JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2005, p. 5491–5497 Vol. 43, No. 11 0095-1137/05/$08.00�0 doi:10.1128/JCM.43.11.5491–5497.2005

Comparison of Real-Time PCR Protocols for Differential Laboratory Diagnosis of Amebiasis Yvonne Qvarnstrom,1,3 Cleve James,1 Maniphet Xayavong,1,3 Brian P. Holloway,2 Govinda S. Visvesvara,1 Rama Sriram,1 and Alexandre J. da Silva1* Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, Georgia1; Scientific Resources Program, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, Georgia2; and Atlanta Research and Education Foundation in Conjunction with the Atlanta VA Medical Center, Decatur, Georgia3

Received 23 May 2005/Returned for modification 8 July 2005/Accepted 15 August 2005

Specific identification of Entamoeba spp. in clinical specimens is an important confirmatory diagnostic step in the management of patients who may be infected with Entamoeba histolytica, the species that causes clinical amebiasis. Distinct real-time PCR protocols have recently been published for identification of E. histolytica and differentiation from the morphologically identical nonpathogenic Entamoeba dispar. In this study, we compared three E. histolytica real-time PCR techniques published by December 2004. The limits of detection and efficiency of each real-time PCR assay were determined using DNA extracted from stool samples spiked with serially diluted cultured E. histolytica trophozoites. The ability of each assay to correctly distinguish E. histolytica from E. dispar was evaluated with DNA extracted from patients’ stools and liver aspirates submitted for confirma­ tory diagnosis. Real-time PCR allowed quantitative analysis of the spiked stool samples, but major differences in detection limits and assay performance were observed among the evaluated tests. These results illustrate the usefulness of comparative evaluations of diagnostic assays.

Clinical features of amebiasis, caused by the protozoan par­ mended for use exclusively with fresh stool samples, since asite Entamoeba histolytica, range from asymptomatic coloni­ storage or use of preservatives destroys the antigen. zation to amebic dysentery and invasive extraintestinal amebi­ For diagnosis of extraintestinal amebiasis, the laboratory asis, most commonly in the form of liver abscesses (24). The methods are even more limited. Detection of amebas by mi­ World Health Organization estimates that amebiasis is one of croscopy is often unsuccessful (32). Although acceptable re­ the three most common causes of death from parasitic disease, sults with extraintestinal specimens have been obtained with responsible for up to 100,000 deaths annually (30). The disease the TechLab II antigen test (14, 22), this test is designed and is spread primarily by food or water contaminated with cysts marketed for examination of stool specimens only. but may also be transmitted from person to person. It is highly PCR, including real-time PCR, has provided means to iden­ prevalent in regions of the world where personal hygiene tify E. histolytica in a variety of clinical specimens, including and/or sanitation are insufficient. stools, tissues, and liver abscess aspirates (24). Several PCR Examination of stained stool smears is used routinely in assays designed for differential detection of E. histolytica and clinical laboratories to differentiate E. histolytica from non­ E. dispar have been developed. Most of them target either the pathogenic intestinal amebas, such as Entamoeba coli, Entam­ small-subunit rRNA (18S rRNA) gene (5, 10, 15, 18) or spe­ oeba polecki, and Entamoeba hartmani. However, this gold cies-specific episomal repeats (1, 19, 21). These targets are standard method cannot differentiate E. histolytica from the present on multicopy, extrachromosomal plasmids in the ame­ morphologically identical E. dispar, which occurs worldwide bas (3). The sensitivity and specificity of PCR assays exceed E. dispar (8). is a harmless commensal protozoan, and its pres­ what can be accomplished with microscopy and are compara­ ence in clinical specimens does not justify treatment (30). ble to those of the antigen test (13, 16, 17, 20, 23). Thus, misidentification of E. histolytica-associated disease may Real-time PCR is a very attractive methodology for labora­ occur if the diagnosis is based solely on examination of smears tory diagnosis of infectious diseases because of its features that (29). For final confirmatory identification of intestinal amebi­ eliminate post-PCR analysis, leading to shorter turn-around asis, molecular methods or immunologic assays for detection of times and minimized risk of amplicon contamination of labo­ E. histolytica antigens are needed (21). Currently, the only ratory environments. This represents obvious advantages in commercially available antigen test for specific detection of E. diagnostics, as amplicon contamination has been reported to histolytica (the histolytica II test from TechLab) is recom­ be the most frequent cause of false-positive results in PCR amplification (31). In addition, real-time PCR is a quantitative method and may allow the determination of the number of * Corresponding author. Mailing address: Parasitic Diseases parasites in various samples (2). Although not relevant for Branch, Division of Parasitic Diseases, Centers for Disease Control estimating the parasite burden in amebiasis patients (the par­ and Prevention, Mail Stop F36, 4700 Buford Highway NE, Atlanta, GA 30341-3724. Phone: (770) 488-4072. Fax: (770) 488-3115. E-mail: asite content can vary tremendously between, or even within, [email protected]. specimens from the same patient), quantitative measures can

5491 5492 QVARNSTROM ET AL. J. CLIN.MICROBIOL.

TABLE 1. Primers and probes used in the real-time PCR assays compared

Gene Amplicon Primer Nucleotide Assay Sequence (5� to 3�)a Reference target size (bp) or probe positionsb

Conventional PCR 18S rRNA 877 PSP5c GGCCAATTCATTCAATGAATTGAG 200–223 5 adapted for SYBR PSP3c CTCAGATCTAGAAACAATGCTTCTC 1076–1052 Green real-time 878 NPSP5d GGCCAATTTATGTAAGTAAATTGAG 200–224 PCR NPSP3d CTTGGATTTAGAAACAATGTTTCTTC 1077–1052 LightCycler 18S rRNA 307 Eh-S26Cc GTACAAAATGGCCAATTCATTCAACG 190–216 4 Ed-27Cd GTACAAAGTGGCCAATTTATGTAAGCA 191–217 Eh-Ed-AS25e GAATTGATTTTACTCAACTCTAGAG 497–473 Eh-Ed-24-Re LC640-TCGAACCCCAATTCCTCGTTATCCp 373–350 Eh-Ed-25-De GCCATCTGTAAAGCTCCCTCTCCGA-FAM 400–376 TaqMan 1 18S rRNA 231 Ehd-239Fe ATTGTCGTGGCATCCTAACTCA 260–239 28 Ehd-88Re GCGGACGGCTCATTATAACA 88–107 histolytica-96Tc FAM-UCAUUGAAUGAAUUGGCCAUUU-BHQ1 217–197 dispar-96Td HEX-UUACUUACAUAAAUUGGCCACUUUG-BHQ1 218–194 TaqMan 2 Episomal 83 histolytica-50Fc CATTAAAAATGGTGAGGTTCTTAGGAA 50–76 28 repeats histolytica-132Rc TGGTCGTCGTCTAGGCAAAATATT 132–109 histolytica-78Tc FAM-TTGACCAATTTACACCGTTGATTTTCGGA-BHQ1 106–78 137 dispar-1Fd GGATCCTCCAAAAAATAAAGTTTTATCA 1–28 dispar-137Rd ATCCACAGAACGATATTGGATACCTAGTA 137–109 dispar-33d HEX-UGGUGAGGUUGUAGCAGAGAUAUUAAUU-BHQ1 33–60

a U, 5-propyne-2�-deoxyuridine. This chemistry mimics the effect on hybridization of the minor-groove binding protein in the so-called MGB probes. LC640, LightCycler Red 640; FAM, 6-carboxyFluorescein; BHQ1, Black Hole Quencher 1; HEX, hexachlorofluorescein; p, phosphate. b The 18S rRNA sequences are filed under GenBank accession number X64142 (E. histolytica) or Z49256 (E. dispar). For episomal repeats, see reference 12. c Specific for E. histolytica. d Specific for E. dispar. e Generic for E. histolytica/E. dispar. be useful for food, water, and distinct classes of environmental diluted sample was used to spike 200 �l parasite-free stools, which were then samples. subjected to DNA extraction (see below). A single stool sample, obtained from Three real-time PCR assays for the specific detection of E. a volunteer with no symptoms of intestinal infection, was used in all spiking experiments. Prior to the spiking procedure, this stool was evaluated for the histolytica had been published as of December 2004: a Light- presence of parasites by microscopic examination of wet mounts and for E. Cycler assay utilizing hybridization probes to detect amplifica­ histolytica and E. dispar using the conventional PCR described below. tion of the 18S rRNA gene (4) and two TaqMan assays tar­ Clinical specimens. A total of 51 clinical specimens (42 stools and 9 liver geting the 18S rRNA gene (25) and the episomal repeats (28), abscess specimens) were used to evaluate the real-time PCR tests. The speci­ mens had been submitted to CDC from state health departments in the United respectively. Although each of these assays has been evaluated States for confirmatory diagnosis during the period from December 2003 to separately, no comparison of the assays has been published so February 2005. Thirty-eight specimens were from patients with suspected ame­ far. In this study, we present a comparative reevaluation of biasis, collected from United States civilians with a travel history outside of the these assays, plus a SYBR Green-based assay using previously United States, immigrants, and refugees; of these, 29 were stools positive for E. published primers (5). Our emphasis was to compare the weak­ histolytica/E. dispar by microscopy performed before submission to CDC, and nine were liver aspirates from nine patients clinically suspected to have amebic nesses and strengths of each assay, with focus on their useful­ liver abscesses. These 38 specimens were tested for the presence of amebas by ness for clinical laboratory diagnosis. Quantification standards conventional PCR, using primers PSP5/PSP3 and NPSP5/NPSP3 (5), upon re­ produced by spiking stools with different concentrations of E. ception at CDC. The remaining 13 samples were stools containing other intes­ histolytica trophozoites and a small set of well-characterized tinal parasites, as confirmed by conventional PCR and DNA sequencing: two clinical samples were used to compare limits of detection, samples each of Entamoeba invadens, Encephalitozoon intestinalis, Enterocyto­ zoon bieneusi, and Cyclospora cayetanensis; one sample each of Entamoeba coli, accuracy, efficiency, relative cost, and ease of use for each Entamoeba chattoni, Encephalitozoon cuniculi, Cryptosporidium parvum, and assay. Such data are crucial to allow reference laboratories to Cryptosporidium hominis. make informed choices for implementation of real-time PCR DNA extraction. Total genomic DNA was extracted from spiked stools and for amebiasis. clinical samples using a modification of the FastDNA method (Q-Biogene, Carls­ bad, Calif.) as previously described (6). DNA was extracted from 300 �l of each clinical specimen. Samples were disrupted in the FP120 cell disruptor instrument MATERIALS AND METHODS at a speed of 5.5 for 10 seconds. Potential inhibitors were removed by further Cultured Entamoeba histolytica trophozoites. Entamoeba histolytica ATCC purification with the QIAquick PCR purification kit (QIAGEN Inc., Valencia, strain HM1 was grown in Diamond’s TYIS-33 medium (9) at 37°C with the Calif.) according to the manufacturer’s instructions. Purified DNA was stored at following modifications: (i) liver extract (Oxoid), 15 g/liter, was substituted for 4°C until it was used in PCRs. casein digest peptone (BBL), (ii) yeast extract was used at 25 g/liter, and (iii) the PCR amplification. All PCRs were performed using commercially available vitamin mixture consisted of NCTC 109 with added vitamins B12,D,andL ­ reagents that included a thermostable DNA polymerase, deoxynucleoside thioctic acid and Tween 80 solution. Cultured E. histolytica trophozoites were triphosphates, MgCl2, and other salts and buffering agents necessary for opti­ harvested, centrifuged, and resuspended in phosphate-buffered saline to 0.2 � mum performance. One microliter of template DNA was added to each reaction 106 to 3.0 � 106 cells/ml. A 1-�l aliquot of this harvested batch was placed in a mixture, and the total volume was 20 �l in all assays. Conventional PCR, using counting chamber (Hausser Scientific Company, Horsham, Pa.), and the con­ previously published primers for E. histolytica detection (5), was employed to centration of trophozoites was calculated. Three 200-�l aliquots of the same define the detection limit of the assay. Cycling was carried out in a GeneAmp harvested batch were used to produce a set of 120 quantification standards: each 9700 PCR thermal cycler (Applied Biosciences, Foster City, Calif.). The Light- aliquot was serially diluted to 10�1 cell/ml, creating three identical dilution series Cycler assay was performed on LightCycler 2.0 (Roche Diagnostics, Indianapo­ with eight diluted samples in each series. This was repeated four more times, lis, Ind.), whereas all other real-time PCR assays were performed on Mx3000P resulting in five batches of three dilution series each. A volume of 200 �l of each (Stratagene, La Jolla, Calif.). Details about the assays are outlined in Table 1 VOL. 43, 2005 REAL-TIME PCR FOR DIFFERENTIAL DIAGNOSIS OF AMEBIASIS 5493

TABLE 2. Details about the compared real-time PCR assays

Assay Cycling structure Enzyme/buffer (source) Primer/probe concn. Detection Conventional PCR 95°C for 5 min, 45 AmpliTaq Gold/AmpliTaq 0.4 �M of each primer 2% agarose gel stained with cycles of 95°C for Gold PCR Master Mix ethidium bromide 15 s, 65°C for 15 s, (Applied Biosciences, 72°C for 1 min, Foster City, Calif.) 72°C for 10 min SYBR Green 95°C for 15 min, 50 HotStar Taq polymerase/ 0.1 �M of each primer Fluorescence at the end of the 80°C cycles of 95°C for QuantiTect SYBR Green incubation plateau and during the 15 s, 60°C for 1 PCR Master Mix melting curve min, 72°C for 1.5 (QIAGEN, Valencia, min, 80°C for 30 s Calif.) � melting curve LightCycler 95°C for 15 min, 50 HotStarTaq polymerase/ 0.5 �M of each primer/0.1 Fluorescence at the end of each cycles of 95°C, QuantiTect Probe PCR �M of each probe annealing plateau 58°C for 10 s,a Master Mix (QIAGEN, 72°C for 20 s Valencia, Calif.) TaqMan1 and 95°C for 3 min, 40 iTaq DNA polymerase/IQ 0.5 �M of each primer/0.1 Fluorescence at the end of each TaqMan 2 cycles of 95°C for Supermix (BioRad, �M of each probe extension plateau 15 s, 60°C for 30 s, Hercules, Calif.) 72°C for 30 s

a A touch-down PCR mode was incorporated to stepwise decrease the annealing temperature from 62°C to 58°C during the first eight cycles.

(target genes and sequences of primers and probes) and Table 2 (cycling struc­ same sample was normally on the order of less than 1 cycle tures, reagents, and detection methods). unit) (data not shown). Counting of trophozoites was as accu­ Data analysis. Except for results from the LightCycler, fluorescence thresholds rate as possible; however, “stickiness” of the parasites could were manually adjusted to the same numerical value for each run to facilitate have made it difficult to obtain a homogenous solution before comparison of run-to-run variation of threshold cycle (Ct) values. Microsoft Excel (Office 2000; Microsoft Corp., Seattle, Wash.) was used for statistical making aliquots and dilutions, resulting in the observed Ct analysis. Student’s t test (two-tailed distribution; unpaired) was performed to differences between samples. The statistical analysis of the Ct determine the quality of quantification standard curves: P values less than 0.05 variation indicated that quantification could be determined were considered significant. DNA sequencing analysis. Primers Ehd-88R and Eh-Ed-AS25 were used to within 1 logarithmic order of magnitude. amplify 410- or 411-bp amplicons, which were purified with the StrataPrep PCR Detection limits and efficiency measures of evaluated real- Purification kit (Stratagene, La Jolla, Calif.) and sequenced by cycle sequencing time PCR tests. Limits of detection for all four real-time PCR using BigDye version 3.1 chemistry (Applied Biosystems, Foster City, Calif.). tests were estimated in quantification experiments using the DNA Sequencing reactions were purified using MultiScreen-HV plates (Millipore, standard samples described above. The probe-based assays (i.e., Billerica, Mass.). Sequencing data were obtained using the ABI Prism 3100 sequence analyzer with data collection software version 2.0 and DNA Sequence the LightCycler and the two TaqMan assays) were very sensitive, Analysis Software version 5.1 (Applied Biosystems, Foster City, Calif.). Sequences with detection limits of less than 10 cells per ml of spiked stool were assembled, edited, and aligned in DNASTAR SeqMan (DNASTAR Inc., (Table 4). The SYBR Green assay was the least sensitive of the Madison, Wis.), as well as in the GeneStudio suite (GeneStudio Inc., Suwanee, Ga.).

RESULTS Quantification standards. Evaluating the quantitative as­ pects of the real-time PCR protocols required samples with known concentrations of Entamoeba histolytica, so a set of standard samples was produced based on cultivated E. histo­ lytica trophozoites. E. histolytica cysts were not used, since encystations of E. histolytica cannot be reliably achieved in the laboratory. The quantification standards consisted of parasite-free stools spiked with known numbers of trophozoites from cul­ tures. To ensure that the detection limit could be reached even for very sensitive assays, we included samples with a calculated content of less than one cell. DNA extracted from these spiked stool samples was first analyzed in the SYBR Green assay. FIG. 1. Variation in Ct values of the standard DNA samples. SYBR Figure 1 illustrates the spread of the resulting Ct values, and Green assay Ct values obtained with DNA extracted from stools con­ Table 3 lists the outcome of statistical analysis of the results. taining 106 to 10�1 E. histolytica trophozoites per ml. Each sample was The variation in C values shown in Fig. 1 and Table 3 was tested three times, and the resulting Ct values were plotted against the t trophozoite concentration. The line corresponds to a linear regression mainly due to differences in DNA concentrations between of all values. The variation in Ct values between samples containing the samples, as each individual sample produced highly reproduc­ same parasite concentration was mainly due to variable DNA concen­ ible results in independent runs (run-to-run variability for the trations in the samples, as explained in Results. 5494 QVARNSTROM ET AL. J. CLIN.MICROBIOL.

TABLE 3. Statistical analysis of the quantification standards as evaluated in the SYBR Green assay

Value at indicated cell count/ml Parameter 106 105 104 103 102 101 100 10�1

Avg Ct 20.4 23.7 28.0 32.6 37.0 40.7 41.7 SD 2.0 2.3 2.0 2.2 2.8 2.2 1.8 a No. of Ct values 36 45 45 45 40 30 7 0 Ct intervals 16.5–24.3 20.0–29.4 24.3–32.7 28.9–37.2 33.6–47.0 36.5–46.7 39.9–44.8 Significance P � 0.001 P � 0.001 P � 0.001 P � 0.001 P � 0.001 P � 0.18

a 6 The maximum number of individual Ct values is 45 (3 tests at 15 samples each) for all concentrations except for the most concentrated (10 /ml), which had 12 samples and thus a maximum of 36 individual Ct values.

real-time PCR assays, but it still had approximately 10-fold-higher 10 of these samples as positive for E. histolytica (4 of the liver sensitivity than conventional PCR (Table 4). aspirates and 6 of the stool specimens), 16 of the stools as Regression analysis identified variable linear ranges for the positive for E. dispar, and 1 stool as positive for both species. assays, with the TaqMan assays having the largest possible All 38 samples were reevaluated in this study, using the four linear range of 8 orders of magnitude (Fig. 2 and Table 4). The real-time PCR assays, and the results are displayed in Tables 5 slopes of the linear parts of the standard curves in Fig. 2 were and 6. To ensure the accuracy of species determination, all used to estimate the amplification efficiency. A slope of �3.3 samples that were positive for amebas in any of the evaluated translates into 100% efficiency, which in practice means that tests were also amplified with primers Ehd-88R and Eh-Ed­ the number of amplicon copies doubles for each amplification AS25, and the amplicons were sequenced (Tables 5 and 6). cycle. By using this criterion, only the TaqMan assay targeting The SYBR Green assay reported seven of the initially positive the 18S rRNA demonstrated 100% efficiency (Table 4). samples as negative for amebas. This could have been associ­ The last two columns in Table 4 provide a rough estimate of ated with long-term storage and subsequent degradation of the time and cost involved in running each evaluated real-time nucleic acids, bringing the concentration of the targets below PCR assay. The SYBR Green assay and the LightCycler assay the detection limit of the SYBR Green assay before real-time used species-specific primers to distinguish E. histolytica from PCR was performed. On the other hand, the probe-based E. dispar. Thus, two separate reactions had to be run in parallel assays (i.e., the LightCycler and the two TaqMan assays) con­ for each sample, resulting in slightly longer set-up times than firmed the initial PCR results in all 27 positive samples (23 for the TaqMan assays. In addition, the LightCycler requires stools and 4 liver aspirates), and in addition detected amebas the reactions to be run in special glass capillaries, which are in four samples (3 stools and 1 liver aspirate) that had been expensive and fragile, requiring extra care to work with. On the negative in the initial PCR (Tables 5 and 6). One of the latter other hand, the LightCycler thermocycler has very fast ramp­ stool samples had been stored for some time before arriving at ing of the temperature, leading to shorter cycle times. Due to the CDC. The other two stools were from patients with sus­ the high cost of fluorescent probes, the probe-free SYBR pected amebiasis based on microscopic findings in previous Green assay was the least expensive. However, because it was samples. The liver aspirate came from a person with a history based on amplification of a large amplicon size, it required of travel to countries where E. histolytica infections are en­ long cycling times, making it more time-consuming than the demic. Although confirmed to contain E. histolytica by se­ other real-time assays. quencing, these four samples had very low parasite content, as

Specificity of evaluated real-time PCR tests. The abilities of judged by consistently high Ct values in the real-time PCR � the tests to accurately differentiate E. histolytica from E. dispar (Ct 34 or above, depending on sample and assay). This were determined using 29 stool and 9 liver aspirate specimens corresponds to around 10 trophozoites or less per ml, which submitted for confirmatory diagnosis at CDC. These samples can explain the negative results in the conventional PCR and had been previously tested for amebiasis by conventional PCR the SYBR Green assay. with primers PSP3/PSP5 and NPSP3/NPSP5 (i.e., the same The TaqMan targeting episomal repeats (TaqMan 2) and primers used in the SYBR Green assay). This had confirmed the LightCycler assay gave mixed results for three and five

TABLE 4. Performance characteristics of assays

Limit of detection Assay Linear range Slope (efficiency) Relative costa Timeb (h) (cells/ml [�SD]) Conventional PCR 119 (�890) NAc NA � 7 SYBR Green 17 (�57) 105–101 �4.2 (72%) �� 7 LightCycler 4 (�14) 106–102 �3.5 (90%) ���� 4 TaqMan 1 1 (�4) 106–10�1 �3.3 (100%) ��� 4 TaqMan 2 0.5 (�1.2) 106–10�1 �3.5 (91%) ��� 4

a Cost for equipment not included. The LightCycler assay requires a LightCycler thermocycler. The other real-time assays can be performed on less expensive real-time thermocyclers. b Estimated time from reception of specimen to final result (2 h for DNA extraction is included). c NA, not applicable. VOL. 43, 2005 REAL-TIME PCR FOR DIFFERENTIAL DIAGNOSIS OF AMEBIASIS 5495

for significant morbidity and mortality, mainly in developing countries. Accurate differentiation of the invasive E. histolytica from the morphologically identical commensal E. dispar is cru­ cial to clinical management of patients and to epidemiologic investigation of outbreaks of amebiasis. Molecularly based dif­ ferentiation of these two amebas has proven to be adequate for this purpose, and the use of real-time PCR should enhance it even further as a diagnostic application, as it allows fast and sensitive detection of E. histolytica in clinical specimens. This study provides a comparison of all real-time PCR procedures for laboratory diagnosis of amebiasis published through 2004 (4, 25, 27, 28). In addition, we evaluated a SYBR Green assay adapted from a conventional PCR technique published previ­ ously (5). Compared to conventional PCR, real-time PCR has several advantages: not requiring postamplification analysis, which minimizes the risks for laboratory contamination (7); ability to FIG. 2. Detection limits and linearity of the real-time PCR assay. differentiate between E. histolytica and E. dispar infections in a Shown are average Ct values by the four real-time PCR assays evalu­ duplex profile (27, 28); and numerical results, which are easier ated in this study, obtained with DNA extracted from stools containing 6 �1 to interpret than the visual examination of a stained gel from 10 to 10 E. histolytica trophozoites per ml. The average Ct values for each concentration range were calculated and plotted against the tro­ a conventional PCR. Nevertheless, real-time PCR is a costly phozoite concentration. The linear parts of the resulting curves were procedure compared with morphological stool exams and an- determined using regression analysis and are displayed as lines. tigen-based detection tests. Thus, poor regions of the world, where E. histolytica is most prevalent, will unfortunately be less likely to benefit from real-time PCR. Instead, this technique stool samples, respectively, that contained only E. dispar as will be feasible primarily in clinical laboratories in developed judged by the other methods (Table 5). In addition, the Light- countries that need to diagnose amebiasis in travelers and Cycler assay had problems with the standard DNA samples immigrants from regions of the world where E. histolytica is from cultured E. histolytica, which occasionally were detected endemic. as positive for E. dispar as well (data not shown). Attempts to An important aspect of real-time PCR is its enhanced sen­ reduce this problem by altering the PCR conditions were sitivity compared to conventional PCR. As expected, all real- mostly unsuccessful, although a slight improvement in the time PCR assays in this study were more sensitive than the LightCycler assay was seen when the concentration of oligo­ conventional PCR, a result that is in agreement with a recent nucleotides was decreased compared to the published protocol study comparing a novel real-time PCR assay with conven­ (data not shown). The sequencing analysis verified the re­ tional PCR for amebiasis (22). sults obtained with the 18S rRNA-targeting TaqMan assay The probe-based real-time PCR assays evaluated in this (TaqMan 1) and did not support the mixed results produced by study were able to identify E. histolytica in four clinical samples TaqMan 2 or the LightCycler assay. with very low parasite concentrations, which the conventional PCR could not detect. The most sensitive real-time PCR assay tested was TaqMan 2, i.e., the one designed to amplify episo­ DISCUSSION mal-repeat regions (28). The calculated detection limit for this E. histolytica is the agent of human intestinal and extra- assay was 0.5 cells per ml of spiked stool, which would mean intestinal amebiasis, a parasitic infectious disease responsible that samples containing only 0.1 cell (DNA was extracted from

TABLE 5. Conventional and real-time PCR results for stool specimens submitted to CDC for confirmatory diagnosis

No. of stool specimens identified as:

Methodology E. histolytica E. dispar Mixed Total Negative E. histolytica Mixed Negative E. dispar Mixed Negative Mixed E. dispar Sequencinga 9 00 1 60 0 1 0 16 c 42 Conventional PCRb 6 03 1 60 0 1 0 3 29 SYBR Green 4 0 5 12 0 4 0 1 16c 42 LightCycler 8 1 0 11 5 0 1 0 16c 42 TaqMan 1 9 0 0 16 0 0 0 1 16c 42 TaqMan 2 9 0 0 13 3 0 1 0 16c 42

a DNA sequencing analysis was performed only to assure the results and not for comparison purposes. b Results from confirmatory diagnosis, performed directly upon reception of the specimen at CDC. c 13 of these were clinical specimens containing other parasites than E. histolytica or E. dispar; see “Clinical specimens” for details. They were included in this study as negative controls for the real-time PCR assays. Conventional PCR for ameba detection was not performed on these samples, as they were not from suspected amebiasis cases. 5496 QVARNSTROM ET AL. J. CLIN.MICROBIOL.

TABLE 6. Conventional and real-time PCR results for specimens mixed sample as containing E. dispar only. The explanation for from suspected extraintestinal amebiasis (liver abscesses) this is associated with the duplex assay profile of the latter No. of liver aspirates specimens TaqMan assay, which used the same primers for simultaneous identified as: amplification of both species. The overabundance of one spe­ Methodology Total E. histolytica cies can mask the ability to detect a second species when the Negative same amplification primers are shared. When presented with E. histolytica Negative these circumstances, such duplex (or multiplex) assays that Sequencinga 5 0 4c 9 distinguish between targets only by different probes are not b Conventional PCR 4 1 4 9 suitable for simultaneous detection of more than one micro­ SYBR Green 3 2 4 9 LightCycler 5 0 4 9 organism. TaqMan 1 5 0 4 9 Two of the assays could not reliably distinguish E. histolytica TaqMan 2 5 0 4 9 from E. dispar: the LightCycler assay and the TaqMan assay

a DNA sequencing analysis was performed only to assure the results and not targeting episomal repeats (TaqMan 2). The LightCycler assay for comparison purposes. occasionally reported false-positive results for both E. dispar­ b Results from confirmatory diagnosis, performed directly upon reception of and E. histolytica-containing samples, including pure E. histo­ the specimen at CDC. c Negative liver aspirates were positive for bacterial liver abscess by culture lytica cultures. Furthermore, the false-positive results were not methods. consistent but varied from run to run. This behavior clearly illustrates a lack of specificity of the primers. Thus, in our hands, the LightCycler assay was not considered specific 0.2 ml stool) were detectable. One explanation for this very low enough to serve as a diagnostic tool for the main purpose of figure is the fact that the DNA target for this assay is located distinguishing E. histolytica from E. dispar. The TaqMan 2 on extrachromosomal, multicopy plasmids (3). Each disrupted assay produced false results with a few samples containing E. cell would therefore release several hundred copies of the dispar. Two other publications have reported peculiar results DNA target, resulting in the presence of amplifiable DNA concerning detection of E. dispar in conventional PCRs target­ even in samples that should contain no cells according to cell ing these episomal-repeat sequences. Verweij and coworkers count calculations. This fact applies to the other assays in this (26) were unable to detect one sample that was positive for E. work as well, since they all target the same multicopy plasmids. dispar in two other PCR assays, concluding that the episomal- Thus, even though the actual values of the detection limits in repeat region seemed to be absent in that particular E. dispar Table 4 may be slightly overestimated, they can still be used for sample. A recent study (11) detected both E. dispar and E. comparison between the assays. Among the original descrip­ histolytica in a liver pus sample, which must be a false result for tions of the real-time PCR assays, the detection limit was E. dispar, since the species is not invasive. Thus, an explanation addressed only for the LightCycler assay (4). The authors used for the nonspecific results obtained with TaqMan 2 in this the same approach with spiked stools as in this work and stated study may be that these target sequences are not as species that one single trophozoite per sample could be detected. specific as previously reported. Supporting this explanation is Based on the results with our quantification samples, we have the presence of a sequence from an E. dispar strain in Gen- no reason to believe that the LightCycler assay would be less Bank that is highly similar to the assumed E. histolytica-specific sensitive in our hands. Thus, it seems reasonable to assume episomal repeat (accession number AJ306927). This calls for a that the LightCycler and the two TaqMan assays were able to reevaluation of the episomal repeats as targets for differential detect one trophozoite per extracted stool sample, which in molecular diagnosis of amebiasis. this work corresponds to five trophozoites per ml of stool. In conclusion, this work identified the TaqMan targeting the The differences in sensitivity among the assays can be par­ 18S rRNA gene as a superior real-time PCR assay for specific tially explained by amplicon size and amplification efficiency. and quantitative diagnosis of amebiasis. The SYBR Green The recommended amplicon size for real-time PCR assays is approach offered a good alternative to the TaqMan assay and less than 200 base pairs, so only TaqMan 2 is well designed by may be especially attractive for those who already have the this criterion (28). However, sensitivity is also influenced by conventional PCR assay running and want to convert to the amplification efficiency, which in turn is related to the quality real-time format. of the primers (no mismatches, secondary structures, or prim­ er-dimer formation). The primer pair designed for TaqMan 1 ACKNOWLEDGMENTS (25) resulted in an amplification efficiency of 100%, thus con­ We are indebted to Barth Reller and Megan Reller for providing tributing to high sensitivity despite a larger amplicon size. The two of the liver aspirates used in the assay evaluations and to student comparatively very large amplicon size of the SYBR Green Jeremy Long for performing some of the SYBR Green experiments. assay explains the lower amplification efficiency and sensitivity We also thank Stephanie Johnston for providing invaluable informa­ of the assay. tion about the clinical specimens, Iaci Moura for exquisite technical assistance, and Dennis Juranek and Norman J. Pieniazek for the thor­ The clinical sample containing both E. histolytica and E. ough revision of the manuscript. dispar produced different results in the different assays. The The use of trade names is for identification only and does not imply sample was positive only for E. dispar in the SYBR Green endorsement by the Public Health Service or by the U.S. Department assay, probably because the content of E. histolytica was below of Health and Human Services. the detection limit of the assay. The LightCycler assay and REFERENCES TaqMan 2 were more sensitive and thus detected both species. 1. Acuna-Soto, R., J. Samuelson, P. De Girolami, L. Zarate, F. Millan-Velasco, However, TaqMan 1 was also very sensitive but reported the G. Schoolnick, and D. Wirth. 1993. Application of the polymerase chain VOL. 43, 2005 REAL-TIME PCR FOR DIFFERENTIAL DIAGNOSIS OF AMEBIASIS 5497

reaction to the epidemiology of pathogenic and nonpathogenic Entamoeba 18. Novati, S., M. Sironi, S. Granata, A. Bruno, S. Gatti, M. Scaglia, and C. histolytica. Am. J. Trop. Med. Hyg. 48:58–70. Bandi. 1996. Direct sequencing of the PCR amplified SSU rRNA gene of 2. Bell, A. S., and L. C. Ranford-Cartwright. 2002. Real-time quantitative PCR Entamoeba dispar and the design of primers for rapid differentiation from in parasitology. Trends Parasitol. 18:337–342. Entamoeba histolytica. Parasitology 112:363–369. 3. Bhattacharyaa, S., I. Soma, and A. Bhattacharyab. 1998. The Ribosomal 19. Nunez, Y. O., M. A. Fernandez, D. Torres-Nunez, J. A. Silva, I. Montano, DNA plasmids of entamoeba. Parasitol. Today 14:181–185. J. L. Maestre, and L. Fonte. 2001. Multiplex polymerase chain reaction 4. Blessmann, J., H. Buss, P. A. Nu, B. T. Dinh, Q. T. Ngo, A. L. Van, M. D. amplification and differentiation of Entamoeba histolytica and Entamoeba Alla, T. F. Jackson, J. I. Ravdin, and E. Tannich. 2002. Real-time PCR for dispar DNA from stool samples. Am. J. Trop. Med. Hyg. 64:293–297. detection and differentiation of Entamoeba histolytica and Entamoeba dispar 20. Pinheiro, S. M., R. M. Carneiro, I. S. Aca, J. I. Irmao, M. A. Morais, Jr., in fecal samples. J. Clin. Microbiol. 40:4413–4417. M. R. Coimbra, and L. B. Carvalho, Jr. 2004. Determination of the preva­ 5. Clark, C. G., and L. S. Diamond. 1992. Differentiation of pathogenic Enta­ lence of Entamoeba histolytica and E. dispar in the pernambuco state of moeba histolytica from other intestinal protozoa by riboprinting. Arch. Med. northeastern Brazil by a polymerase chain reaction. Am. J. Trop. Med. Hyg. Res. 23:15–16. 70:221–224. 6. da Silva, A. J., F. J. Bornay-Llinares, I. N. Moura, S. B. Slemenda, J. L. 21. Romero, J. L., S. Descoteaux, S. Reed, E. Orozco, J. Santos, and J. Samuel- Tuttle, and N. J. Pieniazek. 1999. Fast and reliable extraction of protozoan son. 1992. Use of polymerase chain reaction and nonradioactive DNA parasite DNA from fecal specimens. Mol. Diagn. 4:57–64. probes to diagnose Entamoeba histolytica in clinical samples. Arch. Med. 7. da Silva, A. J., and N. J. Pieniazek. 2003. Latest advances and trends in Res. 23:277–279. PCR-based diagnostic methods, p. 397–412. In D. Dionisio (ed.), Textbook- 22. Roy, S., M. Kabir, D. Mondal, I. K. Ali, W. A. Petri, Jr., and R. Haque. 2005. atlas of intestinal infections in AIDS. Springer-Verlag Italia, Milan, Italy. Real-time-PCR assay for diagnosis of Entamoeba histolytica infection. 8. Diamond, L. S., and C. G. Clark. 1993. A redescription of Entamoeba J. Clin. Microbiol. 43:2168–2172. histolytica Schaudinn, 1903 (Emended Walker, 1911) separating it from En­ 23. Sharma, A. K., S. Chibbar, G. Bansal, U. Kaur, and H. Vohra. 2003. Eval­ tamoeba dispar Brumpt, 1925. J. Eukaryot. Microbiol. 40:340–344. uation of newer diagnostic methods for the detection and differentiation of 9. Diamond, L. S., D. R. Harlow, and C. C. Cunnick. 1978. A new medium for Entamoeba histolytica in an endemic area. Trans. R. Soc. Trop. Med. Hyg. the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. 97:396–397. R. Soc. Trop. Med. Hyg. 72:431–432. 24. Tanyuksel, M., and W. A. Petri, Jr. 2003. Laboratory diagnosis of amebiasis. 10. Evangelopoulos, A., G. Spanakos, E. Patsoula, N. Vakalis, and N. Legakis. Clin. Microbiol. Rev. 16:713–729. 2000. A nested, multiplex, PCR assay for the simultaneous detection and 25. Verweij, J. J., R. A. Blange, K. Templeton, J. Schinkel, E. A. Brienen, M. A. differentiation of Entamoeba histolytica and Entamoeba dispar in faeces. van Rooyen, L. van Lieshout, and A. M. Polderman. 2004. Simultaneous Ann. Trop. Med. Parasitol. 94:233–240. detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium 11. Furrows, S. J., A. H. Moody, and P. L. Chiodini. 2004. Comparison of PCR parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. and antigen detection methods for diagnosis of Entamoeba histolytica infec­ 42:1220–1223. tion. J. Clin. Pathol. 57:1264–1266. 26. Verweij, J. J., J. Blotkamp, E. A. Brienen, A. Aguirre, and A. M. Polderman. 12. Garfinkel, L. I., M. Giladi, M. Huber, C. Gitler, D. Mirelman, M. Revel, and 2000. Differentiation of Entamoeba histolytica and Entamoeba dispar cysts S. Rozenblatt. 1989. DNA probes specific for Entamoeba histolytica possess­ using polymerase chain reaction on DNA isolated from faeces with spin ing pathogenic and nonpathogenic zymodemes. Infect. Immun. 57:926–931. columns. Eur. J. Clin. Microbiol. Infect. Dis. 19:358–361. 13. Haque, R., I. K. Ali, S. Akther, and W. A. Petri, Jr. 1998. Comparison of 27. Verweij, J. J., F. Oostvogel, E. A. Brienen, A. Nang-Beifubah, J. Ziem, and PCR, isoenzyme analysis, and antigen detection for diagnosis of Entamoeba A. M. Polderman. 2003. Prevalence of Entamoeba histolytica and Entamoeba histolytica infection. J. Clin. Microbiol. 36:449–452. dispar in northern Ghana. Trop. Med. Int. Health 8:1153–1156. 14. Haque, R., N. U. Mollah, I. K. Ali, K. Alam, A. Eubanks, D. Lyerly, and W. A. 28. Verweij, J. J., J. Vermeer, E. A. Brienen, C. Blotkamp, D. Laeijendecker, L. Petri, Jr. 2000. Diagnosis of amebic liver abscess and intestinal infection with van Lieshout, and A. M. Polderman. 2003. Entamoeba histolytica infections the TechLab Entamoeba histolytica II antigen detection and antibody tests. in captive primates. Parasitol. Res. 90:100–103. J. Clin. Microbiol. 38:3235–3239. 29. Walsh, J. A. 1986. Problems in recognition and diagnosis of amebiasis: 15. Katzwinkel-Wladarsch, S., T. Loscher, and H. Rinder. 1994. Direct ampli­ estimation of the global magnitude of morbidity and mortality. Rev. Infect. fication and differentiation of pathogenic and nonpathogenic Entamoeba Dis. 8:228–238. histolytica DNA from stool specimens. Am. J. Trop. Med. Hyg. 51:115–118. 30. World Health Organization. 1997. Amoebiasis. Wkly. Epidemiol. Rec. 72: 16. Kebede, A., J. Verweij, W. Dorigo-Zetsma, E. Sanders, T. Messele, L. van 97–99. Lieshout, B. Petros, and T. Polderman. 2003. Overdiagnosis of amoebiasis in 31. Yap, E. P. H., Y.-M. O. Lo, K. A. Flemming, and J. O. D. McGee. 1994. the absence of Entamoeba histolytica among patients presenting with diar­ False-positives and contamination in PCR, p. 249–258. In H. G. Griffin and rhoea in Wonji and Akaki, Ethiopia. Trans. R. Soc. Trop. Med. Hyg. 97: A. M. Griffin (ed.), PCR technology. Current innovations. CRC Press, Boca 305–307. Raton, Fla. 17. Mirelman, D., Y. Nuchamowitz, and T. Stolarsky. 1997. Comparison of use 32. Zengzhu, G., R. Bracha, Y. Nuchamowitz, I. W. Cheng, and D. Mirelman. of enzyme-linked immunosorbent assay-based kits and PCR amplification of 1999. Analysis by enzyme-linked immunosorbent assay and PCR of human rRNA genes for simultaneous detection of Entamoeba histolytica and E. liver abscess aspirates from patients in China for Entamoeba histolytica. dispar. J. Clin. Microbiol. 35:2405–2407. J. Clin. Microbiol. 37:3034–3036.