DOCSLIB.ORG

Literature Reference for Entamoeba Histolytica

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Literature Reference for Entamoeba Histolytica JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2005, p. 5491–5497 Vol. 43, No. 11 0095-1137/05/$08.00�0 doi:10.1128/JCM.43.11.5491–5497.2005 Comparison of Real-Time PCR Protocols for Differential Laboratory Diagnosis of Amebiasis Yvonne Qvarnstrom,1,3 Cleve James,1 Maniphet Xayavong,1,3 Brian P. Holloway,2 Govinda S. Visvesvara,1 Rama Sriram,1 and Alexandre J. da Silva1* Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, Georgia1; Scientific Resources Program, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, Georgia2; and Atlanta Research and Education Foundation in Conjunction with the Atlanta VA Medical Center, Decatur, Georgia3 Received 23 May 2005/Returned for modification 8 July 2005/Accepted 15 August 2005 Specific identification of Entamoeba spp. in clinical specimens is an important confirmatory diagnostic step in the management of patients who may be infected with Entamoeba histolytica, the species that causes clinical amebiasis. Distinct real-time PCR protocols have recently been published for identification of E. histolytica and differentiation from the morphologically identical nonpathogenic Entamoeba dispar. In this study, we compared three E. histolytica real-time PCR techniques published by December 2004. The limits of detection and efficiency of each real-time PCR assay were determined using DNA extracted from stool samples spiked with serially diluted cultured E. histolytica trophozoites. The ability of each assay to correctly distinguish E. histolytica from E. dispar was evaluated with DNA extracted from patients’ stools and liver aspirates submitted for confirma­ tory diagnosis. Real-time PCR allowed quantitative analysis of the spiked stool samples, but major differences in detection limits and assay performance were observed among the evaluated tests. These results illustrate the usefulness of comparative evaluations of diagnostic assays. Clinical features of amebiasis, caused by the protozoan par­ mended for use exclusively with fresh stool samples, since asite Entamoeba histolytica, range from asymptomatic coloni­ storage or use of preservatives destroys the antigen. zation to amebic dysentery and invasive extraintestinal amebi­ For diagnosis of extraintestinal amebiasis, the laboratory asis, most commonly in the form of liver abscesses (24). The methods are even more limited. Detection of amebas by mi­ World Health Organization estimates that amebiasis is one of croscopy is often unsuccessful (32). Although acceptable re­ the three most common causes of death from parasitic disease, sults with extraintestinal specimens have been obtained with responsible for up to 100,000 deaths annually (30). The disease the TechLab II antigen test (14, 22), this test is designed and is spread primarily by food or water contaminated with cysts marketed for examination of stool specimens only. but may also be transmitted from person to person. It is highly PCR, including real-time PCR, has provided means to iden­ prevalent in regions of the world where personal hygiene tify E. histolytica in a variety of clinical specimens, including and/or sanitation are insufficient. stools, tissues, and liver abscess aspirates (24). Several PCR Examination of stained stool smears is used routinely in assays designed for differential detection of E. histolytica and clinical laboratories to differentiate E. histolytica from non­ E. dispar have been developed. Most of them target either the pathogenic intestinal amebas, such as Entamoeba coli, Entam­ small-subunit rRNA (18S rRNA) gene (5, 10, 15, 18) or spe­ oeba polecki, and Entamoeba hartmani. However, this gold cies-specific episomal repeats (1, 19, 21). These targets are standard method cannot differentiate E. histolytica from the present on multicopy, extrachromosomal plasmids in the ame­ morphologically identical E. dispar, which occurs worldwide bas (3). The sensitivity and specificity of PCR assays exceed E. dispar (8). is a harmless commensal protozoan, and its pres­ what can be accomplished with microscopy and are compara­ ence in clinical specimens does not justify treatment (30). ble to those of the antigen test (13, 16, 17, 20, 23). Thus, misidentification of E. histolytica-associated disease may Real-time PCR is a very attractive methodology for labora­ occur if the diagnosis is based solely on examination of smears tory diagnosis of infectious diseases because of its features that (29). For final confirmatory identification of intestinal amebi­ eliminate post-PCR analysis, leading to shorter turn-around asis, molecular methods or immunologic assays for detection of times and minimized risk of amplicon contamination of labo­ E. histolytica antigens are needed (21). Currently, the only ratory environments. This represents obvious advantages in commercially available antigen test for specific detection of E. diagnostics, as amplicon contamination has been reported to histolytica (the histolytica II test from TechLab) is recom­ be the most frequent cause of false-positive results in PCR amplification (31). In addition, real-time PCR is a quantitative method and may allow the determination of the number of * Corresponding author. Mailing address: Parasitic Diseases parasites in various samples (2). Although not relevant for Branch, Division of Parasitic Diseases, Centers for Disease Control estimating the parasite burden in amebiasis patients (the par­ and Prevention, Mail Stop F36, 4700 Buford Highway NE, Atlanta, GA 30341-3724. Phone: (770) 488-4072. Fax: (770) 488-3115. E-mail: asite content can vary tremendously between, or even within, [email protected]. specimens from the same patient), quantitative measures can 5491 5492 QVARNSTROM ET AL. J. CLIN.MICROBIOL. TABLE 1. Primers and probes used in the real-time PCR assays compared Gene Amplicon Primer Nucleotide Assay Sequence (5� to 3�)a Reference target size (bp) or probe positionsb Conventional PCR 18S rRNA 877 PSP5c GGCCAATTCATTCAATGAATTGAG 200–223 5 adapted for SYBR PSP3c CTCAGATCTAGAAACAATGCTTCTC 1076–1052 Green real-time 878 NPSP5d GGCCAATTTATGTAAGTAAATTGAG 200–224 PCR NPSP3d CTTGGATTTAGAAACAATGTTTCTTC 1077–1052 LightCycler 18S rRNA 307 Eh-S26Cc GTACAAAATGGCCAATTCATTCAACG 190–216 4 Ed-27Cd GTACAAAGTGGCCAATTTATGTAAGCA 191–217 Eh-Ed-AS25e GAATTGATTTTACTCAACTCTAGAG 497–473 Eh-Ed-24-Re LC640-TCGAACCCCAATTCCTCGTTATCCp 373–350 Eh-Ed-25-De GCCATCTGTAAAGCTCCCTCTCCGA-FAM 400–376 TaqMan 1 18S rRNA 231 Ehd-239Fe ATTGTCGTGGCATCCTAACTCA 260–239 28 Ehd-88Re GCGGACGGCTCATTATAACA 88–107 histolytica-96Tc FAM-UCAUUGAAUGAAUUGGCCAUUU-BHQ1 217–197 dispar-96Td HEX-UUACUUACAUAAAUUGGCCACUUUG-BHQ1 218–194 TaqMan 2 Episomal 83 histolytica-50Fc CATTAAAAATGGTGAGGTTCTTAGGAA 50–76 28 repeats histolytica-132Rc TGGTCGTCGTCTAGGCAAAATATT 132–109 histolytica-78Tc FAM-TTGACCAATTTACACCGTTGATTTTCGGA-BHQ1 106–78 137 dispar-1Fd GGATCCTCCAAAAAATAAAGTTTTATCA 1–28 dispar-137Rd ATCCACAGAACGATATTGGATACCTAGTA 137–109 dispar-33d HEX-UGGUGAGGUUGUAGCAGAGAUAUUAAUU-BHQ1 33–60 a U, 5-propyne-2�-deoxyuridine. This chemistry mimics the effect on hybridization of the minor-groove binding protein in the so-called MGB probes. LC640, LightCycler Red 640; FAM, 6-carboxyFluorescein; BHQ1, Black Hole Quencher 1; HEX, hexachlorofluorescein; p, phosphate. b The 18S rRNA sequences are filed under GenBank accession number X64142 (E. histolytica) or Z49256 (E. dispar). For episomal repeats, see reference 12. c Specific for E. histolytica. d Specific for E. dispar. e Generic for E. histolytica/E. dispar. be useful for food, water, and distinct classes of environmental diluted sample was used to spike 200 �l parasite-free stools, which were then samples. subjected to DNA extraction (see below). A single stool sample, obtained from Three real-time PCR assays for the specific detection of E. a volunteer with no symptoms of intestinal infection, was used in all spiking experiments. Prior to the spiking procedure, this stool was evaluated for the histolytica had been published as of December 2004: a Light- presence of parasites by microscopic examination of wet mounts and for E. Cycler assay utilizing hybridization probes to detect amplifica­ histolytica and E. dispar using the conventional PCR described below. tion of the 18S rRNA gene (4) and two TaqMan assays tar­ Clinical specimens. A total of 51 clinical specimens (42 stools and 9 liver geting the 18S rRNA gene (25) and the episomal repeats (28), abscess specimens) were used to evaluate the real-time PCR tests. The speci­ mens had been submitted to CDC from state health departments in the United respectively. Although each of these assays has been evaluated States for confirmatory diagnosis during the period from December 2003 to separately, no comparison of the assays has been published so February 2005. Thirty-eight specimens were from patients with suspected ame­ far. In this study, we present a comparative reevaluation of biasis, collected from United States civilians with a travel history outside of the these assays, plus a SYBR Green-based assay using previously United States, immigrants, and refugees; of these, 29 were stools positive for E. published primers (5). Our emphasis was to compare the weak­ histolytica/E. dispar by microscopy performed before submission to CDC, and nine were liver aspirates from nine patients clinically suspected to have amebic nesses and strengths of each assay, with focus
Load more

Recommended publications
  • The Intestinal Protozoa
    The Intestinal Protozoa A. Introduction 1. The Phylum Protozoa is classified into four major subdivisions according to the methods of locomotion and reproduction. a. The amoebae (Superclass Sarcodina, Class Rhizopodea move by means of pseudopodia and reproduce exclusively by asexual binary division. b. The flagellates (Superclass Mastigophora, Class Zoomasitgophorea) typically move by long, whiplike flagella and reproduce by binary fission. c. The ciliates (Subphylum Ciliophora, Class Ciliata) are propelled by rows of cilia that beat with a synchronized wavelike motion. d. The sporozoans (Subphylum Sporozoa) lack specialized organelles of motility but have a unique type of life cycle, alternating between sexual and asexual reproductive cycles (alternation of generations). e. Number of species - there are about 45,000 protozoan species; around 8000 are parasitic, and around 25 species are important to humans. 2. Diagnosis - must learn to differentiate between the harmless and the medically important. This is most often based upon the morphology of respective organisms. 3. Transmission - mostly person-to-person, via fecal-oral route; fecally contaminated food or water important (organisms remain viable for around 30 days in cool moist environment with few bacteria; other means of transmission include sexual, insects, animals (zoonoses). B. Structures 1. trophozoite - the motile vegetative stage; multiplies via binary fission; colonizes host. 2. cyst - the inactive, non-motile, infective stage; survives the environment due to the presence of a cyst wall. 3. nuclear structure - important in the identification of organisms and species differentiation. 4. diagnostic features a. size - helpful in identifying organisms; must have calibrated objectives on the microscope in order to measure accurately.
    [Show full text]
  • 6.5 X 11 Double Line.P65
    Cambridge University Press 978-0-521-53026-2 - The Cambridge Historical Dictionary of Disease Edited by Kenneth F. Kiple Index More information Name Index A Baillie, Matthew, 80, 113–14, 278 Abercrombie, John, 32, 178 Baillou, Guillaume de, 83, 224, 361 Abreu, Aleixo de, 336 Baker, Brenda, 333 Adams, Joseph, 140–41 Baker, George, 187 Adams, Robert, 157 Balardini, Lodovico, 243 Addison, Thomas, 22, 350 Balfour, Francis, 152 Aesculapius, 246 Balmis, Francisco Xavier, 303 Aetius of Amida, 82, 232, 248 Bancroft, Edward, 364 Afzelius, Arvid, 203 Bancroft, Joseph, 128 Ainsworth, Geoffrey C., 128–32, 132–34 Bancroft, Thomas, 87, 128 Albert, Jose, 48 Bang, Bernhard, 60 Alexander of Tralles, 135 Bannwarth, A., 203 Alibert, Jean Louis, 147, 162, 359 Bard, Samuel, 83 Ali ibn Isa, 232 Barensprung,¨ F. von, 360 Allchin, W. H., 177 Bargen, J. A., 177 Allison, A. C., 25, 300 Barker, William H., 57–58 Allison, Marvin J., 70–71, 191–92 Barthelemy,´ Eloy, 31 Alpert, S., 178 Bartlett, Elisha, 351 Altman, Roy D., 238–40 Bartoletti, Fabrizio, 103 Alzheimer, Alois, 14, 17 Barton, Alberto, 69 Ammonios, 358 Bartram, M., 328 Amos, H. L., 162 Bassereau, Leon,´ 317 Andersen, Dorothy, 84 Bateman, Thomas, 145, 162 Anderson, John, 353 Bateson, William, 141 Andral, Gabriel, 80 Battistine, T., 69 Annesley, James, 21 Baumann, Eugen, 149 Arad-Nana, 246 Beard, George, 106 Archibald, R. G., 131 Beet, E. A., 24, 25 Aretaeus the Cappadocian, 80, 82, 88, 177, 257, 324 Behring, Emil, 95–96, 325 Aristotle, 135, 248, 272, 328 Bell, Benjamin, 152 Armelagos, George, 333 Bell, J., 31 Armstrong, B.
    [Show full text]
  • Amoebic Dysentery
    University of Nebraska Medical Center DigitalCommons@UNMC MD Theses Special Collections 5-1-1934 Amoebic dysentery H. C. Dix University of Nebraska Medical Center This manuscript is historical in nature and may not reflect current medical research and practice. Search PubMed for current research. Follow this and additional works at: https://digitalcommons.unmc.edu/mdtheses Part of the Medical Education Commons Recommended Citation Dix, H. C., "Amoebic dysentery" (1934). MD Theses. 320. https://digitalcommons.unmc.edu/mdtheses/320 This Thesis is brought to you for free and open access by the Special Collections at DigitalCommons@UNMC. It has been accepted for inclusion in MD Theses by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. A MOE B leD Y SEN T E R Y By H. c. Dix University of Nebraska College of Medicine Omaha, N~braska April 1934 Preface This paper is presented to the University of Nebraska College of MediCine to fulfill the senior requirements. The subject of amoebic dysentery wa,s chosen due to the interest aroused from the previous epidemic, which started in Chicago la,st summer (1933). This disea,se has previously been considered as a tropical disease, B.nd was rarely seen and recognized in the temperate zone. Except in indl vidu8,ls who had been in the tropics previously. In reviewing the literature, I find that amoebio dysentery may be seen in any part of the world, and from surveys made, the incidence is five in every hun- dred which harbor the Entamoeba histolytlca, it being the only pathogeniC amoeba of the human gastro-intes­ tinal tract.
    [Show full text]
  • Enteric Protozoa in the Developed World: a Public Health Perspective
    Enteric Protozoa in the Developed World: a Public Health Perspective Stephanie M. Fletcher,a Damien Stark,b,c John Harkness,b,c and John Ellisa,b The ithree Institute, University of Technology Sydney, Sydney, NSW, Australiaa; School of Medical and Molecular Biosciences, University of Technology Sydney, Sydney, NSW, Australiab; and St. Vincent’s Hospital, Sydney, Division of Microbiology, SydPath, Darlinghurst, NSW, Australiac INTRODUCTION ............................................................................................................................................420 Distribution in Developed Countries .....................................................................................................................421 EPIDEMIOLOGY, DIAGNOSIS, AND TREATMENT ..........................................................................................................421 Cryptosporidium Species..................................................................................................................................421 Dientamoeba fragilis ......................................................................................................................................427 Entamoeba Species.......................................................................................................................................427 Giardia intestinalis.........................................................................................................................................429 Cyclospora cayetanensis...................................................................................................................................430
    [Show full text]
  • Entamoeba Histolytica?
    Amebas Friend and foe Facultative Pathogenicity of Entamoeba histolytica? Confusing History 1875 Lösch correlated dysentery with amebic trophozoites 1925 Brumpt proposed two species: E. dysenteriae and E. dispar 1970's biochemical differences noted between invasive and non-invasive isolates 80's/90's several antigenic and DNA differences demonstrated • rRNA 2.2% sequence difference 1993 Diamond and Clark proposed a new species (E. dispar) to describe non-invasive strains 1997 WHO accepted two species 1 Family Entamoebidae Family includes parasites • Entamoeba histolytica and commensals • Entamoeba dispar • Entamoeba coli Species are differentiated • Entamoeba hartmanni based on size, nuclear • Endolimax nana substructures • Iodamoeba bütschlii Entamoeba histolytica one of the most potent killers in nature Entamoeba histolytica • worldwide distribution (cosmopolitan) • higher prevalence in tropical or developing countries (20%) • 1-6% in temperate countries • Possible animal reservoirs • Amebiasis - Amebic dysentery • aka: Montezuma’s revenge Taxonomy • One parasitic species? • E. histolytica • E. dispar • E. hartmanni 2 Entamoeba Life Cycle - Direct Fecal/Oral transmission Cyst - Infective stage Resistant form Trophozoite - feeding, binary fission Different stages of cyst development Precysts - rich in glycogen Young cyst - 2, then 4 nuclei with chromotoid bodies Metacysts - infective stage Metacystic trophozoite - 8 8 Excystation Metacyst Cyst wall disruption Ameba emerges Nuclear division 48 Cytokinesis Nuclear division
    [Show full text]
  • 38 Entamoeba Histolytica and Other Rhizophodia
    MODULE Entamoeba Histolytica and Other Rhizophodia Microbiology 38 Notes ENTAMOEBA HISTOLYTICA AND OTHER RHIZOPHODIA 38.1 INTRODUCTION Amoebae can be pathogenic called Entamoeba histolytica and non pathogenic called Entamoeba coli (large intestines), Entamoeba gingivalis (oral cavity). These parasites are motile with pseudopodia. The pseudopodia are cytoplasmic processes which are thrown out. OBJECTIVES After reading this lesson you will be able to: z describe morphology, its life cycle, pathogenecity of Entameba Histolytica, other amoebae and free living amoeba z differentiate between amoebic and Bacillary dysentery z differentiate between Entamoeba Histolytica and Entamoeba Coli z demonstrate Laboratory diagnosis of Entameba 38.2 ENTAMOEBA HISTOLYTICA It belongs to the class Rhizopoda and family Entamoebidae. It is the causative agent of amoebiasis. Amoebiasis can be intestinal and extra intestinal like amoebic hepatitis, amoebic liver abscess. 38.3 MORPHOLOGY The Entamoeba is seen in three stages 344 MICROBIOLOGY Entamoeba Histolytica and Other Rhizophodia MODULE (a) Trophozoite: The trophozoite is 18-40 µm in size. The trophozoite is Microbiology actively motile. The cytoplasm is demarcated into endoplasm and ectoplasm. Ingested food particles and red blood cells are seen in the cytoplasm No bacteria are seen in the cytoplasm. The nucleus is 6-15 µm and has a central rounded karyosome. Nuclear membrane has chromatin granules and spoke like radial arrangement of chromatin fibrils. Notes Fig. 38.1 (b) Precyst: Smaller in size. 10-20 µm in diameter. It is round to oval in shape with blunt pseudopodium. The nuclei is similar to the trophozoite. (c) Cyst: These are round 10-15 µm in diameter. It is surrounded by a refractile membrane called as the cyst wall.
    [Show full text]
  • Acanthamoeba Castellanii
    Int. J. Biol. Sci. 2018, Vol. 14 306 Ivyspring International Publisher International Journal of Biological Sciences 2018; 14(3): 306-320. doi: 10.7150/ijbs.23869 Research Paper Environmental adaptation of Acanthamoeba castellanii and Entamoeba histolytica at genome level as seen by comparative genomic analysis Victoria Shabardina1, Tabea Kischka1, Hanna Kmita2, Yutaka Suzuki3, Wojciech Maka owski1 1. Institute of Bioinformatics, University Münster, Niels-Stensen Strasse 14, Münster 48149, Germany ł 2. Laboratory of Bioenergetics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University 3. Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8562, Japan Corresponding author: [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2017.11.15; Accepted: 2017.12.30; Published: 2018.02.12 Abstract Amoebozoans are in many aspects interesting research objects, as they combine features of single-cell organisms with complex signaling and defense systems, comparable to multicellular organisms. Acanthamoeba castellanii is a cosmopolitan species and developed diverged feeding abilities and strong anti-bacterial resistance; Entamoeba histolytica is a parasitic amoeba, who underwent massive gene loss and its genome is almost twice smaller than that of A. castellanii. Nevertheless, both species prosper, demonstrating fitness to their specific environments. Here we compare transcriptomes of A. castellanii and E. histolytica with application of orthologs’ search and gene ontology to learn how different life strategies influence genome evolution and restructuring of physiology.
    [Show full text]
  • Entamoeba Histolytica Internal Transcribed Spacer 2 (ITS2)
    PCRmax Ltd TM qPCR test Entamoeba histolytica internal transcribed spacer 2 (ITS2) 150 tests For general laboratory and research use only 1 Introduction to Entamoeba histolytica Entamoeba histolytica is an anaerobic, protozoan, intestinal parasite responsible for a disease called amoebiasis. It usually occurs in the large intestine and causes internal inflammation. It belongs to the genus Entamoeba and class Archamoeba. Amongst parasitic diseases, E. histolytica is one of the leading causes of morbidity and mortality in developing countries. E. histolytica is transmitted by ingestion of exit body containing cysts from faecally contaminated food and water or from hands. Due to their protective walls, the cysts can remain viable for several weeks in external environments. Species within this genus are small, single celled organisms with an anterior bulge representing a lobose pseudopod. The E. histolytica trophozoites are oblong and approximately 15-20µM in length, whereas the cysts are spherical and typically 12-15 µM in diameter. Entamoeba cysts are most commonly transmitted by ingestion so must be extremely robust to survive the hostile environment of the stomach. The cysts transform to trophozoites in the small intestine where they multiply by binary fission to then colonise the large intestine. They cause major calcium ion influx to the cells of the large intestine resulting in cell death and ulcer formation. The Trophozoites subsequently form new cysts which are excreted once more in faeces. Infection with E. histolytica generally causes mild symptoms such as abdominal pain, flatulence and diarrhoea, but more severe infections can lead to amoebosis. This is a condition encompassing amoebic dysentery characterized by severe abdominal pain, fever and blood in the faeces and less commonly amoebic liver abscesses.
    [Show full text]
  • Endolimax Nana
    Autonomous University of San Luis Potosí Faculty of Chemical Sciences Laboratory of General Microbiology Searching for intestinal parasites in vegetables Members: Canela Costilla Aaron Jared Gómez Hernández Christiane Lucille Castillo Guevara Diana Zuzim Teacher: Juana Tovar Oviedo Teacher: Rosa Elvia Noyola Medina Days: Tuesday-Thrusday Schedule: 08:00-09:00 hrs Abril 5th of 2017 Objective To perform the search of parasitic forms of protozoa and intestinal helminths in vegetables sold in home samples, using the saline centrifugation technique, microscopic observation with 10X and 40X objective, using lugol as a contrast dye Introduction Protozoans are unicellular microorganisms that lack a cell wall. They usually lack color and are mobile. They are distinguished from prokaryotes by their larger size, algae lacking chloroplast and chlorophyll, yeasts and fungi by being mobile and mucosal fungi because of their inability to form fruiting bodies Because of their appreciable content of ascorbic acid, carotene and dietary fiber, vegetables are widely recommended as part of the daily diet. Celery, lettuce, cabbage, brussels sprouts and other vegetables that are generally eaten raw have been associated with outbreaks of diarrhea and even listeriosis. In addition, contamination with parasitic eggs such as Ascaris lumbricoides, Trichocephalus trichiurus, Entamoeba histolytica cysts, Giardia intestinalis and viruses such as hepatitis A has been found in this type of plant. Collection and preservation of vegetables Vegetables should The sample is allowed Vegetables are be fresh at the time to soak in saline solution chopped and cut of sampling 0.85% for 24 hours into pieces They are placed in The contents are We weigh 40g of the glass glasses and 400ml shaken and left to sample in a granataria of saline solution is stand for 24 hours scale added 0.9% Process 9.
    [Show full text]
  • ZOOLOGY Biology of Parasitism Morphology, Life Cycle
    Paper : 08 Biology of Parasitism Module : 18 Morphology, Life cycle, Pathogenecity, Diagnosis and Prophylaxis of Entamoeba Part 1 Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University of Delhi Paper Coordinator : Dr. Pawan Malhotra ICGEB, New Delhi Content Writer : Dr. Ranjana Saxena Dyal Singh College, University of Delhi Content Reviewer : Prof. Rajgopal Raman Department of Zoology, University of Delhi 1 Biology of Parasitism ZOOLOGY Morphology, Life cycle, Pathogenecity, Diagnosis and Prophylaxis of Entamoeba Part 1 Description of Module Subject Name ZOOLOGY Paper Name Biology of Parasitism; Zool 008 Module Name/Title Protozoans Module Id M18: Morphology, Life cycle, Pathogenecity, Diagnosis and Prophylaxis of Entamoeba Part 1 Keywords Trophozoite, precyst, cyst, chromatoidal bars, excystation, encystation, metacystictrophozoites, amoebiasis, amoebic dysentery, extraintestinalinvasion. Contents 1. Learning Outcomes 2. Introduction 3. History of Entamoeba 4. Classification of Entamoeba 5. Geographical distribution of Entamoeba histolytica 6. Habit and Habitat 7. Host 8. Reservoir 9. Morphology 10. Life cycle 11. Transmission 12. Entamoeba dispar 13. Entamoeba gingivalis 14. Entamoeba coli 15. Entamoeba hartmanni 16. Comparison between the various Entamoeba 17. Summary of Entamoeba histolytica 2 Biology of Parasitism ZOOLOGY Morphology, Life cycle, Pathogenecity, Diagnosis and Prophylaxis of Entamoeba Part 1 1. Learning Outcomes After studying this unit you will be able to: Classify Entamoeba Understand the medical importance of Entamoeba Distinguish between the different species of Entamoeba Identify the pathogenic species of Entamoeba Describe the morphology ofEntamoeba histolytica Explain the life cycle of Entamoeba histolytica Compare the life cycle of different species of Entamoeba 2.
    [Show full text]
  • Entamoeba Histolytica Genesig Easy
    Primerdesign TM Ltd Entamoeba histolytica genesig® Easy Kit for use on the genesig® q16 50 reaction For general laboratory and research use only Entamoeba histolytica 1 genesig Easy kit handbook HB10.18.07 Published Date: 09/11/2018 genesig® Easy: at a glance guide For each DNA test Component Volume Lab-in-a-box pipette E.histolytica reaction mix 10 µl Your DNA sample 10 µl For each positive control Component Volume Lab-in-a-box pipette E.histolytica reaction mix 10 µl Positive control template 10 µl For each negative control Component Volume Lab-in-a-box pipette E.histolytica reaction mix 10 µl Water 10 µl Entamoeba histolytica 2 genesig Easy kit handbook HB10.18.07 Published Date: 09/11/2018 Kit Contents • E.histolytica specific primer/probe mix (BROWN) Once resuspended the kits should remain at -20ºC until ready to use. • Lyophilised oasigTM Master Mix • Lyophilised oasigTM Master Mix resuspension buffer (BLUE lid) • E.histolytica positive control template (RED lid) • Internal extraction control DNA (BLUE lid) • RNase/DNase free water (WHITE lid) • Template preparation buffer (YELLOW lid) • 54 x genesig® q16 reaction tubes Reagents and equipment to be supplied by the user genesig® q16 instrument genesig® Easy Extraction Kit This kit is designed to work well with all processes that yield high quality RNA and DNA but the genesig Easy extraction method is recommended for ease of use. genesig® Lab-In-A-Box The genesig Lab-In-A-Box contains all of the pipettes, tips and racks that you will need to use a genesig Easy kit.
    [Show full text]
  • Entamoeba Histolytica
    Entamoeba histolytica Trophozoite: 20-30 µm Cyst:10-20 μm Trophozoite • Active, feeding stage • Cytoplasm – Clean, not foamy • Nucleus – Central “bullseye” endosome – Thin, even chromatin lining nucleus • Found in loose stools and ectopic infections Cyst • Dormant/resistant stage • Cysts are susceptible to heat (above 40 C.), freezing (below –5 C.), and drying. • Cysts remain viable in moist environment for 1 month. • Spherical • 1-4 nuclei, (4 in mature cysts) • Bluntly rounded chromatoidal bars • Found and released in formed feces Life Cycle • CYST is ingested with food or water contaminated with feces • Excystation occurs in the small intestine in an alkaline environment. • Metacystic amoebas emerge, divide and move down into the large intestine. Habitat: Trophozoites live and may multiply indefinitely within the crypts and mucosa of the LI mucosa feeding on starches and mucous secretions. INFECTIVE STAGE: Cyst Cysts form in response to unfavorable (deteriorating) environmental conditions, as they move down the LI. DISTRIBUTION: Parasite has worldwide distribution but is most common in the tropical and subtropical areas of the world • ~ 500 million people may be affected • ~ 100,000 deaths each year • PREVALENCE: . < 1% in Canada and Alaska . 0.9% in U.S. 40% in the tropics . This parasite is likely under-reported in developing countries and potentially one of the most prevalent parasitic infections in the world. Pathology • E. histolytica has surface enzymes that can digest epithelial cells and therefore hydrolyze host tissues and cause pathology. • Usually the host’s repair of the epithelial cells can keep pace with the damage. • However, when the host is stressed, immunocompromised, has too much HCl, or a high bacterial flora, the digestion will be ahead of repair.
    [Show full text]