, whereas PPP1R7 is mostly present in the principal piece (Figure 33 B, C and D). The inhibitors are also present in the head of spermatozoa and co-localize with PP1γ2 (merged figure shown in yellow). Thus, all three inhibitors share overlapping localization with PP1γ2 in sperm (Table 5).

Figure 33: Co-localization of PP1g2 and PPP1R2, PPP1R7 and PPP1R11 in morphologically normal mouse spermatozoa. Mouse spermatozoa were labeled with fluorescence conjugated secondary antibody as negative control (A), rabbit anti-PP1g2 rabbit anti-PPP1R2 (B), rabbit anti-PP1g2, rabbit anti-PPP1R11 (C), rabbit anti-PP1g2 rabbit anti-

PPP1R7 (D) antibodies. Specific secondary antibodies conjugated with Cyanine 3 fluorophores, and Alexa Fluor 488 were used. To identify the nucleus, a Hoechst dye (blue) was used. Merged pictures show that PPP1R2, PPP1R11 and PPP1R7 are localized in mouse spermatozoa head region as well as in the mid piece and principle piece similar to the staining seen for PP1g2.

Table 6: Summary of mRNA and protein expression of PPP1R2, PPP1R7, PPP1R11 overlaps with PP1γ2.

96 Binding of the inhibitors with PP1g2 in testis and sperm.

We next determined whether the inhibitors were bound to PP1γ2 mouse testis and sperm. We performed immunoprecipitation experiments with testis extracts to determine whether PP1γ2 precipitated all the inhibitors. Western blot analysis clearly shows that in testis extract all the inhibitors co-precipitate with PP1γ2 antibodies. Our next question was whether the binding pattern of PP1γ2 with its inhibitors is altered during passage of sperm through the epididymis.

Results from these experiments are described below (Figure 34).

Figure 34: PP1g2 binds with PPP1R2, PPP1R11 and PPP1R7 in testis. Mouse testis co- immunoprecipitations were done with PP1g2 antibody. The input, beads and flow-through

97 extracts were probed with PPP1R2 (32 kDa), PPP1R11 (26 kDa) and PPP1R7 (43 kDa) antibodies. All the three regulators in testis show up in bead fraction. In the negative control mostly, they were observed in the flow-through fraction.

Association of PPP1R2 with PP1g2

For PPP1R2 we did immunoprecipitation (IP) with mouse caput and caudal sperm extracts. First, we used PP1g2 antibodies (Figure 35A) to check the status of PPP1R2. PPP1R2 does not precipitate with PP1g2 in caput sperm as it is seen in the flow through but not the bound (beads) fraction. In caudal sperm PPP1R2 precipitates with PP1g2 and thus is bound to the enzyme

(Figure 35B). To further confirm this observer IP was performed with PPP1R2 antibodies.

PPP1R2 precipitates PP1g2 in caudal (Figure 35B) but not in caput (Figure 35A) sperm extracts.

Negative control using rabbit serum in place of the specific antibodies show that there is little or no non-specific binding to the antibody bound beads.

Figure 35: Binding of PP1g2 with PPP1R2. (A) Immunoprecipitation is done by PP1g2 and

PPP1R2 in caput sperm extract. Western blot analysis shows that PP1g2 does not bind to

PPP1R2 in sperm extracts and comes down in the flow through (unbound) showing bands at

32kDa and 39kDa for PPP1R2 and PP1g2 respectively. (B) Immunoprecipitation is done in caudal sperm extracts with PP1g2 and PPP1R2 to show that inhibitor PPP1R2 is bound to PP1g2.

99 Association of PPP1R7 with PP1g2.

Binding status of PPP1R7 with PP1g2 was determined. Immunoprecipitation in caput and caudal sperm extracts with PP1g2 showed that and PPP1R7 is bound to PP1g2 in caudal (Figure 36B) but not in caput sperm (Figure 36A) extracts. In the PP1g2/beads and negative control the bands at 55kDa are due to the antibody heavy chains. This binding difference was confirmed by using

PPP1R7 antibodies for immunoprecipitation: PP1g2 is precipitated in caudal but not caput sperm.

Figure 36: Binding difference of PPP1R7 with PP1g2 in caput and caudal epididymis.

(A)Western blot of immunoprecipitated samples shows that PP1g2 is not bound with PPP1R7 in caput sperm extracts. Both PP1g2 and PPP1R7 is seen in flow through samples. (B)Immunoblot shows that immunoprecipitated samples of caudal sperm extracts consists of PPP1R7 bound to

PP1g2.

100 Binding of PPP1R11 with PP1g2.

It has been reported previously that PPP1R11 is associated with PP1g2 (27)and PPP1R7 to form a trimeric complex bovine caudal sperm and testis. But whether there is change of this binding during sperm maturation was not known. Figure 37A and B with reciprocal IP with PP1g2 and

PPP1R11 antibodies show that PPP1R11 is bound to PP1g2 in both caput and caudal sperm.

However as seen above the complex of PP1g2 with PPP1R7 is present caudal but not caput sperm.

Figure 37: Binding PPP1R11 with PP1g2 in caput and caudal epididymis. (A)Western blot analysis of caput sperm extracts with PP1g2 and PPP1R11 antibody shows that PPP1R11 is bound to PP1g2. (B) Immunoprecipitation done in caudal sperm extracts also shows that

101 PPP1R11 is bound to PP1g2. Thus there is no difference in binding of PP1g2 to PPP1R11 in caput and caudal sperm.

Binding of inhibitors with PP1γ2 in bovine caput and caudal epididymis.

We also determined whether the changes in inhibitor binding to PP1g2 also occurs in bovine as in mouse epididymal sperm. Data in Figure 38 shows that same differences in the binding of

PP1γ2 to its inhibitors are also found in bovine caput and caudal epididymal sperm as in mouse epididymal sperm. That is, PP1γ2 is associated with all three regulators in caudal sperm but only with PPP1R11 in caput epididymal sperm. The binding data seen with IP experiments in the western blot are summarized in the Table 6. We suspect that changes in association of PP1g2 with it regulator occurs in all mammalian species as we have demonstrated in both mouse and bovine sperm.

102

Figure 38: Differential binding of PP1γ2 to PPP1R2, PPP1R7 and PPP1R11 in bull caput and caudal epididymal sperm. Immunoprecipitations were done using PP1γ2, PPP1R7,

PPP1R11 or PPP1R2 antibodies in bull caput and caudal sperm extracts and Western blots were then probed with PPP1R7 or PP1γ2 antibodies. PP1γ2 antibody precipitates PPP1R2 and

PPP1R7 from extracts of caudal but not from caput epididymal sperm. This is confirmed by reciprocal immunoprecipitation with PPP1R7 antibody. Antibodies to PPP1R11 precipitate

PP1γ2 from both caput and caudal sperm extracts. (Note: Western blots of PP1γ2 IP developed with PPP1R11 antibodies are not shown because the band for PPP1R11 runs close to the IgG light chain.)

103 Change of binding status of inhibitors with PP1γ2 in Gsk3α and sAC KO mice.

Male mice lacking Gsk3α(57, 58) or sAC (18) are infertile. In both these cases infertility is due to impaired sperm function. PP1γ2 activity and metablic parameters are altered suggesting that

PP1γ2 binding to its inhibitors could be altered in mutant sperm from these KO mice.

Immunoprecipitation of caput sperm extracts from Gsk3α ko and sAC ko mice showed that

PPP1R2 ,PPP1R7 is not bound to PP1γ2 just like in wild type caput sperm.Whereas immunoprecipitation experiments on the caudal sperm extracts from ko mice showed that PP1γ2 is not bound to PPP1R7(Figure 39A and C).This is shown by doing immunoprecipitation by using both the antibodies.Binding of PPP1R2 (Figure 39 A and C) and PPP1R11 in knockout caudal epididymis with PP1γ2 is unaltered. Caudal sperm from Gsk3α ko and sAC ko resembles partially like caput immotile sperm. Thus the two protein kinase GSK3 and PKA are likely to invovled in bind and regulation of PP1g2 by its regulatory proteins.

104

C. D.

Figure 39: (A)Immunoprecipitation was done using PP1γ2 in caudal sperm of sAC KO mouse.Western blot analysis probed with PPP1R7 and PPP1R2 showed that PPP1R2 was bound to PP1γ2 just like in the wild type mouse but PPP1R7 was not bound with PP1γ2.(B)To show whether this is true a reverse IP was done using PPP1R7 to show that PP1γ2 doesnot comes down with PPP1R7.The same blot was reprobed with PPP1R7 to show that the

105 immunoprecipitation worked.(C)Immunoprecipitation was done on Gsk3α KO caudal sperm extracts with PP1γ2 antibody also shows that PPP1R7 is not bound to PP1γ2.The binding status of PPP1R2 remains same.(D) A reciprocal IP was done with PPP1R7 antibody in caudal sperm extracts to show that PP1γ2 is not bound with it.

Table 7:Summerization of binding status of PP1γ2 with its inhibitors in wild type, Gsk3α ko and sAC ko mice caudal and caput sperm extracts.

106 Phosphorylation status of the PP1γ2 inhibitors in caput compared to caudal sperm.

We suspected that the change in binding of the inhibitors to PP1γ2 is likely due to differences in their phosphorylation. Due to unavailability of phospho antibodies against the regulators determination of the phosphorylation status of the inhibitors was determined using phosphoprotein enrichment columns (materials and methods). We enriched phospho-proteins in caput and caudal bull sperm extracts. Extracts before and after phospho-enrichment were compared in western blots of extracts from equal numbers of caput and caudal numbers. Figure 40A and B shows that both PPP1R2 and PPP1R11 are significantly phosphorylated in caput sperm compared to caudal sperm. Sperm extracts of caput and caudal epididymis (i.e. extracts before phosph protein enrichment) were also run to show that equal amount of the proteins were present. (blots labeled as Input in Figure 40 A and B). The ability of the procedure to enrich phosphoproteins was verified with GSK3 which is known to be more phosphorylated in caudal compared to caput sperm. Using phospho-specific Gsk3α/b antibodies we showed that Gsk3α/b is highly phosphorylated in caudal sperm extracts. Western blot of eluates from phospho enrichment probed with phospho-GSK3 antibodies validates the procedure sue to identity phospho proteins (Figure 40D). The predication that PPP1R2 should be phosphorylated due to the high activity of GSK3 is confirmed here(105). In addition, we also found that PPP1R11 is highly phosphorylated and bound to PP1γ2 in caput sperm. It is therefore possible, that phosphorylation of PPP1R11 prevents binding of PPP1R7 to PP1γ2. The inhibitor PPP1R7 is almost equally phosphorylated in both caput and caudal sperm (Figure 40C). A considerable proportion of PPP1R7 is not phosphorylated in both caput and caudal sperm as evidenced by its presence in the unbound flow through fraction.

107

Figure 40: The inhibitors are differentially phosphorylated in caput and caudal epididymis.

Bull caput and caudal sperm lysate was phosphor enriched by using columns. Western blot analysis was of the sample show that PPP1R2 (A) and PPP1R11 (B) is highly phosphorylated in caput sperm lysate where as PPP1R7(C) phosphorylation status is comparable in caput and caudal sperm lysate. Blots with input samples show equal loading and equal amount of the protein before phospho enrichment.

108 Schematic diagram (Figure 41) below summarizes our data and also illustrating the potential mechanism how the protein kinases and phosphatases may be involved in the initiation of motility during sperm maturation in the epididymis. In caput sperm, PP1γ2 activity is high because it is not to bound PPP1R2 and PPP1R7. High GSK3 activity in caput sperm is likely to be responsible for phosphorylation and dissociation of PPP1R2 from PPP1R2. This relationship between activation of PP1 and phosphorylation of PPP1R2 has previously been proposed in other tissues (102, 103, 106). As for PPPR7 we speculate that it does not bind to the PP1γ2-

PPP1R11 complex in caput sperm because PP1γ2 bound PP1R11 is phosphorylated. The kinase responsible for PPP1R11 phoshorylation: it could well be GSK3. Thus the high catalytic activity of PP1γ2 in caput is likely due to two reasons: the lack of binding PPP1R2 and PPP1R7 to

PPP1r7. In caudal sperm, PPPR2 not phosphorylated because of low GSK3 activity, is bound to

PP1γ2. Further the trimeric complex between PP1γ2, PPP1R11, and PPP1R7 exist in caudal.

For both these reasons catalytic activity of PP1γ2 is low which contributes to motility initiation.

The model also shows the possible regulatory interrelationship between PKA, GSK3, and PP1γ2.

Data supporting these mechanistic inter-relationships are from work published from our lab but not presented in the thesis. However my discovery of how phosphorylation and binding of the regulators of PP1γ2 change during epididymal maturation forms an integral part of the scheme shown in the figure.

109

Figure 41: Schematic diagram of how PP1y2 is regulated by its inhibitors in sperm during its transition from caput to caudal epididymis.

110 Summary

Here I showed that the regulators PPP1R2, PPP1R11 and PPP1R7 along with PP1γ2 are expressed at high levels in testis. Spatio-temporal expression in testis also match or overlap with

PP1γ2 expression. These data are consistent with the notion that the inhibitors are likely to play a role in the regulation of PP1γ2 when incorporated into sperm. It is noteworthy that transcripts for the inhibitors are expressed as testis specific forms. We have also shown that changes in the association of PP1γ2 with its regulators occurs during sperm maturation in the epididymis. These changes were shown to occur in both bovine and mouse epididymal sperm. The alteration in binding of the regulators are due to changes in their phosphorylation. This study, for the first time, lays the basis for the long-sought understanding of the biochemical mechanisms underlying sperm maturation in the epididymis.

111 4.3 Discussion

Protein phosphatases in general are regulated by one or more of several proteins (107). An important question relevant to PP1 regulation is how the amounts of the protein regulators compare with the levels of the enzyme in a cell. The levels of the regulators, PPP1R2, PPP1R7,

PPP1R11 and PPP1R36 must match that of PP1γ2 which is expressed starting from initiation of spermatogenesis which occurs around day 10 postnatal testis in sperm. We show that increased and overlapping expression of all four inhibitors with PP1γ2 occurs in developing testis starting with onset of spermatogenesis (Table 2.1.1). Their localization within testis by IHC show that

PPP1R2 and PPP1R11 are predominant in developing haploid cells. The protein PPP1R7 has a more uniform localization within testis. However, the unique sized messenger RNA for PPP1R7 is more abundant coinciding with the onset of spermatogenesis. Remarkably all four

(PPP1R2,PPP1R7,PPP1R11,PPP1R36) inhibitors are expressed as unique mRNA forms in testis compared to other tissues. It is intriguing that the unique mRNA sizes for the inhibitors, found only in testis are expressed at high levels coinciding with onset of spermatogenesis. The mRNA forms found in somatic cells do not change in developing testis. Why the unique message forms exist and how their expression is coordinated with expression of PP1γ2 during onset of spermatogenesis are not known. Analysis with genomic and EST data bases suggest that the unique sizes of the mRNA likely arise due to alternate splicing, alternate transcript start sites, and alternate polyadenylation. It is likely that common regulatory elements for transcription exist in the genes for PP1γ2 and its three inhibitors enabling increased transcription during spermatogenesis. What these regulatory elements and the corresponding transcription factors are remain to be determined.

Sperm maturation in the epididymis is likely to involve changes in protein phosphorylation. It

112 was thought that elevation of cAMP levels and activation of PKA initiate motility in epididymal sperm (108, 109). How cAMP action is altered in epididymal sperm is not known. However it was later noted that cAMP and PKA action in sperm is limited by protein phosphatase activity

(108, 109). The activity of sperm PP1γ2 is high in immotile caput compared to motile caudal sperm. The PP1 inhibitors calyculin A and okadaic acid cause motility initiation and stimulation

(109) suggesting that a decline in PP1γ2 activity may contribute to motility initiation in epididymal sperm. How this decline in PP1γ2 activity during sperm maturation occurs was not known. Here we show, for the first time, that association of PP1γ2 with its proteins regulators is altered in sperm during their passage through the epididymis. In immotile caput sperm PP1γ2 is not bound to PPP1R2 or PPP1R7. It is known that PP1 when not bound to PPP1R2 is catalytically active (109, 110). It is also known that PP1 found as a trimeric complex with

PPP1R7 and R11 is catalytically inactive (27, 111). Thus one of the likely reasons for the high catalytic activity of PP1γ2 caput sperm is because it is not associated with the inhibitors

PPPP1R2 and PPP1R7. In caudal sperm all the three inhibitors are bound to PP1γ2. We hypothesized that differences in binding of the inhibitor proteins to PP1γ2 are due to differences in their phosphorylation. Indeed, phosphoprotein enrichment shows that PPP1R2 and PPP1R11 are phosphorylated in caput compared to caudal sperm. Phosphorylation of PPP1R7 is more or less comparable in caput and caudal sperm. A substantial portion of PPP1R7 is not phosphorylated in both caput and caudal sperm (Figure 2.1.11). Thus, lack of binding of

PPP1R7 to PP1γ2 is most likely due to phosphorylation of PPP1R11 in caput sperm. That is, phosphorylated PPP1R11 bound to PP1γ2 in caput sperm may prevent binding of PPP1R7 thus preventing formation of the trimer that is present in caudal sperm. It is already known that

PPP1R2 remains phosphorylated in caput sperm by GSK3, so data here confirms this

113 observation. Simultaneously we also found that PPP1R11 is highly phosphorylated in caput sperm, even though it remains bound to PP1γ2 in caput sperm. We can speculate from this that high phosphorylation of PPP1R11 prevents binding of PPP1R7 with PP1γ2. We have previously shown that in bovine caudal sperm PP1γ2 as a trimeric complex with PPP1R7, PPP1R11 is catalytically inactive(27). Therefore, epididymal sperm maturation involves dephosphorylation of PPP1R11 and PPP1R2. This is a surprising result because we anticipated that in general phosphorylation of protein increase in sperm during epididymal maturation. Thus decreased rather than increased phosphorylation may be responsible for sperm motility initiation in the epididymis. The protein kinase responsible for both PPP1R2 and PPP1R11 phosphorylation in caput epididymis could be GSK3. We have shown that GSK3 activity in caput sperm is significantly higher compared to caudal sperm(112). It is well known that GSK3 is an enzyme that phosphorylates PPP1R2. Verification of whether the amino acid sequence domain in

PPP1R11 corresponds to the consensus sequence for GSK3 phosphorylation remains to be determined. In testis binding of all three inhibitors resemble caudal sperm (Figure 2.1.5).

Therefore, phosphorylation of PPP1R11 and lack of binding of PPP1R7 to PP1γ2 occurs only in caput sperm. We have shown that caudal sperm for GSK3a and soluble adenylyl cyclase knockout mice PPP1R7 is not bound to PP1γ2, suggest impaired epididymal sperm maturation(57) (Supplementary figure S5). Pull-down experiments with phosphorylated and unphosphorylated recombinant PPP1R11 should provide further verification. It was recently suggested that a non-canonical Wnt signaling resulting in inactivation of GSK3 is involved in epididymal sperm maturation (113). Thus Wnt signaling resulting in decreased phosphorylation of the regulatory proteins of PP1γ2 could be a key signaling event responsible for the acquisition of sperm motility in the epididymis.

114 In summary, we have shown that expression levels of the regulators of PP1γ2 match the expression of the enzyme during spermatogenesis. Appropriate levels of the inhibitors should be required for regulation of PP1γ2 in sperm. We also show for the first time that binding of

PPP1R2, PPP1R11 and PPP1R7 to PP1γ2 changes during passage of sperm through the epididymis. The changes in binding to PP1γ2 occur due to decreased phosphorylation of the inhibitors PPP1R2 and PPP1R11. We suspect that GSK3 could be one of the protein kinases that is responsible for increased phosphorylation of PPP1R2 and PPP1R11. Further studies are required to determine the kinases responsible for the changes in PP1 inhibitor phosphosphorylation. This study reveals, for the first time, the basis for understanding the biochemical mechanisms underlying sperm maturation in the epididymis. The possible roles of how changes in phosphorylation is involved in epididymal sperm maturation is shown in Figure

41.

*Part of this work has been submitted as “Regulators of the protein phosphatase PP1γ2, PPP1R2,

PPP1R7, and PPP1R11 are involved in epididymal sperm maturation, Goswami et al ” to Journal of Cellular Physiology.

115 References

1. Neill Ka. Physiology of Reproduction: Academic Press; 2015. 2. de Kretser DM, Loveland KL, Meinhardt A, Simorangkir D, Wreford N. Spermatogenesis. Hum Reprod. 1998;13 Suppl 1:1-8. Epub 1998/07/15. PubMed PMID: 9663765. 3. Griswold MD. Spermatogenesis: The Commitment to Meiosis. Physiol Rev. 2016;96(1):1-17. Epub 2015/11/06. doi: 10.1152/physrev.00013.2015. PubMed PMID: 26537427; PMCID: PMC4698398. 4. Yanagimachi R. Stability of the mammalian sperm nucleus. Zygote. 1994;2(4):383-4. Epub 1994/11/01. PubMed PMID: 8665175. 5. Yanagimachi R. Fertility of mammalian spermatozoa: its development and relativity. Zygote. 1994;2(4):371-2. Epub 1994/11/01. PubMed PMID: 8665172. 6. Eddy EM. The scaffold role of the fibrous sheath. Soc Reprod Fertil Suppl. 2007;65:45- 62. Epub 2007/07/25. PubMed PMID: 17644954. 7. Eddy EM, Toshimori K, O'Brien DA. Fibrous sheath of mammalian spermatozoa. Microsc Res Tech. 2003;61(1):103-15. Epub 2003/04/03. doi: 10.1002/jemt.10320. PubMed PMID: 12672126. 8. Linck RW, Chemes H, Albertini DF. The axoneme: the propulsive engine of spermatozoa and cilia and associated ciliopathies leading to infertility. J Assist Reprod Genet. 2016;33(2):141-56. Epub 2016/01/31. doi: 10.1007/s10815-016-0652-1. PubMed PMID: 26825807; PMCID: PMC4759005. 9. Cooper TG. The Epididymis, sperm maturation and fertilization. Berlin, Heidelberg: Springer-Verlag; 1986. 10. Austin CR. Observations on the penetration of the sperm in the mammalian egg. Aust J Sci Res B. 1951;4(4):581-96. Epub 1951/11/01. PubMed PMID: 14895481. 11. Burton KA, McKnight GS. PKA, germ cells, and fertility. Physiology (Bethesda). 2007;22:40-6. doi: 10.1152/physiol.00034.2006. PubMed PMID: 17289929. 12. Nolan MA, Babcock DF, Wennemuth G, Brown W, Burton KA, McKnight GS. Sperm- specific protein kinase A catalytic subunit Calpha2 orchestrates cAMP signaling for male fertility. Proc Natl Acad Sci U S A. 2004;101(37):13483-8. Epub 2004/09/02. doi: 10.1073/pnas.0405580101. PubMed PMID: 15340140; PMCID: 518783. 13. Agustin JT, Wilkerson CG, Witman GB. The unique catalytic subunit of sperm cAMP- dependent protein kinase is the product of an alternative Calpha mRNA expressed specifically in spermatogenic cells. Mol Biol Cell. 2000;11(9):3031-44. Epub 2000/09/12. PubMed PMID: 10982398; PMCID: 14973. 14. Desseyn JL, Burton KA, McKnight GS. Expression of a nonmyristylated variant of the catalytic subunit of protein kinase A during male germ-cell development. Proc Natl Acad Sci U S A. 2000;97(12):6433-8. PubMed PMID: 10841548; PMCID: 18620. 15. Steegborn C. Structure, mechanism, and regulation of soluble adenylyl cyclases - similarities and differences to transmembrane adenylyl cyclases. Biochim Biophys Acta. 2014;1842(12 Pt B):2535-47. Epub 2014/09/07. doi: 10.1016/j.bbadis.2014.08.012. PubMed PMID: 25193033. 16. Esposito G, Jaiswal BS, Xie F, Krajnc-Franken MA, Robben TJ, Strik AM, Kuil C, Philipsen RL, van Duin M, Conti M, Gossen JA. Mice deficient for soluble adenylyl cyclase are infertile because of a severe sperm-motility defect. Proc Natl Acad Sci U S A.

116 2004;101(9):2993-8. doi: 10.1073/pnas.0400050101. PubMed PMID: 14976244; PMCID: 365733. 17. Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, Kamenetsky M, Miyamoto C, Zippin JH, Kopf GS, Suarez SS, Levin LR, Williams CJ, Buck J, Moss SB. The "soluble" adenylyl cyclase in sperm mediates multiple signaling events required for fertilization. Dev Cell. 2005;9(2):249-59. Epub 2005/08/02. doi: 10.1016/j.devcel.2005.06.007. PubMed PMID: 16054031; PMCID: 3082461. 18. Xie F, Garcia MA, Carlson AE, Schuh SM, Babcock DF, Jaiswal BS, Gossen JA, Esposito G, van Duin M, Conti M. Soluble adenylyl cyclase (sAC) is indispensable for sperm function and fertilization. Dev Biol. 2006;296(2):353-62. Epub 2006/07/18. doi: 10.1016/j.ydbio.2006.05.038. PubMed PMID: 16842770. 19. Terry-Lorenzo RT, Carmody LC, Voltz JW, Connor JH, Li S, Smith FD, Milgram SL, Colbran RJ, Shenolikar S. The neuronal actin-binding proteins, neurabin I and neurabin II, recruit specific isoforms of protein phosphatase-1 catalytic subunits. J Biol Chem. 2002;277(31):27716-24. Epub 2002/05/23. doi: 10.1074/jbc.M203365200. PubMed PMID: 12016225. 20. Chakrabarti R, Kline D, Lu J, Orth J, Pilder S, Vijayaraghavan S. Analysis of Ppp1cc- null mice suggests a role for PP1gamma2 in sperm morphogenesis. Biol Reprod. 2007;76(6):992-1001. doi: 10.1095/biolreprod.106.058610. PubMed PMID: 17301292. 21. Cohen PT. Protein phosphatase 1--targeted in many directions. J Cell Sci. 2002;115(Pt 2):241-56. Epub 2002/02/13. PubMed PMID: 11839776. 22. Varmuza S, Jurisicova A, Okano K, Hudson J, Boekelheide K, Shipp EB. Spermiogenesis is impaired in mice bearing a targeted mutation in the protein phosphatase 1cgamma gene. Dev Biol. 1999;205(1):98-110. Epub 1999/01/12. doi: 10.1006/dbio.1998.9100. PubMed PMID: 9882500. 23. Sinha N, Pilder S, Vijayaraghavan S. Significant expression levels of transgenic PPP1CC2 in testis and sperm are required to overcome the male infertility phenotype of Ppp1cc null mice. PLoS One. 2012;7(10):e47623. Epub 2012/10/20. doi: 10.1371/journal.pone.0047623. PubMed PMID: 23082183; PMCID: PMC3474748. 24. Soler DC, Kadunganattil S, Ramdas S, Myers K, Roca J, Slaughter T, Pilder SH, Vijayaraghavan S. Expression of transgenic PPP1CC2 in the testis of Ppp1cc-null mice rescues spermatid viability and spermiation but does not restore normal sperm tail ultrastructure, sperm motility, or fertility. Biol Reprod. 2009;81(2):343-52. Epub 2009/05/08. doi: 10.1095/biolreprod.109.076398. PubMed PMID: 19420386; PMCID: PMC2849817. 25. Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, da Cruz e Silva EF, Greengard P. Sperm motility development in the epididymis is associated with decreased glycogen synthase kinase-3 and protein phosphatase 1 activity. Biology of reproduction. 1996;54(3):709-18. Epub 1996/03/01. PubMed PMID: 8835395. 26. Chakrabarti R, Cheng L, Puri P, Soler D, Vijayaraghavan S. Protein phosphatase PP1 gamma 2 in sperm morphogenesis and epididymal initiation of sperm motility. Asian J Androl. 2007;9(4):445-52. doi: 10.1111/j.1745-7262.2007.00307.x. PubMed PMID: 17589781. 27. Cheng L, Pilder S, Nairn AC, Ramdas S, Vijayaraghavan S. PP1gamma2 and PPP1R11 are parts of a multimeric complex in developing testicular germ cells in which their steady state levels are reciprocally related. PLoS One. 2009;4(3):e4861. doi: 10.1371/journal.pone.0004861. PubMed PMID: 19300506; PMCID: 2654099.

117 28. Huang Z, Khatra B, Bollen M, Carr DW, Vijayaraghavan S. Sperm PP1gamma2 is regulated by a homologue of the yeast protein phosphatase binding protein sds22. Biol Reprod. 2002;67(6):1936-42. PubMed PMID: 12444072. 29. Puri P, Myers K, Kline D, Vijayaraghavan S. Proteomic analysis of bovine sperm YWHA binding partners identify proteins involved in signaling and metabolism. Biology of reproduction. 2008;79(6):1183-91. Epub 2008/08/30. doi: 10.1095/biolreprod.108.068734. PubMed PMID: 18753613; PMCID: 2780472. 30. Huang FL, Glinsmann WH. Separation and characterization of two phosphorylase phosphatase inhibitors from rabbit skeletal muscle. Eur J Biochem. 1976;70(2):419-26. Epub 1976/11/15. PubMed PMID: 188646. 31. Smith GD, Wolf DP, Trautman KC, da Cruz eSE, Greengard P, Vijayaraghavan S. Primate sperm contain protein phosphatase 1, a biochemical mediator of motility. Biol Reprod. 1996;54(3):719-27. 32. Zhang J, Zhang L, Zhao S, Lee EY. Identification and characterization of the human HCG V gene product as a novel inhibitor of protein phosphatase-1. Biochemistry. 1998;37(47):16728-34. doi: 10.1021/bi981169g. PubMed PMID: 9843442. 33. Pilder SH, Lu J, Han Y, Hui L, Samant SA, Olugbemiga OO, Meyers KW, Cheng L, Vijayaraghavan S. The molecular basis of "curlicue": a sperm motility abnormality linked to the sterility of t haplotype homozygous male mice. Soc Reprod Fertil Suppl. 2007;63:123-33. PubMed PMID: 17566267. 34. Han YB, Feng HL, Cheung CK, Lam PM, Wang CC, Haines CJ. Expression of a novel T-complex testis expressed 5 (Tctex5) in mouse testis, epididymis, and spermatozoa. Mol Reprod Dev. 2007;74(9):1132-40. doi: 10.1002/mrd.20631. PubMed PMID: 17342733. 35. Ohkura H, Yanagida M. S. pombe gene sds22+ essential for a midmitotic transition encodes a leucine-rich repeat protein that positively modulates protein phosphatase-1. Cell. 1991;64(1):149-57. PubMed PMID: 1846086. 36. Stone EM, Yamano H, Kinoshita N, Yanagida M. Mitotic regulation of protein phosphatases by the fission yeast sds22 protein. Curr Biol. 1993;3(1):13-26. PubMed PMID: 15335873. 37. Wilson R, Ainscough R, Anderson K, Baynes C, Berks M, Bonfield J, Burton J, Connell M, Copsey T, Cooper J, et al. 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature. 1994;368(6466):32-8. doi: 10.1038/368032a0. PubMed PMID: 7906398. 38. MacKelvie SH, Andrews PD, Stark MJ. The Saccharomyces cerevisiae gene SDS22 encodes a potential regulator of the mitotic function of yeast type 1 protein phosphatase. Mol Cell Biol. 1995;15(7):3777-85. PubMed PMID: 7791785; PMCID: 230616. 39. Ceulemans H, Van Eynde A, Perez-Callejon E, Beullens M, Stalmans W, Bollen M. Structure and splice products of the human gene encoding sds22, a putative mitotic regulator of protein phosphatase-1. Eur J Biochem. 1999;262(1):36-42. PubMed PMID: 10231361. 40. Renouf S, Beullens M, Wera S, Van Eynde A, Sikela J, Stalmans W, Bollen M. Molecular cloning of a human polypeptide related to yeast sds22, a regulator of protein phosphatase-1. FEBS Lett. 1995;375(1-2):75-8. PubMed PMID: 7498485. 41. Chun YS, Park JW, Kim GT, Shima H, Nagao M, Kim MS, Chung MH. A sds22 homolog that is associated with the testis-specific serine/threonine protein phosphatase 1gamma2 in rat testis. Biochem Biophys Res Commun. 2000;273(3):972-6. doi: 10.1006/bbrc.2000.3045. PubMed PMID: 10891357.

118 42. Kaidanovich-Beilin O, Woodgett JR. GSK-3: Functional Insights from Cell Biology and Animal Models. Frontiers in molecular neuroscience. 2011;4:40. Epub 2011/11/24. doi: 10.3389/fnmol.2011.00040. PubMed PMID: 22110425; PMCID: 3217193. 43. Doble BW, Patel S, Wood GA, Kockeritz LK, Woodgett JR. Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta-catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev Cell. 2007;12(6):957-71. Epub 2007/06/05. doi: 10.1016/j.devcel.2007.04.001. PubMed PMID: 17543867; PMCID: PMC4485918. 44. Beurel E, Grieco SF, Jope RS. Glycogen synthase kinase-3 (GSK3): regulation, actions, and diseases. Pharmacol Ther. 2015;148:114-31. Epub 2014/12/02. doi: 10.1016/j.pharmthera.2014.11.016. PubMed PMID: 25435019; PMCID: PMC4340754. 45. Beurel E, Jope RS. Differential regulation of STAT family members by glycogen synthase kinase-3. J Biol Chem. 2008;283(32):21934-44. Epub 2008/06/14. doi: 10.1074/jbc.M802481200. PubMed PMID: 18550525; PMCID: PMC2494932. 46. Kaidanovich-Beilin O, Woodgett JR. GSK-3: Functional Insights from Cell Biology and Animal Models. Front Mol Neurosci. 2011;4:40. Epub 2011/11/24. doi: 10.3389/fnmol.2011.00040. PubMed PMID: 22110425; PMCID: 3217193. 47. Medina M, Wandosell F. Deconstructing GSK-3: The Fine Regulation of Its Activity. International journal of Alzheimer's disease. 2011;2011:479249. Epub 2011/06/02. doi: 10.4061/2011/479249. PubMed PMID: 21629747; PMCID: 3100567. 48. Hurtado DE, Molina-Porcel L, Carroll JC, Macdonald C, Aboagye AK, Trojanowski JQ, Lee VM. Selectively silencing GSK-3 isoforms reduces plaques and tangles in mouse models of Alzheimer's disease. J Neurosci. 2012;32(21):7392-402. Epub 2012/05/25. doi: 10.1523/JNEUROSCI.0889-12.2012. PubMed PMID: 22623685; PMCID: PMC3368584. 49. Ly PT, Wu Y, Zou H, Wang R, Zhou W, Kinoshita A, Zhang M, Yang Y, Cai F, Woodgett J, Song W. Inhibition of GSK3beta-mediated BACE1 expression reduces Alzheimer- associated phenotypes. J Clin Invest. 2013;123(1):224-35. Epub 2012/12/04. doi: 10.1172/JCI64516. PubMed PMID: 23202730; PMCID: PMC3533290. 50. Phiel CJ, Wilson CA, Lee VM, Klein PS. GSK-3alpha regulates production of Alzheimer's disease amyloid-beta peptides. Nature. 2003;423(6938):435-9. Epub 2003/05/23. doi: 10.1038/nature01640. PubMed PMID: 12761548. 51. Dajani R, Fraser E, Roe SM, Young N, Good V, Dale TC, Pearl LH. Crystal structure of glycogen synthase kinase 3 beta: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell. 2001;105(6):721-32. Epub 2001/07/07. PubMed PMID: 11440715. 52. Hernandez F, Langa E, Cuadros R, Avila J, Villanueva N. Regulation of GSK3 isoforms by phosphatases PP1 and PP2A. Molecular and cellular biochemistry. 2010;344(1-2):211-5. Epub 2010/07/24. doi: 10.1007/s11010-010-0544-0. PubMed PMID: 20652371. 53. ter Haar E, Coll JT, Austen DA, Hsiao HM, Swenson L, Jain J. Structure of GSK3beta reveals a primed phosphorylation mechanism. Nat Struct Biol. 2001;8(7):593-6. Epub 2001/06/28. doi: 10.1038/89624. PubMed PMID: 11427888. 54. Smith GD, Wolf DP, Trautman KC, Vijayaraghavan S. Motility potential of macaque epididymal sperm: the role of protein phosphatase and glycogen synthase kinase-3 activities. J Androl. 1999;20(1):47-53. PubMed PMID: 10100473. 55. Thomas GM, Frame S, Goedert M, Nathke I, Polakis P, Cohen P. A GSK3-binding peptide from FRAT1 selectively inhibits the GSK3-catalysed phosphorylation of axin and beta- catenin. FEBS letters. 1999;458(2):247-51. Epub 1999/09/11. PubMed PMID: 10481074.

119 56. Smith GD, Wolf DP, Trautman KC, da Cruz e Silva EF, Greengard P, Vijayaraghavan S. Primate sperm contain protein phosphatase 1, a biochemical mediator of motility. Biology of reproduction. 1996;54(3):719-27. Epub 1996/03/01. PubMed PMID: 8835396. 57. Bhattacharjee R, Goswami S, Dey S, Gangoda M, Brothag C, Eisa A, Woodgett J, Phiel C, Kline D, Vijayaraghavan S. Isoform specific requirement for GSK3alpha in sperm for male fertility. Biol Reprod. 2018. Epub 2018/02/01. doi: 10.1093/biolre/ioy020. PubMed PMID: 29385396. 58. Bhattacharjee R, Goswami S, Dudiki T, Popkie AP, Phiel CJ, Kline D, Vijayaraghavan S. Targeted disruption of glycogen synthase kinase 3A (GSK3A) in mice affects sperm motility resulting in male infertility. Biol Reprod. 2015;92(3):65. doi: 10.1095/biolreprod.114.124495. PubMed PMID: 25568307; PMCID: PMC4358024. 59. Bishop A, Buzko O, Heyeck-Dumas S, Jung I, Kraybill B, Liu Y, Shah K, Ulrich S, Witucki L, Yang F, Zhang C, Shokat KM. Unnatural ligands for engineered proteins: new tools for chemical genetics. Annu Rev Biophys Biomol Struct. 2000;29:577-606. Epub 2000/08/15. doi: 10.1146/annurev.biophys.29.1.577. PubMed PMID: 10940260. 60. Lopez MS, Kliegman JI, Shokat KM. The logic and design of analog-sensitive kinases and their small molecule inhibitors. Methods Enzymol. 2014;548:189-213. Epub 2014/11/18. doi: 10.1016/B978-0-12-397918-6.00008-2. PubMed PMID: 25399647. 61. Blethrow J, Zhang C, Shokat KM, Weiss EL. Design and use of analog-sensitive protein kinases. Curr Protoc Mol Biol. 2004;Chapter 18:Unit 18 1. Epub 2008/02/12. doi: 10.1002/0471142727.mb1811s66. PubMed PMID: 18265343. 62. Niswender CM, Ishihara RW, Judge LM, Zhang C, Shokat KM, McKnight GS. Protein engineering of protein kinase A catalytic subunits results in the acquisition of novel inhibitor sensitivity. J Biol Chem. 2002;277(32):28916-22. doi: 10.1074/jbc.M203327200. PubMed PMID: 12034735. 63. Schauble S, King CC, Darshi M, Koller A, Shah K, Taylor SS. Identification of ChChd3 as a novel substrate of the cAMP-dependent protein kinase (PKA) using an analog-sensitive catalytic subunit. J Biol Chem. 2007;282(20):14952-9. doi: 10.1074/jbc.M609221200. PubMed PMID: 17242405. 64. Habelhah H, Shah K, Huang L, Burlingame AL, Shokat KM, Ronai Z. Identification of new JNK substrate using ATP pocket mutant JNK and a corresponding ATP analogue. J Biol Chem. 2001;276(21):18090-5. doi: 10.1074/jbc.M011396200. PubMed PMID: 11259409. 65. Shah K, Shokat KM. A chemical genetic screen for direct v-Src substrates reveals ordered assembly of a retrograde signaling pathway. Chem Biol. 2002;9(1):35-47. PubMed PMID: 11841937. 66. Eblen ST, Kumar NV, Shah K, Henderson MJ, Watts CK, Shokat KM, Weber MJ. Identification of novel ERK2 substrates through use of an engineered kinase and ATP analogs. J Biol Chem. 2003;278(17):14926-35. doi: 10.1074/jbc.M300485200. PubMed PMID: 12594221. 67. Ubersax JA, Woodbury EL, Quang PN, Paraz M, Blethrow JD, Shah K, Shokat KM, Morgan DO. Targets of the cyclin-dependent kinase Cdk1. Nature. 2003;425(6960):859-64. doi: 10.1038/nature02062. PubMed PMID: 14574415. 68. Hindley AD, Park S, Wang L, Shah K, Wang Y, Hu X, Shokat KM, Kolch W, Sedivy JM, Yeung KC. Engineering the serine/threonine protein kinase Raf-1 to utilise an orthogonal analogue of ATP substituted at the N6 position. FEBS Lett. 2004;556(1-3):26-34. PubMed PMID: 14706820.

120 69. Larochelle S, Batliner J, Gamble MJ, Barboza NM, Kraybill BC, Blethrow JD, Shokat KM, Fisher RP. Dichotomous but stringent substrate selection by the dual-function Cdk7 complex revealed by chemical genetics. Nat Struct Mol Biol. 2006;13(1):55-62. PubMed PMID: 16327805. 70. Gregan J, Zhang C, Rumpf C, Cipak L, Li Z, Uluocak P, Nasmyth K, Shokat KM. Construction of conditional analog-sensitive kinase alleles in the fission yeast Schizosaccharomyces pombe. Nat Protoc. 2007;2(11):2996-3000. Epub 2007/11/17. doi: 10.1038/nprot.2007.447. PubMed PMID: 18007635; PMCID: 2957860. 71. Liu Y, Bishop A, Witucki L, Kraybill B, Shimizu E, Tsien J, Ubersax J, Blethrow J, Morgan DO, Shokat KM. Structural basis for selective inhibition of Src family kinases by PP1. Chem Biol. 1999;6(9):671-8. PubMed PMID: 10467133. 72. Chen X, Ye H, Kuruvilla R, Ramanan N, Scangos KW, Zhang C, Johnson NM, England PM, Shokat KM, Ginty DD. A chemical-genetic approach to studying neurotrophin signaling. Neuron. 2005;46(1):13-21. PubMed PMID: 15820690. 73. Jaeschke A, Karasarides M, Ventura JJ, Ehrhardt A, Zhang C, Flavell RA, Shokat KM, Davis RJ. JNK2 is a positive regulator of the cJun transcription factor. Mol Cell. 2006;23(6):899-911. PubMed PMID: 16973441. 74. Wang H, Shimizu E, Tang YP, Cho M, Kyin M, Zuo W, Robinson DA, Alaimo PJ, Zhang C, Morimoto H, Zhuo M, Feng R, Shokat KM, Tsien JZ. Inducible protein knockout reveals temporal requirement of CaMKII reactivation for memory consolidation in the brain. Proc Natl Acad Sci U S A. 2003;100(7):4287-92. PubMed PMID: 12646704. 75. Baker MA, Hetherington L, Weinberg A, Naumovski N, Velkov T, Pelzing M, Dolman S, Condina MR, Aitken RJ. Analysis of phosphopeptide changes as spermatozoa acquire functional competence in the epididymis demonstrates changes in the post-translational modification of Izumo1. J Proteome Res. 2012;11(11):5252-64. Epub 2012/09/08. doi: 10.1021/pr300468m. PubMed PMID: 22954305. 76. Arcelay E, Salicioni AM, Wertheimer E, Visconti PE. Identification of proteins undergoing tyrosine phosphorylation during mouse sperm capacitation. Int J Dev Biol. 2008;52(5-6):463-72. Epub 2008/07/24. doi: 10.1387/ijdb.072555ea. PubMed PMID: 18649259. 77. Honda Z, Suzuki T, Honda H. Identification of CENP-V as a novel microtubule- associating molecule that activates Src family kinases through SH3 domain interaction. Genes Cells. 2009;14(12):1383-94. doi: 10.1111/j.1365-2443.2009.01355.x. PubMed PMID: 19930468. 78. Parte PP, Rao P, Redij S, Lobo V, D'Souza SJ, Gajbhiye R, Kulkarni V. Sperm phosphoproteome profiling by ultra performance liquid chromatography followed by data independent analysis (LC-MS(E)) reveals altered proteomic signatures in asthenozoospermia. J Proteomics. 2012;75(18):5861-71. Epub 2012/07/17. doi: 10.1016/j.jprot.2012.07.003. PubMed PMID: 22796355. 79. Platt MD, Salicioni AM, Hunt DF, Visconti PE. Use of differential isotopic labeling and mass spectrometry to analyze capacitation-associated changes in the phosphorylation status of mouse sperm proteins. J Proteome Res. 2009;8(3):1431-40. Epub 2009/02/04. doi: 10.1021/pr800796j. PubMed PMID: 19186949; PMCID: 2857679. 80. Porambo JR, Salicioni AM, Visconti PE, Platt MD. Sperm phosphoproteomics: historical perspectives and current methodologies. Expert Rev Proteomics. 2012;9(5):533-48. Epub 2012/12/01. doi: 10.1586/epr.12.41. PubMed PMID: 23194270; PMCID: 3561639. 81. Morgan DJ, Weisenhaus M, Shum S, Su T, Zheng R, Zhang C, Shokat KM, Hille B, Babcock DF, McKnight GS. Tissue-specific PKA inhibition using a chemical genetic approach

121 and its application to studies on sperm capacitation. Proc Natl Acad Sci U S A. 2008;105(52):20740-5. doi: 10.1073/pnas.0810971105. PubMed PMID: 19074277; PMCID: 2634883. 82. Blethrow JD, Glavy JS, Morgan DO, Shokat KM. Covalent capture of kinase-specific phosphopeptides reveals Cdk1-cyclin B substrates. Proc Natl Acad Sci U S A. 2008;105(5):1442-7. doi: 10.1073/pnas.0708966105. PubMed PMID: 18234856; PMCID: 2234163. 83. Allen JJ, Li M, Brinkworth CS, Paulson JL, Wang D, Hubner A, Chou WH, Davis RJ, Burlingame AL, Messing RO, Katayama CD, Hedrick SM, Shokat KM. A semisynthetic epitope for kinase substrates. Nat Methods. 2007;4(6):511-6. doi: 10.1038/nmeth1048. PubMed PMID: 17486086; PMCID: 2932705. 84. Vijayaraghavan S, Goueli SA, Davey MP, Carr DW. Protein kinase A-anchoring inhibitor peptides arrest mammalian sperm motility. J Biol Chem. 1997;272(8):4747-52. Epub 1997/02/21. PubMed PMID: 9030527. 85. Vijayaraghavan S, Liberty GA, Mohan J, Winfrey VP, Olson GE, Carr DW. Isolation and molecular characterization of AKAP110, a novel, sperm-specific protein kinase A-anchoring protein. Mol Endocrinol. 1999;13(5):705-17. Epub 1999/05/13. doi: 10.1210/mend.13.5.0278. PubMed PMID: 10319321. 86. Miki K, Willis WD, Brown PR, Goulding EH, Fulcher KD, Eddy EM. Targeted disruption of the Akap4 gene causes defects in sperm flagellum and motility. Dev Biol. 2002;248(2):331-42. Epub 2002/08/09. PubMed PMID: 12167408. 87. Li YF, He W, Jha KN, Klotz K, Kim YH, Mandal A, Pulido S, Digilio L, Flickinger CJ, Herr JC. FSCB, a novel protein kinase A-phosphorylated calcium-binding protein, is a CABYR- binding partner involved in late steps of fibrous sheath biogenesis. J Biol Chem. 2007;282(47):34104-19. Epub 2007/09/15. doi: 10.1074/jbc.M702238200. PubMed PMID: 17855365. 88. Bi J, Li Y, Sun F, Saalbach A, Klein C, Miller DJ, Hess R, Nowak RA. Basigin null mutant male mice are sterile and exhibit impaired interactions between germ cells and Sertoli cells. Dev Biol. 2013;380(2):145-56. Epub 2013/06/04. doi: 10.1016/j.ydbio.2013.05.023. PubMed PMID: 23727514; PMCID: PMC3778672. 89. Chen L, Bi J, Nakai M, Bunick D, Couse JF, Korach KS, Nowak RA. Expression of basigin in reproductive tissues of estrogen receptor-{alpha} or -{beta} null mice. Reproduction. 2010;139(6):1057-66. Epub 2010/04/15. doi: 10.1530/REP-10-0069. PubMed PMID: 20388736; PMCID: PMC4778977. 90. Boussouar F, Mauduit C, Tabone E, Pellerin L, Magistretti PJ, Benahmed M. Developmental and hormonal regulation of the monocarboxylate transporter 2 (MCT2) expression in the mouse germ cells. Biol Reprod. 2003;69(3):1069-78. Epub 2003/05/30. doi: 10.1095/biolreprod.102.010074. PubMed PMID: 12773420. 91. Garcia CK, Brown MS, Pathak RK, Goldstein JL. cDNA cloning of MCT2, a second monocarboxylate transporter expressed in different cells than MCT1. J Biol Chem. 1995;270(4):1843-9. Epub 1995/01/27. PubMed PMID: 7829520. 92. Goddard I, Florin A, Mauduit C, Tabone E, Contard P, Bars R, Chuzel F, Benahmed M. Alteration of lactate production and transport in the adult rat testis exposed in utero to flutamide. Mol Cell Endocrinol. 2003;206(1-2):137-46. Epub 2003/08/29. PubMed PMID: 12943996.

122 93. Mannowetz N, Wandernoth P, Wennemuth G. Basigin interacts with both MCT1 and MCT2 in murine spermatozoa. J Cell Physiol. 2012;227(5):2154-62. Epub 2011/07/28. doi: 10.1002/jcp.22949. PubMed PMID: 21792931. 94. Nakai M, Chen L, Nowak RA. Tissue distribution of basigin and monocarboxylate transporter 1 in the adult male mouse: a study using the wild-type and basigin gene knockout mice. Anat Rec A Discov Mol Cell Evol Biol. 2006;288(5):527-35. Epub 2006/04/14. doi: 10.1002/ar.a.20320. PubMed PMID: 16612830; PMCID: PMC3739424. 95. Chen C, Maekawa M, Yamatoya K, Nozaki M, Ito C, Iwanaga T, Toshimori K. Interaction between basigin and monocarboxylate transporter 2 in the mouse testes and spermatozoa. Asian J Androl. 2016;18(4):600-6. Epub 2015/07/25. doi: 10.4103/1008- 682X.157650. PubMed PMID: 26208397; PMCID: PMC4955187. 96. Klinovska K, Sebkova N, Dvorakova-Hortova K. Sperm-egg fusion: a molecular enigma of mammalian reproduction. Int J Mol Sci. 2014;15(6):10652-68. Epub 2014/06/17. doi: 10.3390/ijms150610652. PubMed PMID: 24933635; PMCID: PMC4100174. 97. Danshina PV, Geyer CB, Dai Q, Goulding EH, Willis WD, Kitto GB, McCarrey JR, Eddy EM, O'Brien DA. Phosphoglycerate kinase 2 (PGK2) is essential for sperm function and male fertility in mice. Biol Reprod. 2010;82(1):136-45. Epub 2009/09/18. doi: 10.1095/biolreprod.109.079699. PubMed PMID: 19759366; PMCID: PMC2802118. 98. Kumar V, Rangaraj N, Shivaji S. Activity of pyruvate dehydrogenase A (PDHA) in hamster spermatozoa correlates positively with hyperactivation and is associated with sperm capacitation. Biol Reprod. 2006;75(5):767-77. Epub 2006/07/21. doi: 10.1095/biolreprod.106.053587. PubMed PMID: 16855207. 99. Mitra K, Shivaji S. Proteins implicated in sperm capacitation. Indian J Exp Biol. 2005;43(11):1001-15. Epub 2005/11/30. PubMed PMID: 16313063. 100. McClintock TS, Glasser CE, Bose SC, Bergman DA. Tissue expression patterns identify mouse cilia genes. Physiol Genomics. 2008;32(2):198-206. doi: 10.1152/physiolgenomics.00128.2007. PubMed PMID: 17971504. 101. Hendrickx A, Beullens M, Ceulemans H, Den Abt T, Van Eynde A, Nicolaescu E, Lesage B, Bollen M. Docking motif-guided mapping of the interactome of protein phosphatase- 1. Chem Biol. 2009;16(4):365-71. Epub 2009/04/25. doi: 10.1016/j.chembiol.2009.02.012. PubMed PMID: 19389623. 102. Korrodi-Gregorio L, Abrantes J, Muller T, Melo-Ferreira J, Marcus K, da Cruz e Silva OA, Fardilha M, Esteves PJ. Not so pseudo: the evolutionary history of protein phosphatase 1 regulatory subunit 2 and related pseudogenes. BMC Evol Biol. 2013;13:242. doi: 10.1186/1471- 2148-13-242. PubMed PMID: 24195737; PMCID: 3840573. 103. Korrodi-Gregorio L, Ferreira M, Vintem AP, Wu W, Muller T, Marcus K, Vijayaraghavan S, Brautigan DL, da Cruz ESOA, Fardilha M, da Cruz ESEF. Identification and characterization of two distinct PPP1R2 isoforms in human spermatozoa. BMC Cell Biol. 2013;14:15. doi: 10.1186/1471-2121-14-15. PubMed PMID: 23506001; PMCID: 3606321. 104. Vijayaraghavan S, Mohan J, Gray F, Khatra B, and Carr D. A role for phosphoryaltion of glycogen synthase kinase-3alpha in bovine sperm motility regulation. Biology of Reproduction. 2000;62:1647-54. 105. Somanath PR, Jack SL, Vijayaraghavan S. Changes in sperm glycogen synthase kinase-3 serine phosphorylation and activity accompany motility initiation and stimulation. Journal of Andrology. 2004;25(4):605-17. PubMed PMID: WOS:000222455000019.

123 106. Korrodi-Gregorio L, Esteves SL, Fardilha M. Protein phosphatase 1 catalytic isoforms: specificity toward interacting proteins. Transl Res. 2014;164(5):366-91. doi: 10.1016/j.trsl.2014.07.001. PubMed PMID: 25090308. 107. Aggen JB, Nairn AC, Chamberlin R. Regulation of protein phosphatase-1. Chem Biol. 2000;7(1):R13-23. PubMed PMID: 10662690. 108. Vijayaraghavan S, Chakrabarti R, Myers K. Regulation of sperm function by protein phosphatase PP1gamma2. Soc Reprod Fertil Suppl. 2007;63:111-21. PubMed PMID: 17566266. 109. Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, da Cruz e Silva EF, Greengard P. Sperm motility development in the epididymis is associated with decreased glycogen synthase kinase-3 and protein phosphatase 1 activity. Biology of reproduction. 1996;54(3):709-18. PubMed PMID: 8835395. 110. DePaoli-Roach AA. Synergistic phosphorylation and activation of ATP-Mg-dependent phosphoprotein phosphatase by F A/GSK-3 and casein kinase II (PC0.7). J Biol Chem. 1984;259(19):12144-52. PubMed PMID: 6090457. 111. Lesage B, Beullens M, Pedelini L, Garcia-Gimeno MA, Waelkens E, Sanz P, Bollen M. A complex of catalytically inactive protein phosphatase-1 sandwiched between Sds22 and inhibitor-3. Biochemistry. 2007;46(31):8909-19. doi: 10.1021/bi7003119. PubMed PMID: 17630778. 112. Somanath PR, Jack SL, Vijayaraghavan S. Changes in sperm glycogen synthase kinase-3 serine phosphorylation and activity accompany motility initiation and stimulation. Journal of andrology. 2004;25(4):605-17. PubMed PMID: 15223849. 113. Koch S, Acebron SP, Herbst J, Hatiboglu G, Niehrs C. Post-transcriptional Wnt Signaling Governs Epididymal Sperm Maturation. Cell. 2015;163(5):1225-36. doi: 10.1016/j.cell.2015.10.029. PubMed PMID: 26590424.

124