Effects of Xie-Zhuo-Chu-Bi-Fang on Mir-34A and URAT1 and Their

Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

1 Contents lists available at ScienceDirect 2 3 4 Journal of Ethnopharmacology 5 6 journal homepage: www.elsevier.com/locate/jep 7 8 9 Research Paper 10 11 12 Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their 13 relationship in hyperuricemic mice 14 15 Wei-Feng Sun a,n,1, Ming-Min Zhu b, Jing Li a,b, Xian-Xian Zhang a, Ying-Wan Liu a, 16 a,nn,1 a Q1 17 Xin-Rong Wu , Zhi-Gang Liu 18 a Department of Traditional Chinese Medicine, General Hospital of Guangzhou Military Command of PLA, Guangzhou 510010, China 19 b Guangzhou University of Chinese Medicine, Guangzhou 510006, China 20 21 22 article info abstract 23 24 Article history: Ethnopharmacological relevance: Xie-Zhuo-Chu-Bi-Fang (XZCBF) is an empirical formula that was 25 Received 13 October 2013 developed based on the principles of traditional Chinese medicine, for the therapeutic purpose of Received in revised form 26 treating hyperuricemia. XZCBF has been clinically utilized in the Department of Traditional Chinese 14 November 2014 Medicine at General Hospital of Guangzhou Military Command of PLA for many years and has exhibited 27 Accepted 1 December 2014 favorable efficacy. The aim of the study is to evaluate the effects of XZCBF on the expression of uric acid Q3 28 transporter 1 (URAT1) and miR-34a in hyperuricemic mice and to determine, the correlation between the 29 Chemical compounds studied in this article: two expression levels. 30 Astilbin (Pubchem CID: 119258) Materials and methods: A hyperuricemic animal model was created by administering adenine and Colchicine (Pubchem CID: 6167) 31 allantoxanic acid potassium salt to mice. The blood uric acid levels were measured in these model mice Ecdysterone (Pubchem CID: 5459840) 32 after treatment with XZCBF for 15 days. The potential targets of miR-34a were screened. The expression 33 Keywords: levels of miR-34a and URAT1 in the renal tissues collected from the model mice were determined by 34 Hyperuricemia quantitative real-time polymerase chain reaction (qRT-PCR) analysis, and their correlation was further 35 Kidney established by immunohistochemistry and in situ hybridization. miR-34a 36 Results: The uric acid levels in the model mice were significantly higher than those in the blank controls URAT1 o fi 37 (P 0.05). These levels were signi cantly lower in the three groups receiving different doses of XZCBF (Po0.05), which was, in agreement with the downregulation of URAT1 and the upregulation of miR-34a 38 in each group. The mRNA expression level of URAT1 was positively correlated with the concentration of 39 uric acid but, negatively correlated with the expression level of miR-34a. 40 Conclusions: The ability of XZCBF to facilitate the excretion of uric acid and to lower its level in the model 41 group was mediated by the upregulation of miR-34a and the inhibition of URAT1 mRNA expression, 42 which suggests that XZCBF could be an option for the treatment of hyperuricemia in mice. 43 & 2014 Published by Elsevier Ireland Ltd. 44 45 67 46 68 fi 47 1. Introduction with conditions such as renal insuf ciency, cardiovascular disease 69 48 and hyperlipidemia. 70 49 Epidemiological surveys from various countries have shown Hyperuricemia is characterized by a state of over-saturation of 71 fi 50 that the prevalence of hyperuricemia and gout has risen signi - extracellular urate, which is caused by a malfunction in purine 72 51 cantly, while the age of incidence has decreased (Roddy et al., metabolism or a decrease in uric acid production. Uric acid is a 73 52 2007; Wu et al., 2008). The asymptomatic period of hyperuricemia product of purine metabolism, and a large majority is excreted in 74 fi 53 is relatively long; however, deposits of uric acid salt cause injury to the urine through four steps, described as ultra ltration, reabsorp- 75 54 tissues and internal organs, which have been closely associated tion, secretion, and post-secretion reabsorption. Ninety-eight 76 fi 55 percent of glomerular- ltered uric acid is reabsorbed by the renal 77 56 tubules, a process that depends on human urate acid transporter 1 78 57 (hURAT1, SLC22A12). hURAT1 is a transporter protein that has 79 n 58 Correspondence to: Department of Traditional Chinese Medicine, General been shown to be closely related to the reabsorption of uric acid. 80 59 Hospital of Guangzhou Military Command of PLA, No.111 Liuhua Road, Yuexiu This transporter is selectively localized on the luminal surface of 81 District, Guangzhou (510010), China. Tel.: þ86 20 36653520. the epithelial lining along the proximal renal tubules (Wang, 60 nn Corresponding author. Tel.: þ86 20 88653476. 82 2004), where it maintains the electrical balance across the cell 61 E-mail addresses: [email protected] (W.-F. Sun), 83 62 [email protected] (X.-R. Wu). membrane by transporting uric acid in exchange for anions (Hong 84 1 63 Contributed equally to this work. et al., 2005). Nonsynonymous mutations in the coding region of Q2 85 64 http://dx.doi.org/10.1016/j.jep.2014.12.001 86 65 0378-8741/& 2014 Published by Elsevier Ireland Ltd. 87 66

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i 2 W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

1 SLC22A12 leading to loss of function were reportedly found in miR-146a) were closely associated with XZCBF. In addition, miR- 67 2 patients diagnosed with familial hypouricemia (Yan and Zhou, 34a was found to be capable of binding to the 30UTR of URAT1, 68 3 Q4 2007), and downregulation of URAT1 could result in elevated which is consistent with the inhibitory role of miR-34a that was 69 4 excretion of uric acid (Cheong et al., 2008). identified in a sensor reporter assay. In this study, we located the 70 5 The promoter of uric acid excretion, benzbromarone, is an binding site of miR-34a in URAT1 by predicting target sites and 71 6 effective inhibitor of URAT1, which facilitates the excretion of uric exploring the relationships between XZCBF, miR-34a, and URAT1 72 7 acid by directly inhibiting URAT1 on the top surface of the renal using biomedical approaches, including vector construction, 73 8 tubules. However, benzbromarone has adverse effects including immunohistochemistry, and in situ hybridization. 74 9 functional impairment of the liver, gastrointestinal reactions, and 75 10 rash. Traditional Chinese medicine (TCM) has definite curative 76 11 effects in the treatment of hyperuricemia without serious adverse 2. Materials and methods 77 12 effects, and an understanding of the underlying mechanism of 78 fi 13 TCM has important practical signi cance. 2.1. Reagents 79 14 Xie-Zhuo-Chu-Bi-Fang (XZCBF) is an empirical formula that was 80 15 developedbasedontheprinciplesofTCMandisusedtotreat The following reagents were acquired: 97% allantoxanic acid 81 16 hyperuricemia. This formula has obtained a national invention patent potassium salt (Sigma-Aldrich, Shanghai), adenine (Sigma-Aldrich, 82 17 (Patent no.: ZL 2007 1 0032363.3). XZCBF consists of the following Shanghai), a uric acid assay kit (liquid, enzymatic method; Eastern 83 18 herbs: Smilax glabra Roxb., rhizome (tu fu ling, Smilacis Glabrae China Diagnostic [Shanghai] Co. Ltd), SYBR Green PCR Master Mix 84 19 Rhizoma), Heterosmilax japonica Kunth, rhizome (bi xie, Heterosmila- (TOYOBO Company, Japan), TRIzols Reagent (Invitrogen, USA), 85 20 cis Rhizoma), Cremastra appendiculata (D.Don) Makino, rhizome (shan anti-digoxigenin-AP (Roche, Switzerland), hsa-miR-34a (Exiqon, 86 21 ci gu, Cremastrae Pseudobulbus), Vaccaria hispanica (Mill.) Rauschert, USA); anti URAT1 (rabbit IgG; Abbiotec, USA), secondary antibody 87 22 seed (wang bu liu xing, Vaccariae Semen), and Achyranthes bidentata (DAKO ChemMate™, Denmark), and a detection kit (DAKO Envi- 88 23 Blume, root (niu xi, Achyranthis Bidentatae Radix). XZCBF has been sion™, Denmark). 89 24 applied clinically in the Department of TCM at General Hospital of 90 25 Guangzhou Military Command for many years, and its overall efficacy 91 26 rate was statistically estimated to reach approximately 90% (Sun et al., 2.2. Chemicals 92 27 2009). For more convenient use, we developed a granular form of 93 28 XZCBF: Compound Tufuling Granules (approved by Guangdong Food The herbs we used in this study were all commercially available 94 29 and Drug Administration, license no. Guang Zhi Zi 2011-F01009). as dry matter and were purchased from Nanhai Pengyang Phar- 95 30 According to the theory of Chinese Materia Medica (Chinese maceutical Co., Ltd. (Table 1). These herbs were identified by 96 31 Pharmacopoeia Commission, 2010), Smilax glabra Roxb., Hetero- Professor Xin-Rong Wu (Pharmacy Department of General Hospi- 97 32 smilax japonica Kunth, Vaccaria hispanica (Mill.) Rauschert and tal of Guangzhou Military Command, Guangzhou, China) and 98 33 Achyranthes bidentata Blume can induce diuresis to dispel “Damp- Director Hui-Chan Hou (Chinese Medicine Department of Guangz- 99 34 ness” and “Turbidity”; Smilax glabra Roxb. and Heterosmilax hou Institute for Drug Control, Guangzhou, China). Voucher speci- 100 35 japonica Kunth can smoothen joint movement to eliminate Impe- mens were deposited in the Herbarium of Guangzhou Institute for 101 36 diment; Cremastra appendiculata (D.Don) Makino, Vaccaria hispa- Drug Control. The dosages of the herbs in XZCBF are based on the 102 37 nica (Mill.) Rauschert, and Achyranthes bidentata Blume can theory of Chinese Materia Medica. 103 38 activate “Blood” and resolve “Stasis”; Achyranthes bidentata Blume These herbs were processed into Compound Tufuling Granules 104 39 can tonify the “Liver” and “Kidney”, and conduct “Blood” down- by the Pharmacy Department of General Hospital of Guangzhou 105 40 ward. All of these effects are beneficial in the treatment of Military Command (10 g per bag, batch no.110916). The formula- 106 41 hyperuricemia and gout in TCM. To support the traditional use of tion was extracted and purified by water extraction and an alcohol 107 42 XZCBF, many studies on the activities of these herbs have been sedimentation process (Liu et al., 2011a). The excipient of the Q5108 43 performed. Smilax glabra Roxb. and its main active compound granules was soluble starch (Xiangtan County Starch Products Co., 109 44 astilbin have anti-inflammatory, analgesic and diuretic effects Ltd., batch number: 20110116) and granule quality was assessed by 110 45 (Zhang et al., 2004). Heterosmilax japonica Kunth can eliminate thin layer chromatography (TLC) and high performance liquid 111 46 uric acid, and it has anti-inflammatory and analgesic effects (Fei et chromatography (HPLC) (Liu et al., 2011b). Using HPLC, the content 112 47 al., 2005, 2007). Colchicine, one of the active compounds in of ecdysterone (one main component of XZCBF) in the granules 113 48 Cremastra appendiculata (D.Don) Makino (Shi et al., 2012), is an was determined to be 0.22 mg/g. 114 49 anti-inflammatory agent. In addition, it can reduce the risk of Benzbromarone was acquired from Longdengrui Pharmaceuti- 115 50 myocardial infarction in gout patients (Crittenden et al., 2012). cal (Kunshan) Co. Ltd. (batch no. 110302). 116 51 Vaccaria hispanica (Mill.) Rauschert has vasodilatory effects (Jing et Distilled water was added at the necessary concentrations for 117 52 al., 2007). Achyranthes bidentata Blume has restorative effects on future use, and samples were shaken to ensure an equal distribu- 118 53 deficiencies of the immune system (Li and Li, 1997), has analgesic tion of the components prior to use. 119 54 and anti-inflammatory effects, and invigorates the circulation (Gao 120 55 et al., 2003). 121 56 Our previous study (Sun et al., 2011) demonstrated that XZCBF 122 Table 1 57 lowered uric acid levels in hyperuricemic mice that were adminis- Information regarding the herbs. 123 58 tered adenine and allantoxanic acid potassium salt. The upstream 124 59 microRNA regulatory mechanism was also examined. MicroRNAs Herbs Origin Specimen Dosage 125 60 are part of the long transcribed segments of RNA, and a mature (China) no. (g) 126

61 microRNA binds to an RNA-mediated silencing complex that is Smilax glabra Roxb., rhizome Guangxi 01-2-2-4 35 127 62 similar to (or the same as) the complex that is involved in RNA Heterosmilax japonica Kunth, rhizome Guangxi 15-1-2-1 18 128 63 interference, resulting in the downregulation of gene expression Cremastra appendiculata (D.Don) Makino, Guizhou 08-4-1-7 15 129 64 in vivo (Lewis et al., 2005; Wu et al., 2006). By screening microRNA rhizome 130 Vaccaria hispanica (Mill.) Rauschert, seed Anhui 20-2-1-8 10 65 spectrum, the expression levels of 32 genes were identiﬁed as 131 Achyranthes bidentata Blume, root Henan 16-1-2-1 10 66 being signiﬁcantly different, and 3 genes (miR-34a, miR-122, and 132

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 3

1 2.3. Equipment 10 min. The serum was separated, and the uric acid level was 67 2 determined by the uricase method (Trinder's method). 68 3 A Hitachi-H7170 automatic biochemical analyzer (Hitachi, Japan), a 69 4 quantitative PCR machine (ABI PRISMs 7500 Sequence Detection 70 5 System, USA), a light microscope (Type: CX41, Olympus, Japan), a 2.7. qRT-PCR analysis of URAT1 and miR-34a expression in kidney 71 6 camera system (Type: MC30, Mingmeike Sci&Tech [Guangzhou] Co. tissue 72 7 Ltd., China), and a freezing microtome (Leica, Germany) were used. 73 8 Bilateral kidneys were harvested from the mice and pulverized 74 9 2.4. miR-34a target -gene predictions and luciferase assay in liquid nitrogen, and total RNA was obtained with a Trizol one- 75 10 step RNA isolation kit. The expressions levels of URAT1 and miR- 76 11 The target genes of miR-34a were predicted by searching the 34a were analyzed following the protocols described below. 77 12 TargetScan database online, and they were confirmed using the The RT reaction of URAT1 was performed in an RNase-free PCR 78 μ 13 miRanda database. tube using the following protocol: DEPC water was added to 1.0 g 79 μ 1 14 To construct the vector for the luciferase assay, the concatemer of total RNA to achieve a volume of 12 L; incubation at 85 C for 80 μ μ 15 of the miR-34a target sequence in the 30UTR of URAT1 and its 5 min; addition of 0.5 L of Oligo(dT)(Promega), 0.5 L of random 81 μ μ 16 complimentary tandem sequence of “seeds” in miR-34a were primer (Promega), 2.0 L of 10 mM dNTP Mix, 0.5 L of RNase 82 μ μ 17 cloned downstream of the luciferase gene, which was driven by inhibitor, 4.0 Lof5 M-MLV RT Buffer, and 0.5 L of M-MLV; 83 μ 1 18 the CMV promoter (Wu et al., 2006). The construct, together with incubation of the 20 L reaction solution at 30 C for 10 min; 84 1 1 19 a miR-34a mimic or non-relevant loop, was transfected into newly incubation at 42 C for 60 min; and incubation at 85 C for 10 min. 85 20 generated myocardiocytes. The cells were collected after 24 h, and qRT-PCR of miR-34a was performed using the stem-loop method. 86 21 their luciferase activity was measured using an Lmax multiwell The reactions were performed in RNase-free PCR tubes as follows: 87 μ 22 luminometer. DEPC water was added to 1.0 goftotalRNAtoachieveavolumeof 88 23 12 μL, incubation at 85 1C for 5 min. Another solution was made in a 89 m 24 2.5. Animal model and administration of chemicals new RNase-free PCR tube with the following constituents: 2.0 Lof 90 25 10 mM dNTP (Promega), 0.5 mL of RNase inhibitor (Promega), 0.5 mLof 91 m 26 Sixty SPF Kunming male mice weighing 2872 g, provided by miR-34a reverse transcription primers, 0.5 L of U6 reverse transcrip- 92 m m 27 the Animal Center of General Hospital of Guangzhou Military tion primers, 4.0 Lof5 buffer, and 0.5 L of M-MLV (Promega). The 93 1 28 Command, were fed normally. All of the study reports were guided solutions in the two PCR tubes were mixed and incubated at 42 Cfor 94 1 29 by the Animal Center of General Hospital of Guangzhou Military 60 min; then, the mixture was incubated at 85 Cfor10minto 95 30 Command, and the animal performance protocol was approved by inactivate the reverse transcriptase. 96 31 the ethics committee of the institution. The sequences of the synthetic primers used in quantitative 97 32 Adenine was combined with allantoxanic acid potassium salt to PCR are shown in Table 2. The reaction system consisted of the 98 μ μ 33 create a model of hyperuricemia. The mice were randomized into following components: 5.0 L of cDNA (1:20), 0.5 L of forward 99 μ μ 34 6 groups: XZCBF high-, medium- and low-dose groups; the benz- primer, 0.5 L of reverse primer, 10 Lof2 SYBR Green PCR 100 μ 35 bromarone group; the model group; and the blank control group. Master Mix, 4.0 LofdH2O. 101 fi 36 Adenine (0.1 g/kg) and 97% allantoxanic acid potassium salt (0.1 g/kg) The URAT1 and miR-34a ampli cation conditions were as 102 1 37 were administered by gavage to each group (except for the blank follows: pre-denaturation at 95 C for 5 min followed by 40 cycles 103 1 1 38 control group) to create the hyperuricemic model; the blank control of denaturation at 95 C for 15 s, annealing at 60 C for 15 s, and 104 1 fi 1 39 group was administered an equal volume of normal saline by gavage extension at 72 C for 32 s, with a nal extension at 72 C for 105 1 40 once per day, and the treatment period was 21 days. 5 min. The reaction was incubated at 4 C for 10 min prior to plate 106 41 The therapeutic drugs were administered on the 7th day of reading. Melting curve analysis was performed at temperatures of 107 – 1 1 42 adenine and allantoxanic acid treatments. The corresponding 60 95 C, with measurements performed at 0.4 C. Each sample 108 43 drugs were administered to the XZCBF high-, medium- and low- was assessed 3 times. 109 44 dose groups, the benzbromarone group, and the model group. 110 45 Compound Tufuling (Rhizoma Smilacis Glabrae) granules at doses 111 2.8. Immunohistochemistry and in situ hybridization of renal tissues 46 of 6, 3, and 1.5 g/kg (equal to XZCBF doses of 37.5, 18.75, and 112 47 9.375 g/kg) were administered to the high-, medium- and low- 113 The expression of miR-34a was assessed using immunohisto- 48 dose groups, respectively. Because drug metabolism is not exactly 114 chemistry and in situ hybridization. 49 the same between human and mice, we utilized 3 different doses 115 For immunohistochemistry, incubation was performed at 4 1C 50 of XZCBF to evaluate its efficacy. The concentrations of the extracts 116 overnight, and secondary antibody incubation was performed at 51 administered were calculated based on body surface area. Adult 117 room temperature for 30 min, followed by developed with DAB, re- 52 patients take Compound Tufuling Granules at a dose of 20 g per 118 staining with hematoxylin, water washing, staining with blue dye, air 53 day, and the average weight of an adult is 60 kg. The body surface 119 54 area conversion coefficient from humans to mice is 9.03; thus the 120 Table 2 55 121 normal dose (medium dose) of Compound Tufuling Granules Fluorescence quantitative PCR primer sequences. 56 administered to mice was 20/60 9.03E3 g/kg. The high dose is 122 57 double the medium dose, and the low dose is half the medium Name Primer Sequences (50–30) 123 58 dose. The benzbromarone group received 20 mg/kg benzbromar- 124 URAT1-F1 50 GAGGGAGACACGTTGACCAT 59 one, and an equal volume of normal saline was administered to 0 125 URAT1-R1 5 TTGCTTCCTAGGGCTTGCA 60 the model and blank groups. Administration was performed once 18s rRNA-F 50 CCTGGATACCGCAGCTAGGA 126 61 per day by gavage, and the treatment period was 15 days. 18s rRNA-R 50 GCGGCGCAATACGAATGCCCC 127 62 mmu-miR-34a-F 50 ACACTCCAGCTGGGTGGCAGTGTCTTAGCTGGT 128 a 0 63 2.6. Blood uric acid analysis miRNA-R 5 CTCAACTGGTGTCGTGGA 129 U6-F 50 CTCGCTTCGGCAGCACA 64 0 130 U6-R 5 AACGCTTCACGAATTTGCGT 65 Blood was drawn from the eyes of mice on the 22nd day of the 131 66 experiment and was centrifuged in dry tubes at 3000 rpm for a miRNA-R denoting microRNA downstream primers. 132

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i 4 W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

1 drying, and film sealing. The working concentration of the primary miR-34a binding site located in the 271–277 bp region of 67 2 antibody was 1:2000. URAT1, 30UTR was found, with the no.2–4 nucleotide “seeds 68 3 For in situ hybridization, incubation was performed with proteinase sequence” precisely matching the target gene sequences, which 69 4 K(40μg/mL)atroomtemperaturefor20min,followedbyincubation indicated that miR-34a could inhibit the expression of URAT1. The 70 5 in the pretreatment buffer for 10 min, preliminary hybridization at result was checked and confirmed with those of another online 71 6 60 1C for 2 h, miRNA probe incubation at 90 1C for 5 min, hybridization tool, miRanda. We cloned mouse URAT1, 30UTR into the multiple 72 7 at 60 1C overnight, sealing at room temperature for 1 h, incubation restrictive sites of the report vector psi-CHECK2 to construct 73 8 with anti-digoxin antibody at 4 1C overnight, and staining with BCIP/ recombinant vector psi-URAT1-miR34a-BS. We then cotransfected 74 9 NBT in the dark for 4–48 h. The reaction was terminated with buffer at it, together with miR-34a mimics, into HEK293 (human embryonic 75 10 pH 8.0. Re-staining was performed with Nuclear Fast Red, and the film kidney 293 cell line, a commonly used cell line in exogenous gene 76 11 was sealed with neutral balsam. The final working concentration was research) (Nadeau and Kamen, 2003). By assessing the expression 77 12 20 nM, and the hybridization temperature was 60 1C. level of the reporter gene, miR-34a was found to significantly 78 13 The digital images of URAT1 and miR-34a were analyzed using an inhibit the expression of luciferase in the psi-URAT1-miR34a-BS 79 14 IPP image analysis software. First, the gray unit was switched to the construct, strongly implying that miR-34a could inhibit the 80 15 optical density unit in the program software, and the optical density expression level of URAT1. 81 16 analysis was performed with the yellow (stained URAT1) and purple 82 17 (miR-34a -labeled) immunohistochemical stained regions as the areas 3.2. MiR-34a targets SLC22A12 83 18 of interest (AOIs). The density (mean) and integrated optical density 84 19 (IOD) of the selected areas were measured. The predicted target site of miR-34a in SLC22A12-30UTR was 85 20 consistent with the effects of miR-34a on the luciferase activity of 86 0 21 2.9. Statistical analysis a luciferase- SLC22A12-3 UTR reporter construct in the 293T cell 87 22 lines (a cell line derived from HEK293 cells that contains the T 88 23 The quantitative data are expressed as the mean7standard devia- antigen, resulting in higher expression of transfected genes). 89 0 24 tion (x7SD). The values were converted to square roots when the Mutations in SLC22A12-3 UTR disrupted the potential miR-34a 90 25 original standard error was large; multiple means were compared binding site, suppressing the inhibitory activity of miR-34a. 91 26 using one-way analysis of variance (ANOVA); the least-significant Luciferase reporter constructs with mutations at the predicted 92 0 27 difference (LSD) method was applied when the variance was equal; miR-34a binding site within the SLC22A12-3 UTR, were generated. 93 0 28 and Dunnett's T3 test was performed when applied when the variance The wild-type SLC22A12-3 UTR construct and its mutant counter- 94 29 was not equal. Pearson's correlation method was used for the correla- part were transfected together with the negative control (NC) into 95 30 tion analysis. All of the statistical analyses were performed with SPSS 293T cells and the luciferase activity was examined 24 h after 96 nn 31 software 16.0 for Windows, with a significance level of α¼0.0500. transfection ( Po0.01) (Fig. 1A and B). 97 32 98 33 99 34 3. Results 3.3. Analysis of uric acid in urine 100 35 101 36 3.1. Targeted inhibition of URAT1 expression by miR-34a The blood uric acid level was 203.85743.34 μmol/L by the end 102 37 of the study period, which was significantly different from that of 103 38 The target genes of miR-34a were predicted using popular the blank control (77.88724.92 μmol/L; Po0.05). Oral adminis- 104 39 online microRNA target predicting tool: the TargetScan database. A tration of XZCBF lowered the concentration of uric acid to 105 40 110.6379.30, 125.34712.23, and 163.14729.56 μmol/L in the 106 41 high-, medium- and low- dose XZCBF treatment groups, respec- 107 42 tively, showing a dose-dependent pattern and a statistically 108 43 significant difference from the concentrations in the model group 109 44 (Po0.05). No differences were identified in either the high- or 110 45 medium- dose XZCBF treatment group or the benzbromarone 111 46 treatment group regarding the level of uric acid (Po0.05); how- 112 47 ever, a significant difference was found between the low- dose 113 48 XZCBF treatment group and the benzbromarone treatment group 114 49 (Po0.05). 115 50 116 51 117 52 3.4. qRT-PCR analysis of URAT1 and miR-34a in kidney tissue 118 53 119 54 The relative sample template quantities (2△△Ct)ofURAT1were 120 55 calculated and compared between the groups. The original standard 121 56 error of URAT1 2△△Ct was too large, thus, the values were converted 122 57 to square roots. Based on ANOVA, the URAT1 expression level 123 58 (2.8971.13) in the blank control group was significantly lower than 124 59 that in the other groups (Po0.05), with the exception of the 125 60 benzbromarone group. The URAT1 expression levels in the high-, 126 61 medium- and low- dose XZCBF treatment groups and the benzbro- 127 62 Fig. 1. Regulation of SLC22A12 by miR-34a. (A) A miR34a binding site was found in marone treatment group were 5.1772.17, 7.9172.40, 8.6772.71, and 128 0 63 SLC22A12- 3 UTR using the microRNA target gene prediction tool TargetScan. 4.5870.56, respectively, all of which were lower than that in the 129 (B) Negative control (NC) and miR-34a mimics, a firefly luciferase vector containing 64 0 model group (16.8273.05, Po0.05). The expression of URAT1 130 the wild type SLC22A12-3 UTR (WT), and a firefly luciferase vector containing the 65 mutant SLC22A12-30UTR were co-transfected into 293T cells, and the luciferase showed a dose-dependent pattern in the three XZCBF treatment 131 66 activity was assessed. nnPo0.01. groups, and no difference was noted between either the high- dose 132

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 5

1 Table 3 XZCBF treatment group or the benzbromarone treatment group and 67 The expression quantities of URAT1 and miR-34a in mouse kidney tissues. 2 the blank control group regarding the mRNA expression level of 68 3 Groups N URAT1 2△△Ct (SQRT) miR-34a 2△△Ct URAT1 (Table 3). 69 4 The relative sample template quantities (2△△Ct) of miR-34a 70 n n 5 XZCBF high dose 10 5.1772.17 △ 6.4672.19 △ were calculated and compared between the groups. According to 71 XZCBF medium dose 10 7.9172.40n△ 6.4071.28n△ 6 7 n 7 n△ the results of ANOVA, the level of miR-34a expression in the blank 72 XZCBF low dose 10 8.67 2.71 5.60 0.93 7 fi 7 Benzbromarone 10 4.5870.56n 6.6671.45n control group (10.32 4.73) was signi cantly higher than that in 73 8 model 10 16.8273.05 1.6170.46 the other 5 groups (Po0.05). The levels of miR-34a expression in 74 9 Blank control 10 2.8971.13n 10.3274.73n the high-, medium- and low- dose XZCBF treatment groups and 75 10 the benzbromarone treatment group were 6.4672.19, 6.4071.28, 76 △Ct¼target gene Ct-internal control Ct; △△Ct¼target gene in the tested sample 11 5.6070.93, and 6.6671.45, respectively, all of which were higher 77 △Ct-target gene in the control sample △Ct (choose the sample with the highest △Ct 7 o 12 if no control was included); when the amplification efficiency of PCR reached 100%; than that in the model group (1.61 0.46; P 0.05). The expres- 78 13 the relative sample template quantity¼2△△Ct. sion of miR-34a exhibited a dose-dependent pattern in the three 79 14 n Po0.05 compared with Model; △P40.05 compared with benzbromarone. XZCBF treatment groups, and no difference in the expression level 80 15 81 16 82 17 83 18 84 19 85 20 86 21 87 22 88 23 89 24 90 25 91 26 92 27 93 28 94 29 95 30 96 31 97 32 98 33 99 34 100 35 101 36 102 37 103 38 104 39 105 40 106 41 107 42 108 43 109 44 110 45 111 46 112 47 113 48 114 49 115 50 116 51 117 52 118 53 119 54 120 55 121 56 122 57 123 58 124 59 125 60 126 61 127 62 128 63 129 64 130 65 Fig. 2. The mRNA Expression of URAT1 in renal tissues by immunohistochemistry and in situ hybridization. (A) Immunohistochemistry and in situ hybridization results. 131 66 (B) Analysis of digital images of URAT1 results by IOD. nPo0.05, compared with model. nnPo0.05, compared with blank control. 132

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i 6 W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

1 of miR-34a was noted between the three XZCBF treatment groups found that the expression level of URAT1 was negatively correlated 67 2 and the benzbromarone treatment group (Table 3). with that of miR-34a. 68 3 69 4 70 5 3.5. Correlation analysis 3.6. Immunohistochemical staining, in situ hybridization and 71 6 correlation analysis 72 7 We performed Pearson's correlation analysis between the uric acid 73 8 levels and the expression levels of URAT1 in the experimental mice The analysis of digital images of URAT1 immunohistochemistry 74 9 (r¼0.766, P¼0.000, Po0.05). The uric acid level was positively results, by IOD, revealed that the intergroup difference in URAT1 75 10 correlated with the expression levels of URAT1 mRNA. Additionally, expression levels was signiﬁcant (Po0.05). The levels of URAT1 76 11 we performed Pearson's correlation analysis between the expression expression in the high-, medium-, and low- dose XZCBF treatment 77 12 levels of URAT1 and miR-34a (r¼0.582, P¼0.000, Po0.05), and we groupswerelowerthanthatinthemodelgroup(Fig. 2A and B), while 78 13 79 14 80 15 81 16 82 17 83 18 84 19 85 20 86 21 87 22 88 23 89 24 90 25 91 26 92 27 93 28 94 29 95 30 96 31 97 32 98 33 99 34 100 35 101 36 102 37 103 38 104 39 105 40 106 41 107 42 108 43 109 44 110 45 111 46 112 47 113 48 114 49 115 50 116 51 117 52 118 53 119 54 120 55 121 56 122 57 123 58 124 59 125 60 126 61 127 62 128 63 129 64 130 65 Fig. 3. The Has-mir-34a expression in renal tissues by immunohistochemistry and in situ hybridization. (A) Immunohistochemistry and in situ hybridization results. 131 66 (B) Analysis of digital images of Has-mir-34a results by IOD. *Po0.05, compared with model. **Po0.05, compared with blank control. 132

Please cite this article as: Sun, W.-F., et al., Effects of Xie-Zhuo-Chu-Bi-Fang on miR-34a and URAT1 and their relationship in hyperuricemic mice. Journal of Ethnopharmacology (2014), http://dx.doi.org/10.1016/j.jep.2014.12.001i W.-F. Sun et al. / Journal of Ethnopharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎ 7

1 the levels of miR-34a expression in the high-, medium-, and low- dose mediated by its capacity to upregulate miR-34a to suppress URAT1, 66 2 XZCBF treatment groups were higher than that in the model group, resulting in improved excretion of uric acid. Thus, XZCBF may play 67 3 indicating that XZCBF may induce the expression of miR-34a in kidney a role in the treatment of hyperuricemia. 68 4 tissue (Fig. 3A and B). This result was consistent with the gene 69 5 expression results reported above, with a similar correlation analysis 70 6 result (r¼0.656, P¼0.000). 71 7 Acknowledgments 72 8 73 9 4. Discussion This project was supported by the National Natural Science Q6 Q774 10 Foundation of China (No.81072915), Guangdong Major Science and 75 11 Our experiments showed that miR-34a could inhibit the Technology Projects (No.2012A080201012), and the Guangdong 76 12 expression of URAT1 and that the target site of miR-34a was Provincial Natural Science Foundation (No.S2012010009032). 77 – 0 13 located at position 331 338 of SLC22A12-3 UTR. Moreover, the 78 14 results also demonstrated that the high, medium, and low doses of 79 15 XZCBF all lowered the uric acid levels in the hyperuricemic mice References 80 16 model. URAT1 and miR-34a were universally expressed in kidney 81 17 tissue in each group; however, the mRNA expression of URAT1 Chen, G.L., Xu, S.Y., 2004. Research progress for animal hyperuricemia model. 82 18 tended to decrease with an increase in the therapeutic dose of Chinese Pharmacological Bulletin 20, 369. 83 XZCBF, while the expression of miR-34a tended to increase. A Cheong, H.I., Kang, J.H., Lee, J.H., Ha, I.S., Kim, S., Komoda, F., et al., 2008. Mutational 19 analysis of idiopathic renal hypouricemia in Korea. Pediatric Nephrology 20, 84 20 dose-dependent relationship between the uric acid level, URAT1, 886–890. 85 21 and miR-34a was clearly present in all three XZCBF treatment Chinese Pharmacopoeia Commission, 2010. Pharmacopoeia of the People's Republic 86 of China. China Medical Science Press, China, 17, 31, 49, 67, 271. 22 groups. This relationship was further supported by the results of 87 immunohistochemistry and in situ hybridization. Pearson's corre- Crittenden, D.B., Lehmann, R.A., Schneck, L., et al., 2012. Colchicine use is associated 23 with decreased prevalence of myocardial infarction in patients with gout. The 88 24 lation analysis showed that the mRNA expression levels of URAT1 Journal of Rheumatology 39, 1458–1464. 89 fl 25 were positively correlated with the uric acid level, but negatively Fei, H.R., Gao, Y.S., Mao, Y.H., et al., 2005. Anti-in ammatory and analgesic effects of 90 correlated with miR-34a expression. aqueous extract from dioscorea collettii Var. Chinese Journal of Clinical Reha- 26 bilitation 39, 110–111. 91 27 Hyperuricemic animal models are important tools for studying Fei, H.R., Mao, Y.H., Zhu, W., et al., 2007. Elimination Effects of Dioscorea collettii 92 – 28 uric acid metabolism and associated diseases. Because uric acid Hook Var on Uric Acid. Herald of Medicine 11, 1270 1272. 93 Gao, C.K., Gao, J., RL, M.A., et al., 2003. Research on analgesic and anti-inflammatory 29 can be further degraded into allantoin by uricase in rodents, but 94 not in humans, it is not easy to create hyperuricemic models in and invigorate circulation effects of total saponins of Achyranthes. Anhui 30 Medical and Pharmaceutical Journal 7, 248–249. 95 31 these animals. Because hyperuricemia is mainly caused by a high Hong, Q., Wu, D., Chen, X.M., Hou, K., Feng, Z., Fu, B., et al., 2005. Location and 96 intake of purine-rich food, to reduce the interspecies difference expression of human uric acid transporter in HKC. Chinese Journal of Nephrol- 32 – 97 between humans and mice, we created a hyperuricemic model by ogy 21, 527 533. 33 Jing, H.E., Niu, C.Q., Hu, J.M., et al., 2007. Vasodilatation effects of the water 98 34 administering 97% allantoxanic acid potassium salt and adenine by decoction of Vaccaria Segetalis (Neck) Garcke on rabbit aorta in vitro. Journal of 99 – 35 gavage, employing the procedures described in previous studies Sichuan of Traditional Chinese Medicine 8, 13 15. 100 (Chen and Xu, 2004; Tong et al., 2009) with some modifications. Lewis, B.P., Burge, C.B., Bartel, D.P., 2005. Conserved seed pairing, often flanked by 36 adenosines, indicates that thousands of human genes are microRNA targets. 101 This model closely mimics the manner in which hyperuricemia 37 Cell 120, 15–20. 102 38 emerges in humans, and its success was supported by the clearly Liu, Z.G., Deng, W.J., Zheng, P.C., Sun, W.F., Wu, X.R., 2011a. Study on extracting and 103 elevated uric acid levels observed in our study. alcohol precipitating craft of compound Tufuling granules. Chinese Archives of 39 – 104 According to the theory of TCM, dampness turbidity (Shizhuo) Traditional Chinese Medicine 29, 1594 1595. 40 Liu, Z.G., Deng, W.J., Sun, W.F., Wu, X.R., 2011b. Studies on the quality and quantity 105 41 and phlegm-static blood (Tanyu) are thought to be the major analysis methods of compound Tufuling granules. Chinese Journal of Pharma- 106 fi – 42 factors in the pathogenesis of hyperuricemia. Innate insuf cien- ceutical Analalysis 31, 119 123. 107 cies, cause deficiencies in the “Kidney” and “Spleen”, reduced Li, Z.K., Li, D.D., 1997. The immunomodulatory effect of Achyranthes bidentata 43 polysaccharides. Acta Pharmaceutica Sinica B 12, 881–887. 108 44 transport, the generation of dampness turbidity, and the blocking Nadeau, I., Kamen, A., 2003. Production of adenovirus vector for gene therapy. 109 “ ” “ ” “ ” 45 of Qi and Blood . The blockage of Blood leads to a static Biotechnology Advances 20, 475–489. 110 combination of phlegm and static blood, which is a tedious Roddy, E., Zhang, W., Doherty, M., 2007. The changing epidemiology of gout. Nature 46 – 111 process that involves the “Kidney”. XZCBF facilitates the excretion Clinical Practice Rheumatology 3, 443 449. 47 Shi, Y., Yang, Y.L., Li, W.Y., et al., 2012. Extraction the colchicine of Iphigenia indica in 112 48 of dampness turbidity and the removal of phlegm-static blood to aqueous two-phase System. Natural Product Research and Development 24, 113 – 49 cure hyperuricemia and gout. Our study results showed that oral 1412 1416. 114 administration of XZCBF lowered uric acid levels in a hyperur- Sun, W.F., Zhang, X.X., Xu, W., 2009. Therapeutic effect of two compositions of 50 Xiezhuo Chubi decoction on primary gout hyperuricemia. Military Medical 115 51 icemic mice model and that high-dose treatment was comparable Journal of South China 23, 35. 116 52 to benzbromarone treatment; however, medium- and low- dose Sun, W.F., Zhang, X.X., Sun, F.Y., et al., 2011. MicroRNA expression patterns in the 117 XZCBF treatment was not as effective, indicating that sufficient kidney of mice treated with XZCBF. Chinese Journal of Integrative Medicine 17, 53 – 118 doses and therapeutic durations during clinical application could 35 42. 54 Tong, G.H., Yi, Zhang, Ma, L., 2009. Research progress for rodent hyperuricemia 119 fi 55 ensure satisfactory clinical ef cacy. Our previous studies also model. Journal of Toxicology 23, 159–162. 120 demonstrated that XZCBF was similar to benzbromarone with Wang, F., 2004. Research progress for urate transporters in renal. Section Endocri- Q8 56 – 121 respect to its ability to inhibit the reabsorption of uric acid nol Foreign Med 24, 388 390. 57 Wu, E.Q., P.A. Patel, Yu AP, et al., 2008. Disease-related and all-cause health care 122 58 mediated by URAT1. costs of elderly patients with gout. Journal of Managed Care Pharmacy 14, 123 – 59 164 175. 124 Wu, L.G., Fan, J.H., Belasco, J.G., 2006. MicroRNAs direct rapid deadenylation of 60 5. Conclusions mRNA. Proceedings of the National Academy of the United States of America 125 61 103, 4034–4039. 126 fl 62 fi Zhang, B.J., Liu, Y.O., Liu, L., et al., 2004. Study on anti-in ammatory, analgesic, 127 In summary, we conclude that XZCBF can signi cantly lower diuretic effect of smilax glabra and astilbin. Pharmacology and Clinics of 63 128 uric acid levels in a hyperuricemic animal model, which may be Chinese Materia Medica 20, 11–12. 64 129 65