Pleuronectiformes: Cynoglossidae: Symphurus)Fromthe Western North Pacific Ocean

Journal of Fish Biology (2014) doi:10.1111/jfb.12440, available online at wileyonlinelibrary.com

Description of a new cryptic, shallow-water tonguefish (Pleuronectiformes: Cynoglossidae: Symphurus)fromthe western North Pacific Ocean

M.-Y. Lee*, T. A. Munroe† and K.-T. Shao ‡ §

*Department of Aquaculture, National Taiwan Ocean University, No. 2, Peining Rd., 20224 Keelung, Taiwan, †National Marine Fisheries Service National Systematics Laboratory, NOAA, Smithsonian Institution, P. O. Box 37012, National Museum of Natural History, WC-57, MRC-153, Washington, DC 20013-7012, U.S.A. and ‡Laboratory of Fish Ecology and Evolution, Biodiversity Research Center, Academia Sinica, Nankang, 11529 Taipei, Taiwan

(Received 8 July 2013, Accepted 6 May 2014)

Combined results based on morphological characters and analyses of partial sequences of the 16s rRNA and coI genes confirm the validity of a new, cryptic, symphurine tonguefish from the western North Pacific Ocean. Symphurus leucochilus n. sp., a diminutive species reaching sizes to c. 67 mm standard length, is described from nine specimens that were collected from fish-landing ports and from trawls made at c. 150 m off Taiwan and Japan. Symphurus leucochilus shares many similar features with those of Symphurus microrhynchus and that of several undescribed species that are morphologically similar to S. microrhynchus. Symphurus leucochilus has also been misidentified as Symphurus orientalis in fish collections because of shared similarities in some aspects of their morphology. The newspecies differs from all congeners by the following combination of meristic, morphological and pigmentation features: a predominant 1–2–2–2–2 pattern of interdigitation of proximal dorsal-fin pterygiophores and neural spines; 12 caudal-fin rays; 89–92 dorsal-fin rays; 76–80 anal-fin rays; 49–51 total vertebrae; four hypurals; 75–83 longitudinal scale rows; 32–35 transverse scales; 15–17 scale rows on the head posterior to the lower orbit; absence of a fleshy ridge on the ocular-side lower jaw and a membra- nous connection between the anterior nostril and lower part of the eye; a narrow interorbital space and dorsal-fin origin anterior to the vertical through the anterior margin of the upper eye; absence ofboth dermal spots at bases of anterior dorsal-fin rays and melanophores on the isthmus; uniformly yellow to light-brown ocular-side colouration without bands; dorsal and anal fins with alternating series of dark rectangular blotches and unpigmented areas; a uniform white blind side and a bluish-black peritoneum. Despite overall similarities in morphology between S. leucochilus and S. orientalis, as well as between two of the nominal species morphologically similar to S. microrhynchus, analyses of partial 16s rRNA and coI gene sequences show that S. leucochilus, S. orientalis and the two other nominal species represent three distinct lineages within the genus Symphurus. © 2014 The Fisheries Society of the British Isles

Key words: cryptic species; DNA barcoding; Symphurus leucochilus; Symphurus microrhynchus; Sym- phurus orientalis.

§Author to whom correspondence should be addressed. Tel.: +886 2 27899545; email: [email protected] 1

INTRODUCTION Six nominal species of the Indo-West Pacific genus Symphurus, characterized by having 12 caudal-fin rays, are considered valid (Munroe, 1992; Munroe & Marsh, 1997; Lee et al., 2013). Most of these nominal species, which include Symphurus orientalis (Bleeker 1879), Symphurus septemstriatus (Alcock 1891), Symphurus trifasciatus (Alcock 1894), Symphurus microrhynchus (Weber 1913), Symphurus luzonensis Cha- banaud 1955 and Symphurus fallax Chabanaud 1957, occur in relatively deep water, are rarely collected and are known only from restricted localities, usually in tropical seas. Of these six species, only S. orientalis, an inhabitant of the outer continental shelf and upper continental slope in the western North Pacific Ocean, occurs beyond subtropical waters (Chyung, 1961; Amaoka, 1982; Ochiai, 1984, 1987, 1988, 1989; Shen, 1984; Shen et al., 1993; Kim & Choi, 1994; Li & Wang, 1995; Yamada, 2000, 2002; Lee et al., 2013). Recently, Lee et al. (2013) re-evaluated and re-described S. orientalis based on a large series of specimens collected from different parts of this species’ geographic range and they stabilized the species concept of S. orientalis by incorporating information from both morphological and molecular analyses. Those authors also called attention to the fact that many unresolved questions exist regarding the identity and status of other populations of nominal Indo-West Pacific species of Symphurus possessing 12 caudal-fin rays. Lee et al. (2013) noted that previously reported (Okada & Matsubara, 1938; Mat- subara, 1955; Ochiai, 1959, 1963) ranges of meristic and morphometric features for specimens purported to be S. orientalis probably included data for at least two other nominal species whose meristic features are lower than those of S. orientalis.Someof the specimens examined by Lee et al. (2013) and M.-Y. Lee & T. A. Munroe (unpubl. data) from the western North Pacific Ocean are similar in their meristic and morphological features to those reported for S. microrhynchus (Munroe & Marsh, 1997). Munroe & Marsh (1997), however, did not examine any specimens of S. microrhynchus from Japanese waters. Symphurus microrhynchus, as understood by Munroe & Marsh (1997), is a small-sized (maximum size c. 51 mm standard length, LS), shallow-water tonguefish with wide distribution in tropical waters of the Indo-Pacific region, especially those in the Indo-Australian archipelago. Diagnostic features of S. microrhynchus (Weber & de Beaufort, 1929; Munroe & Marsh, 1997) include darkly pigmented melanophores in the dermis at the bases of the anteriormost dorsal and anal-fin rays, pigmentation on the isthmus, presence of an obvious fleshy ridge on the posterior half of the ocular-side lower jaw and an anterior placement of the dorsal-fin origin. Results of morphological and molecular analyses (M.-Y. Lee & T. A. Munroe, unpubl. data) indicate that specimens morphologically similar to S. microrhynchus vary significantly among different geographical locations. Results from theDNA sequences, in particular, indicate much higher genetic variation among these populations than would be expected for intraspecific populations (Ward et al., 2005, 2008, 2009; Benziger et al., 2011). These specimens, tentatively identified as S. microrhynchus, actually represent a composite mix of several morphologically similar species. The taxonomic status of these nominal species is unresolved. Unexpectedly, while examining specimens of S. orientalis and those tentatively identified as S. microrhynchus, a small number of specimens were discovered that appeared

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 SYMPHURUS LEUCOCHILUS, NEW TONGUEFISH SPECIES 3 different from any of these other species. Meristic features of these unusual specimens that were captured at several locations in the western North Pacific Ocean overlap nearly completely in the ranges of those found in specimens tentatively identified as S. microrhynchus. Both their meristic features and colouration are similar to those of some of the specimens of S. orientalis that have been examined (unpubl. obs.). Further analyses of these unusual specimens indicated that they represent an undescribed species featuring subtle morphological differences from those observed in S. microrhynchus. They also have slight morphological, but distinct genetic, differences from those of specimens tentatively identified as S. microrhynchus and from those of S. orientalis. The objective of this study was to provide a formal description of this new species of Symphurus based on both morphological and molecular data, and to diagnose it from congeners.

MATERIALS AND METHODS A total of nine specimens identified as Symphurus leucochilus n. sp., including both preserved specimens in fish collections as well as fresh specimens collected in the field, constitute thebasis for data collected in this study. Tissue samples from specimens in field collections were used for DNA analyses. Voucher specimens for all tissue samples analysed were preserved subsequently in 95% ethanol, catalogued and deposited in fish collections. Institutional abbreviations follow those listed by Fricke & Eschmeyer (2014). Comparative materials for all other Indo-Pacific species of Symphurus included in this study are listed in the previous studies by Munroe (1992, 2006), Shen et al. (1993), Munroe & Amaoka (1998), Krabbenhoft & Munroe (2003), Munroe & Hashimoto (2008), Lee et al. (2009a, 2009b, 2013) and Munroe et al. (2011). Methods for counting meristic characters and for measuring morphometric features and general terminology follow those in the study by Munroe (1998). All specimens examined were radiographed. Terminology and formulae for interdigitation patterns of proximal dorsal pterygiophores and vertebral neural spines (ID pattern) follow those in the study by Munroe (1992). Morphometric characters were measured to the nearest 0⋅01 mm using either dial callipers or a dissecting microscope fitted with an ocular micrometre. Morphometric features are expressed either as proportions in per cent LS or per cent head length (LH). Description of pigmentation features are based primarily on freshly landed specimens, with supplemental information provided from specimens preserved in formalin and transferred to 75% ethanol. Maturity was estimated by macroscopic examination of the extent of posterior elongation of ovaries and presence of developing ova in the ovaries (both observed by using light transmitted through the body). In species of Symphurus, no obvious differences are apparent in testis size between mature and immature males; therefore, estimates of maturity are based entirely on females. Tissue samples from a total of 13 specimens, including six of S. cf. microrhynchus (identification based on Munroe & Marsh, 1997) and seven of S. leucochilus, were amplified for both partial 16s rRNA and coI gene sequences. To examine genetic divergence in nominal species, some researchers (Hebert et al., 2003; Ward et al., 2005) suggest using sequences of the 5′ region of the mitochondrial cytochrome c oxidase subunit I gene (coI or coxI) for species identification, whereas others recommend using 16s rRNA as a good model for assisting taxonomic works (Akimoto et al., 2002; Maretto et al., 2007; Lakra et al., 2009). Both genes were examined in this study for identifying species of Symphurus (Lee et al., 2013). Total genomic DNA was extracted from seven individuals of the new species and six individuals of S. cf. microrhynchus (from different localities around Taiwan). DNA was extracted using the Genomic DNA Mini Kit (Geneaid; www.geneaid.com). Sequences were amplified using the following primer pair 16sa-L (5′ CGCCTGTTTACCAAAAACATCGCCT 3′)and16sb-H (5′ CCGGTCTGAACTCAGATCACGT 3′) (Palumbi, 1996) for the 16s rRNA gene. The 16s rRNA sequences of the individuals of each species were aligned to yield a final alignment varying from 505 bp (S. cf. microrhynchus), to 508 bp (S. leucochilus), to 510 bp

(S. orientalis). The primer pair Symphurus-coIf (5′ GGTGCCTGAGCHGGRATAATTGGHAC 3′)andSymphurus-coIr (5′ TAAATTTTTGKGTGGCCAAAGAATCA 3′) was used for the coI gene (Lee et al., 2013). This pair of primers was designed by aligning the universal primer (Ward et al., 2005) with coI sequences of Cynoglossidae, especially species of Symphurus, from GenBank, to focus on amplifying the coI sequences from Symphurus.ThecoI sequences of individuals of each species were aligned to yield a final alignment of 639 bp. A polymerase chain reaction (PCR) was carried out using a thermal cycler (BIO-RAD; www.bio-rad.com) in 25 μl reaction volumes containing 100 ng of total DNA, 1 μM of each primer, 0⋅04 mM of deoxynucleotide triphosphate (dNTP), 1× reaction buffer and 0⋅05 U of Taq polymerase (Genomics; www.genomics.sinica.edu.tw.) with denaturation at 94∘ Cfor4min;thiswas followed by 35 cycles of denaturing at 94∘ C for 30 s, annealing at 48∘ C for 45 s and extension at 72∘ C for 1 min, with a final extension at 72∘ C for 10 min. The PCR products were then sequenced bidirectionally and analysed on an ABI3730XL model (Applied Biosystems; www.appliedbiosystems.com). All sequences were checked against electropherograms and manually edited using the programme 4Peaks 1.7 (www.mekentosj.com/science/4peaks). In order to confirm the absence of stop codons in the amplified coI, the nucleotide sequences were translated according to the vertebrate mitochondrial genetic code using EMBOSS-transeq (EMBL-EBI; www.ebi.ac.uk/Tools/st/emboss_transeq). All sequences were aligned using ClustalW (Thompson et al., 1994) in MEGA 4.0 (Tamura et al., 2007), with default settings chosen for parameters. Nucleotide genetic distances, both the Kimura two-parameter distance (K2P) (Kimura, 1980) and p-distance substitution model including transitions and transversions, complete deletion of gaps and missing data, uniform rates among sites, and between and within species comparisons, were also calculated by using MEGA 4.0 (Tamura et al., 2007). Trees based on sequence data were constructed by the neighbour-joining (NJ) method, K2P substitution model, and evaluated by 10 000 boot- strapping replications (Felsenstein, 1985) using MEGA 4.0 (Tamura et al., 2007). They were constructed only to show divergence in genetic sequences among the samples analysed. The NJ method was used instead of maximum likelihood or maximum parsimony methods because the approach in this study focused on species identifications, with both coI (DNA barcoding) and 16s rRNA applied for this purpose. Sequences were deposited in GenBank under the accession numbers KC900860–KC900885 and KF676778–KF676783, and sequences of three specimens of S. orientalis reported in the study by Lee et al. (2013) were also included in the NJ analysis. Sequences of S. orientalis are JN678742, JN678752 and JN678763 for 16s rRNA, and JN678777, JN678787 and JN678798 for coI.

SYMPHURUS LEUCOCHILUS N. SP. (FIGS 1 – 5 AND TABLES I – IV)

HOLOTYPE ⋅ USNM 408271: mature female, 58 7mmLS, Da-Shi fish market, north-eastern Tai- wan, 24 August 2011.

PARATYPES (N = 7; THREE MALES AND FOUR FEMALES) ⋅ ASIZP 72343: adult male, 54 8mmLS, Dong-Gang fish market, south-western Tai- ⋅ wan, 15 June 2009; ASIZP 72355: immature female, 31 0mmLS, Tosa Bay, off Kochi, ⋅ Japan, 150 m, 17 June 2009; ASIZP 72357: immature female, 32 9mmLS, Tosa Bay, ⋅ off Kochi, Japan, 150 m, 17 June 2009; ASIZP 72369: mature female, 55 9mmLS, Dong-Gang fish market, south-western Taiwan, 3 October 2007; NMMB–P 17767: ⋅ adult male, 66 9mmLS, Da-Shi fish market, north-eastern Taiwan, 24 August 2011; ⋅ USNM 408272: mature female, 57 5mmLS, Da-Shi fish market, north-eastern Taiwan, ⋅ 24 August 2011; and USNM 408273: adult male, 47 4mmLS, Da-Shi fish market, north-eastern Taiwan, 24 August 2011.

(a)

(b)

Fig. 1. Symphurus leucochilus n. sp., holotype USNM 408271, mature female, 58⋅7 mm standard length, north-east Taiwan: (a) ocular-side pigmentation of freshly caught specimen and (b) blind-side colouration of same specimen.

NON-TYPE SPECIMEN ⋅ ASIZP 72356: juvenile (unknown sex), 21 7mmLS, Tosa Bay, off Kochi, Japan, 150 m, 17 June 2009.

DIAGNOSIS Symphurus leucochilus is distinguished from all congeners by the following combination of characters: 1–2–2–2–2 ID pattern; 12 caudal-fin rays; nine abdominal and 49–51 total vertebrae; four hypurals; 89–92 dorsal-fin rays; 76–80 anal-fin rays; 75–83 longitudinal scale rows; 32–35 transverse scales; 15–17 scale rows on the head posterior to the lower orbit; uniformly yellow to light-brown ocular side; uniform white blind side; bluish-black peritoneum; entire lengths of dorsal and anal fins with alternating series of dark rectangular blotches (extending from base to tip of fin) and unpigmented areas; no dermal spots at bases of anterior dorsal-fin rays; no pigmented spots on the isthmus; no fleshy ridge on ocular-side lower jaw; upper and lower eyes separated from each other by a narrow interorbital space; lower eye without a membra- nous connection to anterior nostril; and dorsal-fin origin at the vertical through anterior margin of the upper eye.

115° 120° 125° 130° 135° 140° 145° 45° 45°

40° 40°

35° 35°

30° 30°

4 25° 25°

20° 20°

15° 15°

10° 10° 115° 120° 125° 130° 135° 140° 145°

Fig. 2. Geographic distribution of Symphurus leucochilus n. sp. based on specimens examined in this study. , capture location of holotype; , capture location of other specimens. The numbers indicate the number of specimens collected from locations.

DESCRIPTION Symphurus leucochilus is a diminutive species, reaching a maximum size of 66⋅9 mm LS. Meristic characters are summarized in Table I. Predominant ID pattern 1–2–2–2–2(eight of the nine specimens). Caudal-fin rays 12. Dorsal-fin rays 89–92. Anal-fin rays 76–80. Pelvic-fin rays, four. Total vertebrae 49–51; abdominal vertebrae, nine (3 + 6). Hypurals, four. Longitudinal scale rows 75–83. Scale rows on head posterior to lower orbit 15–17. Transverse scales 32–35. Proportions of morphometric features are presented in Table II. Body relatively deep; maximum depth in anterior one-third of body usually at point between anus and eighth anal-fin ray and body depth tapering rapidly posterior to midpoint. Preanal lengthusu- ally smaller than body depth. Head moderately long and wide; head width (WH) slightly ⋅ ⋅ shorter than body depth, and much greater than head length (WH: LH = 1 07–1 29, ⋅ ⋅ ⋅ X = 1 20). Upper head lobe wider than lower head lobe (LUH:LLH = 1 05–1 37, X = 1⋅22); slightly shorter than postorbital length. Upper lobe of ocular-side opercle wider than lower opercular lobe; posterior margin of lower lobe projecting slightly

(a) KC900866 34 KC900871 KC900867 37 KC900868 S. leucochilus 48 KC900872 100 KC900870 KC900869 JN678752

100 JN678742 S. orientalis 65 JN678762 76 KF646778 100 KF646779 VN KF646780 100 KC900862 KC900865 S. cf. microrhynchus 77 KC900864 80 TW KC900863 75 KC900860 74 KC900861

0·02

(b) KC900879 KC900881 64 KC900880 KC900882 S. leucochilus 100 KC900885 KC900883 KC900884 JN678787 JN678777 S.orientalis 100 JN678797 90 KF646781 100 KF646783 VN KF646782 55 KC900873 100 60 KC900876 S.cf. microrhynchus KC900874 TW 100 KC900875 KC900877 33 KC900878

0·02

Fig. 3. Kimura two-parameter (K2P) and neighbour-joining tree of 19 sequences from the genus Symphurus [TW, Symphurus cf. microrhynchus (TW); VN, S. cf. microrhynchus (VN)]: (a) 16s rRNA sequences and (b) coI sequences. Number at nodes indicates bootstrap values for 10 000 replications and the scale bar represents the K2P distance.

(b)

(a)

Fig. 4. Comparison of the ocular side of the head of two species of Indo-West Pacific Symphurus:(a)Symphurus ⋅ cf. microrhynchus (TW), ASIZP 72370, adult male, 57 0 mm standard length (LS), north-east Taiwan and ⋅ (b) Symphurus leucochilus n. sp., holotype USNM 408271, mature female, 58 7mmLS, north-east Taiwan. beyond posterior margin of upper opercular lobe or both lobes equal with posterior margins reaching similar points along the same vertical plane. Snout moderately long, slightly round to obliquely blunt anteriorly, its length (LSN) much greater than eye ⋅ ⋅ ⋅ diameter (DE)(LSN:DE = 1 47–2 09, X =1 83). Dermal papillae present, but not well developed, on blind side of snout. Ocular-side anterior nostril tubular and short, usually not reaching anterior margin of lower eye when depressed posteriorly. Ocular-side posterior nostril a small, rounded tube located on snout just anterior to interorbital space. Blind-side anterior nostril tubular and short, easily distinguishable from dermal papillae; blind-side posterior nostril a shorter, and wider, posteriorly directed tube situated posterior to vertical at posterior margin of jaws. Jaws long and slightly arched; upper jaw length equal to, or slightly longer than, snout length; posterior margin of upper jaw usually extending to point between verticals through anterior margin of eye and anterior margin of pupil of lower eye. Ocular-side lower jaw without fleshy ridge. Cheek depth shorter than snout length. Eyes moderately large and oval, separated by two to three rows of small ctenoid scales in narrow interorbital space. Eyes usually equal in position, or with anterior margin of upper eye slightly in advance of that of lower eye. Pupillary operculum absent. Dorsal-fin origin located at point between verticals through anterior margin of upper eye and anterior margin of pupil of upper eye; predorsal length moderately short. Anteriormost dorsal-fin rays slightly shorter than more posterior fin rays. Scales absent on both sides of dorsal and anal-fin rays. Pelvic fin moderately long; longest pelvic-fin ray, when extended posteriorly, usually reaching base of first to fourth anal-fin ray. Posteriormost pelvic-fin ray connected to

(a) (b)

Fig. 5. Lateral views comparing the bases of the anteriormost part of the dorsal fin and isthmus in two species of Indo-West Pacific Symphurus:(a,b)Symphurus cf. microrhynchus (TW), ASIZP 67658, adult male, ⋅ 53 3 mm standard length (LS), north-east Taiwan and (c, d) Symphurus leucochilus n. sp. holotype USNM ⋅ 408271, mature female, 58 7mmLS, north-east Taiwan. anal fin by delicate membrane. Caudal fin relatively long, with several rows ofctenoid scales on base of fin. Both sides of body with numerous, strongly ctenoid scales. Teeth present and recurved slightly inwards on all jaws; better developed on blind-side jaws. Ocular-side premaxilla and dentary with single row of sharply pointed, well-developed teeth. Blind-side premaxilla with three to four rows of sharp, recurved teeth. Blind-side lower jaw with four to six rows of well-developed teeth.

PIGMENTATION (FIG. 1). Ocular-side background colouration of body, head and most of external surface of opercle generally light-yellow to light-brown, sometimes also with irregular, darkly shaded areas. External surface overlying abdominal area usually darker bluish-black due to dark peritoneal pigment visible through abdominal wall. Posterior margin of opercle darker brown than more lightly pigmented anterior regions. Outer surface of ocular-side isthmus without conspicuous melanophores. Inner surface of ocular-side opercle and isthmus unpigmented. Ocular-side lips and chin region light-yellow to light-brown; margins of lips with numerous small black dots. Ocular-side anterior nostril light-yellow to brown. Upper aspects of eyes and eye sockets light blue to bluish-green; pupils bluish-black. No conspicuous melanophores on head region posterior to eyes. No conspicuous dermal spots or melanophores at bases of anterior dorsal-fin rays. Blind side generally white to light yellow with darkly pigmented

Table I. Frequency of meristic characters of Symphurus leucochilus. Counts for the holotype (USNM 408271) are indicated (*). Sample size nine fish except where indicated, +, when sample size was eight fish Meristic character n Meristic character n ID pattern 1–2–2–2–2* 8 1–2–1–2–2 1 Longitudinal-scale count Caudal-fin rays 75 1 12* 9 76* 1 Dorsal-fin rays+ 77 2 89 1 78 – 90* 4 79 1 91 2 80 2 92 1 81 – Anal-fin rays+ 82 1 76* 1 83 1 77 1 Head-scale count 78 4 15 2 79 1 16 3 80 1 17* 4 Abdominal vertebrae Lateral-scale count 3+69 32 1 Total vertebrae 33 4 49* 4 34 3 50 3 35* 1 51 2

bluish-black region overlying peritoneum. Background colouration of outer surface of blind-side opercle white to light yellowish; inner surface unpigmented. Small specimens with a streak of black colouration on vertebrae distinctly visible externally through body musculature. Colouration of alcohol-preserved specimens similar to that of freshly caught fish, except bluish-black colouration of pupil of freshly caught specimens blending more gradually and eventually fading into white background colouration. Fin rays of dorsal, anal and pelvic fins uniformly yellow to brown; basal regions of fin rays and membranes covering fin rays light yellow, with diffuse scattering of yellow to brown melanophores covering entire fin membranes on both sides of fins. Entire dorsal and anal finwitha series of dark streaks alternating with lighter areas on fins. Basal margins of blind sides of dorsal and anal-fin rays and associated fin membranes light yellow to light brown.

SIZE AND SEXUAL MATURITY ⋅ ⋅ ⋅ ⋅ Nine specimens range in size from 21 7to669mmLS.Twofish(310 and 32 9mm LS) are immature juvenile females with little elongation of the ovaries. Three other ⋅ ⋅ specimens (57 5–55 9mmLS) are non-gravid, mature females with elongated ovaries. There were no gravid females of this species in the collections studied. Males (n = 3, ⋅ ⋅ 47 4–66 9mmLS) attain similar sizes to those of mature females. The sex of the small- ⋅ est juvenile (21 7mmLS) could not be determined macroscopically.

Table II. Morphometrics for the holotype (USNM 408271), examined specimens of Symphu- rus leucochilus and an atypical juvenile specimen (ASIZP 72356). Characters 2–15 in % of standard length (LS); 16–23 in % of head length (LH) Examined Specimens Characters Holotype n Range Mean ± s.d. ASIZP 72356 ⋅ ⋅ ⋅ ⋅ ⋅ ⋅ 1. LS (mm) 58 78310–66 95064 ± 12 71 21 7 2. Body depth 32⋅3826⋅3–32⋅328⋅76 ± 1⋅86 22⋅7 3. Trunk length 82⋅2879⋅4–83⋅081⋅45 ± 1⋅14 81⋅5 4. Predorsal length 4⋅683⋅4–4⋅63⋅97 ± 0⋅41 6⋅4 5. Preanal length 24⋅4724⋅3–26⋅025⋅29 ± 0⋅70 30⋅7 6. Dorsal-fin length 95⋅5895⋅5–96⋅696⋅04 ± 0⋅40 93⋅7 7. Anal-fin length 75⋅6774⋅0–75⋅774⋅72 ± 0⋅70 69⋅3 8. Pelvic-fin length⋅ 6 875⋅1–7⋅96⋅46 ± 0⋅92 5⋅0 9. Pelvic to anal length 4⋅672⋅7–4⋅63⋅62 ± 0⋅63 4⋅7 10. Caudal-fin length 11⋅4710⋅2–11⋅610⋅76 ± 0⋅62 9⋅0 ⋅ ⋅ ⋅ ⋅ ⋅ ⋅ 11. LH (mm) 20 48187–21 82039 ± 1 07 23 6 12. Head width 26⋅0822⋅4–26⋅024⋅36 ± 1⋅34 20⋅5 13. Postorbital length 13⋅4812⋅6–14⋅713⋅78 ± 0⋅70 14⋅3 14. Upper head lobe width 14⋅6812⋅8–14⋅613⋅54 ± 0⋅57 11⋅0 15. Lower head lobe width 10⋅989⋅9–12⋅311⋅12 ± 0⋅94 9⋅3 16. Predorsal length 22⋅3817⋅6–22⋅319⋅45 ± 1⋅84 26⋅9 17. Postorbital length 65⋅6865⋅6–69⋅567⋅61 ± 1⋅50 60⋅5 18. Snout length 23⋅4818⋅4–23⋅420⋅65 ± 1⋅94 28⋅5 19. Upper jaw length 23⋅6819⋅6–23⋅621⋅89 ± 1⋅42 24⋅0 20. Eye diameter 11⋅7810⋅4–12⋅511⋅30 ± 0⋅76 12⋅0 21. Chin depth 20⋅9815⋅5–20⋅917⋅97 ± 1⋅87 16⋅1 22. Lower opercular lobe 27⋅4826⋅8–34⋅428⋅96 ± 2⋅65 21⋅4 23. Upper opercular lobe 26⋅4823⋅2–27⋅225⋅20 ± 1⋅43 20⋅1 ⋅ ⋅ ⋅ ⋅ ⋅ ⋅ 24. WH/LH 1 27 8 1 07–1 29 1 20 ± 0 07 0 87 25. Pupil:Eye diameter 44⋅6841⋅9–55⋅949⋅33 ± 5⋅64 50⋅3

n, sample size; WH, head width; LH, head length.

DISTRIBUTION Symphurus leucochilus is known from voucher specimens collected from Japanese waters at Tosa Bay, and from two locations off Taiwan (off north-eastern and south-western Taiwan), and in the South China Sea off Dong-Gang, Taiwan (Fig. 2). The only documented depth record for S. leucochilus is the capture of three specimens at 150 m off Tosa Bay, Japan. Other specimens examined were retrieved from fish landings at Da-Shi fish port, north-eastern Taiwan, and Dong-gang fish port, south-western Taiwan. Landings in which this species were collected also contained an assemblage of fish species that generally live at or about 100–200 m. The assemblages of fishescom- prising the landings at both fish ports where S. leucochilus were found suggest that the depth range inhabited by this species is on the outer continental shelf or maybe even on the upper continental slope. More accurate information on exact localities, bathymetric distribution and substrata, where this species is found, is needed to understand the ecology of this diminutive species of tonguefish.

Table III. Catalogue and GenBank information for specimens of Symphurus included in con- struction of the neighbour-joining trees.

GenBank number Species Catalogue number Locality 16s rRNA coI Symphurus orientalis ASIZP 72372 Da-Shi, NE JN678742 JN678777 Taiwan Symphurus orientalis ASIZP 72556 Dong-Gang, JN678752 JN678787 SW Taiwan Symphurus orientalis ASIZP 72358 Tosa Bay, JN678762 JN678797 Japan Symphurus cf. microrhynchus (VN) ASIZP 72365 Nha Trang, KF676778 KF676781 Viet Nam Symphurus cf. microrhynchus (VN) ASIZP 72366 Nha Trang, KF676779 KF676782 Viet Nam Symphurus cf. microrhynchus (VN) ASIZP 72367 Nha Trang, KF676780 KF676783 Viet Nam Symphurus cf. microrhynchus (TW) ASIZP 72361 Dong-Gang, KC900860 KC900873 SW Taiwan Symphurus cf. microrhynchus (TW) ASIZP 72362 Dong-Gang, KC900861 KC900874 SW Taiwan Symphurus cf. microrhynchus (TW) ASIZP 72363 Dong-Gang, KC900862 KC900875 SW Taiwan Symphurus cf. microrhynchus (TW) ASIZP 72370 Da-Shi, NE KC900863 KC900876 Taiwan Symphurus cf. microrhynchus (TW) ASIZP 72371 Da-Shi, NE KC900864 KC900877 Taiwan Symphurus cf. microrhynchus (TW) ASIZP 67658 Nanfang-Ao, KC900865 KC900878 NE Taiwan Symphurus leucochilus ASIZP 72355 Tosa Bay, KC900866 KC900879 Japan Symphurus leucochilus ASIZP 72356 Tosa Bay, KC900867 KC900880 Japan Symphurus leucochilus ASIZP 72357 Tosa Bay, KC900868 KC900881 Japan Symphurus leucochilus USNM 408271 Da-Shi, NE KC900869 KC900882 Taiwan Symphurus leucochilus USNM 408272 Da-Shi, NE KC900870 KC900883 Taiwan Symphurus leucochilus USNM 408273 Da-Shi, NE KC900871 KC900884 Taiwan Symphurus leucochilus NMMB–P 17767 Da-Shi, NE KC900872 KC900885 Taiwan

ETYMOLOGY The name leucochilus is derived from the Greek, leuco meaning white, and chilus meaning border, in reference to the whitish border without dermal spots along bases of the anteriormost dorsal-fin rays and absence of pigmented spots onthe isthmus.

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 SYMPHURUS LEUCOCHILUS, NEW TONGUEFISH SPECIES 13 mitochondrial gene. coI and other congeners distributed in the Indo-Pacific area, based on the alignment Symphurus leucochilus of 624 homologous positions of the 11122333333455555 –––––––––––––––––– –––––––––––––––––– (TW) (VN) diagnostic sites coI KC900882KC900883KC900884 G – – G A T G T G A T G A C T G A C T C G KC900873KC900874KC900875 A A A A A A G G G C C C A A A A A A T T T C C C C C C T T T T T T T T T C C C C C C C C C T T T A A A T T T T T T KF646781KF646782KF646783JN678777 AJN678787 AJN678797 A A AJN678767 A AJN678768 G AJN678769 G A A G C AJN678772 A C AJN678773 G A CJN678774 A G A A A G AJN678799 C A A G AJN678800 C G A GJN678801 C G A A G T T G A AFJ863018 C A T A AFJ863021 C C A T GFJ863025 C C C G A A A C C G A T A G C A A C T G A C G A C T G C C G A A C A C T C A G T G A T C A T G G C A T G T G T G C C A G G T C C C A G T T C C C T A T A C C C T T A C C C C T A A C C C C C T A C C C C T T A A C C C T C T A C C C T C A C C C C C C T C C C C C T A T C C C T C A T T C C T C A T T C C C C T T C C C C T T A C C C G T C C A C G T C T C A C G T C T C T C T T T T T C T A T T C T C T A T T C G C C A T C G T C C T T T G T C T C C T T T C A C T A C C A C A T T C A A T T C C C T T C A A C C A A C T T A A T C T T C T A A C A T A A T A A T A A A A T A T T A A A pce 335944112667500145 Species GenBanknumber3693834581065217305 Table IV. Diagnostic sites between haplotype of Symphurus leucochilus Symphurus cf. microrhynchus Symphurus cf. microrhynchus Symphurus orientalis Symphurus hondoensis Symphurus megasomus Symphurus strictus Symphurus thermophilus

REMARKS Some previous studies dealing with specimens purported to be S. orientalis possibly also included specimens of S. leucochilus. This idea is based on the fact that reported ranges for meristic features of specimens purported to be S. orientalis in these studies are lower than corresponding ranges recently reported (Lee et al., 2013) for specimens of S. orientalis that were collected throughout the geographic range of the species. Given the overall similarities between S. leucochilus and S. orientalis in their general morphologies, it is easy to understand why earlier researchers might have overlooked this species in their studies. Meristic information appearing in the redescription of S. orientalis by Ochiai (1959) probably included data for S. leucochilus. Ochiai’s work (1959, 1963) has been widely cited, and the incorrect information reported for S. orientalis in this study has been perpetuated throughout much of the subsequent literature from Japan, Korea and Taiwan that has dealt with this species (Chyung, 1961; Ochiai, 1987, 1988, 1989; Shen et al., 1993; Sakamoto, 1997; Yamada, 2000, 2002). Now that reliable diagnostic information is available for distinguishing S. leucochilus from S. orientalis, the process of documenting geographic and bathymetric distributions and gathering other life-history information can begin for this poorly known species. One of the three juveniles examined showed substantial differences in its morphological features compared with those of the other specimens (Table II). Most of the differences represent ontogenetic variation in morphometric features. For example, ⋅ ⋅ ⋅ this specimen has a shallower body (22 7 v.263–32 3% LS in other specimens), and ⋅ ⋅ ⋅ ⋅ ⋅ ⋅ ⋅ longer predorsal (6 4 v.34–4 6% LS), preanal (30 7 v.243–26 0% LS) and head (23 6 ⋅ ⋅ v.187–21 8% LS in other specimens) lengths. Head width of this specimen is also ⋅ ⋅ ⋅ smaller than its head length (WH: LH = 0 87 v.107–1 29 in other specimens), whereas its snout length is much longer than that of other specimens (28⋅5 v.18⋅4–23⋅4% ⋅ LH). This specimen also has a correspondingly shorter postorbital length (LPO = 60 5 v. ⋅ ⋅ 65 6–69 5% LH). The intestine and peritoneum are relatively elongated and the anal-fin origin is located at the vertical through the midpoint of the peritoneum (v. anal-fin origin usually at, or slightly in advance of, the vertical through the posteriormost region of the peritoneum). The differences in morphology of this specimen are attributed to the fact that at time of its capture it had just recently completed metamorphosis from the larval stage (evidenced by loop formed from previously protruding gut mass of the larval stage having just been incorporated within ventral body profile). This specimen is considered to be a transitional stage early juvenile.

MOLECULAR DATA Symphurus leucochilus has many similar morphological features, including 12 caudal-fin rays, to those observed in S. orientalis and the specimens from Taiwan (TW) and Viet Nam (VN) that are tentatively identified in this study as S. microrhynchus. Analysis of genetic divergence for the partial 16s rRNA gene sequence indicates that S. leucochilus differs distinctly from S. orientalis by having a mean ± s.d. K2P distance of 10⋅96 ± 0⋅20% and a p-distance of 10⋅13 ± 0⋅17%. Symphurus leucochilus differs from S. cf. microrhynchus (TW) by a 23⋅91 ± 0⋅43% K2P distance and 20⋅19 ± 0⋅30% p-distance. From S. cf. microrhynchus (VN), S. leucochilus also differs distinctly with a 25⋅71 ± 0⋅18% difference in K2P distance and a 21⋅38 ± 0⋅12% difference in p-distance. Similar differences were also apparent in the analysis of the partial coI gene, where a mean ± s.d. K2P distance of 18⋅30 ± 0⋅23% and a p-distance

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 SYMPHURUS LEUCOCHILUS, NEW TONGUEFISH SPECIES 15 of 15⋅82 ± 0⋅16% were found between S. leucochilus and S. orientalis. Between S. leucochilus and S. cf. microrhynchus (TW), the mean ± s.d. K2P distance is 25⋅30 ± 0⋅12% and the p-distance is 21⋅21 ± 0⋅08%. Between S. leucochilus and S. cf. microrhynchus (VN), the K2P distance is 25⋅21% and the p-distance is 21⋅13%. This study also constructed NJ trees (Fig. 3) for species of Symphurus with 12 caudal-fin rays by using the selected sequences listed in Table III. Results clearly show separate clades for these three taxa. K2P and p-distances were also compared between S. leucochilus and several nominal species of Symphurus characterized by having 14 caudal-fin rays. These comparisons included all known sequences from Symphurus hondoensis Hubbs 1915 (Lee et al., 2013), Symphurus megasomus Lee, Chen & Shao 2009 (Lee et al., 2013) and Symphurus strictus Gilbert 1905 (Lee et al., 2013), and some of the sequences (the longer partial sequences with enough numbers of bp: FJ858984, FJ858985 and FJ858987 for 16s rRNA; FJ863018, FJ863021 FJ863024–26 for coI sequences) from Symphurus thermophilus Munroe & Hashimoto 2008 (Tunnicliffe et al., 2010). Symphurus leucochilus differs distinctly from S. hondoensis (11⋅23 ± 0⋅15% K2P distance and 10⋅37 ± 0⋅13% p-distance), S. megasomus (14⋅04 ± 0⋅19% K2P distance and 12⋅68 ± 0⋅15% p-distance), S. strictus (13⋅87 ± 0⋅17% K2P distance and 12⋅55 ± 0⋅14% p-distance) and S. thermophilus (14⋅26 ± 0⋅15% K2P distance and 12⋅82 ± 0⋅13% p-distance) in partial 16s rRNA gene sequences. The coI sequences were shortened from 639 to 624 bp to include sequences of S. thermophilus. Again, differences in K2P and p-distance are also distinct between S. leucochilus and these species: S. hondoensis (24⋅22 ± 0⋅28% K2P distance and 20⋅27 ± 0⋅18% p-distance), S. megasomus (21⋅49 ± 0⋅22% K2P distance and 18⋅37 ± 0⋅16% p-distance), S. strictus (23⋅61 ± 0⋅21% K2P distance and 19⋅82 ± 0⋅14% p-distance) and S. thermophilus (18⋅93 ± 0⋅18 % K2P distance and 16⋅49 ± 0⋅13% p-distance). Symphurus leucochilus is distinguished by 19 diagnostic sites when compared with selected 624 bp coI sequences (Table IV) from these nominal species inhabiting the Indo-Pacific region. Also, there were no nucleotide insertions or deletions in the sequence alignment in this study. Alignment results of NJ trees, and sequences for comparing diagnostic sites between S. leucochilus and the other nominal species of Symphurus from Indo-Pacific areas were deposited at DRYAD (Dryad Digital Repository; http://datadryad.org/).

COMPARISONS Among Indo-Pacific Symphurus, six described species in addition to S. leucochilus have 12 caudal-fin rays (Alcock, 1891; Chabanaud, 1955, 1957; Munroe & Marsh, 1997; Munroe, 2001). Of these, only two, S. microrhynchus and S. trifasciatus,have similar meristic features to those of S. leucochilus, including numbers of dorsal-fin rays (85–92), anal-fin rays (70–80) and total vertebrae (usually <52). < Symphurus leucochilus has low meristic features, relatively small adult size (LS 70 mm), and also inhabits relatively shallow depths, which are morphological and ecological characteristics that it shares with those of another diminutive species, S. microrhynchus. Symphurus microrhynchus was previously considered to be a widely distributed tonguefish of the tropical and sub-tropical Indo-Pacific (Munroe & Marsh, 1997). Data (M.-Y. Lee & T. A. Munroe, unpubl. data), however, indicate that S. microrhynchus as presently conceived actually represents a complex of at

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 16 M.-Y. LEE ET AL. least seven, morphologically similar species, all of which, except S. microrhynchus, are undescribed. Meristic and most morphometric features of S. leucochilus nearly completely overlap those of S. microrhynchus, but several morphological characters easily separate S. leucochilus from S. microrhynchus and other nominal species that are morphologically similar to S. microrhynchus. For example, S. leucochilus lacks a fleshy ridge on its ocular-side lowerv jaw( . fleshy ridge present in S. microrhynchus and morphologically similar nominal species); its dorsal-fin origin (at vertical through anterior margin of upper eye) is situated more anteriorly than that in others (e.g. dorsal-fin origin at, or beyond, vertical through posterior margin of eye) andthe anterior margins of the eyes of S. leucochilus are equal, or nearly equal, in position (v. anterior margin of upper eye usually noticeably in advance of anterior margin of lower eye in S. microrhynchus and morphologically similar nominal species). Additionally, in S. leucochilus, the eyes are separated by a narrow interorbital space and the anterior nostril is not contiguous with the eyes (v. usually both upper and lower eyes contained within the same fleshy membrane and with flap of skin connecting anterior nostril with eye membrane in S. microrhynchus and morphologically similar nominal species; see Fig. 4). Symphurus leucochilus also has different colouration compared with that of S. microrhynchus and these other nominal species (Fig. 5). In particular, it lacks dermal spots or melanophores at bases of the anterior dorsal-fin rays and lacks melanophores on the head region posterior to the eyes and on the ocular-side isthmus (v. S. microrhynchus and morphologically similar nominal species with pepper dots or dermal spots at bases of anterior dorsal and anal-fin rays and with melanophores on the head region posterior to the eyes and also on the isthmus). Small specimens of S. leucochilus also have a streak of black pigment along the caudal portion of their vertebral column that is visible through the body musculature on the blind side, whereas S. microrhynchus and morphologically similar nominal species have uniform whitish colouration along their blind-side vertebrae without this dermal pigment streak (Fig. 6). Symphurus leucochilus differs obviously from S. trifasciatus, a deeper-dwelling tonguefish (ranging between c. 220 and 737 m depth) with an allopatric distribution in the Indian Ocean, in some meristic characters and in many other aspects of its morphology. For example, S. leucochilus has larger scales than those of S. trifasciatus, as reflected in the much lower number of scale rows on the head posterior tothelower orbit (15–17 v. 22–25 in S. trifasciatus) and by the fewer transverse scales (32–35 v. 35–38 in S. trifasciatus). Symphurus leucochilus also differs from S. trifasciatus by having a more anterior point of insertion of its dorsal fin, which is reflected in ⋅ ⋅ ⋅ ⋅ a shorter predorsal length (3 4–4 6 v.52–9 7% LS in S. trifasciatus). Symphurus ⋅ ⋅ ⋅ ⋅ leucochilus also has shorter head (18 7–21 8 v.238–27 2% LS in S. trifasciatus) ⋅ ⋅ ⋅ ⋅ and postorbital lengths (12 6–14 7 v.164–20 4% LS in S. trifasciatus), a wider ⋅ ⋅ ⋅ ⋅ upper head lobe (LUH 12 8–14 6 v.81–10 8%) and narrower lower head lobe (LLH 9⋅9–12⋅3 v.13⋅7–17⋅1%) compared with corresponding features in S. trifasciatus. The anterior profile of the snout of S. leucochilus is rounded to slightly blunt v. the more pointed (usually) snout in S. trifasciatus. Another difference between these species occurs in shape of their opercles. In S. leucochilus, the lower opercular lobe (OPLL) is equal to, or slightly wider than, the upper opercular lobe (OPLL 26⋅8–34⋅4 ⋅ ⋅ v.23 2–27 2% LH), whereas in S. trifasciatus the lower opercular lobe is narrower ⋅ ⋅ ⋅ ⋅ than the upper opercular lobe (OPLL 22 1–29 7 v.303–37 6% LH). In S. leucochilus, the posterior margin of the lower opercular lobe also projects slightly beyond, or is

(a)

(b)

Fig. 6. Blind-side view of the caudal body region in two species of Indo-West Pacific Symphurus:(a)Symphurus ⋅ leucochilus n. sp., paratype ASIZP 72369, mature female, 55 9 mm standard length (LS), south-west Taiwan ⋅ and (b) Symphurus cf. microrhynchus (TW), ASIZP 67658, adult male, 53 3mmLS, north-east Taiwan.

equal to, the vertical at the posterior margin of the upper opercular lobe. In contrast, in S. trifasciatus, the posterior margin of the upper opercular lobe usually extends well beyond the posterior border of the lower opercular lobe. The ocular-side pigmentation of S. leucochilus (light yellow to light brown without crossbands) is distinctly different from the greyish ocular-side background colouration with three to four, prominent, wide (five to 10 scales) crossbands of S. trifasciatus. Symphurus leucochilus appears to be a smaller species (largest specimen attaining only c.67mmLS) that matures at smaller sizes (females mature at c.47mmLS) compared with the larger S. trifasciatus, which reaches sizes to 116 mm LS and possibly also matures at larger sizes (two known mature females are c.90mmLS) than that noted for S. leucochilus. Symphurus orientalis is another species of Symphurus characterized by 12 caudal-fin rays that has a geographical distribution sympatric with that of S. leucochilus. Features

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 18 M.-Y. LEE ET AL. of the ocular-side pigmentation of S. leucochilus are similar to those of specimens of S. orientalis that lack crossbands on their ocular side, which hampers identification of these species. Symphurus leucochilus is easily distinguished from S. orientalis by having 89–92 dorsal-fin raysv ( . 96–101 in S. orientalis), 76–80 anal-fin rays (v. 82–89), 49–51 total vertebrae (v. 52–55), 75–83 longitudinal scale rows (v.87–99inS. orientalis), 32–35 transverse scales (v. 37–42) and 15–17 scale rows on the head posterior to the lower orbit (v. 18–22 scale rows in S. orientalis). Five other Indo-Pacific species of symphurine tonguefishes, Symphurus macroph- thalmus Norman 1939, Symphurus monostigmus Munroe 2006, Symphurus multimac- ulatus Lee, Munroe & Chen 2009, Symphurus schultzi Chabanaud 1955 and Symphurus thermophilus, have counts of dorsal and anal-fin rays, and abdominal and total vertebrae that overlap with those of S. leucochilus. Symphurus leucochilus differs distinctly from all of these species by having 12 caudal-fin rays and four hypuralsv ( . 14 caudal-fin rays and five hypurals in others).

DISCUSSION Recent advances in molecular sequencing methods have contributed to taxonomic studies by discriminating morphologically similar species, discovering cryptic species (Victor, 2007; Diaz de Astarloa et al., 2008; Ward et al., 2008; Baldwin et al., 2011; Luchetti et al., 2011) and by resolving issues concerning the validity of questionable nominal species for which previous taxonomic uncertainty has existed (Byrkjedal et al., 2007; Dooley & Jimenez, 2008; Victor, 2008; Allen et al., 2010; Last et al., 2010; Benziger et al., 2011). These applications are also utilized in resolving taxonomic issues of tonguefishes. One study examining sequence divergences in western Pacific tonguefishes (Tunnicliffe et al., 2010) observed significant differences in partial 16s rRNA (9⋅0%) and coI (14⋅2%) gene sequences among allopatric populations that had previously been considered to be one species, S. thermophilus (Munroe & Hashimoto, 2008). Based on these genetic differences, Tunnicliffe et al. (2010) suggested that their results showed the presence of a cryptic species with similar morphological features to those of S. thermophilus among their studied specimens. Another study (Lee et al., 2013) examining sequence divergence from both partial 16s rRNA and coI genes between two nominal tonguefish species, Symphurus novemfasicatus Shen & Lin 1984 and S. orientalis (Bleeker 1879), found only minor sequence differences (0⋅21% K2P distance in 16s rRNA and 0⋅26% K2P distance in coI) between these two nominal species. In combination with results from morphological evidence, Lee et al. (2013) concluded that S. novemfasciatus was the junior synonym of S. orientalis. Results from the present investigation show that S. leucochilus differs significantly in its genetic composition from other species with which it shares many meristic and morphological similarities. For example, S. leucochilus differs in K2P distances of 16s rRNA and coI sequence from both that of S. orientalis and the nominal species tentatively identified as S. cf. microrhynchus. Additionally, the NJ algorithm shows that S. leucochilus, S. orientalis and the two nominal species identified as S. cf. microrhynchus clearly belong to three different clades (Fig. 3). Based on the algorithm, S. leucochilus is neither in the group, nor is the sister group of the nominal species tentatively identified as S. microrhynchus. Rather, S. leucochilus is the sister group to S. orientalis. Although morphologically most similar to the nominal species tentatively identified

© 2014 The Fisheries Society of the British Isles, Journal of Fish Biology 2014, doi:10.1111/jfb.12440 SYMPHURUS LEUCOCHILUS, NEW TONGUEFISH SPECIES 19 as S. microrhynchus, the genetic divergences between S. leucochilus and S. orientalis, and between S. leucochilus and the other nominal species possessing 14 caudal-fin rays, are much smaller than are those between S. leucochilus and the two populations tentatively identified as S. microrhynchus. Smaller sequence divergences (3⋅87 ± 0⋅33% K2P distance and 3⋅74. ± 0⋅31% p-distance in partial 16s rRNA gene; 8⋅66 ± 0⋅09% K2P distance and 8⋅03 ± 0⋅08% p-distance in partial coI gene) are found between members of these two populations, S. cf. microrhynchus (VN) and S. cf. microrhynchus (TW), than between them and S. leucochilus. Morphological characters show significant differences between S. leucochilus and each of the nominal species that are tentatively identified as S. microrhynchus. Evidence from both morphological and molecular approaches indicates that S. leucochilus is not a member of the clade containing the two nominal species tentatively identified as S. microrhynchus. Approaches that examine DNA sequences can facilitate identifications of morphologically distinct specimens and this capability becomes especially important when study material is limited, as was the case for S. leucochilus, where only one recently settled juvenile was available for study. Most species of Pleuronectiformes metamor- phose at relatively small sizes (between 10 and 25 mm body length, LB; Hensley & Ahlstrom, 1984), and are morphologically quite distinct from juveniles and adults of the species. For species of Symphurus where larval stages are known (Kurtz & Mat- suura, 1994; Aceves-Medina et al., 1999; Evseenko & Shtaut, 2000; Saldierna et al., 2005; Farooqi et al., 2006), transformation also occurs at smaller sizes (usually < 20 mm LB). Morphometric features of symphurine larvae and early stage juveniles are different from those of later stage juveniles and adults. Also, meristic features such as caudal, dorsal and anal-fin rays and scales do not complete their development until late in the larval stage. Because of these factors, previous studies attempting to iden- tify larvae and juveniles of these fishes, most of which have been conducted on species occurring in Atlantic and eastern Pacific Oceans, have had to rely extensively on differences in combinations of short and long anterior dorsal-fin rays, on ID patterns or pigmentation patterns, and also on the presence or absence of specialized structures, such as a conical appendix on the abdominal wall (Ahlstrom et al., 1984; Kurtz & Mat- suura, 1994; Munroe et al., 2000; Farooqi et al., 2006; Munroe & Krabbenhoft, 2010). In the Indo-West Pacific region, where species diversity of Symphurus may be greater than that in other regions and with new species continuing to be discovered, larvae of most of these species are unknown. Furthermore, unlike symphurine species occurring in the Atlantic and eastern Pacific Oceans, species in the Indo-West Pacific region display less variation in key diagnostic features, such as ID pattern and fin-ray counts, that have facilitated identifications of symphurine larvae in these other geographic areas (Kurtz & Matsuura, 1994; Aceves-Medina et al., 1999; Saldierna et al., 2005; Farooqi et al., 2006; Munroe & Krabbenhoft, 2010). With fewer meristic features available for identifying early life-history stages of Indo-West Pacific species of Symphurus, especially when cryptic species and species complexes are involved, other approaches to help with identifications will be required. Incorporation of DNA sequence data in these studies offers great promise in assisting with identifications of these early life-history stages within the subfamily Symphurinae, as well as in other flatfish larvae, and should be explored further.

This work represents a portion of a collecting activities grant investigating the biodiversity and systematics of deep-sea fishes in Taiwanese waters supported by the National Science

Council (NSC 96-2628-B-001-006-MY3 and NSC 99-2621-B-001-008-MY3) and awarded to K.-T.S., Biodiversity Research Center, Academia Sinica. The authors thank H.-C. Ho, P. and L.-P. Lin who assisted with collecting specimens, and with loans and shipments of specimens used in this study. They are especially grateful to H.-C. Ho for providing tissue samples of S. cf. microrhynchus from Viet Nam. K.-C. Hsu advised M.-Y.L. regarding molecular aspects of this research study. M. Nizinski provided assistance and support during M.-Y.L.’s visit to the National Museum of Natural History, Smithsonian Institution. H. Endo, N. Nakayama and R. Asaoka provided assistance and support during M.-Y.L.’s visit to the Department of Biology, Faculty of Science, Kochi University. They also provided three important fresh specimens of S. leucochilus from Japanese waters that assisted with the discovery of this sympatric cryptic species. L. Willis, NMFS-NSL, assisted with literature and specimens. J. Clayton and D. Smith, USNM, assisted with accessioning and cataloguing specimens. M.-Y.L. also extends his appreciation to all members of the Laboratory of Fish Ecology and Evolution for their support and assistance, especially to H. Lee who made the distribution map for this study.

References Aceves-Medina, G., González, E. A. & Saldierna, R. J. (1999). Larval development of Symphu- rus williamsi (Cynoglossidae: Pleuronectiformes) from the Gulf of California. Fishery Bulletin 97, 738–745. Ahlstrom, E. H., Amaoka, K., Hensley, D. A., Moser, H. G. & Sumida, B. Y. (1984). Pleuronec- tiformes: development. In Ontogeny and Systematics of Fishes (Moser, H. G., Richards, W. J., Cohen, D. M., Fahay, M. P., Kendall, A. W. & Richardson, S. L., eds), pp. 640–670. Lawrence, KA: American Society of Ichthyologists and Herpetologists Press. Akimoto, S., Kinoshita, S., Sezaki, K., Mitani, I., & Watabe, S. (2002). Identification of alfon- sino and related fish species belonging to the genus Beryx with mitochondrial 16S rRNA gene and its application on their pelagic eggs. Fisheries Science 68, 1242–1249. Avail- able at 10.1046/j.1444-2906.2002.00561.x/ Alcock, A. W. (1891). Class Pisces. In: II – Natural history notes from H. M. Indian marine survey steamer ‘Investigator,’ Commander R. F. Hoskyn, R. N., commanding. Series II., No. 1. On the results of deep-sea dredging during the season 1890–91. The Annals and Magazine of Natural History (Series 6) 8, 119–138. Allen, G. R., Erdmann, M. V. & Hamilton, A. M. (2010). Hoplolatilus randalli, a new species of sand tilefish (Pisces: Malacanthidae) from the tropical western Pacific with comments on the validity of H. luteus. Aqua, International Journal of Ichthyology 16, 171–186. Amaoka, K. (1982). Symphurus orientalis.InFishes of the Kyushu-Palau Ridge and Tosa Bay. The Intensive Research of Unexploited Fishery Resources on Continental Slopes (Oka- mura, O., Amaoka, K. & Mitani, F., eds) 303 and 408. Tokyo: Japan Fisheries Resource Conservation Association Press. Baldwin, C., Castillo, C., Weigt, L. & Victor, B. (2011). Seven new species within western Atlantic Starksia atlantica, S. lepicoelia,andS. sluiteri (Teleostei, Labrisomidae), with comments on congruence of DNA barcodes and species. ZooKeys 79, 21–72. doi: 10.3897/zookeys.79.1045 Benziger, A., Philip, S., Raghavan, R., Anvar Ali, P. H., Sukumaran, M., Tharian, J. C., Dahanukar, N., Baby, F., Peter, R., Rema Devi, K., VeetilRadhakrishnan, K., AbdulKatherHaniffa, M., Britz, R. & Antunes, A. (2011). Unraveling a 146 years old taxonomic puzzle: validation of Malabar snakehead, species-status and its relevance for channid systematics and evolution. PLoS One 6, 1–12. doi: 10.1371/journal.pone.0021272 Byrkjedal, I., Rees, D. J. & Willassen, E. (2007). Lumping lumpsuckers: molecular and morphological insights into the taxonomic status of Eumicrotremus spinosus (Fabricius, 1776) and Eumicrotremus eggvinii Koefoed 1956 (Teleostei: Cyclopteridae). Journal of Fish Biology 71, 111–131. doi: 10.1111/j.1095-8649.2007.01550.x Chabanaud, P. (1955). Flatfishes of the genus Symphurus from the U.S.S. “Albatross” Expedi- tion to the Philippines, 1907–1910. Journal of the Washington Academy of Sciences 45, 30–32.

Chabanaud, P. (1957). Description d’un Symphurus inédit, fruit de la croisière 1899–1900 du Siboga. Beaufortia 5, 183–185. Chyung, M. K. (1961). Illustrated Encyclopedia: The Fauna of Korea (2): Fishes. Seoul: Iljiisa in Korean. Diaz de Astarloa, J. M., Mabragana, E., Hanner, R. & Figueroa, D. E. (2008). Morphological and molecular evidence for a new species of longnose skate (Rajiformes: Rajidae: Dipturus) from Argentinean waters. Zootaxa 1921, 35–46. Dooley, J. K. & Jimenez, L. (2008). Hoplolatilus luteus Allen & Kuiter, 1989, a junior synonym of H. fourmanoiri Smith, 1964 (Perciformes: Malacanthidae), based on morphological and molecular data. Aqua, International Journal of Ichthyology 14, 77–84. Evseenko, S. A. & Shtaut, M. I. (2000). Early stages of development of two species of tongue soles – Symphurus chabanaudi and S. prolatinaris (Cynoglossidae, Pleuronectiformes) from Central Eastern Pacific. Journal of Ichthyology 40, 751–761(originally published in 2000 in Voprosy Ikhtiologii 40, 792–803). Farooqi, T. W., Shaw, R. F., Ditty, J. G. & Lyczkowski-Shultz, J. (2006). Cynoglossidae. In Early Stages of Atlantic Fishes: An Identification Guide for the Western Central North Atlantic, Vol. 2 (Richards, W. J., ed.), pp. 2367–2380. Boca Raton, FL: CRC Press. Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using bootstrap. Evolution 39, 783–791. Hebert, P. D. N., Cywinska, A., Ball, S. L. & de Waard, J. R. (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society B 270, 313–322. doi: 10.1098/rspb.2002.2218 Hensley, D. A. & Ahlstrom, E. H. (1984). Pleuronectiformes: relationships. In Ontogeny and Systematics of Fishes (Moser, H. G., Richards, W. J., Cohen, D. M., Fahay, M. P., Kendall, A. W. & Richardson, S. L., eds), pp. 670–687. Lawrence, KA: American Society of Ichthyologists and Herpetologists Press. Kim, I.-S. & Choi, Y. (1994). A taxonomic revision of the family Cynoglossidae (Pisces, Pleu- ronectiformes) from Korea. Bulletin of the Korean Fisheries Society 27, 803–813. Kimura, M. (1980). A simple method of estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111–120. doi: 10.1007/BF01731581 Krabbenhoft, T. J. & Munroe, T. A. (2003). Symphurus bathyspilus: a new cynoglossid flatfish (Pleuronectiformes: Cynoglossidae) from deepwaters of the Indo-West Pacific. Copeia 2003, 810–817. Kurtz, F. W. & Matsuura, Y. (1994). Early development of four tonguefishes of the Genus Symphurus (Osteichthyes: Cynoglossidae) from southern Brazil. Japanese Journal of Ichthyology 41, 141–148. Lakra, W. S., Goswami, M. & Gopalakrishnan, A. (2009). Molecular identification and phyloge- netic relationships of seven Indian sciaenids (Pisces: Perciformes, Sciaenidae) based on 16S rRNA and cytochrome c oxidase subunit I mitochondrial genes. Molecular Biology Reports 36, 831–839. doi: 10.1007/s11033-008-9252-1 Last, P.R., White, W. T. & Puckridge, M. (2010). Neotrygon ningalooensis n. sp. (Myliobatoidei, Dasyatidae), a new maskray from Australia. Aqua, International Journal of Ichthyology 16, 37–50. Lee, M.-Y., Shao, K.-T. & Chen, H.-M. (2009a). A new species of deep-water tonguefish genus Symphurus (Pleuronectiformes: Cynoglossidae) from Taiwan. Copeia 2009a, 342–347. Lee, M.-Y., Munroe, T. A. & Chen, H.-M. (2009b). A new species of tonguefish (Pleuronecti- formes: Cynoglossidae) from Taiwanese waters. Zootaxa 2203, 49–58. Lee, M.-Y., Munroe, T. A., & Shao, K.-T. (2013). Symphurus orientalis (Bleeker) redefined based on morphological and molecular characters (Pleuronectiformes: Cynoglossidae) Zootaxa 3620, 379–403. Available at 10.11646/zootaxa.3620.3.3/ Li, S.-Z. & Wang, H.-M. (1995). Fauna Sinica. Osteichthyes, Pleuronectiformes. Beijing: Sci- ence Press in Chinese with English summary. Luchetti, E. A., Iglésias, S. P. & Sellos, D. Y. (2011). Chimaera opalescens n. sp., a new chi- maeroid (Chondrichthyes: Holocephali) from the north-eastern Atlantic Ocean. Journal of Fish Biology 79, 399–417. doi: 10.1111/j.1095-8649.2011.03027.x

Maretto, F., Reffo, E., Dalvit, C., Barcaccia, G. & Mantovani, R. (2007). Finding 16S rRNA gene-based SNPs for the genetic traceability of commercial species belonging to Gadi- formes. Italian Journal of Animal Science 6, 161–163. Matsubara, K. (1955). Fish Morphology and Hierarchy Parts 1–3. Tokyo: Ishizaki Shoten. Munroe, T. A. (1992). Interdigitation pattern of dorsal-fin pterygiophores and neural spines, an important diagnostic character for symphurine tonguefishes (Symphurus: Cynoglossidae: Pleuronectiformes). Bulletin of Marine Science 50, 357–403. Munroe, T. A. (1998). Systematics and ecology of tonguefishes of the genus Symphurus (Cynoglossidae: Pleuronectiformes) from the western Atlantic Ocean. Fishery Bulletin 96, 1–182. Munroe, T. A. (2001). Families Cynoglossidae. In The Living Marine Resources of the Western Central Pacific (Carpenter, K. E. & Niem, H. K., eds) Vol. 6, Part IV, pp. 3890–3901. Rome: FAO. Munroe, T. A. (2006). New western Indian Ocean tonguefish (Pleuronectiformes: Cynoglossi- dae, Symphurus). Copeia 2006, 230–234. Munroe, T. A. & Amaoka, K. (1998). Symphurus hondoensis Hubbs 1915 (Cynoglossidae, Pleu- ronectiformes), a valid species of western Pacific tonguefish. Ichthyological Research 45, 385–391. Munroe, T. A. & Hashimoto, J. (2008). A new Western Pacific Tonguefish (Pleuronectiformes: Cynoglossidae): the first pleuronectiform discovered at active hydrothermal vents. Zootaxa 1839, 43–59. Munroe, T. A. & Krabbenhoft, T. J. (2010). Two unusually large pre-transitional tonguefish larvae (Pleuronectiformes: Cynoglossidae: Symphurus) from oceanic waters near the Galá- pagos Islands. Bulletin of Marine Science 86, 13–31. Munroe, T. A. & Marsh, B. N. (1997). Taxonomic status of three nominal species of Indo-Pacific symphurine tonguefishesSymphurus ( : Cynoglossidae: Pleuronectiformes). Ichthyologi- cal Research 44, 189–200. Munroe, T. A., Allen, R. E., Baltz, D. M. & Ross, S. W. (2000). Symphurus civitatium (Pleu- ronectiformes: Cynoglossidae), a second estuarine-occurring tonguefish off the South- eastern United States and Northern Gulf of Mexico. Estuaries 23, 439–448. Munroe, T. A., Tyler, J. & Tunnicliffe, V. (2011). Description and biological observations on a new species of deepwater symphurine tonguefish (Pleuronectiformes: Cynoglossidae: Symphurus) collected at Volcano–19, Tonga Arc, West Pacific Ocean. Zootaxa 3061, 53–66. Ochiai, A. (1959). Morphology, Taxonomy and Ecology of the Soles of Japan Laboratory of Fisheries. Kyoto: Kyoto University Press in Japanese. Ochiai, A. (1963). Fauna Japonica. Soleina (Pisces). Tokyo: Biogeographical Society of Japan. Ochiai, A. (1984). Family Cynoglossidae. In The Fishes of the Japanese Archipelago (Masuda, H., Amaoka, K., Araga, C., Uyeno, T. & Yoshino, T., eds), pp. 355–356. Tokyo: Tokai University Press. Ochiai, A. (1987). Family Cynoglossidae. In Illustrated Fishes of the World in Colour (Abe, T., ed.), pp. 927–931. Tokyo: Hokuryukan Company Limited in Japanese. Ochiai, A. (1988). Family Cynoglossidae. In The Fishes of the Japanese Archipelago, 2nd edn (Masuda, H., Amaoka, K., Araga, C., Uyeno, T. & Yoshino, T., eds), pp. 341–342. Tokyo: Tokai University Press in Japanese. Ochiai, A. (1989). Cynoglossidae. In Keys to the Japanese fishes Fully Illustrated in Color (Abe, T. & Ochiai, A., eds), pp. 219–222. Tokyo: Hokuryukan Company Limited in Japanese. Okada, Y. & Matsubara, K. (1938). Keys to the Fishes and Fish-like Animals of Japan: Including Kuril Islands, Southern Sakhalin, Bonin Islands, Ryukyu Islands, Korea and Formosa. Tokyo: Sanseido Company Limited in Japanese. Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In Molecular Systemat- ics, 2nd edn (Hillis, D. M., Moritz, C. & Mable, B. K., eds), pp. 205–247. Sunderland, MA: Sinauer Associates. Sakamoto, K. (1997). Cynoglossidae. In Sea Fishes of Japan (Okamura, O. & Amaoka, K., eds), p. 684. Tokyo: Yama-kei Publishing Company Limited in Japanese. Saldierna, R. J., González, E. A. & Aceves-Medina, G. (2005). Larval development of Sym- phurus atramentatus (Cynoglossidae: Pleuronectiformes) from the Gulf of California. Zootaxa 1016, 1–14.

Shen, S.-C. (1984). Coastal Fishes of Taiwan. Taipei: National Taiwan University Press in Chinese. Shen, S.-C., Lee, S.-C., Shao, K.-T., Mok, H.-C., Chen, C.-H., Chen, C.-C. & Tzeng, C.-S. (1993). Fishes of Taiwan. Taipei: National Taiwan University press in Chinese. Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. doi: 10.1093/molbev/msm092 Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tunnicliffe, V., Koop, B. F., Tyler, J. & So, S. (2010). Flatfish at seamount hydrothermal vents show strong genetic divergence between volcanic arcs. Marine Ecology 31, 158–167. doi: 10.1111/j.1439-0485.2010.00370.x Victor, B. C. (2007). Coryphopterus kuna, a new goby (Perciformes: Gobiidae: Gobinae) from the western Caribbean, with the identification of the late larval stage and an estimate of the pelagic larval duration. Zootaxa 1526, 51–61. Victor, B. C. (2008). Redescription of Coryphopterus tortugae (Jordan) and a new allied species Coryphopterus bol (Perciformes: Gobiidae: Gobiinae) from the tropical western Atlantic Ocean. Journal of the Ocean Science Foundation 1, 1–19. Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. & Hebert, P. D. N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B 360, 1847–1857. doi: 10.1098/rstb.2005.1716 Ward, R. D., Costa, F. O., Holmes, B. H. & Steinke, D. (2008). DNA barcoding of shared fish species from the North Atlantic and Australasia: minimal divergence for most taxa, but Zeus faber and Lepidopus caudatus each probably constitute two species. Aquatic Biol- ogy 3, 71–78. doi: 10.3354/ab00068 Ward, R. D., Hanner, R. & Hebert, P. D. N. (2009). The campaign to DNA barcode all fishes, FISH-BOL. Journal of Fish Biology 74, 329–356. doi: 10.1111/j.1095-8649.2008. 02080.x Weber, M. & de Beaufort, L. F. (1929). The Fishes of the Indo-Australian Archipelago,Vol.V. Leiden, NL: E.J. Brill Ltd. Yamada, U. (2000). Cynoglossidae. In Fishes of Japan with Pictorial Keys to the Species, 2nd edn (Nakabo, T., ed.), pp. 1388–1392. Tokyo: Tokai University Press in Japanese. Yamada, U. (2002). Cynoglossidae. In Fishes of Japan with Pictorial Keys to the Species, English edn (Nakabo, T., ed.), pp. 1388–1392. Tokyo: Tokai University Press.

Electronic Reference Fricke, R. & Eschmeyer, W.N. (2014) A Guide to Fish Collections in the Catalog of Fishes. Available at http://research.calacademy.org/redirect?url=http://researcharchive. calacademy.org/research/Ichthyology/catalog/collections.asp/ (accessed 5 March 2014).