DOCSLIB.ORG

Enzymatic Encoding Methods for Efficient Synthesis of Large Libraries

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

(19) TZZ ¥__Z_T (11) EP 2 341 140 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 06.07.2011 Bulletin 2011/27 C12N 15/10 (2006.01) C12Q 1/68 (2006.01) C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 10192716.8 (22) Date of filing: 01.12.2006 (84) Designated Contracting States: • Husemoen, Birgitte Nystrup AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 2500 Valby (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Dolberg, Johannes SK TR 1674 Copenhagen V (DK) Designated Extension States: • Jensen, Kim Birkebæk AL BA HR MK RS 2610 Rødovre (DK) • Petersen, Lene (30) Priority: 01.12.2005 DK 200501704 2100 Copenhagen Ø (DK) 02.12.2005 US 741490 P • Nørregaard-Madsen, Mads 3460 Birkerød (DK) (62) Document number(s) of the earlier application(s) in • Godskesen, Michael Anders accordance with Art. 76 EPC: 2950 Vedbæk (DK) 06818144.5 / 1 957 644 • Glad, Sanne Schrøder 2750 Ballerup (DK) (71) Applicant: Nuevolution A/S • Neve, Søren 2100 Copenhagen 0 (DK) 2800 Lyngby (DK) • Thisted, Thomas (72) Inventors: 3600 Frederikssund (DK) • Franch, Thomas • Kronberg, Tine Titilola Akinleminu 3070 Snekkersten (DK) 3500 Værløse (DK) • Lundorf, Mikkel Dybro • Sams, Christian 4000 Roskilde (DK) 3500 Værløse (DK) • Jakobsen, Søren • Felding, Jakob 2000 Frederiksberg (DK) 2920 Charlottenlund (DK) • Olsen, Eva Kampmann • Freskgård, Per-Ola 2730 Herlev (DK) 603 79 Norrkörping (SE) • Andersen, Anne Lee • Gouliaev, Alex Haahr 4100 Ringsted (DK) 3670 Veksø Sjælland (DK) • Holtmann, Anette • Pedersen, Henrik 2750 Ballerup (DK) 2880 Bagsværd (DK) • Hansen, Anders Holm 2400 Copenhagen NV (DK) (74) Representative: Aamand, Jesper L. et al • Sørensen, Anders Malling Hjerrild & Levin ApS 2860 Søborg (DK) Tuborg Boulevard 12 • Goldbech, Anne 2900 Hellerup (DK) 2200 Copenhagen N (DK) • De Leon, Daen Remarks: 2300 Copenhagen S (DK) This application was filed on 26-11-2010 as a • Kaldor, Ditte Kivsmose divisional application to the application mentioned 2880 Bagsvaerd (DK) under INID code 62. • Sløk, Frank Abildgaard 3450 Allerød (DK) (54) Enzymatic encoding methods for efficient synthesis of large libraries (57) Disclosed is a method for obtaining a bifunction- stranded identifier oligonucleotide, wherein a nascent bi- al complex comprising a molecule linked to a single functional complex comprising a chemical reaction site EP 2 341 140 A1 Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 2 341 140 A1 and a priming site for enzymatic addition of a tag is a) reactants, and b) reacted enzymatically at the priming reacted at the chemical reaction site with one or more site with one or more tag(s) identifying the reactant(s). 2 EP 2 341 140 A1 Description [0001] This application is a non-provisional of U.S. provisional application Serial No. 60/741,490 filed on December 2, 2005, which is hereby incorporated by reference in its entirety. All patent and non-patent references cited in U.S. 5 provisional application Serial No. 60/741,490, or in the present application, are also hereby incorporated by reference in their entirety. Technical Field of the Invention 10 [0002] The present invention relates to bifunctional complexes and methods for synthesising such complexes, as well as to methods for split-and-mix synthesis of different molecules each linked to a single stranded identifier oligonucleotide comprising a plurality of tags identifying the molecule and/or the chemical entities having participated in the synthesis of the molecule. The invention also relates to a method for generating a library of different bifunctional complexes and methods for selecting molecules and/or identifying molecules having a desirable property, such as affinity for a target 15 compound. Background of the Invention [0003] Synthesis methods known as split-and-mix, or split-and-recombine, are known and have been used for the 20 synthesis of different molecules. Split-and-mix methods for synthesising polypeptides and other biochemical polymers have been disclosed e.g. in US 5,723,598 directed to the generation of a library of bifunctional complexes comprising a polypeptide and an identifier oligonucleotide comprising tags in the form of a sequence of nucleotides identifying the amino acids which participated in the formation of the polypeptide. The methods are directed to chemical linkage of tags and do not disclose enzymatic linkage, such as ligation, of the nucleotide tags making up the identifier oligonucleotide. 25 [0004] WO 00/23458 discloses a split-and-mix method in which nucleic acid tags are involved in both molecule syn- thesis and molecule identification. [0005] WO 2004/039825 and WO 2005/058479 disclose split-and-mix methods wherein tags in the form of identifier oligonucleotides are linked enzymatically. The prior art methods do not disclose ligation of a double-stranded oligonu- cleotide substrate comprising a plurality of tags and complementary anti-tags at least partly hybridised to each other, 30 wherein said ligation results in the formation of an identifier oligonucleotide comprising a plurality of consecutive nucle- otides in the form of covalently linked tags, whereas the anti-tags of the double-stranded oligonucleotide substrate are not affected by the action of the ligase, i.e. no anti-tags become covalently linked as a result of the enzymatic ligation of the tag part of the double-stranded oligonucleotide substrate. [0006] Reference is also made to WO2006/053571 disclosing methods for molecule synthesis. 35 Summary of the Invention [0007] There is a need for improved methods for split-and-mix synthesis of libraries of small molecules for e.g. phar- maceutical and other purposes. The small molecules can initially be synthesised as part of a bifunctional complex further 40 comprising an identifier oligonucleotide identifying the reactants which have participated in the synthesis of the small molecule. [0008] The methods of the present invention employs a ligation step wherein the substrate for the ligase is in a double stranded form and wherein the substrate comprises a plurality of tags and at least one or more anti-tags wherein tags and anti-tag(s) is/are at least partly hybridised to each other. The tags are covalently linked as a result of the action of 45 an enzyme comprising a ligase activity on the double stranded substrate, but no anti-tags are covalently linked as a result of said ligase action. [0009] The method facilitates separation of ligated tags and discrete, non-ligated anti-tags because of the size and molecular weight difference between (i) the afore-mentioned single stranded identifier oligonucleotide comprising a plurality of covalently linked tags and (ii) discrete, non-ligated anti-tags. The identifier oligonucleotide comprising the 50 ligated tags will typically have a length at least about 3 times the length of the individual anti-tags. [0010] In one embodiment, the tags comprise a 5’ phosphate, or a variant ligatable reactive group, whereas anti-tags do not. Therefore, the growing bifunctional complex will comprise a covalently linked "top"- strand to which a number, such as one or more, of shorter and non-ligated anti-tag(s) is/are hybridised/annealed. This enables removal of anti-tag(s), e.g. after all tag additions have been performed (Fig. 1) or after each tag addition has been performed (Fig. 6). 55 [0011] Removal of anti-tags generally increases fidelity and allows extension after purification of the single-stranded oligonucleotide identifier comprising a plurality of ligated tags. Said extension makes possible the use of selection-specific sequences, which improves robustness towards contamination, which is a well-known phenomena when e.g. PCR amplifications are performed. Also, diversification-sequences can be used which diversifies otherwise un-distinguishable 3 EP 2 341 140 A1 tag combinations. This makes it possible to identify tag combination sequences which may arise during PCR from a single tag combination. It is advantageous to identify such sequences as they may otherwise be interpreted as arising from several molecular entities containing the same tag combination, thus indicating that the specific tag combination corresponds to a small molecule with relatively high ability to be retained during subsequent selection procedures. 5 [0012] Also, because of the design of the tags, cross-hybridization between single stranded tags can be reduced or essentially eliminated. This greatly improves the purification process of the bifunctional complexes comprising single stranded identifier oligonucleotides following the synthesis reactions. One problem associated with purification of bi- functional complexes comprising double stranded identifier oligonucleotides is that such identifiers are prone to illegiti- mate hybridization when renaturing conditions are resumed following a purification process under denaturing conditions. 10 [0013] In order to achieve a minimum degree of cross-hybridization between tags in an identifier oligonucleotide, the tags can be designed using a computer algorithm to maximize or optimize the number of mismatches between any oligo pair, e.g. resulting in a minimum of seven mismatches between any two tag tags. This maximizes or optimize fidelity of hybridization and enables use of sorting methods, such as the ones disclosed e.g. in WO 00/23458 (Harbury). Moreover, it increases robustness of decoding by sequencing, e.g. the tag information can be decoded even if sequencing errors 15 occur. [0014] It is also possible to perform a quenching reaction with the reactants and tags. After reactant reactions resulting in the synthesis of the molecule, excess reactants are rendered unreactive, e.g., by adding a quencher in the form e.g. of a reactant which reacts with excess reactants, e.g. by raising pH, etc, or by removal of a reactant which is critical for the reaction, etc. This can be done e.g. prior to, after or in parallel with deprotection of reacted reactants.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Supplemental Figure 1. Vimentin

    Supplemental Figure 1. Vimentin

    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
  • (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002

    (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002

    USOO6395889B1 (12) United States Patent (10) Patent No.: US 6,395,889 B1 Robison (45) Date of Patent: May 28, 2002 (54) NUCLEIC ACID MOLECULES ENCODING WO WO-98/56804 A1 * 12/1998 ........... CO7H/21/02 HUMAN PROTEASE HOMOLOGS WO WO-99/0785.0 A1 * 2/1999 ... C12N/15/12 WO WO-99/37660 A1 * 7/1999 ........... CO7H/21/04 (75) Inventor: fish E. Robison, Wilmington, MA OTHER PUBLICATIONS Vazquez, F., et al., 1999, “METH-1, a human ortholog of (73) Assignee: Millennium Pharmaceuticals, Inc., ADAMTS-1, and METH-2 are members of a new family of Cambridge, MA (US) proteins with angio-inhibitory activity', The Journal of c: - 0 Biological Chemistry, vol. 274, No. 33, pp. 23349–23357.* (*) Notice: Subject to any disclaimer, the term of this Descriptors of Protease Classes in Prosite and Pfam Data patent is extended or adjusted under 35 bases. U.S.C. 154(b) by 0 days. * cited by examiner (21) Appl. No.: 09/392, 184 Primary Examiner Ponnathapu Achutamurthy (22) Filed: Sep. 9, 1999 ASSistant Examiner William W. Moore (51) Int. Cl." C12N 15/57; C12N 15/12; (74) Attorney, Agent, or Firm-Alston & Bird LLP C12N 9/64; C12N 15/79 (57) ABSTRACT (52) U.S. Cl. .................... 536/23.2; 536/23.5; 435/69.1; 435/252.3; 435/320.1 The invention relates to polynucleotides encoding newly (58) Field of Search ............................... 536,232,235. identified protease homologs. The invention also relates to 435/6, 226, 69.1, 252.3 the proteases. The invention further relates to methods using s s s/ - - -us the protease polypeptides and polynucleotides as a target for (56) References Cited diagnosis and treatment in protease-mediated disorders.
  • Enzymatic Encoding Methods for Efficient Synthesis Of

    Enzymatic Encoding Methods for Efficient Synthesis Of

    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
  • Supplemental Material

    Supplemental Material

    Supplemental Table B ARGs in alphabetical order Symbol Title 3 months 6 months 9 months 12 months 23 months ANOVA Direction Category 38597 septin 2 1557 ± 44 1555 ± 44 1579 ± 56 1655 ± 26 1691 ± 31 0.05219 up Intermediate 0610031j06rik kidney predominant protein NCU-G1 491 ± 6 504 ± 14 503 ± 11 527 ± 13 534 ± 12 0.04747 up Early Adult 1G5 vesicle-associated calmodulin-binding protein 662 ± 23 675 ± 17 629 ± 16 617 ± 20 583 ± 26 0.03129 down Intermediate A2m alpha-2-macroglobulin 262 ± 7 272 ± 8 244 ± 6 290 ± 7 353 ± 16 0.00000 up Midlife Aadat aminoadipate aminotransferase (synonym Kat2) 180 ± 5 201 ± 12 223 ± 7 244 ± 14 275 ± 7 0.00000 up Early Adult Abca2 ATP-binding cassette, sub-family A (ABC1), member 2 958 ± 28 1052 ± 58 1086 ± 36 1071 ± 44 1141 ± 41 0.05371 up Early Adult Abcb1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A 136 ± 8 147 ± 6 147 ± 13 155 ± 9 185 ± 13 0.01272 up Midlife Acadl acetyl-Coenzyme A dehydrogenase, long-chain 423 ± 7 456 ± 11 478 ± 14 486 ± 13 512 ± 11 0.00003 up Early Adult Acadvl acyl-Coenzyme A dehydrogenase, very long chain 426 ± 14 414 ± 10 404 ± 13 411 ± 15 461 ± 10 0.01017 up Late Accn1 amiloride-sensitive cation channel 1, neuronal (degenerin) 242 ± 10 250 ± 9 237 ± 11 247 ± 14 212 ± 8 0.04972 down Late Actb actin, beta 12965 ± 310 13382 ± 170 13145 ± 273 13739 ± 303 14187 ± 269 0.01195 up Midlife Acvrinp1 activin receptor interacting protein 1 304 ± 18 285 ± 21 274 ± 13 297 ± 21 341 ± 14 0.03610 up Late Adk adenosine kinase 1828 ± 43 1920 ± 38 1922 ± 22 2048 ± 30 1949 ± 44 0.00797 up Early
  • Oral Ambroxol Increases Brain Glucocerebrosidase Activity in a Nonhuman Primate

    Oral Ambroxol Increases Brain Glucocerebrosidase Activity in a Nonhuman Primate

    Received: 17 November 2016 | Revised: 24 January 2017 | Accepted: 12 February 2017 DOI 10.1002/syn.21967 SHORT COMMUNICATION Oral ambroxol increases brain glucocerebrosidase activity in a nonhuman primate Anna Migdalska-Richards1 | Wai Kin D. Ko2 | Qin Li2,3 | Erwan Bezard2,3,4,5 | Anthony H. V. Schapira1 1Department of Clinical Neurosciences, Institute of Neurology, University College Abstract London, NW3 2PF, United Kingdom Mutations in the glucocerebrosidase 1 (GBA1) gene are related to both Parkinson disease (PD) and 2Motac Neuroscience, Manchester, United Gaucher disease (GD). In both cases, the condition is associated with deficiency of glucocerebrosi- Kingdom dase (GCase), the enzyme encoded by GBA1. Ambroxol is a small molecule chaperone that has 3 Institute of Laboratory Animal Sciences, been shown in mice to cross the blood-brain barrier, increase GCase activity and reduce alpha- China Academy of Medical Sciences, Beijing synuclein protein levels. In this study, we analyze the effect of ambroxol treatment on GCase City, People’s Republic of China activity in healthy nonhuman primates. We show that daily administration of ambroxol results in 4University de Bordeaux, Institut des Maladies Neurodeg en eratives, UMR 5293, increased brain GCase activity. Our work further indicates that ambroxol should be investigated as Bordeaux F-33000, France a novel therapy for both PD and neuronopathic GD in humans. 5CNRS, Institut des Maladies Neurodeg en eratives, UMR 5293, Bordeaux F-33000, France KEYWORDS Correspondence ambroxol, glucocerebrosidase,
  • Supplementary Data

    Supplementary Data

    Supplemental Data A novel mouse model of X-linked nephrogenic diabetes insipidus: Phenotypic analysis and therapeutic implications Jian Hua Li, Chung-Lin Chou, Bo Li, Oksana Gavrilova, Christoph Eisner, Jürgen Schnermann, Stasia A. Anderson, Chu-Xia Deng, Mark A. Knepper, and Jürgen Wess Supplemental Methods Metabolic cage studies. Animals were maintained in mouse metabolic cages (Hatteras Instruments, Cary, NC) under controlled temperature and light conditions (12 hr light and dark cycles). Mice received a fixed daily ration of 6.5 g of gelled diet per 20 g of body weight per day. The gelled diet was composed of 4 g of Basal Diet 5755 (Test Diet, Richmond, IN), 2.5 ml of deionized water, and 65 mg agar. Preweighted drinking water was provided ad libitum during the course of the study. Mice were acclimated in the metabolic cages for 1-2 days. Urine was collected under mineral oil in preweighted collection vials for successive 24 hr periods. Analysis of GPCR expression in mouse IMCD cells via TaqMan real-time qRT-PCR. Total RNA prepared from mouse IMCD tubule suspensions was reverse transcribed as described under Experimental Procedures. Tissues from ten 10-week old C57BL/6 WT mice were collected and pooled for each individual experiment. cDNA derived from 640 ng of RNA was mixed with an equal volume of TaqMan gene expression 2 x master mix (Applied Biosystems, Foster City, CA). 100 μl-aliquots of this mixture (corresponding to 80 ng of RNA) were added to each of the 8 fill ports of a 384-well plate of a mouse GPCR array panel (Applied Biosystems).
  • PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia

    PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia

    ABSTRACT Title of Document: PROTEOMIC ANALYSIS OF HUMAN URINARY EXOSOMES. Patricia Amalia Gonzales Mancilla, Ph.D., 2009 Directed By: Associate Professor Nam Sun Wang, Department of Chemical and Biomolecular Engineering Exosomes originate as the internal vesicles of multivesicular bodies (MVBs) in cells. These small vesicles (40-100 nm) have been shown to be secreted by most cell types throughout the body. In the kidney, urinary exosomes are released to the urine by fusion of the outer membrane of the MVBs with the apical plasma membrane of renal tubular epithelia. Exosomes contain apical membrane and cytosolic proteins and can be isolated using differential centrifugation. The analysis of urinary exosomes provides a non- invasive means of acquiring information about the physiological or pathophysiological state of renal cells. The overall objective of this research was to develop methods and knowledge infrastructure for urinary proteomics. We proposed to conduct a proteomic analysis of human urinary exosomes. The first objective was to profile the proteome of human urinary exosomes using liquid chromatography-tandem spectrometry (LC- MS/MS) and specialized software for identification of peptide sequences from fragmentation spectra. We unambiguously identified 1132 proteins. In addition, the phosphoproteome of human urinary exosomes was profiled using the neutral loss scanning acquisition mode of LC-MS/MS. The phosphoproteomic profiling identified 19 phosphorylation sites corresponding to 14 phosphoproteins. The second objective was to analyze urinary exosomes samples isolated from patients with genetic mutations. Polyclonal antibodies were generated to recognize epitopes on the gene products of these genetic mutations, NKCC2 and MRP4. The potential usefulness of urinary exosome analysis was demonstrated using the well-defined renal tubulopathy, Bartter syndrome type I and using the single nucleotide polymorphism in the ABCC4 gene.
  • Characterization of Nudix Hydrolases: a Utilitarian

    Characterization of Nudix Hydrolases: a Utilitarian

    CHARACTERIZATION OF NUDIX HYDROLASES: A UTILITARIAN SUPERFAMILY OF ENZYMES By Andres Hernandez de la Peña A dissertation submitted to the Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland August, 2015 Abstract The present work details the structural and enzymatic characterization of Nudix hydrolases from three different organisms – Bdellovibrio bacteriovorus, Mycobacterium tuberculosis, and Tetrahymena thermophila. Each of these Nudix enzymes presents unique questions about their physiological function within their organism which are answered with a combination of structural biology, genetic manipulation, enzyme kinetics, and a wide range of protein assays. We demonstrate that RenU, from M. tuberculosis, is part of Redox Homeostasis Control System (RHOCS), which senses and regulates NADH concentrations. This control systems involves two other proteins, the serine/threonine protein kinase G (pknG) and the L13 ribosomal subunits, without which the bacterium fails to evade lysosomal delivery and falls prey to the oxidative arsenal of the macrophage host. Bd-NDPSase, a Nudix enzyme encoded by the B. bacteriovorus gene BD3179, localizes to the periplasmic space of the bacterium and hydrolyses at least four nucleoside diphosphate sugars in vitro. Through atomic-resolution models from X-ray diffraction, we identified a motif that differentiates this hydrolase from the similar, but more substrate specific, ADP- ribose hydrolase from E. coli. Lastly, we show that Nud1p from T. thermophila is a member of the Ezl1p complex, the histone methyltransferase Polycomb Group homologue of this protozoan. With the use of in vitro enzymatic assays we show, in addition, that Nu1dp hydrolyses CoA preferentially over acetyl-CoA and other nucleoside derivatives.
  • Serine Proteases with Altered Sensitivity to Activity-Modulating

    Serine Proteases with Altered Sensitivity to Activity-Modulating

    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
  • GM2 Gangliosidoses: Clinical Features, Pathophysiological Aspects, and Current Therapies

    GM2 Gangliosidoses: Clinical Features, Pathophysiological Aspects, and Current Therapies

    International Journal of Molecular Sciences Review GM2 Gangliosidoses: Clinical Features, Pathophysiological Aspects, and Current Therapies Andrés Felipe Leal 1 , Eliana Benincore-Flórez 1, Daniela Solano-Galarza 1, Rafael Guillermo Garzón Jaramillo 1 , Olga Yaneth Echeverri-Peña 1, Diego A. Suarez 1,2, Carlos Javier Alméciga-Díaz 1,* and Angela Johana Espejo-Mojica 1,* 1 Institute for the Study of Inborn Errors of Metabolism, Faculty of Science, Pontificia Universidad Javeriana, Bogotá 110231, Colombia; [email protected] (A.F.L.); [email protected] (E.B.-F.); [email protected] (D.S.-G.); [email protected] (R.G.G.J.); [email protected] (O.Y.E.-P.); [email protected] (D.A.S.) 2 Faculty of Medicine, Universidad Nacional de Colombia, Bogotá 110231, Colombia * Correspondence: [email protected] (C.J.A.-D.); [email protected] (A.J.E.-M.); Tel.: +57-1-3208320 (ext. 4140) (C.J.A.-D.); +57-1-3208320 (ext. 4099) (A.J.E.-M.) Received: 6 July 2020; Accepted: 7 August 2020; Published: 27 August 2020 Abstract: GM2 gangliosidoses are a group of pathologies characterized by GM2 ganglioside accumulation into the lysosome due to mutations on the genes encoding for the β-hexosaminidases subunits or the GM2 activator protein. Three GM2 gangliosidoses have been described: Tay–Sachs disease, Sandhoff disease, and the AB variant. Central nervous system dysfunction is the main characteristic of GM2 gangliosidoses patients that include neurodevelopment alterations, neuroinflammation, and neuronal apoptosis. Currently, there is not approved therapy for GM2 gangliosidoses, but different therapeutic strategies have been studied including hematopoietic stem cell transplantation, enzyme replacement therapy, substrate reduction therapy, pharmacological chaperones, and gene therapy.