DOCSLIB.ORG

Importance of Chromosome 19 Mirna Cluster in Pregnancy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Importance of Chromosome 19 Mirna Cluster in Pregnancy Central Medical Journal of Obstetrics and Gynecology Review Article Special Issue on Importance of Chromosome 19 Prediction of Preeclampsia *Corresponding authors Hironori Takahashi, Department of Obstetrics and Gynecology, Jichi Medical University, 3311- miRNA Cluster in Pregnancy 1 Yakushiji, Shimotsuke, Tochigi 329-0498, JAPAN, Tel: +81-285-58-7376; Fax: +81-285-44-8505; E-mail: 1,2 1 1 Hironori Takahashi *, Akihide Ohkuchi , Rie Usui , Toshihiro Takizawa2, Shigeki Matsubara1 and Mitsuaki Suzuki1 Submitted: 26 April 2014 1Department of Obstetrics and Gynecology, Jichi Medical University, Japan Accepted: 09 June 2014 2Department of Molecular Medicine and Anatomy, Nippon Medical School, Japan Published: 10 June 2014 ISSN: 2333-6439 Abstract Copyright © 2014 Takahashi et al. microRNA (miRNA) has been focused on placental biology and pathogenesis. Chromosome 19 miRNA cluster (C19MC) miRNAs are known for placenta- and primate- OPEN ACCESS specific miRNAs. C19MC miRNAs are detected in maternal plasma even as early as the first trimester. To date, there are no miRNAs to be used as biomarkers of some disease Keywords in routine practice, although a few studies suggested C19MC miRNAs as biomarkers • Exosome of obstetrical diseases. C19MC miRNAs have been also reported as onco-miRs and • MicroRNA C19MC miRNAs target multiple genes in several kinds of malignancies. Two new • Preeclampsia insights into C19MC miRNAs in obstetrics have been recently reported. First, C19MC miRNAs induced viral resistance in non-trophoblast cells by autophagy. Second, fetal oncogenesis is associated with C19MC miRNAs. To clarify the pathogenesis of an obstetrical disease, roles of C19MC miRNAs need to be further investigated. ABBREVIATIONS during pregnancy. Several miRNAs form miRNA clusters, which are localized in chromosome14q and 19q. Chromosome 19 miRNA miRNA: microRNA; RISC: RNA-Induced Silencing cluster (C19MC) and the chromosome 14 miRNA cluster (C14MC) Complex; C19MC: Chromosome 19 miRNA cluster; C14MC: have 46 and 52 miRNAs, respectively [6]. Of those, C19MC is a Chromosome 14 miRNA Cluster; HSD17β1: Hydroxysteroid17- beta Dehydrogenase 1; FGR: Fetal Growth Restriction; MEK1: the placenta [7-10]. Thus, it is reasonable to assume that C19MC Mitogen-activated protein kinase 1; FGFR1: Fibroblast Growth primate-specific cluster, and it is predominantly expressed in Factor Receptor 1; ETMRs: Embryonal Tumors with Multilayered diseases: especially its contribution to preeclampsia has now Rosettes; DNMT3B: DNA- Methyltransferase 3 Beta. becomemiRNAs amay matter be involved of topic. in Furthermore, the pathogenesis C19MC of primate-specificmiRNAs can be st trimester INTRODUCTION [11]. microRNA (miRNA) is a highly conserved, single-stranded, detected in maternal circulating blood flow from the 1 miRNA, to continue to be present in the circulating blood, 20-23-nucleotide RNA molecule. miRNA binds to target mRNA needs to be protected from degradation by RNAase. As described after miRNA is endocytosed by Argonaute protein to form an later, exosomes may contribute to it. Exosomes, approximately miRNA-complex, which is called the RNA-induced silencing 50-nm-sized microvesicles, contain mRNA and miRNAs, and thus complex (RISC). RISC represses or degrades the target gene miRNAs, being present in exosome without direct contact with expression. One important character of miRNA is: miRNA targets RNAase, remains un-degraded. Multiple exosomes are secreted multiple genes, and vice versa, i.e., a gene is targeted by multiple from trophoblasts, which are the functional cells of the placenta. miRNAs. Thus, miRNA, regulating the gene expression, mediates Circulating C19MC miRNAs are candidate markers of obstetrical/ multiple biological behaviors, such as invasion [1], proliferation placental diseases because, as described, they are solely derived from the placenta. In addition, recent papers revealed that 2,500 human miRNAs have been deposited in miRBase, which C19MC miRNAs were also associated with new roles such as constitutes[2], inflammation a database [3], andof miRNA. apoptosis New [4]. miRNAs To date, have approximately been rapidly fetal carcinogenesis, pluripotency, and viral resistance [12-14]. reported, which are added to this database, with the database In this paper, miRNAs in the placenta are reviewed, with special rapidly expanding. reference to C19MC miRNAs. The human placenta expresses numerous kinds of miRNA. C19MC miRNAs More than 800 miRNAsare reported to express in the human The human placenta expresses 3 miRNA clusters: C19MC, placenta [5]. The expression of miRNAs in the placenta changes C14MC, and miR-371-3 clusters. Of the 3 miRNA clusters, C19MC Cite this article: Takahashi H, Ohkuchi A, Usui R, Takizawa T, Matsubara S, et al. (2014) Importance of Chromosome 19 miRNA Cluster in Pregnancy. Med J Obstet Gynecol 2(2): 1032. Takahashi et al. (2014) Email: Central and miR-371-3 clusters have orthologs only with orangutan, are activated by DNA methylation inhibitors, indicating that the gorilla, and chimpanzee [6]. The miR-371-3 cluster is composed region is under epigenetic control [16,18,19]. It was also reported of only miR-371, miR-372, and miR-373, whereas C19MC, located that C19MC miRNAs are onco-miR. A target gene of each C19MC in human chromosome 19 (19q13.42), includes 46 miRNA stranscribed from the -100-kb region [7,15]. The methylation miRNAs as biomarkers in obstetrical/placental of C19MC is regulated, namely, the (epigenetic) methylation miRNA has been clarified mainly in terms of oncology (Table 1). diseases patterns of the GC-rich promoter region in C19MC alter the expression of the region [16,17]. Experimentally, C19MC miRNAs The expressions of circulating miRNAs change in the Table 1: Target genes of C19MC miRNAs. miRNA Cell Target Reference KSHV replication and miR-498 HEK293, HSV-1 infected body cavity-based lymphoma Yan (2013) [31] transcription activator Ovarian cancer cell line (OVCAR3, CAOV3, OV2008, A2780, 1,25-Dihydroxyvitamin D3 Kaslappan (2012) [32] C13), Ishikawa, HeLa, MCF-7 miR-512(-3p, -5p) BeWo PPP3R1 Kurashina (2013) [33] Breast cancer cell line (MDA-MB-231) CD44 Rutnam (2012) [34] Hepatocellular carcinoma cell line (HepG2) c-FLIP Chen (2010) [35] Gastric cancer cell line Mcl-1 Saito (2009) [36] miR-515(-3p, -5p) Breast cancer cell line SK1 Pinho (2013) [37] Breast cancer cell line, HEK-293 IGF-1R Gilam (2013) [38] miR-516a(-3p, -5p) Gastric cancer cell line (44As3) SULF1 Takei (2010) [39] Prostate cancer cell line (LNCaP) KLK10 White (2010) [40] miR-517a(-3p) Liver cancer cell line (YY8103) Pyk2 Liu (2013) [41] HEK293 TNIP1 Olarerin-George (2013) [42] miR-517c(-3p) HEK293 TNIP1 Olarerin-George (2013) [42] miR-518b NT2/D1, HEK-293 FOXN1 Kushwaha (2014) [43] Esophageal cancer cell line (Eca109, Ec9706, TE-1) rap1b Zhang (2012) [44] miR-518c(-3p, -5p) BeWo Ishibashi (2012) [24] miR-519b(-3p, -5p) Breast cancer cell line (T47D, MDA-MB-231) NK1 Navarro (2012) [45] HSD17β1 miR-519c(-3p, -5p) HEK293, Lung cancer cell line Cha (2010) [46] miR-519d(-3p, -5p) Hepatocellular carcinoma cell line (HepG2) PTEN, AKT3, CDKN1A/p21 Fornari (2012) [47] HIF1α Hepatocellular carcinoma cell line (QGY-7703) MKi67 Hou (2011) [48] miR-520a(-3p, -5p) 4T1 TUSC2P Rutnam (2014) [49] HEK-293 PIK3CA Arcaroli (2012) [50] miR-520b Hepatocellular carcinome cell line MEKK2, cyclinD1 Zhang (2012) [51] Breast cancer cell line (MCF-7,MDA-MB-231) HBXIP Hu (2012) [52] Breast cancer cell line (MCF-7, LM-MCF-7, MDA-MB-231) CD46 Cui (2010) [53] HeLa, Breast cancer cell line(MDA-MB-231), Melanoma cell MICA Yadav (2009) [54] line (A375), Colon cancer cell line (HCT116) Mazan-Mamczarz (2014) miR-520c(-3p, -5p) HeLa, Burkitt lymphoma cell line eIF4G [55] Hepatocellular carcinoma cell line Glypican-3 Miao (2013) [56] Breast cancer cell line CD44 Huang (2008) [1] Breast cancer cell line (MDA-MB-231, MCF-7) RELA, TGFBR2 Keklikoglou (2012) [57] miR-520d(-3p, -5p) Ovarian cancer cell line EphA2, EphB2 Nishimura (2013) [58] miR-520e Hepatocellular carcinoma cell line NIK Zhang (2012) [59] Breast cancer cell line (MCF-7, LM-MCF-7, MDA-MB-231) CD46 Cui (2010) [53] miR-520h Gastric cancer cell line (MKN45) HDAC1 Shen (2014) [60] miR-522(-3p, -5p) COS7 (HepG2, HEK-293) PLIN4 Richardson (2011) [61] miR-524(-3p, -5p) Glioblastoma cell line (LN229) Jagged-1, Hes-1 Chen (2012) [62] miR-525(-3p, -5p) Vascular endothelial cell line (EA.hy926) ARRB1, TXN1, HSPA9 Kraemer (2013) [63] HEK-293 VPAC1 Cocco (2010) [64] HEK-293 PIK3CA Arcaroli (2012) [50] KSHV: Kaposi’s sarcoma-associated herpes virus; HSV: Herpes simplex virus; c-FLIP: FLICE-like inhibitory protein; SK-1: Sphingosine kinase 1; SULF1: KLK10: Kallikrein-ralated peptidase 10; Extracellular sulfatase 1; TNIP1; TNFAIP3 interacting protein 1; FOXN1:Forkhead bozproteing N1; PIK3CA: NK1: Neurokinin 1; HIF1: Hypoxia inducible factor 1; TUSC2: Tumor suppressor candidate 2; TUSC2P: Tumor suppressor candidate 2 pseudogene: PIK3CA: Phosphoinositide 3 kinase; HBXIP: Hepatitis B X-interacting protein; MICA: MHC class l-related chain A; eIF4Gll: Eukaryotic translation initiation factor 4, gamma; HDAC1: Histone deacetylase 1 Med J Obstet Gynecol 2(2): 1032 (2014) 2/5 Takahashi et al. (2014) Email: Central maternal blood during pregnancy [11]. Several studies have hand, another author showed that miR-154 is down-regulated in reported the relationships between circulating miRNAs and the preeclamptic placenta [30]. We assume that one of the key obstetrical and/or placental diseases [20-23]. Apart from pointsfor these discrepancies
Load more

Recommended publications
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Bioinformatics Analyses of Genomic Imprinting
    Bioinformatics Analyses of Genomic Imprinting Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Barbara Hutter Saarbrücken 2009 Tag des Kolloquiums: 08.12.2009 Dekan: Prof. Dr.-Ing. Stefan Diebels Berichterstatter: Prof. Dr. Volkhard Helms Priv.-Doz. Dr. Martina Paulsen Vorsitz: Prof. Dr. Jörn Walter Akad. Mitarbeiter: Dr. Tihamér Geyer Table of contents Summary________________________________________________________________ I Zusammenfassung ________________________________________________________ I Acknowledgements _______________________________________________________II Abbreviations ___________________________________________________________ III Chapter 1 – Introduction __________________________________________________ 1 1.1 Important terms and concepts related to genomic imprinting __________________________ 2 1.2 CpG islands as regulatory elements ______________________________________________ 3 1.3 Differentially methylated regions and imprinting clusters_____________________________ 6 1.4 Reading the imprint __________________________________________________________ 8 1.5 Chromatin marks at imprinted regions___________________________________________ 10 1.6 Roles of repetitive elements ___________________________________________________ 12 1.7 Functional implications of imprinted genes _______________________________________ 14 1.8 Evolution and parental conflict ________________________________________________
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
    US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al.
    [Show full text]
  • Upregulation of 15 Antisense Long Non-Coding Rnas in Osteosarcoma
    G C A T T A C G G C A T genes Article Upregulation of 15 Antisense Long Non-Coding RNAs in Osteosarcoma Emel Rothzerg 1,2 , Xuan Dung Ho 3 , Jiake Xu 1 , David Wood 1, Aare Märtson 4 and Sulev Kõks 2,5,* 1 School of Biomedical Sciences, The University of Western Australia, Perth, WA 6009, Australia; [email protected] (E.R.); [email protected] (J.X.); [email protected] (D.W.) 2 Perron Institute for Neurological and Translational Science, QEII Medical Centre, Nedlands, WA 6009, Australia 3 Department of Oncology, College of Medicine and Pharmacy, Hue University, Hue 53000, Vietnam; [email protected] 4 Department of Traumatology and Orthopaedics, University of Tartu, Tartu University Hospital, 50411 Tartu, Estonia; [email protected] 5 Centre for Molecular Medicine and Innovative Therapeutics, Murdoch University, Murdoch, WA 6150, Australia * Correspondence: [email protected]; Tel.: +61-(0)-8-6457-0313 Abstract: The human genome encodes thousands of natural antisense long noncoding RNAs (lncR- NAs); they play the essential role in regulation of gene expression at multiple levels, including replication, transcription and translation. Dysregulation of antisense lncRNAs plays indispensable roles in numerous biological progress, such as tumour progression, metastasis and resistance to therapeutic agents. To date, there have been several studies analysing antisense lncRNAs expression profiles in cancer, but not enough to highlight the complexity of the disease. In this study, we investi- gated the expression patterns of antisense lncRNAs from osteosarcoma and healthy bone samples (24 tumour-16 bone samples) using RNA sequencing.
    [Show full text]
  • Structural Basis for the Assembly of the Ragulator-Rag Gtpase Complex
    ARTICLE DOI: 10.1038/s41467-017-01762-3 OPEN Structural basis for the assembly of the Ragulator- Rag GTPase complex Ryo Yonehara1, Shigeyuki Nada2, Tomokazu Nakai2, Masahiro Nakai2, Ayaka Kitamura2, Akira Ogawa2, Hirokazu Nakatsumi3, Keiichi I. Nakayama3, Songling Li4, Daron M. Standley4, Eiki Yamashita1, Atsushi Nakagawa 1 & Masato Okada2 The mechanistic target of rapamycin complex 1 (mTORC1) plays a central role in regulating 1234567890 cell growth and metabolism by responding to cellular nutrient conditions. The activity of mTORC1 is controlled by Rag GTPases, which are anchored to lysosomes via Ragulator, a pentameric protein complex consisting of membrane-anchored p18/LAMTOR1 and two roadblock heterodimers. Here we report the crystal structure of Ragulator in complex with the roadblock domains of RagA-C, which helps to elucidate the molecular basis for the regulation of Rag GTPases. In the structure, p18 wraps around the three pairs of roadblock heterodimers to tandemly assemble them onto lysosomes. Cellular and in vitro analyses further demonstrate that p18 is required for Ragulator-Rag GTPase assembly and amino acid- dependent activation of mTORC1. These results establish p18 as a critical organizing scaffold for the Ragulator-Rag GTPase complex, which may provide a platform for nutrient sensing on lysosomes. 1 Laboratory of Supramolecular Crystallography, Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871, Japan. 2 Department of Oncogene Research, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan. 3 Medical Institute of Bioregulation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-0054, Japan. 4 Department of Genome Informatics, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan.
    [Show full text]
  • A High-Throughput Study in Melanoma Identifies Epithelial- Mesenchymal Transition As a Major Determinant of Metastasis
    Research Article A High-Throughput Study in Melanoma Identifies Epithelial- Mesenchymal Transition as a Major Determinant of Metastasis Soledad R. Alonso,1 Lorraine Tracey,1 Pablo Ortiz,4 Beatriz Pe´rez-Go´mez,5 Jose´ Palacios,1 Marina Polla´n,5 Juan Linares,6 Salvio Serrano,7 Ana I. Sa´ez-Castillo,6 Lydia Sa´nchez,2 Raquel Pajares,2 Abel Sa´nchez-Aguilera,1 Maria J. Artiga,1 Miguel A. Piris,1 and Jose´ L. Rodrı´guez-Peralto3 1Molecular Pathology Programme and 2Histology and Immunohistochemistry Unit, Centro Nacional de Investigaciones Oncolo´gicas; Departments of 3Pathology and 4Dermatology, Hospital Universitario 12 de Octubre; 5Centro Nacional de Epidemiologı´a, Instituto de Salud Carlos III, Madrid, Spain; and Departments of 6Pathology and 7Dermatology, Hospital Universitario San Cecilio, Granada, Spain Abstract with a less favorable prognosis as potential candidates for adjuvant Metastatic disease is the primary cause of death in cutaneous or novel therapies. malignant melanoma (CMM) patients. To understand the Currently, the prognosis of primary CMM is mainly based mechanisms of CMM metastasis and identify potential on histopathologic criteria. The most important of these is the predictive markers, we analyzed gene-expression profiles of Breslow index, although it is merely a measure of tumor depth. 34 vertical growth phase melanoma cases using cDNA micro- New molecular markers that correlate with melanoma genesis and/or progression are continuously being identified but, to date, arrays. All patients had a minimum follow-up of 36 months. Twenty-one cases developed nodal metastatic disease and 13 most of them have been obtained in experimental models and did not.
    [Show full text]
  • Construct a Circrna/Mirna/Mrna Regulatory Network to Explore Potential Pathogenesis and Therapy Options of Clear Cell Renal Cell
    www.nature.com/scientificreports OPEN Construct a circRNA/miRNA/mRNA regulatory network to explore potential pathogenesis and therapy options of clear cell renal cell carcinoma Shuheng Bai1, YinYing Wu3, Yanli Yan1, Shuai Shao1, Jiangzhou Zhang2, Jiaxin Liu2, Beina Hui1, Rui Liu1, Hailin Ma1, Xiaozhi Zhang1 & Juan Ren1* Clear cell renal cell carcinoma (ccRCC) is the most representative subtype of renal cancer. CircRNA acts as a kind of ceRNA to play a role in regulating microRNA (miRNA) in many cancers. However, the potential pathogenesis role of the regulatory network among circRNA/miRNA/mRNA is not clear and has not been fully explored. CircRNA expression profle data were obtained from GEO datasets, and the diferentially expressed circRNAs (DECs) were identifed through utilizing R package (Limma) frstly. Secondly, miRNAs that were regulated by these circRNAs were predicted by using Cancer- specifc circRNA database and Circular RNA Interactome. Thirdly, some related genes were identifed by intersecting targeted genes, which was predicted by a web tool (miRWalk) and diferentially expressed genes, which was obtained from TCGA datasets. Function enrichment was analyzed, and a PPI network was constructed by Cytoscape software and DAVID web set. Subsequently, ten hub-genes were screened from the network, and the overall survival time in patients of ccRCC with abnormal expression of these hub-genes were completed by GEPIA web set. In the last, a circRNA/miRNA/ mRNA regulatory network was constructed, and potential compounds and drug which may have the function of anti ccRCC were forecasted by taking advantage of CMap and PharmGKB datasets. Six DECs (hsa_circ_0029340, hsa_circ_0039238, hsa_circ_0031594, hsa_circ_0084927, hsa_circ_0035442, hsa_circ_0025135) were obtained and six miRNAs (miR-1205, miR-657, miR-587, miR-637, miR- 1278, miR-548p) which are regulated by three circRNAs (hsa_circ_0084927, hsa_circ_0035442, hsa_ circ_0025135) were also predicted.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name hepatitis B virus x interacting protein Gene Symbol Hbxip Organism Mouse Gene Summary Description Not Available Gene Aliases 1110003H18Rik, XIP RefSeq Accession No. NC_000069.6, NT_039240.8 UniGene ID Mm.290035 Ensembl Gene ID ENSMUSG00000087260 Entrez Gene ID 68576 Assay Information Unique Assay ID qMmuCID0007576 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000145735 Amplicon Context Sequence CTAACCTCTGACCCCACCGACATCCCTGTGGTATGTTTAGAATCAGATAATGGGA ACATTATGATCCAGAAACACGATGGCATCACAGTGGCTGTGCACAAAATGGCCT CTTGACATCTGATGTCAGCTCTCCAGTGGCCTCTCACCGGGATTCAGTCATGCC TGTCTCAGCTCATTTGTAAAACTATTAAAGTTCCAGAAATAGGCCATTCAGTTAAT GT Amplicon Length (bp) 191 Chromosome Location 3:107281974-107283802 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 20.47 cDNA Tm (Celsius) 84.5 gDNA Cq 23.79 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hbxip, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTAL INFORMATION A study restricted to chemokine receptors as well as a genome-wide transcript analysis uncovered CXCR4 as preferentially expressed in Ewing's sarcoma (Ewing's sarcoma) cells of metastatic origin (Figure 4). Transcriptome analyses showed that in addition to CXCR4, genes known to support cell motility and invasion topped the list of genes preferentially expressed in metastasis-derived cells (Figure 4D). These included kynurenine 3-monooxygenase (KMO), galectin-1 (LGALS1), gastrin-releasing peptide (GRP), procollagen C-endopeptidase enhancer (PCOLCE), and ephrin receptor B (EPHB3). KMO, a key enzyme of tryptophan catabolism, has not been linked to metastasis. Tryptophan and its catabolites, however, are involved in immune evasion by tumors, a process that can assist in tumor progression and metastasis (1). LGALS1, GRP, PCOLCE and EPHB3 have been linked to tumor progression and metastasis of several cancers (2-4). Top genes preferentially expressed in L-EDCL included genes that suppress cell motility and/or potentiate cell adhesion such as plakophilin 1 (PKP1), neuropeptide Y (NPY), or the metastasis suppressor TXNIP (5-7) (Figure 4D). Overall, L-EDCL were enriched in gene sets geared at optimizing nutrient transport and usage (Figure 4D; Supplementary Table 3), a state that may support the early stages of tumor growth. Once tumor growth outpaces nutrient and oxygen supplies, gene expression programs are usually switched to hypoxic response and neoangiogenesis, which ultimately lead to tumor egress and metastasis. Accordingly, gene sets involved in extracellular matrix remodeling, MAPK signaling, and response to hypoxia were up-regulated in M-EDCL (Figure 4D; Supplementary Table 4), consistent with their association to metastasis in other cancers (8, 9).
    [Show full text]
  • A Systematic Screen of Breast Cancer Patients' Exomes For
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.04.123240; this version posted June 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 Title: 3 A systematic screen of breast cancer patients’ exomes 4 for retrotransposon insertions reveals disease 5 associated genes 6 7 8 Authors: 9 Sylvia De Brakeleer, Jacques De Grève and Erik Teugels* 10 11 12 Affiliation: 13 Laboratory of Molecular and Medical Oncology 14 Vrije Universiteit Brussel 15 Laarbeeklaan 103, 1090 Brussels 16 Belgium 17 18 19 Email adresses: 20 Sylvia De Brakeleer [email protected] 21 Jacques De Grève [email protected] 22 Erik Teugels [email protected] 23 24 25 *corresponding author 26 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.04.123240; this version posted June 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 27 ABSTRACT 28 Background: Retrotransposons are genetic elements that jump within the genome via an RNA 29 intermediate. Although they had a strong impact on human genome evolution, only a very tiny 30 fraction of them can be reactivated nowadays, most often with neutral or detrimental 31 consequences. The pathological outcomes associated with such genetic alterations are poorly 32 investigated in the clinic, merely due to their difficult detection.
    [Show full text]