TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Zootaxa 3620 (3): 379–403 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3620.3.3 http://zoobank.org/urn:lsid:zoobank.org:pub:7B363037-12FA-4C2E-A219-0040FA12BCC6 Symphurus orientalis (Bleeker) redefined based on morphological and molecular characters (Pleuronectiformes: Cynoglossidae)

MAO-YING LEE1, THOMAS A. MUNROE2 & KWANG-TSAO SHAO3, 4 1Department of Aquaculture, National Taiwan Ocean University, No. 2, Peining Rd., 20224 Keelung, Taiwan. E-mail: [email protected] 2National Marine Fisheries Service National Systematics Laboratory, NOAA, Smithsonian Institution, P.O. Box 37012, National Museum of Natural History, WC–57, MRC–153, Washington, DC 20013–7012. E-mail: [email protected] 3Laboratory of Fish Ecology and Evolution, Biodiversity Research Center, Academia Sinica, Nankang, 11529 Taipei, Taiwan. E-mail: [email protected] 4Corresponding author. E-mail: [email protected]

Abstract

Aphoristia (= Symphurus) orientalis Bleeker 1879, collected from an unspecified depth and location in Japanese waters, is the first described species of symphurine tonguefish from Indo-Pacific waters. The original description with accompanying illustration is based on the unique holotype specimen and provides limited diagnostic characters for this taxon. Subsequent to its description, the holotype of A. orientalis has been lost. Limited diagnostic information and loss of the holotype have caused considerable confusion to subsequent systematic studies regarding the identity of this and similar tonguefish species occurring in the Indo-West Pacific region. Several, often-cited, taxonomic accounts purportedly redescribing S. orientalis are erroneous because they include more than one species in these redescriptions. These erroneous redescriptions not only confused the species concept of S. orientalis (Bleeker), but also confounded the systematics of similar Indo-West Pacific tonguefishes. Symphurus novemfasciatus Shen and Lin, described on two specimens collected in southern Taiwan, shares many morphological and pigmentation features similar to those of S. orientalis. Morphological data from a large series of tonguefishes collected in Taiwanese and Japanese waters, as well as molecular data from a smaller number of specimens from these locations, including the type locality of S. novemfasciatus, confirm the presence of only one species, S. orientalis (Bleeker), among these specimens. Symphurus novemfasciatus Shen and Lin is therefore regarded as a junior subjective synonym of S. orientalis. Symphurus orientalis is redefined based on a large series of specimens identified by a consistent set of morphological criteria, and a neotype is designated to stabilize nomenclature and systematics of this species. Symphurus orientalis differs from congeners by its combination of: a predominant 1–2–2–2–2 pattern of interdigitation of proximal dorsal-fin pterygiophores and neural spines, 12 caudal- fin rays, 9 abdominal and 52–55 total vertebrae, four hypurals, 96–101 dorsal-fin rays, 82–89 anal-fin rays, 87–99 longitudinal scale rows, 37–42 transverse scales, 5–11 (usually) distinct, complete or incomplete, blackish-brown crossbands on the ocular side, uniformly white blind side, and conspicuous bluish-black peritoneum. Documenting morphological variation for S. orientalis represents the most important step towards clarification of the identity of this and other symphurine tonguefish species from this region. Reliable identification of specimens of S. orientalis also provides the foundation for evaluating the status of several other, poorly-known, nominal species of Indo-West Pacific tonguefishes that have features similar to those of S. orientalis. Improved identifications will lead to better knowledge on the geographic distribution of S. orientalis and these other species, as well as to improve estimates of biodiversity and the biogeography of Indo-West Pacific symphurine tonguefishes.

Key words: Symphurus orientalis, Symphurus novemfasciatus, flatfish, redescription, synonym, tonguefish, species com- plex, cryptic species

Introduction and history of the problem

Bleeker (1879) described a new species of tonguefish, Aphoristia orientalis, based on a single specimen collected from an unspecified location and depth in marine waters off Japan. This report represents the first reliable description of a member of Symphurus captured in the Indo-Pacific region. [Aphoristia Kaup, 1858 is currently

Accepted by J. Sparks: 10 Jan. 2013; published: 7 Mar. 2013 379 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

(Eschmeyer 2012) considered a junior subjective synonym of Symphurus Rafinesque, 1810 and this generic assignment is followed in this study.] Information provided in the original description and derived from the accompanying illustration of S. orientalis distinguishes this species as a tonguefish featuring 100 dorsal-fin rays, 86 anal-fin rays, 12 caudal-fin rays, approximately 90 longitudinal scales and 40 transverse scales, and with an ocular-side pigmentation pattern consisting of multiple crossbands, a uniformly white blind side, and black peritoneum. Somewhere in its history, the holotype of S. orientalis was lost and its whereabouts are unknown (Eschmeyer 2012). Limited diagnostic information contained in the original description, compounded by loss of this holotype, have rendered it difficult for subsequent researchers interested in the taxonomy and systematics of Indo-West Pacific tonguefishes to adequately distinguish the species described by Bleeker (1879). Of characters discussed in the original description, noteworthy is the number of caudal-fin rays (12) reported for the holotype, as this is one of the most important characters for differentiating phenetic groups of species within Symphurus (Ginsburg 1951; Chabanaud 1955; Munroe 1992). In an extensive study summarizing information from several thousand specimens of Symphurus, Munroe (1992) reported that the number of caudal-fin rays is one of the most conservative and important diagnostic features for identifying species of Symphurus. Several other internal morphological characteristics of symphurine tonguefishes also important in characterizing and diagnosing these species include the pattern of interdigitation of dorsal proximal pterygiophores and neural spines (ID pattern; Munroe 1992) and the number of abdominal and total vertebrae (Chabanaud 1955; Munroe 1992). Indo-Pacific species of Symphurus can readily be separated into different phenetic groups based on combinations of the numbers of caudal-fin rays, abdominal vertebrae, and by their ID patterns (Munroe 1992). Internal features were not reported in the original description of A. orientalis and it is not now possible to know what the character states were for this nominal species. Thus, the species concept of S. orientalis as envisioned by Bleeker (1879) is known only from the limited information available in the original description and the accompanying illustration of this nominal species. Reliance on data presented in the original description of S. orientalis and the inability to compare the holotype specimen with other nominal species of Symphurus collected subsequently has resulted in considerable taxonomic confusion and misidentifications regarding specimens of Symphurus collected in the Indo-Pacific region. Jordan and Starks (1906), for example, in their review of the flounders and soles of Japan questioned whether the specimen described by Bleeker actually belonged to Symphurus. Okada and Matsubara (1938) and Matsubara (1955) wrote identification keys for fishes occurring in Japanese waters, but did not list any catalogue information for specimens they examined. In their key to the species of Symphurus, they provided ranges for meristic and morphometric features for specimens purportedly of S. orientalis. However, based on specimens we identified as S. orientalis (Lee & Munroe unpubl. data), data in Matsubara’s study overestimates those for S. orientalis and appear to be derived from at least two, and possibly more, sympatric and morphologically similar species of Symphurus featuring 12 caudal-fin rays, including some specimens with meristic features much lower than those of S. orientalis (Bleeker 1879; Lee & Munroe unpubl. data). The works of Okada and Matsubara (1938) and Matsubara (1955) had a profound influence on another work, that of Ochiai (1959 Japanese edition; and English edition 1963), which purportedly redescribed S. orientalis. Interestingly, Ochiai’s redescription, which is based on catalogued specimens, reports ranges of several important meristic and morphometric features for this species that are the same as those listed in Matsubara’s study (1955). It is uncertain if Ochiai’s work was based on the same specimens as those included in Matsubara’s study (1955) because catalogue numbers for specimens were not included in the latter study, but it seems likely. Ochiai’s study (1959; 1963) is the most widely cited work on S. orientalis, but his redescription includes data from several morphologically similar species with 12 caudal-fin rays. A consequence of being so widely cited is that the erroneous data in Ochiai’s study has been perpetuated in subsequent literature based on this work and this has contributed significantly to the confusion and misunderstanding regarding the range of variation in morphological features in this nominal species. Chen and Weng (1965), based on four specimens, potentially represents the first report of S. orientalis from Taiwanese waters, but, according to the number of caudal-fin rays (15) they reported for their specimens, it is uncertain whether they actually examined any specimens of this species. Specimens included in the study by Chen and Weng (1965) have been lost so it is difficult to know whether these authors counted caudal-fin rays accurately, or if their redescription was based on specimens of more than one species, at least one of which featured 15 caudal-

380 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. fin rays. No species of Symphurus described to date has been found to have 15 fin rays as the typical count for caudal-fin rays (Munroe 1992; Lee et al. 2009a; 2009b). Although some individuals with 15 caudal-fin rays are occasionally encountered in specimens of symphurine species that typically have a count of 14 caudal-fin rays, we have never found any specimens with 15 (or even 14) caudal-fin rays among those species examined that characteristically have 12 caudal-fin rays. Therefore, it seems unlikely that the number of caudal-fin rays was accurately reported in the study of Chen and Weng (1965), and the tonguefishes they examined belonged to species characterized by 14 caudal-fin rays. With loss of the specimens, their identifications will never be determined. Incorrect information contained in the redescription of S. orientalis by Ochiai (1959; 1963) has been repeated in much of the subsequent systematic literature dealing with this species (e.g., Chyung 1961; Amaoka 1982; Shen 1984; Ochiai 1984; Ochiai 1987; Ochiai 1988; Ochiai 1989; Shen 1993; Kim & Choi 1994; Li & Wang 1995; Yamada 2000; 2002). Several studies dealing with western Pacific Symphurus (Munroe & Amaoka 1998; Munroe & Hashimoto 2008) have also noted cases where different nominal species have been incorrectly identified as S. orientalis. None of these studies, however, attempted to resolve issues regarding the identity and taxonomic status of S. orientalis. Shen and Lin (1984), likely influenced by misinformation on caudal-fin ray counts presented in Chen and Weng’s study (1965) for specimens purported to be S. orientalis from Taiwanese waters (as evidenced by comparisons section in account of S. strictus by Shen 1984:141), described the nominal species, S. novemfasciatus, from off Dong-Gang, southwestern Taiwan. In their description of S. novemfasciatus, Shen and Lin (1984) did not mention or diagnose their nominal species from the previously described S. orientalis despite the fact that it has 12 caudal-fin rays and multiple ocular-side crossbands, and also has dorsal- and anal-fin ray counts similar to those features reported for the holotype of S. orientalis. Subsequent studies recognizing S. novemfasciatus as a valid species (Munroe 1992; Shen 1993; Lin 1994; Li & Wang 1995; Munroe 2000; Liu 2008) have never adequately diagnosed this species from S. orientalis or, for that matter, any of three other previously described Indo-West Pacific species with similar meristic features including S. septemstriatus (Alcock, 1891), S. luzonensis Chabanaud, 1955, and S. fallax Chabanaud, 1957. Consequently, the taxonomic status of S. novemfasciatus, as well as that of these other species, is questionable. In recent years, symphurine tonguefishes have been collected by commercial fishery trawlers operating off Japan and Taiwan and these fishes are sometimes landed as bycatch species at several different fish ports in these countries. Recent collections of fishes taken by research vessels trawling in moderately deep waters off Japan and Taiwan (Lee unpubl. data) have also included specimens of Symphurus. Based on their relatively frequent occurrence and abundance in both scientific and commercial catches, these tonguefishes appear to be more common in deepwater habitats in these waters than previously thought. A large number of the symphurine tonguefishes captured off Japan and Taiwan and preserved in fish collections in these countries have been identified as S. orientalis. However, based on shared similarities in meristic and morphological characteristics, it is impossible to distinguish these specimens from S. novemfasciatus. Most often, specimens from Japan have been identified as S. orientalis, while those taken off southern Taiwan have been identified as either species. In addition to this problem, among museum lots containing specimens from Taiwanese and Japanese waters that have been identified as S. orientalis, we have also identified several other diminutive species of tonguefishes featuring 12 caudal-fin rays. Taxonomic status of these nominal species is unresolved and currently under study (Lee & Munroe in prep.). However, given the overall similarity of these diminutive species to S. orientalis, it seems likely that specimens of these small-sized species could easily have been misidentified as juvenile S. orientalis and included in earlier accounts for that species. As mentioned previously, other potential problems regarding the taxonomy of Indo-West Pacific symphurine tonguefishes involve the status of several nominal species similar to S. orientalis and S. novemfasciatus including S. septemstriatus, S. luzonensis, and S. fallax. These species also have 12 caudal-fin rays and other meristic features similar to those of both S. orientalis and S. novemfasciatus. In the original descriptions of these species, none were ever compared and diagnosed from S. orientalis. Scant information, except for that provided in the original descriptions, is known about those rarely-caught species, which in the case of S. luzonensis and S. fallax is even more limited because we know these species only from information based on the unique holotype specimens. We currently lack reliable information as to how many of these nominal species are valid. Symphurus orientalis (Bleeker, 1879), as the oldest available name for an Indo-Pacific species of symphurine tonguefish, has priority over any other names proposed subsequently for this species. An important first step in

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 381 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. stabilizing the taxonomy and nomenclature for this and other similar nominal species from this region (and beyond) is to more precisely define the concept of S. orientalis. Proper delineation of this species requires better understanding of the variation present in its morphological features. To address this need, we provide a redescription of this species based on information from the original description, together with new data recovered from examination of a large series of recently-collected specimens that were identified as S. orientalis based on their shared similarities with the specimen originally reported in Bleeker (1879). We also designate a neotype for this species to further resolve taxonomic confusion between this and other morphologically similar species. The large number of similarities between S. orientalis and S. novemfasciatus Shen and Lin, 1984 required us to test the hypothesis that specimens from southeastern Taiwan, the type locality of S. novemfasciatus, represent a species distinct from S. orientalis from off Japan. This comparison was made using both morphological characters and molecular information analyzed from DNA samples of a series of specimens from Taiwan and Japan, respectively. Recently-developed molecular methods comparing genetic divergence between nominal species can be useful for identifying cryptic species and disentangling problems involving two or more morphologically similar species (Victor 2007; 2008; Diaz de Astarloa et al. 2008; Pyle et al. 2008; Last et al. 2010). While these molecular methods can provide evidence for taxonomists to discover cryptic (and often, undescribed) species, they can also confirm the status of invalid species (Byrkjedal et al. 2007; Dooley & Jimenez 2008). Since molecular approaches do not rely on morphology, they provide an independent test to evaluate the status of different populations that share a similar morphology. Because of the confusion surrounding the identity of S. orientalis and the status of similar nominal species occurring in the Indo-West Pacific, we lack proper understanding of the systematics, distribution, and biogeography of all of these fishes. Tonguefishes purported to be S. orientalis have been reported from a variety of locations including that off Vladivostok, Russia (Jordan & Starks 1906; Jordan et al. 1913; Okada 1938), in Korean waters (Mori 1928; Mori & Uchida 1934; Okada 1938; Mori 1952; Kamohara 1958; Ochiai 1959; 1963; Chyung 1961; 1977; Kim & Choi 1994; Sakamoto 1997; Yamada 2000; Lin 2001; Youn 2002; Kim et al. 2005), off mainland China (Chu 1931; Wu 1932; Fowler 1934; Ochiai 1959; Wang 1993; Li & Wang 1995; Yamada 2000; Munroe 2000; Lin 2001; Liu 2008), and the Philippine Islands (Fourmanoir 1985). Many of these records are based on species other than S. orientalis, so it is difficult to know the actual geographic distribution of S. orientalis. Resolving the taxonomic status of both S. orientalis and S. novemfasciatus is an important contribution and first step towards understanding the systematics of these and other nominal species of Symphurus characterized by 12 caudal-fin rays and high counts of meristic features. This information, in turn, provides the foundation for better estimates of the distributions and ecology of these species, as well as improving our knowledge concerning the biodiversity and biogeography of Indo-West Pacific tonguefishes.

Materials and methods

A total of 94 specimens, including preserved specimens in fish collections as well as fresh specimens collected in the field, constituted the basis for data collected in this study. Included among these specimens were the holotype of S. novemfasciatus and 10 other specimens collected from the type locality of S. novemfasciatus. Tissue samples for molecular analyses involved a muscle biopsy from specimens taken in field collections made in Japan and Taiwan. Tissue samples were originally stored in 95% ethanol. Voucher specimens for all tissue samples analyzed were subsequently preserved in 10% formalin, transferred to 75% ethanol, catalogued and deposited in fish collections (see Material examined section). Institutional abbreviations follow those listed in http://www.asih.org/ codons.pdf, except that of ASIZP (formerly ASIZT), the Biodiversity Research Center, Academia Sinica, Taipei, Taiwan, and NMMBP, National Museum of Marine Biology and Aquarium, Pintung, Taiwan. Comparative materials for all other Indo-Pacific species of Symphurus included in this study are listed in Munroe (1992), Shen (1993), Munroe and Amaoka (1998), Krabbenhoft and Munroe (2003), Munroe (2006), Munroe and Hashimoto (2008), and Lee et al. (2009a; 2009b). Methods for counting meristic characters and for measuring morphometric features and general terminology follow those of Munroe (1998). All 94 specimens examined were radiographed. Terminology and formulae for interdigitation patterns of proximal dorsal pterygiophores and neural spines (ID pattern) follow those of Munroe (1992). Morphometric characters were taken to the nearest 0.1 mm using either dial calipers or a dissecting

382 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. microscope fitted with an ocular micrometer. Morphometric features are expressed either as proportions in percent standard length (SL) or percent head length (HL). Description of pigmentation features are based primarily on freshly-landed specimens, with supplemental information provided from specimens preserved in formalin and transferred to 75% ethanol. Maturity was estimated by macroscopic examination of the extent of posterior elongation of ovaries and presence of developing ova in the ovaries (both observed by using light transmitted through the body). In species of Symphurus, no obvious differences are apparent in testis size between mature and immature males; therefore, estimates of maturity are based entirely on females. To examine genetic divergence in nominal species, some researchers (Hebert et al. 2003; Ward et al. 2005) suggest using sequences of the 5’ region of the mitochondrial cytochrome c oxidase subunit I gene (CO I or COX I) for species identification, whereas others recommend using 16S rRNA as a good model for assisting taxonomic works (Akimoto et al. 2002; Maretto et al. 2007; Lakra et al. 2009). We chose to examine both genes in an attempt to maximize the information derived from tissue samples. Total genomic DNA was extracted from 12 individuals of S. orientalis (identifications based on morphological and pigmentation characters consistent with those listed in Bleeker’s (1879) original description of this species), including 10 from Taiwan and two from Japan, as well as that from 10 individuals tentatively identified as S. novemfasciatus (based on their capture at Dong-Gang, Taiwan, the type locality of this nominal species). For comparative purposes, analyses of DNA also included data from three individuals of S. strictus Gilbert (identifications based on comparisons with original description), four S. hondoensis Hubbs (identifications following redescription of Munroe & Amaoka (1998)), and six S. megasomus Lee et al. (based on tissue samples of type specimens). DNA was extracted using the Genomic DNA Mini Kit (Geneaid, Taipei, Taiwan). Approximately 639 base pair (bp) fragments of the COX I gene and 510 bp of the 16S rRNA were amplified using the following primer pair 16Sa-L (5’CGCCTGTTTACCAAAAACATCGCCT’) and 16Sb-H (5’CCGGTCTGAACTCAGATCACGT’) (Palumbi 1996) for the 16S rRNA gene, and a newly developed primer pair Symphurus-COIF (5’GGTGCCTGAGCHGGRATAATTGGHAC’) and Symphurus-COIR (5’TAAATTTTTGKGTGGCCAAAGAATCA’) for the COI gene. A polymerase chain reaction (PCR) was carried out using a thermal cycler (BIO-RAD, Philadelphia, PA, USA) in 25-μl reaction volumes containing 100 ng total DNA, 1 μM of each primer, 0.4 mM dNTP, 1x reaction buffer, and 0.5 U of Taq polymerase (Genomics, Taipei, Taiwan) with denaturation at 94°C for 4 min; followed by 35 cycles of denaturing at 94°C for 30 s, annealing at 48°C for 45 s, and extension at 72°C for 1 min, with a final extension at 72°C for 10 min. The PCR products were then sequenced bidirectionally and analyzed on an ABI3730XL model (Applied Biosystems, Foster City, CA, USA). All sequences were checked against electropherograms and manually edited using the program 4Peaks version 1.7 (Griekspoor & Groothuis, 2006). In order to confirm the absence of stop codons in the amplified COI, we translated the nucleotide sequences with the vertebrate mitochondrial genetic code using EMBOSS- transeq (EMBL-EBI, URL http://www.ebi.ac.uk/Tools/st/emboss_transeq/). All sequences were aligned with CLUSTAL X version 1.81 (Thompson et al. 1997). Nucleotide genetic distances, the Kimura two-parameter distance (K2P) (Kimura 1980) substitution model including transitions and transversions, complete deletion of gaps/missing data, uniform rates among sites, and between and within species comparisons, were also calculated using MEGA 4.0 (Tamura et al. 2007). Trees based on sequence data were constructed by the neighbor-joining (NJ) method and evaluated by 10,000 bootstrapping replications (Felsenstein 1985) using MEGA 4.0 (Tamura et al. 2007). Trees were constructed only to show divergence in genetic sequences among the samples analyzed. We decided to use the neighbor-joining method instead of maximum likelihood and maximum parsimony because our approach in this study focused on species identifications, with both COI (DNA barcoding) and 16S rRNA applied for this purpose. Sequences were deposited in GenBank (accession numbers JN678732—JN678801).

Symphurus orientalis (Bleeker, 1879) (Figs.1–5; Tables 1–2)

Aphoristia orientalis Bleeker, 1879: 31, Pl. 2 (fig. 1) (Japan; description, illustration of holotype). Symphurus orientalis.—Jordan and Snyder 1901: 122 (listed; questionable occurrence, Japan). Jordan and Starks 1906: 243 (synonymy; description based on Bleeker (1879); doubted validity of species; transfer to Symphurus; coasts of Japan, north

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 383 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

of Vladivostok, based on Schmidt (1904)). Jordan et al. 1913: 335 (listed in catalogue; both coasts of Japan, off Vladivostok, based on Schmidt (1904)). Hubbs 1915: 496 (brief description; one specimen, Suruga Gulf, Japan). Mori 1928: 8 (listed, Korea). Chu 1931: 94 (listed, China). Wu 1932: 162 (synonymy; listed, China). ?Fowler 1934: 223 (synonymy; redescription; Chihli, Peking, China and Japan; figure). Mori and Uchida 1934: 33 (listed; Korea). Taranetz 1937: 148 (in key). Okada 1938: 270 (listed; Honshu, Japan, Korea, and Vladivostok). Okada and Matsubara 1938: 439 (in part; brief morphological information for key; counts; off Japan, Pusan and Vladivostok). Chabanaud 1939: 27 (listed, world catalogue of flatfishes). Mori 1952:183 (listed, Pusan, Korea). Matsubara 1955: 1287 (in part) (brief data on meristic and morphometric features; Suruga Bay, Owase, Kochi, Japan and Pusan). Kamohara 1958: 64 (listed; Suruga Bay to Kochi Prefecture, Japan; and Korea). Ochiai 1959: 217 (in part) (redescription based on composite series of specimens; meristic and morphometric data following Matsubara (1955); figure; 200 m; China Sea, Yellow Sea, and Pacific side of southern Japan). Chyung 1961: 657 (in part) (redescription based on Ochiai (1959); Korea). Ochiai 1963: 102 (in part) (English edition of Ochiai (1959)). Chen and Weng 1965: 102 (in part? likely more than one species included in account; Tungkong, Taiwan; brief redescription). Chen 1969: 225, 226 (in part?) (brief description for identification key; follows Chen and Weng (1965); figure; Dong-Gang, Taiwan). Chyung 1977: 582 (listed; Pusan, Korea). ?Son 1980 (listed; east coast of Korea, cited from Kim and Choi (1994)). Yasuda et al. 1981: 19, 569 (local name in several languages). Amaoka 1982: 302–3, 408 (redescription based on one specimen; color photograph; Tosa Bay, Japan). ?Shen 1983: 107 (in part) (brief redescription possibly based on composite series of specimens; Taiwan). Shen 1984: 581 (in part) (redescription based on composite series of specimens; figure; in key; Taiwan). Ochiai 1984: 356 (in part) (redescription based on composite series of specimens following that of Ochiai (1959); figure; Japan, Suruga Bay to Yellow Sea, East China Sea). Chen and Yu 1986: 830 (in part) (listed; brief description for key; Taiwan). Shen 1986: 264 (Chinese, Japanese names). Li 1987: 513 (listed; figure; eastern Yellow Sea to northern South China Sea). Ochiai 1987: 931 (in part) (description following Ochiai (1959); color figure; Suruga Bay, Yellow Sea, East China Sea). Ochiai 1988: 342 (in part) (Japanese version of Ochiai (1984)). Ochiai 1989: 222 (in part) (description following Ochiai (1959); color figure; Suruga Bay, Yellow Sea, East China Sea). Munroe 1992: 374, 379 (ID pattern; meristic information). Lindberg and Federov 1993: 207 (mentioned in footnote; Japan side, sea of Japan). Shen 1993: 581 (in part) (redescription based on composite series of specimens; black and white photo not this species; Taiwan). Wang 1993: 115 (listed, South China Sea). Kim and Choi 1994:810 (no specimens; description based on composite series of specimens following Ochiai (1959); Korea (based on Son 1980)). Li and Wang 1995:380 (no specimens; redescription based on composite series of specimens following Ochiai (1959); illustrations; in key; China). Sakamoto 1997:684 (in part; more than one species included in brief account; color photo is not S. orientalis; 200–400 m; Japan, East China Sea, Yellow Sea). Munroe and Amaoka 1998: 389 (discussed confusion surrounding species concept; distinguished from S. hondoensis; Japan). Eschmeyer 1998: 1248, 2436 (literature; listed as valid species). Evseenko 1998: 61 (vertebral count; depth of occurrence; phylogenetic information of Pleuronectiformes). Schwarzhans 1999:366 (description and illustration of otoliths; Japan). Yamada 2000: 1392 (in part) (brief redescription based on composite series of specimens following Ochiai (1959); in key; illustration; 200–400 m; Pacific coast Japan, East China Sea, Yellow Sea). Munroe 2000: 646 (listed, South China Sea). Lin 2001: 458 (listed, China’s seas including northeastern Yellow Sea to north of South China Sea). Munroe 2001: 3895 (listed, West Central Pacific). Shinohara et al. 2001: 337 (listed, Tosa Bay, Japan). Yoda et al. 2002: 29 (listed; Japanese, English names). Yamada 2002:1392 (in part) (English edition of Yamada (2000)). Youn 2002:441, 690 (in part) (brief redescription; in key; Korea). Kim et al. (2005): 490 (in part) (brief redescription; listed, Korea; photograph not of this species). Shinohara et al. 2005: 443 (listed, off Ryukyu Islands, Japan). Liu 2008: 1057 (listed, China, in eastern part of Yellow Sea and South China Sea; off Japan). Munroe and Hashimoto 2008: 44 (comments on misidentifications; comparisons with S. thermophilus). Lee et al. 2009b: 57 (compared with S. multimaculatus). Shen and Wu 2011: 763 (brief redescription with illustration; Taiwan). Symphurus arientalis (Bleeker).—Minami 1988:962 (in part; meristic data follows that of Ochiai (1959); description of larval stages; Japan). Symphurus orientulis (Bleeker).—Lin 1994: 747 (listed, China’s seas including northeastern Yellow Sea to north of South China Sea). Symphurus novemfasciatus Shen and Lin, 1984: 8, Fig. 3 (based on two specimens; color photograph; Tung-Kong (=Dong- Gang), Taiwan). Shen 1984:141 (after Shen and Lin (1984); description, color figure; Taiwan; compared with S. septemstriatus (Alcock)). Shen 1986: 264 (listed; Chinese name). Chen and Yu 1986: 831 (listed; brief description for key). Munroe 1992: 379 (listed in table; meristic features following those in original description). Shen 1993: 581 (description based on Shen and Lin (1984), color photograph; Taiwan). Lin 1994: 747 (listed, sandy flat, southern Taiwan). Li and Wang 1995: 383 (no specimens; description based on Shen and Lin (1984); black and white photo; in key). Eschmeyer 1998: 1204, 2436 (literature; listed as valid species). Munroe 2000: 646 (listed; South China Sea). Liu 2008: 1057 (listed; off Dong-Gang, southwestern Taiwan). Ho and Shao 2011:63 (listed; type catalogue; Taiwan). Shen and Wu 2011: 763 (brief description with color photo). Symphurus cf. orientalis (not of Bleeker).—Sowerby 1930: 182 (Symphurus sp. listed in Schmidt (1904) likely a species of Cynoglossus). Shen 1984: 141 (compared specimen identified as S. strictus Gilbert with S. orientalis sensu Chen and Weng (1965); Taiwan). ?Fourmanoir 1985: 50 (three specimens, Philippine Islands). Hashimoto et al. 1988: 87 (Kaikata Caldera, west of Chichijima Island, Ogasawara (Bonin) Islands). Hashimoto et al. 1995: 585 (hydrothermal vents, Minami-Ensei Knoll, Mid-Okinawa Trough, Western Pacific). Ono et al. 1996: 223 (hydrothermal vents, Kaikata Seamount near Ogasawara (Bonin) Islands, South Japan). Fujikura et al. 2002: 24 (hydrothermal vent, Okinawa Trough).

384 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Symphurus orientalis (not of Bleeker). Ohashi and Motomura 2011: 115 (brief description from single specimen; 70–100 m; Shibushi Bay, Kagoshima).

FIGURE 1. Symphurus orientalis (Bleeker, 1879), ASIZP 72344, female, 77.0 mm SL, off northeast Taiwan. A. Ocular-side pigmentation of freshly-caught specimen. B. Blind-side coloration of same specimen.

Neotype. BSKU 44238, mature female, 91.0 mm SL; Tosa Bay, off Kochi, Japan; bottom trawl, 300–400 m; collected by O. Okamura, 13 Nov 1987. Counted and measured. 91 specimens (54.7–109.0 mm SL). Taiwan, off northeastern coast. ASIZP 72344, mature female, 77.0 mm SL; 24º49.22’N, 121º58.50’E, T.-W. Wang, 23 Aug 2007. ASIZP 72345, male, 77.0 mm SL; 24º52.17’N, 121º57.53’E, T.-W. Wang, 23 Aug 2007. ASIZP 72346, mature female, 81.7 mm SL; 24º52.17’N, 121º57.53’E, T.-W. Wang, 23 Aug 2007. ASIZP 72347, male, 77.1 mm SL; 24º52.17’N, 121º57.53’E, T.-W. Wang, 23 Aug 2007. ASIZP 67634, mature female, 93.5 mm SL; Nanfang-Ao fish port, M.-Y. Lee, 6 Jan 2007. Taiwan, off northeastern coast, in landings at Da-Shi fish port. ASIZP 72340, 2 mature females, 87.8–91.0 mm SL; M.- Y. Lee, 23 Aug 2007. ASIZP 72372 (JN678742 and JN678777), mature female, 72.9 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72373 (JN678743 and JN678778), mature female, 86.0 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72374 (JN678744 and JN678779), male, 74.1 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72375 (JN678745 and JN678780), mature female, 91.3 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72376 (JN678746 and JN678781), male, 60.1 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72377 (JN678747 and JN678782), male, 64.0 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72378 (JN678748 and JN678783), mature female, 88.8 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72379 (JN678749 and JN678784), male, 83.3 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72380 (JN678750 and

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 385 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

JN678785), mature female, 78.6 mm SL; M.-Y. Lee, 30 Dec 2009. ASIZP 72381 (JN678751 and JN678786), mature female, 75.3 mm SL; M.-Y. Lee, 30 Dec 2009. NMMB–P 1663, male, 96.4 mm SL; Y.-M. Ju, 9 Sep 2003. NMMB–P 6127, mature female, 89.2 mm SL; Y.-M. Ju, 8 May 2003. NMMB–P 6184, male, 94.7 SL; Y.-M. Ju, 8 May 2003. NMMB–P 6186, mature female, 85.6 mm SL; Y.-M. Ju, 8 May 2003. NMMB–P 8631, 2 mature females, 78.8–89.0 mm SL; T.-M. Ju, 18 Jun 2005. NMMB–P 9114, 10 (2 exam., 1 male and 1 immature female), 67.1–78.2 mm SL; Ta-Shi (=Da-Shi) fish port, H.-W. Chen, 7 Aug 2008. NMMB–P 7484, mature female, 80.8 mm SL; Y.-M. Ju, 16 Apr 2004. Eastern Taiwan, off Su-ao. ASIZP 65666, male, 67.7 mm SL; 24º47.75’–24º48.01’N, 122º00.09’–122º02.09’E, ORE beam trawl, 265–352 m, Fishery Researcher I, OCP 273, 13 Jun 2005. ASIZP 66767, 4 (2 exam., females), 66.9–88.7 mm SL; 24º55.11’–24º57.47’N, 122º04.73’–122º05.43’E, beam trawl, 267–430 m, Fishery Researcher I, CP 291, 8 Aug 2005. ASIZP 66821, 4 (3 exam., male and an immature and mature female), 71.4–83.1 mm SL; 24º57.07’–24º58.27’N, 122º04.61’–122º05.57’E, beam trawl, 236–272 m, Fishery Researcher I, CP 292, 8 Aug 2005. ASIZP 66898, 10 (4 exam. 2 males, 1 immature and 1 mature female), 65.7–79.4 mm SL; 24º55.70’–24º57.23’N, 122º04.30’–122º04.81’E, beam trawl, 212–275 m, Ocean Researcher I, CP 290, 28 Aug 2004. Taiwan, off southwestern coast, in landings at Dong-Gang fish port. ASIZP 67650, male, 76.5 mm SL; M.-Y. Lee, 4 Jul 2007. ASIZP 67651, male, 83.8 mm SL; M.-Y. Lee, 4 July 2007. ASIZP 67652, male, 82.5 mm SL; M.-Y. Lee, 4 Jul 2007. ASIZP 67653, mature female, 80.4 mm SL; M.-Y. Lee, 4 Jul 2007. ASIZP 72341, 2 males, 72.1–81.1 mm SL; M.-Y. Lee, 28 May 2008. ASIZP 72342, 6 (4 males and 1 immature and 1 mature female), 69.1–84.2 mm SL; M.-Y. Lee, 28 May 2008. ASIZP 72556 (JN678752 and JN678787), male, 79.1 mm SL; M.-Y. Lee, 21 July 2011. ASIZP 72557 (JN678753 and JN678788), immature female, 75.3 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72558 (JN678754 and JN678789), immature female, 68.7 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72559 (JN678755 and JN678790), immature female, 62.6 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72560 (JN678756 and JN678791), male, 76.1 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72561 (JN678757 and JN678792), male, 62.8 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72562 (JN678758 and JN678793), male, 69.7 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72563 (JN678759 and JN678794), male, 80.5 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72564 (JN678760 and JN678795), male, 61.9 mm SL; M.-Y. Lee, 21 Jul 2011. ASIZP 72565 (JN678761 and JN678796), mature female, 72.3 mm SL; M.-Y. Lee, 21 Jul 2011. NMMB–P 3714, male, 72.1 mm SL; Dong-Kang (=Dong-Gang) fish port, J.-H. Wu, 2 May 2002. NMMB–P 5776, 2 mature females, 77.2–81.4 mm SL; Dong-Kang (=Dong-Gang) fish port, Y.-M. Ju, 13 Mar 2003. NMMB–P 6222, mature female, 90.9 mm SL; Tong-Kong (=Dong-Gang) fish port, H-C. Ho, 5 Jul 2007. NMMB–P 7914, male, 85.9 mm SL; Y-M. Ju, 11 Jun 2004. NMMB–P 8147, mature female, 76.3 mm SL; Y.-M. Ju, 11 Jun 2004. NMMB–P 6222, 3 (2 males and 1 mature female), 61.9–82.6 mm SL; Tong-Kong (=Dong-Gang) fish port, C-W. Chang, 27 Aug 2008. NTUM 04564, Holotype of S. novemfasciatus, mature female, 79.9 mm SL, Tung-kong (=Dong-Gang), S.-C. Shen, 1 Feb 1980. Taiwan, off southwestern coast. NMMB–P 7615, 2 mature females, 65.4–78.8 mm SL; Kao- Hsung, Y.-M. Ju, 4 Jul 2004. NMMB–P 3713, 2 mature females, 76.8–80.2 mm SL; Fon-Kan fish port, 200 m, J.- H. Wu, 2 Aug 2001. South China Sea. ASIZP 66881, 2 (male and mature female), 72.9–77.8 mm SL; Off Siao Liouciou, 22º21.64’–22º22.29’N, 120º11.55’–120º13.28’E, mini-beam trawl, 336–395 m, Ocean Researcher I, PCP 348, 9 Mar 2006. Japan. Tosa Bay, off Kochi, in landings at Mimase fish port. BSKU 341, mature female, 91.8 mm SL; 11 Apr 1951. BSKU 617, male, 82.3 mm SL; 5 Feb 1951. BSKU 618, mature female, 81.2 mm SL; 5 Feb 1951. BSKU 807, male, 92.5 mm SL; 19 Feb 1951. BSKU 808, male, 86.2 mm SL; 19 Feb 1951. BSKU 810, male, 91.7 mm SL; 19 Feb 1951. BSKU 1585, mature female, 96.3 mm SL; 20 Jan 1952. BSKU 3457, mature female, 91.2 mm SL; 6 Dec 1953. BSKU 40990, male, 70.4 mm SL; off Saga, traditional bottom trawl, 26 Feb 1985. Tosa Bay, off Kochi. BSKU 67756, male, 58.5 mm SL; R/V Kotaka-maru, 25 Jul 2003. BSKU 69970, 2 (exam. 1, male), 54.7 mm SL; 200 m, R/V Kotaka-maru, 7 Oct 2003. BSKU 88734, male, 68.7 mm SL; in landings at fish port, 3 Mar 2006. Off Murado Cape, Kochi. BSKU 3528, male, 109.0 mm SL; 1953. Suruga Bay. NSMT- P 7471, mature female, 97.3 mm SL; 16–20 Sep 1968. NSMT-P 49992, male, 74.5 mm SL; Off Heda, 245–440 m, 34º59.74’N, 138º45.17’E, 10 Nov 1996. NSMT-P 78389, mature female, 86.3 mm SL; 300–400 m, 1 Apr 1986. USNM 77066, male, 56.4 mm SL; 270–520 m, 16 Oct 1906.

386 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 2. A. Symphurus novemfasciatus Shen and Lin, 1984, holotype, NTUM 04586, female, 79.9 mm SL, off Dong-Gang, southwest Taiwan. B. Blind-side coloration of same specimen. C. Symphurus orientalis, Neotype, BSKU 44238, female, 91.0 mm SL, collected off Kochi, Japan. D. Blind-side coloration of Neotype.

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 387 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Counted. 2 specimens (31.4–33.8 mm SL). ASIZP 72358 (JN678762 and JN678797), male, 33.8 mm SL; off Kochi, Tosa Bay, Japan, 200 m, R/V Toyohata-maru, 17 Jun 2009. ASIZP 72359 (JN678763 and JN678798), male, 31.4 mm SL; off Kochi, Tosa Bay, Japan, 200 m, R/V Toyohata-maru, 17 Jun 2009. Diagnosis. Symphurus orientalis is distinguished from all congeners by the combination of: a predominant 1–2–2–2–2 ID pattern, 12 caudal-fin rays, 9 abdominal vertebrae, 52–55 total vertebrae, four hypurals, 96–101 dorsal-fin rays, 82–89 anal-fin rays, 87–99 longitudinal scale rows, 37–42 transverse scales, 18–22 scale rows on the head posterior to the lower orbit, and usually with 5–11 distinct, wide (covering 4–8 scales), complete or incomplete dark, blackish-brown crossbands on the ocular side, an alternating series of rectangular blotches and unpigmented areas (both extending from base to tip of fin) throughout entire lengths of dorsal and anal fins, uniformly white blind side, and conspicuous bluish-black peritoneum. Description. Symphurus orientalis is a medium-sized species reaching sizes to approximately 109 mm SL. Meristic characters are summarized in Table 1. Predominant ID pattern 1–2–2–2–2 (83/91 specimens). Caudal-fin rays 12 (two specimens with 11). Dorsal-fin rays 96–101. Anal-fin rays 82–89. Pelvic-fin rays 4. Total vertebrae 52–55; abdominal vertebrae 9(3 + 6). Hypurals 4. Longitudinal scale rows 87–99. Scale rows on head posterior to lower orbit 18–22. Transverse scales 37–42.

TABLE 1. Frequency of meristic characters of Symphurus orientalis. Counts for the neotype (BSKU 44238) indicated by an asterisk (*); those of the holotype of S. novemfasciatus (NTUM 04564) indicated by a solid star( . ). ID Pattern 1-2-2-2-2* 1-2-3-2-2 1-2-2-2-1 1-3-2-2-2 1-2-1-2-2 N 83 3 1 2 2 91 Dorsal-fin rays 96 97 98* 99 100 101 . N 12 11 23 23 11 12 92 Anal-fin rays 82 83 84 85 86 87* 88 . 89 N 2 8 19 15 26 17 4 1 92 Caudal-fin rays Abdominal vertebrae 11 12* . N 3+6* N 2 92 94 93 93 Total vertebrae 52 53 54* 55 N 5 27 50 9 91 Longitudinal scale count 87 88 89 90 91 92 93 94* . 95 96 97 98 99 N 1 4 2 6 6 9 9 13 7 10 7 9 3 86 Head scale count 18 19 20* . 21 22 N 5 31 33 16 1 86 Transverse scale count 37 38 39* . 40 41 42 N 7 21 21 24 12 1 86

Proportions of morphometric features are presented in Table 2. Body relatively deep and moderately elongate; maximum depth in anterior one-third of body usually at point between anus and fourth anal-fin ray, with moderate taper posteriorly from anus to posterior body margin. Preanal length smaller than body depth. Head moderately short and wide; head width slightly shorter than body depth, and much greater than head length (HW/HL= 1.05–1.28, x = 1.12). Upper head lobe wider than lower head lobe (UHL/LHL= 1.02–1.51, x = 1.18); slightly

388 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. shorter than postorbital length. Lower lobe of ocular-side opercle wider than upper opercular lobe; posterior margin of lower lobe projecting slightly beyond posterior margin of upper opercular lobe. Snout moderately short, slightly rounded to obliquely blunt anteriorly, its length greater than eye diameter (SNL/ED= 1.39–2.11, x =1.62). Dermal papillae present, but not well developed, on blind-side snout. Ocular-side anterior nostril tubular and short, usually not reaching anterior margin of lower eye when depressed posteriorly. Ocular-side posterior nostril a small, rounded tube located on snout just anterior to interorbital space. Blind-side anterior nostril tubular, short, easily distinguishable from dermal papillae; blind-side posterior nostril a shorter and wider, posteriorly-directed, tube situated posterior to vertical at posterior margin of jaws. Jaws long and slightly arched; upper jaw length longer than snout length; posterior margin of upper jaw usually extending to point between verticals through anterior margin of pupil and midpoint of lower eye. Ocular-side lower jaw without fleshy ridge. Chin depth slightly shorter than, or equal to, snout length. Eyes moderately large and oval, separated by three to four rows of small ctenoid scales in narrow interorbital space. Eyes usually equal in position, or upper eye slightly in advance of lower eye. Pupillary operculum absent. Dorsal-fin origin located at point between verticals through anterior margin of upper eye and anterior margin of pupil of upper eye; predorsal length moderately short. Anteriormost dorsal-fin rays slightly shorter than more posterior fin rays. Scales absent on both sides of dorsal- and anal-fin rays. Pelvic fin moderately long; longest pelvic-fin ray, when extended posteriorly, usually reaching base of first to third anal-fin ray. Posteriormost pelvic-fin ray connected to anal fin by delicate membrane (torn in many specimens). Caudal fin relatively long, with several rows of ctenoid scales on base of fin. Body with numerous, strongly ctenoid scales on both sides.

TABLE 2. Morphometrics for the neotype (BSKU 44238) and examined specimens of Symphurus orientalis, including those for the holotype of S. novemfasciatus (NTUM 04564). SL in mm; characters 2–15 in % of SL; 16–23 in % of HL. Character Neotype NTUM 04564 Examined Specimens n Range Mean ± SD 1. Standard length 91.0 79.9 92 54.7–109.0 78.63±10.30 2. Body depth 26.1 26.8 92 24.2–28.8 26.29±1.12 3. Trunk length 84.2 82.9 90 80.3–85.1 82.93±1.14 4. Predorsal length 2.9 3.6 90 2.4–4.5 3.44±0.42 5. Preanal length 22.9 22.5 91 21.0–25.6 23.44±1.05 6. Dorsal-fin length 97.0 96.4 90 94.8–97.6 96.54±0.47 7. Anal-fin length 77.3 77.4 90 74.5–79.2 76.53±1.04 8. Pelvic-fin length 8.0 – 80 5.8–9.2 7.54±0.89 9. Pelvic to anal length 3.6 2.3 84 1.5–4.8 3.28±0.75 10. Caudal-fin length 10.8 11.2 72 10.2–12.7 11.30±0.65 11. Head length 17.7 19.7 92 17.4–21.6 19.62±1.02 12. Head width 20.0 22.7 91 19.0–25.2 22.04±1.29 13. Postorbital length 11.9 12.8 91 11.4–14.7 13.18±0.73 14. Upper head lobe width 10.8 12.1 89 10.2–14.1 12.29±0.82 15. Lower head lobe width 9.5 11.1 89 8.6–12.4 10.30±0.77 16. Predorsal length 16.6 18.3 90 12.9–21.87 17.57±2.14 17. Postorbital length 67.3 65.3 91 64.0–71.4 67.10±1.57 18. Snout length 18.2 17.4 90 17.2–22.1 18.75±1.22 19. Upper jaw length 20.1 20.5 90 17.2–22.8 20.28±1.21 20. Eye diameter 11.7 11.3 92 9.7–12.6 11.43±0.64 21. Chin depth 19.5 16.3 90 13.9–22.4 17.12±1.84 22. Lower opercular lobe 29.2 27.6 88 21.8–32.7 26.68±2.26 23. Upper opercular lobe 24.5 26.8 88 21.0–31.4 25.65±2.33 24. HW/HL 1.13 1.15 91 1.05–1.28 1.12±0.05 25. Pupil/Eye diameter 52.4 52.8 92 51.1–77.1 61.81±5.96

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 389 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Teeth present and recurved slightly inwards on all jaws, but better developed on blind-side jaws. Ocular-side premaxilla and dentary with single row of sharply pointed, well-developed teeth. Blind-side premaxilla with two to four rows of sharp, recurved teeth. Blind-side lower jaw with three to five rows of well-developed teeth. Coloration of fresh-caught specimens (Fig. 1). Body pigmentation generally similar for both sexes at all sizes. Ocular-side background coloration generally straw-colored to dark-brown, usually with 5–11 distinct, wide (covering 4–8 scales), complete or incomplete, dark blackish-brown, crossbands; crossbands not continued onto dorsal and anal fins; some specimens with crossbands faded and indistinct or with uniformly brown pigmentation without crossbands. Anteriormost crossband on body region between opercle and vertical through anus; successive crossbands present on mid-body region to caudal-fin base. External surface of abdominal area usually bluish-black on both sides of body, but sometimes with same general coloration as that of ocular-side body (because darker peritoneal pigment obscured by abdominal wall and not visible externally). Background coloration of ocular-side head generally similar to that on body. Ocular-side snout light yellow. Ocular-side lips and chin region uniformly yellow to brown, margins of lips pigmented with small black chromatophores. Ocular-side anterior nostril brown. Upper aspects of eyes and eye sockets light blue; pupils bluish-black. Outer surface of ocular-side opercle yellow to brown, usually with same background coloration as that of head and body. Inner surface of ocular-side opercle and isthmus unpigmented. Blind side generally white to light yellow with bluish-black peritoneum showing through abdominal musculature. Outer surface of blind-side opercle uniformly white to light yellowish. Inner surface of blind-side opercle unpigmented. Fin rays of dorsal, anal, and pelvic fins uniformly yellow to brown; basal regions of fin rays and membranes covering fin rays light yellow, with diffuse scattering of yellow to brown melanophores covering entire fin membranes on both sides of fins. Dorsal and anal fins throughout their lengths with alternating series of darkly streaked and lightly pigmented fin rays. Basal margins of fin rays and associated fin membranes on blind side light yellow to light brown. Coloration of recently preserved specimens (Fig. 2). Similar to that of freshly-caught fishes. Specimens stored in preservative for decades usually mostly faded and with only remaining pigmentation consisting of the bluish-black eye sockets and black peritoneum. Size and sexual maturity. 94 specimens range in size from 31.4 to 109.0 mm SL. Females (n = 49; 31.4–103.4 mm SL) and males (n = 45, 33.8–109.0 mm SL) attain similar sizes. Nine females (31.4–77.5 mm SL) are immature and show only slight elongation of the ovaries; 40 females ranging in size from 65.4 to 103.4 mm SL are mature with elongate ovaries, 29 of these (65.4–103.4 mm SL) are mature with elongate ovaries, but are non- gravid, while another 11 females, ranging from 75.9 to 97.3 mm SL, are gravid. Distribution. Symphurus orientalis is known from voucher specimens taken off the continental shelf and upper continental slope including captures in Japanese waters at Suruga Bay, Tosa Bay, and the Pacific side of southern Japan; also in the East China Sea in the Okinawa Trough; and from several locations off Taiwan including off I-lan, off northeastern and southwestern Taiwan, and in the South China Sea off Dong-Gang, Taiwan (Fig. 3). Based on voucher specimens, this species occurs at depths ranging from 200 to 520 m throughout its geographic range, with most captures usually occurring between 250 and 400 m. Symphurus orientalis is frequently taken on muddy substrata or a mixture of mud-sand substrata. Literature accounts reporting tonguefishes identified as S. orientalis list this species from a wider geographic range including the Philippines (Fourmanoir 1985), off mainland China, off Korea, and off Vladivostok, Russia. Because of uncertainties involving specimens previously identified as S. orientalis, reports of S. orientalis from some of these locations are questionable. We did not examine the three specimens from the Philippines that Fourmanoir (1985) identified as S. orientalis, which were taken at similar depths (299–320 m) to those occupied by S. orientalis. Counts he reported for these specimens are at the low ends of ranges of those for S. orientalis from Japan and Taiwan, respectively. Possibly, these specimens are S. orientalis. However, they need to be compared with other specimens from the Philippines with 12 caudal-fin rays including those that Chabanaud (1955) identified as S. septemstriatus and others representing another nominal species of uncertain status that we (Lee & Munroe unpubl. data) have identified among specimens from the Philippine Islands. Both nominal forms are similar to S. orientalis, but they differ from it in several of their morphometric features.

390 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Although several studies (Chu 1931; Sowerby 1930; Wu 1932; Fowler 1934; Li 1987; Lin 1994; Liu 2008) reported the geographic distribution of S. orientalis to include waters off mainland China (Bei-Jing and other localities), these records seem doubtful and none are vouchered by specimens. Li and Wang (1995) in their work on flatfishes inhabiting Chinese waters commented that reported captures of S. orientalis from off mainland China were “suspect.” They, instead, listed the distribution of S. orientalis from Taiwan (based on Chen & Weng 1965) to the eastern part of the Yellow Sea and southern Japan. In an extensive study of fishes trawled at depths of 120–1100 m in the East China Sea between 26° and 33°N latitudes, Chengyu et al. (1986) did not report capturing this species, nor have recent collecting efforts off mainland China (X. Kong person. commun., 27 November, 2009) collected any Symphurus in the deepwater areas sampled off mainland China. Water depths off the coast of China are usually shallower than 100 m, and based on what we know concerning depth of capture of specimens of S. orientalis from other areas it seems unlikely to find S. orientalis in the waters off China. Other studies (Mori 1928; Mori & Uchida 1934; Son 1980; Kim & Choi 1994 (based on Son 1980)) record S. orientalis from off the east coast of North Korea, or from Korean waters (Kim et al. 2005). Reported occurrences of S. orientalis in waters off the east coasts of North and South Korea are questionable because they are based, at least in part, on misidentified specimens. For example, identifications in Kim and Choi (1994) are based on data provided in Ochiai’s (1959) redescription of S. orientalis, which includes more than one species (see detailed comments below). Kim et al. (2005) in their illustrated book of Korean Fishes record S. orientalis from Korean waters, and provide a brief description with a color photograph of a specimen purported to be this species. However, their description of S. orientalis follows that of Ochiai (1959), and furthermore, the fish in the color photograph that they identify as S. orientalis is not that species. No voucher specimens were listed in any of the studies (Son 1980; Kim and Choi 1994; Kim et al. 2005) reporting S. orientalis from Korean waters so it is not now possible to determine if specimens included in those accounts are actually this species. Off South Korea and adjacent areas, such as the Yellow Sea, continental shelf depths are shallower than 150 m. These depths are shallower than those typically inhabited by S. orientalis (200 m and deeper) based on voucher specimens we examined. Most literature (Ochiai 1959; 1963; Amaoka 1982; Sakamoto 1997; Yamada 2000; 2002; Choi et al. 2002) as well as detailed collecting efforts in the Sea of Japan (Yeh 2001; Tian et al. 2006), the only known deeper- water area off Korea where S. orientalis would most likely be found based on depth of occurrence of voucher specimens we examined, have not reported capturing specimens of Symphurus from these waters nor do they include the Sea of Japan as a part of the geographic range of S. orientalis. Based on the numerous misidentifications of specimens and the lack of documented captures for this species, we conclude that reports of S. orientalis from Korean waters need confirmation with voucher specimens. Several studies (Jordan & Starks 1906; Jordan et al. 1913; Okada 1938) record S. orientalis from off Vladivostok based on Schmidt’s (1904) account of Symphurus sp. from this area. However, this locality record for S. orientalis is doubtful. Jordan and Starks did not examine any specimens of S. orientalis, including the specimen listed by Schmidt (1904). And reports of S. orientalis from this location are based only on the specimen listed in Schmidt (1904). However, Schmidt’s account of Symphurus sp. is problematic because it is based on an 85 mm juvenile specimen in poor condition that is missing most of its scales, has damaged fins with several fin rays broken, and because the description of this specimen includes so little useful diagnostic information that it can not be unequivocally determined even if it is based on a specimen of Symphurus, let alone a specimen that could be positively identified as S. orientalis, as suggested by its inclusion in the synonymy and distribution sections of Jordan and Starks’ (1906) account of S. orientalis. Even though Schmidt states that his specimen lacks a lateral line, which is a diagnostic feature for species belonging to Symphurus, it is possible that Schmidt could have examined a juvenile specimen of Cynoglossus that was missing its scales and thus appeared to lack a lateral line(s). For juvenile specimens of some species of Cynoglossus that have lost their scales, it is sometimes difficult to determine if they have 0, 1, or 2 lateral lines (Jordan & Starks 1906; Munroe unpubl. data). Sowerby (1930), too, thought that Schmidt’s account of a specimen of Symphurus from off Vladivostok was actually a specimen of Cynoglossus. Based on information presented in Schmidt’s account of a specimen identified as Symphurus sp., we can not conclusively rule out the possibility that Schmidt had a specimen of Symphurus. However, if Schmidt had actually examined a specimen of Symphurus, we can confirm that this specimen belonged to a species other than S. orientalis because the reported number of dorsal-fin rays (75), if accurate, is well below the range of dorsal-fin rays observed in our specimens of S. orientalis (96–101; see Table 1). Thus, we conclude that reports of S. orientalis from off Vladivostok are suspect, if not erroneous. The record of S. orientalis from this area is based on the

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 391 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. geographic distribution reported for S. orientalis that appeared in Jordan and Starks (1906). This record, in turn, relied on Schmidt’s (1904) report of an unidentified tonguefish specimen that we conclude is not very likely this species, if even a specimen of Symphurus. Records of symphurine tonguefishes from the continental shelf off Vladivostok need updating based on documented catches and reliable identifications of voucher specimens. Remarks. The original description and illustration of the holotype of S. orientalis by Bleeker (1879: 31) clearly indicate that the holotype (and only specimen) is a symphurine tonguefish characterized by 12 caudal-fin rays and a banded pigmentation pattern. At the time of its description, S. orientalis was differentiated from other described species of Symphurus by its unique combination of number of dorsal- and anal-fin rays, scale counts and pigmentation pattern. While the original description of S. orientalis contained sufficient information to diagnose this species from other described symphurine tonguefishes known at the time of its discovery, information contained in the original description has since proven inadequate to differentiate this from other similar nominal species described or discovered subsequent to Bleeker’s study. Also, because S. orientalis was known only from a single specimen, the range in values for diagnostically important morphological features were unknown for the species, and this uncertainty has undoubtedly contributed to the inadequate redescriptions of this nominal species appearing in works of subsequent ichthyologists. Further compounding this difficulty is the subsequent loss of the holotype specimen of S. orientalis, which has eliminated any possibilities of knowing additional diagnostic characters (i.e., ID pattern, vertebral counts) about Bleeker’s nominal species that would facilitate more detailed comparisons with other tonguefishes that have similar features to those reported for the holotype of S. orientalis. Matsubara’s (1955) identification key provided a wide range of meristic counts and morphometric measurements for specimens purported to be S. orientalis. Ochiai’s (1959; 1963) redescription of S. orientalis followed the information provided in Matsubara (1955), but Ochiai’s study is more detailed and also provides catalogue numbers of the examined specimens. This is the primary reason that his redescription (Ochiai 1959; 1963) of S. orientalis has been widely cited as an authoritative work on this species and data from that study have often been repeated in subsequent reports of S. orientalis from western Pacific localities. However, recent discoveries (Lee & Munroe unpubl. data) of several additional nominal species in the western Pacific region that have some similarities to S. orientalis reveal that Ochiai’s redescription of S. orientalis likely combined morphological data for this species as well as that for one or more of these other nominal species. In continental shelf waters off Japan, two nominal species of Symphurus featuring 12 caudal-fin rays (same number as in S. orientalis), but with fewer meristic features than those of S. orientalis [in fact, more similar to those of S. microrhynchus (Weber), see Munroe & Marsh 1997], have recently been discovered (Lee & Munroe unpubl. data). Meristic data for one or both of these species were likely included in the key appearing in Matsubara (1955) and in the redescription of S. orientalis by Ochiai (1959; 1963) as evidenced by the wide ranges reported for several meristic features observed for these specimens (dorsal-fin rays 86–100, anal-fin rays 74–86, longitudinal scales 81–87). In contrast, specimens we identified as S. orientalis in our study, which represent specimens from localities spanning a wide geographic range, including Japan, have a much narrower, and higher range of values for dorsal- (96–101) and anal-fin rays (82–89), as well as different counts for longitudinal scales (87–99). Chen and Weng (1965) recorded S. orientalis from Taiwanese waters. However, their report of this species from Taiwan is questionable because their redescription of S. orientalis indicates that specimens they identified as S. orientalis have 15 caudal-fin rays, whereas S. orientalis typically has only 12 caudal-fin rays (Bleeker 1879; Munroe 1992; this study). Unfortunately, specimens examined by Chen and Weng (1965) are lost, precluding possibilities of confirming whether the caudal-fin ray counts reported by Chen and Weng were in error. However, of the many specimens of Symphurus that we have examined, we have not found any specimens of species characterized by having 12 caudal-fin rays that had either 14 or 15 caudal-fin rays. We think that specimens examined by Chen and Weng were actually other species of Symphurus, such as S. bathyspilus Krabbenhoft and Munroe or S. multimaculatus Lee et al. (2009b). These species, which occur in Taiwanese waters (Lee unpubl. data), differ from S. orientalis in having 14 caudal-fin rays, but are similar in their counts of dorsal- and anal-fin- rays. In 1984, Shen and Lin (1984) described another nominal tonguefish species from southern Taiwan, S. novemfasciatus, based on two specimens featuring 12 caudal-fin rays and an ocular-side pigmentation pattern with nine crossbands. Perhaps misled by the erroneous caudal-fin ray counts reported earlier in Chen and Weng (1965) for specimens purported to be S. orientalis from Taiwanese waters, Shen and Lin (1984) did not compare their

392 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. specimens with those of Chen and Weng, nor did they diagnose or compare their specimens with Bleeker’s description of S. orientalis from off Japan. Neither did they compare their specimens with those included in the redescription of S. orientalis by Ochiai (1959). In a later study, Shen (1984) mentioned some similarity between S. novemfasciatus and the “closely related” S. septemstriatus, but none of the other subsequent studies dealing with S. novemfasciatus (Shen 1993; Lin 1994) compared S. novemfasciatus with S. orientalis or any of the other previously-named species in this species complex (see further remarks below). Because of the many similarities between S. orientalis and S. novemfasciatus, the status of this nominal species needed to be evaluated to determine if it is distinct from S. orientalis. Variations in meristic and morphometric features of 92 specimens of S. orientalis collected from different locations ranging from Japan to Dong-Gang, Taiwan, off northeast Taiwan, off Ping-tung, southwestern Taiwan including the type locality of S. novemfasciatus, and from the South China Sea were slight and no clinal trends in morphological variation were evident among these specimens. Detailed comparisons of the morphology and pigmentation of the holotype of S. novemfasciatus (Fig. 2A, 2B) with those from this larger series of specimens of S. orientalis reveal nearly complete overlap between the two nominal species in many features. Several important diagnostic characters, such as ID pattern or vertebral counts, could not be determined in the holotype of S. novemfasciatus because its skeleton has decalcified (precluding observing these features from a radiograph). Meristic features of S. novemfasciatus that overlap those of S. orientalis include fin-ray (caudal-fin rays 12 in both species; dorsal-fin rays 101 vs. 96–101 in S. orientalis; anal-fin rays 88 vs. 82–89 in S. orientalis) and scale counts (longitudinal rows 94 vs. 87–99 in S. orientalis; transverse scales 39 vs. 37–42 in S. orientalis). Likewise, proportions of many morphometric features of the holotype of S. novemfasciatus lie within ranges of those features recorded for S. orientalis (Table 2). Both nominal species have a relatively deep body (BD of S. novemfasciatus = 26.8% SL vs. 24.2–28.8 % in S. orientalis), both have their preanal lengths shorter than their body depths (PAL 22.5% SL vs. 21–25.6% in S. orientalis), both have a moderately short and wide head, with the head width just slightly less than the body depth and much greater than their head length (HW/HL = 1.15 vs. 1.05–1.28 in S. orientalis). Other similarities between the two species include the width of the upper head lobe compared with that of the lower head lobe (UHL/LHL = 1.09 in S. novemfasciatus vs. 1.02–1.51 in S. orientalis), shape and size of their short snouts (SNL 17.4% HL in S. novemfasciatus vs. 17.2–22.1% in S. orientalis), and their small eyes (ED 11.3% HL in S. novemfasciatus vs. 9.7–12.6% in S. orientalis). Additionally, these two nominal species have similar coloration. Ocular-side coloration was one feature that Shen and Lin (1984) considered diagnostic for S. novemfasciatus among its congeners. They considered the nine ocular-side crossbands of S. novemfasciatus to be a unique, diagnostically important, character for this species. However, Bleeker (1879) had much earlier indicated a banded coloration pattern for S. orientalis, and we also found that many specimens of S. orientalis from across the geographic range of this species, including southern Taiwan, feature 5–11 crossbands on their ocular sides. To gain better understanding of the genetic divergence among tonguefishes that we identified as S. orientalis, including those from the type locality of S. novemfasciatus, we compared partial sequences of COI and 16S rRNA between specimens from Japan and northeast Taiwan. Genetic divergence among individuals from these widespread locations was shallow for both genes (only 0.12% K2P distance in the 16S and 0.22% K2P distance in the COI sequence data). If S. novemfasciatus were distinct from S. orientalis, much greater genetic divergence would be expected between these taxa. Ward et al. (2005; 2009), for example, suggested that, in fishes, an average K2P distance of less than 0.4% is within the range of variation expected within a species. The amount of divergence between S. novemfasciatus and S. orientalis (16S: S. novemfasciatus: 0.30% K2P distance, S. orientalis: 0.13%; COI: S. novemfasciatus, 0.26% K2P distance, S. orientalis: 0.27%) and between the nominal species (16S: 0.21% K2P distance, COI: 0.26%) is similar to that expected for populations within a species. Such shallow genetic divergence observed for populations of S. orientalis indicates a lack of structure among these widespread populations (Taiwan and Japan), a finding which further supports the hypothesis that these populations belong to one panmictic species. Furthermore, the N-J trees (Figs. 4–5) constructed from both the 16S rRNA and COI sequence data also show this lack of structure between populations representing these two nominal species and also indicate that these individuals are members of the same genetic lineage. Based on nearly complete overlap in morphological features and the low amount of genetic divergence among specimens from Japan and Taiwan, all evidence indicates that only one species is represented by this material. These data strongly support recognizing S. orientalis (Bleeker), with S. novemfasciatus as its junior subjective synonym.

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 393 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 3. Geographic distribution of Symphurus orientalis based on specimens examined in this study (indicated by triangles) and reliable literature reports (indicated by stars). Questionable localities in the literature where S. orientalis has been reported to occur are indicated by a question mark (?). Symbols may represent more than one locality and/or more than a single collection from each locality.

394 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 4. Neighbor-joining tree (part) from partial 16S rRNA gene sequence of species of Symphurus. Numbers above nodes indicate bootstrap values for 10000 replications.

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 395 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

FIGURE 5. Neighbor-joining tree (part) from partial COI gene sequence of species of Symphurus. Numbers above nodes indicate bootstrap value for 10000 replications.

396 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Given the long history of confusion regarding the taxonomic status and identity of S. orientalis, it is necessary to designate a neotype to stabilize the nomenclature of this nominal species. Since the original description of S. orientalis (Bleeker) is based on a specimen from Japan, the following specimen is designated as the neotype of S. orientalis (Bleeker): BSKU 44238 (Figs 2C, 2D): 91.0 mm SL; mature (not gravid) female; collected by O. Okamura, Nov 1987, from Tosa Bay off Kochi at a depth between 300 and 400 m. Meristic features of the neotype are: 1–2–2–2–2 ID pattern; 12 caudal-fin rays; 98 dorsal-fin rays; 87 anal-fin rays; 9(3+6) abdominal vertebrae; 54 total vertebrae; 4 hypurals; 94 longitudinal scales; 39 transverse scales; and 20 scale rows on the head from the posterior margin of its lower orbit to the posterior margin of the opercle. Comparisons. Among Indo-Pacific Symphurus, in addition to S. orientalis (including S. novemfasciatus), five other named species also feature 12 caudal-fin rays (Alcock 1891; Alcock 1896; Weber 1913; Chabanaud 1955; Chabanaud 1957). Of these, only S. septemstriatus, S. luzonensis, and S. fallax have similar fin-ray and/or vertebral counts to those of S. orientalis. Symphurus septemstriatus is known from relatively few specimens collected in deep waters (260–730 m) of the Indian Ocean including the Andaman Sea, the Laccadive Sea off Colombo, Sri Lanka, and in the Gulf of Mannar (Alcock 1891; 1896; and 1899, respectively). Opportunities to directly study the types and other specimens of this species curated at the Zoological Survey of India were not available to us. Nor is there any published information on morphological features of this species for any other specimens from Indian Ocean localities beyond counts and measurements of the holotype (Norman 1928; Munro 1955). Records of this species and accompanying morphological data from specimens collected at localities beyond these Indian Ocean locations (e.g., the Philippines; in Chabanaud (1955)) may be that for S. septemstriatus, but these specimens require further study to determine their identity (Lee & Munroe unpubl. data). We do, however, have a photograph of the holotype of Aphoristia septemstriata, which provides some useful comparative information on this species. Based on our data, S. orientalis differs from S. septemstriatus in having more anal-fin rays (82–89 vs. 80 in S. septemstriatus) and its upper head lobe is larger than the lower head lobe (UHL/LHL = 1.02–1.51 in S. orientalis vs. UHL/LHL < 1.0 in S. septemstriatus). The snout of S. orientalis is rounded or obliquely blunt anteriorly versus pointed and narrower in S. septemstriatus, and the migrated eye has a more medial position compared with that of S. septemstriatus, which has the migrated eye located closer to the dorsal margin of the head. Shen (1984) had noted a difference in number of ocular-side crossbands between his S. novemfasciatus (= S. orientalis) and S. septemstriatus, however, when a larger series of S. orientalis are examined this apparent difference does not exist as the two species overlap completely in this feature. Symphurus luzonensis is another nominal species of western Pacific deepwater tonguefish described from a single specimen that was collected off Luzon Island, Philippines (Chabanaud 1955). Chabanaud (1955) reported that this specimen had 10 abdominal vertebrae and 52 total vertebrae and thus only diagnosed his species from S. regani Weber, a species that has 10 abdominal vertebrae and a similar number of total vertebrae. A radiograph of the holotype of S. luzonensis, however, reveals that this species actually has 9 abdominal and 53 total vertebrae, and an ID pattern and fin-ray counts that are more similar to those of S. orientalis (Munroe 1992). Symphurus orientalis differs from S. luzonensis in having more scales in a transverse row (37–42 vs. 34 in S. luzonensis), a deeper body (BD 24.2–28.8% SL vs. 22.1% in S. luzonensis), a wider upper opercular lobe (OPUL 21.0–31.4% HL vs. 18.9% in S. luzonensis), larger HW/HL ratio (HW/HL = 1.05–1.28 vs. 0.99 in S. luzonensis), and its dorsal-fin origin is located more anteriorly than is that of S. luzonensis. Symphurus fallax Chabanaud is another poorly-known nominal species described from a small (45 mm SL), damaged, holotype specimen, which was collected at 397 m off Kei Island, Indonesia (Weber 1913). No photograph or illustration accompanied the original description of this nominal species (Chabanaud 1957), nor was any provided in Weber’s (1913) or Weber and de Beaufort’s (1929) accounts of the specimen, which they referred to as an unidentified species of Aphoristia or Symphurus, respectively. Further compounding problems with the identity of this nominal species is that Chabanaud did not return the holotype to the Zoological Museum of Amsterdam’s fish collection (Eschmeyer 2012). Thus, the only information on this species is that contained in the original description. Of interest is that in the description, Chabanaud did not differentiate his nominal species from S. orientalis, despite the fact that based on our assessments his species was morphologically similar to this congener, especially with respect to the numbers of caudal-fin rays. We found only minor differences in meristic features between S. orientalis and those reported for S. fallax (dorsal-fin rays 96–101 in S. orientalis vs. 95 in S. fallax) and S. orientalis has a slightly deeper body (BD 24.2–28.8% SL vs. 22.0% in S. fallax). Otherwise, little

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 397 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. else differentiates these nominal species, a finding which questions the validity of S. fallax. Before arriving at a taxonomic decision regarding the status of this nominal species, more specimens from the type locality are needed to determine if S. fallax is valid and distinct from S. orientalis and S. septemstriatus.

Discussion

Most problems regarding the taxonomic status of many nominal, deep-water species of Symphurus occurring in Indo-Pacific waters are due to the limited amount and overall poor condition of many of the study specimens, incomplete and insufficient descriptions, and by an overall similarity in phenetic features among several of these nominal species (Munroe 1992; Munroe & Amaoka 1998; Munroe & Hashimoto 2008). Symphurus orientalis is now known from a comparatively large number (over 100) of preserved specimens identified by a consistent set of diagnostic features. Results of this study provide robust morphological data, a detailed description, and updated information on the geographic and bathymetric distributions of this species. This study also resolves the taxonomic status of S. novemfasciatus Shen and Lin as it was shown that this nominal species is invalid based on the nearly complete overlap in morphological and pigmentation features between it and S. orientalis. In recent years, molecular tools (Tautz et al. 2003) including DNA barcoding (Hebert et al. 2003) and knowledge about DNA sequences have become more common in helping to resolve taxonomic problems involving closely-related species. With respect to most taxonomic groups, including some tonguefishes (Tunnicliffe et al. 2010), studies of DNA sequences have revealed that estimates of biodiversity at the species level that are based on morphological characters actually underestimate the real diversity represented among the specimens (see also Hebert et al. 2004; Ward et al. 2008; Teletchea 2009; Tornabene et al. 2010). Molecular tools have been especially valuable in discovering cryptic species present among specimens previously considered to represent only a single nominal species. Cryptic species show only minor differences in morphology, and these minor differences are largely ignored as insignificant features useful for identification. Among tonguefishes, one example of cryptic species was found among allopatric populations occurring on seamounts in the Pacific Ocean when Tunnicliffe et al. (2010) observed large genetic divergence in partial 16S rRNA (9.0%) and COI (14.2%) gene sequences between populations that had previously (Munroe & Hashimoto 2008) been considered as one species, S. thermophilus. In light of these findings, we tested the hypothesis that two nominal species might be represented among specimens we studied: S. orientalis which inhabits marine waters from Japan to the Pacific side of Taiwan, and a second, cryptic species, S. novemfasciatus, with a more limited and allopatric distribution in the region of Dong- Gang, South China Sea. This hypothesis seemed plausible because these nominal species share so many similarities in their morphological features and pigmentation, but are geographically separated. The slight genetic divergences we found between populations hypothesized to represent S. novemfasciatus and S. orientalis, both in the partial 16S (0.21% K2P distance) and COI (0.26% K2P distance) gene sequences, indicated that S. novemfasciatus should not be considered a cryptic species. Rather, based on these results, close genetic similarity among these geographically separated populations (Taiwan and Japan) supports conclusions based on morphological data that S. novemfasciatus is a junior subjective synonym of S. orientalis. Despite improvements in our understanding of morphological and genetic variation in S. orientalis, a large need still remains for more reliable information on several important biological aspects of this species including its geographic and bathymetric distributions, diet, reproduction, life history demographics, microhabitat preferences, population density, and spatial distribution. Better definition of the species concept of S. orientalis and an improved understanding of the morphological variation within populations of this species should lead to more reliable identification of specimens of this and related species in the future. In turn, this should lead to improvements in data documenting its bathymetric and geographic distributions and should provide better insight into the ecology of this species. From a systematics perspective on the genus Symphurus, now that the status of S. orientalis and S. novemfasciatus has been critically evaluated and resolved, the task of validating the status of similar, nominal species and other populations of Indo-West Pacific Symphurus can begin. Questions still abound considering the status and identity of S. luzonensis and S. fallax, which are known only from holotype specimens. It remains to be determined how many other Indo-West Pacific species, together with S. orientalis and S. septemstriatus, compose

398 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited. the species complex whose members are characterized by a 1–2–2–2–2 ID pattern, 12 caudal-fin rays and high meristic features. Further expeditions, both to locations where specimens of rare and poorly-known species were originally collected and also to those areas that have never been sampled, are needed to provide additional specimens to resolve the systematic problems surrounding these tonguefishes.

Acknowledgments

This work represents a portion of a collecting activities grant investigating the biodiversity and systematics of deep-sea fishes in Taiwanese waters supported by the National Science Council (NSC 96–2628–B–001–006–MY3 and NSC 99–2621–B–001–008–MY3) and awarded to K.-T. Shao, Biodiversity Research Center, Academia Sinica. We thank H.-M. Yeh, Coastal and Offshore Resource Research Center, Fisheries Research Institute, who kindly provided trawl station data from research vessels. H.-C. Ho, P.-F. Lee, Y.-C. Liao and L.-P. Lin assisted with collecting specimens and kindly provided other specimens used in this study. K.-C. Hsu advised M.-Y. Lee regarding molecular aspects of this research study. A. Collins, NSL, kindly provided information and helpful editorial suggestions regarding molecular approaches used in this study. L.-P. Lin and C.-W. Chang assisted with loans and shipments of specimens. M. Nizinski provided assistance and support during M.-Y. Lee’s visit to the National Museum of Natural History, Smithsonian Institution. H. Endo, N. Nakayama, and R. Asaoka provided assistance and support during M.-Y. Lee’s visit to the Department of Biology, Faculty of Science, Kochi University. They also provided two important fresh specimens of S. orientalis from Japan to help with molecular comparisons. K. Matsuura and G. Shinohara provided loan of Suruga Bay specimens during M.-Y. Lee’s visit to the Department of Zoology, National Science Museum. K. Murphy (USNM) assisted with specimen and catalogue information. K. Nakaya, Hokkaido University, provided the photograph of the holotype of S. septemstriatus. K. Vinnikov, University of Hawaii at Manoa, graciously provided translations of Russian literature. L. Willis, NMFS-NSL, assisted with literature. H.-M. Chen provided comments on an early draft of the manuscript. M.-Y. Lee extends his appreciation to all members of the Laboratory of Fish Ecology and Evolution for their support, especially H. Lee for helping to draw the distribution map and assistance during this study.

Literature cited

Akimoto, S., Kinoshita, S., Sezaki, K., Mitani, I. & Watabe, S. (2002) Identification of alfonsino and related fish species belonging to the genus Beryx with mitochondrial 16S rRNA gene and its application on their pelagic eggs. Fisheries Science, 68(6), 1242–1249. http://dx.doi.org/10.1046/j.1444-2906.2002.00561.x Alcock, A.W. (1891) Class Pisces. In: II. –Natural history notes from H. M. Indian marine survey steamer ‘Investigator,’ Commander R. F. Hoskyn, R. N., commanding. Series II., No. 1. On the results of deep-sea dredging during the season 1890–91. The Annals and Magazine of Natural History (Series 6), 8 (43/44), 119–138. Alcock, A.W. (1896) Natural history notes from H. M. Indian marine survey steamer ‘Investigator,’ Commander C. F. Oldham, R. N., commanding. Series II., No. 23. A supplementary list of the marine fishes of India, with description of 2 new genera and eight new species. Journal of the Asiatic Society of Bengal. Volume 65 (part II), Number 3, 301–338. Alcock, A.W. (1899) A descriptive catalogue of the Indian deep-sea fishes in the Indian Museum, collected by the R.I.M.S. Investigator. Government Printing, Calcutta, 220 pp. Amaoka, K. (1982) Symphurus orientalis. In: Okamura, O., Amaoka, K. & Mitani, F. (Eds), Fishes of the Kyushu-Palau Ridge and Tosa Bay. The intensive research of unexploited fishery resources on continental slopes. Japan Fisheries Resource Conservation Association, Tosho Printing Co., Tokyo, pp. 303, 408. (Japanese and English). Bleeker, P. (1879) Énumerátion des espèces de poissons actuellement connues du Japon et description de trois espèces inédites. Verslagen en Mededeelingen der Koninklijke Akademie van Wetenschappen. Afdeling Natuurkunde, 18, 1–33. Byrkjedal, I., Rees, D.J. & Willassen, E. (2007) Lumping lumpsuckers: molecular and morphological insights into the taxonomic status of Eumicrotremus spinosus (Fabricius, 1776) and Eumicrotremus eggvinii Koefoed 1956 (Teleostei: Cyclopteridae). Journal of Fish Biology, 71(suppl. A), 111–131. http://dx.doi.org/10.1111/j.1095-8649.2007.01550.x Chabanaud, P. (1939) Catalogue systématique et chorologique des Téléostéens dyssymétriques du globe. Bulletin de L’Institut Océanographique (Foundation Albert Ier, Prince de Monaco), Number 763, 31 pp. Chabanaud, P. (1955) Flatfishes of the genus Symphurus from the U.S.S. “Albatross” Expedition to the Philippines, 1907–1910. Journal of the Washington Academy of Sciences, 45(1), 30–32. Chabanaud, P. (1957) Description d'un Symphurus inédit, fruit de la croisière 1899–1900 du Siboga. Beaufortia, 5(62), 183–185.

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 399 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Chen, J.T.F. (1969) A synopsis of the vertebrates of Taiwan. Revised edition. Volume 1. The Commercial Press, Taipei, 548 pp. (in Chinese). Chen, J.T.F. & Weng, H.T.C. (1965) A review of the flatfishes of Taiwan. Biological Bulletin Tunghai University Ichthyology Series (5), 25 & 27, 1–103. Chen, J.T.F. & Yu, M.J. (1986) A synopsis of the vertebrates of Taiwan. Revised and enlarged edition. Volu me 2. Th e Commercial Press, Taipei, 443–1092 pp. (in Chinese). Chengyu, X., Siming, D., Hongxi, Z. & Keqin, H. (1986) Studies on the fish fauna of the outer region of the continental shelf and the continental slope in the East China Sea. Transactions of the Chinese Ichthyological Society, (5), 47–63. (Chinese with English abstract). Choi, Y., Kim, J.-H. & Park, J.Y. (2002) Marine fishes of Korea. Kyo-Hak Publishing, Seoul, 647 pp. (In Korean). Chu, Y.T. (1931) Index Piscium Sinensium. Biological Bulletin of St. John’s University, Shanghai. Number 1, 291 pp. Chyung, M.K. (1961) Illustrated Encyclopedia The fauna of Korea (2) Fishes. Iljiisa, Seoul, 861 pp. (In Korean). Chyung, M.K. (1977) The fishes of Korea. Iljiisa, Seoul, 727 pp. (In Korean). Diaz de Astarloa, J.M., Mabragana, E., Hanner, R. & Figueroa, D.E. (2008) Morphological and molecular evidence for a new species of longnose skate (Rajiformes: Rajidae: Dipturus) from Argentinean waters. Zootaxa, 1921, 35–46. Dooley, J.K. & Jimenez, L. (2008) Hoplolatilus luteus Allen & Kuiter, 1989, a junior synonym of H. fourmanoiri Smith,1964 (Perciformes: Malacanthidae), based on morphological and molecular data. Aqua, International Journal of Ichthyology, 14(2), 77–84. Eschmeyer, W.N. (1998) Catalog of Fishes. Center for Biodiversity Research and Information, Special Publication 1. California Academy of Sciences, San Francisco. 3 Volumes. 2905 pp. Eschmeyer, W.N. & Fricke, R. (Eds) (2012) Catalog of Fishes. Electronic version–15 March 2012. California Academy of Sciences. Avalaible from: http://research.calacademy.org/ichthyology/catalog/fishcatmain.asp (March 15, 2012). Evseenko, S.A. (1998) The family Achiropsettidae and its position in taxonomical and ecological classifications of the order Pleuronectiformes. Russian Academy of Science, 62 pp. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using bootstrap. Evolution, 39, 783–791. http:// dx.doi.org/10.2307/2408678 Fourmanoir, P. (1985) Poissons. Liste et description de cinq espèces nouvelles (MUSORSTOM II)/ Fishes. List and description of five new species (MURSORSTOM II). Résultats des campagnes Musorstom I et II. Philippines (1976, 1980), Tome 2. Mémoires du Muséum National d’Histoire Naturelle. Nouvelle Série, Série A, Zoologie. Tome 133, 31–54. Fowler, H.W. (1934) A synopsis of the fishes of China. Part V, continued. Hong Kong Naturalist 5(3): 210–225. Fujikura, K., Hashimoto, J. & Okutani, T. (2002) Estimated population densities of megafauna in two chemosynthesis based communities: a cold seep in Sagami Bay and a hydrothermal vent in the Okinawa Trough. Benthos Research, 57(1), 21–30. Ginsburg, I. (1951) Western Atlantic tonguefishes with descriptions of six new species. Zoologica (New York), 36, 185–201. Griekspoor A. & Groothuis, T. (2006) 4Peaks, version 1.7. Computer program distributed by the authors. Avalaible from: http://www.mekentosj.com/science/4peaks Hashimoto, J., Ohta, S., Fujikura, K. & Miura, T. (1995) Microdistribution pattern and biogeography of the hydrothermal vent communities of the Minami-Ensei Knoll in the Mid-Okinawa Trough, Western Pacific. Deep-Sea Research Part I, 42(4), 577–598. http://dx.doi.org/10.1016/0967-0637(94)00037-S Hashimoto, J., Hotta, H. & Deep Sea Survey Group (1988) The biological communities found at the vicinity of the central cone of the Kaikata Caldera, west of Chichijima Island, Ogasawara (Bonin) Islands. Abstract Papers, 5th symposium of Shinkai 2000 study. JAMSTEC Journal of Deep Sea Research, 5, 87–88 (in Japanese). Hebert, P.D.N., Cywinska, A., Ball, S.L. & de Waard J.R. (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society B, 270(1512), 313–322. http://dx.doi.org/10.1098/rspb.2002.2218 Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H. & Hallwachs, W. (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceeding of the National Academy of Sciences of Philadelphia, 101(41), 14812–14817. Ho, H.-C. & Shao, K.-T. (2011) Annotated checklist and type catalog of fish genera and species described from Taiwan. Zootaxa Number 2957: 1–74. Hubbs, C. (1915) Flounders and soles from Japan collected by United States Bureau of Fisheries Steamer “Albatross” in 1906. Proceedings of the United States National Museum, 48(2082), 449–496. http://dx.doi.org/10.5479/si.00963801.48- 2082.449 Jordan, D.S. & Snyder, J.O. (1901). A preliminary check-list of the fishes of Japan. Annotationes Zoologicae Japonensis, 3, 1–159. Jordan, D.S. & Starks, E.C. (1906) A review of the flounders and soles of Japan. Proceedings of the United States National Museum, 31(1484), 161–246. http://dx.doi.org/10.5479/si.00963801.31-1484.161 Jordan, D.S., Tanaka, S. & Snyder, J.O. (1913) A catalogue of the fishes of Japan. Journal of the College of Science, Imperial University, Tokyo, 33(1), 1–497. Kamohara, T. (1958) A catalogue of fishes of Kochi Prefecture (Province Tosa) Japan. Report of the Usa Marine Biological Station, 5(1), 1–76 (English with Japanese names). Kim, I.-S. & Choi, Y. (1994) A taxonomic revision of the family Cynoglossidae (Pisces, Pleuronectiformes) from Korea.

400 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

Bulletin of the Korean Fisheries Society, 27(6), 803–813. Kim, I.-S., Choi, Y., Lee, C.-Y., Lee, Y.-J., Kim, B.-J. & Kim, J.-H. (2005), Illustrated booked of Korean Fishes. Kyohak Publishing Company, Limited, 615 pp. (In Korean). Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120. http://dx.doi.org/10.1007/BF01731581 Krabbenhoft, T.J. & Munroe, T.A. (2003) Symphurus bathyspilus: a new cynoglossid flatfish (Pleuronectiformes: Cynoglossidae) from deepwaters of the Indo-West Pacific. Copeia, 2003(4), 810–817. http://dx.doi.org/10.1643/IA02- 189.1 Lakra, W.S., Goswami, M. & Gopalakrishnan, A. (2009) Molecular identification and phylogenetic relationships of seven Indian sciaenids (Pisces: Perciformes, Sciaenidae) based on 16S rRNA and cytochrome c oxidase subunit I mitochondrial genes. Molecular Biology Reports, 36(5), 831–839. http://dx.doi.org/10.1007/s11033-008-9252-1 Last, P.R., White, W.T. & Puckridge, M. (2010) Neotrygon ningalooensis n. sp. (Myliobatoidei, Dasyatidae), a new maskray from Australia. Aqua, International Journal of Ichthyology, 16(2), 37–50. Lee, M.-Y., Shao, K.-T. & Chen, H.-M. (2009a) A new species of deep-water tonguefish Genus Symphurus (Pleuronectiformes: Cynoglossidae) from Taiwan. Copeia, 2009(2), 342–347. http://dx.doi.org/10.1643/CI-08-080 Lee, M.-Y., Munroe, T.A. & Chen, H.-M. (2009b) A new species of tonguefish (Pleuronectiformes: Cynoglossidae) from Taiwanese waters. Zootaxa, 2203, 49–58. Li, S.-Z. (1987) Pleuronectiformes. In: Cheng, Q. & Zheng, B. (Eds), Systematic synopsis of Chinese fishes. Volume I. Science Press, Beijing, pp. 489–513 (In Chinese). Li, S.-Z. & Wang, H.-M. (1995) Fauna Sinica. Osteichthyes. Pleuronectiformes. Science Press, Beijing, 433 pp. (Chinese with English summary). Lin, S.-D. (with edits by Qiu, S.-Y., Yang, J.-J., Lin, F.-S. & Shao, K.-T.) (1994) Vertebrata. In: Huang, Z.-G. (Ed), Marine species and their distributions in China’s Seas. China Ocean Press, Beijing, pp. 658–764 (In Chinese). Lin, S.-D. (with edits by Qiu, S.-Y., Yang, J.-J., Lin, F.-S. & Shao, K.-T.) (2001) Vertebrata. In: Huang, Z.-G. (Ed), Marine species and their distribution in China’s Seas. Krieger Publishing Company, Malabar, Florida, pp. 404–463 (English edition). Lindberg, G.U. & Federov, V.V. (1993) Fishes of the sea of Japan and adjacent parts of the Sea of Okhotsk and the Yellow Sea. Part 6. Teleostomi. Osteichthyes. Actinopterygii. XXXI. Pleuronectiformes (CXCV. Fam. Psettodidae —CCI. Fam. Cynoglossidae). Handbook on the Identification of Animals, Zoological Institute of the Russian Academy, (166), 1–271 (In Russian). Liu, J. (2008) Cynoglossidae. In: Liu, R. (Ed) Checklist of Marine Biota of China Seas. Science Press, Beijing, pp. 1056–1057 (Chinese and English). Maretto, F., Reffo, E., Dalvit, C., Barcaccia, G. & Mantovani, R. (2007) Finding 16S rRNA gene-based SNPs for the genetic traceability of commercial species belonging to Gadiformes. Italian Journal of Animal Science, 6(1), 161–163. Matsubara, K. (1955) Fish Morphology and Hierarchy. Ishizaki Shoten, Tokyo. Part II, pp. 790–1605 (In Japanese). Minami, T. (1988) Family Cynoglossidae. In: Okiyama, M. (Ed), An atlas of the early stage fishes in Japan. Tokai University Press, pp. 959–964 (In Japanese). Mori, T. (1928) A catalogue of the fishes of Korea. Journal of the Pan-Pacific Research Institution 3(3), 2–8. Mori, T. (1952) Checklist of the fishes of Korea. Memoirs of the Hyogo University of Agriculture, 1(3), 1–228. Mori, T. & Uchida, K. (1934) A revised catalogue of the fishes of Korea. Journal of the Chosen Natural History Society Number 19, 12–33 (In Japanese). Munro, I.S.R. (1955) The marine and fresh water fishes of Ceylon. Department of External Affairs, Canberra, Australia, 351 pp. Munroe, T.A. (1992) Interdigitation pattern of dorsal-fin pterygiophores and neural spines, an important diagnostic character for symphurine tonguefishes (Symphurus: Cynoglossidae: Pleuronectiformes). Bulletin of Marine Science, 50(3), 357–403. Munroe, T.A. (1998) Systematics and ecology of tonguefishes of the genus Symphurus (Cynoglossidae: Pleuronectiformes) from the western Atlantic Ocean. Fishery Bulletin, 96(1), 1–182. Munroe, T.A. (2000) Family Cynoglossidae. In: Randall, J.E. & Lim, K.K.P. (Eds), A checklist of the fishes of the South China Sea, Raffles Bulletin of Zoology, Supplement Number 8. The Biodiversity of the South China Sea, pp. 646–647. Munroe, T.A. (2001) Family Cynoglossidae. In: Carpenter, K.E. & Niem V.H. (Eds). Species identification guide for fishery purposes, The living marine resources of the western central pacific, Bony fishes part 4. Food and Agriculture Organization of the United Nations, Rome, pp. 3890–3901. Munroe, T.A. (2006) New western Indian Ocean tonguefish (Pleuronectiformes: Cynoglossidae, Symphurus). Copeia, 2006(2), 230–234. http://dx.doi.org/10.1643/0045-8511(2006)6[230:NWIOTP]2.0.CO;2 Munroe, T.A. & Amaoka, K. (1998) Symphurus hondoensis Hubbs 1915 (Cynoglossidae, Pleuronectiformes), a valid species of western Pacific tonguefish. Ichthyological Research, 45(4), 385–391. http://dx.doi.org/10.1007/BF02725191 Munroe, T.A. & Hashimoto, J. (2008) A new Western Pacific Tonguefish (Pleuronectiformes: Cynoglossidae): The first pleuronectiform discovered at active hydrothermal vents. Zootaxa, 1839, 43–59. Munroe, T.A. & Marsh, B.N. (1997) Taxonomic status of three nominal species of Indo-Pacific symphurine tonguefishes (Symphurus: Cynoglossidae: Pleuronectiformes). Ichthyological Research, 44(2), 189–200. http://dx.doi.org/10.1007/

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 401 TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

BF02678697 Norman, J.R. (1928) The flatfishes (Heterosomata) of India, with a list of the specimens in the Indian Museum. Part II. Records of the Indian Museum, 30, 173–215. Ochiai, A. (1959) Morphology, taxonomy and ecology of the soles of Japan. Laboratory of Fisheries, Faculty of Science, Kyoto University, Kyoto, 236 pp. (In Japanese). Ochiai, A. (1963) Fauna Japonica. Soleina (Pisces). Biogeographical Society of Japan, Tokyo, 114 pp. Ochiai, A. (1984) Family Cynoglossidae. In: Masuda, H., Amaoka, K., Araga, C., Uyeno, T. & Yoshino, T. (Eds), The fishes of the Japanese Archipelago. Tokai University Press, Tokyo, pp. 355–356. Ochiai, A. (1987) Family Cynoglossidae. In: Abe, T. (Ed), Illustrated fishes of the world in colour. Hokuryukan Company, Limited, Tokyo, pp. 927–931 (In Japanese). Ochiai, A. (1988) Family Cynoglossidae. In: Masuda, H., Amaoka, K., Araga, C., Uyeno, T. & Yoshino, T. (Eds) The Fishes of the Japanese Archipelago (2nd Edition). Tokai University Press, Tokyo pp. 341–342 (In Japanese). Ochiai, A. (1989) Cynoglossidae. In: Abe, T. & Ochiai, A., (Eds), Keys to the Japanese fishes fully illustrated in color. Hokuryukan Company Limited, Tokyo, pp. 219–222 (In Japanese). Ohashi, Y. & Motomura, H. (2011) Pleuronectiform fishes of northern Kagoshima prefecture, Japan. Nature of Kagoshima 37, 71–118. Okada, Y. (1938) A catalogue of vertebrates of Japan. Maruzen Company Limited, Tokyo, 412 pp. (English and Japanese). Okada, Y. & Matsubara, K. (1938) Keys to the fishes and fish-like animals of Japan: including Kuril Islands, Southern Sakhalin, Bonin Islands, Ryukyu Islands, Korea and Formosa. Sanseido Company Limited, Tokyo, 584 pp. (In Japanese). Ono, T., Fujikura, K., Hashimoto, J., Fujiwara, Y. & Segawa, S. (1996) The hydrothermal vent community at the Kaikata Seamount near Ogasawara (Bonin) Islands, South Japan. JAMSTEC Journal of Deep Sea Research, 12, 221–230 (In Japanese with English abstract and legends). Palumbi, S.R. (1996) Nucleic acids II: the polymerase chain reaction In: Hillis, D.M., Moritz, C. & Mable, B.K. (Eds), Molecular systematics, 2nd Edition. Sinauer Associates, Inc, Sutherland, MA, pp. 205–247. Pyle, R., Earle, J.L. & Greene, B.D. (2008) Five new species of the damselfish genus Chromis (Perciformes: Labroidei: Pomacentridae) from deep coral reefs in the tropical western Pacific. Zootaxa, 1671, 3–31. Sakamoto, K. (1997) Pleuronectidae, Soleidae and Cynoglossidae. In: Okamura, O. & Amaoka, K. (Eds), Sea fishes of Japan, Yama-kei Publishing Company, Limited, Tokyo, pp. 672–684 (In Japanese). Schmidt, P.J. (1904) Fishes of the eastern seas of the Russian empire. Scientific results of the Korea-Sakhalin Expedition of the Emperor Russian Geographical Society, 1900–1901. Saint Petersburg, 466 pp. (In Russian). Schwarzhans, W. (1999) A comparative morphological treatise of recent and fossil otoliths of the order Pleuronectiformes. Vo lum e 2 Piscium catalogus: Pt. Otolithi piscium (Pfeil, F.H., Ed), München, Germany, 392 pp. Shen, S.-C. (1983) Cynoglossid fishes (Pleuronectiformes: Cynoglossidae) of Taiwan. Bulletin of the Institute of Zoology Academia Sinica, 22(1), 105–118. Shen, S.-C. (1984) Coastal fishes of Taiwan. Shih-Chieh Shen, Department of Zoology, National Taiwan University, Taipei, 190 pp. Shen, S.-C. (1986) Chinese-English-Japanese scientific glossary of fishes. Shih-Chieh Shen, Taiwan Museum, Taipei, 427 pp. Shen, S.-C. (1993) Pleuronectiformes. In: Shen, S.-C., Lee, S.-C., Shao, K.-T., Mok, H.-C., Chen, C.-H., Chen, C.-C. & Tzeng, C.-S. (Eds), Fishes of Taiwan, National Taiwan University, Taipei, Taiwan, pp. 565–585 (In Chinese). Shen, S.-C. & Lin, W.-W. (1984) Some new records of fishes from Taiwan with descriptions of three new species. Taiwan Museum Special Publication Series (4), 1–25. Shen, S.-C. & Wu, K.-Y. (2011) Cynoglossidae. In: Shen, S.-C. and Wu, K.-Y. (Eds), Fishes of Taiwan. National Museum of Marine Biology & Aquarium, Pingtung, Taiwan, pp. 763–767 (In Chinese). Shinohara, G., Endo, H., Matsuura, K., Machida, Y. & Honda, H. (2001) Annotated Checklist of the deepwater fishes from Tosa Bay, Japan. In: Fujita, T, Saito, H. & Takeda, M. (Eds), Deep-sea fauna and pollutants in Tosa Bay. National Science Museum Tokyo Monographs Number 20, pp. 283–343. Shinohara, G., Sato, T., Aonuma, Y., Horikawa, H., Matsuura, K., Nakabo, T. & Sato, K. (2005) Annotated checklist of deep- sea fishes from the waters around the Ryukyu Islands, Japan. In: Hasegawa, K, Shinohara, G. & Takeda, M. (Eds), Deep- sea fauna and pollutants in the Nansei Islands. National Science Museum Tokyo Monographs Number 39, pp. 683–735.. Son, Y.H. (1980) The fishes of east sea of Chosen. Science Press, Pyonyang, 464 pp. (In Korean). Sowerby, A.de.C. (1930) The naturalist in Manchuria, Volumes 4–5. Tientsin Press, 571 pp. Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24(8), 1596–1599. http://dx.doi.org/10.1093/molbev/msm092 Taranetz, A.J. (1937) Handbook for identification of fishes of Soviet Far East and adjacent waters. Bulletin of the Pacific Science Institute 11, 1–200 (In Russian). Tautz, D., Arctander, P., Minelli, A., Thomas, R.H. & Vogler, A.P. (2003) A plea for DNA taxonomy. Trends in Ecology and Evolution, 18(2), 70–74. http://dx.doi.org/10.1016/S0169-5347(02)00041-1 Teletchea, F. (2009) Molecular identification methods of fish species: reassessment and possible applications. Reviews in Fish Biology and Fisheries, 19(3), 265–293. http://dx.doi.org/10.1007/s11160-009-9107-4 Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25(24),

402 · Zootaxa 3620 (3) © 2013 Magnolia Press LEE ET AL. TERMS OF USE This pdf is provided by Magnolia Press for private/research use. Commercial sale or deposition in a public library or website is prohibited.

4876–4882. http://dx.doi.org/10.1093/nar/25.24.4876 Tian, Y., Kidokor, H. & Watanabe, T. (2006) Long-term changes in the fish community structure from the Tsushima warm current region of the Japan/East Sea with an emphasis on the impacts of fishing and climate regime shift over the last four decades. Progress in Oceanography, 68(2–4), 217–237. http://dx.doi.org/10.1016/j.pocean.2006.02.009 Tornabene, L., Baldwin, C., Weigt, L.A. & Pezold, F. (2010) Exploring the diversity of western Atlantic Bathygobius (Teleostei: Gobiidae) with cytochrome c oxidase-I, with description of two new species. Aqua, International Journal of Ichthyology, 16(4), 141–170. Tunnicliffe, V., Koop, B.F., Tyler, J. & So, S. (2010) Flatfish at seamount hydrothermal vents show strong genetic divergence between volcanic arcs. Marine Ecology, 31(Suppl. 1), 158–167. http://dx.doi.org/10.1111/j.1439-0485.2010.00370.x Victor, B.C. (2007) Coryphopterus kuna, a new goby (Perciformes: Gobiidae: Gobiinae) from the western Caribbean, with the identification of the late larval stage and an estimate of the pelagic larval duration. Zootaxa, 1526, 51–61. Victor, B.C. (2008) Redescription of Coryphopterus tortugae (Jordan) and a new allied species Coryphopterus bol (Perciformes: Gobiidae: Gobiinae) from the tropical western Atlantic Ocean. Journal of the Ocean Science Foundation, 2008(1), 1–19. Wang, C. (1993) Ecological characteristics of the fish fauna of the South China Sea. In: Morton, B. (Ed), The Marine Biology of the South China Sea, Volume 1. Proceedings of the First International Conference on the Marine Biology of Hong Kong and the South China Sea, Hong Kong, 28 October-3 November, pp. 77–118. Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. & Hebert, P.D.N. (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B, 360(1462), 1847–1857. http://dx.doi.org/10.1098/rstb.2005.1716 Ward, R.D., Holmes, B.H. & Yearsley, G.K. (2008) DNA barcoding reveals a likely second species of Asian seabass (barramundi) (Lates calcarifer). Journal of Fish Biology, 72(2), 458–463. http://dx.doi.org/10.1111/j.1095- 8649.2007.01703.x Weber, M. (1913) Die Fische der Siboga-Expedition. E.J. Brill, Leiden, 710 pp. Weber, M. & de Beaufort, L.F. (1929) The fishes of the Indo-Australian Archipelago. V. Anacanthini, Allotriognathi, Heterostomata, Berycomorphi, Percomorphi: families Kuhliidae, Apogonidae, Plesiopidae, Pseudoplesiopidae, Priacanthidae, Centropomidae. The Fishes of the Indo-Australian Archipelago, E.J. Brill Ltd, Leiden, Volume 5, 458 pp. Wu, H.W. (1932) Contribution à l’étude morphologiques, biologiques et systématique des poissons Hétérosomes (Pisces: Heterosomata) de la China. Thése de Faculty de Sciences, Université de Paris, 179 pp. Yamada, U. (2000) Cynoglossidae. In: Nakabo, T. (Ed) Fishes of Japan with pictorial keys to the species. Second edition. Tokai University Press, Tokyo, pp. 1388–1392 (In Japanese). Yamada, U. (2002) Cynoglossidae. In: Nakabo, T. (Ed) Fishes of Japan with pictorial keys to the species. English edition. Tokai University Press, Tokyo, pp. 1388–1392. Yasuda, F., Tokkagi, K., Tominaga, Y., Uyeno, T., Abe, T., Ishiyama, R., Iwai, T., Ochiai, A., Kuronuma, K. & Nakamura, M. (1981). Dictionary of Japanese fish names and their foreign equivalents. Sanseido Company, Limited, Tokyo, Japan, 834 pp. (In Japanese, Chinese, English, French, German, Russian and other languages). Yeh, H.-M. (2001) Community structure, faunal zonation and biogeography of the deep-sea demersal fishes around Japan, and their relationships with environmental parameters. Unpublished Ph. D. dissertation, University of Tokyo, 272 pp. Yoda, M., Tokimura, M., Horikawa, H. & Yamada, U. (2002) A catalogue of the fishes from the East China and Yellow seas with their local names. Seikai National Fisheries Research Institute, Fisheries Research Agency, Japan, 47 pp. (In Japanese). Youn, C.-H. (2002) Fishes of Korea with Pictorial Key and Systematic List. Academic Seojeok, Seoul, 747 pp. (In Korean).

SYMPHURUS ORIENTALIS REDEFINITION Zootaxa 3620 (3) © 2013 Magnolia Press · 403