Studies on Genetic Diversity of Japanese and Vietnamese Melon Germplasm by Using Molecular Markers

Studies on genetic diversity of Japanese and Vietnamese melon germplasm by using molecular markers

2019, September Tran Phuong Dung

Graduate School of Environmental and Life Science (Doctor’s course) OKAYAMA UNIVERSITY

Table of contents

Chapter 1. General introduction ...... 3 1.1. Phylogenetic relationships in genus Cucumis ...... 4 1.2. Intraspecific classification and domestication history of melon ...... 9 1.3. Asia – the origin center of modern melon cultivars ...... 16 Chapter 2. Genetic diversity of Japanese melon breeding lines ...... 18 2.1. Introduction ...... 18 2.2. Materials and Methods ...... 19 2.3. Result ...... 23 2.4. Discussion ...... 28 Chapter 3. Development of RAPD‐derived STS markers for genetic diversity assessment in melon (Cucumis melo L.) ...... 32 3.1. Introduction ...... 32 3.2 Materials and methods ...... 33 3.3. Result and discussion ...... 36 3.3.1. Development of RAPD‐STS markers ...... 36 3.3.2. Detection efficiency and sensitivity of RAPD‐STS markers ...... 37 3.3.3. Validation of RAPD‐STS markers ...... 39 3.3.4. Genetic diversity analysis of melon germplasm ...... 40 3.4. Conclusion ...... 43 Chapter 4. General conclusions ...... 45 Acknowledgements ...... 47 Appendix ...... 59

Chapter 1. General introduction

Melon (Cucumis melo L.) is one of the most economically important horticulture crops.

Genetic resource is the main topic of many researches of melon in the past two decades. They showed several interesting points. Firstly, melon has great diversity in morphology especially fruit traits. Some melons have thick skin with netted, ribs or vein tracts while others have smooth skin with different color with or without spots and stripes. The flesh color varies from light‐yellow or creamy to light orange to salmon, dark orange and magenta or maybe white. Fruit size and shape vary widely from 30‐50 g to 35 kg per fruit and from flat (length/diameter =0.6) to very long

(length/diameter>10), respectively (Pitrat et al., 2016). Secondly, the availability of melon landraces in Asia is higher than other regions, particularly in India, while wild Cucumis species mainly distributed in Africa. Even though Sebastian et al. (2010) reported the wild Cucumis species in Australia, the total number of them is still limited compared with those in Africa.

Furthermore, numerous crosses between C. melo and African species of Cucumis were failed to obtain the fertile F1 offspring (Kirkbride et al., 1993; Chen et al., 2000). In consequence, the question of origin and domestication of melon has not been solved completely yet and the infraspecific classification of melon has been revised several times. This chapter aimed to review three main themes of genetic resources of melon including (1) phylogenetic relationships in genus Cucumis; (2) Infraspecific classification and domestication history of melon; (3) Asia – the primary diversity center of melon.

1.1. Phylogenetic relationships in genus Cucumis

Genus Cucumis was firstly described by Linnaeus in 1753 which contained seven species. So far, the taxonomy of genus Cucumis has been revised several times with the increase in the number of species accepted in this genus. Two approaches of taxonomy in genus Cucumis can be recognized clearly, namely taxonomy based on the morphological analysis and taxonomy based on the molecular genetic analysis. The earliest work mainly based on morphology consisted of the monographic studies of Cucumis and the family Cucurbitaceae by Naudin (1859), Cogniaux

(1881), Pangalo (1950) and Jeffrey (1980). The study of Kirkbride (1993) was the most comprehensive study of genus Cucumis at that time. The number of Cucumis species he defined was much higher than previous works (32 species). His classification was based on not only morphology but also other taxonomic keys comprising chromosome number, type of cucurbitacin, type of flavonoid, isozymes, DNA and crossability. He divided genus Cucumis into two subgenera based on chromosome number (Cucumis subgen. Cucumis (2n = 14) including two species C. sativus and C. hystrix (at that time he did not know chromosome number of C. hystrix

(2n=24)) and Cucumis subgen. melo (2n=20‐72) with thirty species, then based on the absence or presence of aculei of the female hypanthium and fruit to divide into two sections (Cucumis sect. melo and Cucumis sect. aculeatosi). Under section level, genus Cucumis was split into six series

(ser. humifructuosi, ser. melo, ser. hirsuti, ser. metuliferi, ser. angurioidei, ser. myriocarpi).

Interestingly, molecular phylogenetic studies selected Cucumis species for analysis based on the study of Kirkbride (1993) and made the comparison with his work in order either to support or to against. Garcia‐Mas et al. (2004) used ITS sequence for analysis and suggested to divide genus

Cucumis into two clades A and B, of which clade A contained only cucumber (C. sativus) and clade

B contained melon (C. melo) and other Cucumis species which agreed with Kirkbride (1993) who divided genus Cucumis into two subgenera. Clade B was further split into four sub‐clades from

B1 to B4, of which sub‐clades B1 and B2 were of melon and C. metuliferus, respectively, while sub‐clades B3 and B4 were the mixture of several African Cucumis species. The study of Chung et al. (2006) by analyzing the consensus chloroplast SSRs showed the contrast to Garcia‐Mas et al.

(2004), that was, melon and cucumber formed a major cluster which was distinct from the cluster of African Cucumis species. The commonality among three studies was that cucumber (C. sativus), melon (C. melo) and African Cucumis species belonged to distinct groups. However, the relationship among three groups was still unclear. The reason for that might be due to African bias in selecting samples. Later studies (since 2007) of Cucumis phylogenetic relationship

(Schaefer et al., 2007; Kocyan et al., 2007; Renner et al., 2007; Ghebretinsae et al., 2007, Sebstian et al., 2010) did not support Kirkbride’s classification and supposed it was highly unreasonable.

These studies explored new samples for analysis not only from Africa but also from Asia and

Australia which were supposed to be in different genera in previous studies, namely

Dicaelospermum ritchiei, Mukia maderaspatana, Cummella bryoniifolia, Oreosyce africana,

Myrmecosicyos messorius in Kocyan et al. (2007) or Mukia javanica, four species of genus

Cucumella in Ghebretinsae et al. (2007). Interestingly, all the new samples nested in Cucumis group which made the phylogenetic tree become reasonable. As a result, the genus Cucumis was revised to be supplemented by 19 species formally transferred from five genera consisting of

Cucumella, Dicoelospermum, Mukia, Myrmecosicyos and Oreosyce (Schaefer et al., 2007). The appearance of 19 new species made the classification of genus Cucumis clearer and more reasonable and widely accepted. Genus Cucumis is monophyletic and is the sister to genus

Muellerargia. It was divided into two subgenera: subgenus Humifructus containing only C. humifructus and C. hirsutus and subgenus Cucumis containing the remaining of the species (50 species). The latter was further divided into sections Aculeatosi, Cucumella, Cucumis, Metuliferi and Sagittati. Cucumis section Cucumis included both melon and cucumber and other seven

Cucumis species. Among them, seven species were collected from Asia, only one species from

Africa and melon was not transparent about the origin. The remaining sections were filled by mainly Cucumis from Africa. At that time, the classification of wild Cucumis species did not answer the question of the origin of melon. Sebastian et al. (2010) provided comprehensive view of

Cucumis species and the relationship of melon with other Cucumis species. This was the first report in which a phylogenetic tree of Cucumis species including African Cucumis species (38 species) and Asian/Australian Cucumis species (25 species) was demonstrated (Fig.1.1). As a result, it revealed clearly that melon and cucumber were placed in the clade of Asia/Australia which means that melon and cucumber of Asian origin. Besides, they found numerous wild relatives of melon and cucumber in Australia. More surprisingly, the closest relative of melon is

Cucumis picrocarpus from Australia. Some points obtained from this study are African Cucumis species are the primitive and distantly related to melon; there was at least one divergence event occurred in Africa (11.9 ±2 Ma ago), transmitting to Asia and Australia; among the Asia/Australia clade that split from African clade, the progenitor of melon was separated since 10.1 ±1.7 Ma.

Two species are supposed to be the progenitor of melon found in India including C. callosus and

C. trigonus. Unfortunately, Sebastian et al. (2010) showed they were the synonym of C. melo.

Endl et al. (2018) discovered one interesting thing that many studies, even Sebastian et al. (2010), confused C. trigonus Roxburgh with C. melo subsp. melo f. agrestis. The true C. trigonus was the

6 species found in India and, as discussed by John et al. (2013), it was confused with C. callosus. In consequence, their result pointed out C. trigonus was the closest relative of melon in Asia. Endl et al. (2018) contributed to confirm again the conclusion of Sebastian et al. (2010) that melon had origin in Asia. Based on the studies of phylogenetic relationship of Cucumis during the past twenty years, genus Cucumis was proved to be monophyletic and the earliest divergence event took place in Africa and its lineage was transmitted to Asia and Australia which explains the discovery of two closest relatives of melon in Asia and Australia. Therefore, they suggested the origin of melon is in Asia. However, the idea of Asian origin of melon is still in controversy, especially from the viewpoints of researches of genetic diversity of melon.

Fig 1.1. ML tree for 63 taxa of Cucumis based on combined sequences from chloroplast and nuclear data (6,202 aligned nucleotides) analyzed under a GTR + Γ model. (Sebastian et al., 2010)

1.2. Intraspecific classification and domestication history of melon

As mentioned above, melon has a great diversity in morphology so that there are many systems of infraspecific classification of melon. Earliest classification works were based on the characters of fruits and the uses. Naudin (1859) divided melon into ten groups (agrestis, cantalupensis, reticulatus, saccharinus, inodorus, flexuosus, conomon, dudaim, chito and erythraesus). Munger and Robinson’s classification (1991) was like the system of Naudin (1859) but they mentioned about eight varieties instead of ten varieties described in Naudin (1859).

They excluded three varieties (reticulatus, saccharinus and erythraesus) and added one variety

(momordica). Robinson and Decker‐Walters (1997) was almost the same to Munger and

Robinson (1991) except for exclusion of var. chito from their system. Meanwhile, Grebenschikov

(1953) and Hammer et al. (1986) divided firstly into two subspecies melo and agrestis and then further divided ssp. melo into convariety. Whitaker and Davis (1962) only focused on the cultivated melon and did not mention about agrestis group (wild or weedy type of melon). Since

1990s, with the development of PCR technique, numerous studies on genetic diversity of melon germplasm was conducted using molecular markers (Staub et al., 1997; Silberstein et al., 1999;

Stepansky et al., 1999; Garcia‐Mas et al., 2000). Stepansky et al. (1999) provided a comprehensive viewpoint of infraspecific classification of melon. In this study, they analyzed 54 accessions from

23 countries by using Inter‐SSR PCR and RAPD techniques. The dendrogram split 54 accessions into two distinct groups; group I – dessert melon including vars. cantalupensis, inodorous, and flexuosus and group II– non‐dessert melon including vars. agrestis, conomon, chito, dudaim, and momordica. Their result supported the system of dividing melon into two subspecies (agrestis and melo). Group II consisted of ssp. agrestis was more diversified than the description of

9 previous studies; herein, it contained not only var. agrestis but also four other varieties which were well‐classified into sub‐clusters within this group. Var. agrestis comprised accessions both from Asia and Africa. Var. chito was placed in the sub‐cluster of agrestis. Stepansky et al. (1999) presented a new concept of group agrestis (ssp. agrestis) more diversified with the supplement of cultivated melon. Continuing with that idea, Pitrat (2008) suggested a classification that was widely accepted: melon was divided into two subspecies (agrestis and melo); ssp. agrestis included five varieties (acidulus, conomon, momordica, makuwa and chinensis) and ssp. melo included ten varieties (chate, flexuosus, tibish, adana, ameri, cantalupensis, chandalak, reticulatus, inodorus, dudaim). He also suggested the domestication of two subspecies might be independent and formed the foundation of multiple domestication hypothesis in melon. The characters of varieties (Pitrat, 2008) were summarized in Table 1.1.

Table 1. 1. The characters of melon varieties (Pitrat, 2008) Variety Geographic Characters Sex Examples of cultivars name distribution type conomon East Asia Elongated fruit, smooth thin A Shiro‐uri, Freeman’s skin, non‐sweet and non‐ cucumber, Aodaisimo‐uri, aroma fruit, white firm flesh. Wasada‐uri makuwa East Asia Flat to round to oval fruit, A Ginsen makuwa, Kanro smooth thin skin, sweet and a makuwa, Kinko makuwa, Ogon little aroma, white flesh 9 chinensis China and Pear‐shape fruit, light or dark A PI 161375, PI 255479, PI Korea green with spots skin, green or and 255479 orange flesh, medium sugar H content, little or low aroma. momordica India Flat to round to elongated M PI 124111, PI 414723, PI fruit, smooth or ribbed thin 164343, skin, bursting and low aroma PI 183307, PI 532841, when ripen, mealy and white Faizabadi phoont, Gill patti flesh, low sugar content. phut acidulus Southern India Oval or elliptic, smooth with a M PI 164323, 90625, Kekiri green or orange skin, uniform or with spots; white, firm, crisp flesh; neither sugar nor aroma. tibish Sudan Oval shape with dark green A Tibish and seinat cultivar skin with light or yellow stripes; white, firm flesh without sugar and aroma. chate Mediterranean Round to oval with ribs and M Carosella basin, western light to dark green skin fruit; or A Asia white to light orange flesh without either aroma or sugar; climacteric fruit. flexuosus Northern Africa Long to very long fruit, light M Fakouss, Fegous, Adjour, to Turkey to green or dark green, ribbed or Alficoz, Silka, Kakri long green, Iraq to India wrinkled; white to light Acur, PI 222187

orange, mealy at maturity without either sugar or aroma cantalupensis Europe, Flat to oval fruit with strongly A Charentais, Ogen, Ananas d’ Western Asia, to moderately ribbed with a Amérique, Noir des Carmes, North and smooth skin; orange flesh, Prescott, Muscatello South America aroma and sweet; climacteric fruit. reticulatus Europe, Asia, Round to oval fruit with a A Topmark, PMR 45, Hale ‘s Best, North and typical netted skin with or Delicious 51, Sucrin de Tours, South America without ribs; orange, aromatic Earl’s favourite, Galia and sweet flesh; climacteric fruit. ameri Western and Elongated and oval shaped A Ananas, Altajskaja, Khatoni, Central Asia with a yellow to light green Kzyl urum skin color fruit; slightly netted skin; white to light orange juicy flesh with a low aroma and very good sugar content; climacteric fruit. inodorus Central Asia, Round to elliptic fruit with skin A Piel de sapo, Rochet, Amarillo, Mediterranean to yellow to dark green skin Cassaba, Kirkagac, Yuva, basin, North with spots or uniform, often Hassanbey, Tendral, and South wrinkled, with or without ribs; Honeydew, Branco America white flesh, sweet and low aroma. dudaim Central Asia, Round, small, yellow with A Queen Anne’s pocket melon, from Turkey to ochre stripes and a velvety Dastanbou, PI 177362 Afghanistan skin; strong typical aroma; white thin flesh without any sugar; climacteric fruit A: Andromonoecious M: Monoecious H: Hermaphrodite

A range of studies evaluated melon germplasm uncovered genetic diversity and

relationship in melon germplasms from different geographical areas and provided data for

speculating the domestication history of melon. The hypothesis that melon may have been

domesticated twice, in Asia and in Africa, was proved directly in three studies (Serres‐Giardi et

12 al., 2010; Tanaka et al., 2013; Endl et al., 2018). Serres‐Giardia et al. (2010) classified 701 melon accessions into seven subgroups of which three subgroups belonged to ssp. agrestis (E ‐ India, F

‐ Africa and G – Far east) and four subgroups (A – var. indorous from Europe, Middle East, America and Africa, B‐ var. reticulatus and var. cantalupensis from Europe, America and Africa , C – vars. chate, chandalak, adana, ameri, and flexuosus, D – unknown types from India and var. flexuosus from India, Middle East and North Africa) belonged to ssp. melo. Three subgroups of ssp. agrestis were well‐ isolated from each other and were highly consistent with geographical distribution, whereas four subgroups of ssp. melo were not distinctly isolated. Genetic diversity of subgroups

E–India and F–Africa were high. Furthermore, African wild melon was clustered together with

African cultivated melon of subgroup F, while Asian wild melon was grouped together with Indian melon of subgroup E, suggesting two independent domestication events might occur, one in

Africa and the other in Asia (India). Subgroup G (Far east) was closely related to subgroup E (India) than subgroup F (Africa), and its genetic diversity was quite low, indicating that Far ‐Eastern melon had origin from Indian melon, probably small‐seed type (seed length shorter than 9mm)

(Akashi et al., 2002; Tanaka et al., 2007). In parallel to the spread of melon cultivation towards

Far East, Indian melon would have been introduced towards the west, leading to the development of subgroup D in ssp. melo. This group comprised unknown types of India and var. flexuosus from India to Middle East and was regarded as intermediate subgroup between ssp. agrestis and ssp. melo. Their results suggested that current melon cultivars might originate in

Asia. This suggestion was supported by the recent study (Endl et al., 2018) and consistent with the phylogenetic analysis in genus Cucumis (Sebastian et al., 2010). Endl et al. (2018) analyzed wild melon (var. agrestis) from three continents Asia (22 accessions), Africa (10 accessions) and

Australia (5 accessions), which were divided into two distinct clades, clade Africa and clade

Asia/Australia. The time of divergence was 1.9 Ma ago which supported well Sebastian et al.

(2010) (Fig 1.2). Furthermore, the phylogenetic tree of melon cultivars (33 accessions) and wild type of melon figured out Asian melon cultivars was placed in the clade Asia/ Australia while

African melon cultivars was placed in the clade Africa. This result supported the suggestion of two independent domestication events and Asian origin of modern melon cultivars (Tanaka et al., 2006, 2013; Serres‐Giardia et al., 2010). Both studies go to the same conclusion even though they used different markers, a set of 20 SSR markers in Serres‐Giardia et al. (2010) and nuclear and plastid sequences in Endl et al. (2018). Interestingly, the conclusion of both studies reminds the long‐forgotten observations of Naudin (1859) and his collages that the wild populations of melon in India and Africa were domesticated independently. Tanaka et al. (2013) agreed with the suggestion of multiple origin of cultivated melon but the conclusion of this study revealed the opposite opinion from above two studies. They indicated that cultivated melon in Europe and

Asia originated from two distinct gene pools of Africa, northern large‐seed melon and southern small‐seed melon, respectively. Besides, one sub‐cluster Ic was unique to African melon germplasm which was supposed to be domesticated independently. It means that Tanaka et al.

(2013) agreed with the presence of a unique melon germplasm in Africa as above two studies.

The difference between Tanaka et al. (2013) and two studies (Serres‐Giardia et al., 2010; Endl et al., 2018) might be due to the lack of Indian wild melon in Tanaka’s study. The most update study

(Gonzalo et al., 2019) strongly confirms that India is the primary center of diversity of melon, and that occidental and Far–Eastern melon were the result of divergence from Indian melon.

Fig 1.2. A part of chronogram from Bayesian relaxed molecular clock analysis of Cucumis based on the combined nuclear and plastid sequence matrix (5696 nucleotides, wild accessions only). Blue bars show 95% confidence intervals of the divergence time estimates for each split. Letter coding: green, Asian/Malagassy/American melon; blue, Australian/New Guinean accessions; red, African melon; yellow, C. picrocarpus; brown, C. trigonus (Endl et al., 2018).

1.3. Asia – the origin center of modern melon cultivars

Basically, Asia is widely accepted as the diversity center of melon. Asian melon can be roughly split into three groups according to geographic distribution, that is, Central Asian melon,

South Asian melon and East Asian melon. South and Central Asia are considered the center of diversity, whereas East Asian melon was established from South Asian melon through severe selection. East Asian melon is typically consisted of two varieties conomon and makuwa. Several studies agreed that East Asian melon had origin from small‐seed type melon in India which formed a distinct group from the others with low genetic diversity (Akashi et al., 2002; Yashiro et al., 2005; Tanaka et al., 2007 & 2013; Serres‐Giardia et al., 2010, Esteras et al., 2013). Studies of genetic diversity of melon in each country (Nakata et al., 2005; Yi et al., 2009; Nhi et al., 2010) contributed to support the above viewpoint. However, the detail of differentiation of vars. conomon and makuwa is still unclear. Nhi et al. (2010) proposed that two varieties might be established around Vietnam and then introduced into China, Korea and Japan.

India is the center of diversity of melon (Akashi et al., 2002; McCrieght et al., 2004; Tanaka et al., 2007; Dhillon et al., 2007 and 2009; Luan et al., 2008; Esteras et al., 2013; Malik et al.,2014;

Endl et al., 2018). Gonzalo et al. (2019) indicated that Indian germplasm of melon had the highest genetic diversity, showing high SNP variability, high proportion of SNPs with high MAF (Minor

Allele Frequency) and low haplotype fixation, indicating that India was not only the center of diversity of melon but also the origin center of melon. They recognized low allele fixation in local landrace which could be explained by frequent intercross between cultivated and wild type of melon (var. agrestis). Two varieties supposed to be native to India are vars. momordica (snap melon) and acidulus (Dhillon et al., 2007 and 2009; Fergany et al., 2011). Var. momordica showed

16 high variability, was placed at intermediate position (Blanca et al., 2012; Esteras et al., 2013), and has seeds ranged from small to large (Akashi et al., 2002). Central Asia, where melon of vars. inodorous, ameri, and flexuosus are grown, was also supposed to be the diversity center of ssp. melo, and melon varieties were diffused to Europe, Mediterranean basin (Jeffrey 1980; Robinson and Decker‐Walters, 1997; Stepansky et al, 1999; Pitrat et al., 1999; Sabato et al., 2019).

Nonetheless, high‐level of admixture among those varieties in Central Asia was found by several researches (Serres‐Giardia et al., 2010, Esteras et al., 2013). Recently, Gonzalo et al. (2019) pointed out those varieties (they called as group inodorous‐related) had close relationship with

Indian melon but observed heterozygosity (Ho) was much lower than that of Indian melon. Hence, it was one more evidence to support that India is the primary center of cultivated melon. Vars. cantalupensis and dudaim were considered to be established when the diffusion occurred from

India to Central Asia to Europe region.

Chapter 2. Genetic diversity of Japanese melon breeding lines

2.1. Introduction Melon is one of the important horticultural crops in Japan and has a long history of utilization and cultivation dating back to the end of the first millennium BCE (Li, 1970; Fujishita,

1992). The traditional melon belongs to groups Conomon and Agrestis, among which the latter is weedy, feral or free‐living melon and has bitter taste (Pitrat, 2008). Archeological evidences clearly indicated that group Conomon has been cultivated and utilized at the Shikata site,

Okayama Prefecture, at least from 180 CE (Tanaka et al., 2015). This type of melon has smooth skin, soft epicarp and poor shelf life, and both ripe and young fruits are consumed as desert and vegetable (Kitamura, 1950; Fujishita, 1992; Pitrat, 2008). Thereafter, melon of group Momordica had been also introduced to Japan and became popular from ca. 800 CE (Fujishita, 1992). The sweet type and sour type of group Conomon are called as ‘makuwa’ and ‘shirouri’, which are consumed as dessert and vegetable, respectively, and various kinds of local landraces have been established in each area (Kastumata et al., 1964). Another type of melon introduced after ca.

1900 is netted, sweet melon of group Cantalupensis (Seko, 1998a). Among the cultivars introduced, the English cultivars showed rather good adaptability to the Japanese condition, and a cultivar ‘Earl's Favourite’ introduced in 1925 became the founder of the Japanese netted melon.

Various kinds of pure line cultivars have been bred through pure line selection from ‘Earl's

Favourite’ and crossing with ‘British Queen’ and contributed to the production of high‐quality fruits mainly in Shizuoka Prefecture (Kamiya, 1973). For large scale production of good quality melon, ‘Earl's Favourite’ and pure line cultivars have been crossed to various kinds of melon genetic resources to improve the adaptability and resistance to diseases and pests (Seko, 1998b).

Such cultivars and breeding lines are now used as parents of F1 hybrid cultivars of the Japanese netted melon. These facts clearly indicate that Japanese netted melon has been established by utilizing various genetic resources of domestic and foreign origins, as indicated by Nakata et al. (2005), Kato et al. (1998) analyzed peroxidase isozyme of the Japanese melon cultivars including commercial F1 hybrids, and, based on isozyme polymorphism, they classified the cultivars into three types; PX2A type mainly includes breeding lines with disease resistance, PX2B type mainly consists of pure line derivatives of ‘Earl's Favourite’, and hetero‐type comprised of commercial F1 hybrids. However, little is known about the detail of their genetic structure.

Therefore, in the present study, we analyzed genetic diversity and relationship among melon cultivars, many of which have been utilized in the breeding programs, by RAPD (random amplified polymorphic DNA) analysis which has been widely used for diversity analysis of melon (Stepansky et al., 1999; Staub et al., 2004). Then we tried to figure out the genetic structure of the Japanese netted melon.

2.2. Materials and Methods

Plant materials

Two sets of melon accessions were used in this study. The detail of melon accessions was summarized below and indicated in Table 2.1. The first set comprised of 47 accessions of melon

(Cucumis melo L.) from three horticultural groups. Twenty‐two accessions of group

Cantalupensis (European cantaloupe: 6, netted melon (England glasshouse type: 5, American open‐field type: 7, Japanese breeding line: 4)), 15 accessions of group Inodorus (Honeydew type:

4, Chinese Hami‐melon: 6, winter melons from Spain and Russia: 5), 10 accessions of group

Conomon (var. makuwa: 5, var. conomon: 5). The second set consists of 10 pure line cultivars of

19 the Japanese netted melon ( ‘Haru 3’, ‘Haru 3B’, ‘Natsu 1’, ‘Natsu 4’, ‘Natsu 7’, ‘Aki 1’, ‘Fuyu 1’,

‘Fuyu 1A’, ‘Fuyu 3’, ‘Fuyu 4’) among which ‘Natsu 1’, ‘Natsu 4’ and ‘Natsu 7’ were bred by crossing

‘Earl's Favourite’ with ‘British Queen’ and the rest by pure line selection from ‘Earl's Favourite’.

The two plants were examined for all accessions. Seeds of these accessions were provided from

NARO Institute of Vegetable and Tea Science (NIVTS), Japan.

Table 2.1. List of the first set of melon (47 accessions) analyzed in the present study

Acces‐ PS‐ Seed sion Cultivar name Group/Variety Melon type ID Clusterb typea No. typea

P71 Charentais Cantalupensis European cantaloupe Large T II P72 №58‐21 Cantalupensis European cantaloupe Large T II P94 Melon Cantalupo di Charentais Cantalupensis European cantaloupe Large T II P95 Cantaloure de Bellegrade Cantalupensis European cantaloupe Large T II P98 Ogen 780045 Cantalupensis European cantaloupe Large T III P110 Carosello Scopatizzo Barese Cantalupensis European cantaloupe Large T III P67 Rocky Ford Cantalupensis America open field Large T II P68 Homegarden Cantalupensis America open field Large T II P69 Georgia 47 Cantalupensis America open field Large T II P93 SC108 Cantalupensis America open field Large T III P107 Rio Gold Cantalupensis America open field Large T II P108 Hales Best Cantalupensis America open field Large T II P109 Spicy Cantalupensis America open field Large T II P33 Barnet Hill Favourite Cantalupensis England glasshouse Large T IV P62 Earl's Favourite Cantalupensis England glasshouse Large T IV P63 Blenheim Orange Cantalupensis England glasshouse Large T IV P64 British Queen Cantalupensis England glasshouse Large T IV P65 Hero of Lockinge Cantalupensis England glasshouse Large T IV P85 Pearl Cantalupensis Japanese breeding line Large T IV P86 Kurume 2 Cantalupensis Japanese breeding line Large T III P87 Annou 1 Cantalupensis Japanese breeding line Large T VI P88 Annou 3 Cantalupensis Japanese breeding line Large T VI P73 Honey Dew Inodorous Honey dew Large T III P74 Honey Dew (600011) Inodorous Honey dew Large T III P75 Honey Dew (610002) Inodorous Honey dew Large T III P76 Honey Dew (650013) Inodorous Honey dew Large T III P77 Chinese Honey Dew Inodorous Chinese Hami Large T V P78 Hamiuri Inodorous Chinese Hami Large T V P79 Hamiuri 2 Inodorous Chinese Hami Large T III P80 Hamigua 6 Inodorous Chinese Hami Large T III P81 Hamigua H Inodorous Chinese Hami Large T III

P82 Hamigua J Inodorous Chinese Hami Large T III P116 Spain Noboru 3 Inodorous Spanish melon Large T IV P117 Tendral o Invernale a Buccia Verde Inodorous Spanish melon Large T IV P118 Kokand (Russia) Inodorous Russian melon Large T V P119 Mirzuchulskaga Inodorous Russian melon Large T V P120 Ak‐Urug Inodorous Russian melon Large T V P83 Mi‐tang‐ting Conomon makuwa Small A I P89 Kanro Conomon makuwa Small A I P90 Kinpyo Conomon makuwa Small A I P121 Seikan Conomon makuwa Small A I P124 Nanbukin Conomon makuwa Small A I P91 Takada Shirouri Conomon conomon Small A I P92 Tokyowase Shirouri Conomon conomon Small A I P129 Nagasaki Tsukeuri Conomon conomon Small A I P130 Karimori Conomon conomon Small A I P132 Hyogo Aoshimauri Conomon conomon Small A I a Seed size and PS‐ID type was obtained from Tanaka et al. (unpublished). b The cluster number shown in Fig. 2.2.

DNA extraction

Seeds of each plant were sown on wet filter paper in a Petri dish and germinated in an incubator maintained at 260C with a 16 h light and 8 h dark cycle at a light intensity of 46.5 μM s‐

1 m‐2. After 2 weeks, cotyledons from two seedlings of each accession were ground individually in liquid nitrogen. Total DNA was extracted using the cetyl‐trimethyl‐ammonium bromide method (CTAB) (Murray and Thompson, 1980) with minor modifications. The quality and quantity of each DNA sample were determined with a spectrophotometer.

RAPD analysis

A total of 176 random primers (12 mer, Bex, Japan) were tested by using five cultivars of melon: group Cantalupensis cv. ‘Earl’s Favourite’ (netted), group Cantalupensis cv. ‘Rocky Ford’

(netted), group Cantalupensis cv. ‘Charentais’, group Conomon var. makuwa cv. ‘Kinpyo’, and group Conomon var. conomon cv. ‘Takada‐shiro‐uri’. Twenty‐four random primers selected for their ability to detect polymorphism and for the stability of PCR amplification were used

21 for RAPD analysis (Table 2.2). PCR amplification was done in a 10 μL mixture containing

50ng genomic DNA, 1 μL PCR buffer (Sigma‐Aldrich, USA: 10mM Tris‐HCl (pH 8.3), 50mM

KCl), 2.5mM MgCl2, 0.25U Taq polymerase (Pharmacia, USA), 0.1mM dNTP and 0.5 μM primer by using PC‐700 (ASTEC, Japan). An initial denaturing step at 950C for 3 mins., 40 PCR cycles at

940C for 1 min., 400C for 2 mins. and 720C for 2 mins were done, and then a final extension at 720C for 5 mins. After the amplification, samples were undergoing electrophoresis on 1.5% agarose gel (L03, Takara, Japan) at constant voltage 100V (Mupid‐2, Cosmo Bio, Japan).

Then the PCR products were visualized with ethidium bromide staining and their polymorphisms were evaluated.

Data analysis

The RAPD marker band was scored as 1 for presence and 0 for absence. From these data, the polymorphic index content (PIC) was calculated according to Anderson et al. (1993). Genetic similarity (GS) among accessions was calculated as described by Apostol et al. (1993), and their genetic distance (GD) was calculated with the formula GD=1‐GS. A dendrogram was constructed by the PHYLIP program (Felsenstein, 1993) using the unweighted pair group method with arithmetic mean (UPGMA) method. Principal co‐ordinate analysis (PCO) (Gower, 1966) based on the genetic similarity matrix was done to show multiple dimensions of each group and melon accessions on a scatterplot.

Table 2.2. Twenty‐four RAPD primers analyzed in this study and the size of polymorphic fragments

Primer Polymorphic fragment Sequence No. No. Size (bp) A07 GATGGATTTGGG 2 1353, 872 A20 TTGCCGGGACCA 4 1500, 1400, 1100, 900 A22 TCCAAGCTACCA 3 1520, 1000, 970 A23 AAGTGGTGGTAT 3 1860, 700, 670 A26 GGTGAGGATTCA 3 1700, 1500, 1400 A31 GGTGGTGGTATC 1 800 A39 CCTGAGGTAACT 2 2027, 872 A41 TGGTACGGTATA 3 1353, 1020, 930 A53 GACGCCCATTAT 2 1860, 900 A57 ATCATTGGCGAA 3 1353, 1078, 800 B13 GGTCACCGATCC 3 1078, 970, 780 B15 CCTTGGCATCGG 3 1800, 1300, 600 B29 GATGGTCCGTTT 3 1600, 1400, 600 B32 ATCATCGTACGT 1 940 B37 AGGGCTCTAGGC 1 1600 B39 GAGCTCCCGACA 1 2000 B55 TGGCTTCATCAC 3 1700, 1500, 1400 B68 CACACTCGTCAT 1 1078 B71 GGACCTCCATCG 1 1020 B84 CTTATGGATCCG 3 700, 600, 550 B86 ATCGAGCGAACG 2 1400, 1350 B96 GTGAAGACTATG 3 2000, 850, 750 B99 TTCTGCTCGAAA 3 1600, 1500, 1400 C00 GAGTTGTATGCG 1 1350

2.3. Result

RAPD primers amplified multiple bands with different size as shown in Fig. 2.1. Primer B99 amplified three polymorphic bands with different band sizes 1400bp, 1500bp and 1600bp which were shown in the lane number 11, number 9 and number 10 respectively (Fig 2.1.).

Fig. 2.1 . Pattern of RAPD profiles obtained by primer B99. Polymorphic fragments were 1400bp, 1550bp and 1600bp. Lane M represent 100bp DNA ladder. Lane 1: Spicy, Lane 2: Carosello Scopatizzo Barese, Lane 3: Spain Noboru 3,Lane

4:Chinese Honey Dew, Lane 5: Hamiuri , Lane 6: Hamiuri 2, Lane 7: Hamigua H, Lane 8:Hamigua J , Lane 9: Mi‐tang‐ting, Lane 10: Pearl, Lane 11: 1400bp‐ band control.

RAPD analysis of 47 melon accessions successfully detected 55 marker bands which are

polymorphic among accessions and stable in PCR amplification (Table 2.2). The number of marker

bands ranged from one to four per primer, and the average was 2.29. The most polymorphic

markers are A26‐1400bp, B71‐1020bp and B84‐600bp, which were amplified from 24, 23, 24

accessions, respectively. The least polymorphic markers are A20‐1400bp, B13‐780bp, B15‐

1300bp and B86‐1400bp, which were amplified from 2, 1, 45, 46 accessions, respectively. A

marker band A53‐900bp was amplified from 10 accessions of group Conomon, but not from other

37 accessions. Similarly, two marker bands A20‐1100bp and C00‐1350bp were not amplified in

10 accessions of group Conomon and ‘Annou 3’ of the Japanese breeding line but amplified from

other 36 accessions. These three markers could be used to distinguish the Asian melon group

Conomon from other groups, since ‘Annou 3’ was bred by the cross with group Conomon cv. ‘Mi‐

tang‐ting’. Genetic diversity within each cultivar group was evaluated based on PIC which was

summarized in Table 2.3, along with the number of polymorphic markers. The PIC value was

0.175 in 47 accessions and was over 0.070 in cultivars of groups Cantalupensis and Inodorus

except for Honeydew type. On the contrary, it was smaller than 0.054 in group Conomon. The

24 number of polymorphic markers was also higher in groups Cantalupensis and Inodorus than that of group Conomon.

Table 2.3 Polymorphic index and number of polymorphic markers in each variety or cultivar group

No. of Horticultural group or No. of PIC polymorphic cultivar group accessions markers Group Cantalupensis European cantaloupe 6 0.108 31 American open field 7 0.104 29 England glasshouse 5 0.07 20 Japanese breeding line 4 0.092 31 Group Inodorous Honeydew 4 0.014 4 Chinese Hami melon 6 0.092 26 Russian melon 3 0.071a 19a Spanish melon 2 Group Conomon makuwa 5 0.054 16 conomon 5 0.047 13 a The values were calculated for five cultivars of Russian and Spanish melon.

GD among 47 accessions ranged from 0 between ‘Honey Dew (610002)’ and ‘Honey Dew

(650013)’ to 0.709 between ‘Kokand (Russia)’ and ‘Mi‐tang‐ting’. Genetic relationship among 47 accessions was visualized by UPGMA cluster analysis based on GD. As shown in Fig. 2. 2, 47 accessions were classified into six clusters. The most divergent was cluster I which consists of 10 accessions of group Conomon. The second divergent was cluster II which includes 10 accessions of group Cantalupensis (European cantaloupe: 4, American open‐field type: 6). All the England glasshouse melons were grouped into cluster IV, along with two Spanish melon accessions of group Inodorus. Furthermore, other accessions of group Inodorus appeared in clusters III and V both of which were closely related with cluster IV. These results indicate genetic differentiation

25 within group Cantalupensis and may suggested genetic introgression from group Inodorus for the establishment of the England glasshouse melon. The Japanese breeding lines belonged to clusters II, IV and VI. Among them, ‘Pearl’ known as good fruit quality was grouped together with

‘Earl's Favourite’ in cluster IV, while two breeding lines (“Annou 1” and “Annou 3”) bred by introducing disease resistant genes from genetic resources formed cluster VI. In the case of

Kurume2, it was hybrid between “SC108” and “BC5” (a strain of “Earl’s Favourite” type) (Kawaide,

1975) which explained why it was in the cluster III together with “SC108”.

Genetic relationship among melon accessions demonstrated on dendrogram was also reproduced on PCO plot (Fig. 2.3). PCO1 explaining 34.9% of total variation clearly separated group Conomon from other groups. The distant relationship of European cantaloupe and

American open‐field type with England glasshouse melon became obvious on PCO1 and PCO2 plot, of which the latter explained 8.9% of total variation. The England glasshouse melon including ‘Earl’s Favourite’ was surrounded by group Inodorus accessions, as also shown in Fig.2.2.

Fig. 2.2. Genetic relationship between 47 accessions of melon, revealed by UPGMA cluster analysis based on GD.

Fig. 2.3. Distribution on the first two principal co‐ordinates of 47 accessions of melon. Symbols represent group/type of each accession. △: American open‐field type, ■: England glasshouse type, □: Japanese breeding line, ▲: European cantaloupe, ◎: Honey Dew, ◇: Chinese Hami melon, ◆:Russian and Spanish melon, ●: var. makuwa, ○: var. conomon.

The second set of melon accessions was also analyzed by RAPD. However, most of the

accessions showed RAPD profile identical with that of ‘Earl's Favourite’, and polymorphism

among 10 accessions was rarely detected. Among 24 primers, two primers successfully detected

polymorphism. The A07 primer amplified a 740bp band only in ‘Aki 1’, while A53 primer produced

a 2000bp band in three accessions, ‘Fuyu 1’, ‘Fuyu 3’, and ‘Fuyu 4’. Three cultivars, ‘Natsu 1’,

‘Natsu 4’, and ‘Natsu 7’, were bred by crossing ‘Earl’s Favourite’ with ‘British Queen’ (Kamiya,

1973), and thus expected to show difference from others. However, no difference was detected

by RAPD analysis using 24 primers. These results indicated that pure line cultivars selected from

‘Earl’s Favourite’ or derived from the cross with ‘British Queen’ are mostly homogenous.

2.4. Discussion

Although the Japanese netted melon has shorter history compared with those of the

traditional Japanese non‐netted melon and European and American netted melon, various kinds

28 of melon accessions have been introduced and utilized for improving the adaptability, disease resistance, fruit quality and so on (Kamiya, 1973; Takada, 1983; Robinson and Decker‐Walters,

1997;Seko, 1998b, 1998c & 1999). In the present study, genetic diversity and relationship among these melon accessions were surveyed by RAPD analysis, in order to understand the genetic basis of the Japanese netted melon. Although the number of melon accessions was only four, the genetic diversity, shown by PIC, in the Japanese netted breeding lines was 0.092 and equivalent to those of other cultivars of group Cantalupensis (Table 2.3). Close genetic relationships were also recognized in other Japanese netted melon (Nakata et al., 2005). The use of various types of melon in a short period of breeding history was supported by the result of this study. Then GD among the Japanese netted melon and other groups of melon was compared. The average GD within the Japanese netted melon accessions were 0.255. On the contrary, GD among the

Japanese netted melon and four cultivar groups, that is, England glasshouse type, European cantaloupe, American open‐field type, and group Conomon, was 0.244, 0.358, 0.342, and 0.513, respectively. Such a genetic relationship was clearly demonstrated in two Japanese netted melon lines, ‘Annou 1’ and ‘Annou 3’. Although group Conomon cv. ‘Mi‐tang‐ting’ was used as one of the cross parent to introduce resistant genes for CMV, Gummy stem blight, and Fusarium wilt

(Takada, 1983), they are closely related with ‘Earl's Favourite’ (GD from 0.236 to 0.309) compared with ‘Mi‐tang‐ting’ (from 0.455 to 0.527). According to Tanaka et al. (2006), England glasshouse type shared same chloroplast genome type to Japanese netted melon. Based on these results, it was clearly indicated that the Japanese netted melon is most closely related with England glasshouse type, irrespective that various melon accessions have been crossed to improve the adaptability, disease resistance and so on.

England glasshouse type and American open‐field type commonly have net on fruit rind and were classified as var. reticulatus according to Pitrat (2008). However, rather distant relationship among these two types of netted melon was indicated in this study (Fig. 2.2). Instead, the close relationship among American open‐field type and European cantaloupe, which was formerly classified as var. cantalupensis, was clearly shown in Fig. 2.2, as also shown by the analysis of chloroplast genome (Tanaka et al., 2006). These results support the new classification system in which all three types were classified as group Cantalupensis (Munger and Robinson, 1991). Fig.

2.2 also highlighted close relationship between England glasshouse type and group Inodorus. The average GD within England glasshouse type was 0.175. On the contrary, GD among England glasshouse type and three cultivar groups, that is, European cantaloupe, American open‐field type, and group Inodorus, was 0.286, 0.303, and 0.236, respectively. Furthermore, accessions of group Inodorus were clustered together with England glasshouse type accessions (Fig. 2.2) and surrounded them on PCO plot (Fig. 2.3). Taking all together, the present results indicated close relationship between England glasshouse type and group Inodorus. One of the traits by which

‘Earl’s Favourite’ successfully adapted to the Japanese condition is the shelf life of fruit which is clearly longer than accessions of European cantaloupe (Seko, 1998b). Group Inodorus is well known for its very long shelf life and called as winter melon because it can be stored until winter

(Robinson and Decker‐Walters, 1997; Pitrat, 2008; Aierken et al., 2011). The fruit characteristics presented us clear picture that England glasshouse type was established from the hybrids between European cantaloupe and Group Inodorus, as suggested by Aierkin et al. (2011).

As mentioned above, group Conomon is often used as cross parent as important genetic resources for disease resistance, such as Fusarium wilt, gummy stem blight and cucumber mosaic

30 virus (Takada 1979 & 1983). It was formerly classified as var. makuwa and var. conomon, both of which have a long history of cultivation and utilization in East Asia (Kitamura, 1950). The var. makuwa is characterized by sweet fruits and utilized as a dessert, while the var. conomon has sour fruits and mainly utilized as a vegetable (Pitrat, 2008). Although these two varieties have been recognized as different crops in China and Japan, the detail of their origin and genetic relationship have not been analyzed. In the present study, it was clearly indicated that genetic diversity was small in group Conomon compared with other groups of melon (Table 2.3), which is in good accordance with the previous studies (Akashi et al., 2002; Tanaka et al., 2007; Esteras et al., 2013). As shown in Fig. 2.2, it was clearly demonstrated that group Conomon endemic to

East Asia was distantly related with groups Cantalupensis and Inodorus as also shown by previous studies (Stepansky et al., 1999; Nakata et al., 2005; Esteras et al., 2013). Fig.2.2 also demonstrated that accessions of vars. makuwa and conomon are not differentiated at all, since they were intermixed in cluster I. Interestingly, six accessions located at the bottom of cluster I, which formed a sub‐cluster, have green color of fruit rind, while others have white or yellow rind.

It was therefore suggested that vars. makuwa and conomon share the same gene pool through intercrossing in the field mediated by bees and supported the new classification system in which both varieties are classified together as group Conomon. Non‐netted melon grown in eastern part of India is considered as the prototype of this group, that is, both var. makuwa and var. conomon, and introduced to East Asia through Southeast Asia (Tanaka et al., 2007).

Chapter 3. Development of RAPD‐derived STS markers for genetic diversity assessment in melon (Cucumis melo L.) 3.1. Introduction

Melon (Cucumis melo L.) is considered as one of the most morphologically diverse species among the major cucurbit crops, even among vegetables. Pitrat et al. (2008) have classified fifteen botanical groups of melon including five botanical groups in ssp. agrestis (acidulus, conomon, momordica, makuwa, chinensis) and ten botanical groups in ssp. melo (chate, flexuosus, tibish, adana, ameri, cantalupensis, chandalak, reticulatus, inodorus, dudaim). However, recent findings of the African and Asian melon not included in this taxonomy caused confusion.

Application of molecular markers to assess genetic diversity is essential to refine morphological‐ based classification.

Abundant of molecular markers are applicable to reveal the variation within melon accessions including restriction fragment length polymorphisms (RFLP) (Neuhausen, 1992), random ampliﬁed polymorphic DNA (RAPD (Tanaka et al., 2007; Nhi et al., 2010)), simple sequence repeats (SSR (Aierken et al., 2011)), and single nucleotide polymorphisms (SNP (Blanca et al., 2013)). PCR‐based markers, especially RAPD and SSR, have received much attention; however, RAPD markers are dominant markers and incapable to detect heterozygote; also, difficult to reproduce RAPD profile between different laboratories due to their lack of specificity.

In contrast, SSR markers often require high resolution and laboratory intensive techniques.

Therefore, genetic diversity analysis requires a new type of marker targeted to specific sites and needs no manipulation of amplified products for polymorphism detection.

In broad sense, STS markers are generated by a pair of primers (18‐21 nucleotides) which are designed based on known DNA sequences. In narrow sense, STS markers are produced based on the conversion from RAPD/AFLP/RFLP markers which are referred as another name SCAR

(Sequence Characterized Amplified Region). STS marker was firstly introduced by Olson et al.

(1989) as a DNA landmark in physical map of human which occurred only once in a genome or chromosome. STS marker is now used as a valuable genetic marker to distinguish individuals with many advantages including high specificity and reproducibility, low time‐consuming and easiness to conduct (Paran & Michelmore, 1993; Horejsi et al., 1999; Mammadov et al. 2010; Heikrujam et al., 2014; Kanno et al., 2014).

The goal of this study was to develop RAPD‐STS markers by designing specific primer sets from RAPD sequences to provide potential markers for genetic diversity analysis in melon.

3.2 Materials and methods

DNA materials

A total of twenty‐four melon accessions for each primer were selected based on RAPD profile from previous studies (Tanaka et al., 2007; Nhi et al., 2010) for screening polymorphism of RAPD‐STS markers. The polymorphic RAPD‐STS markers were used to genotype forty‐one melon accessions (Nhi et al., 2010) (Table 3.1).

Total DNA from melon leaves was extracted by CTAB (cetyl trimethyl ammonium bromide) method as described by Murray and Thompson (1980) with minor modifications.

Table 3.1. Forty‐one melon accessions using for RAPD‐STS markers validation (Nhi et al., 2010)

Accession Province /Cultivar Country of origin Group/Variety Melon type No.

VN3 Cao Bang Vietnam Momordica Dua bo VN16 Hoa Binh Vietnam Momordica Dua bo VN23 Son La Vietnam Momordica Dua bo VN24 Son La Vietnam Momordica Dua bo VN25 Son La Vietnam Momordica Dua bo VN102 Lang Son Vietnam Momordica Dua bo VN145 Dien Bien Vietnam Momordica Dua bo VN146 Dien Bien Vietnam Momordica Dua bo VN170 Ha Tinh Vietnam Momordica Dua bo VN19 Son La Vietnam Conomon var. makuwa Dua vang VN20 Son La Vietnam Conomon var. makuwa Dua le VN123 Thua Thien Hue Vietnam Conomon var. makuwa Dua le VN140 Phu Yen Vietnam Conomon var. makuwa Dua le VN174 Ha Tinh Vietnam Conomon var. makuwa Dua le VN120 Quang Tri Vietnam Conomon var. conomon Dua gang VN131 Thanh Hoa Vietnam Conomon var. conomon Dua gang VN137 Quang Nam Vietnam Conomon var. conomon Dua gang VN139 Phu Yen Vietnam Conomon var. conomon Dua gang VN12 Bac Kan Vietnam Conomon Dua thom VN13 Tuyen Quang Vietnam Conomon Dua thom VN21 Son La Vietnam Conomon Dua thom VN22 Son La Vietnam Conomon Dua thom VN43 Son La Vietnam Conomon Dua thom VN47 Dien Bien Vietnam Conomon Dua thom VN53 Son La Vietnam Conomon Dua thom VN56 Son La Vietnam Conomon Dua thom VN135 Hung Yen Vietnam Agrestis Dua dai P90 Japan Conomon var. conomon Kinpyo P130 Japan Conomon var. conomon Karimori C28 China Conomon var. makuwa Xing‐tang‐mian‐gua P83 China Conomon var. makuwa Mi‐tang‐ting P142‐1 China Conomon var. makuwa Da‐mian‐gua P144‐1 China Conomon var. makuwa Shi‐ling‐huang‐jin‐gua P154‐1 China Conomon var. conomon Chi‐86‐61 P155‐1 China Conomon var. makuwa Qian‐zhong‐5 CYW37 Yunnan China Conomon CYW49 Yunnan China Conomon Tan6‐1 China Conomon Qqing‐pi‐cai‐gua P73 USA Inodorus Honey Dew P94 France Cantalupensis Charentais P117 Spain Inodorus Tendral

Cloning and sequencing of RAPD‐ generated DNA fragments

RAPD reactions were performed and analyzed following Nhi et al. (2010). The bright and highly reproducible products of eighteen RAPD markers were excised from agarose gel and purified by QIAquick PCR purification kit (QIAGEN, USA). The RAPD fragments were cloned into pCR2.1‐TOPO of the TOPO TA cloning kit (Invitrogen, USA) followed by the manufacturer’s instructions and sequenced by using an ABI PRISMR 3730 DNA Analyzer (Applied Biosystems,

USA).

RAPD‐STS primer design

To design a pair of primer (forward primer and reserve primer) specific to each RAPD marker sequence, the additional 5’ and 3’ flanking sequences were obtained from the melon genome database by BLAST using the marker sequence as a query (http://melonomics.net/).

Based on the genomic sequence including RAPD marker sequence and 5’ and 3’ flanking sequences obtained, primers consisting of 18‐21 nucleotides were designed by Primer3

(http://bioinfo.ut.ee/primer3‐0.4.0/primer3/). Whole or part of the original RAPD primer sequence was included in the new primers.

RAPD–STS analysis

The 10µl PCR mixture for RAPD‐STS analysis comprised of 50ng of genomic DNA; 1µl PCR buffer (Sigma, USA: 10 mM Tris‐HCl; pH 8.3, 50 mM KCl); MgCl2; 0.1 mM dNTP; 0.25 μM of each primer, and 0.25U Taq polymerase (Sigma, USA). Amplification reactions were performed using an iCycler (Bio‐Rad, USA). The PCR cycle started with an initial denaturing step at 950C for 3 minutes, followed by 35 cycles of 1 min at 950C, 1 min for annealing and 2 min at 720C. The final

0 step was at 72 C for 5 min. The annealing temperature and MgCl2 concentration were adjusted depending on RAPD–STS primer sets. The PCR products were separated on 1.5% agarose gels in

TBE buffer, stained with ethidium bromide, and visualized under ultraviolet light.

Data analysis

The RAPD marker band and RAPD‐STS marker band were scored as 1 for presence and 0 for absence. From these data, the polymorphic index content (PIC) was calculated according to

Anderson et al. (1993). Genetic similarity (GS) among accessions was calculated as described by

Apostol et al. (1993) and their genetic distance (GD) was calculated with the formula GD=1‐GS. A dendrogram was constructed by the PHYLIP program (Felsenstein, 1993) using the unweighted pair group method with arithmetic mean (UPGMA) method. Mantel’s test of XLSTAT software was used to find out the correlation between dendrograms constructed respectively by RAPD‐

STS markers and RAPD markers. Population structure and identification of admixed individuals was performed using STRUTURE 2.2 software (Pritchard et al., 2000).

3.3. Result and discussion

3.3.1. Development of RAPD‐STS markers

A total of 18 polymorphic bands of RAPD markers were cloned and successfully sequenced. Basically, based on the internal sequence within the cloned RAPD markers, RAPD‐STS markers were designed either by adding 10 to 14 bases to 3’ end of the original primer sequence

(Paran et al., 1993; Horejsi et al., 1999; Kiran et al., 2010) or by settling inner side of the cloned

RAPD fragments without regard to the sequence of the RAPD primers (Monna et al., 1994;

Mekuria et al., 2002). Upstream and downstream of sequences flanking to the RAPD marker sequence were obtained using BLAST tool. RAPD‐STS primers were then designed (Table 3.2).

Table 3.2. Sequence of 18 RAPD‐STS primer sets and their expected size

Expe RAPD- RAPD- cted Expected STS Primer sequence STS Primer sequence size size(bp) marker marker (bp) ATAGATCACCTAGCGGGACCA CACACTCGTCATATACA A20 800 B68 1078 ACGAACTCAAACCGGGACCA CACACTCGTCATGTTT TTTTCCAAGAACGGGAAGG GGACCTCCATCGATAA A22 350 B71 1220 GGTGAAGAAGCCAAACTACCA GGACCTCCATCGTATCC AGTGGTGGTATACCTGT CTTATGGATCCGCTTGGTATG A23 1200 B84-600 600 CAGGAGTAAGCCGAATC CTTATGGATCCGACGAAGAG GTTAATGGAGCTGCGTATTCA CTTATGGATCCGTTTGGTAA A26 1400 B84-700 700 TGAGGATTCATTAGGCAAAGC CTTATGGATCCGACGAAGAG GGCAGCAGTGGTGGCATC TCGAGCGAACGTAATGAAGA A31 800 B86 1370 GGAACAAATAAGTGTGTGGTATC TACTGTTATCCCGAGCGAATG

AATAGACCCTTGTACGGTAT AAAGACTGCTACCAAAACGAA A41 930 B96-750 750 GATGAGGAGTTGGTACTGTAT TGGTCGTGTGAATACTATGGA GGCTACAAAGGTGAAAACTAT GCTAATAAGCAATTGGCGAAC A57 800 B96-850 GG 850 GCCAAAGATCGATTGTCGAA TGAGATTATGAATCCTATGTATG CCTTGGCATCGGTATGTA TTCTGCTCGAAACTCTAGG B15 600 B99 1550 CTTGGCATCGGCACCTTT TTCTGCTCGAAATACAAGAAA TTTTTACGTACGTGGATACCAA GAGTTGTATGCGGAGTTGGA B32 700 C00 1350 TCATCTAAAATTAATGGATCGT GTTGTATGCGATAAAGTCAACA

3.3.2. Detection efficiency and sensitivity of RAPD‐STS markers

Three out of eighteen RADP‐STS markers (A23, B32 and B68) failed to amplify. Fifteen primers successfully produced a single band of expected sizes from melon genome, except for A22.

Marker A22‐RAPD‐STS amplified a 350bp fragment, which was much smaller than those amplified by A22‐RAPD (1520 bp‐fragment). The sequence of 350bp fragment was 99.99% identical to the downstream sequence of 1520bp fragment.

Reference accessions including ‘plus RAPD’ accessions (can be amplified according to RAPD profile) and ‘minus RAPD’ accessions (cannot be amplified according to RAPD profile) were used

37 for selecting the polymorphic marker among 15 RAPD–STS primers. Two different types of polymorphism were observed. A20 showed different sizes of fragment (1100bp and 800bp), while

A22, A31, A57, B15, B71 and C00 showed presence or absence of band (Fig.3.1). For these markers, positive control primer sets shown in Table 3.3 were combined in the PCR reaction and multiplex PCR was performed, in order to confirm the absence of marker band. Interestingly,

B99‐RAPD‐STS marker can recognize not only the presence or absence of 1550bp band as expected but also independently can recognize the presence or absence of 1400bp band. It means that B99‐RAPD marker was converted into two RAPD‐STS markers which are B99‐1550‐

RAPD‐STS and B99‐1400‐RAPD‐STS. The other seven markers showed no polymorphism.

In this study, the loss of polymorphism was observed in ten out of eighteen RAPD‐STS markers.

The difficulty in polymorphism reproduction was also observed by Paran et al. (1993); Horejsi et al. (1999); Mammadov et al. (2010). Paran et al. (1993) explained that the lack of specificity in

RAPD primer can lead to mismatch at the primer sites and produce the artifactual bands (false positives) corresponding to rearranged fragments. Therefore, the sequence data of RAPD marker fragment did not provide information on these mismatches explains why RAPD‐STS markers lost the polymorphism when converted from RAPD markers.

Fig.3.1. The comparison of two RAPD‐STS markers with the corresponding RAPD markers A: A20‐RAPD‐STS marker showed the polymorphism by the difference of band sizes, an 800bp band in the ‘RAPD plus’ accession and a 1100bp band in the ‘RAPD minus’ accession. ‘*’ indicates the discrepancy between RAPD profile and RAPD‐STS profile. B: A20‐RAPD showed the polymorphism by the difference of band sizes, 800bp and 1100 bp, respectively. C: B15‐RAPD‐STS marker showed 600bp + 387bp bands in ‘RAPD plus’ accession and only 387bp band in ‘RAPD minus’ accession, respectively. A 387bp band is the band size of positive control ETR2. D: B15‐RAPD showed the polymorphism by the appearance or the absence of 600bp band. M is the lane of 100bp DNA ladder.

3.3.3. Validation of RAPD‐STS markers

To confirm the accuracy and stability of new RAPD‐STS markers (A20, A22, A31, A57, B15, B71,

B99 and C00), 41 melon accessions were genotyped and compared with RAPD profile (Nhi et al.,

2010). All markers produced clear and reproducible polymorphic fragments in the 41 accessions, except for C00. C00 did not show polymorphism among 41 melon accessions so that it was eliminated during establishment of phylogenetic tree. As mentioned above, the B99‐RAPD marker was successfully converted into two RAPD‐STS markers hence, validation of RAPD‐STS markers by using 41 melon accessions, the dendrogram derived from RAPD‐STS markers was constructed by the analysis of nine markers in contrast to eight markers in the case of RAPD markers.

The average PIC value of all the RAPD‐STS markers was 0.346, with a maximum of 0.485 for

A22 and a minimum of 0.136 for B99‐1400 and B15 (Table 3.2). Most of PIC values obtained from

RAPD‐STS markers were higher than those obtained from RAPD markers. Thus, RAPD‐STS markers were more polymorphic than RAPD markers.

3.3.4. Genetic diversity analysis of melon germplasm

A total of forty‐one melon accessions were used to assess their genetic diversity. Of these, twenty‐seven accessions were collected from Vietnam. These accessions mainly belong to var. conomon and var. makuwa and have a large phenotypic diversity and a low genetic diversity (Nhi et al., 2010). Despite of the low genetic diversity of 41 melon accessions, both of RAPD markers and RAPD‐STS markers still divided them into two major clusters (Fig.3.2). Cluster I consisted of

28 accessions which were dominated by andromonoecious type, except for VN139, whereas the remaining accessions were included in cluster II which was further divided into two sub‐clusters.

Sub‐cluster IIa included 10 monoecious accessions, while sub‐cluster IIb was composed of three andromonoecious accessions of European and American origin. Furthermore, the correlation between RAPD‐STS‐based dendrogram and RAPD‐based dendrogram was 0.896 by Mantel’s test.

Table 3.3. PCR conditions of nine sets of RAPD‐STS primers and the PIC values of RAPD‐STS and RAPD polymorphism in 41 melon accessions

PICc RAPD‐ Annealing concentration Expected Type of Positive control Amount of STS temperature a b of MgCl2 (mM) size(bp) polymorphism primers primers RAPD‐ markers (0C) RAPD STS

800 A20 62 2.5 InDel Not used 0.450 0.485

1100 0.433 0.433

A22 62 2.5 350 Presence/absence ACO1‐MS3 2:1 0.485 0.476

A31 64 2.5 800 Presence/absence ACO1‐MS3 2:1 0.414 0.314

A57 62 2.5 800 Presence/absence ETR‐MS2 1:1 0.450 0.000

B15 62 2.5 600 Presence/absence ETR‐MS2 2:1 0.136 0.136

B71 60 2.5 1220 Presence/absence B86‐1370 2:1 0.214 0.214

B99 64 2.5 1400 Presence/absence Not used 0.393 0.136

Presence/absence 1550 0.136 ‐

C00 62.5 2.0 1350 Presence/absence ETR‐MS2 2:1 0.000 0.000 a Sequence of positive control primers ACO1‐MSF3CCACCTCCTCTCTTTCCCACATA ACO1‐MSR3 CTCCTTAAACCTCTCTTCCATAC ETR‐MSF2ATCGATTGTTGAAGCAACTTT ETR‐MSR2GAGACCCAGAAAGGCGTTTAG B86‐1370‐F2 TCGAGCGAACGTAATGAAGA B86‐1370‐RTACTGTTATCCCGAGCGAATG b (amount of RAPD‐STS primers): (amount of positive control primers) C’‐ ‘means that the marker band was not scored by Nhi et al. (2010)

Based on the membership coefficients, the accessions which had the coefficients over 70 % were assigned to the corresponding subgroups, while others categorized as the admixture (Fig.

3.3). With RAPD‐STS markers, a monoecious accessions VN139 is considered as admixture form with inferred value from cluster I and cluster II are 69% and 31%, respectively. The admixture is likely the result of hybridization between two groups. As one more remarkable case, VN13 was regarded as admixture with inferred value from cluster II quite high (34.8%) by RAPD analysis while this value was only 3.4% by RAPD‐STS analysis. In other words, the genetic architecture of

41 divergent accessions can be estimated by assessing the STRUTURE of the population using RAPD‐

STS markers.

Fig.3.2. Comparison of phylogenetic trees constructed by RAPD‐STS analysis (RAPD‐STS ‐41‐9) and RAPD analysis (RAPD – 41‐8).

Fig. 3.3. Bar plots for individual melon accessions by STRUCTURE 2.2 using the admixture model based on eight RAPD markers (upper) and nine RAPD‐STS markers (lower)

In short, the results derived from analysis of genetic diversity and population structure strongly supported that nine RAPD‐STS markers can be utilized as efficient molecular markers to analyze diversity of melon.

3.4. Conclusion In general, this study contributed advantages of STS markers compared with RAPD markers. With the use of primer sets designed using the external sequences of the cloned RAPD fragments; we can identify the position of RAPD‐STS markers in the melon genome, which is meaningful not only for diversity analysis but also for mapping projects. Conversion of RAPD markers into RAPD‐STS markers was not easy task. Especially, the polymorphism loss tended to occur at high frequency. However, the success of conversion of nine RAPD‐STS markers (A20, A22,

A31, A57, B15, B71, B99‐1400, B99‐1550 and C00) will be useful for genetic diversity analysis as well as population mapping. RAPD‐STS marker A20 showed polymorphism with different sizes of

43 fragment; while the remaining markers (A22, A31, A57, B15, B71, B99‐1400, B99‐1550 and C00) showed presence/absence polymorphism. These nine markers could amplify various sizes of marker fragment ranging from 350 bp to 1350bp, indicating that they are valuable for diversity analysis. Indeed, validation of these nine markers using 41 melon accessions was initial evidence for the applicability of them. In order to widely apply the set of these RAPD‐STS markers, we suggest these nine markers need to continue being validated on various melon populations. If they are stable and reliable, nine markers should be used as efficient molecular markers to analyze diversity of melon and Cucumis sp.

Chapter 4. General conclusions

Melon is high value crops especially melon belong to group Cantalupensis and Inodorus.

However, only breeding and selection within those groups cannot improve cultivars in terms of yield, fruit quality and disease resistance because of the narrow genetic base. Therefore, to broaden genetic base is required. One of the solutions is to explore melon germplasm from Asia,

Australia and Africa. Surprisingly, Asian melon contains high genetic diversity with the high number of landraces. For 20 years, studies of Asian melon germplasm are conducted not only for breeding purpose but also for genetic conservation and for answering the question of melon origin and domestication. Our study has focused on investigation on melon germplasm in East

Asia, namely Japanese melon and South East Asia, namely Vietnamese melon. We also studied about the development of molecular markers to provide more effective tools for analysis.

Here, the summary of our results is shown:

Firstly, to figure out genetic structure of Japanese melon, in this study, 57 melon accessions from three horticultural groups were examined by using 24 RAPD primers. Japanese melon can be divided into two types (netted melon and group Conomon). Netted melon had close relationship with England glasshouse type which classified as var. reticulatus. Furthermore, our result confirmed that England glasshouse type had been established from the hybrids between European cantaloupe and Group Inodorus. Meanwhile, group Conomon was formerly classified as var. makuwa and var. conomon, both of which have a long history of cultivation and utilization in East Asia.

Secondly, we are successful to develop nine RAPD‐STS markers derived from eight corresponding RAPD markers which can be used for analysis of genetic diversity of melon.

Validation of these nine markers using 41 melon accessions, among them 27 Vietnamese melon included, indicated the applicability of them. However, the number of markers successfully converted was still limited, hence they are not enough to be applied as the independent set for genetic diversity analysis.

Acknowledgements

Undertaking this PhD has been a truly life‐changing experience for me, and it would not have been possible to do without the support and encouragement that I received from many people.

Foremost, I would like to express my sincere gratitude to my supervisor Prof. Kenji Kato who gave me the continuous support and guidance throughout my time of studying and researching in Okayama

University. Without his persist effort and encouragement, I would not have been possible to make this work come into existence.

I would like to express my special appreciation to Assoc. Prof. Hidetaka Nishida for his valuable suggestions on my research and for always being so supportive of my work.

My sincere thanks go to Dr. Katsunori Tanaka (Hirosaki University) for his insightful comments which have contributed greatly to the improvement of my study. I would like to express the gratitude to

M.Sc. Duong Thanh Thuy who has been my great partner in all projects we have participated together.

I am especially grateful to all Professors, Lecturers and Staffs who have taught and supported me during three years in Okayama University.

I thank my fellow lab mates of the laboratory of Plant Genetics and Breeding, Faculty of Agriculture,

Okayama University for the stimulating discussions, for the sleepless nights we were working together before deadlines, and for all the fun we have had in the last three years.

Sincere thanks to all my friends, especially Vietnamese friends studying in Okayama University, who have shared good time as well as difficult time with me.

Last but not the least, I would like to say a heartfelt thank you to my parents for always believing in me and encouraging me to follow my dreams.

References

1. Aierken, Y., Y. Akashi, P. T. P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M. Z.

Wu and K. Kato (2011). Molecular analysis of the genetic diversity of Chinese Hami melon

and its relationship to the melon germplasm from Central and South Asia. J. Jpn. Soc.

Hortic. Sci., 80, 52–65.

2. Akashi, Y., Fukuda, N., Wako, T., Masuda, M., Kato, K. (2002). Genetic variation and

phylogenetic relationships in East and South Asian melon, Cucumis melo L., based on the

analysis of five isozymes. Euphytica, 125,358 ‐ 396.

3. Anderson, J. A., G. A. Churchill, J. E. Autrique, S. D. Tanksley and M. E. Sorrells (1993).

Optimizing parental selection for genetic‐linkage maps. Genome, 36, 181–186.

4. Apostol, B. L., W. C. IV Black, B. R. Miller, P. Reiter and B. J. Beaty (1993). Estimation of

the number of full sibling families at an oviposition site using RAPD‐PCR markers:

applications to the mosquito Aedes aegypti. Theor. Appl. Genet., 86, 991–1000.

5. Blanca J, Esteras C, Ziarsolo P, Perez D, Ferna´ndez V, Collado C, Rodriguez R, Ballester A,

Roig C, Canĩzares J, Pico B (2012). Transcriptome sequencing for SNP discovery across

Cucumis melo. BMC Genomics, 13:280. doi:10.1186/1471‐2164‐13‐280.

6. Chen J. F. and and Jeffrey A. (2000). Interspecific hybridization in Cucumis—Progress,

problems, and perspectives. HORTSCIENCE, VOL 35, (1), 11‐15.

7. Chung SM, Staub JE, Chen JF (2006). Molecular phylogeny of Cucumis species as revealed

by consensus chloroplast SSR marker length and sequence variation. Genome ,49, 219–

229.

8. Cogniaux A. (1881). Cucurbitaceae. In Monogr. Phan., eds. A. L. P. P. de Candolle and A. C.

P. de Candolle, 3, 325‐951, 953‐954. Paris: G. Masson.

9. Dhillon NPS, Ranjana R, Singh K, Eduardo I, Monforte AJ, Pitrat M, Dhillon NK, Singh PP

(2007). Diversity among landraces of Indian snap melon (Cucumis melo var. momordica).

Genet Resour Crop Evol, 54, 1267–1283.

10. Dhillon NPS, Singh J, Fergany M, Monforte AJ, Sureja AK (2009). Phenotypic and molecular

diversity among landraces of snap melon (Cucumis melo var. momordica) adapted to the

hot and humid tropics of eastern India. Plant Genet Resour: Charact Util, 7(3), 291–300.

doi:10.1017/S1479262109990050.

11. Endl, J., Achigan‐Dako, E. G., Pandey, A. K., Monforte, A. J., Pico, B., & Schaefer, H. (2018).

Repeated domestication of melon (Cucumis melo L.) in Africa and Asia and a new close

relative from India. American Journal of Botany, 105(10), 1662 ‐ 1671.

12. Esteras, C., G. Formisano, C. Roig, A. Díaz, J. Blanca, J. Garcia‐Mas, M. L. Gómez‐Guillamón,

A. I. López‐Sesé, A. Lázaro, A. J. Monforte and B Picó (2013). SNP genotyping in melon:

genetic variation, population structure, and linkage disequilibrium. Theor. Appl. Genet.,

126, 1285–1303.

13. Felsenstein, J. 1993. PHYLIP: phylogeny inference package (version 3.5c). University of

Washington, Seattle.

14. Fergany, M., Kaur, B., Monforte, A. J., Pitrat, M., Rys, C., Lecoq, H., Dhillon, N. P. S.,

Dhaliwal, S.S. (2011). Variation in melon (Cucumis melo) landraces adapted to the humid

tropics of southern India. Genet Resour Crop Evol, 58, 225 ‐ 243.

15. Funicity, N. (1992). Melon in ancient Japan based on the analysis of seed remains ‐ its type,

introduction, transmission and use ‐. Archaeol. J., 354, 7–13 (in Japanese).

16. Garcia‐Mas J, Oliver M., Gómez‐Paniagua H., de Vicente M.C. (2000). Comparing AFLP,

RAPD and RFLP markers for measuring genetic diversity in melon. Theor Appl Genet, 101,

860–864.

17. Garcia‐Mas J, Monforte AJ, Arús P (2004). Phylogenetic relationships among Cucumis

species based on the ribosomal internal transcribed spacer sequence and microsatellite

markers. Plant Syst Evol, 248,191–203.

18. Ghebretinsae A.G., Thulin M., Barber J.C. (2007). Relationships of cucumbers and melon

unraveled: Molecular phylogenetics of Cucumis and related genera (Benincaseae,

Cucurbitaceae). Am J Bot, 94, 1256–1266.

19. Gonzalo M. J.,Díaz A., Dhillon N.PS., Reddy U.K., Picó B. and Monforte A.J. (2019). Re‐

evaluation of the role of Indian germplasm as center of melon diversification based on

genotyping by‐sequencing analysis. BMC Genomics, 20:448.

https://doi.org/10.1186/s12864‐019‐5784‐0.

20. Gower, J. C. (1966). Some distance properties of latent root and vector methods used in

multivariate analysis. Biometrika, 53, 325–338.

21. Grebenschikov I. (1953). Die Entwicklung der Melonensystematik. Kulturpflanze. 1, 121‐

138.

22. Hammer, K., P. Hanelt and P. Perrino. (1986). Carosello and the taxonomy of Cucumis

melo L. especially of its vegetable races. Kulturpflanze, 34, 249‐259.

23. Heikrujam M., Sharma K., Kumar J., Agrawal V. (2014). Generation and validation of

unique male sex‐specific sequence tagged sites (STS) marker from diverse genotypes of

dioecious Jojoba‐Simmondsia chinensis (Link) Schneider. Euphytica, 199(3),363–372.

24. Horejsi T., Box J. M., Staub J. E. (1999). Efficiency of Randomly Amplified Polymorphic DNA

to sequence characterized amplified region marker conversion and their comparative

Polymerase Chain Reaction sensitivity in cucumber. J. Amer. Soc. Hort. Sci, 124(2), 128–

135.

25. Jeffrey C (1980). A review of the Cucurbitaceae. Bot J Linn Soc, 81, 233–247.

26. John, J., S. Scariah, V. A. M. Nissar, M. Latha, S. Gopalakrishnan, S. R. Yadav, and K. V. Bhat.

(2013). On the occurrence, distribution, taxonomy and gene pool relationship of Cucumis

callosus (Rottler) Cogn., the wild progenitor of Cucumis melo L. from India. Genetic

Resources and Crop Evolution, 60, 1037–1046.

27. Kawaide, T. (1975). Breeding for disease resistance of vegetable crops in Japan, part 1

Cucurbits. JARQ, 9 (4), 212‐216.

28. Kamiya, E. (1973). Onshitsu Meron no Saibai to Keiei [Cultivation and management in

greenhouse melon]. Seibundo Shinkosha, Tokyo (in Japanese).

29. Kanno A., Shosei K., Katsuya I. (2014). Conversion of a male‐specific RAPD marker into

an STS marker in Asparagus officinalis L. Euphytica, 197(1), 39‐46.

30. Kato, K., Y. Akashi, A. Okamoto, S. Kadota and M. Masuda (1998). Isozyme polymorphism

in melon (Cucumis melo L.), and application to seed purity test of F1 cultivars. Breed. Sci.,

48, 237–242.

31. Katsumata, H. and H. Yasui (1964). Studies on the combining abilities and classification of

the varieties in oriental melon (Cucumis melo L.). Bull. Hortic. Res. Stn. Ser. D, Kurume 2,

49–68 (in Japanese with English summary).

32. Kirkbride J. H. (1993). Biosystematic monograph of the genus Cucumis (Cucurbitaceae).

Parkway Publishers, North Carolina.

33. Kitamura, S. (1950). Notes on Cucumis of Far East. Acta Phytotaxon Geobot., 14, 41–44.

34. Kocyan A, Zhang LB, Schaefer H, Renner SS (2007). A multi‐locus chloroplast phylogeny

for the Cucurbitaceae and its implications for character evolution and classification. Mol

Phylogenet Evol, 44, 553–577.

35. Li, H. L (1970). The origin of cultivated plants in Southeast Asia. Econ. Bot., 24, 3–19.

36. Luan F, Delannay I, Staub JE (2008). Chinese melon (Cucumis melo L.) diversity analyses

provide strategies for germplasm curation, genetic improvement, and evidentiary

support of domestication patterns. Euphytica, 164, 445–461.

37. Mammadov A.Ch., Li X.M., Wang R.C. (2010). Development of STS and CAPS markers

specific to genomes in the tribe Triticeae. Proceedings of ANA (Biological Sciences), 65(5‐

6), 122‐131.

38. Malik, A. A., Vashisht, V.K., Singh, K., Sharma, A., Singh, D. K., Singh, H., Monforte, A. J.,

McCreight, J. D., Dhillon, N. P. S. (2014). Diversity among melon (Cucumis melo L.)

landraces from the Indo‐Gangetic plains of India and their genetic relationship with USA

melon cultivars. Genet Resour Crop Evol, 61, 1189 ‐ 1208.

39. McCreight, J. D. (2004). Isozyme variation in Indian and Chinese melon (Cucumis melo L.)

germplasm collections. J. AMER. SOC. HORT. SCI, 129 (6), 811 ‐ 818.

40. Mekuria G. T., Sedgley M., Collins G. (2002). Development of a Sequence‐tagged site for

the RAPD maker linked to leaf spot resistance in olive. J. Amer. Soc. Hort. Sci., 127(4), 673‐

676.

41. Monna L., Miyao A., Inoue T., Fukuoka S., Yamazaki M., Zhong H. S., Sasaki T., Minibe Y.

(1994). Determination of RAPD markers in rice and their conversion into Sequence Tagged

Sites (STSs) and STS‐specific primers. DNA Res., 1, 139‐148.

42. Munger HM, Robinson RW (1991). Nomenclature of Cucumis melo L. Cucurbit Genet Coop

Rpt, 14, 43–44.

43. Murray, G. C. and W. F. Thompson (1980). Rapid isolation of high molecular weight DNA.

Nucleic Acids Res.,8, 4321–4325.

44. Nakata, E., J. E. Staub, A. I. López‐Sesé and N. Katzir (2005). Genetic diversity in Japanese

melon (Cucumis melo L.) as assessed by random amplified polymorphic DNA and simple

sequence repeat markers. Genet. Resour. Crop Evol., 52, 405–419.

45. Naudin C (1859) Review des cucurbitace’es cultive Museum. Ann Sci Natl Ser 4 Bot 12:79–

164.

46. Neuhausen S.L. (1992). Evaluation of restriction fragment length polymorphism in

Cucumis melo. Theor. Appl. Genet., 83, 379– 384.

47. Nhi, P. T. P., Akashi, Y., Hang, T. T. M., Tanaka, K., Aierken, Y., Yamamoto, T., Nishida, H.,

Long, C., Kato, K. (2010). Genetic diversity in Vietnamese melon landraces revealed by the

analyses of morphological traits and nuclear and cytoplasmic molecular markers.

Breeding Science, 60, 255 ‐ 266.

48. Olson M., Hood L., Cantor C., Botstein D. (1989). A common language for physical mapping

of the human genome. Science, 245, 1434‐1435.

49. Paran I., Michelmore R.W. (1993). Development of reliable PCR based markers linked to

downy mildew resistance genes in lettuce. Theor. Appl. Genet., 85, 985–993.

50. Pangalo K. J. (1950). Melon as the independent genus Melo Adans. Bot. Zhurn. (Moscow

& Leningrad) 35 (6), 571‐580 [in Russian].

51. Pitrat M, Chauvet M, Foury C (1999). Diversity, history, and production of cultivated

cucurbits. Acta Hortic 492:21–28.

52. Pitrat, M. (2008). Melon. In Prohens, J. and Nuez, F.[eds], Handbook of plant breeding –

Vegetables I: Asteraceae, Brassicaceae, Chenopodicaceae, and Cucurbitaceae, 238 ‐ 317.

53. Pitrat M. (2017). Melon genetic resources: phenotypic diversity and horticultural

taxonomy. In: Grumet R, Katzir N, editors. Genetics and genomics of the Cucurbitaceae.

New York: J Garcia‐Mas Springer, 25–60.

54. Pritchard, J.K., Stephens, M., Donnelly, P. (2000). Inference of population structure using

multi‐locus genotype data. Genetics, 155, 945 ‐ 959.

55. Renner SS, Schaefer H, Kocyan A (2007). Phylogenetics of Cucumis (Cucurbitaceae):

cucumber (C. sativus) belongs in an Asian/ Australian clade far from melon (C. melo). BMC

Evol Biol 7:58. doi:10.1186/1471‐2148‐7‐58.

56. Robinson, R.W. and D.S. Decker‐Walters. (1997). Cucurbits, CAB International, Oxon (U.K.),

New York (U.S.A.).

57. Sabato D., Esteras C., Grillo O., Peña‐Chocarro L., Leida C., Ucchesu M., Usai A., Bacchetta

G., Picó B. (2019). Molecular and morphological characterisation of the oldest Cucumis

melo L. seeds found in the Western Mediterranean Basin. Archaeol Anthropol Sci 11:789–

810. https://doi.org/10.1007/s12520‐017‐0560‐z.

58. Schaefer H. (2007). Cucumis (Cucurbitaceae) must include Cucumella, Dicaelospermum,

Mukia, Myrmecosicyos, and Oreosyce: A recircumscription based on nuclear and plastid

DNA data. Blumea, 52, 165–177

59. Sebastian, P., Schaefer, H., Telford, I. R. H., & Renner, S. S. (2010). Cucumber (Cucumis

sativus) and melon (C. melo) have numerous wild relatives in Asia and Australia, and the

sister species of melon is from Australia. Proceedings of the National Academy of Sciences,

107(32), 14269 ‐ 14273.

60. Seko, T. (1998a). Waga‐koku Roji (hausu) meron no keifu (1) [Pedigree record in Japanese

open‐field and greenhouse melon (1)]. Nogyo oyobi Engei, 73, 8, 68–72 (in Japanese).

61. Seko, T. (1998b). Waga‐koku Roji (hausu) meron no keifu (2) [Pedigree record in Japanese

open‐field and greenhouse melon (2)]. Nogyo oyobi Engei, 73, 9, 55–58 (in Japanese).

62. Seko, T. (1998c). Waga‐koku Roji (hausu) meron no keifu (3) [Pedigree record in Japanese

open‐field and greenhouse melon (3)]. Nogyo oyobi Engei, 73, 10, 68–71 (in Japanese).

63. Seko, T. (1999). Waga‐koku Roji (hausu) meron no keifu (15) [Pedigree record in Japanese

open‐field and greenhouse melon (15)]. Nogyo oyobi Engei, 74, 10, 67–72 (in Japanese)

64. Serres‐Giardi, L. and Dogimont, C. (2012). How microsatellite diversity helps to

understand the domestication history of melon. In N. Sari, I. Solmaz, and V. Aras [eds.],

Cucurbitaceae 2012. In Proceedings of the Xth EUCARPIA meeting on genetics and

breeding of Cucurbitaceae, 254 ‐ 263, University of Cukurova, Antalya, Turkey.

65. Silberstein L, Kovalski I, Huang R, Anagnostou K, Jahn MK, Perl‐Treves R (1999). Molecular

variation in melon (Cucumis melo L.) as revealed by RFLP and RAPD markers. Sci Hort, 7,

101–111.

66. Staub J., Box J., Meglic V., Horejsi T.F., McCreight J. D. (1997). Comparison of isozyme and

random amplified polymorphic DNA data for determining intraspecific variation in

Cucumis, Genet Res, Crop Evol, 44: 257‐269.

67. Staub, J. E., A. I. López‐Sesé and N. Fanourakis (2004). Diversity among melon landraces

(Cucumis melo L.) from Greece and their genetic relationships with other melon

germplasm of diverse origins. Euphytica,136, 151–166.

68. Stepansky, A., Kovalski, I., and Perl‐Treves, R. (1999). Intraspecific classification of melon

(Cucumis melo L.) in view of their phenotypic and molecular variation. Plant Systematics

and Evolution, 217, 313 ‐ 333.

69. Takada, K., K. Kanazawa and K. Takatsuka (1974). Studies on the breeding of melon for

resistance to powdery mildew. I. Difference of resistance among varieties and the

breeding of the resistant variety ‘Sunrise’. Bull. Veg. Ornam. Crop Res. Stn. Jpn. Ser.

A, 1, 59–91 (in Japanese with English summary).

70. Takada, K. (1979). Studies on the breeding of melon resistant to cucumber mosaic virus.

III. Inheritance of resistance of melon to cucumber mosaic virus and other characteristics.

Bull. Veg. Ornam. Crops Res. Stn. Ser. A, 5, 71–79 (in Japanese with English summary).

71. Takada, K. (1983) Breeding and characteristics of disease‐resistant melon varieties (Lines

‘Anō No. 1, No. 2 and No. 3). Bull. Veg. Ornam. Crops Res. Stn. Ser. A, 11, 1–22 (in

Japanese with English summary).

72. Tanaka, K., K. Fukunaga, Y. Akashi, H. Nishida, K. Kato and M. T. Khaing (2006).

Polyphyletic origin of cultivated melon inferred from analysis of its chloroplast genome.

In Proceedings of Cucurbitaceae 2006 (Holmes, G.J. ed.), pp.372–379, Universal Press,

Asheville, North Carolina.

73. Tanaka, K., Nishitani, A., Akashi, Y., Sakata, Y., Nishida, H., Yoshino, H., & Kato, K. (2007).

Molecular characterization of South and East Asian melon, Cucumis melo L., and the origin

of Group Conomon var. makuwa and var. conomon revealed by RAPD analysis. Euphytica,

153, 233 ‐ 247.

74. Tanaka, K., Akashi, Y., Fukunaga, K., Yamamoto, T., Aierken, Y., Nishida, H., Long, C.,

Yoshino, H., Sato, Y., Kato, K. (2013). Diversification and genetic differentiation of

cultivated melon inferred from sequence polymorphism in the chloroplast genome.

Breeding Science, 63, 183 – 196.

75. Tanaka, K., C. J Stevens, S. Iwasaki, Y. Akashi, E. Yamamoto, T. P. Dung, H. Nishida, D. Q

Fuller and K. Kato (2015). Seed size and chloroplast DNA of modern and ancient seeds

explain the establishment of Japanese cultivated melon by introduction and

selection. Genet. Resour. Crop Evol., DOI:10.1007/s10722‐015‐0314‐7.

76. Whitaker T. W. and Davis G. N. (1962). Cucurbits – botany, cultivation and utilization.

London Leonard Hill Ldt., Interscience Publisher Inc., New York.

77. Yashiro, K., Iwata, H., Akashi, Y., Tomita, K., Kuzuya, M., Tsumura, Y., Kato, K. (2005).

Genetic relationship among East and South Asian melon (Cucumis melo L.) revealed by

AFLP analysis. Breeding Science, 55, 197 ‐ 206.

78. Yi, S. S., Akashi, Y., Tanaka, K., Cho, T. T., Khaing, M. T., Yoshino, H., Nishida, H., Yamamoto,

T., Win, K., Kato, K. (2009). Molecular analysis of genetic diversity in melon landraces

(Cucumis melo L.) from Myanmar and their relationship with melon germplasm from East

and South Asia. Genet Resour Crop Evol, 56, 1149 ‐ 1161.

Appendix

Appendix 1. Sequence of 17 fragments amplified by 17 RAPD markers which were used for designing RAPD‐STS markers. The red bold letters indicated the whole or a part of the sequence of RAPD primer.

>A20‐800 P90 781 TTGCCGGGACCA TTGCCGGGACCACCACTAGAATTGACCTGCTATTCTCTGGCCATAGAACTAGGTTGTAGGACCCAAAATGTAGAGGAGTTAGAAAATTG GAGGGAATTAGGTTGAGATTTGGGAGAGGAGAAAATAATTTGGCTATTTTGTAAAAATAAATTTACCAAAATTTCAAAAAAAGTTTTTA AAATTTTGAAAAAAATGGATTTAAATAACTTAATTACATGCAATGCCAAATTTCAACACTTAACATTCCACTAACCATTAATGGAACTT AGTGGGTTAGGTGTCTACGTCTCATGTAGCCACCTATCCCACTAAATGTTAGTGTAATTATTCAACAAAATGTTGGATTTTTCCACTAA CTAATCCAATGGCAATATGGTCATTTGGCCATTTATGTCAAAGTCAATAACATTAAATATGTTTGTCCGTTTCTCTCTCTTTATCTAAT TTGGATAATTCAAATTATTCCTACATATTATTCTAAGTTAAATCCGTATGAGATAACAAGACGAATAACAAATTACATTTTCTTGAAGA GACAGACGACTAAAATTCTTATAAAATCAAGATCTTCACCAAATATAAGATCATCAAAACTAACAAAAATAATTTTAAAATTTAAAATA CTGAAAAACATATAAATATATGCGAAATCTAATTGTGTGCCCCATATGGCATGCCACAAATCCCTTTTCAAGTTCCTATCTTAGCCTGA AATATTAAAAATAGAAAAGAGTGAGTACATAAATATACCCAGTAAGAGACCCACTCCTGGTCCCGGCAA >A23‐1200 P83 1161 AAGTGGTGGTAT AAGTGGTGGTATACCTGTACTTGTCCAAAGGAATACAGATCTATTATGCAGAGAACTTGGACAACATCGTCGTCGACATTAATGATGTG AAGCCACAGATATTTACCACGGTTCCACGTGTATTGGAAAAGGTCTACGACAAGATTGTCGAAAAGGGCAAGGCGCTTACCGGTGTCAA GAAAAGCCTTTTCTTTTGGGCCTTGGATCTAGGACATCGCTATCAAGAACCACCTAAAAATGGCTTTTTATACAACCTCAAGCTGGGCA TTGCGCGGAAGTTAATTTTCTCCAAATGGAAGGAAGCGCTGGGCGGAAACATCGAGCTGATCATTTCAGGCGGCGCAGCATTGCAAGAA CGCTTGGGACGCGTATTCTGGGCTGCCGGCATCAAGGTGCTAGAAGGATATGGCTTAACGGAAACATCTCCTGTTATTGCGGTCAATTC ACATGTGGAAACCGATGTGAAATTTGGTACTGTAGGGCGCGTGCTCAAAAACTTAACGGTCAAGATTGCCAGTGATGGCGAAATACTGG TGAAAGGGCCCAGCATTACCGTAGGCTATTTCAAGAATGACGAAGCCACAAAGGAAGCGATCGATAGCGACGGCTTTTTCCATACAGGC GATATTGGCGAACTTACATCGGACGGTTTCCTAAAAATAACCGACCGTAAAAAAGAAATGTTCAAGACAGCGGGTGGTAAGTACGTGGC ACCCCAAGCGTTGGAGAATAAATTTATGGAGTCTACCCTCGTGGCTCAAGTGATGGTGGTTGGCGAAAACCAACGCTTCCCTGCAGCCC TTATTGTTCCTGCTTTTGAAGAGCTGGAAAAATGGGCTAAACACAAGGGAGTCACCTTCGGATCCAAGGAAGAGCTCATTAAAAATGCC GAGGTTATCGACAAATATCAAAAAGAATTGGATCGCTTGAACAATGATTTTGGACAATGGGAAAAAGTTAAGAAATTTGAACTGCTTCC GAAAGAATGGACAATCGATGGAGGCGAGCTTACACCGAAGCTCAGCCTGAAAAGAAAAGTAATACTCAAAAACTCGGAAGCTATCATTA ATAAAATATACGAAGAGTAGTAAACTATGGAAAAAGAAACACTAGGGCAAAAACTAAAGGGATTCGGCTTACTCCTGTTCGATACCACC ACTT >A26‐1400 1279 GGTGAGGATTCA GGTGAGGATTCATGATGAGTTTCTTCTGCTTCACAGAAATTATTTAGTTCTTCATTCTCGAATTCCTTTCCATGATCACTTCTGATTCG AACAATAATCTTTCCTTGCTCATGTTGAAGAATCAAACATAAACTGATGCATACTTTGGCAGTATTGGATTTTCCTTTGAGAAATATTA CCCAAGTAAAGCGAAAGAAGTCATCCACAACTAGAAACACATACTTTTTCCTTCCAAGGTTCTCAGTTTGCATAGGACCATAGATCCAT GTGTAATAATTCTAAAACTCTGTTCGTACAACACTCCTTCAAAATTTTGTGAGATGCCTTGATTTGCTTCCCTAATTGACAGTCACCAC AAAACAACTTGCTATTTGAGTCAATGTTTGAAATTCCTATGATAACCTCATTTTTTATAGCTTTATCAATACAACTTAAGTTGGCATGT CCCAATTTCCTATGTCATAACTGAGTTTGATCTTCTTTGATTGGGTGACATACATAAAAAACTTTAAATATCCAATGGTAACATTTATC GGCTTGTCTGCAGCCATGTATACGAATTCTTTTATTTGTATAAATTACTATGCAATTATCTTTGCTGAAATTCACAATGTAACCTTGGT CACAAAGTTGACTGACACTAATTAGATTTGTCTTGAGCCCTTCAACATACCGAACATCATTTNNNNNTCAAAATACCAAGCATTAGTTG AAGATTGAATTGTTGTAAAGTCGATATTACAAATTTCAGAATTCTTGACTCCCTATTCCTTATAACTTCTCTTGCTTCTTGATGAAAAT GAATTTAAGTTTGCGCTTTTGTGAATTATGCATAGCTTTCTGATATCAAAATCTATGTCTTTGTAAGGCTTAACAAAAAGGTCGAATAT GACCCTTTTTACCACAGTAATGACACACTTATTATTATTTTTTTTTTTGTAGAAGTGCTAACAACTTTTGTTTTAATAGGTAGTTCAGA CTTGATGTTCACAGTAGCAGGAGCAAATTTTATCCCTGTTACTTGACCAGTGCTCTTTACTGATGCGTCAAAGCCAAGACCACATCTAC TGGAACTAGGTTGTCCTGAACTCAGTATTTGATCTAAATTTTCAGACCCTGAATTTAGCATTTTTATAGATTTCATAGTTTGATCATAT

TCAGTCTGAACCTCCGTTAATTTTAGCTTCAGTGAGGATATAATGGACAATAGTCGTTCATTTTCTTCCATGAGGCCTTGTATCTTTTC TTTCTGTATAGCTTTGCCTAATGAATCCTCACC >A31‐800 P90 828 GGTGGTGGTATC GGTGGTGGTATCGACATTGGAGGACAGGGGTGACACCAAAAGAGTCGTAAAAGGCGATGAAAACGACATTTCGCGTGGTGGCAGGAGTG ACTTTTGTGAGACCTTGATCATGTTTTTGAACTTATGCGATAAGACCACACACGACAAGAATTGTATGTATTGAGGTTACACACCAAAC AAGTTGGCGACTGGAGGTATTGTGAAGCAAACTGTAAGAAGCGTTTTAGCTAAGAAAGAGTTGTGTGTTGAGGTGGGAAGCGATGTAAG CGTGGGAAGCAATGTAAGCTTCCTTCACCATGAAGTAGCTGATGTCATCCTTATGTAACAAGGTTGACGTTTTAAGTGAATTTGATCAA GATAAGGTAGTGGTTGCGGTCACATGGCGTTTTGATATTGAATGATCCTTATGTCGAACAGAGGTAATCATTCCAGCATCGAAAGCTTC ACTGGAAAAGCTTATATATATATAGGGGAAATCCAGTCAATTTAAGAGCTCATTTTTCTACATTGTGTTTGCTTAAGAAAAATTGAAGG ATTTGCAAGAAGTTTTAGGAGATGAGTTAAGCTTCGACAAAGAATTGGCTAAAAAAACTCAAGGAGTAAGTCATCCGATTGTCAGTGGT TTTCTCTAAAAGTATTTGTTAAATAAATGAATTTCTATTATGAATTCTTTTATATATCTCTTAAAATTGTTGTGTTCAATGATTTGTAT TATGTTGGTCAAATTCTTAAAATGGATATTGACTTACAAATAATTCAGAACTGAAACGAATTTGAATGGTTGTTGTAAAATGATTTTAG TACCCTATTGGATGAGATACCACCACC >A41‐930 952 TGGTAGGTAACT GTACGGTATAGGTTTGTTGGCATTACTTGTGAGTTATAGTAATATGTGATGATAACGTGTTAATTATTATTTCATTATTGATGCATATT TACATAATTTTTTAGAGCTTGTTTTATGAGCTTTTTTCTTCTAAAAACTTACCACTCACTGAGTTTTAGCCCACGTTTTCAATGTTTTT CTTCCCCATTCAGGTAGCGGTCAAGGTCTAAGCATTTGTTGAGCTCCCCATCACCATTGTAGATTCCTATTTCTTTTGTATGTATATAC TTAAGTTTTGTATTGCATTATGGGGTTATTAGAGGTGTCGAGGTTCATGCTATGGACATGTGATTGAGAGATTATTAGTGGACTGTAAT CCCTTTGTAACTAAATTCTTAGTTGGATATAAACTCTGATTGAGATTTTGGACTAGTTTGGATGAGTGTGTGGTGAGACACACTCGATG TGATTTTGTGTCTGAAGATCTCTTATATATAGAAGTGAAAATTCTTCCATTTTCAGGTTTGGCTAACCCATGTTTTAGGGAGATGTACT AAAATGTCTGGAAAATTTTATTATACATGTCCTATAGAAGTTTAAGTTGGAAAAGGTCGTTTCCAAAAGTGTTTTCATGCCACGATATA GGTTAGAGGGGAAAACAACGAGGTGTGACATGATTAGCAAGAGCCTTTAGCCAAGATATTATACACACTAGTAATAAGATTGATAGGCT GGAACAACTTTACCCTGTTTGCATTTTCCTTTTTGGGAATCAAACAGATGAAGGTTTCCACCATTGAGCTGTTCAGAATCCCTCTTTCA AAGAACTCCTTAAAAACTCCATCCAGACCCCTTTTGATAAGATTCCAATTTTTCTAAAAGAAAGCCAAAAGAACCCATATGGATTTGGA GATTTGTTACCTTCTCAACTGAAAACAATCTTTTTAATCTCTTTTATAGTATACAGTACCA >A57‐800 P90 ATCATTGGCGAA ATCATTGGCGAAAAGGGGAAGCCGATCGGTTGCGATTGAACTGACGGCAACGGTAGGAGGTGCTGATACTGGTCGACTGTAGCGGCTCC AACGGGGAAAATGACAGTGGCAGTGACGTAGTTGAGGTTGGTAGTACCGGTGAGGTTATTGCAGGTGGTCAAGAGTTTTGTGTTAGGGT TTTCCATTGGTTGATTTTTGTCAATGACAGCTAGGATTTCATTGTTCCTATGCTCCTGATACCATATTGAAAAAGAGGAAGATGAGAAA GCACAAGTTATATATGAAAAACCCTCGTACAAGGAGAAAAAACTATGATAGAAGCCTTTATTATTTTCTAATGATAAGAAGAGTACAAA AGAGAAGAATATATATATGCCATAATAAGCTCTAACAAAAAAGGAAATAAAACTAGTGTACAATAAACTATACAAATATCCTTGGGCAA TAAACCCTAATTGTTTATACTAGACTCTAATTTCCAACAATACTTCAATTGTTTCGTAGTGCAATATGTTGTTATATGATCTTGATGTT TCATGTAGCTGCTTGGCCCTGTTGTGGTTTCTATCCTTCAAGAAGCAATGAGTGGTTGCTCAAGTTTAGTGACTGAAATATCTCCGGGA TTACTTCTTAAAGATGCTGCTTATGGTGCTGCTGCATATGTTTATTATGAGCTTTCTAATTACCTGACCTTCAAGGACTGGTATGAGCT TTTTCTGATTTGTATAACACTCTTCTTCTCGTTTTAGTCTATTGTTTTATCTGTTCAGTTCGCCAATGAT >B15‐600 P90 566 CCTTGGCATCGG CCTTGGCATCGGTATGTACATGCCTAAAACTTCAGTTGTAAAACAACACTAGGAAATTCAAGCTTTTTATTTAGTATAATCCAAATTCA ACTACGTGTTAAGCGTAGCATTTATGTTTCAACCTGTTACTCTTGCATCAAAATAATCGTTTTATCTAATGTAAATTTGATAAATGATG ATAGGTTGAGATTGCCCAAGCGTATGAGAAAGGTGGAGCAGCATGCCTTAGCGTTCTCACAGATGAAAAGTTTTTTCAGGTGAAGAACA TTTTAGGAGCTCTGTCTTTCTTTCAATCTCTCGGATGGTGTTTGTCTTTTTATTCATTTTCTTTTAGTACCTGAGTTTTACATCTGTTG TTTTGGGGATTAGGGAAGCTTTGAGAATCTGGAGAAGATAAGGAATGCCGGAGTGAAGGTTTGTCTTATTTAATCATAATTTTATATAT TGGTATGTGAATTGTACTTCTAAAAGTGGGAAACATATGCAGTGCCCTCTCTTGTGCAAAGAATTTGTGGTTGATGCATGGCAGATCTA CTATGCCCGATCCAAAGGTGCCGATGCCAAGG >B32‐700 718 ATCATCGTACGT ACGTACGTGGATACCAATCATTCTCTAAAATCATGGAATGAAAATAATTAAAACAAAATTAGCTAAGTTTAAATTCAAAATTCAACCCC TCCCTAAAATCATGACAAATGCAATGCAATAATTAATTATTATGATAAAAGTTAAGAAATTAAAGAAAAATAAATTAAAAGATTCAATT TGAAGCAATGTGAAAAGTGATCTTAACAATTAACCGAAACAGAGAAAAGAACCGACATGGCCGCGCAAAAGAATGAAAATTTGAAGGAT

ATTGATTTAAGAGGAAAGAACAGAGGAAAGAACCGAGATTTGAGAAAAGAACGGAAGAACCAACAACATTTTTTATTTTCTAAATTATT TAAAAAAAACACATAATAAATTAAGTTTACATTCTCTTAATTTTAACATTTTTATTTTCTAAATTATTTATAAAAAAATCATTAATTTT GCATTCCTAACATTAGATTCCTAACATTTTGTCATATCGGTGTATTTGTTGAGATAAAAAAATCAAATAAAATATCACATATCACGAAC AAATACAATGTATTTGTAAACAATAATTCTTAACTAACTCAAAAAAAATATTATATTGTTCTAACAATCCCTAAAGAAATGTCATTAGT TTCAAAGTTCCCTAATTATTAGGATACAAAATAGAGTGTATTAATTTAGATTCTTAAATTGAATTCCTAAAATTATGCCAAAGATAACG TACGAT >B68‐1078 1053 CACACTCGTCAT CACACTCGTCATATACATTCCAACCAAGTCTCCATAATCAGCAGATTTTTTAAACCAAAGTAAAGCCTCATTAAAGTCTTTTTTCGTTT CATAAAAGCCATAATAATATCTTAATCCAATTTCCTGCATAGGAGCTATATTACCTTTTTCAGCAGACTTTTTAAAAACTTGAAACGCT TTTTCATACTCCTTATTCTTGGTAAGTTCCATTCCTAATTTATAATCAGCATGTTCCTTAAACTCCAATTCTTTATCTTGCGCCTTCAC TATCCCTATACTAAAAAGTGTGAGGAAAATTATAATTATTTTTTTCATTTTGTTATTGTTTTTAATTGTTAATCGACATAGTTATGTAC TCCAATTCCCTGATTTTCTTTATTCCAAATGCCATTATTTGGTTAGGTGTTTCTTTTTTATTATAATCTGTTTCTGCAAGGCTTTTTTG CTGCAAACAGTACAAACCACCCAGACTTCAGGTAGAAATTTTAGGTGATTTTGTTTTGGTCATTGAAGCGTTGGTTTATCATCAAACTA TTATTTCTTACATGTAAAATTAAATGTCGTAACGGTTATTTTAACATCTGTAATATCAGATTTTATTCGTGCTATTGCTCTTTTTCTAC CCTCTTCAGCTTGTTCTTTAGTCCGAAAATCTTCTTCATTTTCATTATCGCCATACGGCAAATACGAAAATCCTATATCACCGTACTGA TCAGCTTTAAATCCGTATTGAGATATCAAGTATTTTTCAAAGGTTTCTTTTGCAGATGTAATAAAGGTTTTATCACCACATTCGTTCTG TGTTAGTTGAAAAATGTCACTATAATATATATCATTAAAGTGGTAATGATATTCTAAATATCCGAAAATAGGTTTCTTTTCTTGTGCAT TCGCTATTCCTAATCCAAGAAATAGTACAAAAAGTGTAATTAGTTTTTTCATTTGTAAAATTGTTTTAAGTTAAAGGTGTTCCTACAAC AATAGAACTACTCCATTTCCACGCATAATATAAATGTTGTATATCTTGTTCATATGTTAAACATGACGAGTGTG >B71‐1220 P135 1186 GGACCTCCATCG GGACCTCCATCGATAAACTGCATAAATGGGGACATGTATGCTTTGCACCGGTTGCAACGCACAGGACCGAGTTCTCCCATGTCCACAAT TGGAGGATCGTTTTCCCCTGGTTTGATTTGAGCAAGAGGGCTCAACACGATGCCAAATGGCACAGATGCCTGAAAATGAAACAGTCACA ACCCTTAAAAAATTTCTCAGGCAACAAGATCATATTTTGCAAATGGAATCAAAACTTTGGGATGGTCAATTATGCACACATCCTGGACA ATTTCCGATTAAAAGGGTCAATTTATGTAAACCTTCTGACTTATTTTTCAAAGTCGCTTTCTTAACATGAGATAAAGCAGCCTGGCAAA AAATTGAGTGTTCGAAAGTGATTCTCATAAAATTTCTGGAGGTTATTACTCTTAAAAACTCTGACAAAGATATGTCAAGGAAAAAAATG GAATCCACCCCTCACATGAAATTGACTTTTCAAAATTTAACAGGGAGCATGAGATCGAAGAATGAAGAGTACCTGTTTCATGATGTCTT GGGTGATAGGCACGTTGTACATGGTTGAGCGAATAAACCTCGCACTTGCATTCCCCTGATCTTGTACGATAAAATCTGTGGTGACTAAT GGTGGCACCAACCCCTTTTGATTTGTATAGAATTTTCCGGACTTCGCACGTTGGTCATCAGTTATTACTTGGATCTAAAATTCAATCAG AAAATGAATGATTAATGGTGTGCAACCAGCGAAGAACAACAAGTAAAAATGAATATAAAAAGCGCAGGAAGAAAGTGTTTAGATGATGA TTGGCAAAGTAGAAATGTTATGAGGCCGAAGATTAAATAATAAAGGCAGATCTTTTCACTAAGAATCTCTTGCCAAATCAAAACTTTAT TTGTTGCTTTTGGCGATTCTAGGGGTTACTTTCTACTTTCATTACCTTAGAATTCTAGTATCAAAGTAACATCCCTAACACCTTAACCT AGAAATTAGCCTGAATAACAAAATTTAGAGTATTTAAAAATAAAAATAAATTCTTACCGGACTAGGCATTTGGTCAGGGTCAAGCTTCC GCTGCGGTTCTTGTGGTTGAGCTGGGTAGTGTGGTTGCGAGGGCTGGGATGGATAACCCCCACTTTGAGGGTAGTTAGGTGAAGGGTAT CCCCCAGGCTGTGGATACGATGGAGGTCC >B84‐600 P90 545 CTTATGGATCCG CTTATGGATCCGCTTGGTATGTTTACTGTGTCTAAGGTTTCTCGATTTTTTCTCATTTTATAATAAATTATTGGAAACAAAAAAAATAT TTTTTTTCTAGTTTCCTCTTTCTCAATTTATTTATATTTGTTTTCTTTTCTTTTTTCTCAATTATTTTTATCGGTTTTCTTTTTCTTTT TTAATTATTTTTATTGATTTTTTTTCCTTTTTCTCAATTATTTTTATTTGTTTTCTTGTGTTGTTACTCAATTATTTGTATCGGTTTCA TTTTATTGTTTCTCAATTATATTTTATTGTTTCCTTTTTGGATGGTTTCCTTTTCTTTTTCTCAATTATTTTATTTGTTTCCTTTTCTT TTTTTCTTAATTATTTTTGTTGGTTTCCTTTTCTTCCGATCTCCATCCTCTTCCTCAAATAATCATTCTCTTCCTCTCTTTCACTCATT ATCTTCCTTTACAATCCAAACTATTCCTCTTCGCTGGACTGTTCCTCTTCGTCGGATCCATAGTTTTTGATTGATTATTCCTCTTCGTC GGATCCATAAG >B84‐700 P90 680 CTTATGGATCCG CTTATGGATCCGTTTGGTAACGCTCTCGTTTCCTATTTTCTATTTTTGTTTTCATTTTTTAAGAAACAAAGGTGTTTGGTAACGTTCAT TGTTTCTTGTTCTAAAAAAAATAGAAATGTTTCTCATTTTATAAGGAATTATTAGGAACAAAAAGTGTTTCTTCTGTTCTATTTCTCAA TTATTTCTATTGGTTTACTTTTATGTTTTCTCAATTTATTTCTATTTGTTTCTTTTTTCTTTTTCTCAATTATTTTTATTAGTTTTCTT TTCCTTTTTCTCAATTATTTTTTTATTGGTTTCCTTTTTCTTTTTCTCAATCATTTTTATTGGTTTTCGTTTCCTTTTTCTCAATTATC TTTATTGGTTTTCGTTTCCTTTTTTCTCAATTATTTTTCTATTGGTTTTCTTTTCCTTTTTTCTCAATTATTTTTCTATTGGTTTCCTT

TTCCTTTTTTCTCAATTATTTTTCTATTGGTTTCCTTTTCATTTTTCTCAATTATTTTTCTATTGGTTTCCTTTTCCTTTTCTATTTTC CTCTCTGCGTGATGTTTCTTTTTATTCTTCTTATCTCCATCATCTTTTTCAAATAATCATCGTTTTCCTCTACACGTCATCTTTCGCTT CGCCTCTCATTGTCTTCCTCTATAAGCCGAACTTTTCCTCTTCGTCGGATCCATAAG >B86‐1370‐P90b 1369 ATCGAGCGAACG ATCGAGCGAACGGAGCCATTGCATACCTAGTACGACATCAACTCCTCCGAGTTCTAATGGTAGAAATTCTTCCTTCACTTTCCAATTCG TTAGTTGAATTTCCACGTTTTCACATATTCCTTTGCCTTGTACTGCTGTTCCGGATCCAAGTATAACACCGTAGTGGGCGGTTTCCTTG ACTGGTAATTGTAGTGATTCCACTAATTTTTCGGGAATGAAATTGTGGGTGGCTCCACAATCTATGAGGATGATCACTTCTTTCTCTTG GATTTTTCCTTTGACTTTCATTGTGCCCGGATCGTTCAGTCCAACAACAGAGTTTAGAGATAGTTCGGCAAAGGTCTTTTGCTTCTCTT CTACTTGCGGTGGTGCTAGTGTTTTTTCTTCAGTGGTATTTTCCTCAATTATCTCGTATTCTTCGCCTTCTTTTTTCACAACAAACATT TACAGTTCGCGTAATTCTTTCATTTTGCATCTATGATCAGCTGAATATTTTTCGTTGCATATAAAACAGAGTCCTTTTTCTTTTCGGGC CTGAAACTCTACGTCGGGTAGTCTTCTTGAGTTGGTATCCTTACGAATTTCGGCGTTATTAGAGCTCCTTAAGGTGATAGTTTGCATGG GGAAATTAGTATTCGTCTTGTTATCGCTGTTGGTGTTTGCCGATGTTCTGTTGTTTACTGTATTTTGATATTTCCCGCTCGCGAGGTTA TTTAAATTTGCTTCGTTGCGCACGATTTCTCTGTTTTCGACCAACTGCGCGAATTCCATCATTTCGGCTAATCCTTTTGGCCGACAGAG TATCACTTCCGCTCTTATCCATGGGAACAAGCCATTCATGAAGGTATCTTCGATGACTGGATCTGAAACATCACTCAATGGTGCGACGA GCTTGTCGAACAAATTCCGGTAATCATCGACTGTGGATTCTTGCTTAACTCGTAAAAACTTTCCCAATATTGTTCCGTCTCGGCTTGAT CTGAATCTTACTAATAGTCTTTCCTTCAAGTTTGACCAGCTGGTGAACTTCTCTCTTTCTTCTTGAGATCGATACCAATTCAAGGCAGG GCCATCGAAACTGATCGTAGAAACTAGCATTTTTTCAGAATCGGATAGTTTATGGATCTGAAAGTACCTTTCGGCTCTGAAGAGCCATG AGTCTGGATCTTCTCCGGCGAACACGGGCATTTCGACTTTCTTGAATTTATTCCGGTCGGCAGCGGCTTCTTCGGTCTCTGTTTTTCCT TTGTTTCGGTCGTCGAAGTTGCTTCGACCCGATACGGCCGATTTGCTGGAGTTTGCTTCTTTTTCCTTCCCTTTATTTGTCACAGACAT GTGCGCATTGGGTTCTTCATTACGTTCGCTCGAT

>B96‐750 P90 793 GTGAAGACTATG GTGAAGACTATGCTACCAAAACGAACCTACATCATCTTAAGAAATCCTTTCAACACCTCTAGAACTCCAAAATTGAATTCATAAGCCTT AGCAACCTATTAAGCTTTGTCTAATTTTGGTGAGAATGACAAAATTGGAAGTACCTTTAGCATTAATTATTCTGGCTAGAGACTTGAAG CCCTTCGCATTCCATAAAAGATCAATGAGAGCCAACTTTTCCCTCAGACTAGCAAACTTTTTGCTTTTCATTATTAGAGAGCACTGAAG ATTTTTTAGTTTACAACGTGGGATAAAAAAAGTAGTAAATACATGAAAGGGGATTATTATACAAGAAAAAGAAAAACCAAAAAAACTCC TCCAAAGAAAGGGTTCTCAACTAAGTAACATGCTACCTAGCAGTTAATTACAAAAAGTACTTGAGACTGAAGTTTAAAGAGAACATGGA ACTTCACCAAGAACCAAACATTGTATGGTCCCTCTCCACACACCCCTAAACACTATGTTATTCCTCTCCCCCCAAATATCTCACAAAAT AGCGCACACCCCAGCTGACTGTAAAAATCGGTATTTCTCAATGAAAAGCATGAGAAGAAGGAACTCCTCGATCGTCTCCCAAGCATCTC TCTGGCAAGCTAACTCAATATGAAACTCTTAAAAGAAATAGTTCCACACCGATCTAGTAAACTAACAATTCAAAAGAAGGTGATATGGA TCTTACTCTACCTTCCGACAGAGAATACAACAAAAAAGCCTCCCAAGAAGACTTCTACAATAGCCTATCCATAGTCTTCAC >B96‐850 US55 832 GTGAAGACTATG GTGAAGACTATGTATGTAGATAATGATTTGAACAAGCGTATTAATAAGTAATTCTACAATCAAAACTTTCAAGAAGCAATTTTACAAAC ATTAAGGGGAAAATAAATATGTGCATTAGTCCTACAATTAAAGCGTTGTAAAGACTACCAAAATAAGACACAAAATTACTCTTATCCTA TTGTACTTTCATGGTCTAGATAGATATCAACATAATTTTCAGAGATTTTTCTTCACTTTATTGTGAGATCGAGAGAGAAGGAAGATAGC AACAATGAAGATAAACACAAAGCGAACGACAACCGGCAACGATCATGGGGCAATCATGATCGAAATCAAGGAACCAATGATATCAAACA TTCAAAGAGTTGTACACATACTTGTGAGCCATATAGCTAAAAAGAGCAACTAAAATGCTCTCCAACGACAAAAACTCAATACCAAAATT TGTTTCACCACACTAATACCAATCTCATTGCCATCCTCGACTTGATGAGCAGTGTAATAAAATTGCTGCACTATGAACAGAATATTCAA TTCGACGTATAGGAAGCATCAGAAGCTAAAGTTTACATGTTAATTCACTCCCAATTTGGCACAAACGGGTTTCTAATTGGTTAAATTTT TCTGACAGCTATAATAACAACTTCCCCTATCAACATCATTTTAAATGTACAGCTACACTTGCAAAATGTAATGCAGCATAATAAATAAT ACAGGACAACACCCATTACCTGCACATGGCGAAAGCTTCAAGATAGAAGAGACTTCATTCTGATGAACATCCTTCAAATTTTGGTTAAA TTTACAGCTCCTTCTCAACCATAGTCTTCAC > B99‐1550 P90 1276 TTCTGCTCGAAA TTCTGCTCGAAATACAAGAAAGGGATCTCATGCAGCCAAAACAAGCATTGAGATGCTAGTAAACTACATAATGGACATCATCATTTTTA ATCTTCAATTAACCCAAAAAAAACATGAAATTTTAAATATGTTCATTTCAAATCTTGGTTGGATTAATAATTTAAAATCATCTCTTCAA TTATATACTCCTCTTTATTTTCATATTATAATTAAAATAAATACTAATATAACCTCTAGAGTTGTTTCTGTTTTTTATAAAGTTATTTC

AAACTCAAATTTATTTTATAAAGAAGAATGACGTAAAAATGATAACAATTCTCTTTTTTTTTTCGGTAAAAAAAGATTAAACTTGTAAA ACTTTTTTATAAGTTGAAACTTCAAACTATAGTAAATTAATAATTGGGAAGTAGGGTTGGTTTCATGTGAAGGGTATTATATACCCTAG AGATTTATGATAACATTACAACTCCATAAAATGATGCCACCAATCACTGGGGACATACACAAACAATCCCACATAACACACCAAAGCCA ATAATAATAACAATGTTGAATTGAATAAATGGAATGAAGGCATTTCTTGTTTGTTCTTTGATATATATATATATATAGnnnnnnnCTAT ATTTATGTGTATACCAACCATTATTATTCCTTCATAATATCAATCAAATTAATGTTATGCTGCCAATTCTCTCTTCATATTCATAAAGC ACTTGACTTCCTCCATGTCACCAGTGACTTCAGAAACTCCATCACCTGCATTTCCATATCATTCACCCACCTCTAATCAGATATTATAC ACTTGGCCTGTCCAAGCACAGGCTCAAAAATGGCTAAACAAATCACTCAGAATTTGAAGATGTTTAGTTTCCAGGGTTATGAGAGTTTG TACCTCAGATGGGTCTCTCAAAGAGTAAGCTGCACTGCTTTCCTTCGCCACTGAAGAGACTAATATGCCATAACCGCAATTTCTTTCTT TCAGTACCTGTAATTCAACTCCTTTCATTTCTAAGTTTGAACTTCCTAGCGGGAGATAACCATGGTATAGGAATTAATGGGATGATAAA CTTACTCGGAAGGCATCTTCATCCATGCGATCATCTCCTATGTAAATCGGGAGCACTTCATCGCAATTGTTAAGTCCTGGAGTACGGTT TTAAGATTTTGACGGTGTCAAAGATAGACATTGATAATAATTAAACTTGAACGAGAATGTTCTTGAAAGGAAACAAGAGTTACAACTAC TGGCTTTCTTACCTAGAGTTTCGAGCAGAA >C00‐1350 OU23‐1 1246 GAGTTGTATGCG GAGTTGTATGCGGAGTTGGACATTAGAGAGGTGGTTCCTGGAGATGATTGTTGAAGGTGGTCTTCCTGGGATGTGGTTTTTGAAGGTGG TCATCAGTGAGTTAGCAGTATTCATCGATGGTGTTTGTAGCCAAAGTTAGGTGTCAGGGGTAGTTGCTGGAGTTAGTCACCATAGATGG TTGTAGGTGCTTGTTGCTGGTAATTATTGTCATCGGAGCAGGTCATTAGCGATGGCCAGCTGGTGGAGTTATTGAAACACTGGAGGTAG AGAAAAAGGTGAAGATAAAGTTCCTCGAAAATAAAGTTCCTCGATAAATATGCAAACTTCAATAGTGAACCCTATAGAAGATGAAGTTG AGTTATTTTATGTCAACTTTCGAAGTTGGTGGGTAACATTCAATTGAGATTTTATCTCAACCCAACTCAACTTAGGTCATTGCTCTAGG CAACCCCTTAATATCATATAAATGATGCAAAATTGTTGGTATTATTTTGGCTTCTGAGGTAAATTGAGCATTTTTATCCCTTCAAATGA GATGTAACCAATAAACCTAGAAGTTTTACATTCTAATTGAACTTATTGACTTCTCTGAGCTGCATAATTTTGTTGGTTCATTAGTTGAT CCTCCTGGTCTTTTTCTCTCAAAATAGTATTACTGTTCCCTACCCTGAACCTTTAATTCTAAATGAAATTAAAGTCGTTCTTCCTTCAT CTAGTAATATTTATCAGTGTAGATCTGACTGAATTGCTTCTGCTATTATAGACAAACCTTCTTTGGGGGACTTGCAATACTTCTTGGAG TTCCAAATTCCAACACAATGGGCACCAAACTTCTGTGAGTTACCTCTTGGGCATCAGAGGAAGAAGGCTTCTTGTCCCACCCTGCAGTT CACTTTTATGAGTCCTAGGACTTACGTCACCTCCACCCAGGTAATCAATTTTTTCTATTTCAATTCTACAAAAGCTGCATTATCTCCAC TCGATAACATATAAATTAGCAACTTCTGAATTGTTCGTAGCATACAAGTTTTGGTTGGTAATATTGTTCTGCCATATTTCCACAAATAT GATTGCAAAATCTTTTGGTATGTTTGAGAATTGTTTTTAGCACGAACATCGTGTTTAGATATAAGTTTTTTCTTAATTTAATGTTCTAT GTTGGAGACCTTTTCTTCATTTACTTTCTTCTTTTTTGGAATGAATTATATTGCTCTTTCCTAAATGTTGACTTTATCGCATACAACTC Appendix 2. Sequence of two fragments (1413 bp and 270 bp – downstream of 1413 bp fragment indicated by bold letter) amplified by A22_RAPD marker and the CLUSTALW result. The red bold letters indicated the whole or a part of the sequence of RAPD primer.

>A22‐1520 P90 1413 TCCAAGCTACCA TCCAAGCTACCATCCCCAAACTGACGGCCAGACTGAGCGATTCAACAGCATGCTCGAGGAATACTTGCGCCATTTTGTAAACGCAAGAC AAAAGAATTGGGTCCAGCTGTTGGACGTAGCACAATTCTGTTTCAACGCTCAGACAAGTTCAGCTACAGGGAGAAGTCCATTTGAGATT GTTTCTGGGAGGCAACCAGTACTGCCACACCTTGTTGATCATCCTTTTGCAGGGAAGAACCCTCAAGCCCTCAATTTCACGAAGGAGTG GAGACAGACAAACGACATCGCCCGAGCGTACTTAGAAAAAGCATCGAAGCGGATGAAGAAGTGGGCAGATAAGAAGCGACGGCCCCTTG GGTTTCGAGCAGGAGACCAGGTACTCATCAAATTACGACCAGAGCAAGTCAGGTTTCGAGGACGCAAAGACCAACGTCTCGTCAGGAAG TACGAAGGGCCAGTTGAAGTGCTGAAAAAGGTAGGGAATACTTCTTACAGAGTAGCGTTGCCCACATGGATGAAGATCTACCCAGTAAT TCATGTTAGCAACCTGAAGCCGTACCACCAAGACACAGAAGACCTGCAGCGGAATGTCGTAACTCGCCCAACTATCGACCTTAGTCGGA AGGAAGACAAAGATGTTGAAGAAATTCTGGCCGAGCGAGTAAGGAGGGGCAGAAGACCCGCACGAAGGATCCACGAGTATCTGGTAAAG TGGNNNNNNNAGAATGTCAAGGGCATAATTGTCCATGGTATTATTTACCGATGGTCGTATGCCCGAATACCCCCCAAATCACTTTATCT TTATGTCTTGAAAGTAGTTTAGGTTAATTCTTTCGTTTAGGTGTCGCCGAGTCATAGTGTGACATTTCGGCTTTTTCATAGGCAAGCCT GCCAAGGCCAAAATTCTCAATATGTACTATAGGGGGTACATGACTAAGTCCGACCCCCGCCCAAGCCTTGTCGCACTCTTTGCATGTTG AGTTATTTTCCTTACAATTGACAGTCTTCAATGCTTTCTTTATGACGTTTTCAACTATTTACTTTCTCTCTCCCGTTTTATAAAAACAT

TTTTCCAAGAACGGGAAGGGAGGCTACGTCATACCGCGAGTTTGACCGCGGATTCCGATTTTCGAACGGCTGACTTGCTGATTAAGCT AAGCAAGTGCCGCACAATCGTGTCGAGAAGTTACGATTGTGACACTCAGCACCCATCTTTTATCTTTCTGGAATTGGCATTCGTCATC ATAACTTTTATTTTTATTTTTTTAGATTTCATAGTCATGGAAGATGAACAGATACCCACCAAGGTGACAAGATCTCAACAATGAAGTG ACATACTTCAAATTCAGATTGTCATACCCCAAAGAAATGAAGTTTCAGCATTGAATCCCCTTTACTGATTGGTAGCTTGGA CLUSTALW Result

Sequence 1: VN19F 270 bp Sequence 2: 1 1413 bp

Sequences (1:2) Aligned. Score: 99

VN19F ------GACCGCGGATTCCGATTTTCGAACGGCTG 1 GGGAAGGGAGGCTACGTCATACCGCGAGTTTGACCGCGGATTCCGATTTTCGAACGGCTG *****************************

VN19F ACTTGCTGATTGAGCTAAGCAAGTGCCGCACAATCGTGTCGAGAAGTTACGATTGTGACA 1 ACTTGCTGATTAAGCTAAGCAAGTGCCGCACAATCGTGTCGAGAAGTTACGATTGTGACA *********** ************************************************

VN19F CTCAGCACCCATCTTTTATCTTTCTGGAATTGGCATTCGTCATCATAACTTTTATTTTTA 1 CTCAGCACCCATCTTTTATCTTTCTGGAATTGGCATTCGTCATCATAACTTTTATTTTTA ************************************************************

VN19F TTTTTTTAGATTTCATAGTCATGGAAGATGAACAGATACCCACCAAGGTGACAAGATCTC 1 TTTTTTTAGATTTCATAGTCATGGAAGATGAACAGATACCCACCAAGGTGACAAGATCTC ************************************************************

VN19F AACAATGAAGTGACATACTTCAAATTCAGATTGTTATACCCCAAAGAAATGAAGTTTCAG 1 AACAATGAAGTGACATACTTCAAATTCAGATTGTCATACCCCAAAGAAATGAAGTTTCAG ********************************** *************************

VN19F C------1 CATTGAATCCCCTTTACTGATTGGTAGCTTGGA *