Dealing with Document Size Limits
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
SHARING FILES and FOLDERS in WTC and WORKSPACES WORKSPACES V1.3X USER GUIDE
SHARING FILES AND FOLDERS IN WTC AND WORKSPACES WORKSPACES v1.3x USER GUIDE GlobalSCAPE, Inc. (GSB) Corporate Headquarters Address: 4500 Lockhill-Selma Road, Suite 150, San Antonio, TX (USA) 78249 Sales: (210) 308-8267 Sales (Toll Free): (800) 290-5054 Technical Support: (210) 366-3993 Web Support: http://www.globalscape.com/support/ © 2008-2017 GlobalSCAPE, Inc. All Rights Reserved August 2, 2017 Table of Contents How Do I Share Files? .................................................................................................................................................... 7 WTC Administration ...................................................................................................................................................... 9 Enabling User Access to the Web Transfer Client .................................................................................................. 9 Localization (Language) Settings .......................................................................................................................... 10 WTC Error Messages in EFT .................................................................................................................................. 11 Disable CRC ........................................................................................................................................................... 14 Disabling "Update Your Browser" Prompts .......................................................................................................... 14 Terms and -
Powerview Command Reference
PowerView Command Reference TRACE32 Online Help TRACE32 Directory TRACE32 Index TRACE32 Documents ...................................................................................................................... PowerView User Interface ............................................................................................................ PowerView Command Reference .............................................................................................1 History ...................................................................................................................................... 12 ABORT ...................................................................................................................................... 13 ABORT Abort driver program 13 AREA ........................................................................................................................................ 14 AREA Message windows 14 AREA.CLEAR Clear area 15 AREA.CLOSE Close output file 15 AREA.Create Create or modify message area 16 AREA.Delete Delete message area 17 AREA.List Display a detailed list off all message areas 18 AREA.OPEN Open output file 20 AREA.PIPE Redirect area to stdout 21 AREA.RESet Reset areas 21 AREA.SAVE Save AREA window contents to file 21 AREA.Select Select area 22 AREA.STDERR Redirect area to stderr 23 AREA.STDOUT Redirect area to stdout 23 AREA.view Display message area in AREA window 24 AutoSTOre .............................................................................................................................. -
Visual Validation of SSL Certificates in the Mozilla Browser Using Hash Images
CS Senior Honors Thesis: Visual Validation of SSL Certificates in the Mozilla Browser using Hash Images Hongxian Evelyn Tay [email protected] School of Computer Science Carnegie Mellon University Advisor: Professor Adrian Perrig Electrical & Computer Engineering Engineering & Public Policy School of Computer Science Carnegie Mellon University Monday, May 03, 2004 Abstract Many internet transactions nowadays require some form of authentication from the server for security purposes. Most browsers are presented with a certificate coming from the other end of the connection, which is then validated against root certificates installed in the browser, thus establishing the server identity in a secure connection. However, an adversary can install his own root certificate in the browser and fool the client into thinking that he is connected to the correct server. Unless the client checks the certificate public key or fingerprint, he would never know if he is connected to a malicious server. These alphanumeric strings are hard to read and verify against, so most people do not take extra precautions to check. My thesis is to implement an additional process in server authentication on a browser, using human recognizable images. The process, Hash Visualization, produces unique images that are easily distinguishable and validated. Using a hash algorithm, a unique image is generated using the fingerprint of the certificate. Images are easily recognizable and the user can identify the unique image normally seen during a secure AND accurate connection. By making a visual comparison, the origin of the root certificate is known. 1. Introduction: The Problem 1.1 SSL Security The SSL (Secure Sockets Layer) Protocol has improved the state of web security in many Internet transactions, but its complexity and neglect of human factors has exposed several loopholes in security systems that use it. -
If You Have Attempted to Upload Your Files and You Receive an Error Or
If you have attempted to upload your files and you receive an error or they simply will not upload to EDJOIN, your files are probably either in an inappropriate format, or too large. Please ensure that your document meets the appropriate format and size requirements below. Acceptable format: .PDF Size limit: Each file must not exceed 1 MB (megabyte) or 1024 KB File Name: The file name must contain less than 50 characters including spaces. If the file name contains more than 50 characters or any special characters, you may have trouble attaching your documents and/or the district you are applying to may have trouble viewing them. Please make sure your document title only contains letters and numbers. If the document is multiple pages, you may need to scan multiple sections of the document to maintain the 1MB file size allowance. Saving Your Documents to .PDF Format: If Using A PC: Microsoft Word 2007 or later allows you to save a document as .PDF on a PC 1. Open the document from where you have it saved in your computer. 2. Once the document opens in Microsoft Word, go to the File menu at the top left of your Microsoft Word window and click on Save as. 3. Note where you will be saving the document, go to the bottom of the window and select PDF (*.pdf) in the Save as type box. 4. Save and close. If Using A Mac: Using the print dialog box allows you to save just about any document to .PDF format from a Mac 1. -
A Graphical User Interface for PHAST
GoPhast: A Graphical User Interface for PHAST Techniques and Methods 6-A20 U.S. Department of the Interior U.S. Geological Survey Cover: GoPhast screen view for Example 2 (p. 74). The grid has been colored to show the distribution of initial hydraulic head. The status bar (at bottom) shows the coordinates of the mouse cursor, the column and row numbers at the cursor position, the value of initial head in the user’s choice of units at the cursor position, and a description of how the initial head value at that location was specified. GoPhast: A Graphical User Interface for PHAST By Richard B. Winston Techniques and Methods 6-A20 U.S. Department of the Interior U.S. Geological Survey U.S. Department of the Interior P. Lynn Scarlett, Acting Secretary U.S. Geological Survey P. Patrick Leahy, Acting Director U.S. Geological Survey, Reston, Virginia: 2006 Any use of trade, product, or firm names in this publication is for descriptive purposes only and does not imply endorsement by the U.S. Government. Suggested citation: Winston, R.B., 2006, GoPhast: A Graphical User Interface for PHAST: U.S. Geological Survey Techniques and Methods 6-A20, 98 p. Contents 1. Abstract..................................................................................................................................... 1 2. Introduction............................................................................................................................... 1 2.1 Reasons for Using Graphical User Interfaces ...................................................................... -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Augmented Reality Tangible Interfaces for CAD Design Review
Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1-1-2005 Augmented reality tangible interfaces for CAD design review Ronald Sidharta Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Recommended Citation Sidharta, Ronald, "Augmented reality tangible interfaces for CAD design review" (2005). Retrospective Theses and Dissertations. 20909. https://lib.dr.iastate.edu/rtd/20909 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Augmented reality tangible interfaces for CAD design review by Ronald Sidharta A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Human Computer Interaction Program of Study Committee: Adrian Sannier (Co-major Professor) Carolina Cruz-Neira (Co-major Professor) Dirk Reiners Ying Cai Iowa State University Ames, Iowa 2005 Copyright © Ronald Sidharta, 2005. All rights reserved. 11 Graduate College Iowa State University This is to certify that the master's thesis of Ronald Sidharta has met the thesis requirements of Iowa State University Signatures have been redacted for privacy 111 TABLE OF CONTENTS ABSTRACT ........................................................................................................................... -
Technical Note Image Studio™ Software Export Guide
Technical Note Image Studio™ Software Export Guide Developed for: Image Studio Software Please refer to your manual to confirm that this protocol is appropriate for the applications compatible with your instrument model. Published July 2014. Revised September 2014. The most recent version of this Technical Note is posted at http://biosupport.licor.com/support Page 2 - Image Studio™ Software Export Guide Table of Contents Page I. Introduction 3 II. Explanation of Exportable Image Formats 3 JPEG File Type 3 PNG File Type 3 TIFF File Type 3 III. Exporting Images and Movies: For Presentation Only 4 Export Single Image View 4 Current Image 4 Selected Images in the Images Table 4 Export Color Bar Only 5 Exporting Multiple Image View 6 Exporting from Single Image View or Multiple Image View Without Annotations 6 Using the Export Dialog Box: for Single Image View and Multiple Image View 6 Resizing Images 7 Choosing the Desired Image Format and Resolution 7 Naming the Exported Image Using the File Name Text Field 7 Using the Insert Button to Add Images Table Values to File Name 8 IV. Exporting Movies 8 When to Use 8 Procedure 9 V. Definition of Acquisition Folders and When to Export 9 Acquisition Folder vs. Zip Files 10 Exporting Acquisition Folders and Zip Files 10 VI. Exporting a Lab Book 12 Layout Template 13 Editing the Layout 14 Editing Header Options 15 What a Header Is 15 Editing Headers 15 Saving a Customized Lab Book Layout 16 VII. Changing the Page Setup, Previewing, and Saving a Lab Book 17 Image Studio™ Software Export Guide - Page 3 VIII. -
Mac OS X Server
Mac OS X Server Version 10.4 Technology Overview August 2006 Technology Overview 2 Mac OS X Server Contents Page 3 Introduction Page 5 New in Version 10.4 Page 7 Operating System Fundamentals UNIX-Based Foundation 64-Bit Computing Advanced BSD Networking Architecture Robust Security Directory Integration High Availability Page 10 Integrated Management Tools Server Admin Workgroup Manager Page 14 Service Deployment and Administration Open Directory Server File and Print Services Mail Services Web Hosting Enterprise Applications Media Streaming iChat Server Software Update Server NetBoot and NetInstall Networking and VPN Distributed Computing Page 29 Product Details Page 31 Open Source Projects Page 35 Additional Resources Technology Overview 3 Mac OS X Server Introduction Mac OS X Server version 10.4 Tiger gives you everything you need to manage servers in a mixed-platform environment and to con gure, deploy, and manage powerful network services. Featuring the renowned Mac OS X interface, Mac OS X Server streamlines your management tasks with applications and utilities that are robust yet easy to use. Apple’s award-winning server software brings people and data together in innovative ways. Whether you want to empower users with instant messaging and blogging, gain greater control over email, reduce the cost and hassle of updating software, or build your own distributed supercomputer, Mac OS X Server v10.4 has the tools you need. The Universal release of Mac OS X Server runs on both Intel- and PowerPC-based The power and simplicity of Mac OS X Server are a re ection of Apple’s operating sys- Mac desktop and Xserve systems. -
Fewer Clicks and Less Frustration: Reducing the Cost of Reaching the Right Folder Xinlong Bao Jonathan L
Fewer Clicks and Less Frustration: Reducing the Cost of Reaching the Right Folder Xinlong Bao Jonathan L. Herlocker Thomas G. Dietterich School of EECS School of EECS School of EECS Oregon State University Oregon State University Oregon State University Corvallis, OR 97331 Corvallis, OR 97331 Corvallis, OR 97331 +1 541 737-1646 +1 541 737-8894 +1 541 737-5559 [email protected] [email protected] [email protected] ABSTRACT locating the desired file is becoming an increasingly time- Helping computer users rapidly locate files in their folder consuming operation. Some previous investigations have shown hierarchies has become an important research topic in today’s that computer users spend substantial time and effort in just intelligent user interface design. This paper reports on finding files [1, 10, 11]. Thus, designing intelligent user interfaces FolderPredictor, a software system that can reduce the cost of that can help users quickly locate the desired files has emerged as locating files in hierarchical folders. FolderPredictor applies a an important research topic. cost-sensitive prediction algorithm to the user’s previous file Previous research on helping users find files has focused on access information to predict the next folder that will be accessed. building Personal Information Management (PIM) systems in Experimental results show that, on average, FolderPredictor which documents are organized by their properties [5, 7]. These reduces the cost of locating a file by 50%. Another advantage of properties include both system properties, like name, path and FolderPredictor is that it does not require users to adapt to a new content of the document, and user-defined properties that reflect interface, but rather meshes with the existing interface for the user’s view of the document. -
Converting Audio – Audio File Size
Converting Audio – Audio File Size By the end of this worksheet you should: • know how to calculate the possible file size of an audio recording You should now be very familiar with the following concepts: • BIT: a single zero (0) or (1), short for Binary digIT • BYTE: 8 bits • Analogue: a continuously varying signal • Digital: a pulse that alternates between OFF (0) and ON (1) • ADC: Analogue to Digital Converter • Sample Rate: how many times per second the ADC tests the incoming analogue signal • Sample Resolution: the number of bits allocate to each sample taken We only need to add 1 more snippet of knowledge to calculate the possible file size of an audio recording, and that is the duration of the recording. Imagine that you record 10 seconds of audio, setting the sample rate to 44.1kHz and using 16 bits per sample. What does this all mean? Page 1 of 5 Converting Audio – Audio File Size Well, we know that… • each sample uses 16 bits • there are 44 100 samples per second • this means that we are using 44 100 samples per second x 16 bits = 705 600 bits per second • Since we recorded for 10 seconds we have 705 600 bits per second x 10 seconds = 7 056 000 bits in total • There are 8 bits to a byte so 7 056 000 ÷ 8 = 882 000 bytes • 1 000 is a kilo so 882 000 bytes = 882 kilobytes or 882KB So, a 10 second recording that is set at 16 bits/44.1kHz might result in a file of 882KB. -
Student Guide to Take-Home Exams
Student Guide to Take-Home Exams Instructors at the Earle Mack School of Law have the option of giving their final exams in the traditional in-class format or in take-home format. While in-class exams typically make use of the Securexam Student software, take-home exams require only a web browser (Internet Explorer, Firefox, or Safari) and Microsoft Word. While no special software is needed, there are some specific instructions that must be followed to insure that you are able to access and complete your take-home exam and submit it for grading. General Information about Take-Home Exams Download Your Exam – Log in to the PlanetSSI website and download the exam question(s). Complete Your Exam – Answer the exam questions in Microsoft Word. Prepare Your Exam For Uploading – Remove your non-anonymous information from the exam response, insert your anonymous exam ID, and save it in an appropriate format. Upload Your Exam – Log in to PlanetSSI and upload your file to the appropriate class. Check Your Exam Status – See exactly when you downloaded or uploaded an exam. Troubleshooting Tips and Getting Help – If you have problems with any of the above, check here first. General Information about Take-Home Exams There are a few significant differences between in-class and take-home exams. Specifically: You do not use Securexam Student for take-home exams; you’ll type your exam answer into Microsoft Word. Since Word lacks the integrated anonymity features of Securexam Student, you need to take specific steps to ensure that all personally-identifiable information (other than your exam ID) is removed from your document before uploading it to PlanetSSI.