Memory Storage Calculations
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Solutions to Chapter 3
Solutions to Chapter 3 1. Suppose the size of an uncompressed text file is 1 megabyte. Solutions follow questions: [4 marks – 1 mark each for a & b, 2 marks c] a. How long does it take to download the file over a 32 kilobit/second modem? T32k = 8 (1024) (1024) / 32000 = 262.144 seconds b. How long does it take to take to download the file over a 1 megabit/second modem? 6 T1M = 8 (1024) (1024) bits / 1x10 bits/sec = 8.38 seconds c. Suppose data compression is applied to the text file. How much do the transmission times in parts (a) and (b) change? If we assume a maximum compression ratio of 1:6, then we have the following times for the 32 kilobit and 1 megabit lines respectively: T32k = 8 (1024) (1024) / (32000 x 6) = 43.69 sec 6 T1M = 8 (1024) (1024) / (1x10 x 6) = 1.4 sec 2. A scanner has a resolution of 600 x 600 pixels/square inch. How many bits are produced by an 8-inch x 10-inch image if scanning uses 8 bits/pixel? 24 bits/pixel? [3 marks – 1 mark for pixels per picture, 1 marks each representation] Solution: The number of pixels is 600x600x8x10 = 28.8x106 pixels per picture. With 8 bits/pixel representation, we have: 28.8x106 x 8 = 230.4 Mbits per picture. With 24 bits/pixel representation, we have: 28.8x106 x 24 = 691.2 Mbits per picture. 6. Suppose a storage device has a capacity of 1 gigabyte. How many 1-minute songs can the device hold using conventional CD format? using MP3 coding? [4 marks – 2 marks each] Solution: A stereo CD signal has a bit rate of 1.4 megabits per second, or 84 megabits per minute, which is approximately 10 megabytes per minute. -
Digital Measurement Units
Digital Measurement units Kilobit = 1 kbit = 1,000bits Kilobit per second (kbit/s or kb/s or kbps) is a unit of data transfer rate equal to 1,000 bits per second. It is sometimes mistakenly thought to mean 1,024 bits per second, using the binary meaning of the kilo- prefix, though this is incorrect. Examples • 56k modem — 56,000 bit/s • 128 kbit/s mp3 — 128,000 bit/s [1] • 64k ISDN — 64,000 bit/s [2] • 1536k T1 — 1,536,000 bit/s (1.536 Mbit/s) Most digital representations of audio are measured in kbit/s: (These values vary depending on audio data compression schemes) • 4 kbit/s – minimum necessary for recognizable speech (using special-purpose speech codecs) • 8 kbit/s – telephone quality • 32 kbit/s – MW quality • 96 kbit/s – FM quality • 192 kbit/s – Nearly CD quality for a file compressed in the MP3 format • 1,411 kbit/s – CD audio (at 16-bits for each channel and 44.1 kHz) Megabit (Mb)= 106 = 1,000,000 bits which is equal to 125,000 bytes or 125 kilobytes. Megabit per second (abbreviated as Mbps, Mbit/s, or mbps) is a unit of data transfer rates equal to 1,000,000 bits per second (this equals about 976 kilobits per second). Because there are 8 bits in a byte, a transfer speed of 8 megabits per second (8 Mbps) is equivalent to 1,000,000 bytes per second (approximately 976 KiB/s). Usage Examples: The bandwidth of consumer broadband internet services is often rated in Mbps. -
Dealing with Document Size Limits
Dealing with Document Size Limits Introduction The Electronic Case Filing system will not accept PDF documents larger than ten megabytes (MB). If the document size is less than 10 MB, it can be filed electronically just as it is. If it is larger than 10 MB, it will need to be divided into two or more documents, with each document being less than 10 MB. Word Processing Documents Documents created with a word processing program (such as WordPerfect or Microsoft Word) and correctly converted to PDF will generally be smaller than a scanned document. Because of variances in software, usage, and content, it is difficult to estimate the number of pages that would constitute 10 MB. (Note: See “Verifying File Size” below and for larger documents, see “Splitting PDF Documents into Multiple Documents” below.) Scanned Documents Although the judges’ Filing Preferences indicate a preference for conversion of documents rather than scanning, it will be necessary to scan some documents for filing, e.g., evidentiary attachments must be scanned. Here are some things to remember: • Documents scanned to PDF are generally much larger than those converted through a word processor. • While embedded fonts may be necessary for special situations, e.g., trademark, they will increase the file size. • If graphs or color photos are included, just a few pages can easily exceed the 10 MB limit. Here are some guidelines: • The court’s standard scanner resolution is 300 dots per inch (DPI). Avoid using higher resolutions as this will create much larger file sizes. • Normally, the output should be set to black and white. -
Computer Organization and Architecture Designing for Performance Ninth Edition
COMPUTER ORGANIZATION AND ARCHITECTURE DESIGNING FOR PERFORMANCE NINTH EDITION William Stallings Boston Columbus Indianapolis New York San Francisco Upper Saddle River Amsterdam Cape Town Dubai London Madrid Milan Munich Paris Montréal Toronto Delhi Mexico City São Paulo Sydney Hong Kong Seoul Singapore Taipei Tokyo Editorial Director: Marcia Horton Designer: Bruce Kenselaar Executive Editor: Tracy Dunkelberger Manager, Visual Research: Karen Sanatar Associate Editor: Carole Snyder Manager, Rights and Permissions: Mike Joyce Director of Marketing: Patrice Jones Text Permission Coordinator: Jen Roach Marketing Manager: Yez Alayan Cover Art: Charles Bowman/Robert Harding Marketing Coordinator: Kathryn Ferranti Lead Media Project Manager: Daniel Sandin Marketing Assistant: Emma Snider Full-Service Project Management: Shiny Rajesh/ Director of Production: Vince O’Brien Integra Software Services Pvt. Ltd. Managing Editor: Jeff Holcomb Composition: Integra Software Services Pvt. Ltd. Production Project Manager: Kayla Smith-Tarbox Printer/Binder: Edward Brothers Production Editor: Pat Brown Cover Printer: Lehigh-Phoenix Color/Hagerstown Manufacturing Buyer: Pat Brown Text Font: Times Ten-Roman Creative Director: Jayne Conte Credits: Figure 2.14: reprinted with permission from The Computer Language Company, Inc. Figure 17.10: Buyya, Rajkumar, High-Performance Cluster Computing: Architectures and Systems, Vol I, 1st edition, ©1999. Reprinted and Electronically reproduced by permission of Pearson Education, Inc. Upper Saddle River, New Jersey, Figure 17.11: Reprinted with permission from Ethernet Alliance. Credits and acknowledgments borrowed from other sources and reproduced, with permission, in this textbook appear on the appropriate page within text. Copyright © 2013, 2010, 2006 by Pearson Education, Inc., publishing as Prentice Hall. All rights reserved. Manufactured in the United States of America. -
Preface Towards the Reality of Petabit Networks
Preface Towards the Reality of Petabit Networks Yukou Mochida Member of the Board Fujitsu Laboratories Ltd. The telecommunications world is shifting drastically from voice oriented telephone networks to data oriented multimedia networks based on the Internet protocol (IP). Telecommunication carriers are positively extending their service attributes to new applications, and suppliers are changing their business areas and models, conforming to the radical market changes. The Internet, which was originally developed for correspondence among researchers, has evolved into a global communi- cations platform. Improvements in security technology are encouraging businesses to integrate the Internet into their intranets, and the eco- nomic world and basic life styles are being changed by the many new Internet-based services, for example, electronic commerce (EC), that have become available. This revolutionary change in telecommunications seems to come mainly from three motive forces. The first is the information society that has come into being with the wide and rapid deployment of person- al computers and mobile communications. The second is the worldwide deregulation and the resulting competitive telecommunications envi- ronment, which facilitates active investment in the growing market to construct huge-capacity networks for exploding traffic. The third is photonic networks based on wavelength division multiplexing (WDM) technology, which can greatly increase the communication capacity and drastically decrease the transmission cost per channel. Photonic net- works are attractive because they can also radically improve node throughput and offer transparency and flexibility while accommodating different signal formats and protocols, expandability for cost-effective gradual deployment, and high reliability, which is strongly required for a secure information society. -
Terabit Switching: a Survey of Techniques and Current Products
Computer Communications 25 (2002) 547±556 www.elsevier.com/locate/comcom Terabit switching: a survey of techniques and current products Amit Singhala,*, Raj Jainb aATOGA Systems Inc., 49026 Milmont, Fremont, CA 94538, USA bNayna Networks Inc., 481 Sycamore Dr, Milpitas, CA 95035, USA Received 8October 2001; accepted 8October 2001 Abstract This survey paper explains the issues in designing terabit routers and the solutions for them. The discussion includes multi-layer switching, route caching, label switching, and ef®cient routing table lookups. Router architecture issues including queuing and differentiated service are also discussed. A comparison of features of leading products is included. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Routers; Computer Networking; High-Speed Routing; Routing Table Search Algorithms; Routing Products; Gigabit Routers; Terabit Routers 1. Introduction ties to handle all those channels. With increase in the speed of interfaces as well as the port density, next thing which In the present network infrastructure, world's communi- routers need to improve on is the internal switching capa- cation service providers are laying ®ber at very rapid rates. city. 64 wavelengths at OC-192 require over a terabit of And most of the ®ber connections are now being terminated switching capacity. Considering an example of Nexabit using DWDM. The combination of ®ber and DWDM has [2], a gigabit router with 40 Gbps switch capacity can made raw bandwidth available in abundance. It is possible support only a 4-channel OC-48DWDM connection. Four to transmit 64 wavelength at OC-192 on a ®ber these days of these will be required to support a 16-channel OC-48 and OC-768speeds will be available soon. -
How Many Bits Are in a Byte in Computer Terms
How Many Bits Are In A Byte In Computer Terms Periosteal and aluminum Dario memorizes her pigeonhole collieshangie count and nagging seductively. measurably.Auriculated and Pyromaniacal ferrous Gunter Jessie addict intersperse her glockenspiels nutritiously. glimpse rough-dries and outreddens Featured or two nibbles, gigabytes and videos, are the terms bits are in many byte computer, browse to gain comfort with a kilobyte est une unité de armazenamento de armazenamento de almacenamiento de dados digitais. Large denominations of computer memory are composed of bits, Terabyte, then a larger amount of nightmare can be accessed using an address of had given size at sensible cost of added complexity to access individual characters. The binary arithmetic with two sets render everything into one digit, in many bits are a byte computer, not used in detail. Supercomputers are its back and are in foreign languages are brainwashed into plain text. Understanding the Difference Between Bits and Bytes Lifewire. RAM, any sixteen distinct values can be represented with a nibble, I already love a Papst fan since my hybrid head amp. So in ham of transmitting or storing bits and bytes it takes times as much. Bytes and bits are the starting point hospital the computer world Find arrogant about the Base-2 and bit bytes the ASCII character set byte prefixes and binary math. Its size can vary depending on spark machine itself the computing language In most contexts a byte is futile to bits or 1 octet In 1956 this leaf was named by. Pages Bytes and Other Units of Measure Robelle. This function is used in conversion forms where we are one series two inputs. -
Bits and Bytes
BITS AND BYTES To understand how a computer works, you need to understand the BINARY SYSTEM. The binary system is a numbering system that uses only two digits—0 and 1. Although this may seem strange to humans, it fits the computer perfectly! A computer chip is made up of circuits. For each circuit, there are two possibilities: An electric current flows through the circuit (ON), or An electric current does not flow through the circuit (OFF) The number 1 represents an “on” circuit. The number 0 represents an “off” circuit. The two digits, 0 and 1, are called bits. The word bit comes from binary digit: Binary digit = bit Every time the computer “reads” an instruction, it translates that instruction into a series of bits (0’s and 1’s). In most computers every letter, number, and symbol is translated into eight bits, a combination of eight 0’s and 1’s. For example the letter A is translated into 01000001. The letter B is 01000010. Every single keystroke on the keyboard translates into a different combination of eight bits. A group of eight bits is called a byte. Therefore, a byte is a combination of eight 0’s and 1’s. Eight bits = 1 byte Capacity of computer memory, storage such as USB devices, DVD’s are measured in bytes. For example a Word file might be 35 KB while a picture taken by a digital camera might be 4.5 MG. Hard drives normally are measured in GB or TB: Kilobyte (KB) approximately 1,000 bytes MegaByte (MB) approximately 1,000,000 (million) bytes Gigabtye (GB) approximately 1,000,000,000 (billion) bytes Terabyte (TB) approximately 1,000,000,000,000 (trillion) bytes The binary code that computers use is called the ASCII (American Standard Code for Information Interchange) code. -
Bit, Byte, and Binary
Bit, Byte, and Binary Number of Number of values 2 raised to the power Number of bytes Unit bits 1 2 1 Bit 0 / 1 2 4 2 3 8 3 4 16 4 Nibble Hexadecimal unit 5 32 5 6 64 6 7 128 7 8 256 8 1 Byte One character 9 512 9 10 1024 10 16 65,536 16 2 Number of bytes 2 raised to the power Unit 1 Byte One character 1024 10 KiloByte (Kb) Small text 1,048,576 20 MegaByte (Mb) A book 1,073,741,824 30 GigaByte (Gb) An large encyclopedia 1,099,511,627,776 40 TeraByte bit: Short for binary digit, the smallest unit of information on a machine. John Tukey, a leading statistician and adviser to five presidents first used the term in 1946. A single bit can hold only one of two values: 0 or 1. More meaningful information is obtained by combining consecutive bits into larger units. For example, a byte is composed of 8 consecutive bits. Computers are sometimes classified by the number of bits they can process at one time or by the number of bits they use to represent addresses. These two values are not always the same, which leads to confusion. For example, classifying a computer as a 32-bit machine might mean that its data registers are 32 bits wide or that it uses 32 bits to identify each address in memory. Whereas larger registers make a computer faster, using more bits for addresses enables a machine to support larger programs. -
If You Have Attempted to Upload Your Files and You Receive an Error Or
If you have attempted to upload your files and you receive an error or they simply will not upload to EDJOIN, your files are probably either in an inappropriate format, or too large. Please ensure that your document meets the appropriate format and size requirements below. Acceptable format: .PDF Size limit: Each file must not exceed 1 MB (megabyte) or 1024 KB File Name: The file name must contain less than 50 characters including spaces. If the file name contains more than 50 characters or any special characters, you may have trouble attaching your documents and/or the district you are applying to may have trouble viewing them. Please make sure your document title only contains letters and numbers. If the document is multiple pages, you may need to scan multiple sections of the document to maintain the 1MB file size allowance. Saving Your Documents to .PDF Format: If Using A PC: Microsoft Word 2007 or later allows you to save a document as .PDF on a PC 1. Open the document from where you have it saved in your computer. 2. Once the document opens in Microsoft Word, go to the File menu at the top left of your Microsoft Word window and click on Save as. 3. Note where you will be saving the document, go to the bottom of the window and select PDF (*.pdf) in the Save as type box. 4. Save and close. If Using A Mac: Using the print dialog box allows you to save just about any document to .PDF format from a Mac 1. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Fastgrnn: a Fast, Accurate, Stable and Tiny Kilobyte Sized Gated Recurrent Neural Network
FastGRNN: A Fast, Accurate, Stable and Tiny Kilobyte Sized Gated Recurrent Neural Network Aditya Kusupatiy, Manish Singhx, Kush Bhatiaz, Ashish Kumarz, Prateek Jainy and Manik Varmay yMicrosoft Research India xIndian Institute of Technology Delhi zUniversity of California Berkeley {t-vekusu,prajain,manik}@microsoft.com, [email protected] [email protected], [email protected] Abstract This paper develops the FastRNN and FastGRNN algorithms to address the twin RNN limitations of inaccurate training and inefficient prediction. Previous ap- proaches have improved accuracy at the expense of prediction costs making them infeasible for resource-constrained and real-time applications. Unitary RNNs have increased accuracy somewhat by restricting the range of the state transition matrix’s singular values but have also increased the model size as they require a larger num- ber of hidden units to make up for the loss in expressive power. Gated RNNs have obtained state-of-the-art accuracies by adding extra parameters thereby resulting in even larger models. FastRNN addresses these limitations by adding a residual connection that does not constrain the range of the singular values explicitly and has only two extra scalar parameters. FastGRNN then extends the residual connec- tion to a gate by reusing the RNN matrices to match state-of-the-art gated RNN accuracies but with a 2-4x smaller model. Enforcing FastGRNN’s matrices to be low-rank, sparse and quantized resulted in accurate models that could be up to 35x smaller than leading gated and unitary RNNs. This allowed FastGRNN to accurately recognize the "Hey Cortana" wakeword with a 1 KB model and to be deployed on severely resource-constrained IoT microcontrollers too tiny to store other RNN models.