Effects of a Novel Corticotropin-Releasing-Hormone

Home , Sauvagine

Molecular Psychiatry (2000) 5, 137–141  2000 Macmillan Publishers Ltd All rights reserved 1359-4184/00 $15.00 www.nature.com/mp IMMEDIATE COMMUNICATION Effects of a novel corticotropin-releasing-hormone receptor type I antagonist on human adrenal function HS Willenberg1, SR Bornstein2, N Hiroi2,GPa¨th1, PE Goretzki3, WA Scherbaum1 and GP Chrousos2

1Diabetes Research Institute at the University of Du¨sseldorf, Germany; 2National Institute of Child Health and Human Development, NIH, Bethesda, MD, USA; 3Department of Surgery at the University of Du¨sseldorf, Germany

Corticotropin-releasing hormone (CRH) is the principal regulator of the hypothalamic-pituitary-adrenal (HPA) axis and an activator of the sympathoadrenal (SA) and systemic sympathetic (SS) systems. Mental disorders, including major depression and, more recently, Alzhei- mer’s disease have been associated with dysregulation of the HPA axis and the SA/SS systems. Treatment of rats or monkeys with the novel CRH receptor type 1 (CRH-R1) antagonist antalarmin inhibits the HPA and/or the SA/SS axes. This is the first study to examine the potential direct effect of antalarmin on human adrenal function. Adrenocortical and adrenomedullary cells were characterized by double-immunohistochemistry with anti-17 ␣ hydroxylase (cortical cells) and anti-chromogranin A (chromaffin cells). Expression of CRH, ACTH, CRH type I and type II receptor mRNA were analyzed by reverse-transcription (RT) PCR. Human adrenal cortical and/or chromaffin cells in co-culture were incubated with CRH, antalarmin, and both CRH and antalarmin in vitro. Exposure of these cells to corticotropin or vehicle medium served as positive and negative controls, respectively. Cortical and chromaffin tissues were interwoven in the human adrenals, and both in situ and in the co-culture system the endocrine cell types were in close cellular contact. ACTH, CRH, and CRH-R1 and CRH-R2 mRNAs were expressed in the human adrenal as determined by RT-PCR. CRH (10−8 M) led to a moderate increase of cortisol release (145.7 ± 20.0%) from cortical and chromaffin adrenal cells in co-culture. This effect corresponded to 41.8% of the maximal increase induced by ACTH (10−8 M). The action of CRH was completely inhibited by antalarmin. CRH, ACTH, and both CRH-R1 and CRH-R2 mRNAs are expressed in the adult human adrenal gland. CRH stimulates cortisol production in cortical and chromaffin cell co-cultures. This effect is blocked by antalarmin, a selective CRH-R1 receptor antagonist, suggesting that CRH-R1 receptors are involved in an intraadrenal CRH/ACTH control system in humans. Molecular Psy- chiatry (2000) 5, 137–141. Keywords: CRH; CRH-receptor antagonist; human; adrenal

Introduction system.6,7 Since several mental disorders, including melancholic depression,8 anxiety disorders,9,10 and Corticotropin-releasing hormone (CRH) and its recep- Alzheimer’s disease,8 are associated with hyperactiv- tors are widely expressed in the brain and peripheral ation of the HPA axis and the sympathetic system, it tissues.1–3 This hormone is the principal regulator of is of major interest to identify substances which selec- the hypothalamic-pituitary-adrenal (HPA) axis2 and tively inhibit the activity of these systems. Because of exerts its effects via two main receptor subtypes, type its chemical structure, its oral actions, and its ability 1 (CRH-R1)3 and 2 (CRH-R2).4 CRH also activates both to cross the blood–brain barrier, the novel CRH-R1 the adrenomedullary and systemic sympathetic system antagonist antalarmin holds promise in the treatment of limbs and an intraadrenal CRH/ACTH/cortisol system disorders associated with an increased CRH drive.11–13 has been postulated.5 Recently, the CRH-R1 has been This is the first study to examine the direct effect of demonstrated in mid-gestation human fetal adrenals the CRH-R1 antagonist antalarmin on human adrenal and CRH has been shown to stimulate directly adrenal cortical and/or medullary cells in vitro. steroidogenesis in human fetal adrenal cells via the phospholipase C-inositol phosphate second messenger Materials and methods Materials Correspondence: SR Bornstein, MD, National Institute of Child Normal human adrenal glands (n = 4) were surgically Health and Human Development, Pediatric and Reproductive Endocrinology Branch, National Institutes of Health, Bethesda, removed along with one kidney for renal carcinoma. Maryland 20892, USA. E-mail: BornsteSȰcc1.nichd.nih.gov Excised tissues were transferred to prechilled phos- Received 1 December 1999; accepted 13 December 1999 phate-buffered saline, pH 7.6, and kept on ice until Effects of antalarmin on human adrenal function HS Willenberg et al 138 further treatment. In addition, the human adrenocort- plus antalarmin (10−7 M), or vehicle medium served as ical cell line NCI-H295 was employed to test the effects positive and negative controls. NCI-H295 human adre- of antalarmin on cortisol secretion of pure adrenocort- nocortical carcinoma cells were treated in the same ical cells. manner. Culture supernatants were radioimmuno- assayed (Biermann, Germany) for cortisol content. Immunohistology Results are given as a percentage of basal secretion ± Adrenocortical and chromaffin cells were charac- SEM. Intra- and inter-assay coefficients were less than terized by single and double immunohistochemistry 5%. Statistical analysis was performed employing the using paraffin-embedded tissue samples and cultured two-tailed Student’s t-test with Welch’s correction. cells. The labelled streptavidin-biotin-peroxidase reac- Antalarmin, N-butyl-N-ethyl-[2,5,6-trimethyl-7-(2,4,6- tion (DAKO, Hamburg, Germany) was combined with trimethylphenyl)-7H-pyrrolo[2,3-d]pyri-midin-4-yl]amine, the DAB chromogen and the peroxidase-anti-peroxi- was synthesized, purified, and tested in a receptor dase method (DAKO) with the AEC chromogen. binding assay as previously reported.16 Cortical cells were identified with a specific rabbit antibody to 17-alpha hydroxylase (courtesy of MR Water- man, Nashville, USA) and chromaffin cells with a specific monoclonal mouse antibody to chromogranin A Results (DAKO) as described previously.14,15 Cortical and chromaffin cells were interwoven to a Reverse-transcription PCR great degree in human adrenal glands as visualized by Human adrenal mRNA (1 ␮g) which was purchased double immunohistochemistry (Figure 1a). In the co- from Clontech (Palo Alto, CA, USA) was reversely tran- culture system, human adrenocortical cells showed a scribed to cDNA in a first step according to the instruc- positive staining signal for anti-17-alpha hydroxylase tions of the first strand cDNA synthesis kit (Roche immunoglobulin and were documented to be in direct Diagnostics, Mannheim, Germany). For PCR amplifi- contact with adrenomedullary cells (Figure 1b). Intra- cation, we used the CRH, CRH-R1, and CRH-R2 pri- adrenal CRH (122-bp fragment) and ACTH (77-bp mers listed in Table 1, and applied the conditions as fragment) mRNA were found to be expressed as evi- follows: 40 thermal step cycles of denaturation at 94°C denced by RT-PCR (Figure 2a). The expression of CRH- for 1 min, annealing at 60°C for 1 min, and elongation R1 mRNA (592-bp fragment) (Figure 2b) and CRH-R2 at 72°C for 2 min. For the ACTH primer, all conditions mRNA (Figure 2c) could be documented for adrenal were identical except for the annealing temperature, and as a positive control in pituitary tissue. Antalarmin which was 55°C. For positive control, we used mRNA at 10−7 M did not affect basal cortisol secretion from from pituitary gland (Clontech). For negative control, cells of the adrenocortical cell line NCI-H295 and from we amplified preparations skipping the RT step. adrenal cells in primary cultures (100.4 ± 9.0% of basal secretion) (Figure 3). ACTH at 10−8 M led to a maximal Co-culture system increase in cortisol secretion from cultured adrenal For in vitro studies adrenal tissue was mechanically cells (209.3 ± 15.4%, P Ͻ 0.001) which was not blocked dissected and enzymatically digested. Both medullary by antalarmin (188.5 ± 73.6%, P Ͻ 0.05) (Figure 3a). and cortical cells were dispersed in culture wells as CRH (10−8 M) led to a moderate increase of cortisol described previously.14,15 Briefly, after 3 days of undis- secretion of 145.7 ± 20.0% from mixed adrenal cells (P turbed growth, cells were washed and subjected to Ͻ 0.05), but not from pure adrenocortical cells. The incubation with CRH (10−8 M), antalarmin (10−7 M), CRH-mediated increase was completely blocked by co- and CRH (10−8 M) plus antalarmin (10−7 M) for 12 h. incubation with antalarmin (109.8 ± 19.9%) (Figure Exposure of cells to ACTH (10−8 M), ACTH (10−8 M) 3b).

Table 1 Primer sequences, products size and primer speciﬁc conditions

Primer Primer sequences (5Ј–3Ј) Product Cycles Ta

CRH S TCCGAGGAGCCTCCCATC 122 bp 40 cycles 60°C AS AATCTCCATGAGTTTCCTGTTGC ACTH S CACTTCCGCTGGGGCAAGCC 77 bp 40 cycles 55°C AS GACTCGTCCTCGGCGCCGTT CRH-R1 S ACAAACAATGGCTACCGGGA 592 bp 40 cycles 60°C AS TCATGGGGCCCTGGTAGAT CRH-R2 S TGTGGAAGGCTGCTACCTG 615 bp 40 cycles 60°C AS GTCTGCTTGATGCTGTGGAA

S, sense primer; AS, antisense primer; bp, base pairs; Ta, annealing temperture; CRH-R1, CRH-type I receptor; CRH-R2, CRH- type II receptor.

Molecular Psychiatry Effects of antalarmin on human adrenal function HS Willenberg et al 139 a

Figure 2 RT-PCR analysis of human adrenal and pituitary messenger RNA. (a) Human adrenal gland expresses the CRH and ACTH mRNA. The 122-bp (arrow head) and 77-bp (arrow) RT-PCR amplified products correspond to the CRH and ACTH predicted bands. (b) Expression of the CRH-R1 gene in human adrenal and pituitary gland. RT-PCR product of 592 bp (arrow) from both adrenal gland and pituitary gland. (c) Expression of the CRH-R2 gene in human adrenal and pituitary gland, showing RT-PCR product of 615-bp fragments (arrow) from both adrenal gland and pituitary gland. Figure 1 (a) Double-immunohistochemistry: Adrenocortical tissue (brown, and denoted by the letter ‘C’) is strongly interwoven with chromaffin tissue (red, and denoted by the letter ‘M’). The endocrine cell types are in direct cellular contact anisms. Thus, while cortisol treatment lowered adrenal with each other (arrows). (b) Chromaffin and cortical adrenal CRH content after 7 days,26 the intraadrenal content of cells are in tight contact in our co-culture system (arrows). CRH and ACTH immunoreactivity increased in hypo- Cortical cells (red) were visualized using a specific antibody physectomized rats.27 A complete CRH/ACTH system to 17-alpha hydroxylase. exists within the human adrenal with the adrenal medulla as a source of CRH and adrenal medullary chromaffin cells as the target for this local releasing hormone Discussion and the source of ACTH. It is possible that the adrenal This is the first study to examine the effect of antalar- CRH/ACTH system is important in the overall function min, a novel CRH-R1 antagonist, on human adrenal and fine-tuning of the gland. Certainly the close mor- tissue using an in vitro culture system. Whereas the phological relationship of cortical and chromaffin ACTH-mediated rise in cortisol secretion from normal tissue is crucial for this system.28 human adrenal cells was not affected, stimulation of Chromaffin and cortical cells were found to be in cortisol secretion by CRH was completely reversed by direct cellular contact in our in vitro co-culture system, co-incubation with this compound. In addition, we which also reflected the close anatomical co-localiz- demonstrated the expression of ACTH, CRH, and both ation of the two endocrine cell types in the adrenal in CRH-R1 and CRH-R2 mRNAs in the adult human adre- situ. Therefore, since chromaffin cells produce POMC- nal. These findings support the hypothesis of the exist- derived peptides, including ACTH as well as other cor- ence of an intraadrenal CRH system.5,17 tisol secretagogues17 and respond to stimulation with Within the adrenal itself, CRH-like immunoreactivity CRH, we assume that exposure of chromaffin cells to has been detected in the medulla of humans and other CRH directly leads to secretion of ACTH with sub- species.18,19 This adrenal CRH is identical to the hypo- sequent stimulation of steroidogenesis by adrenocort- thalamic CRH and is released in response to physio- ical cells in a paracrine manner. logical stimuli such as hemorrhage,20 splanchnic nerve Two major subtypes of the CRH receptors (CRH-R1, activation,21,22 K+-induced depolarization, nicotine,23 CRH-R2) have been identified, cloned, and charac- and various neuropeptides and cytokines.24,25 Like the terized in terms of their pharmacological specificity central CRH/ACTH system, the peripheral adrenal and regional localization.29–35 CRH-R1 receptors are CRH/ACTH system is regulated via feedback mech- most abundant in neocortical, cerebellar, and sensory

Molecular Psychiatry Effects of antalarmin on human adrenal function HS Willenberg et al 140 Acknowledgements We would like to thank Keith Zachman, KC Rice and Jennifer Neria for their technical support. This work was supported by Heisenberg grant BO 1141 6-1 (to SRB).

References 1 Wong ML, Licinio J, Pasternak KI, Gold PW. Localization of corticotropin-releasing hormone (CRH) receptor mRNA in adult rat brain by in situ hybridization histochemistry. Endocrinology 1994; 135: 2275–2278. 2 Vale W, Spiess J, Rivier C, Rivier J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 1981; 213: 1394–1397. 3 Vita N, Laurent P, Lefort S, Chalon P, Lelias JM, Kaghad M et al. Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS Lett 1993; 335: 1–5. 4 Liaw CW, Lovenberg TW, Barry G, Oltersdorf T, Grigoriadis DE, de Souza EB. Cloning and characterization of the human corticotropin-releasing factor-2 receptor complementary deoxyribonucleic acid. Endocrinology 1996; 137: 72–77. 5 Andreis PG, Neri G, Belloni AS, Mazzocchi G, Kasprzak A, Nussdorfer GG. Interleukin-1 beta enhances corticosterone secretion by acting directly on the rat adrenal gland. Endocrinology 1991; 129: 53–57. 6 Smith R, Mesiano S, Chan EC, Brown S, Jaffe RB. Corticotropin- releasing hormone directly and preferentially stimulates dehydro- epiandrosterone sulfate secretion by human fetal adrenal cells. J Figure 3 (a) Mean (± SE) cortisol secretion in response to Clin Endocrinol Metab 1998; 83: 2916–2920. ACTH in the presence or absence of antalarmin in the super- 7 Chakravorty A, Mesiano S, Jaffe RB. Corticotropin-releasing hor- ± mone stimulates P450 17alpha-hydroxylase/17,20-lyase in human natant of human adrenal co-cultures. (b) Mean ( SE) cortisol fetal adrenal cells via protein kinase C. J. Clin Endocrinol Metab secretion in response to CRH in the presence or absence of 1999; 84: 3732–3738. antalarmin in the supernatant human adrenal co-cultures. 8 Raadsheer FC, van Heerikhuize JJ, Lucassen PJ, Hoogendijk WJ, Til- Values are means (± SE) of four incubation mixtures from ders FJ, Swaab DF. Corticotropin-releasing hormone mRNA levels cells of four human adrenals. P values are for the comparison in the paraventricular nucleus of patients with Alzheimer’s disease with basal cortisol secretion. Asterisks indicate significant P- and depression. Am J Psychiarty 1995; 152: 1372–1376. values (* for P Ͻ 0.05, *** for P Ͻ 0.001). 9 Luger A, Deuster PA, Kyle SB, Gallucci WT, Montgomery LC, Gold PW et al. Acute hypothalamic-pituitary-adrenal responses to the stress of treadmill exercise. Physiologic adaptions to physical train- ing. N Engl J Med 1987; 316: 1309–1315. 10 Gold PW, Pigott TA, Kling MA, Kalogeras K, Chrousos GP. Basic relay structures, while CRH-R2 receptors are predomi- and clinical studies with corticotropin-releasing hormone. Impli- nantly localized in specific subcortical areas and per- cations for a possible role in panic disorder. Psychiatr Clin North 3 Am 1988; 11: 327–334. ipheral tissues. Antalarmin effectively displaces 125 11 Bornstein SR, Webster EL, Tropy DJ, Richman SJ, Mitsiades N, Igel ovine CRH binding in tissues expressing CRH-R1 but M et al. Chronic effects of a nonpeptide corticotropin-releasing hor- not in tissues expressing CRH-R2, and therefore is a mone type 1 receptor antagonist on pituitary-adrenal function, specific CRH-R1 receptor antagonist. body weight, and metabolic regulation. Endocrinology 1998; 139: The complete inhibition of the CRH-mediated 1546–1555. 12 Wong ML, Webster EL, Spokes H, Phu P, Ehrhart-Bornstein M, response by antalarmin, a specific CRH-R1 receptor Bornstein SR et al. Chronic administration of the non-peptide CRH antagonist, and the molecular evidence for CRH-R1 type 1 receptor antagonist antalarmin does not blunt hypothalamic- expression in adult human adrenal tissue establishes pituitary-adrenal axis responses to acute immobilization stress. Life the involvement of this receptor in the intraadrenal Sci 1999; 65: PL53–58. 13 Deak T, Nguyen KT, Ehrlich AL, Watkins LR, Spencer RL, Maier CRH/ACTH/cortisol system. In addition, the presence SF et al. The impact of the nonpeptide corticotropin-releasing hor- of CRH-R1 receptors on immune cells and the docu- mone antagonist antalarmin on behavioral and endocrine responses mented steroidogenic action of immune mediators to stress. Endocrinology 1999; 140: 79–86. such as interleukin-15,36 and interleukin-6,37,38 also 14 Willenberg HS, Stratakis CA, Marx C, Ehrhart-Bornstein M, suggest an intraadrenal paracrine CRH/immune pep- Chrousos GP, Bornstein SR. Aberrant interleukin-1 receptors in a cortisol-secreting adrenal adenoma causing Cushing’s syndrome. N tide axis which may contribute to the increase in cor- Engl J Med 1998; 339: 27–31. tisol production by adrenocortical cells as well. Partici- 15 Haidan A, Bornstein SR, Glasow A, Uhlmann K, Lubke C, Ehrhart- pation of the CRH-R1 in intraadrenal cortisol Bornstein M. Basal steroidogenic activity of adrenocortical cells is regulation, in the process of inflammation,39,40 and in increased 10-fold by coculture with chromaffin cells. Endocrin- ology 1998; 139: 772–780. the syndrome of ectopic CRH production seem to jus- 16 Webster EL, Lewis DB, Torpy DJ, Zachman EK, Rice KC, Chrousos tify clinical trials in pathologic states with the above GP. In vivo and in vitro characterization of antalarmin, a nonpep- mentioned conditions. tide corticotropin-releasing hormone (CRH) receptor antagonist:

Molecular Psychiatry Effects of antalarmin on human adrenal function HS Willenberg et al 141 suppression of pituitary ACTH release and peripheral inflam- 29 Grigoriadis DE, Lovenberg TW, Chalmers D, Liaw C, DeSouza EB. mation. Endocrinology 1996; 137: 5747–5750. Characterization of corticotropin-releasing factor receptor subtypes. 17 Nussdorfer, Mazzocchi G. Immune-endocrine interactions in the Ann NY Acad Sci 1996; 780: 60–80. mammalian adrenal gland: facts and hypotheses. Int Rev Cytol 30 Stenzel P, Kesterson R, Yeung W, Cone RD, Rittenberg MB, Stenzel- 1998; 183: 143–184. Poore MP. Identification of a novel murine receptor for corticotro- 18 Suda T, Tomori N, Tozawa F, Mouri T, Demura H, Shizume K. pin-releasing hormone expressed in the heart. Mol Endocrinol Distribution and characterization of immunoreactive corticotropin- 1995; 9: 637–645. releasing factor in human tissues. J Clin Endocrinol Metab 1984; 31 Kishimoto T, Pearse RV, Lin CR, Rosenfeld MG. A 59: 861–866. sauvagine/corticotropin-releasing factor receptor expressed in heart 19 Suda T, Tomori N, Tozawa F, Demura H, Shizume K, Mouri T et and skeletal muscle. Proc Natl Acad Sci USA 1995; 92: 1108–1112. al. Immunoreactive corticotropin and corticotropin-releasing factor 32 Chen R, Lewis KA, Perrin MH, Vale WW. Expression cloning of a in human hypothalamus, adrenal, lung cancer, and pheochromocy- human corticotropin-releasing factor receptor. Proc Natl Acad Sci toma. J Clin Endocrinol Metab 1984; 58: 919–924. USA 1993; 90: 8967–8971. 20 Bruhn TO, Engeland WC, Anthony ELP, Gann DS, Jackson IMD. 33 Lovenberg TW, Liaw CW, Grigoriadis DE, Clevenger W, Chalmers Corticotropin-releasing factor in the dog adrenal medulla is DT, DeSouza EB et al. Cloning and characterization of a func- secreted in response to hemorrhage. Endocrinology 1987; 120: tionally distinct corticotropin-releasing factor receptor subtype 25–33. from rat brain. Proc Natl Acad Sci USA 1995; 92: 836–840. 21 Edwards AV, Jones CT. Secretion of corticotropin releasing factor 34 Chang CP, Pearse RV, O’Connell S, Rosenfeld MG. Identification of from the adrenal during splanchnic nerve stimulation in conscious a seven transmembrane helix receptor for corticotropin-releasing calves. J Physiol 1988; 400: 89–100. factor and sauvagine in mammalian brain. Neuron 1993; 133: 22 McDonald TJ, Nathanielsz PW. The involvement of innervation in 3058–3061. the regulation of fetal adrenal steroidogenesis. Horm Metab Res 35 Perrin MH, Donaldson CJ, Chen R, Lewis KA, Vale WW. Cloning 1998; 30: 297–302. and functional expression of a rat brain corticotropin releasing fac- 23 Venihaki M, Gravanis A, Margioris AN. Comparative study tor (CRF) receptor. Endocrinology 1993; 133: 3058–3061. between normal rat chromaffin and PC12 rat pheochromocytoma 36 Bornstein SR, Gonzalez-Hernandez JA, Ehrhart-Bornstein M, Adler cells: production and effects of corticotropin-releasing hormone. G, Scherbaum WA. Intimate contact of chromaffin and cortical cells Endocrinology 1997; 138: 698–704. within the human adrenal gland forms the cellular basis for 24 Ehrhart-Bornstein M, Hinson JP, Bornstein SR, Scherbaum WA, important intraadrenal interactions. J Clin Endocrinol Metab 1994; Vinson GP. Intraadrenal interactions in the regulation of adreno- 78: 225–232. cortical steroidogenesis. Endocr Rev 1998; 19: 101–143. 37 Marx C, Ehrhart-Bornstein M, Scherbaum WA, Bornstein SR. Regu- 25 Pignatelli D, Magalha˜es MM, Magalha˜es MC. Direct effects of stress lation of adrenocortical function by cytokines—relevance for on adrenocortical function. Horm Metab Res 1998; 30: 464–474. immune-endocrine interaction. Horm Metab Res 1998; 30: 416– 26 Bagdy G, Calogero AE, Szemeredi K, Chrousos GP, Gold PW. Effects 420. of cortisol treatment on brain and adrenal corticotropin-releasing 38 Path G, Bornstein SR, Ehrhart-Bornstein M, Scherbaum WA. hormone (CRH) content and other parameters regulated by CRH. Interleukin-6 and the interleukin-6 receptor in the human adrenal Regul Pept 1990; 31: 83–92. gland: expression and effects on steroidogenesis. J Clin Endocrinol 27 Mazzocchi G, Malendowicz LK, Markowska A, Nussdorfer GG. Metab 1997; 82: 2343–2349. Effect of hypophysectomy on corticotropin-releasing hormone and 39 Karalis K, Sano H, Redwine J, Listwak S, Wilder RL, Chrousos GP. adrenocorticotropin immunoreactivities in the rat adrenal gland. Autocrine or paracrine inflammatory actions of corticotropin- Mol Cell Neurosci 1994; 5: 345–349. releasing hormone in vivo. Science 1991; 254: 421–423. 28 Bornstein SR, Vaudry H. Paracrine and neuroendocrine regulation 40 Webster EL, Torpy DJ, Elenkov IJ, Chrousos GP. Corticotropin- of the adrenal gland—basic and clinical aspects. Horm Metab Res releasing hormone and inflammation. Ann N Y Acad Sci 1998; 840: 1998; 30: 292–296. 21–32.

Molecular Psychiatry