G C A T T A C G G C A T genes

Article Target-Genes Reveal and Genotypic Specificity of Anthocyanin Pigmentation in and Related Genera

1,2, 1, 1,2 1 Chiara Catalano †, Angelo Ciacciulli † , Fabrizio Salonia , Maria Patrizia Russo , Paola Caruso 1, Marco Caruso 1, Giuseppe Russo 1, Gaetano Distefano 2 and Concetta Licciardello 1,* 1 CREA, Research Centre for Olive, and Citrus Crops, Corso Savoia 190, 95024 Acireale, Italy; [email protected] (C.C.); [email protected] (A.C.); [email protected] (F.S.); [email protected] (M.P.R.); [email protected] (P.C.); [email protected] (M.C.); [email protected] (G.R.) 2 Department of Agriculture, Food and Environment (Di3A), University of Catania, Via Valdisavoia 5, 95123 Catania, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-095-765-3104 Authors contributed equally to the work. †  Received: 4 June 2020; Accepted: 10 July 2020; Published: 16 July 2020 

Abstract: Background: Anthocyanin pigmentation characterizes a number of tissues of Citrus and its relatives. The gain and loss of pigmentation is intriguing and is inherited variously among species. Methods: Citrus germplasm was used to investigate the anthocyanin pigmentation of tissues never before considered, including , style and , and of young , , rind and flesh of 28 genotypes belonging to 14 species. Citrus genotypes encompassed , , sweet , , and Citrus relatives included Microcitrus, Murraya, and . A relative qRT-PCR analysis was carried out on the structural and regulatory genes: phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 30-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), uridine diphosphate glucose flavonoid glucosyl-transferase (UFGT), glutathione S-transferase (GST), Ruby and Noemi. Image analysis and a genomic approach were employed to evaluate how the red pigmentation is inherited among tissues and species. Results: Pigmentation of young leaves and petals is specific to citron and its hybrids. Ruby controls the pigmentation of petals, but not of leaves. The red color of the rind and flesh is a trait that particularly characterizes a diversity of sweet oranges, citron hybrids and Citrus relatives. Color expression depends on external factors and also on developmental stage. The coloration of stamen and style is citron-specific, while a red stigma is exclusive to Moro orange and its hybrids. Conclusion: It is hypothesized that there is a relationship among Citrus species and genes controlling anthocyanin pigmentation.

Keywords: red color; Citrus; fruit; stamen; stigma; style; image analysis; qRT-PCR

1. Introduction Sweet oranges, , limes, , and pummelos are all economically important species belonging to the Citrus . A recent study [1] described ten natural Citrus species, hypothesizing that they developed sometime from the late (10.4–10.5 million years ago) to the early Pliocene (5.3–5.4 million years ago). It is thought that in addition to mandarin (Citrus reticulata), pummelo (Citrus maxima), and citron (Citrus medica), which are defined as the ‘primary’ species from which most cultivated Citrus have originated, another two species are crucial to the origin of limes

Genes 2020, 11, 807; doi:10.3390/genes11070807 www.mdpi.com/journal/genes Genes 2020, 11, 807 2 of 30 and calamondin, namely, Citrus (belonging to the subgenus ) and Fortunella japonica (also known as ) [2]. Citrus species and their relatives, such as Microcitrus australasica spp., Severinia spp., , and Citrus hystrix, exhibit significant variability in anthocyanin pigmentation among their different tissues, especially in their leaves and petals. The accumulation of anthocyanins in the mature is a particular feature that characterizes the flesh and the rind of ‘blood’ oranges ( Moro, Tarocco, and Sanguinello) and occurs exclusively in the rind of ancient pummelos [3,4]. Anthocyanins are water-soluble pigments, and represent the largest class of the flavonoid family. They are responsible for the red to purple color of tissues. The different hues are the result of vacuolar pH, co-pigmentation with other polyphenols, and the presence of ionic complexes [5]. Anthocyanins are involved in a range of aspects of and in defense including in dispersal and protection against biotic and abiotic stresses [6,7]. Furthermore, fruits and vegetables rich in anthocyanins are highly sought after by consumers due to their visual attractiveness and to their nutraceutical properties—they are well known to protect the human body from cardiovascular diseases and several types of cancer, in addition to offering defense from damage caused by free radicals [8]. A slimming effect caused by the anthocyanins in Moro has been demonstrated in obese mice subjected to a high fat diet [9]. Environmental conditions play a crucial role in controlling anthocyanin pigmentation. In the various cultivars, the anthocyanin accumulation is cold-dependent. Storage conditions in the range 4 to 9 ◦C have been shown to increase the transcription levels of the associated biosynthetic and regulatory genes, as well as increasing the anthocyanin content [10–13]. Natural low temperatures, typical of winter, induce increases in the accumulations of anthocyanins in sweet oranges [14]. In Citrus, as in most other species, light also regulates pigmentation [15]. Two categories of genes are necessary for anthocyanin production: structural genes, encoding for enzymes directly involved in anthocyanin biosynthesis, and the complex WMBW made up of transcription factors (i.e., WRKY, MYB, bHLH, and WD-repeats), that control the tissue-specific expression of the structural genes. These have all been studied extensively [16]. The most important are: (1) phenylalanine ammonia-lyase (PAL), cinnamate 4-hydroxylase and 4-coumarate-CoA ligase, involved in the phenylpropanoid pathway; (2) early biosynthetic genes (EBGs), working in the first steps of the anthocyanin pathway and including chalcone synthase (CHS), chalcone isomerase (CHI) and flavanone 30-hydroxylase (F3H); (3) late biosynthetic genes (LBGs), such as dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), and uridine diphosphate glucose flavonoid glucosyl-transferase (UFGT). Lastly, glutathione S-transferase (GST) is responsible for the vacuolization of anthocyanins. It has been reported in some plant species that the EBGs are not expressed differently between pigmented and non-pigmented examples; this contrasts with the LBGs [17,18]. For the regulatory genes in Citrus, it has been demonstrated that the insertion of a Copia-like Long Terminal Repeat (LTR) retrotransposon, Tcs1, promotes the expression of Ruby, the MYB-like gene that, together with Noemi (bHLH-like) and a WD40 repeat, control the anthocyanin trait in the pigmented orange fruits [12,19]. In addition to Ruby, it has recently been reported that Ruby2 works as the activator responsible for anthocyanin accumulation in both modern and primitive Citrus [4]. More recently it was recognized in Noemi the gene that controls both the anthocyanin trait and the acidity trait in Citrus fruits [19]. Moreover, several MYB repressors have been shown to contribute to the negative regulation of anthocyanin biosynthesis [20]. Additionally, CsMYB3 working together with Ruby, has been reported to form a regulatory ‘activator-and-repressor’ loop, operating in Citrus and its wild relatives [21]. A number of studies have focused on tissue pigmentation of the sweet orange cultivars, especially that of the flesh [10,22–26]. However, no results have been reported for tissues other than the fruit, or in species outside the Citrus genus, where red and purple colors are present in the young leaves and flowers. Genes 2020, 11, 807 3 of 30

The present work employs transcriptional analysis to investigate the main structural genes (e.g., PAL, CHS, CHI, F3H, DFR, ANS, UFGT, and GST) and regulatory genes (e.g., Ruby and Noemi). Here, these are evaluated in a set of tissues including: young leaves, petals, , styles, stigmas, flesh/juice, and rind. Some of these have not been evaluated previously in 28 genotypes belonging to 14 species (C. medica, C. sinensis, C. limon, C. limonia, C. aurantifolia, C. latifolia, C. meyeri, C. celebica, C. latipes, C. hystrix, Microcitrus australasica, Murraya paniculata, Severina disticha, and S. buxifolia). The genotypes were chosen based on the variability of pigmentation in a number of their tissues. This study aims to elucidate the phenotypic and genotypic variability of red–purple pigmentation. It suggests possible inheritance traits in each tissue across these species. The results of the study advance our understanding of the control of anthocyanin expression, and provides a foundation for further improvement and for the breeding of novel genotypes. Furthermore, it proposes new phenotypic markers, such as a purple stigma, that can be used to trace breeding materials.

2. Materials and Methods

2.1. Plant Material Plant materials were collected between November 2018 and April 2019 from the germplasm collection in Acireale and from the experimental orchard in Lentini of the Council for Agricultural Research and Economics-CREA (Table1, Figure1). Details on the geo-metereological conditions and soil compositions are reported in Figure S1. The tissues sampled for transcriptional analysis are: the young leaves, petals, stamens, styles, stigmas, flesh/juice, and rind. From one to three negative controls (unpigmented) for each tissue were also collected. All samples were stored at 80 C pending − ◦ RNA extraction. The 28 accessions selected for our study belong to 14 species. They were gathered in four groups in consideration of their parentage: (1) sweet orange and its hybrids, (2) citron and its hybrids, (3) other Citrus species, and (4) subgenus Papeda and related genera. From one to three negative controls (no anthocyanin pigmentation) for each tissue were also selected, depending on the variability of the pigmentation and the availability of the tissues and genotypes for each group. The main traits and the origins of the accessions are described in Table1. Genes 2020, 11, 807 4 of 30

GenesGenesGenesGenes 202020202020 2020 2020,,, , 11 1111, ,11 ,,11, , x xxx, , FOR FORx FORFORx FOR FOR PEER PEERPEERPEER PEER PEER REVIEW REVIEWREVIEWREVIEW REVIEW REVIEW 444 of 4ofof4 of of33 3333 33 33

Table 1. Tissues and species evaluated in the study. The origins of the species and the for each accession are reported, as well as the accession code used in the qRT-PCR data, the referencesTableTableTable andTable 1.1. the1. Tissues1.Tissues Tissues Tissues main andand and and traitsspeciesspecies species species characterizingevaluatedevaluated evaluated evaluated inin in inthe the the the study.study. study. study. each TheThe The The accession. originsorigins origins origins ofof of ofthe the the the Brightspeciesspecies species species andand greenandand thethe the the hybridhybrid hybrid boxeshybrid forforforfor for for are each eacheacheach each each used accession accessionaccessionaccession accession accession for are areareare negativeare are reported, reported,reported,reported, reported, reported, as as controls,asas as as well wellwellwell well well as asas as as the thethe the the bright accession accessionaccession accession accession red code codecode code code boxes used usedused used used in inin arein in the thethe the the qRT-used qRT-qRT- qRT- qRT- for anthocyanin-rich tissues. ThePCRPCRPCR correspondingPCR data,data, data,data, thethe thethe referencesreferences referencesreferences light andand andand green thethe thethe mainmain mainmain and traitstraits traitstraits light characterizingcharacterizingcharacterizingcharacterizing characterizingcharacterizing red boxes eacheacheacheach eacheach refer accession.accession.accession.accession. accession.accession. to unpigmented BrightBrightBrightBright BrightBright grgrgrgr greengreeneeneeneen boxesboxesboxes boxesboxes and areareare areare pigmented usedusedused usedused forforfor forfor negativenegativenegative negativenegative tissues controls,controls,controls, controls,controls, collected brightbrightbright brightbright redredred redred for boxesboxesboxes boxesboxes the areareare expressionareare usedusedused usedused forforfor forfor anthocyanin-anthocyanin-anthocyanin- anthocyanin-anthocyanin- analysis. richrichrichrichrich tissues. tissues.tissues. tissues. tissues. The TheThe The The corresponding correspondingcorresponding corresponding corresponding light lightlightlight light light green greengreengreen green green and andandand and and light lightlightlight light light red redredred red red boxes boxesboxesboxes boxes boxes refer referreferrefer refer refer to tototo to to unpigm unpigmunpigmunpigm unpigm unpigmentedentedentedentedented and andand and and pigmented pigmentedpigmented pigmented pigmented tiss tisstiss tiss tissuesuesuesues collectedcollected collected collected forfor for for thethe the the exex ex pressionexpressionpressionpression analysis.analysis. analysis. analysis. GreenGreen Green Green boxesboxes boxes boxes withwith with with asterisksasterisks asterisks asterisks # Green boxes with asterisks referreferrefer toreferreferrefer lycopene-rich tototo to to lycopene-richlycopene-richlycopene-rich lycopene-richlycopene-rich tissues.tissues. tissues. tissues.tissues. #### TheThe The#The# TheThe The pigmentationpigmentationpigmentationpigmentation pigmentationpigmentation pigmentation ofofofof of of S.S.S. S. S.distichadistichadisticha distichadisticha of fruitsfruitsfruitsfruitsS. fruitsfruits disticha couldcouldcouldcould couldcould bebebebe befruitsbe duedueduedue duedue totototo to tocould thethethethe thethe seedlingseedlingseedlingseedling seedlingseedling be due originoriginorigin originorigin to ofofof theof of thethethe thethe accessionseedlingaccessionaccession accessionaccession locatedlocatedlocated located originlocated ininin in in thethe ofthe thethe the‘Council‘Council‘Council ‘Council‘Council accession forforfor forfor AgriculturalAgriculturalAgricultural AgriculturalAgricultural located ResearchResearchResearch ResearchResearch in the ‘Council for Agricultural Researchandandandandand and Economics’ Economics’Economics’ Economics’Economics’ Economics’ bank bankbank bankbank germplasm. germplasm.germplasm. germplasm. bankgermplasm. germplasm.

SpeciesSpeciesSpeciesSpeciesSpecies & && & & AccessioAccessioAccessioAccessioAccessio ReferencReferencReferencReferencReferenc TissuesTissuesTissuesTissuesTissuesTissues Taxonomic Species &TaxonomicTaxonomicTaxonomicTaxonomicTaxonomic Classification ClassificationClassification Classification Classification Accession AccessionAccessionAccessionAccessionAccession MainMainMainMain TraitsTraits Traits Traits Accession HybridHybridHybridHybridHybrid Reference nnn Code CodenCoden Code Code Maineeee ee Traits YoungYoungYoungYoungYoung lea lealea lea ffleaf f ff PetalPetalPetalPetalPetalPetalPetal Style Style Style Style Style Style Style Stamen Stamen Stamen Stamen Stamen Stamen Stamen StigmaStigmaStigmaStigmaStigmaStigmaStigma Flesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/Juice RindRindRindRindRindRindRind Classification Hybrid Code TypicalTypicalTypicalTypicalTypical non- non-non- non- non- Young NavelNavelNavelNavelNavel NNN N N [27][27][27][27][27] Style Stamen Stigma Flesh / Juice Rind pigmentedpigmentedpigmentedpigmentedpigmented orange orangeorange orange orange Lycopene-richLycopene-richLycopene-richLycopene-richLycopene-rich and andand and and VanigliaVanigliaVanigliaVanigliaVaniglia sanguigno sanguignosanguigno sanguigno sanguigno VS VS VS VS VS [27] [27] [27] [27] [27] *** * ** Navel N [27] Typical non-pigmentedacidlessacidlessacidlessacidlessacidlessacidless orange fleshflesh fleshflesh flesh flesh Vaniglia HighlyHighlyHighly pigmentedpigmented pigmented VS [27] Lycopene-rich andHighly acidlessHighly pigmented pigmented flesh * sanguigno TaroccoTaroccoTaroccoTaroccoTarocco Lempso LempsoLempso Lempso Lempso TL TL TL TL TL [27] [27] [27] [27] [27] inininin theinthe theinthe the the rindrind rindrind rind rind andand andand and and less in the flesh Tarocco Highly pigmented inlessless thelesslessless inin in rind theinthe inthe the thefleshflesh flesh flesh andflesh C. reticulata x TL [27] HighlyHighlyHighlyHighlyHighly purple, purple,purple, purple, purple, C.C.C. C. reticulata reticulataC.reticulata reticulata reticulata x xxLempso (C. (C.x(C. x (C. (C.reticulata reticulatareticulata reticulata reticulata x xx x x TaroccoTaroccoTaroccoTaroccoTarocco Ippolito IppolitoIppolito Ippolito Ippolito TI TI TI TI TI less [27] [27] [27] in [27] [27] the fleshinternallyinternallyinternallyinternallyinternallyinternally andand andand and and (C. reticulata x C. sinensis C.C.C. C. sinensis sinensisC.sinensis sinensis sinensis Sweet oranges SweetSweetSweetSweetSweet C.C.C. C. maxima) maxima)C.maxima) Taroccomaxima) maxima) Highly purple, internallyexternallyexternallyexternallyexternallyexternallyexternally C. maxima) orangeorangeorangeorangeorange TI [27] Rind intensely & hybrids Ippolito and externallyRindRindRindRind intensely intensely intensely intensely ssss && &&ss & & red-colouredred-colouredred-colouredred-colouredred-colouredred-coloured atat atat at at hybridhybridhybridhybridhybrid Doppio DoppioDoppioDoppio sanguignosanguigno sanguigno Rind DS DS intenselyDS [27] [27] [27]red-coloured fullyfullyfullyfully maturity; maturity;maturity; maturity; at fully DSDoppioDoppio [sanguigno27 sanguigno] DS DS [27] [27] fullyfully maturity; maturity; ssss ss sanguigno maturity; flesh well-colouredfleshfleshfleshfleshfleshflesh well-well- well-well- well- well- coloured Highly pigmented, internallycolouredcolouredcolouredcolouredcoloured Moro M [27] HighlyHighlyHighlyHighlyHighly pigmented, pigmented,pigmented, pigmented, pigmented, MoroMoroMoroMoro MM M M and[27][27][27] externally[27] internallyinternallyinternallyinternallyinternallyinternally andand andand and and C. reticulata x Seedy fruits containingexternallyexternallyexternally three-timesexternallyexternallyexternally Mandarin-like Sunred S [28,29] C. sinensis more anthocyanins thanSeedySeedySeedySeedySeedy fruitsMoro fruitsfruits fruits fruits containingcontainingcontainingcontainingcontainingcontaining three-three- three-three- three- three- C.C.C. C. reticulata reticulataC.reticulata reticulata reticulataDiamante x xx C. C.xC. x C.sinensis sinensisC.sinensis sinensis sinensis Mandarin-likeMandarin-likeMandarin-likeMandarin-like CD SunredSunred [SunredSunred30] S S S S Typical[28,29][28,29][28,29][28,29] citron timestimestimestimestimestimes moremore moremore more more C. medica C. medica Buddha’s Fingered citron, purpleanthocyaninsanthocyaninsanthocyaninsanthocyaninsanthocyaninsanthocyanins flower thanthan thanthanbud than than MB [30] MoroMoroMoroMoro hand DiamanteDiamanteDiamanteDiamanteDiamante andCDCDCDCD CDpurple-tinted [30][30][30][30][30] openTypicalTypicalTypicalTypicalTypical flowers citron citroncitron citron citron Unknown Incomparabile Ancient origin describedFingeredFingeredFingeredFingered as citron, citron,hybridcitron, citron, C. medica FingeredFingered citron, citron, hybrid C.C.C. C. medica medicaC.medica medica medica C. C. C. C.medica medica C.medica medica medicaLI [31] purplepurplepurplepurplepurple flowerflower flower flower budbud bud bud parent lemon Buddha'sBuddha'sBuddha'sBuddha'sBuddha's hand handhand hand hand between MB MB MB MB MB sour [30] [30] [30] [30] [30] orange and citron and purple-tinted CitronCitronCitronCitronCitron Volkamer andandandandand purple-tintedpurple-tinted purple-tinted purple-tinted purple-tinted &&& its& itsits& its its CV [30] Used as rootstockopenopenopenopenopen flowersflowers flowers flowers directdirectdirectdirectdirect lemon AncientAncientAncientAncientAncient origin originorigin origin origin hybridhybridhybridhybridhybrid New lightly purple-tinted;describeddescribeddescribeddescribeddescribed as asas as as C. reticulata x ssss ss C.C.C. C. medica RangpurmedicaC.medica medica medica hybrid hybrid hybridhybridhybrid hybrid hybrid lime Unknown Unknown Unknown Unknown Unknown Unknown UnknownRaL parent parent parentparentparent parent parent In In In In Incomparabilecomparabile Incomparabilecomparabile Incomparabilecomparabile [30] lemonlemon lemonlemon lemon lemon LI LI LI LI LI LI [31] [31] [31] [31] [31] [31] hybridhybridhybridhybridhybrid between betweenbetween between between C. limonia flowers petals deeply purple-tinted C. medica soursoursoursoursoursour orangeorange orangeorange orange orange andand andand and and New shoots lightly purple-tinted;citroncitroncitroncitroncitroncitron Red Lime RL [30] Citron & its C.C.C. C. reticulata reticulataC.reticulata reticulata reticulata x xx C. C.xC. x C.medica medicaC.medica medica medica C. C. C. C.limonia limonia C.limonia limonia limonia VolkamerVolkamerVolkamerVolkamerVolkamer lemon lemonlemon lemon lemon flowers CV CV CV CV CV petals [30] [30] [30] deeply [30] [30] Used Used Used Used Used purple-tinted Used Used as as asasas as rootstock rootstock rootstockrootstockasrootstock rootstock rootstock direct hybrids Lima rossa New shoots lightly purple-tinted; LR [30] corrugata flowers petals deeply purple-tinted Non-pigmented flowers and Zagara bianca ZB [30] young leaves Femminello FA [30] Typical lemon Adamo C. aurantium x C. limon Also called ‘Variegated Pink C. medica Fleshed Eureka Lemon’; rind Pink fleshed PF [30] variegated in green and yellow, * * fading during the ripening; lycopene-rich flesh GenesGenesGenesGenes 202020202020 2020 2020,,, , 11 1111, ,11 ,,11, , x xxx, , FOR FORx FORFORx FOR FOR PEER PEERPEERPEER PEER PEER REVIEW REVIEWREVIEWREVIEW REVIEW REVIEW 444 of 4ofof4 of of33 3333 33 33

TableTableTableTable 1.1. 1. Tissues1.Tissues Tissues Tissues andand and and speciesspecies species species evaluatedevaluated evaluated evaluated inin in inthe the the the study.study. study. study. TheThe The The originsorigins origins origins ofof of ofthe the the the speciesspecies species species andand and and thethe the the hybridhybrid hybrid hybrid forforforfor for for each eacheacheach each each accession accessionaccessionaccession accession accession are areareare are are reported, reported,reported,reported, reported, reported, as asasas as as well wellwellwell well well as asas as as the thethe the the accession accessionaccession accession accession code codecode code code used usedused used used in inin in in the thethe the the qRT- qRT-qRT- qRT- qRT- Genes 2020, 11, 807 5 of 30 PCRPCRPCRPCR data,data, data,data, thethe thethe referencesreferences referencesreferences andand andand thethe thethe mainmain mainmain traitstraits traitstraits characterizingcharacterizingcharacterizingcharacterizing characterizingcharacterizing eacheacheacheach eacheach accession.accession.accession.accession. accession.accession. BrightBrightBrightBright BrightBright grgrgrgr greengreeneeneeneen boxesboxesboxes boxesboxes areareare areare usedusedused usedused forforfor forfor negativenegativenegative negativenegative controls,controls,controls, controls,controls, brightbrightbright brightbright redredred redred boxesboxesboxes boxesboxes areareare areare usedusedused usedused forforfor forfor anthocyanin-anthocyanin-anthocyanin- anthocyanin-anthocyanin- richrichrichrichrich tissues. tissues.tissues. tissues. tissues. The TheThe The The corresponding correspondingcorresponding corresponding corresponding light lightlightlight light light green greengreengreen green green and andandand and and light lightlightlight light light red redredred red red boxes boxesboxesboxes boxes boxes refer referreferrefer refer refer to tototo to to unpigm unpigmunpigmunpigm unpigm unpigmentedentedentedentedented and andand and and pigmented pigmentedpigmented pigmented pigmented tiss tisstiss tiss tissuesuesuesues collectedcollected collected collected forfor for for thethe the the exex ex pressionexpressionpressionpression analysis.analysis. analysis. analysis. GreenGreen Green Green boxesboxes boxes boxes withwith with with asterisksasterisks asterisks asterisks referreferreferreferrefer tototo to to lycopene-richlycopene-richlycopene-rich lycopene-richlycopene-rich tissues.tissues.tissues. tissues.tissues. #### TheThe The#The# TheThe pigmentationpigmentationpigmentationpigmentation pigmentationpigmentation ofofofof of of S.S.S. S. S.distichadistichadisticha distichadisticha fruitsfruitsfruitsfruits fruitsfruits couldcouldcouldcould couldcould bebebebe bebe duedueduedue duedue totototo to to thethethethe thethe seedlingseedlingseedlingseedling seedlingseedling originoriginorigin originorigin ofofof of of thethethe thethe accessionaccessionaccession accessionaccession locatedlocatedlocated locatedlocated ininin in in thethethe thethe ‘Council‘Council‘Council ‘Council‘Council forforfor forfor AgriculturalAgriculturalAgricultural AgriculturalAgricultural ResearchResearchResearch ResearchResearch andandandandand Economics’ Economics’Economics’ Economics’Economics’ bank bankbank bankbank germplasm. germplasm.germplasm. germplasm.germplasm. Table 1. Cont.

SpeciesSpeciesSpeciesSpeciesSpecies & && & & AccessioAccessioAccessioAccessioAccessio ReferencReferencReferencReferencReferenc TissuesTissuesTissuesTissuesTissuesTissues Taxonomic Species &TaxonomicTaxonomicTaxonomicTaxonomicTaxonomic Classification ClassificationClassification Classification Classification Accession AccessionAccessionAccessionAccessionAccession MainMainMainMain TraitsTraits Traits Traits Accession HybridHybridHybridHybridHybrid Reference nnn Code CodenCoden Code Code Maineeee ee Traits YoungYoungYoungYoungYoung lea lealea lea ffleaf f ff PetalPetalPetalPetalPetalPetalPetal Style Style Style Style Style Style Style Stamen Stamen Stamen Stamen Stamen Stamen Stamen StigmaStigmaStigmaStigmaStigmaStigmaStigma Flesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/JuiceFlesh/Juice RindRindRindRindRindRindRind Classification Hybrid Code TypicalTypicalTypicalTypicalTypical non- non-non- non- non- Young NavelNavelNavelNavelNavel NNN N N [27][27][27][27][27] Petal Style Stamen Stigma Flesh / Juice Rind pigmentedpigmentedpigmentedpigmentedpigmented orange orangeorange orange orange leaf Lycopene-richLycopene-richLycopene-richLycopene-richLycopene-rich and andand and and VanigliaVanigliaVanigliaVanigliaVaniglia sanguigno sanguignosanguigno sanguigno sanguigno Also VS VS VS called VS VS ’West [27] [27] [27] [27] [27] Indian lime’; new *** * ** Mexican lime acidlessacidlessacidlessacidlessacidlessacidless fleshflesh fleshflesh flesh flesh C. aurantifolia LMT [30] shoots, flower budsHighlyHighly andHighly pigmentedpigmented young pigmented Citron & its C. micrantha x (tornless) HighlyHighly pigmented pigmented TaroccoTaroccoTaroccoTaroccoTarocco Lempso LempsoLempso Lempso Lempso flowers TL TL TL TL TL faintly [27] [27] [27] [27] [27] purple-tintedinininin theinthe theinthe the the rindrind rindrind rind rind andand andand and and direct hybrids C. medica lesslesslesslesslessless inin inin theinthe theinthe the the fleshflesh fleshflesh flesh flesh Southwickù C. celebica CC [32] PapedocitrusHighlyHighlyHighlyHighlyHighly purple, purple,purple, purple, purple, C.C.C. C. reticulata reticulataC.reticulata reticulata reticulata xCRC2453 xx (C. (C.x(C. x (C. (C.reticulata reticulatareticulata reticulata reticulata x xx x x TaroccoTaroccoTaroccoTaroccoTarocco Ippolito IppolitoIppolito Ippolito Ippolito TI TI TI TI TI [27] [27] [27] [27] [27] internallyinternallyinternallyinternallyinternallyinternally andand andand and and C.C.C. C. sinensis sinensisC.sinensis sinensis sinensis (C. maxima x SweetSweetSweetSweetSweet C.C.C. C. maxima) maxima)C.maxima) maxima) maxima) externallyexternallyexternallyexternallyexternallyexternally orangeorangeorangeorangeorange Flowers and newRind intensely C. reticulata) x C. meyeri LM [30] RindRindRindRind intensely intensely intensely intensely ssss && &&ss & & purple-tintedred-colouredred-colouredred-colouredred-colouredred-colouredred-coloured atat atat at at Other Citrus C. medica hybridhybridhybridhybridhybrid DoppioDoppioDoppioDoppioDoppio sanguigno sanguignosanguigno sanguigno sanguigno DS DS DS DS DS [27] [27] [27] [27] [27] fullyfullyfullyfullyfullyfully maturity;maturity; maturity;maturity; maturity; maturity; species ssss ss Triploid; purple colorationfleshfleshfleshfleshfleshflesh well-well- well-well- usually well- well- C. limon x C. colouredcolouredcolouredcoloured C. latifolia Tahiti lime LT [30] faint and evanescentcoloured incoloured both aurantifolia (3n) HighlyHighlyHighlyHighlyHighly pigmented, pigmented,pigmented, pigmented, pigmented, MoroMoroMoroMoro MM M M flowers[27][27][27][27] and shootsinternallyinternallyinternallyinternallyinternallyinternally andand andand and and Microcitrus externallyexternallyexternallyexternallyexternallyexternally Seedy fruits australasica x SeedySeedySeedySeedy fruits fruits fruits fruits Citrus hybrid Faustrime MAF [30] Trigeneric hybridcontainingcontainingcontainingcontainingcontainingcontaining three-three- three-three- three- three- (Fortunella sp. x C.C.C. C. reticulata reticulataC.reticulata reticulata reticulata x xx C. C.xC. x C.sinensis sinensisC.sinensis sinensis sinensis Mandarin-likeMandarin-likeMandarin-likeMandarin-like SunredSunredSunredSunred S S S S [28,29][28,29][28,29][28,29] timestimestimestimestimestimes moremore moremore more more Citrus sp) anthocyaninsanthocyaninsanthocyaninsanthocyaninsanthocyaninsanthocyanins thanthan thanthan than than MoroMoroMoroMoro M. Red-pulped of the genus Microcitrus Sanguinea MASDiamanteDiamanteDiamanteDiamanteDiamante [30] CDCDCDCD CD [30][30][30][30][30] TypicalTypicalTypicalTypicalTypical citron citroncitron citron citron australasica Australian finger-limeFingeredFingeredFingeredFingeredFingered citron, citron,citron, citron, citron, C.C.C. C. medica medicaC.medica medica medica C. C. C. C.medica medica C.medica medica medica purplepurplepurplepurplepurple flower flowerflower flower flower bud budbud bud bud Buddha'sBuddha'sBuddha'sBuddha'sBuddha's hand handhand hand hand Australian MB MB MB MB MB origin; [30] [30] [30] [30] [30] ornamental uses; genus Murraya M. paniculataCitronCitronCitron - MP [30] andandandandand purple-tinted purple-tintedpurple-tinted purple-tinted purple-tinted * Subgenus CitronCitron and purple-tinted &&& its& itsits& its its orange-colouredopenopen berriesopenopenopen flowers flowersflowers flowers flowers Papeda and directdirectdirectdirectdirect Primitive Citrus, alsoAncientAncientAncientAncientAncient called origin originorigin origin origin other genera S.hybridhybridhybrid distichahybridhybrid - SD [30] ’Philippine Box Orange’;describeddescribeddescribeddescribeddescribed as asas as as sss s C. medica hybridhybrid Unknown Unknown parentparent In Incomparabile lemon LI [31] hybrid between s s C.C. C.medica C.medica medica medica hybridhybrid hybrid hybrid hybrid Unknown Unknown Unknown Unknown Unknown parentparent parent parent parent In In Incomparabilecomparabile Incomparabile Incomparabilecomparabile lemonlemon lemon lemon lemon yellowish-green LI LI LI LI LI [31] [31] [31] [31] [31] peel athybridhybridhybrid maturityhybrid between between between between (#) genus Severinia soursoursoursoursoursour orangeorange orangeorange orange orange andand andand and and Primitive Citrus, alsocitroncitroncitroncitron calledcitroncitron S. buxifolia C.C.C. C. reticulata reticulataC.reticulata reticulata reticulata x xx C. C.xC. x -C.medica medicaC.medica medica medica C. C. C. C.limonia limonia C.limonia limonia limonia SB VolkamerVolkamerVolkamerVolkamerVolkamer [30 lemon lemonlemon] lemon lemon ’Chinese CV CV CV CV CV box [30] [30]orange’; [30] [30] [30] Used Used Used Used Used black Used Used as as asasas as rootstock rootstock rootstockrootstockasrootstock berriesrootstock rootstock at maturity Typical “double” leaves with wide C. hystrix - CH [30] petioles; petals yellowish white or subgenus Papeda red-tinted Wild nonedible citrus species; C. latipes - CL [32] commonly called “Khasi papeda” Genes 2020, 11, 807 6 of 30 Genes 2020, 11, x FOR PEER REVIEW 5 of 33

Figure 1. Variability in the levels of anthocyanins in the tissues of the accessions used in this study. Figure 1. Variability in the levels of anthocyanins in the tissues of the accessions used in this study. These are combined into four groups as indicated in Table 1. For each group is presented a range of These are combined into four groups as indicated in Table1. For each group is presented a range of images of the most indicative accessions in terms of pigmentation in the young leaves, petals, stamens, images of the most indicative accessions in terms of pigmentation in the young leaves, petals, stamens, styles, stigmas, flesh, and rind. Unpigmented examples are also shown for all tissues. styles, stigmas, flesh, and rind. Unpigmented examples are also shown for all tissues.

2.2.2.2. Total Total RNA RNA Extraction Extraction and and Expression Expression Analysis Analysis TotalTotal RNA RNA was was extracted extracted from: from: (1) (1) 3 3 mLmL ofof filteredfiltered juice,juice, (2)(2) 22 g of rind and pulp (exclusively (exclusively for for M.M. australasica australasicaand andFaustrime Faustrime),), andand (3)(3) 100100 mgmg ofof youngyoung leaves,leaves, petals,petals, stamens, styles, styles, and and stigmas, stigmas, previouslypreviously homogenized homogenized for for 30 s30 at s 30 at rpm 30 usingrpm using the Tissuelyser the Tissuelyser II (Qiagen). II (Qiagen). One volume One ofvolume extraction of buextractionffer (0.2 Mbuffer TRIS (0.2 pH M TRIS 8.0, 0.2pH M8.0, NaCl, 0.2 M NaCl, 50 mM 50 mM EDTA, EDTA, 2% 2% (w /(w/v)v) SDS), SDS), one one volume volume of phenol, phenol, and 0.02 volume of β-mercaptoethanol were added to the sample. After incubation at 50 °C for 5 min, and 0.02 volume of β-mercaptoethanol were added to the sample. After incubation at 50 ◦C for samples were centrifuged at 4000 rpm at 4 °C for 15 min. Two cycles of centrifugation were carried 5 min, samples were centrifuged at 4000 rpm at 4 ◦C for 15 min. Two cycles of centrifugation were carriedout, adding out, adding to the toupper the upperaqueous aqueous phase phaseone volume one volume of chloroform:isoamyl of chloroform:isoamyl alcohol alcohol (24:1, v/v). (24:1, RNA v/v). RNAwas wasprecipitated, precipitated, adding adding one-half one-half volume volume of 6 M of LiCl 6 M to LiCl the to upper the upper phasephase at −20 at°C overnight.20 C overnight. After − ◦ Aftercentrifugation centrifugation at 8500 at rpm 8500 for rpm 40 min, for 40the min,precip theitated precipitated RNA was RNAwashed was with washed 70% (v/v) with ethanol 70% (vand/v) centrifuged at 7500 rpm for 20 min. The total RNA was resuspended in 50 μL of RNase-free water. ethanol and centrifuged at 7500 rpm for 20 min. The total RNA was resuspended in 50 µL of RNase-free The qualities and the quantities were evaluated using a Nanodrop 1000 spectrophotometer (Thermo

Genes 2020, 11, 807 7 of 30 water. The qualities and the quantities were evaluated using a Nanodrop 1000 spectrophotometer (Thermo Scientific) and by gel electrophoresis (agarose 0.8% in TAE 1 ). The quality was considered × optimal for values of 260/280 between 1.80 and 2.0. DNAse treatment was carried out by adding to 40 µL of RNA 1 of RNaseOUT Recombinant × Ribonuclease Inhibitor (Invitrogen), 0.1 M of DTT (Invitrogen), 5 Buffer, 1 of DNAse in a final × × volume of 50 µL. Samples were incubated at 37 ◦C for 30 min and purified using RNA Cleanup protocol (Qiagen), according to the manufacturer’s protocol. cDNA synthesis was carried out as previously described [12] using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) and specifically adding to 500 ng of RNA 1 RT Buffer, 4 mM of dNTPs, 1 RT Random Primers, × × 0.1 of MultiScribe Reverse Transcriptase, in a final volume of 20 µL. Thermal cycler conditions for × cDNA synthesis were: 10 min at 25 ◦C, 37 ◦C for 120 min, and 85 ◦C for 5 s. Relative quantification qRT-PCR was carried out using the ABI 7300 Real Time PCR System (Applied Biosystems). The PCR mixture (final volume, 15 µL) contained 7.5 µL Power SYBR Green PCR Master mix (Applied Biosystems), 0.1 mM of each gene-specific forward and reverse primer and 100 ng of the cDNA sample, according to the manufacturer’s protocol. The following standard thermal profile was used for all PCRs: 50 ◦C for 2 min, 95 ◦C for 10 min, 40 cycles of 95 ◦C for 15 s, and 60 ◦C for 1 min. Three technical replicates were assayed and a no-template negative control was routinely included in each plate. Data analyses were carried out using the standard curve method. For each gene of each tissue the calibrator was represented by the sample with the lowest ratio of ‘EF mean and gene mean’ and the qRT-PCR results are indicated as ‘mRNA fold-increase’ with respect to the calibrator.

2.3. Primer Design and Citrus Genome Support Primers were designed using Primer 3 software [33], preferably on coding sequences on the exon-exon junction. The presence of dimers was confirmed using the Oligo Analysis Tool [34]. The genes, coded by genome position, and their related primers are listed in Table2. The elongation factor 1 alpha (Cs8g16990) was used as a housekeeping gene to normalize the expression data.

Table 2. Characteristics of primers used for qRT-PCR analysis. Asterisks indicate that primers had been used previously (* [25]; ** [12]; *** [19]).

Gene Classification Gene Gene Position Sequence 50 30 Fw/Rev Amplicon (pb) AAGCTGGTATCTCCAAGGATGGT Fw Housekeeping EF * Cs8g16990 72 CCAAGGGTGAAAGCAAGCAA Rev Phenylpropanoid GGAAGCTCATGTTTGCCCAA Fw PAL Cs6g11950 118 pathway TCAGCGCCCTTGAAACCATA Rev CCAGGCTGATTATCCCGACT Fw CHS Cs2g14720 90 TTGTCACACATGCGCTTGAA Rev Early biosynthetic TCCAGGATCAACAAAGTCGCA Fw CHI Cs7g28130 95 genes ACACTCCTATCGCCGTGAAC Rev ATGGCTCCTTCAACCCTCAC Fw F3H Cs1g25280 86 ACCTTGGGACGCTCATCTTG Rev TGCGTGGAAGTTTGCTGAAG Fw DFR Cs3g25090 101 TGAGACTGGGTGGCATTGAC Rev Late biosynthetic CACTTGGCTTGGGACTGGAA Fw ANS Cs5g09970 114 genes CCAGTTCTGGTTGAGGGCAT Rev TGATCGGGAGGCCATTCTTT Fw UFGT Cs5g24820 99 TGCAAATCCCTCCACCATCT Rev Anthocyanins GGGACAGCTTCACATTGGC Fw GST Cs6g15900 73 vacuolization CCATTCCAGCTTCGTTCAT Rev AGCTGCTGGGCAACAGATGGT Fw CsRuby1 ** Cs6g17570 68 CTTCACATCGTTCGCTGTTC Rev Transcription factors CAGGAACCGGTTATGATAGGTAGC Fw Noemi *** Cs5g31400 80 TCTGGCGTCAATTCTTCTTCCGGTG Rev Genes 2020, 11, 807 8 of 30

To ensure the evaluation of genes corresponding as closely as possible to each accession, all primers were first designed on the C. sinensis genome [35]. Then a blast against NCBI Primer tool [36] was carried out to evaluate the conservation of the target sequence in species different from sweet orange. At the same time, the nucleotide sequence of each gene of sweet orange was searched, for homology against species deposited in the Citrus genome collection [37,38]. Specifically, we matched against the genomes of C. maxima, C. medica, C. reticulata, and S. buxifolia, representing the parents or the species themselves that we considered in the present study. Moreover, we also blasted against the C. ichangensis genome, a Papeda like C. hystrix and C. latipes. Finally, we also included the blast against Fortunella hindsii which is close enough to the Citrus species, although it belongs to another genus [39]. The CLC Sequence Viewer software [40] was used to carry out the nucleotide and aminoacidic ClustalW alignments of the genes and primers to individuate the perfect match or the eventual differences among species (Table S1 and Figure S2). The M. australasica genome (SRR6188442 SRA) was downloaded in FASTQ format using the “FASTQ-dump” tool of the SRA toolkit [41] from NCBI, with the option split-files to obtain two separate files for the paired-end data. The two files were trimmed by Trim Galore [42] and aligned on the C. maxima reference genome [37] by Stampy [43], which is able to map reads from highly divergent species to a reference genome. The hybrid mode Bwa/Stampy [43] was used to speed up the alignment. The file obtained was sorted and indexed by SAMtools [44]. After alignment, the depth and coverage were estimated by SAMtools. To produce a FASTA format of each gene investigated, the reads mapping on each gene model were extracted with SAMtools-view and the consensus was produced with SAMtools-mpileup, BCFtools-call [45], and the vcfutils.pl concatenate process [46].

2.4. Image Analysis of the Petals Photographs of the petals were taken against a green background under artificial light sources (Figure S3). As a reference for the size and color calibration, a yellow tag label was positioned close to the petals. The petals were arranged in rows, exhibiting the inner and the outer faces. Photographs were processed by Fiji distribution of ImageJ [47], and the binary images were obtained using SIOX segmentation [48]. The basic intensity quantification was done by analyzing particles as mean grey values of a 16-bit image converted to greyscale [49].

2.5. Statistical Analyses Correlations among gene expressions were evaluated as mRNA-fold increases for each tissue using the Pearson method and data were considered discriminant for p-values 0.05. ≤ A qualitative test was used to compare the significant differences between pigmented and non-pigmented samples for all tissues, except young leaves, stamens and styles because only one negative control was collected. The normal distribution of the expression data, based on the mRNA-fold increase values, was tested using the Shapiro-Wilk method [50]. The means of the normally distributed samples was compared by t-test, while the samples that were not normally distributed were tested using the Wilcoxon signed-rank test [51]. Two different Ward hierarchical clustering analyses with bootstrapped p-values were applied to all genes and all accessions evaluated for each tissue, except for the stamens, styles, and stigmas because of the small number of accessions (from 4 to 6). The analyses were done using the default setting by ‘pvclust’ R package [52]. Principal component analysis (PCA) was carried out on all genes and the accessions of all tissues (except for the stamens, styles, and stigmas) by the ‘prcomp’ function [53]. Partial least square regression (PLS) was carried out on all the genes of the accessions, where petals were analyzed by the ‘plsr’ function of ‘the pls’ package [54] and validated using the leaving one out ‘LOO’ method. The graphics were plotted using the ‘ggplot2’ package [55]. Social network analysis was carried out and plotted using ‘d3Network’ [56] and ‘igraph’ [57]. All statistical analyses were carried out in R ambience [58]. Genes 2020, 11, 807 9 of 30

2.6. Anthocyanin and Lycopene Quantification Anthocyanin quantification was carried out spectrophotometrically at 520 nm of absorbance (Varian UV-Vis spectrophotometer mod. Cary 100 Scan) according to the differential pH method [59]. Volumesof 2 mL of centrifuged juice (13,000 rpm for 40 min) were used for sweet oranges, while volumes of 4 mL of methanolic extract were used for the flesh of M. australasica. Methanolic extracts were obtained by adding 2 g of M. australasica flesh to 50 mL of 80% acidified methanol (0.5% HCl), stored under agitation in the dark for 3 h, and then centrifuged at 8000 rpm for 40 min. Total anthocyanins were expressed as milligrams per liter (mg/L) of cyanidin 3 glucoside. Lycopene quantification was carried out spectrophotometrically at 503 nm of absorbance [60] by extracting carotenoid pigments [61] with 25 mL of hexane/acetone/ethanol solution mixed with 3 g of M. australasica flesh and, similarly, with 20 mL of hexane/acetone/ethanol solution (50:25:25) mixed with 10 mL of orange juice. Lycopene content, expressed in milligrams per liter (mg/L), was determined 1% using the molar extinction coefficient of E 1 cm = 3450 [62].

3. Results and Discussion

3.1. Genome Data Support the Variability and Specificity of the Expression Analysis The genomes of all accessions considered here are not totally or publicly available. The M. paniculata genome has been released but is not yet available (Unpublished data-“CREA-OFA jointly IGA-TS De novo sequencing of M. paniculata-ORPRAMed project”). The genome of M. australasica is available but it has been aligned against the C. maxima genome resulting in an average coverage of 38 , × covering 269 Mb of the total 302 Mb of the reference genome. Generally, we observed that anthocyanin biosynthesis is highly conserved in all the species we considered. This finding is supported by the high sequence homology for all structural genes. Two considerations deserve mention: the first relates to M. paniculata and S. buxifolia, in which the primers worked correctly, even though very few nucleotidic and aminoacidic mutations were reported in the primer(s); the second relates to genes with null expressions even though no mutations were reported in the primer sequences. Murraya spp. is known for its ornamental value (specifically M. paniculata and M. ovatifoliolata) and for the uses of their leaves as (M. koeniji). From a phylogenetic point of view, the relationship between the Murraya and Citrus genera is controversial, even though the Murraya genus is considered quite distant from Citrus. Recently some authors [63,64] have indicated that M. paniculata is more closely related to Citrus than previously thought. However, this suggestion has not yet been fully accepted [65]. This is the first time in which red fruits have been evaluated and genetically characterized for the presumed presence of anthocyanins. Except for PAL, which was perfectly conserved (100% homology), the other genes showed some mutations that did not affect their aminoacidic sequences (such as CHS, DFR, and ANS) and some others (such as UFGT, GST, Ruby and Noemi) showed longer mismatches that compromised not only the synthesis of anthocyanins but also their accumulation and the regulation (Table S1, Figure S2). The expression of GST was completely null (see later), and Ruby was not found in the M. paniculata genome. This leads us to hypothesize that the brilliant red color of the fruit may not be due to anthocyanins [30], as also reported in Table S2. Previous phytochemical studies reported that fruits of M. paniculata contain coumarin and coumurrayin [66], in addition to polymethoxylated flavones, flavonols, and flavanonols [67]. Severinia buxifolia and S. disticha represent unusual accessions, because S. disticha, in particular, accumulates anthocyanins in both mature fruits and young leaves [30] differently from the other citrus accessions. Although most of the structural genes (except ANS) showed from one to three nucleotide substitutions in the primer binding regions (but not in any case modifying the amino acid sequence), the anthocyanin pathway was fully conserved, as demonstrated by the purple pigmentations in the young leaves and in the fruit. The peculiarity of S. buxifolia is associated with the unusual control of anthocyanins, being due to Ruby2 [4] instead of to Ruby. Nucleotidic substitutions inducing differences Genes 2020, 11, 807 10 of 30 in the aminoacidic sequences were found in the Noemi gene, although they did not interfere with gene expression, which was the greatest in the rind. Moreover, the nucleotide and amino acid substitutions were the same as those observed in citron, pummelo, M. australasica, and C. ichangensis, demonstrating very close conservation (Table S1 and Figure S2). The second consideration regards the null expression of Ruby in the young purple leaves of both , i.e., ‘Diamante’ and ‘Buddha’s hand’, and for M. australasica, despite the perfect match of the primers. We speculate that the pigmentation of the leaves of these genotypes is not under the control of Ruby. In contrast, the null expression of Ruby in the white petals of ‘Zagara bianca’ could be due to the loss of function of Ruby itself, since Ruby is transcriptionally active in lemons with purple flowers. Lastly, the missing expression of Noemi in the pigmented leaves of C. celebica and M. australasica, such as in the purple petals of ‘Incomparabile’ and ‘Red lime’, could be attributed to the fact that Noemi co-works with Ruby in the flesh [19], but probably not in the other pigmented tissues, as reported in other [44,45]. The missing expression of Noemi in the low-acid flesh of ‘Vaniglia sanguigno’ confirms its role as the gene responsible for the loss of acidity [19]. The primers of Noemi were specifically designed in the region that has been deleted in the low acid accessions.

3.2. Anthocyanin Pigmentation Is an Extremely Variable Trait among Citrus Species and Tissues The understanding of how gene expression patterns can change among tissues and during evolution is an important question that involves both developmental and evolutionary biology [68]. Pigmentation represents an attractive model for such studies, changes in color being easy to score visually, and providing a genetic network under the control of external factors [69–71]. In plants, the R2R3-MYBs play a central role in regulating the spatio-temporal expression pattern of the genes involved in synthesis and accumulation of pigments, such as anthocyanins [72], condensed tannins [73], betalains [74], and copigment flavonols [75], which are the main players in determining pigmentation patterns. In a present study, we investigated the tissue-specificity of anthocyanin pigmentation in a range of samples belonging to several species and hybrids. In modern and ancient Citrus, the genetic control of pigmentation is variously inherited, depending on the tissue. Pigmentation is also influenced by environmental factors, such as light [15], cold [12], and cultural practices [14,76]. To reduce the influence of such effects, which might upset inter-comparison among samples, all accessions were sampled from the same germplasm bank. Nevertheless, we cannot exclude the possibility that a part of the observed variability could be typical of our environment and so might not be evident in other citrus growing areas.

3.2.1. The Pigmentation of Young Leaves Was Inherited from Citron In the leaves of some plant species, anthocyanins are expressed throughout development (reviewed in [6]). In other species the pigments are expressed only in the early stages, disappearing later as development proceeds [77–79]. Meanwhile, in other species, pigmentation is specific to the later stages of leaf senescence (for woody perennials see [80], for herbaceous species see [6]). Many researchers have explored the possible functional role(s) of anthocyanins in leaves, seeking to explain the molecular mechanisms controlling this phenomenon. None of the hypotheses offered provide a unified explanation for the diverse range of environmental triggers, or for the variability in pigment location and expression in particular stages of development [81,82]. In Citrus and related genera, the purple pigmentation of the leaves typically characterizes the early status of development while the red coloration of large adult leaves generally decreases, eventually disappearing. The expression data indicate that most EBGs do not usually show differences between pigmented and non-pigmented samples (Figure2). Nevertheless, the strategic role of F3H in regulating pigmentation is confirmed, as has also been reported in bilberry [83]. Among the LBGs, UFGT and GST represent genes with higher correspondence between expression and pigmentation (Figure2). ‘Zagara bianca’ is the negative control and, at the same time, also serves as the calibrator of expression Genes 2020, 11, 807 11 of 30 analysis. All genes belonging to phenylpropanoid and anthocyanins biosynthesis and accumulation, help to explain the variability among accessions. From a functional point of view, UFGT represents the last gene of the biosynthesis, which induces anthocyanins to be synthesized in the cytosol, then conjugates these with glutathione and transfers them to the vacuole where the anthocyanins Genes 2020, 11, x FOR PEER REVIEW 11 of 33 are accumulated. In citrus, as in other plants, the role played by of anthocyanins in the leaf vacuoles remains obscure.

Figure 2. qRT-PCR expression data for all structural Early Biosynthetic Genes (EBGs)and Late Biosynthetic Genes (LBGs) and Transcription Factors (TFs) separated from young leaves. Figure 2. qRT-PCR expression data for all structural Early Biosynthetic Genes (EBGs) and Late The expression levels were calculated as the mRNA fold increase. Each accession is indicated by a code: Biosynthetic Genes (LBGs) and Transcription Factors (TFs) separated from young leaves. The ‘Zagara bianca’—ZB, ‘Red lime’—RL, ‘ lime’—RaL, ‘Incomparabile’—LI, ‘Pink fleshed’—PF, expression levels were calculated as the mRNA fold increase. Each accession is indicated by a code: Citrus latipes—CL, ‘Tahiti’—LT, C. volkameriana—CV, C. hystrix—CH, ‘Mexican lime’—LMT, ‘Lima rossa ‘Zagara bianca’—ZB, ‘Red lime’—RL, ‘Rangpur lime’—RaL, ‘Incomparabile’—LI, ‘Pink fleshed’—PF, corrugata’—LR, C. celebica—CC, ‘Buddha’s hand’—MB, M. australasica var. sanguinea—MAS, Citrus latipes—CL, ‘Tahiti’—LT, C. volkameriana—CV, C. hystrix—CH, ‘Mexican lime’—LMT, ‘Lima ‘Diamante’—CD, ‘Meyer’—LM, ‘Femminello Adamo’—FA. rossa corrugata’—LR, C. celebica—CC, ‘Buddha’s hand’—MB, M. australasica var. sanguinea—MAS, ‘Diamante’—CD,In our study, around ‘Meyer’—LM 85% of, ‘Femminello the variance Adamo’—FA. in the pigmentation of young leaves is explained by two main components (Figure3a). Pure citrons, i.e., ‘Buddha’s hand’ and ‘Diamante’, are separated from all the other accessions, even though they are close to citron hybrids, including the lemon group. Among these accessions ‘Femminello Adamo’ is clearly separated from the rest of the lemons because it represents the only true lemon considered in the present work, as characterized by pigmented young leaves and flowers and by an acidic juice [84]. The other lemons we considered were somatic mutations with clear phenotypic differences. Specifically, ‘Zagara bianca’ is characterized by non-pigmented leaves and petals, and ‘Pink fleshed’ which accumulates lycopene in the flesh and produces variegated fruits and leaves.

Genes 2020, 11, 807 12 of 30 Genes 2020, 11, x FOR PEER REVIEW 12 of 33

FigureFigure 3. 3.Statistical Statistical analysesanalyses carriedcarried outouton on accessions accessions characterized characterizedby by the the pigmentation pigmentation of of young young leaves.leaves. ( a(a)) Principal Principal component component analysis; analysis; cluster cluster dendrograms dendrograms based based on on the the distribution distribution of of expression expression datadata focusing focusing on on ( b(b)) accessions accessions and and ( c()c) genes genes where where AU AU refers refers to to Approximately Approximately Unbiased Unbiasedp -valuep-value andand BP BP is is for for Bootstrap Bootstrap Probability Probability value. value. Each Each accession accession is is indicated indicated by by a a code: code: ‘Zagara‘Zagara bianca’—ZB,bianca’—ZB, ‘Red‘Red lime’—RL, lime’—RL, ‘Rangpur ‘Rangpur lime’—RaL, lime’—RaL, ‘Incomparabile’—LI, ‘Incomparabile’—LI, ‘Pink‘Pink fleshed’—PF,fleshed’—PF,Citrus Citrus latipeslatipes—CL,—CL, ‘Tahiti’—LT,‘Tahiti’—LT,C. C. volkameriana volkameriana—CV,—CV,C._hystrix C._hystrix—CH,—CH, ‘Mexican ‘Mexican lime’—LMT, lime’—LMT, ‘Lima ‘Lima rossa rossa corrugata’—LR, corrugata’— C.LR, celebica C. celebica—CC,—CC, ‘Buddha’s ‘Buddha’s hand’—MB, hand’—MB,M. M. australasica australasicavar. var. sanguinea—MAS, sanguinea—MAS, ‘Diamante’—CD, ‘Diamante’—CD, ‘Meyer’—LM,‘Meyer’—LM, ‘Femminello ‘Femminello Adamo’—FA. Adamo’—FA.

TheThe PCA PCA showsshows thatthat ‘Meyer’‘Meyer’ isis thethe accessionaccession thatthat divergesdiverges mostmost fromfrom thethe othersothers (Figure(Figure3 a,b).3a,b). Presumably,Presumably, this this is is due due to to the the very very high high expression expression levels levels of of some some of of the the structural structural genes genes (such (suchas as PAL,PAL, F3H, F3H, DFR, DFR, ANS, ANS, and and UFGT; UFGT; Figure Figure2), as2), alsoas also emphasized emphasized in the in clusterthe cluster dendrogram dendrogram (Figure (Figure3c). We3c). hypothesize We hypothesize that thethat divergence the divergence of ‘Meyer’ of ‘Meyer’ can be ca tracedn be traced back back to its to origin, its origin, considering considering that itthat is theit is only the accession only accession that has thatC. maxima has C.as maxima a parent as [ 84a ].parent There [84]. are a numberThere are of nucleotidea number substitutionsof nucleotide alongsubstitutions the sequences along ofthe the sequences genes we of considered, the genesthough we considered, these do notthough lie within these thedo primernot lie sequences.within the primerThe sequences. regulatory genes Ruby and Noemi induce a divergence between ‘Mexican lime’ and ‘LimaThe regulatory rossa corrugata’, genes Ruby on theand one Noemi hand, induce and ‘Buddha’sa divergence hand’ between and ‘Diamante’‘Mexican lime’ on and the other‘Lima (Figurerossa corrugata’,3a,b). The expression on the one levels hand, of and first ‘Buddha’s two accessions hand’ are and very ‘Diamante’ high (a 60,000-fold on the other increase (Figure for Ruby 3a,b). andThe a expression 1700-fold increaselevels of forfirst Noemi) two accessions (Figure2 are). Previous very high studies (a 60,000-fold have suggested increase thatfor Ruby ‘Mexican and a lime’ 1700- isfold a direct increase hybrid for Noemi) of citron (Figure and C. 2). micrantha Previous[ 84studie–86].s have This issuggested the only that accession ‘Mexican with lime’ both is parents a direct beinghybrid characterized of citron and as havingC. micrantha purple [84–86]. leaves, This likely is explaining the only theaccession extreme with separation both parents from otherbeing accessions.characterized Moreover, as having Ruby purple is correlated leaves, likely only explai withning Noemi the andextreme Noemi separation is negatively from other correlated accessions. with GSTMoreover, (Table S3),Ruby leading is correlated us to hypothesize only with Noemi that the an accumulationd Noemi is negatively of anthocyanins correlated in the with young GST leaves(Table isS3), not leading under us the to direct hypothesize control that of Rubythe accumulation and Noemi. of This anthocyanins interpretation in the isyoung also supportedleaves is not by under the expressionthe direct incontrol ‘Zagara of Ruby bianca’ and and Noemi. by the This lack ofinterp expressionretation inis citronsalso supported and M. australasica by the expression(Figure2 ).in Ruby‘Zagara is knownbianca’ and to be by cold-dependent the lack of expression [12]. Inin citrons contrast, and the M. leaf australasica pigmentation (Figure in 2).Citrus Ruby isrequires known furtherto be cold-dependent investigation, with [12]. the In availablecontrast, the evidence leaf pigmentation suggesting this in Citrus trait is requires independent further of investigation, temperature. Thewith young the available leaves of evidence all the accessions suggesting we this evaluated trait is independent are typically purpleof temperature. during the The vegetative young leaves season, of whichall the is accessions in springtime. we Asevaluated also reported are typically in peach, purple we cannot during exclude the vegetative the possibility season, that which a different is in MYB-likespringtime. could As bealso responsible reported forin peach, regulating we cannot anthocyanin exclude accumulation the possibility in vegetative that a different organs, MYB-like such as leavescould [be82 ].responsible Phenotypic for observations regulating anthocyanin show that, amongaccumulation the four in true vegeCitrustative (pummelo,organs, such mandarin, as leaves [82]. Phenotypic observations show that, among the four true Citrus (pummelo, mandarin, citron, and C. micrantha), only those species with citron and C. micrantha as parents are characterized by

Genes 2020, 11, 807 13 of 30 citron, and C. micrantha), only those species with citron and C. micrantha as parents are characterized by purple young leaves, not considering their related genera. We suggest that species-specific transcription factors could be responsible for the inheritance of the trait for purple pigmentation in the young leaves. Such is demonstrated for the strategic role of Ruby2 exclusively in the leaves of S. buxifolia but not in its (purple) fruit [4]. In Rosaceae it has been clearly demonstrated that MYB I is mainly responsible for anthocyanin accumulation in the fruits, while MYB II regulates anthocyanin accumulation in the leaves [82].

3.2.2. The Molecular Mechanism Controlling the Pigmentation of Petals in Citrus Is Deeply Articulated and Unusual In Citrus, the anthocyanin pigmentations of young leaves and of petals generally characterize the same species. Indeed, it is unusual to find accessions with purple young leaves and white flowers, or vice versa. Despite this, our expression analyses in association with image analyses, indicate that the pigmentation of petals is under the control of a complex genetic machine. By browsing our expression results for petals, no differences are observed between pigmented accessions and ‘Zagara bianca’ (Figure4). Even though the purple petals of ‘ C. celebica’ represent the sample with the highest expression of PAL. ‘Zagara bianca’, whose petals are completely white, show an expression level 47-fold higher than of the purple petalled ‘Incomparabile’. Similarly, the EBGs are not much different between the pigmented and non-pigmented samples. In fact, for CHS, CHI and F3H, although more highly expressed in C. celebica than in ‘Zagara Bianca’ (about a 45-fold difference), F3H is still highly expressed in comparison with several of the pigmented accessions. Surprisingly, the LBG expressions are not very different between pigmented and non-pigmented samples. About 78% of the total variance among samples is attributed to the two main components (Figure5a), also showing a large divergence for C. celebica (Figure5b). This could be due to the higher expressions of DFR, ANS, and GST compared to the other accessions (the fold increases are 240,000, 93,000 and 1900 mRNA, respectively) (Figure4) supported by their high correlations (Table S3) and to divergence with respect to the other genes (Figure5c). The exclusivity of C. celebica can be ascribed to its origins: C. celebica derives from C. micrantha (similar to ‘Mexican lime’), even though it is sited in the opposite direction (Figure5a), confirming a previous report [ 86]. Grayscale image analysis of the petals reveals the highest value of color intensity is 171, for ‘Zagara bianca’, the whitest among the accessions. The darkest petals are those of ‘Incomparabile’, recording a relative color intensity value of 81 (Figure6a). The other accession values decreased gradually between these maximum and the minimum values of the range. Surprisingly, petal color intensity does not show a significant direct relationship with the expression data. To better investigate this, two different approaches were used, namely PLS (Figure6b) and social network analysis (Figure6c). During the development of the PLS model, four accessions appeared as outliers—the negative control ‘Zagara bianca’ and three of the pigmented samples, ‘Diamante’, ‘Red lime’, and ‘Lima rossa corrugata’. The exclusion of these accessions from the dataset allowed the construction of a simple model for predicting color intensity. This is represented by the PLS validation plot (Figure6b). The graph shows the comparison between the intensity calculated through image analysis (abscissa) vs. the intensity predicted by the PLS analysis (ordinate). The input data for this are the expression values just for the first two components, which explain 57% of the intensity variance (Table S4). We cannot exclude the possibility that the unexplained variance may be due to the thickness of the petals of all the species. These covered a wide range of thickness values and were also different in size, which could also reduce the sensitivity of the analysis. Using the subset defined in the PLS, a social network analysis was set up (Figure6c), which emphasizes the relationship between petal intensity and the expressions of the CHI, CHS and F3H genes. These results are consistent with the weights that the expressions of these genes had in the PLS model (Table S4). In the paired t-test (Table S5), CHI, CHS, and F3H did not show differences between the pigmented and non-pigmented Genes 2020, 11, 807 14 of 30 samples. The social network analysis indicates that the fine regulation of anthocyanins accumulation in petals seems to be modulated by these three genes. Focusing on the transcription factors, Ruby and Noemi showed significant differences in expression between pigmented and non-pigmented petals (Table S5). Nevertheless, as evidenced in the statistical analyses (Pearson’s correlation, Table S3; PLS and network analyses—Figure6b,c), Ruby alone cannot be considered the transcription factor controlling the pigmentation in petals. For example, in petunia flowers, the pigmentation of petals is under the control of a complex machinery, including also ATPases required for vacuolar hyperacidification linked with the pH of petals [87–90], in addition to R2R3-MYB, that together govern anthocyanin synthesis under a range of spatio-temporal circumstances [91,92]. For Noemi, the importance of ion exchange and the role of vacuolar ATPase in petals are well known [93]. Therefore, we cannot exclude the possibility that a tissue-specific ATPase works together withGenes 2020 Noemi, 11, x and FOR RubyPEER REVIEW to regulate the variability in anthocyanin pigmentation. This possibility14 of is33 currently being evaluated.

Figure 4. The qRT-PCR expression data of all structural genes: Early Biosynthetic Genes (EBGs), Late Biosynthetic Genes (LBGs) and Transcription Factors (TFs) analyzed in petals. Figure 4. The qRT-PCR expression data of all structural genes: Early Biosynthetic Genes (EBGs), Late The expression levels are calculated as the mRNA fold increase. Each accession is indicated by code: Biosynthetic Genes (LBGs) and Transcription Factors (TFs) analyzed in petals. The expression levels ‘Lima rossa corrugata’—LR, ‘Incomparabile’—LI, ‘Femminello Adamo’—FA, ‘Zagara bianca’—ZB, are calculated as the mRNA fold increase. Each accession is indicated by code: ‘Lima rossa ‘Rangpur lime’—RaL, ‘Meyer’—LM, ‘Mexican lime’—LMT, ‘Diamante’—CD, C. volkameriana—CV, corrugata’—LR, ‘Incomparabile’—LI, ‘Femminello Adamo’—FA, ‘Zagara bianca’—ZB, ‘Rangpur M. australasica var. sanguinea—MAS, ‘Tahiti’—LT, ‘Red lime’—RL, Citrus latipes—CL, ‘Pink fleshed’—PF, lime’—RaL, ‘Meyer’—LM, ‘Mexican lime’—LMT, ‘Diamante’—CD, C. volkameriana—CV, M. ‘Buddha’s hand’—MB, C. celebica—CC. australasica var. sanguinea—MAS, ‘Tahiti’—LT, ‘Red lime’—RL, Citrus latipes—CL, ‘Pink fleshed’— PF, ‘Buddha’s hand’—MB, C. celebica—CC.

Genes 2020, 11, 807 15 of 30 Genes 2020, 11, x FOR PEER REVIEW 15 of 33

FigureFigure 5.5. StatisticalStatistical analyses analyses carried carried out out on on accessio accessionsns selected selected for for their their petal petal pigmentation. pigmentation. (a) (Principala) Principal components components analysis; analysis; cluster cluster dendrogr dendrogramsams based based on on the the distributions ofof expressionsexpressions focusedfocused on on (b (b) )accessions accessions and and on (c on) genes (c) geneswhere whereAU refers AU to refersApproximately to Approximately Unbiased p-value Unbiased and pBP-value is for andBootstrap BP is Probability for Bootstrap value. ProbabilityEach accession value. is indicated Each accession by code: ‘Lima is indicated rossa corrugata’— by code: ‘LimaLR, ‘Incomparabile’—LI, rossa corrugata’—LR, ‘Femminello ‘Incomparabile’—LI, Adamo’—F ‘FemminelloA, ‘Zagara Adamo’—FA,bianca’—ZB, ‘Rangpur ‘Zagara bianca’—ZB, lime’—RaL, ‘Rangpur‘Meyer’—LM, lime’—RaL, ‘Mexican ‘Meyer’—LM, lime’—LMT, ‘Mexican ‘Diamante’—CD, lime’—LMT, C. ‘Diamante’—CD,volkameriana—CV,C. M. volkameriana australasica—CV, var. M.sanguinea—MAS, australasica var. sanguinea—MAS, ‘Tahiti’—LT, ‘Red ‘Tahiti’—LT, lime’—RL, ‘Red Citrus lime’—RL, latipes—CL,Citrus ‘Pink latipes —CL,fleshed’—PF, ‘Pink fleshed’—PF, ‘Buddha’s ‘Buddha’shand’—MB, hand’—MB, C. celebica—CC.C. celebica —CC.

3.2.3.Surprisingly, The Pigmentation petal of color the Rind intensity Is Independent does not ofshow the Genetic a significant Basis of direct the Parents relationship and Isunder with thethe Control Mainly of External Factors and Fruit Developmental Stage expression data. To better investigate this, two different approaches were used, namely PLS (Figure 6b) Theand pigmentationsocial network of theanalysis fruits of(FigureCitrus and6c). relatedDuring genera the development is very variable, of consideringthe PLS model, that either four oraccessions neither or appeared both the rindas outliers—the and the flesh negative can be pigmented.control ‘Zagara Additionally, bianca’ and many three factors of the can pigmented influence thesamples, pigmentation ‘Diamante’, including ‘Red lime’, low temperature, and ‘Lima rossa exposure corrugata’. to light The and exclusion stage of development of these accessions [10,14]. from the Thedataset samples allowed in our the study construction embrace a wideof a rangesimple of model variation for in predicting fruit pigmentation color intensity. across a numberThis is ofrepresented species, including by the PLS of sweet validation oranges, plot mandarin (Figure types,6b). The several graph hybrids shows ofthe citron, comparison also including between other the generaintensity such calculated as Microcitrus through, Murraya image, analysis and Severinia (abscissa)(Table vs.1). the intensity predicted by the PLS analysis (ordinate).The expression The input data data show for this that, are as the with expressi other tissues,on values PAL just is for not the expressed first two di components,fferentially among which samplesexplain (Figure57% of7 ).the Indeed, intensity ‘Navel’ variance showed (Table an expressionS4). We cannot level comparableexclude the to possibility ‘Tarocco Lempso’that the (aboutunexplained a 31-fold variance increase) may which be due is deeply to the pigmentedthickness of [14 the] and petals the expressionof all the species. in ‘Faustrime’ These covered is similar a towide that range in ‘Doppio of thickness sanguigno’—the values and firstwere not also at different all pigmented in size, but which the second could also is very reduce much the pigmented. sensitivity Amongof the analysis. EBGs, the Using CHS the in M.subset paniculata definedand in ‘Faustrime’the PLS, a social is highly network expressed analysis compared was setto up in (FigureS. disticha 6c),, S.which buxifolia emphasizes, ‘Sunred’, the and relationship ‘Moro’, which between are petal the accessions intensity and showing the expressions high pigmentation of the CHI, in CHS the rind. and Similarly,F3H genes. F3H These did notresults reveal are anyconsistent interesting with di thefferences weights between that the the expressions pigmented of and these non-pigmented genes had in samples.the PLS model A completely (Table S4). di Inff erentthe paired trend t-test and (Table expression S5), CHI, levels CHS, characterize and F3H did the not LBGs, show strategically differences involvedbetween the in thepigmented control ofand the non-pigmented pigmentation samples. of the rind. The social For example, network theanalysis expression indicates of DFRthat the in M.fine australasica regulation, with of anthoc highlyyanins pigmented accumulation rind, is the in petals highest seems with to a 2.5 be million-foldmodulated by increased these three expression genes. level. Similarly, the expression of UFGT, the last enzyme of the phenylpropanoid biosynthesis, showed around a 6 million-fold increase in expression in M. australasica compared to M. paniculata,

Genes 2020, 11, 807 16 of 30

the accession with the lowest expression of UFGT in the rind. Additionally, very interesting are the expressions of GST, Ruby and Noemi, these being highly and exclusively expressed in the pigmented samples, compared with the negative controls. Generally, we can assume that the rind pigmentation is under the control of DFR, ANS, GST, Ruby and Noemi, as also shown in the t-test analysis (Table S5). These presumably represent the major genes determining rind pigmentation. The expression patterns of Ruby and Noemi mirrored the differences between the pigmented and non-pigmented samples. InGenes terms 2020, of 11 the, x FOR values PEER of REVIEW the mRNA fold increase, they were higher for Ruby than for Noemi. 16 of 33

Figure 6. StatisticalStatistical analyses analyses of ofthe the quantitative quantitative trait trait of anthocyanins of anthocyanins accumulation accumulation in petals. in petals. The Theaccessions accessions are areindicated indicated with with code codes:s: ‘Incomparabile’—LI, ‘Incomparabile’—LI, ‘Meyer’—LM, ‘Meyer’—LM, M.M. australasica australasica var.var. sanguineaMAS, ‘Femminello Adamo’—FA, ‘Mexican‘Mexican lime’—LMT, ‘Rangpur‘Rangpur lime’—RaL,lime’—RaL, ‘Buddha’s‘Buddha’s hand’—MB, C. volkameriana —CV, Citrus latipes —CL, ‘Pink fleshed’—PF, fleshed’—PF, C.C. celebica celebica—CC,—CC, ‘Tahiti’—LT, ‘Tahiti’—LT, ‘Lima‘Lima rossarossa corrugata’—LR,corrugata’—LR, ‘Red‘Red lime’—RL,lime’—RL, ‘Diamante’—CD,‘Diamante’—CD, ‘Zagara‘Zagara bianca’—ZB.bianca’—ZB. (a) Bar plotplot ofof petalpetal colorcolor intensityintensity measured measured by by image image analysis analysis on on petals petals as as the the intensity intensity in grayscalein grayscale (whitest (whitest has has the highestthe highest value) value) reported reported for for each each accession. accession. (b ()b Validation) Validation plot plot of of the the partial partial least least squaresquare regressionregression (PLS)(PLS) modelmodel forfor petalpetal pigmentations.pigmentations. Values measuredmeasured byby imageimage analysisanalysis ofof petalspetals versusversus predictedpredicted values from genegene expressionexpression usingusing thethe firstfirst twotwo componentscomponents ofof thethe model.model. (c) TheThe networknetwork ofof genegene expressions inin petals involved in pigmentation measuredmeasured asas thethe color intensity. The thickness of edges representsrepresents thethe Pearson’sPearson’s Correlation Correlation Coe Coefficientfficient value, value, the the node node dimension dimension represents represents the the weight weight of the of nodethe node in the in network,the network, the colorthe color of the ofedge the edge represents represents the relationship the relationship among among genes genes in grey in andgrey with and thewith phenotypical the phenotypical trait in trait dark in orange. dark orange. The node The colors node represent colors represent the subgroups the subgroups and the halo and represents the halo communityrepresents community detection, based detection, on edge-betweenness. based on edge-betweenness.

TheFocusing separation on the between transcription pigmented factors, and non-pigmentedRuby and Noemi rinds showed is clearly significant seen in the differences PCA, where in allexpression negative between controls pigmented are near the and origin non-pigmented of the plot peta (Figurels (Table8a). AroundS5). Nevertheless, 65% of the as variability evidenced isin explainedthe statistical by the analyses two main (Pearson’s components, correlation, these are Table almost S3; equal PLS with and 34.6% network and 30.2%analyses—Figure of total variability. 6b,c), TheRuby PCA alone (Figure cannot8a) be and considered the cluster the dendrogram transcription (Figure factor8b) controlling show how genesthe pigmentation with higher in expressions, petals. For suchexample, as UFGT in petunia (a 6 million-foldflowers, the pigmentation increase), followed of petals by is DFR under (a the 2 million-fold control of a increase),complex machinery, and Ruby (aincluding 390,000-fold also ATPases increase) required characterize for vacuolar the samples hyperacidification with deep external linked color,with the such pH as ofM. petals australasica [87–90],, ‘Moro’,in addition and S.to buxifoliaR2R3-MYB,. The that PCA together (Figure 8governa) and theanthocyanin cluster dendrogram synthesis under (Figure a8 c)range also of support spatio- thetemporal interspecies circumstances discrimination, [91,92]. confirmingFor Noemi, thatthe importance the external of pigmentation ion exchange of and fruits the ofrole sweet of vacuolar orange, citron,ATPase and in petals the citron are well hybrids, knownS. disticha[93]. Therefore,spp. and weM. cannot australasica exclude, is the very possibility variable. that The a rindtissue- of bloodspecific oranges ATPase becomes works together purple duringwith Noemi maturation, and Ruby likely to underregulate the the control variability of low in temperatures. anthocyanin Thepigmentation. fruits of S. distichaThis possibilityspp. are externallyis currently pigmented being evaluated. at maturity but this is independent of temperature and light [4]. The fruits of M. australasica var. sanguinea are pigmented; they are also very small and3.2.3. maintain The Pigmentation their red colorof the throughoutRind Is Independen development.t of the Finally,Genetic accessionsBasis of the with Parents citron and as Is a under parent (suchthe Control as ‘Incomparabile’) Mainly of External are characterized Factors and by Fruit having Developmental pigmented fruits Stage only when they are very small, the pigmentation then decreases, disappearing altogether as the fruit enlarges. We hypothesize that the The pigmentation of the fruits of Citrus and related genera is very variable, considering that separation of ‘Incomparabile’ and ‘Pink fleshed’ from all the other accessions can be ascribed to stage of either or neither or both the rind and the flesh can be pigmented. Additionally, many factors can development and maturity, very precocious compared to the mature fruits of all of the other accessions. influence the pigmentation including low temperature, exposure to light and stage of development [10,14]. The samples in our study embrace a wide range of variation in fruit pigmentation across a number of species, including of sweet oranges, mandarin types, several hybrids of citron, also including other genera such as Microcitrus, Murraya, and Severinia (Table 1). The expression data show that, as with other tissues, PAL is not expressed differentially among samples (Figure 7). Indeed, ‘Navel’ showed an expression level comparable to ‘Tarocco Lempso’ (about a 31-fold increase) which is deeply pigmented [14] and the expression in ‘Faustrime’ is similar to that in ‘Doppio sanguigno’—the first not at all pigmented but the second is very much pigmented. Among EBGs, the CHS in M. paniculata and ‘Faustrime’ is highly expressed compared to in S. disticha, S. buxifolia, ‘Sunred’, and ‘Moro’, which are the accessions showing high pigmentation in the rind.

Genes 2020, 11, x FOR PEER REVIEW 17 of 33

Similarly, F3H did not reveal any interesting differences between the pigmented and non-pigmented samples. A completely different trend and expression levels characterize the LBGs, strategically involved in the control of the pigmentation of the rind. For example, the expression of DFR in M. australasica, with highly pigmented rind, is the highest with a 2.5 million-fold increased expression level. Similarly, the expression of UFGT, the last enzyme of the phenylpropanoid biosynthesis, showed around a 6 million-fold increase in expression in M. australasica compared to M. paniculata, the accession with the lowest expression of UFGT in the rind. Additionally, very interesting are the expressions of GST, Ruby and Noemi, these being highly and exclusively expressed in the pigmented samples, compared with the negative controls. Generally, we can assume that the rind pigmentation is under the control of DFR, ANS, GST, Ruby and Noemi, as also shown in the t-test analysis (Table S5). These presumably represent the major genes determining rind pigmentation. The expression patternsGenes 2020 ,of11 ,Ruby 807 and Noemi mirrored the differences between the pigmented and non-pigmented17 of 30 samples. In terms of the values of the mRNA fold increase, they were higher for Ruby than for Noemi.

Figure 7. qRT-PCRqRT-PCR expression expression data data for for all all structural structural genes genes in in the the rind rind separated into Early Biosynthetic Genes Genes (EBGs), (EBGs), Late Late Biosynthetic Biosynthetic Genes Genes (LBGs) (LBGs) and andTranscription Transcription Factors Factors (TFs). (TFs). The expressionThe expression level was level calculated was calculated as the mRNA as the -fold mRNA increase. -fold Each increase. accession Each is coded: accession M. paniculata is coded:— MP,M. paniculata ‘Vaniglia—MP, sanguigno’—VS, ‘Vaniglia sanguigno’—VS, ‘Navel’ – N, ‘Navel’—N,‘Faustrime’—MAF, ‘Faustrime’—MAF, ‘Pink fleshed’—PF, ‘Pink fleshed’—PF, ‘Doppio ‘Doppiosanguigno’—DS, sanguigno’—DS, ‘Sunred’—S, ‘Sunred’—S, S. distichaS. disticha—SD, —SD,M. M.australasica australasica var.var. sanguinea—MAS, ‘Incomparabile’—LI,‘Incomparabile’—LI, ‘Tarocco‘Tarocco Lempso’—TL,Lempso’—TL, ‘Tarocco‘Tarocco Ippolito’—TI, Ippolito’—TI,S. S. buxifolia buxifolia—SB,—SB, ‘Moro’—M. ‘Moro’—M.

3.2.4.The Flesh separation Pigmentation between Is Exclusive pigmented to Purple and non-pigmented Sweet Oranges rinds and tois M.clearly australasica seen inand the IsPCA, Diff erentlywhere allCorrelated negative with controls the Acidity are near Trait the origin of the plot (Figure 8a). Around 65% of the variability is Flesh pigmentation is a very unusual trait among Citrus species, being exclusive to a subset of sweet orange varieties including Moro, Tarocco, and Sanguinello and of hybrids with one of these as a parent. Even though pummelo represents one of the parents of the sweet orange, where a very ancient and original variety has been reported to be externally pigmented, the pigmentation of the flesh is specific only to sweet orange. The red color of the flesh of M. australasica var. sanguinea represents another example of inner fruit pigmentation, but different from sweet orange. In fact, the fruits of M. australasica are characterized by a homogeneous distribution of pigmentation in the flesh, independent of ripening. In sweet orange the pigmentation of the flesh increases during the fruit ripening. This is the first time that a genetic overview has been conducted on a subset of accessions, that include sweet orange varieties with different levels of pigmentation, and other Citrus species. Genes 2020, 11, x FOR PEER REVIEW 18 of 33

explained by the two main components, these are almost equal with 34.6% and 30.2% of total variability. The PCA (Figure 8a) and the cluster dendrogram (Figure 8b) show how genes with higher expressions, such as UFGT (a 6 million-fold increase), followed by DFR (a 2 million-fold increase), and Ruby (a 390,000-fold increase) characterize the samples with deep external color, such as M. australasica, ‘Moro’, and S. buxifolia. The PCA (Figure 8a) and the cluster dendrogram (Figure 8c) also support the interspecies discrimination, confirming that the external pigmentation of fruits of sweet orange, citron, and the citron hybrids, S. disticha spp. and M. australasica, is very variable. The rind of blood oranges becomes purple during maturation, likely under the control of low temperatures. The fruits of S. disticha spp. are externally pigmented at maturity but this is independent of temperature and light [4]. The fruits of M. australasica var. sanguinea are pigmented; they are also very small and maintain their red color throughout development. Finally, accessions with citron as a parent (such as ‘Incomparabile’) are characterized by having pigmented fruits only when they are very small, the pigmentation then decreases, disappearing altogether as the fruit enlarges. We hypothesize that the separation of ‘Incomparabile’ and ‘Pink fleshed’ from all the other accessions can be ascribed to stage of development and maturity, very precocious compared to the mature fruits of all of the other Genes 2020, 11, 807 18 of 30 accessions.

Figure 8. StatisticalStatistical analyses analyses carried carried out out on onaccessio accessionsns selected selected for fortheir their rind rind pigmentation. pigmentation. (a) (Principala) Principal component component analysis, analysis, cluster cluster dendrogram dendrogram based based on the on distribution the distribution of expression of expression data datafocused focused (b) on ( bgenes) on geneswhere whereAU refers AU to refers Approximately to Approximately Unbiased Unbiased p-value andp-value BP is and for Bootstrap BP is for BootstrapProbability Probability value; and value; (c) on and accessions. (c) on accessions. Accessions Accessionsare coded: are M coded:paniculataM—MP, paniculata ‘Vaniglia—MP, ‘Vanigliasanguigno’—VS, sanguigno’—VS, ‘Navel’—N, ‘Navel’—N, ‘Faustrime’—MAF, ‘Faustrime’—MAF, ‘Pink ‘Pink fleshed’—PF, fleshed’—PF, ‘Doppio ‘Doppio sanguigno’—DS, sanguigno’—DS, ‘Sunred’—S,‘Sunred’—S,S S disticha disticha—SD,—SD,M. M. australasica australasicavar. var. sanguinea—MAS, sanguinea—MAS, ‘Incomparabile’—LI, ‘Incomparabile’—LI, ‘Lempso’—TL, ‘Lempso’— ‘Ippolito’—TI,TL, ‘Ippolito’—TI,S. buxifolia S. buxifolia—SB,—SB, ‘Moro’—M. ‘Moro’—M.

Expression analysis of the genes involved in the early steps of biosynthesis shows no particular difference between the pigmented and non-pigmented samples (Figure9). The expression of PAL in ‘Navel’, ‘Vaniglia sanguigno’, and ‘Faustrime’ is very similar to that in ‘Doppio sanguigno’ and ‘Tarocco Lempso’ blood oranges, which are typically pigmented. Similarly, the expression of CHS in ‘Faustrime’ is higher than in ‘Tarocco Ippolito’. Moreover, the expression of CHI in the flesh of ‘Vaniglia sanguigno’ is higher than those in the pigmented accessions. The expression of F3H in ‘Tarocco Lempso’ is comparable to that of the negative controls. In contrast to this is the LBG trend. DFR was the highest expressing of the LBG genes with an expression showing about a 26,000-fold increase, followed by GST with 8600-fold, both in ‘Sunred’ (Figure9). The DFR showed very high expressions (1000- to 25,000-fold increases) in all the pigmented samples, compared with the negative controls. In particular, ‘Sunred’ juice showed around 25,000-fold increased expression, compared with the negative controls ‘Faustrime’, ‘Navel’, and ‘Vaniglia sanguigno’. Our results support the strategic role of DFR in the anthocyanin pathway, as previously reported [12,25,94]. For ANS and UFGT we observed some irregularities, mainly for ‘Vaniglia sanguigno’. Our results show an expression of ANS in ‘Vaniglia sanguigno’ comparable to that in M. australasica and ‘Tarocco Lempso’ (both highly pigmented), even though the expression level of ANS in ‘Vaniglia sanguigno’ is very low. The expression levels of UFGT in ‘Vaniglia sanguigno’ and ‘Moro’ juice are very similar (about 30-fold increases). Lastly, the expression of GST in ‘Vaniglia sanguigno’ is also very similar to that in ‘Tarocco Lempso’ and M. australasica. Anthocyanin and lycopene quantifications in ‘Vaniglia sanguigno’ show that the red pigmentation could be due to Genes 2020, 11, 807 19 of 30 lycopene (Table S2) and not to anthocyanin, as previously proposed [14,27]. We cannot exclude the possibility that the expression, mostly of LBG and GST, is because the primers were designed in a shared region, although these genes could be truncated somewhere along the sequence. Genes 2020, 11, x FOR PEER REVIEW 20 of 33

Figure 9. qRT-PCRqRT-PCR expression data for all structural genes separated into Early Biosynthetic Genes (EBGs), Late BiosyntheticBiosynthetic Genes Genes (LBGs), (LBGs), and and Transcription Transcription Factors Factors (TFs) (TFs) in thein the flesh flesh of M. of australasicaM. australasicaand andFaustrime Faustrime, and, ofand the of juices the ofjuices all other of all accessions. other accessions. The expression The expression level was calculatedlevel was ascalculated the mRNA-fold as the mRNA-foldincrease. Accessions increase. are Accessions coded: ‘Faustrime’—MAF, are coded: ‘Faustrime’—MAF, ‘Navel’—N, M. australasica‘Navel’—N,var. M. sanguinea—MAS, australasica var. ‘Taroccosanguinea—MAS, Lempso’—TL, ‘Tarocco ‘Vaniglia Lempso’—TL, sanguigno’—VS, ‘Vaniglia ‘Doppio sanguigno’—VS, sanguigno’—DS, ‘Doppio ‘Tarocco sanguigno’—DS, Ippolito’—TI, ‘Moro’—M,‘Tarocco Ippolito’—TI, ‘Sunred’—S. ‘Moro’—M, ‘Sunred’—S.

InThe contrast role of to GST this is is strategic. the LBG trend. It is a DFR very was large the family highest of aboutexpressing 10 classes, of the theseLBG genes differing with both an expressionstructurally showing and functionally. about a 26,000-fold This family increase, is implicated followed in theby GST vacuolar with sequestration8600-fold, both of in flavonoids, ‘Sunred’ (Figureas well as9). in The xenobiotic DFR showed detoxification very high (reviewed expressions in [95 ]).(1000- Less to recently, 25,000-fold it has beenincreases) noted in how all GSTthe pigmentedtissue-specific samples, expression compared can be with due the to exposurenegative tocontrols. chemical In treatmentsparticular, and‘Sunred’ to biotic juice or showed abiotic aroundstresses 25,000-fold [6]. We selected increased the memberexpression, belonging compared to thewith phi the class, negative which controls is involved ‘Faustrime’, in anthocyanin ‘Navel’, andaccumulation ‘Vaniglia sanguigno’. in blood orange Our fleshresults [96 support,97]. the strategic role of DFR in the anthocyanin pathway, as previously reported [12,25,94]. For ANS and UFGT we observed some irregularities, mainly for ‘Vaniglia sanguigno’. Our results show an expression of ANS in ‘Vaniglia sanguigno’ comparable to that in M. australasica and ‘Tarocco Lempso’ (both highly pigmented), even though the expression level of ANS in ‘Vaniglia sanguigno’ is very low. The expression levels of UFGT in ‘Vaniglia sanguigno’ and ‘Moro’ juice are very similar (about 30-fold increases). Lastly, the expression of GST in ‘Vaniglia sanguigno’ is also very similar to that in ‘Tarocco Lempso’ and M. australasica. Anthocyanin and lycopene quantifications in ‘Vaniglia sanguigno’ show that the red pigmentation

Genes 2020, 11, x FOR PEER REVIEW 21 of 33

could be due to lycopene (Table S2) and not to anthocyanin, as previously proposed [14,27]. We cannot exclude the possibility that the expression, mostly of LBG and GST, is because the primers were designed in a shared region, although these genes could be truncated somewhere along the sequence. The role of GST is strategic. It is a very large family of about 10 classes, these differing both structurally and functionally. This family is implicated in the vacuolar sequestration of flavonoids, as well as in xenobiotic detoxification (reviewed in [95]). Less recently, it has been noted how GST tissue-specific expression can be due to exposure to chemical treatments and to biotic or abiotic Genesstresses2020 ,[6].11, 807We selected the member belonging to the phi class, which is involved in anthocyanin20 of 30 accumulation in blood orange flesh [96,97]. FromFrom a statistical statistical point point of of view, view, the the qualitat qualitativeive difference difference between between the pigmented the pigmented and non- and non-pigmentedpigmented accessions accessions is due is to due PAL to and PAL Ruby and (Table Ruby S5), (Table the major S5), the genes major for flesh genes tissue. for flesh The crucial tissue. Therole crucialof PAL role was of firstly PAL wasexplained firstly by explained Lo Piero by et Lo al. Piero[10], who et al. showed [10], who how showed PAL expression how PAL expression increased increasedin Tarocco in under Tarocco exposure under exposure to low-temperatures. to low-temperatures. This suggests This suggests its role itsas rolea cold as protector a cold protector [98]. Later [98]. Lateron, after on, afterthe construction the construction of a ofsuppression a suppression library library,, the the overexpression overexpression of of PAL PAL in in Moro Moro was further demonstrateddemonstrated toto bebe oneone ofof thethe genesgenes didifferentiallyfferentially expressedexpressed [[25].25]. Overall,Overall, more more than than 86% 86% of ofthe the variance variance among among the samples the samples is explained is explained by the first by thetwo firstprincipal two principalcomponents components (Figure 10a). (Figure In particular, 10a). In the particular, deep and theintense deep purple and intensepigmentation purple of pigmentation‘Moro’, ‘Tarocco of ‘Moro’,Ippolito’ ‘Tarocco and ‘Sunred’ Ippolito’ is due and mainly ‘Sunred’ to F3H, is dueto all mainly LBGs, to to GST F3H, and to to all Ruby LBGs, (Figure to GST 10b,c). and According to Ruby (Figureto previous 10b,c). reports, According the anthocyanin to previous reports,content thevaries anthocyanin between contentapproximately varies between 6 and 25 approximately mg/L for the 6’Sanguigno’, and 25 mg/ L‘Sanguinello‘, for the ’Sanguigno’, and ‘Tarocco’ ‘Sanguinello‘, accessions, and from ‘Tarocco’ 50 to 120 accessions, mg/L for from Moro, 50 and to 120 from mg 450/L for to Moro,680 mg/L and for from mandarin-like 450 to 680 mghybrids/L for [14,28]. mandarin-like The expression hybrids of [14 Ruby,28]. is The the expression highest among of Ruby the isgenes the highestwe consider among in thethis genes study we (Figure consider 9). From in this a study580,000 (Figure- to a 11,000-fold-increase,9). From a 580,000- to the a 11,000-fold-increase, expression of Ruby theis shared expression among of all Ruby of the is sharedpigmented among samples. all of theThe pigmented peculiarity samples. of the Ruby The gene peculiarity is described of the in Ruby [12], genewhich is reports described how in [a12 Copia-like], which reports retrotransposon, how a Copia-like inserted retrotransposon, upstream in the inserted Ruby gene, upstream induces in the its Rubyexpression, gene, inducescontrolled its expression,mostly by controlledcold stress. mostly The bycold-induced cold stress. Thesynthesis cold-induced and accumulation synthesis and of accumulationanthocyanins ofhas anthocyanins been reported has previously been reported [14]. previously [14].

FigureFigure 10.10. StatisticalStatistical analysis analysis of of access accessionsions selected selected for for their their pigment pigmentationation in flesh in flesh and and juice. juice. (a) (Principala) Principal component component analysis, analysis, cluster cluster dendrogram dendrogram based based on the on distribution the distribution of expression of expression data datafocused focused (b) on (genesb) on and genes (c) on and accessions. (c) on accessions.Accessions are Accessions coded: ‘Faustrime’—MAF, are coded: ‘Faustrime’—MAF, ‘Navel’—N, M. ‘Navel’—N, M. australasica var. sanguinea—MAS, ‘Tarocco Lempso’—TL, ‘Vaniglia sanguigno’—VS, ‘Doppio sanguigno’—DS, ‘Tarocco Ippolito’—TI, ‘Moro’—M, ‘Sunred’—S.

From a genetic point of view, the PCA (Figure 10a) and the cluster dendrogram (Figure 10c) show that ‘Sunred’ (deeply pigmented) is far from the sweet oranges group. Among them, ‘Moro’ and ‘Tarocco Ippolito’ (highly pigmented) are located in a central position with respect to ‘Doppio sanguigno’ and ‘Tarocco Lempso’ (less pigmented). We suggest this could be due to the hybrid nature of ‘Sunred’, considering that it is derived from a cross between ‘Oroval’ and ‘Moro’ orange. M. australasica Genes 2020, 11, 807 21 of 30 var sanguinea is clearly far from the other samples, because it belongs to a different genus. It is interesting to observe that the collocation of ‘Vaniglia sanguigno’ and ‘M. australasica’, on opposite extremes of the second dimension, is presumably due to the strategic role played by Noemi, the bHLH transcription factor that, together with Ruby, controls anthocyanin pigmentation [19]. The peculiarity of Noemi is also due to the fact that it mainly represents the gene that, if specifically interrupted, causes a loss of function of the acidic trait, making Citrus fruits low acid [19]. The primers used for expression analysis were designed in the interrupted region, to investigate both traits simultaneously, the pigmentation and the acidity. In fact, ‘Vaniglia sanguigno’ is a sweet (low acid) variety, with a pH of 6 and a titratable acidity of 0.2 [99]. The qRT-PCR expression data show a completely null expression for Noemi (Figure9). Conversely, the expression of Noemi is reported for all other accessions considered in the study (Figure9), even though not necessarily linked with pigmentation (see, for example ‘Faustrime’ and ‘Navel’ whose expressions are similar to blood oranges). Otherwise, M. australasica represents the most acidic sample among those considered, with its content higher than that of the other Citrus fruits [100]. Microcitrus is commonly known as ‘lemon cavial’ due to the spherical shape of vesicle juice and to the high acidity typical of lemon. The interconnection between anthocyanin pigmentation and the low acid trait has been reported [19], demonstrating how, in lemon and in other species derived from citron, the purple pigmentation in the leaves and petals is strictly correlated with the acidity of the fruit—an exception is sweet orange, whose pigmentation is fruit-exclusive. Therefore, its provisional role (pigmentation of vegetative tissues means acidic fruit) cannot yet be concluded, not even for a particular Tarocco clone, ‘Ferreri’, which is anthocyanin-rich in the flesh and also low acid [14,19].

3.2.5. The Pigmentation of the Stamens and Styles Is Species-Specific, while the Red Color of the Stigmas is Genotype Dependent Pigmentation represents a suitable model for studying how new patterns are generated along the evolution of species, as previously demonstrated in Drosophila wings whose pigmentation contributes to the separation of species [70], or in mammals where the diversification of coat color results in a strategic study of adaptation mechanisms [71]. In plants, the pigmentation is generally related to reproduction [101] and to adaptation to different growth conditions [102]. The development and regulation of flower color are influenced by many internal and external factors. Generally, flower tissues have variable pigmentation according to season, which depends also on environmental conditions and on biotic and abiotic stresses [102]. Therefore, understanding the mechanism of color development and its regulation provides an important theoretical platform, for the cultivation and improvement of new colors in various plant tissues, not having an exclusive ornamental value [103]. Moreover, the use of flower tissues as potential antioxidant sources has been studied in depth in saffron, where the stigmas, , styles, and stamens represent antioxidant sources that may be used as functional ingredients [104]. Even though red flowers have evolved repeatedly in plants, as well as in Citrus, the color of the flowers represents an impressive trait, mostly for accessions of interest for their ornamental value. However, little is known about the pigmentation of stamens, styles, and stigmas, either from a phenotypic or from a genetic point of view. To the best our knowledge, this is the first time the different tissues of flowers have been characterized in Citrus from a genetic point of view, evaluating the role of anthocyanin’s biosynthetic and regulatory genes. Citrus species generally have perfect flowers comprising an androecium (the male reproductive part), made up of 20–40 stamens topped by white or yellow anthers containing the . Meanwhile, the (the female reproductive part) comprises a pistil including (from bottom to top) an , a style, and a stigma. The number of accessions considered to carry out a transcriptional analysis of flower tissues limits the opportunity for cluster and PCA analyses, as carried out for the other tissues of our study. Hence, this must be considered only a pilot study. Nevertheless, firstly, for the stamens and styles no differences were observed between the negative controls and the pigmented samples for PAL Genes 2020, 11, x FOR PEER REVIEW 23 of 33

by white or yellow anthers containing the pollen. Meanwhile, the gynoecium (the female Genes 2020, 11, 807 22 of 30 reproductive part) comprises a pistil including (from bottom to top) an ovary, a style, and a stigma. The number of accessions considered to carry out a transcriptional analysis of flower tissues and EBGs,limits the except opportunity for F3H for (Figure cluster 11and). PCA For example,analyses, as ‘Pink carried fleshed’ out for is the the other accession tissues of with our thestudy. highest Hence, this must be considered only a pilot study. Nevertheless, firstly, for the stamens and styles no expression of CHS and CHI in the style, but the negative control ‘Navel’ has an expression level higher differences were observed between the negative controls and the pigmented samples for PAL and thanEBGs, the other except pigmented for F3H (Figure accessions. 11). For Similarly, example, in‘Pink the fleshed’ stamen, is CHS the accession did not showwith the any highest particular differencesexpression among of CHS samples. and CHI In fact,in the the style, stamen but the of ‘Zagaranegative Bianca’control showed‘Navel’ has the an same expression expression level level as M.higher australasica than the(a other one-fold pigmented increase) accessions. - the former Similarly, non-pigmented in the stamen, and CHS the did latter not highlyshow any colored. As forparticular the other differences tissues, LBGsamong (except samples. UFGT In fact, for thethe style)stamen showed of ‘Zagara preferential Bianca’ showed high expressions the same for all pigmentedexpression sampleslevel as M. compared australasica to (a negligible one-fold increase) expressions - the in former the negative non-pigmented controls, and ‘Zagara the latter bianca’ and ‘Navel’,highly colored. independent As for the of other the expressiontissues, LBGs level (exc (Figureept UFGT 11 for). Especiallythe style) showed for the preferential stamens, high the large differenceexpressions in expression for all pigmented between thesamples purple compared samples to and negligible ‘Navel’, expressions supports thein the hypothesis negative controls, that all LBGs are strictly‘Zagara interdependent bianca’ and ‘Navel’, in biosynthesis independent and of translocation the expression of anthocyanins.level (Figure 11). Among Especially the transcription for the stamens, the large difference in expression between the purple samples and ‘Navel’, supports the factors, only the stamens are under the control of Ruby and Noemi, even though the expression of hypothesis that all LBGs are strictly interdependent in biosynthesis and translocation of the latteranthocyanins. is lower Among (Figure the11). transcription The stamens factors, of the only citrons the stamens ‘Diamante’ are under and ‘Buddha’sthe control of hand’ Ruby and and of M. australasicaNoemi, areeven highly though expressed the expression compared of the tolatter a very is lower negligible (Figure expression 11). The stamens in ‘Navel’ of the (from citrons a 2000- to a 4000-fold‘Diamante’ increase and ‘Buddha’s for Ruby, hand’ from and a of 10- M. to australasica a 20-fold are increase highly for expressed Noemi). compared These results to a very suggest a putativenegligible relationship expression betweenin ‘Navel’ Ruby(from a and 2000- Noemi, to a 4000-fold as observed increase exclusively for Ruby, from for a the 10- rindto a 20-fold (Figure 4), evenincrease though thefor functionalNoemi). These role results of Noemi suggest in these a puta tissuestive relationship remains uncertain. between SomeRuby ofand these Noemi, evaluations as are inobserved progress. exclusively The roles for of the Ruby rind and(Figure Noemi 4), even in thethough styles the are functional less clear, role considering of Noemi in these for example tissues the higherremains expression uncertain. in ‘Navel’ Some of compared these evaluations to ‘Tahiti’ are andin progress. ‘Mexican The lime’, roles of for Ruby Ruby, and and Noemi ‘Mexican in the lime’ styles are less clear, considering for example the higher expression in ‘Navel’ compared to ‘Tahiti’ and ‘Rangpur lime’ for Noemi (Figure 11). and ‘Mexican lime’, for Ruby, and ‘Mexican lime’ and ‘Rangpur lime’ for Noemi (Figure 11).

Figure 11. qRT-PCR expression data for all structural genes separated into Early Biosynthetic Genes

(EBGs) and Late Biosynthetic Genes (LBGs) and Transcription Factors (TFs) in stamen, style, and stigma. The expression levels were calculated as mRNA-fold increases. Each accession is indicated by a code: ‘Zagara bianca’—ZB, M. australasica var. sanguinea—MAS, ‘Buddha’s hand’—MB, ‘Diamante’—CD, ‘Navel’—N, ‘Tahiti’—LT, ‘Mexican lime’—LMT, ‘Pink fleshed’—PF, ‘Rangpur lime’—RaL, ‘Moro’—M, ‘Sunred’—S. Genes 2020, 11, 807 23 of 30

The stigmas represent an interesting exception, because all EBGs (except CHS) and LBGs are highly expressed in ‘Moro’ and ‘Sunred’ compared to the negative controls ‘Navel’, ‘Mexican lime’, and ‘Tahiti’ (Figure 11). The stigmas represent the only tissues in which the entire pathway from phenylpropanoid to anthocyanin biosynthesis and accumulation work together to explain the genotypically interconnected genetic control. In the framework of regulatory genes, only Ruby explains the differences between the pigmented and non-pigmented samples (Table S5), even though with a lower expression level compared to the styles and stamens (Figure 11). Moreover, from a statistical point of view, ANS and Ruby represent the two major genes responsible for the variability between pigmented and non-pigmented samples (Table S5), as also supported by the Pearson coefficients, which are highly significant ( 0.88) for all genes except for CHS (Table S3). ≥ Among Citrus the red pigmentation of the stamens, styles, and stigmas is very interesting. The first phenotypic observation is that there is no correspondence or relationship with one another. The pigmentation of stamens is almost exclusively in citron and M. australasica and we found this to be very stable and independent of environmental conditions. The purple pigmentation of the styles is most frequent among citron and lemons but it is highly dependent on light. Interestingly, flowers, with abnormal development characterized by a protrusion of the style, show an unconventional blood pigmentation (Figure S4). Generally, we suppose that the pigmentation of the stamens and styles (except for M. australasica) has been inherited by citron, even though not stably, as observed for young leaves and petals. Not all accessions with pigmented leaves and petals show colored styles and stamens. In contrast, the pigmentation of the stigmas is an exception and is genotype-dependent. The pigmentation of the stigmas is unique and exclusive to ‘Moro’ and ‘Sunred’. The stigmas of the other pigmented and non-pigmented sweet orange varieties showed no phenotypic pigmentation (Figure S5). The pigmentation of stigmas is very specific and represents a new phenotypic marker. The observation of the stigmas, in addition to the investigation on a genotype-specific single nucleotide polymorphism [105], helps clarify the origins of ‘Sunred’ (initially labeled as a ‘Tarocco’) as a ‘Moro’ hybrid [29].

4. Conclusions For the first time in Citrus and related genera, a wide selection of pigmented tissues has been characterized genetically and phenotypically. A hypothesis is proposed regarding the genetic inheritance of anthocyanin pigmentation in leaves, petals, flesh, rind, stamens, styles, and stigmas (Figure 12). We find that:

1. The pigmentation in young leaves and petals depends on citron. In species different from Citrus, the purple color in both tissues is not always correlated, such as in Severinia (purple young leaves and white flowers). Ruby represents the MYB transcription factor that controls the pigmentation of petals, but not of leaves. 2. The pigmentation of fruit tissues has been gained and lost frequently through the history of Citrus, but stably characterizes blood oranges. The control of the variability in the flesh and rind represents one of the main traits sought by consumers and producers, and one of the focuses of breeding programs all over the world. 3. The pigmentation of stamens and styles has given rise to the citron parent, but this trait is genetically less stable than in leaves and petals. Ruby and Noemi also control the pigmentation of stamens, in species different from citron and its hybrids, such as in Microcitrus for stamens. 4. The pigmentation of the stigma is Moro-dependent, the only genotype-dependent trait, representing a new strategic phenotypic marker. The study of light and cold-dependent control of stigma pigmentation is similar to that known in fruits, and is currently under evaluation. Genes 2020, 11, x FOR PEER REVIEW 25 of 33

4. The pigmentation of the stigma is Moro-dependent, the only genotype-dependent trait, representing a new strategic phenotypic marker. The study of light and cold-dependent control of stigma pigmentation is similar to that known in fruits, and is currently under evaluation. A more thorough investigation of the promoter regions, as well as of transcription factors other than from Ruby and Noemi, is need if we are to better explain which mutations and molecular mechanisms dominate in the control of pigmentation in all tissues. Fuller understanding of the Citrus genome will help identify the specific genes forming the WMBW complex that, under various rearrangements, may provide a punctilious genetic basis to explain the generation of new patterns of Genespigmentation2020, 11, 807 in all species. 24 of 30

FigureFigure 12.12. A model illustrating the putative inheritance ofof anthocyanin pigmentationpigmentation inin tissuestissues ofof thethe mainmain CitrusCitrus speciesspecies andand hybridshybrids consideredconsidered inin thisthis study.study. AA schemescheme ofof leaves,leaves, fruits,fruits, andand flowersflowers tissuetissue pigmentationpigmentation isis shown. shown. A A representation representation of transcriptionof transcription factors factors (Ruby (Ruby and Noemi),and Noemi), biosynthetic biosynthetic genes (PAL,genes dihydroflavonol(PAL, dihydroflavonol 4-reductase 4-reductase (DFR), anthocyanidin (DFR), anthocyanidin synthase (ANS),synthase glutathione (ANS), glutathione S-transferase S- (GST)) and their relationship based on the qualitative statistical analysis describing the difference transferase (GST)) and their relationship based on the qualitative statistical analysis describing the between pigmented and non-pigmented samples in tissues is presented. difference between pigmented and non-pigmented samples in tissues is presented. A more thorough investigation of the promoter regions, as well as of transcription factors other Supplementary Materials: The following are available online at www.mdpi.com/xxx/s1, Figure S1. Geo- thanmetereological from Ruby conditions and Noemi, are illustrated is need as ifplots we representing are to better weather explain indexes which from mutations SIAS database and molecularfor Riposto mechanisms(Acireale—(37°62 dominate′ N, 15°16 in′ E, the 102 control m a.s.l.) of and pigmentation Lentini (Palazzelli—37°20 in all tissues.′ N, Fuller 14°53′ understandingE, 48 m a.s.l.) sites. of theThe Citrussmoothedgenome line was will obtained help identify by Loess the regression specific approach. genes forming Fill color the represents WMBW the complex site, the that, line undercolor represents various rearrangements,the site and year combination. may provide (a) a punctiliousDaily mean temper geneticature basis (Tm); to explain (b) Daily the min generation temperature of new(Tmin); patterns (c) Daily of pigmentationmax temperature in all(Tmax); species. (d) Daily Relative humidity as max value (RH); (e) Daily Relative humidity as min value (RH); (f) Potential evapotranspiration (mm); (g) Precipitation (mm) as monthly amount. The soil Supplementarycomposition for Materials:accessions sampledThe following in Acireale are available consists onlineof sand at 94%, http: loam//www.mdpi.com 2%, clay 4%, /pH2073-4425 7.2, active/11/ 7lime/807 0%,/s1, Figureorganic S1. matter Geo-metereological 0.58%, available conditions P Olsen are9 mg illustrated kg−1. The as soil plots composition representing for weather sweet oranges indexes fromand Sunred SIAS database hybrid for Riposto (Acireale—(37 62 N, 15 16 E, 102 m a.s.l.) and Lentini (Palazzelli—37 20 N, 14 53 E, 48 m a.s.l.) sampled in Lentini is reported◦ 0 in [18].◦ 0 Figure S2. ClustalW alignment (CLC Sequence◦ 0 Viewer◦ 0 software) of sites. The smoothed line was obtained by Loess regression approach. Fill color represents the site, the line color representsamplicons thefor each site and gene year is shown. combination. (a) PAL (a) and Daily Early mean Bios temperatureynthetic Genes (Tm); (CHS, (b) CHI, Daily F3 minH), temperature(b) Late biosynthetic (Tmin); (c)genes Daily (DFR, max ANS, temperature UFGT) and (Tmax); GST, (d) (c) Daily transcription Relative factors humidity (Rub asy maxand valueNoemi). (RH); The (e) species Daily are: Relative Citrus humidity sinensis, asC. minmedica value, Severinia (RH); (f)buxifolia Potential and evapotranspirationMurraya paniculata include (mm);(g) accessions Precipitation collected (mm) and as analyzed. monthlyamount. C. maxima The and soil C. compositionreticulata represent for accessions one of the sampled parents of in species Acireale considered consists of in sandthe study. 94%, C. loam ichangensis 2%, clay and 4%, Fortunella pH 7.2, activehindsii limehave 1 0%,been organic considered matter because 0.58%, they available are am Pong Olsen the 9 species mg kg− for. Thewhich soil the composition full genome for is sweet publicly oranges available and Sunredand for hybrid sampled in Lentini is reported in [18]. Figure S2. ClustalW alignment (CLC Sequence Viewer software) of which the sequence can be used to support the conservation of genes evaluated for expression analysis. Figure amplicons for each gene is shown. (a) PAL and Early Biosynthetic Genes (CHS, CHI, F3H), (b) Late biosynthetic genesS3. Flow (DFR, diagram ANS, of UFGT) the image and GST, analysis. (c) transcription (A) the picture factors of petals (Ruby on and green Noemi). background; The species (B) are:the binaryCitrus sinensismask of, C.petals medica obtained, Severinia with buxifolia SIOX segmentator;and Murraya (C) paniculata outputinclude scheme accessionsfor analyzing collected particles and which analyzed. needsC. image maxima A andand C.mask reticulata B to dorepresent the image one analysis; of the parents D) output of species Table for considered analyzing in particles, the study. theC. ID ichangensis correspondingand Fortunella to the petals hindsii ID haveplotted been in consideredthe scheme because C. Figure they S4. are Color among of style the species of a flower for which of Femminello the full genome Siracusano is publicly 2kr lemon available with and(a) non for which the sequence can be used to support the conservation of genes evaluated for expression analysis. Figure S3. Flow diagram of the image analysis. (A) the picture of petals on green background; (B) the binary mask of petals obtained with SIOX segmentator; (C) output scheme for analyzing particles which needs image A and mask B to do the image analysis; D) output Table for analyzing particles, the ID corresponding to the petals ID plotted in the scheme C. Figure S4. Color of style of a flower of Femminello Siracusano 2kr lemon with (a) non regular and (b) normal development. Figure S5. Flowers showing the color of the stigma. The style is pigmented in (a) ‘Sunred’ and (b) ‘Moro’, not pigmented in (c) ‘Doppio sanguigno’, (d) ‘Tarocco’ or (e) ‘Navel’. (a), (b), (c) and (d) are blood oranges, (e) represents a common blond orange. Table S1. Data showing the homology of the amplicons for each gene. Concerning the species, Citrus sinensis, C. medica, Severinia buxifolia and Murraya paniculata include accessions collected and analyzed here. C. maxima and C. reticulata represent one of the parents of species considered in the study. C. ichangensis and Fortunella hindsii have been considered because they are among species for which the full genome is publicly available and for which sequence can support the conservation of genes evaluated for Genes 2020, 11, 807 25 of 30 expression analysis. The number of different nucleotides and the correspondent modification in the amino acid in the primers are reported. Table S2. Anthocyanin and lycopene quantification in the rind of Murraya paniculata and in the flesh of ‘Navel’, ‘Tarocco Lempso’, ‘Tarocco Ippolito’ and ‘Moro’ oranges. Table S3. Significant values of Pearson’s correlation coefficient among gene expressions reported for each tissue. Table S4. Weights and % of explained variance of scaled gene expression of the four components of the PLS model for prediction of petal color intensity. Table S5. Paired test of qualitative presence/absence of anthocyanin pigmentation in petals, rind, flesh/juice, and stigma. Student t-test of normally distributed values of gene expression and Wilcox test for non-normal distributed values of gene expression. Only tissues with at least one significant value are reported. The significant values are shown in bold. Author Contributions: Investigation, C.C., Visualization, Writing—original draft; A.C. Investigation, Software, Writing—original draft; F.S. Investigation; M.P.R. Investigation; P.C. Resources; Writing—review & editing; M.C. Writing—review & editing; G.R. Resources, Funding acquisition; G.D. Supervision, Writing—review & editing; C.L. Conceptualization, Funding acquisition, Supervision, Writing—review & editing. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Italian Ministry of Agriculture Food and through the Projects “RGV-FAO Conservazione, caratterizzazione, uso e valorizzazione delle risorse genetiche vegetali per l’alimentazione e l’agricoltura” (D.M. 20380) and “BIOTECH Biotecnologie sostenibili per l’agricoltura italiana” (DM 15930/7305/2018). Acknowledgments: ORPRAMed project D.M. 28681/7303/15 del 28/12/2015 funded through ARIMNet2 (ERA-NET no. 618127)—www.arimnet2.net and the coordinator Paola Caruso (coauthor of the present manuscript) to have enclosed the genome of M paniculata. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Wu, G.A.; Terol, J.; Ibanez, V.; López-García, A.; Pérez-Román, E.; Borredá, C.; Domingo, C.; Tadeo, F.R.; Carbonell-Caballero, J.; Alonso, R.; et al. Genomics of the Origin and Evolution of Citrus. Nature 2018, 554, 311–316. [CrossRef][PubMed] 2. Ollitrault, P.; Curk, F.; Krueger, R. Citrus . In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Eds.; Woodhead Publishing, Elsevier: Duxford, UK, 2020. [CrossRef] 3. Butelli, E.; Garcia-Lor, A.; Licciardello, C.; Las Casas, G.; Hill, L.; Recupero, G.R.; Keremane, M.L.; Ramadugu, C.; Krueger, R.; Xu, Q.; et al. Changes in Anthocyanin Production during Domestication of Citrus. Plant Physiol. 2017, 173, 2225–2242. [CrossRef][PubMed] 4. Huang, D.; Wang, X.; Tang, Z.; Yuan, Y.; Xu, Y.; He, J.; Jiang, X.; Peng, S.A.; Li, L.; Butelli, E.; et al. Subfunctionalization of the Ruby2–Ruby1 Gene Cluster during the Domestication of Citrus. Nat. Plants 2018, 4, 930–941. [CrossRef][PubMed] 5. Li, H.; Deng, Z.; Zhu, H.; Hu, C.; Liu, R.; Young, J.C.; Tsao, R. Highly Pigmented Vegetables: Anthocyanin Compositions and Their Role in Antioxidant Activities. Food Res. Int. 2012, 46, 250–259. [CrossRef] 6. Dixon, R.A.; Paiva, N.L. Stress-Induced Phenylpropanoid Metabolism. Plant 1995, 7, 1085–1097. [CrossRef] 7. Winkel-Shirley, B. Biosynthesis of Flavonoids and Effects of Stress. Curr. Opin. Plant Biol. 2002, 5, 218–223. [CrossRef] 8. He, J.; Giusti, M.M. Anthocyanins: Natural Colorants with Health-Promoting Properties. Annu. Rev. Food Sci. Technol. 2010, 1, 163–187. [CrossRef] 9. Titta, L.; Trinei, M.; Stendardo, M.; Berniakovich, I.; Petroni, K.; Tonelli, C.; Riso, P.; Porrini, M.; Minucci, S.; Pelicci, P.G.; et al. Blood Orange Juice Inhibits Fat Accumulation in Mice. Int. J. Obes. 2010, 34, 578–588. [CrossRef] 10. Lo Piero, A.R.; Puglisi, I.; Rapisarda, P.; Petrone, G. Anthocyanins Accumulation and Related Gene Expression in Red Orange Fruit Induced by Low Temperature Storage. J. Agric. Food Chem. 2005, 53, 9083–9088. [CrossRef] 11. Crifò, T.; Puglisi, I.; Petrone, G.; Recupero, G.R.; Lo Piero, A.R. Expression Analysis in Response to Low Temperature Stress in Blood Oranges: Implication of the Flavonoid Biosynthetic Pathway. Gene 2011, 476, 1–9. [CrossRef] 12. Butelli, E.; Licciardello, C.; Zhang, Y.; Liu, J.; Mackay, S.; Bailey, P.; Reforgiato-Recupero, G.; Martin, C. Retrotransposons Control Fruit-Specific, Cold-Dependent Accumulation of Anthocyanins in Blood Oranges. 2012, 24, 1242–1255. [CrossRef][PubMed] Genes 2020, 11, 807 26 of 30

13. Carmona, L.; Alquézar, B.; Marques, V.V.; Peña, L. Anthocyanin Biosynthesis and Accumulation in Blood Oranges during Postharvest Storage at Different Low Temperatures. Food Chem. 2017, 237, 7–14. [CrossRef] [PubMed] 14. Caruso, M.; Ferlito, F.; Licciardello, C.; Allegra, M.; Strano, M.C.; Di Silvestro, S.; Russo, M.P.; Pietro Paolo, D.; Caruso, P.; Las Casas, G.; et al. Pomological Diversity of the Italian Blood Orange Germplasm. Sci. Hortic. 2016, 213, 331–339. [CrossRef] 15. Huang, D.; Yuan, Y.; Tang, Z.; Huang, Y.; Kang, C.; Deng, X.; Xu, Q. Retrotransposon Promoter of Ruby1 Controls Both Light- and Cold-Induced Accumulation of Anthocyanins in Blood Orange. Plant Cell Environ. 2019, 42, 3092–3104. [CrossRef] 16. Dooner, H.K.; Robbins, T.P.; Jorgensen, R.A. Genetic and Developmental Control of Anthocyanin Biosynthesis. Annu. Rev. Genet. 1991, 25, 173–199. [CrossRef] 17. Guo, N.; Han, S.; Zong, M.; Wang, G.; Zheng, S.; Liu, F. Identification and Differential Expression Analysis of Anthocyanin Biosynthetic Genes in Leaf Color Variants of Ornamental Kale. BMC Genom. 2019, 20, 564. [CrossRef] 18. Liu, Y.; Tikunov, Y.; Schouten, R.E.; Marcelis, L.F.M.; Visser, R.G.F.; Bovy, A. Anthocyanin Biosynthesis and Degradation Mechanisms in Solanaceous Vegetables: A Review. Front. Chem. 2018, 6, 52. [CrossRef] 19. Butelli, E.; Licciardello, C.; Ramadugu, C.; Durand-Hulak, M.; Celant, A.; Reforgiato Recupero, G.; Froelicher, Y.; Martin, C. Noemi Controls Production of Flavonoid Pigments and Fruit Acidity and Illustrates the Domestication Routes of Modern Citrus Varieties. Curr. Biol. 2019, 29, 158–164. [CrossRef] 20. Ma, D.; Constabel, C.P. MYB Repressors as Regulators of Phenylpropanoid Metabolism in Plants. Trends Plant Sci. 2019, 24, 275–289. [CrossRef] 21. Huang, D.; Tang,Z.; Fu, J.; Yuan,Y.; Deng, X.; Xu, Q. CsMYB3 and CsRuby1 Form an “Activator-and-Repressor” Loop for the Regulation of Anthocyanin Biosynthesis in Citrus. Plant Cell Physiol. 2019, 61, 318–330. [CrossRef] 22. Moriguchi, T.; Kita, M.; Tomono, Y.; Endo-Inagaki, T.; Omura, M. One Type of Chalcone Synthase Gene Expressed during Embryogenesis Regulates the Flavonoid Accumulation in Citrus Cell Cultures. Plant Cell Physiol. 1999, 40, 651–655. [CrossRef] 23. Moriguchi, T.; Kita, M.; Tomono, Y.; Endo-Inagaki, T.; Omura, M. Gene Expression in Flavonoid Biosynthesis: Correlation with Flavonoid Accumulation in Developing Citrus Fruit. Physiol. Plant 2001, 11, 66–74. [CrossRef] 24. Cotroneo, P.S.; Russo, M.P.; Ciuni, M.; Recupero, G.R.; Lo Piero, A.R. Quantitative Real-Time Reverse Transcriptase-PCR Profiling of Anthocyanin Biosynthetic Genes during Orange Fruit Ripening. J. Am. Soc. Hortic. Sci. 2006, 131, 537–543. [CrossRef] 25. Licciardello, C.; Russo, M.P.; Vale’, G.; Recupero, R.G. Identification of Differentially Expressed Genes in the Flesh of Blood and Common Oranges. Genet. Genomes 2008, 4, 315–331. [CrossRef] 26. Muccilli, V.; Licciardello, C.; Fontanini, D.; Russo, M.P.; Cunsolo, V.; Saletti, R.; Reforgiato Recupero, G.; Foti, S. Proteome Analysis of Citrus sinensis L. (Osbeck) Flesh at Ripening Time. J. Proteom. 2009, 73, 134–152. [CrossRef][PubMed] 27. Hodgson, R.W. Horticultural Varieties of Citrus. In ; Reuther, W., Webber, H.J., Batchelor, L.D., Eds.; University of California Press: Ruverside, CA, USA, 1967; pp. 431–591. 28. Rapisarda, P.; Fabroni, S.; Peterek, S.; Russo, G.; Mock, H.P. Juice of New Citrus Hybrids (Citrus Clementina Hort. Ex Tan. C. Sinensis L. Osbeck) as a Source of Natural Antioxidants. Food Chem. 2009, 117, 212–218. × [CrossRef] 29. Russo, G.; Licciardello, C.; Caruso, P.; Russo, M.P.; Petro Paolo, D.; Reforgiato Recupero, G.; Rapisarda, P.; Ballistreri, G.; Fabroni, S.; Caruso, M. New CREA Citrus Hybrids. Citrus Res. Technol. 2016, 37, 98–101. [CrossRef] 30. Swingle, W.; Reece, P. The of Citrus and its wild relatives. In The Citrus Industry; Reuther, W., Webber, H.J., Batchelor, L.D., Eds.; University of California Press: Ruverside, CA, USA, 1967; pp. 190–430. 31. La Rosa, G.; Reforgiato Recupero, G.; Nicolosi, E.; Russo, G.; Continella, G. Recupero e salvaguardia di germoplasma agrumicolo italiano. Italus Hortus 2005, 12, 31–36. 32. Deng, X.; Yang, X.; Yamamoto, M.; Biswas, M.K. Domestication and history. In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Eds.; Woodhead Publishing, Elsevier: Duxford, UK, 2020; pp. 33–51. [CrossRef] 33. Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3-Masker: Integrating Masking of Template Sequence with Primer Design Software. Bioinformatics 2018, 34, 1937–1938. [CrossRef] Genes 2020, 11, 807 27 of 30

34. Olio Analysis Tool. Eurofins Genomics. Available online: https://www.eurofinsgenomics.eu/en/dna-rna- oligonucleotides/oligo-tools/oligo-analysis-tool/ (accessed on 24 April 2018). 35. Xu, Q.; Chen, L.L.; Ruan, X.; Chen, D.; Zhu, A.; Chen, C.; Bertrand, D.; Jiao, W.B.; Hao, B.H.; Lyon, M.P.; et al. The Draft Genome of Sweet Orange (Citrus Sinensis). Nat. Genet. 2013, 45, 59–68. [CrossRef] 36. Johnson, M.; Zaretskaya, I.; Raytselis, Y.; Merezhuk, Y.; McGinnis, S.; Madden, T.L. NCBI BLAST: A Better Web Interface. Nucleic Acids Res. 2008, 36, W5–W9. [CrossRef][PubMed] 37. Wang, X.; Xu, Y.; Zhang, S.; Cao, L.; Huang, Y.; Cheng, J.; Wu, G.; Tian, S.; Chen, C.; Liu, Y.; et al. Genomic Analyses of Primitive, Wild and Cultivated Citrus Provide Insights into . Nat. Genet. 2017, 49, 765–772. [CrossRef][PubMed] 38. Wang, L.; He, F.; Huang, Y.; He, J.; Yang, S.; Zeng, J.; Deng, C.; Jiang, X.; Fang, Y.; Wen, S.; et al. Genome of Wild Mandarin and Domestication History of Mandarin. Mol. Plant 2018, 11, 1024–1037. [CrossRef] [PubMed] 39. Zhu, C.; Zheng, X.; Huang, Y.; Ye, J.; Chen, P.; Zhang, C.; Zhao, F.; Xie, Z.; Zhang, S.; Wang, N.; et al. Genome Sequencing and CRISPR/Cas9 Gene Editing of an Early Flowering Mini-Citrus (Fortunella Hindsii). Plant Biotechnol. J. 2019, 17, 2199–2210. [CrossRef][PubMed] 40. CLC sequence Viewer. Quiagen. Available online: www.clcbio.com (accessed on 3 February 2020). 41. Sherry, S.; Xiao, C.; Durbrow, K.; Kimelman, M.; Rodarmer, K.; Shumway, M.; Yaschenko, E. NCBI SRA Toolkit Technology for Next Generation Sequence Data. In Proceedings of the Plant and Animal Genome XX Conference, San Diego, CA, USA, 14–18 January 2012. 42. Krueger, F. Trim Galore. Available online: http://www.bioinformatics.babraham.ac.uk/projects/trimgalore/ (accessed on 12 February 2020). 43. Lunter, G.; Goodson, M. Stampy: A Statistical Algorithm for Sensitive and Fast Mapping of Illumina Sequence Reads. Genome Res. 2011, 21, 936–939. [CrossRef][PubMed] 44. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [CrossRef][PubMed] 45. Narasimhan, V.; Danecek, P.; Scally, A.; Xue, Y.; Tyler-Smith, C.; Durbin, R. BCFtools/RoH: A Hidden Markov Model Approach for Detecting Autozygosity from next-Generation Sequencing Data. Bioinformatics 2016, 32, 1749–1751. [CrossRef] 46. Scholz, M. Available online: http://www.metagenomics.wiki/tools/samtools/consensus-sequence (accessed on 20 April 2020). 47. Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [CrossRef] 48. Wang, F. SIOX Plugin in ImageJ: Area Measurement Made Easy. UV4Plants Bull. 2017, 2, 37–44. [CrossRef] 49. Igathinathane, C.; Pordesimo, L.O.; Columbus, E.P.; Batchelor, W.D.; Methuku, S.R. Shape Identification and Particles Size Distribution from Basic Shape Parameters Using ImageJ. Comput. Electron. Agric. 2008, 63, 168–182. [CrossRef] 50. Shapiro, S.S.; Wilk, M.B. An Analysis of Variance Test for Normality (Complete Samples). Biometrika 1965, 52, 591–611. [CrossRef] 51. Wilcoxon, F. Individual Comparisons of Grouped Data by Ranking Methods. J. Econ. Entomol. 1946, 39, 269–270. [CrossRef][PubMed] 52. Suzuki, R.; Shimodaira, H. Pvclust: An R Package for Assessing the Uncertainty in Hierarchical Clustering. Bioinformatics 2006, 22, 1540–1542. [CrossRef][PubMed] 53. Martins, T.G. Computing and Visualizing PCA. Available online: https://www.r-bloggers.com/computing- and-visualizing-pca-in-r/ (accessed on 22 June 2020). 54. Mevik, B.-H. The pls Package: Principal Component and Partial Least Squares Regression in R. J. Stat. Softw. 2007, 18, 1–24. [CrossRef] 55. Wickham, H. Ggplot2, 2nd ed.; Springer International Publishing: New York, NY, USA, 2009. [CrossRef] 56. Rousseaux, E.; Bolano, D.; Ritschard, G. The Rsocialdata Package: Handling Survey Data in R. In Proceedings of the XXVII IUSSP International Population Conference, Busan, Korea, 26–31 August 2013. 57. Hunter, J.E.; Cohen, S.H. Package: Igraph. Educ. Psychol. Meas. 2007.[CrossRef] Genes 2020, 11, 807 28 of 30

58. R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2017; ISBN 3-900051-07-0. Available online: http://www.R-project.org (accessed on 10 March 2020). 59. Rapisarda, P.; Fanella, F.; Maccarone, E. Reliability of Analytical Methods for Determining Anthocyanins in Blood Orange Juices. J. Agric. Food Chem. 2000, 48, 2249–2252. [CrossRef] 60. Choudhary, R.; Bowser, T.J.; Weckler, P.; Maness, N.O.; McGlynn, W. Rapid Estimation of Lycopene Concentration in Watermelon and Tomato Puree by Fiber Optic Visible Reflectance Spectroscopy. Postharvest Biol. Technol. 2009, 52, 103–109. [CrossRef] 61. Rapisarda, P.; Bellomo, S.E.; Fabroni, S.; Russo, G. Juice Quality of Two New Mandarin-like Hybrids (Citrus Clementina Hort. Ex Tan x Citrus Sinensis L. Osbeck) Containing Anthocyanins. J. Agric. Food Chem. 2008, 56, 2074–2078. [CrossRef] 62. Torres, G.J.J.; Tadiotti, A.C.; De Sylos, C.M. Comparison of Carotenoid Content in Tomato, Tomato Pulp and Ketchup By Liquid Chromatography. Alim. Nutr. Araraquara 2006, 17, 353–358. 63. Samuel, R.; Ehrendorfer, F.; Chase, M.W.; Greger, H. Phylogenetic Analyses of () Based on Non-Coding DNA Sequences and Phytochemical Features. Plant Biol. 2001, 3, 77–87. [CrossRef] 64. Bayer, R.J.; Mabberley, D.J.; Morton, C.; Miller, C.H.; Sharma, I.K.; Pfeil, B.E.; Rich, S.; Hitchcock, R.; Sykes, S. A Molecular Phylogeny of the Orange Subfamily (Rutaceae: Aurantioideae) Using Nine CpDNA Sequences. Am. J. Bot. 2009, 96, 668–685. [CrossRef][PubMed] 65. Mou, F.J.; Tu, T.Y.; Chen, Y.Z.; Zhang, D.X. Phylogenetic Relationship of Clauseneae (Rutaceae) Inferred from Plastid and Nuclear DNA Data and Taxonomic Implication for Some Major Taxa. Nord. J. Bot. 2018, 36, e01552. [CrossRef] 66. Ramstad, E.; Lin, N.C.; Lin, T.J.; Koo, W.Y. Coumurrayin, a New Coumarin from Murraya paniculata L. Jack. Tetrahedron Lett. 1968, 9, 811–813. [CrossRef] 67. Ferracin, R.J.; Da Silva, M.F.D.G.F.; Fernandes, J.B.; Vieira, P.C. Flavonoids from the Fruits of Murraya Paniculata. 1998, 47, 393–396. [CrossRef] 68. Zhang, H.; Koes, R.; Shang, H.; Fu, Z.; Wang, L.; Dong, X.; Zhang, J.; Passeri, V.; Li, Y.; Jiang, H.; et al. Identification and Functional Analysis of Three New Anthocyanin R2R3-MYB Genes in Petunia. Plant Direct 2019, 1–13. [CrossRef] 69. Dembeck, L.M.; Huang, W.; Carbone, M.A.; Mackay, T.F.C. Genetic Basis of Natural Variation in Body Pigmentation in Drosophila Melanogaster. Fly 2015, 9, 75–81. [CrossRef] 70. Gompel, N.; Prud’Homme, B.; Wittkopp, P.J.; Kassner, V.A.; Carroll, S.B. Chance Caught on the Wing: Cis-Regulatory Evolution and the Origin of Pigment Patterns in Drosophila. Nature 2005, 433, 481–487. [CrossRef] 71. Hoekstra, H.E. Genetics, Development and Evolution of Adaptive Pigmentation in Vertebrates. Heredity 2006, 97, 222–234. [CrossRef] 72. Quattrocchio, F.; Wing, J.; Van Der Woude, K.; Souer, E.; De Vetten, N.; Joseph, M.; Koes, R. Molecular Analysis of the Anthocyanin2 Gene of Petunia and Its Role in the Evolution of Flower Color. Plant Cell 1999, 11, 1433–1444. [CrossRef] 73. Baudry, A.; Heim, M.A.; Dubreucq, B.; Caboche, M.; Weisshaar, B.; Lepiniec, L. TT2, TT8, and TTG1 Synergistically Specify the Expression of BANYULS and Proanthocyanidin Biosynthesis in Arabidopsis Thaliana. Plant J. 2004, 39, 366–380. [CrossRef] 74. Hatlestad, G.J.; Lloyd, A. The Betalain Secondary Metabolic Network. In Pigments in Fruits and Vegetables. Genomics and Dietetics; Chen, C., Ed.; Springer: New York, NY, USA, 2015; pp. 127–140. 75. Sheehan, H.; Moser, M.; Klahre, U.; Esfeld, K.; Dell’Olivo, A.; Mandel, T.; Metzger, S.; Vandenbussche, M.; Freitas, L.; Kuhlemeier, C. MYB-FL Controls Gain and Loss of Floral UV Absorbance, a Key Trait Affecting Preference and Reproductive Isolation. Nat. Genet. 2016, 48, 159–166. [CrossRef][PubMed] 76. Continella, A.; Pannitteri, C.; La Malfa, S.; Legua, P.; Distefano, G.; Nicolosi, E.; Gentile, A. Influence of Different Rootstocks on Yield Precocity and Fruit Quality of ‘Tarocco Scirè’ Pigmented Sweet Orange. Sci. Hortic. 2018, 230, 62–67. [CrossRef] 77. Choinski, J.S.; Ralph, P.;Eamus, D. Changes in during Leaf Expansion in Corymbia Gummifera. Aust. J. Bot. 2003, 51, 111–118. [CrossRef] Genes 2020, 11, 807 29 of 30

78. Cai, Z.Q.; Slot, M.; Fan, Z.X. Leaf Development and Photosynthetic Properties of Three Tropical Tree Species with Delayed Greening. Photosynthetica 2005, 43, 91–98. [CrossRef] 79. Lawrence, W.J.C.; Price, J.R.; Robinson, G.M.; Robinson, R. A Survey of Anthocyanins. V. Biochem. J. 1938, 32, 1661–1667. [CrossRef] 80. Neill, S.O.; Gould, K.S.; Kilmartin, P.A.; Mitchell, K.A.; Markham, K.R. Antioxidant Activities of Red versus Green Leaves in Elatostema Rugosum. Plant Cell Environ. 2002, 25, 539–547. [CrossRef] 81. Zhou, Y.; Zhou, H.; Lin-Wang, K.; Vimolmangkang, S.; Espley, R.V.; Wang, L.; Allan, A.C.; Han, Y. Transcriptome Analysis and Transient Transformation Suggest an Ancient Duplicated MYB Transcription Factor as a Candidate Gene for Leaf Red Coloration in Peach. BMC Plant Biol. 2014, 338, 1–13. [CrossRef] 82. Jaakola, L.; Hohtola, A.; Määttä, K.; Törrönen, R.; Kärenlampi, S. Flavonoid Biosynthesis in Bilberry (Vaccinium myrtillus L.). Acta Hortic. 2002, 618, 415–419. [CrossRef] 83. Curk, F.; Ollitrault, F.; Garcia-Lor, A.; Luro, F.; Navarro, L.; Ollitrault, P. Phylogenetic Origin of Limes and Lemons Revealed by Cytoplasmic and Nuclear Markers. Ann. Bot. 2016, 117, 565–583. [CrossRef] 84. Scora, R.W. On the History and Origin of Citrus. Bull. Torrey Bot. Club 1975, 102, 369–375. [CrossRef] 85. Nicolosi, E.; Deng, Z.N.; Gentile, A.; La Malfa, S.; Continella, G.; Tribulato, E. Citrus Phylogeny and Genetic Origin of Important Species as Investigated by Molecular Markers. Theor. Appl. Genet. 2000, 100, 1155–1166. [CrossRef] 86. Faraco, M.; Spelt, C.; Bliek, M.; Verweij, W.; Hoshino, A.; Espen, L.; Prinsi, B.; Jaarsma, R.; Tarhan, E.; deBoer, A.H.; et al. Hyperacidification of Vacuoles by the Combined Action of Two Different P-ATPases in the Tonoplast Determines Flower Color. Cell Rep. 2014, 6, 32–43. [CrossRef] 87. Spelt, C.; Quattrocchio, F.; Mol, J.; Koes, R. ANTHOCYANIN1 of Petunia Controls Pigment Synthesis, Vacuolar PH, and Seed Coat Development by Genetically Distinct Mechanisms. Plant Cell 2002, 14, 2121–2213. [CrossRef] 88. Faraco, M.; Li, Y.; Li, S.; Spelt, C.; Di Sansebastiano, G.P.; Reale, L.; Ferranti, F.; Verweij, W.; Koes, R.; Quattrocchio, F.M. A Tonoplast P3B-ATPase Mediates Fusion of Two Types of Vacuoles in Petal Cells. Cell Rep. 2017, 19, 2413–2422. [CrossRef][PubMed] 89. Quattrocchio, F.; Verweij, W.; Kroon, A.; Spelt, C.; Mol, J.; Koes, R. PH4 of Petunia Is an R2R3 MYB Protein That Activates Vacuolar Acidification through Interactions with Basic-Helix-Loop-Helix Transcription Factors of the Anthocyanin Pathway. Plant Cell 2006, 18, 1274–1291. [CrossRef][PubMed] 90. Verweij, W.; Spelt, C.; Di Sansebastiano, G.P.; Vermeer, J.; Reale, L.; Ferranti, F.; Koes, R.; Quattrocchio, F. An H+ P-ATPase on the Tonoplast Determines Vacuolar PH and Flower Colour. Nat. Cell Biol. 2008, 10, 1456–1462. [CrossRef] 91. Albert, N.W.; Lewis, D.H.; Zhang, H.; Schwinn, K.E.; Jameson, P.E.; Davies, K.M. Members of an R2R3-MYB Transcription Factor Family in Petunia Are Developmentally and Environmentally Regulated to Control Complex Floral and Vegetative Pigmentation Patterning. Plant J. 2011, 65, 771–784. [CrossRef] 92. Schwinn, K.; Venail, J.; Shang, Y.; Mackay, S.; Alm, V.; Butelli, E.; Oyama, R.; Bailey, P.; Davies, K.; Martin, C. A Small Family of MYB-Regulatory Genes Controls Floral Pigmentation Intensity and Patterning in the Genus Antirrhinum. Plant Cell 2006, 18, 831–851. [CrossRef][PubMed] 93. Strazzer, P.; Spelt, C.E.; Li, S.; Bliek, M.; Federici, C.T.; Roose, M.L.; Koes, R.; Quattrocchio, F.M. Hyperacidification of Citrus Fruits by a Vacuolar Proton-Pumping P-ATPase Complex. Nat. Commun. 2019, 10, 1–11. [CrossRef] 94. Lo Piero, A.R.; Puglisi, I.; Petrone, G. Gene Characterization, Analysis of Expression and in Vitro Synthesis of Dihydroflavonol 4-Reductase from [Citrus Sinensis (L.) Osbeck]. Phytochemistry 2006, 67, 684–695. [CrossRef] 95. Sylvestre-Gonon, E.; Law, S.R.; Schwartz, M.; Robe, K.; Keech, O.; Didierjean, C.; Dubos, C.; Rouhier, N.; Hecker, A. Functional, Structural and Biochemical Features of Plant Serinyl-Glutathione Transferases. Front. Plant Sci. 2019, 10, 1–22. [CrossRef][PubMed] 96. Lo Piero, A.R.; Puglisi, I.; Petrone, G. Gene Isolation, Analysis of Expression, and in Vitro Synthesis of Glutathione S-Transferase from Orange Fruit [Citrus Sinensis L. (Osbeck)]. J. Agric. Food Chem. 2006, 54, 9227–9233. [CrossRef][PubMed] 97. Licciardello, C.; D’Agostino, N.; Traini, A.; Recupero, G.R.; Frusciante, L.; Chiusano, M.L. Characterization of the Glutathione S-Transferase Gene Family through ESTs and Expression Analyses within Common and Pigmented Cultivars of (L.) Osbeck. BMC Plant Biol. 2014, 14, 1–15. [CrossRef][PubMed] Genes 2020, 11, 807 30 of 30

98. Sanchez-Ballesta, M.T.; Zacarias, L.; Granell, A.; Lafuente, M.T. Accumulation of PAL Transcript and PAL Activity as Affected by Heat-Conditioning and Low-Temperature Storage and Its Relation to Chilling Sensitivity in Mandarin Fruits. J. Agric. Food Chem. 2000, 48, 2726–2731. [CrossRef][PubMed] 99. Licciardello, C.; Las Casas, G.; Caruso, M.; Caruso, P.; Russo, M.P.; Pietro Paolo, D.; Russo, G.; Reforgiato Recupero, G. The Evolution of Citrate Metabolism in Acidic and Acidless Citrus Genotypes during Fruit Development and Ripening. Acta Hortic. 2016, 1135, 53–60. [CrossRef] 100. Wang, Y.; Ji, S.; Zang, W.; Wang, N.; Cao, J.; Li, X.; Sun, C. Identification of Phenolic Compounds from a Unique Citrus Species, Finger Lime () and Their Inhibition of LPS-Induced NO-Releasing in BV-2 cell Line. Food Chem. Toxicol. 2019, 129, 54–63. [CrossRef][PubMed] 101. Galliot, C.; Stuurman, J.; Kuhlemeier, C. The Genetic Dissection of Floral Syndromes. Curr. Opin. Plant Biol. 2006, 9, 78–82. [CrossRef] 102. Ahmed, N.U.; Park, J.I.; Jung, H.J.; Yang, T.J.; Hur, Y.; Nou, I.S. Characterization of Dihydroflavonol 4-Reductase (DFR) Genes and Their Association with Cold and Freezing Stress in Brassica Rapa. Gene 2014, 550, 46–55. [CrossRef] 103. Zhao, D.; Tao, J. Recent Advances on the Development and Regulation of Flower Color in Ornamental Plants. Front. Plant Sci. 2015, 6, 1–13. [CrossRef] 104. Serrano-Díaz, J.; Sánchez, A.M.; Maggi, L.; Martínez-Tomé, M.; García-Diz, L.; Murcia, M.A.; Alonso, G.L. Increasing the Applications of Crocus Sativus Flowers as Natural Antioxidants. J. Food Sci. 2012, 77, 1162–1168. [CrossRef] 105. Caruso, M.; Las Casas, G.; Scaglione, D.; Gattolin, S.; Rossini, L.; Distefano, G.; Cattonaro, F.; Catara, A.; Licciardello, G.; Morgante, M.; et al. Detection of Natural and Induced Mutations from next Generation Sequencing Data in Sweet Orange Bud Sports. Acta Hortic. 2019, 1230, 117–122. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).