J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. Available online at www.jstage.jst.go.jp/browse/jjshs1 JSHS © 2011

Molecular Analysis of the Genetic Diversity of Chinese Hami Melon and Its Relationship to the Melon Germplasm from Central and South Asia

Yasheng Aierken1,2, Yukari Akashi1, Phan Thi Phuong Nhi1, Yikeremu Halidan1, Katsunori Tanaka3, Bo Long4, Hidetaka Nishida1, Chunlin Long4, Min Zhu Wu2 and Kenji Kato1*

1Graduate School of Natural Science and Technology, Okayama University, Okayama 700-8530, Japan 2Hami Melon Research Center, Xinjiang Academy of Agricultural Science, Urumuqi 830000, China 3Research Institute for Humanity and Nature, Kyoto 603-8047, Japan 4Kunming Institute of Botany, CAS, Heilongtan, Kunming, Yunnan 650204, China

Chinese Hami melon consists of the varieties cassaba, chandalak, ameri, and zard. To show their genetic diversity, 120 melon accessions, including 24 accessions of Hami melon, were analyzed using molecular markers of nuclear and cytoplasmic genomes. All Hami melon accessions were classified as the large-seed type with seed length longer than 9 mm, like US and Spanish Inodorus melon. Conomon accessions grown in east China were all the small- seed type. Both large- and small-seed types were in landraces from Iran, Afghanistan, Pakistan, and Central Asia. Analysis of an SNP in the PS-ID region (Rpl16-Rpl14) and size polymorphism of ccSSR7 showed that the melon accessions consisted of three chloroplast genome types, that is, maternal lineages. Hami melon accessions were T/338 bp type, which differed from Spanish melon and US Honey Dew (T/333 bp type), indicating a different maternal lineage within group Inodorus. The gene diversity (D), calculated from random amplified polymorphic DNA (RAPD) and simple sequence repeat (SSR) polymorphism, was 0.476 in 120 melon accessions; the largest diversity was in Central Asian accessions (D = 0.377) but was low for Hami melon accessions (D = 0.243), even though Hami melon has diverse morphological traits, earliness, and shelf life. Reflecting such small genetic diversity, Hami melon accessions of vars. ameri and zard were grouped into cluster II, except for one accession, by the unweighted pair group method and the arithmetic mean (UPGMA) cluster analysis. Variety chandalak with distinct characters, such as early maturing and poor shelf life, was assigned to clusters IV and VI, indicating inter-varietal genetic differentiation within Hami melon. Three accessions from Turkmenistan and Afghanistan, with large seeds and T/338 bp type of chloroplast genome, were classified as cluster II with Hami melon accessions of vars. ameri and zard. We therefore concluded that Hami melon may have been transmitted from the west. The small-seed type melon of group Conomon grown in east China may have been introduced into China independently of Hami melon, because it had the A/338 bp type of the chloroplast genome and was clustered distantly from Hami melon according to nuclear genome analysis.

Key Words: chloroplast genome, Cucumis melo, genetic diversity, Hami melon, SSR.

with a total production of 9.7 million tons a year. Chinese Introduction melon is generally divided into two types based on the Melon (Cucumis melo L.) is one of the most important thickness of the fruit skin: thick-skinned melon is horticultural crops in China, and is cultivated in 353 kha classified as Group Inodorus or Cantalupensis among seven horticultural groups defined by Munger and Robinson (1991), and thin-skinned melon is classified Received; July 5, 2010. Accepted; August 12, 2010. as Group Conomon. These two types also differ in This study was partly supported by a Grant-in-Aid for International cultivation area. Thick-skinned melon is mostly Scientific Research of Ministry of Education, Science, Culture and produced in Xinjiang (Xinjiang Uyghur Autonomous Sports, Japan (No. 19255009), and JSPS Asian CORE Program. This is Contribution number 23 from the Sato Project of Research Institute Region), and thin-skinned melon in eastern China. Both for Humanity and Nature (RIHN), Japan. types are cultivated between these two areas in Qinghai, * Corresponding author (E-mail: [email protected]). Gansu, and Shaanxi provinces.

52 J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 53

Xinjiang is in north-west China, and is one-sixth of var. chandalak is consumed in Xinjiang and is not China’s national land. It has a dry continental climate exported because this type is unsuitable for long-distance with great extremes of winter and summer temperature. transportation because of its short shelf life. However, Rainfall is scant, and the annual precipitation is less than var. zard and the mid-season maturing group of var. 500 mm in north Xinjiang and less than 100 mm in south ameri have a long (> six months) to moderately long Xinjiang. It is below 40 mm in Tulufan and Hami, famous (one month) shelf life and are exported as Hami melon for producing Hami melon, in the eastern part of to foreign countries, as well as to other provinces of Xinjiang. The daily fluctuation of air temperature is China. Taking such diversification into account, Pitrat large, and the average difference between day and night et al. (2000) proposed to classify varieties cassaba and temperature is from 11.3°C to 14.8°C depending on the zard as var. inodorus (group Inodorus), and the varieties area. Other important features of the climate are strong chandalak and ameri as independent varieties. However, sunshine and long sunshine duration. These conditions the classification was primarily based on morphological are advantageous for producing sweet melon. Thick- and physiological characters, and the genetic diversity skinned melon called Hami melon (“Hami Gua” in within each variety, and the genetic relationship between Chinese) is cultivated in 41 kha with a total production varieties, has remained unclear. of 1.1 million tons a year. In the last decade, the genetic diversity and Local landraces of Hami melon are rich in diversity, phylogenetic relationship between various groups of and 101 local landraces of melon were collected in cultivated melon have been studied using analysis of Xinjiang to study melon germplasm in the 1950s and molecular polymorphism, which can be easily detected 1980s (Wu, 1982). These landraces were classified as using various types of DNA markers, such as random var. cassaba Pang Greb (round fruits with three or five amplified polymorphic DNA (RAPD: Dhillon et al., carpels, one accession), var. chandalak Pang Greb (extra 2007; López-Sesé et al., 2003; Luan et al., 2008; Nakata early Guadan melon, five accessions), var. ameri Pang et al., 2005; Soltani et al., 2010; Staub et al., 2000, 2004; Greb (summer melon, 70 accessions), and var. zard Pang Stepansky et al., 1999; Tanaka et al., 2007; Yi et al., Greb (winter melon, 25 accessions) (Lin, 1991). Figure 1 2009), simple sequence repeats (SSRs: Dhillon et al., shows photographs of typical fruits of these varieties. 2007; Garcia-Mas et al., 2004; López-Sesé et al., 2002; Var. ameri consists of early maturing and mid-season Monforte et al., 2003; Nakata et al., 2005; Staub et al., maturing groups. Similarly, var. zard includes autumn 2000), and amplified fragment length polymorphism melon and late maturing winter melon groups. The (AFLP: Garcia-Mas et al., 2000; Yashiro et al., 2005). sowing time is from the end of March (south Xinjiang) These results showed distinct genetic differentiation to the middle of April (north Xinjiang). The harvest of between subsp. agrestis and subsp. melo, which were var. chandalak starts from 10 June, and the latest defined by Pitrat et al. (2000) and Jeffrey (2001): subsp. maturing winter melon (var. zard) is harvested in agrestis has short hairs on the ovary and subsp. melo October; the fruits of var. zard are stored until May of has long hairs on the ovary. Seed size is also an important the next year. Cultivation of these types facilitates the character to distinguish these two subspecies. Small-seed year-round supply of Hami melon. Among these types, type melon groups Conomon and Agrestis with seed length shorter than 9 mm were classified as subsp. agrestis, and large-seed type melon groups Catalupensis, Inodorus and Flexuosus with seed length over 9 mm were classified as subsp. melo (Akashi et al., 2002). However, the genetic differentiation between varieties is not clear within each subspecies, and subsp. melo accessions of groups Catalupensis, Inodorus and Flexuosus have been clustered together (López-Sesé et al., 2003; Soltani et al., 2010; Stepansky et al., 1999). In contrast, the geographical variation in each horticultural group is often significant, as indicated by López-Sesé et al. (2003) who detected clear differences between Spanish landraces and US-EU improved cultivars of Inodorus, although most Inodorus accessions analyzed in these studies were selected from Europe and USA, and little attention was paid to accessions from Central Asia and China. Although Monforte et al. (2003) analyzed one accession each of varieties chandalak and ameri, these accessions were from Russia and Uzbekistan, respectively. Therefore, little is known about Fig. 1. Photographs of fruits of four varieties of Hami melon. the genetic diversity and genetic structure of Hami 54 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato melon, irrespective of its importance as a novel genetic included as Central Asian accessions, Spanish acces- resource for a wide range of shelf life, flavor, high sugar sions, US Inodorus, and US Cantalupensis, respectively, content, large fruit, etc. (Lin, 1991; Liu et al., 2004). in this study, even though Tanaka et al. (2007) used them In Central Asian countries located to the west of as reference accessions. Xinjiang, group Inodorus is mainly grown, and group For DNA analysis, total DNA was extracted from one Conomon vars. conomon and makuwa are mainly grown plant of each accession, as described below. The 120 in the eastern part of China. Based on their geographical accessions were classified into large-seed type (≥ distribution and their similar morphological traits, such 9.0 mm) and small-seed type (< 9.0 mm) based on their as fruit shape and seed length, speculating that Hami seed length according to Akashi et al. (2002). melon was introduced from Central Asia seems Seeds of these accessions were provided by the North reasonable. Akashi et al. (2002) also supported this idea Central Regional Plant Introduction Station, Iowa State by indicating independent origins of Hami melon and University (USDA-ARS), USA; National Institute of Chinese Conomon using isozyme analysis, Tanaka et al. Vegetable and Tea Science (NIVTS), Japan; Institute of (2006) studied the sequence polymorphism in the Plant Genetics and Crop Plant Research (IPK), Germany. chloroplast genome to classify cytoplasmic types, that These accessions were cultivated in the field or in a is, the maternal lineage, of cultivated melon, and showed glasshouse at Okayama University, Japan. that both Hami melon and Inodorus from Central Asia have the same PS-ID sequence (T-type), which differed DNA extraction from that (A-type) of group Conomon. However, Seeds were sown on filter paper and were grown at analysis of ccSSR markers showed contradictory results 26°C in a 16 h light-8 h dark cycle at light intensity (Tanaka et al., 2006): the amplified fragment size of 46.5 μmol·m−2·s−1. Ten-day-old seedlings were individu- ccSSR7 was 333 bp in Inodorus accessions from Spain, ally ground in liquid nitrogen, and total DNA was USA, and Central Asia, and was 338 bp in Hami melon extracted using the procedure of Murray and Thompson and group Conomon. These results indicated the (1980) with minor modifications. importance of analyzing the genetic structure of Inodorus melon of different geographical origins to know the Analysis of PS-ID and ccSSR7 origin and diversification of Hami melon. As molecular markers to determine the cytoplasmic Therefore, in this study, the genetic diversity of melon type, two chloroplast markers, SNP in the PS-ID region landraces cultivated in areas from Iran to Xinjiang was (Rpl16-Rpl14) and size polymorphism of ccSSR7, were studied using RAPD and SSR markers and chloroplast analyzed using the same method as Tanaka et al. (2006). genome markers PS-ID and ccSSR7. The genetic The SNP (A/T) in PS-ID sequences (Nakamura et al., relationship between melon landraces was analyzed from 1997) was analyzed using dCAPS primers. The DNA polymorphism data, and the origin and diversifi- nucleotide sequence of each primer was: Psid2F—5' cation of Hami melon are discussed. AAAAAAAAACAATTGCAGATTRAATT 3' (R = A or G) and Psid1R—5' AGCATTTAAAAGGGTCTGAGGT Materials and Methods 3'. PCR amplification was performed in a 10 μL mixture Plant materials containing 50 ng genomic DNA, 1 μL PCR buffer This study analyzed 120 accessions of melon (Sigma, USA: 10 mM Tris-HCl (pH 8.3), 50 mM KCl), μ (C. melo), including landraces from Iran to China 2.5 mM MgCl2, 0.1 mM dNTP, 0.25 M of each primer (Table 1, Fig. 2): 23 accessions of Hami melon from and 0.25 U Taq polymerase (Sigma, USA). Amplification Xinjiang Uyghur Autonomous Region of China, 19 reactions were performed by using an i-Cycler (Bio-Rad, accessions of small-seed type melon from eastern China USA). The PCR cycle was: an initial denaturing step at (group Conomon vars. conomon and makuwa) and 95°C for 3 min, 35 PCR cycles at 95°C for 1 min, 52°C Yunnan, 10 accessions each from Iran and Afghanistan, for 2 min, and 72°C for 2 min. The final extension step 11 accessions from Pakistan, 17 accessions from Central was at 72°C for 5 min. The PCR products were digested Asia (Russia, Kazakhstan, Turkmenistan, Uzbekistan with Apo I (New England BioLabs, USA) and then and Tajikistan), and 9 accessions from Spain. As electrophoresed on 3% agarose gel (GenePure LE; BM improved cultivars, one accession of Hami melon (X011 Bio, Japan) at constant voltage 100 V using a horizontal released in 1986, Fig. 1) from Xinjiang Uyghur gel electrophoresis system (Mupid-2; Cosmo Bio, Autonomous Region and 16 accessions from USA (var. Japan). Gels were stained with ethidium bromide and inodorus; 8, var. cantalupensis; 8) were also used. visualized by illumination with UV light. Also analyzed as reference accessions (RA) were Another marker of the chloroplast genome, the ‘Earl’s Favourite’, ‘Melon Cantalupo di Charentais’ consensus chloroplast SSR marker, ccSSR7 (Chung and (group Cantalupensis), ‘Kinpyo’ (group Conomon var. Staub, 2003), was used in this study because Tanaka et makuwa) and ‘Karimori’ (group Conomon var. al. (2006) reported that ccSSR7 was polymorphic by conomon). Accessions, ‘Kokand’, ‘Tendral o Invernale deletion of 5 bp (ATATT). The nucleotide sequence of a Buccia Verde’, ‘Honey Dew’, and ‘Homegarden’ were each primer was: ccSSR7-F—5' CGGGAAGGGCTCG J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 55

Table 1. List of melon accessions analyzed in this study.

Accession x w v ccSSR7 u Country of origin Province/Cultivar Accession No. Group/Variety Seed size PS-ID Cluster No. (bp) US 84 Iran Mazandaran PI 140666 — L T 338 IV US 86 Iran Khorasan PI 140814 — L T 333 III US 88 Iran West Azerbaijan PI 143231 — L T 333 III US 90 Iran Esfahan PI 230185 — L T 338 Xa US 415 Iran Kerman PI 137834 — L T 333 IV US 417 Iran Mazandaran PI 140675 — L T 338 IV US 422 Iran Tehran PI 211922 — L A 338 IX US 423 Iran East Azerbaijan PI 211923 — S A 338 IX US 425 Iran Fars PI 211942 — S A 338 IX US 431 Iran — PI 351132 — L T 338 Ia IPK 4 Afghanistan — CUM 254 Dudaim S, L A 338 IX US 10 Afghanistan Balkh PI 125942 — L T 333 VIIa US 14 Afghanistan Badakhshan PI 126050 — L T 333 IIa US 19 Afghanistan Samangan PI 127534 — L T 338 IIa US 21 Afghanistan Herat PI 212089 — L T 338 III US 386 Afghanistan Takhar PI 126090 — S A 338 Xa US 387 Afghanistan Jowzjan PI 126105 — S, L T 338 III US 389 Afghanistan Ghazni PI 127550 — L T 338 III US 390 Afghanistan Kabul PI 207478 — L T 338 IIa US 392 Afghanistan Helmand PI 220515 — S T 338 VIIa US 457 Pakistan Punjab PI 116824 — L T 338 III US 458 Pakistan Punjab PI 123188 — S T 338 VIII US 459 Pakistan Sind PI 124552 — L T 338 V US 460 Pakistan Sind PI 124553 — L T 338 V US 461 Pakistan Punjab PI 163211 — S T 338 V US 462 Pakistan Punjab PI 217525 — S T 338 III US 463 Pakistan Mingora PI 217945 — S T 338 VIII US 464 Pakistan Punjab PI 218070 — S T 338 V US 465 Pakistan Mingora PI 218071 — S T 338 V US 466 Pakistan — PI 426629 Flexuosus S A 338 VI US 467 Pakistan Skardu PI 532929 — L T 333 IIa P 173 Russia, Altai region Altajskaja skorospelaja — — L T 338 VIIa P 174 Russia, Altai region Barnaulka — — S T 338 VIIa P 175 Russia, Ukrine Kolkhoznitsa — — L T 338 IV US 95 Kazakhstan Imljskaja VIR 6809 PI 476342 — L T 338 Ib US 531 Kazakhstan Alma Ata Ames 19036 — L T 338 Ib US 119 Turkmenistan Zaami 672 VIR 40689 PI 476331 — L T 338 IIb IPK 64 Turkmenistan — CUM 209 Agrestis S A 338 Xa P 250 Turkmenistan — — — L A 338 VIIa P 251 Turkmenistan — — — S A 338 VIIa US 121 Uzbekistan Kokca 588 VIR 5149 PI 476333 — L T 333 IIc US 122 Uzbekistan Sakor-polak 554 VIR 5883 PI 476337 — L T 333 III z P 118 Uzbekistan Kokand 930172 Inodorus L T 333 IIb P 119 Uzbekistan Mirzuchulskaja 930177 Inodorus L T 333 IIb P 120 Uzbekistan Ak-Urug 930190 var. ameri L T 333 IIb IPK 61 Tajikistan Dushanbe CUM 333 — L T 333 IIc IPK 63 Tajikistan Dushanbe CUM 334 var. chandalak L T 338 IIc IPK 62 Tajikistan Dushanbe CUM 389 — L T 338 III X 001 China Laoguniang — var. ameri (early maturing) L T 338 III X 002 China Mizigua — var. ameri (early maturing) L T 338 IIa X 003 China Kukeqi — var. ameri L T 338 IIb X 005 China Paotaihong — var. zard L T 338 IIb X 006 China Hongxincui — var. ameri L T 338 IIb X 007 China Wanshudonggua — var. zard L T 338 IIb X 008 China Kakeqie — var. ameri L T 338 IIb X 009 China Bixiekexin — var. cassaba L T 338 IIb X 010 China Kuche — var. ameri L T 338 IIb X 011 China Huanghou — var. ameri L T 333 IIb X 012 China Bawudong — var. ameri (early maturing) L T 338 IIb X 013 China Xiekesu — var. ameri (early maturing) L T 338 IIb X 014 China Kashi — var. ameri L T 338 IIb X 021 China Baipicui — var. ameri (early maturing) L T 338 IIb X 023 China Kalakusai — var. zard L T 338 IIb X 024 China Kaernaishi — var. ameri L T 338 IIb 56 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato

Table 1. Continued.

Accession x w v ccSSR7 u Country of origin Province/Cultivar Accession No. Group/Variety Seed size PS-ID Cluster No. (bp) X 030 China Wangwenxiang — var. ameri (early maturing) L T 338 IIb X 031 China Heimeimaomijigan — var. zard L T 338 IIb X 032 China Kutuerkukeqi — var. ameri L T 338 IIb X 043 China Huangdanzi — var. chandalak L T 338 IV X 044 China Qingpiqingrouguadanzi — var. chandalak L T 338 VI X 045 China Reguadan — var. chandalak L T 338 VI X 051 China Qingpiqingroukekouqi — var. zard L T 338 IIb X 053 China Qingpihongroukekouqi — var. zard L T 338 IIb z y P 117 Spain Tendral 950076 Inodorus L T 333 Ic US 102 Spain Zaragoza PI 512411 — L T 333 Ic US 103 Spain Zaragoza PI 512413 — L T 333 Ic US 104 Spain Cadiz PI 512462 — L T 333 Ic US 105 Spain Lerida PI 512489 — L T 333 Ic US 106 Spain Caceres PI 512501 — S, L T 333 Ic US 107 Spain Badajoz PI 512510 — L T 333 Ib US 108 Spain Valencia PI 512564 — L T 333 Ic US 109 Spain Castellon de Plana PI 512581 — S, L T 333 Ic z P 73 USA Honey Dew 940325 Inodorus L T 333 Ia P 74 USA Honey Dew 600011 Inodorus L T 333 Ia P 75 USA Honey Dew 610002 Inodorus L T 333 Ia P 76 USA Honey Dew 650013 Inodorus L T 333 Ia US 7 USA Floridew NSL 20616 Inodorus (casaba type) L T 333 Ia US 217 USA Golden Crenshaw NSL 5647 Inodorus (casaba type) L T 338 Ib US 218 USA Golden Beauty Casaba NSL 5659 Inodorus (casaba type) L T 338 Ib US 221 USA Sungold Casaba NSL 5709 Inodorus (casaba type) L A 338 Ia P 67 USA Rocky Ford 920049 Cantalupensis L T 338 VIIb z P 68 USA Homegarden 600063 Cantalupensis L T 333 VIIb P 69 USA Georgia 47 920047 Cantalupensis L T 338 VIIb P 72 USA #58-21 600068 Cantalupensis L T 333 VIIb P 93 USA SC108 590034 Cantalupensis L T 338 VIIb P 107 USA Rio Gold 600015 Cantalupensis L T 338 VIIa P 108 USA Hales Best 600021 Cantalupensis L T 338 VIIb P 109 USA Spicy 940326 Cantalupensis L T 333 VIIb C 28 China Xingtangmiangua — Conomon var. makuwa S A 338 Xc P 83 China Mi-tang-tin 910008 Conomon var. makuwa S A 338 Xb P 142 China Damiangua 760007 Conomon var. makuwa S A 338 Xb P 143 China Shidaodaqinggua 760008 Conomon var. makuwa S A 338 Xb P 144 China Shilinghuangjingua 780143 Conomon var. makuwa S A 338 Xb P 147 China Wengua 910055 Conomon var. makuwa S A 338 Xb P 153 China Chi-86-56 940178 Conomon var. makuwa S A 338 Xb P 155 China Qianzhong-5 940184 Conomon var. makuwa S A 338 Xb P 208 China Chi-87-12 2000121 Conomon var. makuwa S A 338 Xc C 32 China Heipilengzisudigua — Conomon var. conomon S A 338 Xc P 154 China Chi-86-61 940182 Conomon var. conomon S A 338 Xb P 158 China Qingpilürouxianggua 940307 Conomon var. conomon S A 338 Xb P 169 China Caigua — Conomon var. conomon S A 338 Xb P 171 China Qingpicaigua — Conomon var. conomon S A 338 Xb CYW 37 China Yunnan — Conomon S A 338 Xd CYW 38 China Yunnan — Conomon S A 338 Xd CYW 49 China Yunnan — Conomon S A 338 Xd CYW 60 China Yunnan — Conomon S A 338 Xd CYW 61 China Yunnan — Conomon S A 338 Xd z P 62 RA UK Earl’s Favourite 900074 Cantalupensis L T 338 IIa z y P 94 RA Italy Charentais 910049 Cantalupensis L T 338 VIIb z P 90 RA Japan Kinpyo 920007 Conomon var. makuwa S A 338 Xc z P 130 RA Japan Karimori 940333 Conomon var. conomon S A 338 Xc z Reference accessions used by Tanaka et al. (2007). y Tendral; Tendral o Invernale a Buccia Verde, Charentais; Melon Cantalupo di Charentais. x Accession No. at USDA, IPK, and NIVTS. w —; Local landraces whose horticultural group/variety was not specified. v S; Small-seed type, L; Large-seed type. u Cluster number shown in Figure 6. J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 57

KGCAG 3' (K = T or G) and ccSSR7-R—5' GTTCGAAT 72°C for 2 min. The final extension step was at 72°C CCCTCTCTCTCCTTTT 3'. The PCR mixture and PCR for 5 min. After amplification, electrophoresis and gel cycle were the same as for PS-ID analysis, but annealing staining were performed as for PS-ID analysis, but the was performed at 56°C for 1 min. PCR products were concentration of agarose gel was 1.5%. electrophoresed on 10% nondenatured polyacrylamide For SSR analysis, as a preliminary experiment, size gel at a constant voltage of 260 V. Gels were stained as polymorhism was examined for large-seed type melon above. accessions Hami 2 (China, group Inodorus), Kokand (Uzbekistan, group Inodorus), and Melon Cantalupo di RAPD and SSR analysis Charentais (Italy, group Cantalupensis), and a small-seed Eighteen random primers (12-mer; Bex, Japan), which type melon accession SUD-4 (Sudan, group Agrestis). were selected for their ability to detect polymorphism Sixteen SSR markers showing distinct stable polymor- by Tanaka et al. (2007), were used in this study (Table 2). phism were selected among 177 SSR markers developed The PCR mixture was the same as for PS-ID analysis, by Danin-Poleg et al. (2000), Akashi et al. (2001), Chiba but the concentration of primers was 0.5 μM. The PCR et al. (2003), Ritschel et al. (2004), and Fukino et al. cycle was: an initial denaturing step at 95°C for 3 min, (2007). Table 3 shows details of the SSR markers used. 40 PCR cycles at 93°C for 1 min, 40°C for 2 min, and The method for ccSSR7 analysis was used for SSR analysis.

Data analysis Marker bands of RAPD were scored as 1 for present and 0 for absent. For SSR, marker fragments were scored based on their size from smallest (1) to largest. From these data, the polymorphic index content (PIC) was calculated according to Anderson et al. (1993). The genetic similarity (GS) between accessions was calculated as described by Apostol et al. (1993), and the gene diversity (D) within each group and genetic distance (GD) among groups were calculated as described by Weir (1996) and Nei (1972), respectively. A dendrogram was constructed using the Phylip program with the Fig. 2. Map of China and neighboring countries. Countries are named unweighted pair group method and the arithmetic mean whose melon landraces were examined in this study.

Table 2. Eighteen random primers used in this study, with the size of polymorphic fragments and their polymorphic index content (PIC).

Primer number Sequence Size of polymorphic Polymorphic index (5' → 3') fragments (bp) content (PIC) A07 GATGGATTTGGG 970* 0.358 A20 TTGCCGGGACCA 1100*, 800* 0.219, 0.255 A22 TCCAAGCTACCA 1520* 0.255 A23 AAGTGGTGGTAT 1200 0.489 A26 GGTGAGGATTCA 1400 0.439 A31 GGTGGTGGTATC 800 0.391 A39 CCTGAGGTAACT 2027 0.499 A41 TGGTAGGTAACT 1353, 1020, 930 0.460, 0.495, 0.231 A57 ATCATTGGCGAA 800 0.460 B15 CCTTGGCATCGG 600 0.391 B32 ATCATCGTACGT 900, 700 0.193, 0.080 B68 CACACTCGTCAT 1078 0.444 B71 GGACCTCCATCG 1220 0.483 B84 CTTATGGATCCG 700, 600, 550 0.499, 0.499, 0.455 B86 ATCGAGCGAACG 1500, 1350* 0.499, 0.049 B96 CTGAAGACTATG 850, 750 0.439, 0.489 B99 TTCTGCTCGAAA 1400* 0.375 C00 GAGTTGTATGCG 1350* 0.320

*; No polymorphism among 24 Hami melon landraces. PIC was indicated from the larger fragment, when two or three markers were produced. 58 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato

Table 3. Primer sequences of 16 SSR markers used in this study, with the expected size of PCR products and their polymorphic index content (PIC).

Expected fragment Polymorphic index Marker F primer (5' → 3') R primer (5' → 3') size (bp) content (PIC) ACS2-ms1 TCTTTTGTTCTTGGTTGTGAGT GATTGCTTTATTTTGAATCTTTTG 200 0.892 CMBR 2 TGCAAATATTGTGAAGGCGA ATCCCCACTTGTTGGTTTG 114 0.839 CMBR 12 ACAAACATGGAAATAGCTTTCA GCCTTTTGTGATGCTCCAAT 134 0.651 CMBR 22 TCCAAAACGACCAAATGTTCC ATACAGACACGCCTTCCACC 177 0.724 CMBR 53 GCCTTTTGTGATGCTCCAAT AAACAAACATGGAAATAGCTTTCA 134 0.607 CMBR 83 CGGACAAATCCCTCTCTGAA GAACAAGCAGCCAAAGACG 142 0.595 CMBR 105 TGGTAAGCATTTTGAAATCACTTTT TTCCAGACATCTAAAGGCATTG 139 0.673 CMBR 120 CTGGCCCCCTCCTAAACTAA CAAAAAGCATCAAAATGGTTG 167 0.582 CMN 04-03* ATCACAGAGACCGCCAAAAC GGTTGAAGATTGCGCTTGAT 218 0.575 CMN 04-07 GAAAGCATTAAATATGGCATTGG AAGCTTAACAGCTTCCAGGG 286 0.771 CMN 04-40 CACCTGACGATAGGGGTGTT AGTATTCGGGTTGGCAAAAA 212 0.552 CMN 08-22* CATCCTCCTCATCCTCCTCA ACGGATGAATCGGAACTTCA 223 0.406 CMN 08-90* CCACGCCCTCTATACCCATA GGGACTGTTGGGTTTTCTGA 210 0.341 CMN 21-41 GAGGAAATTTTGGAGTTTTTCAA TTCCAGACATCTAAAGGCATTG 281 0.527 CMN 22-16 CAGAGGAGGTGGAACTAACCA CCATTTTCAACCTCCCAAGA 233 0.609 CMN 61-44 TGTTGGAGTTTAATGAGGAAGGA AGAGAAGATGAATGGGGCAC 233 0.901 *; No polymorphism among 24 Hami melon landraces.

Table 4. Variation of chloroplast genome type among melon accessions with different geographical origin.

Area/Group No. of Large-seed type Small-seed type accessions y y y y y y A/338 T/338 T/333 Total A/338 T/338 T/333 Total Iran 10 1 4 3 8 2 — — 2 Afghanistan 10 0.5x 4.5x 27 1.5x 1.5x —3 Pakistan 11 — 3 1 4 1 6 — 7 Central Asia 17 1 7 6 14 2 1 — 3 Hami melon 24 — 23 1 24 — — — 0 Spain 9 — — 8 8 — — 1 1 US Inodorus 8 1 2 5 8 — — — 0 US Cantalupensis 8 — 5 3 8 — — — 0 Chinese Conomon 19 — — — 0 19 — — 19 RAz 4— 2— 2 2—— 2

Total 120 3.5 50.5 29 83 27.5 8.5 1 37 z Reference accessions (RA). y Chloroplast genome type was indicated by the combination of PS-ID SNP and ccSSR7, like A/338. x For accessions with large and small seeds mixed in original seed sample, the count was divided into large- and small-seed types.

(UPGMA) method. Principal coordinate analysis (PCO: they could not be grouped into the large- or small-seed Gower, 1966) based on the genetic similarity matrix was type. As expected, accessions of Hami melon, US performed to show multiple dimensions of each group Inodorus, and US Cantalupensis were all large-seed type, and the accessions in a scatter plot. and all accessions of Conomon from China and Japan were small-seed type. However, both large- and small- Results seed types were in landraces from Iran, Afghanistan, Seed size Pakistan, and Central Asia. Seed size was from 4.8 mm to 16.0 mm among accessions, and 120 melon accessions were grouped into PS-ID and ccSSR7 of chloroplast genome the large-seed type (81 accessions) and small-seed type Based on the SNP in the PS-ID region (Rpl16-Rpl14), (35 accessions) (Table 1). The original seed samples of 120 melon accessions were grouped as A-type (31 four accessions from Afghanistan and Spain were a accessions) and T-type (89 accessions) (Tables 1 and 4). mixture of small and large seeds, which might reflect T-type accessions were further divided into two groups the polymorphism in a farmer’s field or derive from by the size polymorphism of ccSSR7: 338 bp type (59 spontaneous hybridization in a farmer’s fields, and thus accessions) and 333 bp type (30 accessions). All A-type J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 59 accessions were 338 bp type. As a result, the 120 melon Hami melon, even though its morphological and accessions were classified into three cytoplasmic types physiological traits are diverse. (Table 4) by analysis of PS-ID and ccSSR7. The frequency of the three cytoplasmic types differed SSR analysis between large- and small-seed types (χ2 = 65.97, df = 2, A total of 114 polymorphic marker bands were P < 0.01). Large-seed type accessions consisted mostly amplified from 120 melon accessions using 16 primer of cytoplasmic types T/338 bp type and T/333 bp type. sets. The average number of polymorphic bands of each All accessions of Spanish melon and US Honey Dew primer set, which was considered to represent the number were T/333 bp type. Hami melon accessions were of alleles, was 7.13, and ranged from two (CMN 08-22) T/338 bp type, except X011, showing a difference in to 17 (CMN 61-44 and ACS2-ms1). The most maternal lineage within group Inodorus, as well as polymorphic marker was CMN 61-44 (PIC = 0.901), between Hami melon and Chinese Conomon. followed by ACS2-ms1 (PIC = 0.892) (Fig. 3B). The least polymorphic marker was CMN 08-90 (PIC = 0.341), RAPD analysis followed by CMN 08-22 (PIC = 0.406). Hami melon Eighteen primers provided 26 polymorphic marker accessions were monomorphic for three markers bands of approximately 550–2027 bp in size, and the (Table 3, asterisk). average number of marker bands produced by each The gene diversity was 0.640 for 120 melon primer was 1.44 (Table 2). Most polymorphic bands were accessions, and the largest diversity was for Central produced by primers A39 and B84 (Fig. 3A), and their Asian accessions (D = 0.522), followed by accessions marker bands of 2027 bp and 700 bp (A39-2027 and from neighboring countries, such as Iran, Afghanistan, B84-700, respectively) were amplified in 63 accessions and Pakistan (Table 5). However, D was low for Hami among 120 melon accessions. They were followed by melon accessions (D = 0.323), which was similar to markers B84-600 and B86-1500, which were amplified Spanish and US Inodorus accessions. This result also in 58 and 62 accessions, respectively. In contrast, the indicated rather small genetic variations in Hami melon. least polymorphic band was produced by primer B86, whose marker band of 1350 bp was amplified in 117 Analysis by combined RAPD and SSR accessions. Hami melon accessions were monomorphic The gene diversity calculated by combining RAPD for seven markers (Table 2, asterisk). and SSR data was 0.476 for 120 melon accessions, and The gene diversity was 0.376 for 120 melon the largest diversity was observed for Central Asian accessions, of which the largest diversity was for Iran accessions (D = 0.377), except RA, followed by accessions (D = 0.288), except RA, followed by acces- accessions from neighboring countries, such as Iran, sions of neighboring countries, such as Afghanistan, Afghanistan, and Pakistan (Table 5). However, it was Pakistan, and Central Asia (Table 5). However, D was low for Hami melon accessions (D = 0.243). low for Hami melon accessions (D = 0.194), which was The GD between nine melon populations was similar to accessions of US Cantalupensis and Chinese calculated from the frequency of RAPD and SSR marker Conomon, indicating rather small genetic variations in bands in each population. The GD from Hami melon was 0.089 (Central Asia) to 0.997 (Chinese Conomon) (Table 6). The genetic relationship between populations

Table 5. Gene diversity within each population, calculated from RAPD and SSR data, singly or combined.

No. of Gene diversity Area/Group accessions RAPD SSR SSR + RAPD Iran 10 0.288 0.518 0.376 Afghanistan 10 0.278 0.491 0.360 Pakistan 11 0.275 0.487 0.355 Central Asia 17 0.287 0.522 0.377 Hami melon 24 0.194 0.323 0.243 Spain 9 0.156 0.330 0.222 US Inodorus 8 0.147 0.338 0.219 US Cantalupensis 8 0.197 0.371 0.263 Chinese Conomon 19 0.182 0.373 0.255 Fig. 3. Polymorphism among melon landraces studied. (A) Random z RA 4 0.293 0.516 0.378 amplified polymorphic DNA (RAPD) with B84 primer on 1.5% agarose gel. (B) Simple sequence repeat (SSR) with primer All accessions 120 0.376 0.640 0.476 ACS2-ms1 on 10% nondenatured polyacrylamide gel. Arrows show polymorphic bands. Lane M, 100 bp DNA ladder marker. z Reference accessions (RA). 60 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato

Table 6. Genetic distance between nine populations of melon of different geographical origin, calculated from RAPD and SSR analysis.

US US Area/Group Iran Afghanistan Pakistan Central Asia Hami melon Spain Inodorus Cantalupensis Afghanistan 0.086 — Pakistan 0.130 0.110 — Central Asia 0.124 0.086 0.130 — Hami melon 0.195 0.153 0.182 0.089 — Spain 0.203 0.196 0.236 0.146 0.155 — US Inodorus 0.182 0.206 0.250 0.142 0.183 0.146 — US Cantalupensis 0.252 0.261 0.243 0.252 0.389 0.421 0.313 — Chinese Conomon 0.606 0.744 0.669 0.815 0.997 1.036 0.996 0.581

Fig. 4. Genetic relationship between nine melon populations, shown by UPGMA cluster analysis based on the GD. was visualized using UPGMA cluster analysis and PCO analysis. Cluster I consisted of Chinese Conomon, which is related distantly to other populations (Fig. 4). Cluster Fig. 5. Distribution on the first and third principal coordinates of II was US Cantalupensis. Hami melon formed cluster nine melon groups. III together with landraces from Pakistan, Iran, Afghanistan, and Central Asia. Spanish accessions and clusters. Four of these clusters were further divided into US Inodorus were classified as cluster IV. The genetic 12 subclusters. Table 7 summarizes the number of melon relationship indicated by cluster analysis was clearly accessions classified into each cluster and subcluster. reproduced on a PCO plot of the 1st and 3rd principal Cluster I was divided into three subclusters, mostly coordinates that explained 57.3% and 9.8% of total of US Inodorus and Spanish accessions. Cluster II was variance, respectively (Fig. 5). also divided into three subclusters; 20 of 24 Hami melon accessions were classified in this cluster, together with Genetic relationship among melon accessions landraces from Afghanistan, Pakistan, and Central Asia. The GD between the 120 melon accessions was Nineteen accessions of Hami melon, of var. ameri, var. calculated from the RAPD and SSR data. The average zard, or var. cassaba, were grouped in subcluster IIb, GD was 0.480 and ranged from 0.024 to 0.881 (data not which also included one accession of Turkmenistan shown). The largest GD was recorded between US121 (T/338 bp type) and three accessions of Uzbekistan (Uzbekistan) and P158 (Chinese Conomon). The (T/333 bp type). Interestingly, reference accession ‘Earl’s smallest GD was between accession pairs X010 and Favourite’ was grouped into subcluster IIa, even though X024 (Hami melon), CYW60 and CYW61 (Yunnan), this is a famous Japanese cultivar of Cantalupensis, the and P74 and P76 (US Honey Dew). The GD, calculated remaining accessions of which were grouped in cluster by combining the RAPD and SSR data, related to those VII. Clusters III to VI included melon landraces from calculated singly from RAPD data (r = 0.950, P < 0.01) Iran, Afghanistan, Pakistan, and Central Asia. Four and from SSR data (r = 0.895, P < 0.01). The correlation accessions of Hami melon were also classified in these coefficient between the GDs calculated singly from clusters; three of the four were var. chandalak. Cluster RAPD and SSR data was 0.711 (P < 0.01). VII was also divided into two subclusters. All To determine the genetic relationship between melon Cantalupensis accessions, except ‘Earl’s Favorite’, were landraces, a dendrogram was constructed based on GD grouped in this cluster together with landraces from values calculated by combining RAPD and SSR data Central Asia and Afghanistan. Clusters VIII was (Fig. 6). The 120 accessions were grouped into 10 major landraces from Pakistan and cluster IX was landraces J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 61

Fig. 6. Genetic relationship between 120 melon accessions, including 24 accessions of Hami melon, shown by UPGMA cluster analysis based on genetic distance calculated from RAPD and SSR. Table 1 explains the accession numbers within each cluster and subcluster. 62 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato

Table 7. Number of melon accessions classified into 10 clusters, in each melon population.

No. of Cluster Area/Group accessions Ia Ib Ic IIa IIb IIc III IV V VI VIIa VIIb VIII IX Xa Xb Xc Xd Iran 101–––––23–––––31––– Afghanistan 10 – – – 3––3–––2––11––– Pakistan 11 – – – 1––2–51––2––––– Central Asia 17–2––4321––4–––1––– Hami melon 24–––119–11–2–––––––– Spain 9 –18––––––––––––––– US Inodorus 8 62–––––––––––––––– US Cantalupensis 8 – – –––––––17–––––– Chinese Conomon19–––––––––––––––1135 RAz 4 –––1–––––––1––––2–

Total 120758623310553782431155 z Reference accessions (RA). from Iran and one accession of group Dudaim from as a unique marker for small-seed type melon from East Afghanistan. Cluster X related distantly to other clusters Asia. was divided into four subclusters, among which two Although the ability of SSR to discriminate was higher subclusters (Xb and Xc) comprised Chinese and Japanese than that of RAPD, RAPD markers A41-1353, A41- accessions of Conomon vars. conomon and makuwa. 1020, B68-1078, and B71-1220 were also polymorphic Subcluster Xd consisted of Conomon accessions from in all nine populations. RAPD markers B84-700 and Yunnan. Subcluster Xa included landraces from Iran, B84-600 were polymorphic in eight populations, except Turkmenistan, and Afghanistan. Chinese Conomon, and in B86-1500, except US Cantalupensis. For these seven RAPD markers, the PIC Discussion was from 0.444 to 0.499 (Table 2). The 18 RAPD primers To show the genetic diversity of Hami melon, 16 SSR used in this study were strictly selected from 176 primers, markers and 26 RAPD markers were used in this study. based on their ability to detect polymorphism and the The gene diversity detected by SSR and RAPD analyses stability of PCR amplification by Tanaka et al. (2007). was 0.640 and 0.376, respectively, for 120 melon The strictness of their selection can be seen in this study accessions (Table 5). The GD between melon accessions from the small number of marker bands of each primer also differed depending on the marker system used. The (1.44), similar to 1.69 of Mliki et al. (2001) and much GD averaged 0.646 (SSR) and 0.379 (RAPD), and the smaller than 11.22 of Dhillon et al. (2007). variation was 0.037 for SSR and 0.029 for RAPD (data Among the melon accessions studied, Chinese not shown). Such differences depending on the marker Conomon should be classified as C. melo ssp. agrestis system were also reported by Staub et al. (2000) and and the others as C. melo ssp. melo according to the Nakata et al. (2005), indicating that the ability of SSR classification of Pitrat et al. (2000) and Jeffrey (2001). markers to discriminate was better than that of RAPD Figures 4 and 5 clearly show the genetic differentiation markers. Polymorphism was successfully detected in all between these subspecies, as already reported by nine melon populations by five markers (CMN 04-07, Stepansky et al. (1999) and Monforte et al. (2003). These CMN 61-44, CMBR 2, CMN 04-40, CMN 21-41) among two figures also show a close relationship between the 16 SSR markers used (data not shown). For the first Spanish accessions and US Inodorus, which was rather three markers especially, PIC was high and over 0.771 distantly related to US Cantalupensis. Although (Table 3). These five SSR markers are useful for diversity Cantalupensis (Galia type) and Inodorus (Cassaba, Piel analysis of melon. Although SSR markers, CMBR 22, de Sapo, and Tendral types) are grown in Spain (López- CMBR 83, CMBR 105, ACS2-ms1, and CMBR 53, were Sesé et al., 2002), Galia type was not included in the also highly polymorphic, the first three markers were Spanish accessions examined here and thus should be monomorphic in US Cantalupensis, and the last two classified as group Inodorus. Therefore, Figures 4 and 5 markers were monomorphic in Chinese Conomon. also successfully show a close relationship within group ACS2-ms1 was developed to detect the repeat number Inodorus of members of different geographical origin. polymorphism of (TA) in the 5' flanking region of CMe- These results show the usefulness of the RAPD and SSR ACS2 (Akashi et al., 2001). The amplicon size of Chinese marker sets used in this study for diversity and Conomon seemed unique and the same size of fragment phylogenetic analyses of melon, as well as for cultivar was amplified only from two accessions from Iran and identification. one accession from Afghanistan; thus, this could be used We believe this is the first study of the genetic diversity J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 63 of Hami melon analyzed using RAPD and SSR markers. skinned Chinese melon (Luan et al., 2008). Thick- The gene diversity of Hami melon (D = 0.243) was skinned melon accessions correspond to either Inodorus similar to the D of Spanish accessions, US Cantalupensis, or Cantalupensis, and thin-skinned accessions corre- and Chinese Conomon, and was smaller than the D of spond to Conomon. However, only one accession of landraces from Iran to Central Asia (Table 5). The gene thick-skinned melon from Xinjiang was studied by Luan diversity in each variety of Hami melon was even smaller et al. (2008), and thus the genetic relationship between at 0.186 in var. ameri, 0.160 in var. zard, and 0.201 in Hami melon and melon accessions from other areas var. chandalak (data not shown). Hami melon landraces remains unknown. In this study, genetic differentiation of these varieties shared an identical chloroplast genome between Hami melon and Conomon of eastern China type (T/338 bp), while an improved cultivar of Hami was clearly indicated (Table 6, Fig. 4). Analysis of the melon (X011, Fig. 1), bred by crossing with foreign chloroplast genome type showed that Hami melon germplasm, had a different chloroplast genome type (T/338 bp type) and Conomon (A/338 bp type) belong (T/333 bp) (Table 4). Therefore, the genetic variation of to different maternal lineages (Table 4). Hami melon was rather small, even though Hami melon In the case of melon accessions of Central Asia, consisted of different varieties (chandalak, ameri, zard, varieties chandalak, ameri, zard, cassaba, bucharica, cassaba) with diverse morphological traits, earliness, and gurvak are grown in Uzbekistan (Mavlyanova et al., and fruit shelf life (Lin, 1991). 2005). Figures 4 and 5, based on the genetic distance Figure 6 clearly shows the genetic relationship and shown in Table 4, show that Hami melon is related differentiation between Hami melon varieties. Hami closely to melon landraces of areas from Iran to Central melon accessions of vars. ameri and zard were mostly Asia. Large-seed type melon accessions sharing the same grouped as subcluster IIb, but those of var. chandalak maternal lineages as Hami melon (T/338 bp type) were as clusters IV and VI. The GD calculated between each in Central Asia (Table 4), even though Tanaka et al. pair of ameri accessions and zard accessions averaged (2006) reported only the T/333 bp type. The T/338 bp 0.210, but it was 0.409 between three accessions of var. type was distributed frequently from Iran to Central Asia chandalak and 20 accessions of vars. ameri and zard (Table 4), and several accessions, such as US 119 (data not shown). These results clearly indicated that (Turkmenistan, subcluster IIb), US 19, US 390 (both var. chandalak was rather distantly related to vars. ameri Afghanistan, subcluster IIa), were closely related to and zard, which were closely related to each other. Var. Hami melon (vars. ameri and zard) by analysis of the chandalak is early maturing and is grown mainly for nuclear genome (Table 1, Fig. 6). We therefore concluded local consumption because of its poor shelf life (one that Hami melon may have been transmitted from the week). Var. ameri consists of early and mid-season west along the so-called “Silk Road.” maturing groups (Lin, 1991). The fruit shelf life also Another interesting conclusion was deduced about the differs, at approximately two weeks and one month, origin of ‘Earl’s Favourite’, which is the leading breed respectively. The mid-season maturing group of var. of Japanese Cantalupensis melon. This cultivar was ameri, as well as of var. zard, whose shelf life is over imported from the UK in 1925. Among Cantalupensis one month, are commonly grown for export to eastern accessions imported from France and the UK, only China and other countries as Hami melon. These ‘Earl’s Favourite’ adapted to the Japanese growing accessions with a long shelf life were grouped into conditions and it was selected as one of the sweetest. subcluster IIb (Table 1, Fig. 6), indicating their close Although the mature fruit is less fragrant, this cultivar relationship. Therefore, we suggest that not only var. has a good shelf life and has been intensively used as a zard but also the mid-season maturing group of var. cross parent for melon breeding. In this study, ‘Earl’s ameri should be classified as Inodorus, even though Favourite’ was used as a reference accession of group Pitrat et al. (2000) did not include var. ameri as Inodorus. Cantalupensis, and was expected to show a close The fruit shelf life of the early maturing group of var. relationship to accessions of US Cantalupensis. ‘Earl’s ameri is 1–2 weeks, and two of six accessions were Favourite’ had an identical chloroplast genome type to grouped into clusters IIa and III, not into IIb (Table 1, US Cantalupensis (T/338 bp type) (Tables 1 and 4). Fig. 6). Similar variation of shelf life, from two weeks However, they were classified as distant subclusters, IIa to three months, is also known in var. ameri of Uzbek (‘Earl’s Favourite’) and VIIb (US Cantalupensis), by melon (Mavlyanova et al., 2005). Therefore, the analysis of nuclear genome markers (Table 1, Fig. 6). classification of var. ameri should be reconsidered. Cluster II consisted of vars. ameri and zard of Hami The genetic diversity between Chinese melon melon and landraces from Iran to Central Asia. We landraces has been studied in the last decade. Based on therefore suggest that ‘Earl’s Favourite’ might be isozyme variation, Akashi et al. (2002) indicated distinct selected from the hybrid of Inodorus melon from Iran genetic differentiation between the large-seed type, to Xinjiang and European Cantalupensis melon, even including Hami melon, and the small-seed type though no information is available about the origin of cultivated in eastern China. RAPD analysis has indicated this cultivar. genetic differentiation between thick-skinned and thin- 64 Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato

Acknowledgments D. K. Wu and D. P. Lin (eds.). Chinese Melon. Popular Science Press, Beijing (In Chinese). We would like to thank Dr. Y. Sakata, National Liu, L., F. Kakihara and M. Kato. 2004. Characterization of six Institute of Vegetable and Tea Science (NIVTS), Japan, varieties of Cucumis melo L. based on morphological and Dr. K. R. Reitsma, Iowa State University, USA, and physiological characters, including shelf-life of fruit. Dr. A. Graner, Leibniz Institute of Plant Genetics and Euphytica 135: 305–313. Crop Plant Research (IPK), Germany, for kindly López-Sesé, A. I., J. E. Staub and M. L. Gómez-Guillamón. 2003. Genetic analysis of Spanish melon (Cucumis melo L.) supplying the seeds, and Dr. N. Fujishita for his kind germplasm using a standardized molecular-marker array and encouragement throughout this study. geographically diverse reference accessions. Theor. Appl. Literature Cited Genet. 108: 41–52. López-Sesé, A. I., J. E. Staub, N. Katzir and M. L. Gómez- Akashi, Y., N. Fukuda, T. Wako, M. Masuda and K. Kato. 2002. Guillamón. 2002. Estimation of between and within accession Genetic variation and phylogenetic relationships in East and variation in selected Spanish melon germplasm using RAPD South Asian melon, Cucumis melo L., based on the analysis and SSR markers to assess strategies for large collection of five isozymes. Euphytica 125: 385–396. evaluation. Euphytica 127: 41–51. Akashi, Y., S. Shiomi, Y. Kubo, M. Masuda and K. Kato. 2001. Luan, F., I. Delannay and J. E. Staub. 2008. Chinese melon Microsatellite and CAPS markers for ethylene-related genes, (Cucumis melo L.) diversity analyses provide strategies for 1-Aminocyclopropane-1-Carboxylic Acid (ACC) synthase germplasm curation, genetic improvement, and evidentiary and ACC Oxidase genes, and their variation in melon support of domestication patterns. Euphytica 164: 445–461. (Cucumis melo L.). Breed. Sci. 51: 107–112. Mavlyanova, R., A. Rustamov, R. Khakimov, A. Khakimov, M. Anderson, J. A., G. A. Churchill, J. E. Autrique, S. D. Tanksley Turdieva and S. Padulosi. 2005. Melons of Uzbekistan. and M. E. Sorrells. 1993. Optimizing parental selection for IPGRI’s Sub-regional office for Central Asia, Tashkent. genetic-linkage maps. Genome 36: 181–186. Mliki, A., J. E. Staub, Z. Y. Sun and A. Ghorbel. 2001. Genetic Apostol, B. L., W. C. I. V. Black, B. R. Miller, P. Reiter and B. J. diversity in melon (Cucumis melo L.): An evaluation of Beaty. 1993. Estimation of the number of full sibling families African germplasm. Genet. Resour. Crop Evol. 48: 587–597. at an oviposition site using RAPD-PCR markers: applications Monforte, A. J., J. Garcia-Mas and P. Arús. 2003. Genetic to the mosquito Aedes aegypti. Theor. Appl. Genet. 86: 991– variability in melon based on microsatellite variation. Plant 1000. Breed. 122: 153–157. Chiba, N., K. Suwabe, T. Nunome and M. Hirai. 2003. Munger, H. M. and R. W. Robinson. 1991. Nomenclature of Development of microsatellite markers in melon (Cucumis Cucumis melo L. Cucurbit Genet. Coop. Rep. 14: 43–44. melo L.) and their application to major Cucurbit crops. Breed. Murray, G. C. and W. F. Thompson. 1980. Rapid isolation of high Sci. 53: 21–27. molecular weight DNA. Nucl. Acids Res. 8: 4321–4325. Chung, S. M. and J. E. Staub. 2003. The development and Nakamura, I., N. Kameya, Y. Kato, S. I. Yamanaka, H. Jomori evaluation of consensus chloroplast primer pairs that possess and Y. Sato. 1997. A proposal for identifying the short ID highly variable sequence regions in a diverse array of plant sequence which addresses the plastid subtype of higher plants. taxa. Theor. Appl. Genet. 107: 757–767. Breed. Sci. 47: 385–388. Danin-Poleg, Y., N. Reis, S. Baudracco-Arnas, M. Pitrat, J. E. Nakata, E., J. E. Staub, A. I. López-Sesé and N. Katzir. 2005. Staub, M. Oliver, P. Arus, C. M. deVicente and N. Katzir. Genetic diversity of Japanese melon cultivars as assessed by 2000. Simple sequence repeats in Cucumis mapping and map random amplified polymorphic DNA and simple sequence merging. Genome 43: 963–974. repeat markers. Genet. Resour. Crop Evol. 52: 405–419. Dhillon, N. P. S., R. Ranjana, K. Singh, I. Eduardo, A. J. Monforte, Nei, M. 1972. Genetic distance between populations. Am. Nat. M. Pitrat, N. K. Dhillon and P. P. Singh. 2007. Diversity 106: 283–292. among landraces of Indian snapmelon (Cucumis melo var. Pitrat, M., P. Hanelt and K. Hammer. 2000. Some comments on momordica). Genet. Resour. Crop. Evol. 54: 1267–1283. intraspecific classification of cultivars of melon. Proc. Fukino, N., Y. Sakata, M. Kunihisa and S. Matsumoto. 2007. Cucurbitaceae: 29–36. Characterisation of novel simple sequence repeat (SSR) Ritschel, P. S., T. C. L. Lins, R. L. Tristan, G. S. C. Buso, J. A. markers for melon (Cucumis melo L.) and their use for Buso and M. E. Ferreira. 2004. Development of microsatellite genotype identification. J. Hort. Sci. Biotech. 82: 330–334. markers from an enriched genomic library for genetic analysis Garcia-Mas, J., A. J. Monforte and P. Arus. 2004. Phylogenetic of melon (Cucumis melo L.). BMC Plant Biol. 4: 9. relationships among Cucumis species based on ribosomal Soltani, F., Y. Akashi, A. Kashi, Z. Zamani, Y. Mostofi and K. internal transcribed spacer region. Plant Sys. Evol. 248: 191– Kato. 2010. Characterization of Iranian melon landraces of 203. Cucumis melo L. Groups Flexuosus and Dudaim by analysis Garcia-Mas, J., M. Oliver, H. Gomez-Paniagua and M. C. de of morphological characters and random amplified polymor- Vicente. 2000. Comparing AFLP, RAPD and RFLP markers phic DNA. Breed. Sci. 60: 34–45. for measuring genetic diversity in melon. Theor. Appl. Genet. Staub, J. E., Y. Danin-Poleg, G. Fazio, T. Horejsi, N. Reis and N. 101: 860–864. Katzir. 2000. Comparative analysis of cultivated melon Gower, J. C. 1966. Some distance properties of latent root and groups (Cucumis melo L.) using random amplified vector methods used in multivariate analysis. Biometrika 53: polymorphic DNA and simple sequence repeat markers. 325–338. Euphytica 115: 225–241. Jeffrey, C. 2001. Cucurbitaceae. p. 1510–1557. In: P. Hanelt and Staub, J. E., A. I. López-Sesé and N. Fanourakis. 2004. Diversity Institute of Plant Genetics and Crop Plant Research (eds.). among melon landraces (Cucumis melo L.) from Greece and Mansfeld’s Encyclopedia on Agricultural and Horticultural their genetic relationship with other melon germplasm of Crops. Springer, Berlin-Heidelberg-New York. diverse origins. Euphytica 136: 151–166. Lin, D. P. 1991. Classification of melon, p. 9–21. In: S. K. Qi, Stepansky, A., I. Kovalski and R. Perl-Treves. 1999. Intraspecific J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 65

classification of melons (Cucumis melo L.) in view of their Wu, M. Z. 1982. Genetic resources of thick-skinned melon phenotypic and molecular variation. Plant Sys. Evol. 217: collected from Turpan Depression and their utilization. China 313–332. Fruits 1982: 28–33 (In Chinese). Tanaka, K., K. Fukunaga, Y. Akashi, H. Nishida, K. Kato and Yashiro, K., H. Iwata, Y. Akashi, K. Tomita, M. Kuzuya, Y. M. T. Khaing. 2006. Polyphyletic origin of cultivated Tsumura and K. Kato. 2005. Genetic relationship among East melon inferred from analysis of its chloroplast genome. and South Asian melon (Cucumis melo L.) revealed by AFLP Cucurbitaceae 2006: 372–379. analysis. Breed. Sci. 55: 197–206. Tanaka, K., A. Nishitani, Y. Akashi, H. Nishida, H. Yoshino and Yi, S. S., Y. Akashi, K. Tanaka, T. T. Cho, M. T. Khaing, H. K. Kato. 2007. Molecular characterization of South and East Yoshino, H. Nishida, T. Yamamoto, K. Win and K. Kato. Asian melon, Cucumis melo L., and the origin of group 2009. Molecular analysis of genetic diversity in melon Conomon var. makuwa and var. conomon revealed by RAPD landraces (Cucumis melo L.) from Myanmar and their analysis. Euphytica 153: 233–247. relationship with melon germplasm from East and South Asia. Weir, B. S. 1996. Genetic data analysis II. Sinauer Associate Inc. Genet. Resour. Crop Evol. 56: 1149–1161. Publisher, Massachusetts.