DOCSLIB.ORG

Effects of a Novel Corticotropin-Releasing-Hormone

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of a Novel Corticotropin-Releasing-Hormone Molecular Psychiatry (2000) 5, 137–141 2000 Macmillan Publishers Ltd All rights reserved 1359-4184/00 $15.00 www.nature.com/mp IMMEDIATE COMMUNICATION Effects of a novel corticotropin-releasing-hormone receptor type I antagonist on human adrenal function HS Willenberg1, SR Bornstein2, N Hiroi2,GPa¨th1, PE Goretzki3, WA Scherbaum1 and GP Chrousos2 1Diabetes Research Institute at the University of Du¨sseldorf, Germany; 2National Institute of Child Health and Human Development, NIH, Bethesda, MD, USA; 3Department of Surgery at the University of Du¨sseldorf, Germany Corticotropin-releasing hormone (CRH) is the principal regulator of the hypothalamic-pitu- itary-adrenal (HPA) axis and an activator of the sympathoadrenal (SA) and systemic sympath- etic (SS) systems. Mental disorders, including major depression and, more recently, Alzhei- mer’s disease have been associated with dysregulation of the HPA axis and the SA/SS systems. Treatment of rats or monkeys with the novel CRH receptor type 1 (CRH-R1) antagon- ist antalarmin inhibits the HPA and/or the SA/SS axes. This is the first study to examine the potential direct effect of antalarmin on human adrenal function. Adrenocortical and adreno- medullary cells were characterized by double-immunohistochemistry with anti-17 ␣ hydroxylase (cortical cells) and anti-chromogranin A (chromaffin cells). Expression of CRH, ACTH, CRH type I and type II receptor mRNA were analyzed by reverse-transcription (RT) PCR. Human adrenal cortical and/or chromaffin cells in co-culture were incubated with CRH, antalarmin, and both CRH and antalarmin in vitro. Exposure of these cells to corticotropin or vehicle medium served as positive and negative controls, respectively. Cortical and chromaf- fin tissues were interwoven in the human adrenals, and both in situ and in the co-culture system the endocrine cell types were in close cellular contact. ACTH, CRH, and CRH-R1 and CRH-R2 mRNAs were expressed in the human adrenal as determined by RT-PCR. CRH (10−8 M) led to a moderate increase of cortisol release (145.7 ± 20.0%) from cortical and chromaffin adrenal cells in co-culture. This effect corresponded to 41.8% of the maximal increase induced by ACTH (10−8 M). The action of CRH was completely inhibited by antalarmin. CRH, ACTH, and both CRH-R1 and CRH-R2 mRNAs are expressed in the adult human adrenal gland. CRH stimulates cortisol production in cortical and chromaffin cell co-cultures. This effect is blocked by antalarmin, a selective CRH-R1 receptor antagonist, suggesting that CRH-R1 receptors are involved in an intraadrenal CRH/ACTH control system in humans. Molecular Psy- chiatry (2000) 5, 137–141. Keywords: CRH; CRH-receptor antagonist; human; adrenal Introduction system.6,7 Since several mental disorders, including melancholic depression,8 anxiety disorders,9,10 and Corticotropin-releasing hormone (CRH) and its recep- Alzheimer’s disease,8 are associated with hyperactiv- tors are widely expressed in the brain and peripheral ation of the HPA axis and the sympathetic system, it tissues.1–3 This hormone is the principal regulator of is of major interest to identify substances which selec- the hypothalamic-pituitary-adrenal (HPA) axis2 and tively inhibit the activity of these systems. Because of exerts its effects via two main receptor subtypes, type its chemical structure, its oral actions, and its ability 1 (CRH-R1)3 and 2 (CRH-R2).4 CRH also activates both to cross the blood–brain barrier, the novel CRH-R1 the adrenomedullary and systemic sympathetic system antagonist antalarmin holds promise in the treatment of limbs and an intraadrenal CRH/ACTH/cortisol system disorders associated with an increased CRH drive.11–13 has been postulated.5 Recently, the CRH-R1 has been This is the first study to examine the direct effect of demonstrated in mid-gestation human fetal adrenals the CRH-R1 antagonist antalarmin on human adrenal and CRH has been shown to stimulate directly adrenal cortical and/or medullary cells in vitro. steroidogenesis in human fetal adrenal cells via the phospholipase C-inositol phosphate second messenger Materials and methods Materials Correspondence: SR Bornstein, MD, National Institute of Child Normal human adrenal glands (n = 4) were surgically Health and Human Development, Pediatric and Reproductive Endocrinology Branch, National Institutes of Health, Bethesda, removed along with one kidney for renal carcinoma. Maryland 20892, USA. E-mail: BornsteSȰcc1.nichd.nih.gov Excised tissues were transferred to prechilled phos- Received 1 December 1999; accepted 13 December 1999 phate-buffered saline, pH 7.6, and kept on ice until Effects of antalarmin on human adrenal function HS Willenberg et al 138 further treatment. In addition, the human adrenocort- plus antalarmin (10−7 M), or vehicle medium served as ical cell line NCI-H295 was employed to test the effects positive and negative controls. NCI-H295 human adre- of antalarmin on cortisol secretion of pure adrenocort- nocortical carcinoma cells were treated in the same ical cells. manner. Culture supernatants were radioimmuno- assayed (Biermann, Germany) for cortisol content. Immunohistology Results are given as a percentage of basal secretion ± Adrenocortical and chromaffin cells were charac- SEM. Intra- and inter-assay coefficients were less than terized by single and double immunohistochemistry 5%. Statistical analysis was performed employing the using paraffin-embedded tissue samples and cultured two-tailed Student’s t-test with Welch’s correction. cells. The labelled streptavidin-biotin-peroxidase reac- Antalarmin, N-butyl-N-ethyl-[2,5,6-trimethyl-7-(2,4,6- tion (DAKO, Hamburg, Germany) was combined with trimethylphenyl)-7H-pyrrolo[2,3-d]pyri-midin-4-yl]amine, the DAB chromogen and the peroxidase-anti-peroxi- was synthesized, purified, and tested in a receptor dase method (DAKO) with the AEC chromogen. binding assay as previously reported.16 Cortical cells were identified with a specific rabbit anti- body to 17-alpha hydroxylase (courtesy of MR Water- man, Nashville, USA) and chromaffin cells with a spe- cific monoclonal mouse antibody to chromogranin A Results (DAKO) as described previously.14,15 Cortical and chromaffin cells were interwoven to a Reverse-transcription PCR great degree in human adrenal glands as visualized by Human adrenal mRNA (1 ␮g) which was purchased double immunohistochemistry (Figure 1a). In the co- from Clontech (Palo Alto, CA, USA) was reversely tran- culture system, human adrenocortical cells showed a scribed to cDNA in a first step according to the instruc- positive staining signal for anti-17-alpha hydroxylase tions of the first strand cDNA synthesis kit (Roche immunoglobulin and were documented to be in direct Diagnostics, Mannheim, Germany). For PCR amplifi- contact with adrenomedullary cells (Figure 1b). Intra- cation, we used the CRH, CRH-R1, and CRH-R2 pri- adrenal CRH (122-bp fragment) and ACTH (77-bp mers listed in Table 1, and applied the conditions as fragment) mRNA were found to be expressed as evi- follows: 40 thermal step cycles of denaturation at 94°C denced by RT-PCR (Figure 2a). The expression of CRH- for 1 min, annealing at 60°C for 1 min, and elongation R1 mRNA (592-bp fragment) (Figure 2b) and CRH-R2 at 72°C for 2 min. For the ACTH primer, all conditions mRNA (Figure 2c) could be documented for adrenal were identical except for the annealing temperature, and as a positive control in pituitary tissue. Antalarmin which was 55°C. For positive control, we used mRNA at 10−7 M did not affect basal cortisol secretion from from pituitary gland (Clontech). For negative control, cells of the adrenocortical cell line NCI-H295 and from we amplified preparations skipping the RT step. adrenal cells in primary cultures (100.4 ± 9.0% of basal secretion) (Figure 3). ACTH at 10−8 M led to a maximal Co-culture system increase in cortisol secretion from cultured adrenal For in vitro studies adrenal tissue was mechanically cells (209.3 ± 15.4%, P Ͻ 0.001) which was not blocked dissected and enzymatically digested. Both medullary by antalarmin (188.5 ± 73.6%, P Ͻ 0.05) (Figure 3a). and cortical cells were dispersed in culture wells as CRH (10−8 M) led to a moderate increase of cortisol described previously.14,15 Briefly, after 3 days of undis- secretion of 145.7 ± 20.0% from mixed adrenal cells (P turbed growth, cells were washed and subjected to Ͻ 0.05), but not from pure adrenocortical cells. The incubation with CRH (10−8 M), antalarmin (10−7 M), CRH-mediated increase was completely blocked by co- and CRH (10−8 M) plus antalarmin (10−7 M) for 12 h. incubation with antalarmin (109.8 ± 19.9%) (Figure Exposure of cells to ACTH (10−8 M), ACTH (10−8 M) 3b). Table 1 Primer sequences, products size and primer specific conditions Primer Primer sequences (5Ј–3Ј) Product Cycles Ta CRH S TCCGAGGAGCCTCCCATC 122 bp 40 cycles 60°C AS AATCTCCATGAGTTTCCTGTTGC ACTH S CACTTCCGCTGGGGCAAGCC 77 bp 40 cycles 55°C AS GACTCGTCCTCGGCGCCGTT CRH-R1 S ACAAACAATGGCTACCGGGA 592 bp 40 cycles 60°C AS TCATGGGGCCCTGGTAGAT CRH-R2 S TGTGGAAGGCTGCTACCTG 615 bp 40 cycles 60°C AS GTCTGCTTGATGCTGTGGAA S, sense primer; AS, antisense primer; bp, base pairs; Ta, annealing temperture; CRH-R1, CRH-type I receptor; CRH-R2, CRH- type II receptor. Molecular Psychiatry Effects of antalarmin on human adrenal function HS Willenberg et al 139 a b Figure 2 RT-PCR analysis of human adrenal and pituitary messenger RNA. (a) Human adrenal gland expresses the CRH and ACTH mRNA. The 122-bp (arrow head) and 77-bp (arrow) RT-PCR amplified products correspond to the CRH and ACTH predicted bands. (b) Expression of the CRH-R1 gene in human adrenal and pituitary gland. RT-PCR product of 592 bp (arrow) from both adrenal gland and pituitary gland. (c) Expression of the CRH-R2 gene in human adrenal and pitu- itary gland, showing RT-PCR product of 615-bp fragments (arrow) from both adrenal gland and pituitary gland.
Load more

Recommended publications
  • Corticotropin-Releasing Hormone Physiology
    European Journal of Endocrinology (2006) 155 S71–S76 ISSN 0804-4643 Corticotropin-releasing hormone physiology Joseph A Majzoub Division of Endocrinology, Children’s Hospital Boston, Thomas Morgan Rotch Professor of Pediatrics, Harvard Medical School, 300 Longwood Avenue, Boston, Massachusetts 02115, USA (Correspondence should be addressed to J A Majzoub; Email: [email protected]) Abstract Corticotropin-releasing hormone (CRH), also known as corticotropin-releasing factor, is a highly conserved peptide hormone comprising 41 amino acid residues. Its name derives from its role in the anterior pituitary, where it mediates the release of corticotropin (ACTH) leading to the release of adrenocortical steroids. CRH is the major hypothalamic activator of the hypothalamic–pituitary– adrenal (HPA)axis. Major functions of the HPAinclude: (i) influencing fetal development of major organ systems including lung, liver, and gut, (ii) metabolic functions, including the maintenance of normal blood glucose levels during the fasting state via glycogenolysis and gluconeogenesis, (iii) modulation of immune function, and (iv) maintenance of cardiovascular tone. In addition, CRH, acting both directly and via the HPA, has a role in regulating several neuroendocrine functions including behavior, food intake, reproduction, growth, immune function, and autonomic function. CRH has been localized to the paraventricular nucleus (PVN) of the hypothalamus, which projects to the median eminence and other hypothalamic and midbrain targets. The CRH gene is composed of two exons. The CRH promoter contains a cAMP-response element, and the intron contains a restrictive element-1/neuron restrictive silencing element (RE-1/NRSE) sequence. Recently, a family of CRH-related peptides, termed the urocortins, has been identified.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • Neuropeptide-Induced Contraction and Relaxation of the Mouse
    Proc. Natl. Acad. Sci. USA Vol. 81, pp. 625-629, January 1984 Physiological Sciences Neuropeptide-induced contraction and relaxation of the mouse anococcygeus muscle (neurohypophysial peptides/neurotensin/thyrotropin-releasing hormone/urotensin i/vasoactive intestinal polypeptide) ALAN GIBSON*, HOWARD A. BERNtt, MICHAEL GINSBURG*, AND JACK H. BOTTING* *Department of Pharmacology, Chelsea College, University of London, Manresa Road, London SW3 6LX, United Kingdom; and tDepartment of Zoology and Cancer Research Laboratory, University of California, Berkeley, CA 94720 Contributed by Howard A. Bern, September 26, 1983 ABSTRACT Isometric tension responses to neuropeptides fects of a wide range of neuropeptides on tone of the mouse were recorded from anococcygeus muscles isolated from male anococcygeus in vitro. mice. This smooth muscle tissue is innervated by inhibitory nonadrenergic, noncholinergic nerves that resemble, ultra- MATERIALS AND METHODS structurally, the peptidergic neurons of the gastrointestinal Male mice (LACA strain from A. Tuck & Son, Battles- tract; the physiological function of the anococcygeus is not bridge, Essex, U.K.; 25-35 g) were stunned and bled. Both known. Slow sustained contractions were produced by oxyto- anococcygeus muscles were dissected from the animal and cin (0.2-20 nM), [Arg8]vasopressin (0.4-200 nM), and [Arg]- set up in series, joined at the point of unification on the ven- vasotocin (0.4-100 nM); the mouse anococcygeus is, therefore, tral rectum, in 1-ml glass organ baths that contained Krebs one of the few examples of nonvascular smooth muscle from bicarbonate solution (mM: NaCl, 118.1; KCI, 4.7; MgSO4, male mammals to respond to low concentrations of oxytocin 1.0; KH2PO4, 1.2; CaCl2, 2.5; NaHCO3, 25.0; glucose, 11.1).
    [Show full text]
  • Urocortin 2 Autocrine/Paracrine and Pharmacologic Effects to Activate AMP-Activated Protein Kinase in the Heart
    Urocortin 2 autocrine/paracrine and pharmacologic effects to activate AMP-activated protein kinase in the heart Ji Lia, Dake Qib, Haiying Chengc, Xiaoyue Hub, Edward J. Millerd, Xiaohong Wub, Kerry S. Russellb, Nicole Mikushb, Jiasheng Zhangb, Lei Xiaoe, Robert S. Sherwinc, and Lawrence H. Youngb,1 aDepartment of Pharmacology and Toxicology, University at Buffalo, The State University of New York, Buffalo, NY 14214; bSection of Cardiovascular Medicine and cSection of Endocrinology, Department of Internal Medicine, Yale University School of Medicine, New Haven, CT 06520; dDepartment of Medicine, Boston University, Boston, MA 02118; and eUniversity of Florida Shands Cancer Center, Department of Anatomy and Cell Biology, College of Medicine, Gainesville, FL 32610 Edited* by Gerald I. Shulman, Howard Hughes Medical Institute and Yale University, New Haven, CT, and approved August 9, 2013 (received for review July 11, 2013) Urocortin 2 (Ucn2), a peptide of the corticotropin-releasing factor Ucn2 (5). Signaling pathways have substantial cross-talk, and (CRF) family, binds with high affinity to type 2 CRF receptors pharmacologic inhibitor studies suggest a possible association (CRFR2) on cardiomyocytes and confers protection against ische- between activation of PKCe and the energy-stress kinase AMP- mia/reperfusion. The mechanisms by which the Ucn2-CRFR2 axis activated protein kinase (AMPK) (10). AMPK is activated by mitigates against ischemia/reperfusion injury remain incompletely changes in cellular energetics, but its activity is also modulated
    [Show full text]
  • Neuropeptide Regulation of Signaling and Behavior in the BNST
    Mol. Cells 2015; 38(1): 1-13 http://dx.doi.org/10.14348/molcells.2015.2261 Molecules and Cells http://molcells.org Established in 1990G Neuropeptide Regulation of Signaling and Behavior in the BNST Thomas L. Kash*, Kristen E. Pleil, Catherine A. Marcinkiewcz, Emily G. Lowery-Gionta, Nicole Crowley, Christopher Mazzone, Jonathan Sugam, J. Andrew Hardaway, and Zoe A. McElligott Recent technical developments have transformed how neu- aversion related behaviors, however there is also evidence that roscientists can probe brain function. What was once it can regulate appetitive responses. Numerous pharmacologi- thought to be difficult and perhaps impossible, stimulating a cal studies targeting different peptide systems as well as single set of long range inputs among many, is now relative- monoaminergic systems have found that the BNST plays a key ly straight-forward using optogenetic approaches. This has role in anxiety. For example, the Davis group has found that provided an avalanche of data demonstrating causal roles CRF in the BNST can potently enhance anxiety (Walker et al., for circuits in a variety of behaviors. However, despite the 2009b) and the Hammack group has found that PACAP signal- critical role that neuropeptide signaling plays in the regula- ing can alter stress responses (Kocho-Schellenberg et al., tion of behavior and physiology of the brain, there have 2014; Lezak et al., 2014a; 2014b). In support of this, recent been remarkably few studies demonstrating how peptide findings from several groups using optogenetic approaches release is causally linked to behaviors. This is likely due to have shown the BNST plays a role in anxiety (Jennings et al., both the different time scale by which peptides act on and 2013a; Kim et al., 2013), however these manuscripts also the modulatory nature of their actions.
    [Show full text]
  • Coordinated Changes in Energy Intake and Expenditure Following Hypothalamic Administration of Neuropeptides Involved in Energy Balance
    Europe PMC Funders Group Author Manuscript Int J Obes (Lond). Author manuscript; available in PMC 2010 January 01. Published in final edited form as: Int J Obes (Lond). 2009 July ; 33(7): 775–785. doi:10.1038/ijo.2009.96. Europe PMC Funders Author Manuscripts Coordinated changes in energy intake and expenditure following hypothalamic administration of neuropeptides involved in energy balance Nina M Semjonous*, Kirsty L Smith*, James RC Parkinson, David JL Gunner, Yong-Ling Liu, Kevin G Murphy, Mohammad A Ghatei, Stephen R Bloom, and Caroline J Small Department of Investigative Medicine, Imperial College London, Hammersmith Campus, Du Cane Road, London, W12 0NN, UK Abstract Objective—The hypothalamic control of energy balance is regulated by a complex network of neuropeptide-releasing neurons. Whilst the effect of these neuropeptides on individual aspects of energy homeostasis has been studied, the coordinated response of these effects has not been comprehensively investigated. We have simultaneously monitored a number of metabolic parameters following ICV administration of 1nmol and 3nmol of neuropeptides with established roles in the regulation of feeding, activity and metabolism. Ad libitum fed rats received the orexigenic neuropeptides neuropeptide Y (NPY), agouti-related protein (AgRP), melanin- concentrating hormone (MCH) or orexin-A. Overnight food deprived rats received an ICV injection of the anorectic peptides α-MSH, corticotrophin releasing factor (CRF) or neuromedin U (NMU). Results—Our results reveal the temporal sequence of the effects of these neuropeptides on both Europe PMC Funders Author Manuscripts energy intake and expenditure, highlighting key differences in their function as mediators of energy balance. NPY and AgRP increased feeding and decreased oxygen consumption, with the effects of AgRP being more prolonged.
    [Show full text]
  • The Role of Corticotropin-Releasing Hormone at Peripheral Nociceptors: Implications for Pain Modulation
    biomedicines Review The Role of Corticotropin-Releasing Hormone at Peripheral Nociceptors: Implications for Pain Modulation Haiyan Zheng 1, Ji Yeon Lim 1, Jae Young Seong 1 and Sun Wook Hwang 1,2,* 1 Department of Biomedical Sciences, College of Medicine, Korea University, Seoul 02841, Korea; [email protected] (H.Z.); [email protected] (J.Y.L.); [email protected] (J.Y.S.) 2 Department of Physiology, College of Medicine, Korea University, Seoul 02841, Korea * Correspondence: [email protected]; Tel.: +82-2-2286-1204; Fax: +82-2-925-5492 Received: 12 November 2020; Accepted: 15 December 2020; Published: 17 December 2020 Abstract: Peripheral nociceptors and their synaptic partners utilize neuropeptides for signal transmission. Such communication tunes the excitatory and inhibitory function of nociceptor-based circuits, eventually contributing to pain modulation. Corticotropin-releasing hormone (CRH) is the initiator hormone for the conventional hypothalamic-pituitary-adrenal axis, preparing our body for stress insults. Although knowledge of the expression and functional profiles of CRH and its receptors and the outcomes of their interactions has been actively accumulating for many brain regions, those for nociceptors are still under gradual investigation. Currently, based on the evidence of their expressions in nociceptors and their neighboring components, several hypotheses for possible pain modulations are emerging. Here we overview the historical attention to CRH and its receptors on the peripheral nociception and the recent increases in information regarding their roles in tuning pain signals. We also briefly contemplate the possibility that the stress-response paradigm can be locally intrapolated into intercellular communication that is driven by nociceptor neurons.
    [Show full text]
  • 2755.Full.Pdf
    (CANCER RESEARCH 49, 2755-2760, May 15, 1989] Corticotropin-releasing Factor and Vasopressin Production in the Rat Pituitary Tumor 7315a: Biochemical and Immunohistochemical Studies1 MaríaInésMoranoand Fernando E. Estivariz2 Centro de Estudios Endocrinos, Facultad de Ciencias Medicas, Universidad Nacional de La Plata, Casilla de Correo 455, 1900 La Plata, Argentina ABSTRACT (16). We have found it interesting to study the production and secretion of hypothalamic factors by this tumor, principally In order to investigate the production and secretion of hypothalamic those involved in the control of POMC peptides secretion. In factors by the prolactin and proopiomelanocortin (POMC)-derived, pep- tide-producing, transplanta blu rat pituitary tumor 7315a, we determined the present report, we determined the tumor content and in the concentrations of corticotropin-releasing factor (CRF)- and vasopres- vitro secretion of CRF and AVP, compared with the production sin (AVP)-like immunoreactivities (IR) in the tumor extracts [14.0 ±1.6 of rat prolactin and POMC peptides in the 7315a tumor. In (SE) and 4.2 ±0.9 pmol/g, respectively] and incubation media (0.26 ± addition, we have investigated the Chromatographie character 0.01 and 0.07 ±0.01pmol/107 cells/h, respectively). Total peptide content istics of the CRF- and AVP-like immunoreactivities, and fi correlated well with tumor weight. Moreover, there is a very good nally, we have explored the possibility of distinct populations correlation between the CRF and AVP IR, but not as good between CRF of tumor cells producing the different hormones. or AVP IR and POMC peptide IR tumor contents.
    [Show full text]
  • Urocortins: Emerging Metabolic and Energy Homeostasis Perspectives
    Review Urocortins: emerging metabolic and energy homeostasis perspectives Yael Kuperman and Alon Chen Department of Neurobiology, Weizmann Institute of Science, Rehovot 76100, Israel The effects of stress on energy balance and the through the expression of neuropeptide Y and agouti-related pep- involvement of the neuropeptide corticotropin releasing tide. The Arc is accessible to circulating signals of energy balance, factor in modulating the anorexia of stress and sympath- through the underlying median eminence, because this region of the etic nervous system tone are well recognized. Currently, brain is not protected by the blood–brain barrier. Thus, the Arc serves as an integrative center responsible for information processing and studies centered on the roles of the more recently coordinating appropriate output [58]. described members of this family of ligands, the urocor- Bed nucleus of the stria terminalis (BNST): the BNST is located within tins, and their preferred receptor, the corticotropin the basal forebrain and is considered to be the extended amygdala. It releasing factor type 2 receptor, suggest that they are seems to be involved in a number of complex functions, including important modulators of centrally controlled metabolic sexual behavior, autonomic function, anxiety and aversiveness of opiate withdrawal [58]. functions. In addition, urocortins also regulate fuel util- Dorsal raphe nucleus (DRN): the raphe nuclei are located in the ization in the periphery by acting locally within key midbrain and provide the major ascending serotonergic projection metabolic tissues through autocrine and/or paracrine to the forebrain. The raphe projects to the striatum, amygdala, mechanisms. Recent findings have demonstrated that caudate putamen, hippocampus, substantia nigra and locus coeru- urocortin 2 and urocortin 3, by acting through their leus.
    [Show full text]
  • Outperforming Sub-2 Um Totally Porous Particles Using Fused-Core Technology
    Outperforming Sub-2-µm Totally Porous Particles using Fused-Core Technology Robert E. Moran, Stephanie A. Schuster, Barry E. Boyes, William L. Miles Advanced Materials Technology Inc., Wilmington, DE 19810 Presented at EAS 2014 Abstract Comparing van Deemter Plots (h) Ballistic Separation of Anticoagulants Steroids Separation : HALO vs. TPP Explosive Separation : HALO vs. TPP Reduced Plate Height vs. Mobile Phase Velocity Plots Column : 2.1 x 100 mm Flow rate : 0.4 mL/min Sample : Column : 2.1 x 50 mm PFP Temperature : 30 °C Sample : Hydrocortisone Columns: 50 x 2.1 mm; Instrument: Shimadzu Nexera; Solute: naphthalene Peak Identities : Mobile Phase : 72/28 H2O/MeOH Temperature : 42 °C 1. HMX Column : 2.1 x 30 mm HALO 2 C18, 2µm, 90 Å Flow rate : 1.1 mL/min Detection : 240 nm Predisolone 2. RDX Mobile phase: Halo - 50/50 ACN/water, k = 6.3; o 1. Uracil Mobile Phase : 57% H2O/ 43% MeOH Cortisone Fused-core particles have shown distinct advantages over comparable Mobile phase A : 20 mM formic acid Temperature : 45 C Instrument : Shimadzu Nexera Detection : 254 nm 3. 1,3,5-Trinitrobenzene 1.6 m SPP - 48.5/51.5 ACN/water, k = 6.3; 1.7 m SPP - 47/53 ACN/water, k = 6.2 2. 6,7-dihydroxycoumarin Flow rate : 0.3 mL/min Injection volume : 1.0 µL Prednisone o Mobile phase B : 50/50 ACN/MeOH Detection : 254 nm Injection volume : 1.0 µL 4. 1,3-Dinitrobenzene 1.7 m TPP - 48.5/51.5 ACN/water, k=6.3; Temperature: 35 C; Injection volume: 0.2 L 3.
    [Show full text]
  • G Protein‐Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
    [Show full text]
  • Adrenomedullin Inhibits Connective Tissue Growth Factor Expression
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector original article http://www.kidney-international.org & 2008 International Society of Nephrology Adrenomedullin inhibits connective tissue growth factor expression, extracellular signal-regulated kinase activation and renal fibrosis T Nagae1, K Mori1, M Mukoyama1, M Kasahara1, H Yokoi1, T Suganami1, K Sawai1, T Yoshioka1, M Koshikawa1, Y Saito1, Y Ogawa1, T Kuwabara1, I Tanaka1, A Sugawara1, T Kuwahara2 and K Nakao1 1Department of Medicine and Clinical Science, Kyoto University Graduate School of Medicine, Kyoto, Japan and 2Department of Nephrology, Osaka Saiseikai Nakatsu Hospital, Osaka, Japan Systemic administration of the potent vasodilating peptide Tubulointerstitial fibrosis is a common feature of progressive adrenomedullin reduces cardiac and renal fibrosis in renal injury and predicts the long-term outcome of renal hypertensive animals. Here, we investigated the effects function.1 Among proposed mechanisms by which interstitial of kidney-specific adrenomedullin gene delivery in fibrosis progresses, transforming growth factor-b (TGFB1) normotensive rats after unilateral ureteral obstruction, plays a central role in the pathogenesis.2–4 TGFB1 promotes an established model of renal tubulointerstitial fibrosis. the accumulation of extracellular matrix, through the enhan- Overexpression of exogenous adrenomedullin in the renal ced synthesis of extracellular matrix proteins, such as fibro- interstitium following ureteral
    [Show full text]