DOCSLIB.ORG

A High-Throughput Study in Melanoma Identifies Epithelial- Mesenchymal Transition As a Major Determinant of Metastasis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Research Article A High-Throughput Study in Melanoma Identifies Epithelial- Mesenchymal Transition as a Major Determinant of Metastasis Soledad R. Alonso,1 Lorraine Tracey,1 Pablo Ortiz,4 Beatriz Pe´rez-Go´mez,5 Jose´ Palacios,1 Marina Polla´n,5 Juan Linares,6 Salvio Serrano,7 Ana I. Sa´ez-Castillo,6 Lydia Sa´nchez,2 Raquel Pajares,2 Abel Sa´nchez-Aguilera,1 Maria J. Artiga,1 Miguel A. Piris,1 and Jose´ L. Rodrı´guez-Peralto3 1Molecular Pathology Programme and 2Histology and Immunohistochemistry Unit, Centro Nacional de Investigaciones Oncolo´gicas; Departments of 3Pathology and 4Dermatology, Hospital Universitario 12 de Octubre; 5Centro Nacional de Epidemiologı´a, Instituto de Salud Carlos III, Madrid, Spain; and Departments of 6Pathology and 7Dermatology, Hospital Universitario San Cecilio, Granada, Spain Abstract with a less favorable prognosis as potential candidates for adjuvant Metastatic disease is the primary cause of death in cutaneous or novel therapies. malignant melanoma (CMM) patients. To understand the Currently, the prognosis of primary CMM is mainly based mechanisms of CMM metastasis and identify potential on histopathologic criteria. The most important of these is the predictive markers, we analyzed gene-expression profiles of Breslow index, although it is merely a measure of tumor depth. 34 vertical growth phase melanoma cases using cDNA micro- New molecular markers that correlate with melanoma genesis and/or progression are continuously being identified but, to date, arrays. All patients had a minimum follow-up of 36 months. Twenty-one cases developed nodal metastatic disease and 13 most of them have been obtained in experimental models and did not. Comparison of gene expression profiling of metastatic have not yet been confirmed in series of human samples. and nonmetastatic melanoma cases identified 243genes with The development of high-throughput screening techniques in a >2-fold differential expression ratio and a false discovery genomics and proteomics has enabled the analysis of the rate of <0.2 (206 up-regulated and 37 down-regulated). This expression of multiple genes and proteins in large series set of genes included molecules involved in cell cycle and of tumor samples (1) and may contribute to the resolution of apoptosis regulation, epithelial-mesenchymal transition some specific issues of clinical relevance, such as identifying the (EMT), signal transduction, nucleic acid binding and tran- steps for melanoma progression and metastasis. Until now, most scription, protein synthesis and degradation, metabolism, and studies characterizing CMM have been done using cell lines (2, 3), mouse models (4), or metastatic tumor samples (2, 5). However, a specific group of melanoma- and neural-related proteins. Validation of these expression data in an independent series data obtained from primary CMM samples are difficult to obtain, of melanomas using tissue microarrays confirmed that the due in part to the lack of retrospective collections of frozen expression of a set of proteins included in the EMT group primary melanomas samples or adequate follow-up (5–7). (N-cadherin, osteopontin, and SPARC/osteonectin) were sig- Molecular changes associated with the acquisition of metastatic nificantly associated with metastasis development. Our results capacity in vertical growth phase melanoma are still to be fully suggest that EMT-related genes contribute to the promotion described. We might expect a repertoire of differentially expressed of the metastatic phenotype in primary CMM by supporting genes defining the metastatic phenotype for primary CMM cases. specific adhesive, invasive, and migratory properties. These The present study aimed to investigate the metastasis signature data give a better understanding of the biology of this in primary CMM. To this end, we compared the gene expression aggressive tumor and may provide new prognostic and patient profile in a series of vertical growth phase primary CMMs that had stratification markers in addition to potential therapeutic developed metastatic disease with vertical growth phase CMM targets. [Cancer Res 2007;67(7):3450–60] without metastatic disease by the end of follow-up. Our results confirm the multifactorial genesis of melanoma metastasis and identify the epithelial-mesenchymal transition (EMT) and the Introduction relation with the extracellular matrix as key steps in melanoma progression. In primary cutaneous malignant melanoma (CMM) patients, it is essential to determine the molecular changes associated with metastasis and to apply this knowledge to the fields of outcome prediction and targeted treatment. This information will lead to a Materials and Methods better understanding of the biology of this tumor, and will probably Patients and tissue samples. This study featured a series of 34 primary provide prognostic information for defining subgroups of patients CMMs provided by the Hospital San Cecilio (Granada, Spain) and the Hospital 12 de Octubre (Madrid, Spain). Patients were recruited between 1990 and 2002 to ensure a minimum follow-upof 36 months. Samples were collected and frozen according to standard protocols, and their histology Note: Supplementary data for this article are available at Cancer Research Online was reviewed by two pathologists (S.R.A. and J.L.R-P.) to confirm that they (http://cancerres.aacrjournals.org/). contained at least 50% tumor cells. All selected cases corresponded to Requests for reprints: Miguel A. Piris, Programa de Patologı´a Molecular, Centro consecutive melanoma tumors with potential metastatic capacity (i.e., Nacional de Investigaciones Oncolo´gicas, C/Melchor Ferna´ndez Almagro 3, Madrid vertical growth phase cases with a Breslow index >1 mm). The cutoff was 28029, Spain. Phone: 34-91-224-69-00; Fax: 34-91-224-69-23; E-mail: [email protected]. I2007 American Association for Cancer Research. selected taking into account the criteria of the American Joint Committee doi:10.1158/0008-5472.CAN-06-3481 on Cancer by which thin melanomas (V1 mm) have an excellent prognosis Cancer Res 2007; 67: (7). April 1, 2007 3450 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2007 American Association for Cancer Research. Metastasis Signature in Melanoma Table 1. Antibodies used in the study indicating clone, source, dilution, visualization method, scoring, threshold, and positive controls Protein Clone Source Dilution Visualization Scoring Threshold Positive control system Glypican 3 Polyclonal Santa Cruz 1:25 LSAB/DAB Pos/neg >10% positive cells Hepatocarcinoma Biotechnology N-cadherin 3B9 Zymed 1:10 LSAB/DAB Pos/neg z5% positive cells, Ovarian carcinoma, membranous expression cardiac muscle SPARC/ 15G12 Novocastra 1:25 LSAB/DAB Pos/neg >10% positive cells, cytoplasm Endothelial cells in osteonectin malignant tumors Osteopontin Polyclonal Abcam 1:1,500 LSAB/DAB Pos/neg >10% positive cells, cytoplasm Stromal cells in normal skin PKCa H7 Santa Cruz 1:25 LSAB/DAB High/low z50% positive cells, cytoplasm Small lymphocytes, nevus Biotechnology Abbreviations: Pos/neg, positive/negative; LSAB, peroxidase-labeled streptavidin biotin; DAB, diaminobenzidine. (>90% survival at 5 years) compared with melanomas with a penetration online.8 Sample hybridizations were done as described elsewhere (12). depth of >1 mm (8). Histologic review of the cases was done on paraffin- After washing, the two fluorescent signals on the slides were scanned with embedded tissue, whereas frozen sections were examined for assessing the a standard two-color microarray scanner (Scanarray 5000XL, GSI proportion of the tumoral cells and the character of the neoplastic Lumonics, Kanata, Ontario, Canada). Images were analyzed with the infiltrate. GenePix 4.1 software (Axon Instruments, Inc., Union City, CA). The clone For tissue microarray (TMA) analysis, we used a retrospective cohort sequences of all the genes included in the OncoChipand the repro- of patients representing 127 primary vertical growth phase melanoma ducibility of the expression data of multiple genes have been previously cases (formalin-fixed and paraffin-embedded tissue) collected from 1980 verified (12). to 2000. These cases were obtained from the Hospital 12 de Octubre Data extraction and analysis. Data from each hybridization were (Madrid) and were included in six separate TMAs (1.5-mm core maintained in a database for analysis. Fluorescence intensity measurements diameter), with two representative duplicate cores for each case (9), were subjected to automatic background subtraction. The Cy3/Cy5 ratios and constructed with a manual tissue arrayer (Beecher Instruments, Sun were normalized to the value of the median ratio of all spots in the array. Prairie, WI) using a standard method (10). Patient medical records were The sum of the median background for each channel was calculated, reviewed to gather information on age, gender, localization, tumor and spots with total intensities less than the calculated sum of median thickness, distant invasion (lymph node or skin), and follow-up of at backgrounds were discarded. Additionally, spots with background- least 36 months. Patients were not treated before the development of subtracted signal intensities <500 fluorescence units (sum of the two metastasis. The work was conducted in accordance with the Declaration channels) and bad spots were excluded from the analysis. All ratio values of Helsinki Principles and under the supervision of the Hospital 12 de were log-transformed (base 2), and duplicated spots in the array
Recommended publications
  • Inhibition of Breast and Brain Cancer Cell Growth by Bccipα, An

    Inhibition of Breast and Brain Cancer Cell Growth by Bccipα, An

    Oncogene (2001) 20, 336 ± 345 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc Inhibition of breast and brain cancer cell growth by BCCIPa,an evolutionarily conserved nuclear protein that interacts with BRCA2 Jingmei Liu1, Yuan Yuan1,2, Juan Huan2 and Zhiyuan Shen*,1 1Department of Molecular Genetics and Microbiology, University of New Mexico Health Sciences Center; 915 Camino de Salud, NE. Albuquerque, New Mexico, NM 87131, USA; 2Graduate Program of Molecular Genetics, College of Medicine, University of Illinois at Chicago, 900 S. Ashland Ave. Chicago, Illinois, IL 60607, USA BRCA2 is a tumor suppressor gene involved in mammary mouse BRCA2. It is expected that important functions tumorigenesis. Although important functions have been of BRCA2 reside in these conserved domains. Based on assigned to a few conserved domains of BRCA2, little is the functional analysis of the conserved BRCA2 known about the longest internal conserved domain domains, several models have been proposed for the encoded by exons 14 ± 24. We identi®ed a novel protein, role of BRCA2 in tumor suppression. designated BCCIPa, that interacts with part of the An N-terminus conserved domain in exon 3 (amino internal conserved region of human BRCA2. Human acids 48 ± 105) has been implicated in transcriptional BCCIP represents a family of proteins that are regulation of gene expression (Milner et al., 1997; evolutionarily conserved, and contain three distinct Nordling et al., 1998). Deletion of this region has been domains: an N-terminus acidic domain (NAD) of 30 ± identi®ed in breast cancers (Nordling et al., 1998).
  • The Rise and Fall of the Bovine Corpus Luteum

    The Rise and Fall of the Bovine Corpus Luteum

    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
  • University of California, San Diego

    University of California, San Diego

    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
  • (12) Patent Application Publication (10) Pub. No.: US 2016/0237501 A1 SHARP Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2016/0237501 A1 SHARP Et Al

    US 2016O23750 1A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0237501 A1 SHARP et al. (43) Pub. Date: Aug. 18, 2016 (54) BIOMARKERS FOR DIAGNOSIS OF Related U.S. Application Data TRANSIENT SCHEMICATTACKS (62) Division of application No. 13/182,630, filed on Jul. (71) Applicant: The Regents of the University of 14, 2011, now abandoned. California, Oakland, CA (US) (60) Provisional application No. 61/364.334, filed on Jul. 14, 2010. (72) Inventors: Frank SHARP, Davis, CA (US); Xinhua ZHAN. Vacaville, CA (US); Publication Classification Glen C. JICKLING, Sacramento, CA (US): S. Claiborne JOHNSTON, San (51) Int. Cl. Francisco, CA (US) CI2O I/68 (2006.01) (52) U.S. Cl. (73) Assignee: The Regents of the University of CPC ........ CI2O 1688 (2013.0); CI2O 2600/158 California, Oakland, CA (US) (2013.01); C12O 2600/1 18 (2013.01) (57) ABSTRACT (21) Appl. No.: 15/043,577 The present invention provides methods and compositions for diagnosing and predicting the risk and cause of transient (22) Filed: Feb. 14, 2016 ischemic attacks (TIA). Patent Application Publication Aug. 18, 2016 Sheet 1 of 4 US 2016/0237SO1 A1 Standardized intensity s sis: iagnosis Controls xIA Figure IA-B Patent Application Publication Aug. 18, 2016 Sheet 2 of 4 US 2016/0237SO1 A1 & TA Cross-validated Probabilities (Thresholds 0.89) * Controls Controls TA ----------------------------------------------------------------------------------------------------------------------------------------- ... 0.9 O.8 O O 20 Subjects30 40 SO 50 Figure 2 Patent Application Publication Aug. 18, 2016 Sheet 3 of 4 US 2016/0237SO1 A1 Cross-validated Probabilities (Threshold=3.97) & TIA1 & A2 TIA1 T1A2 .
  • Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of Trans Esnps Infers Regulatory Network Architecture

    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
  • Short Reports a Small Interstitial Deletion in the GPC3 Gene Causes Simpson-Golabi-Behmel Syndrome in a Dutch-Canadian Family

    Short Reports a Small Interstitial Deletion in the GPC3 Gene Causes Simpson-Golabi-Behmel Syndrome in a Dutch-Canadian Family

    J Med Genet 1999;36:57–58 57 Short reports J Med Genet: first published as 10.1136/jmg.36.1.57 on 1 January 1999. Downloaded from A small interstitial deletion in the GPC3 gene causes Simpson-Golabi-Behmel syndrome in a Dutch-Canadian family Jian Y Xuan, Rhiannon M Hughes-Benzie, Alex E MacKenzie Abstract prisingly, a family member with the apparent Deletions in the heparan sulphate proteo- stigmata of SGBS including Wilms tumour glycan encoding glypican 3 (GPC3) gene appeared not to inherit the SGBS chromosome have recently been documented in several in a previous linkage study.2 The definition of Simpson-Golabi-Behmel syndrome the GPC3 mutation has allowed the unequivo- (SGBS) families. However, no precisely cal documentation of a normal GPC3 status in defined SGBS mutation has been pub- this child. lished. We report here a 13 base pair DNA (extracted from peripheral blood and deletion which causes a frameshift and tumour tissues) was obtained from members of premature termination of the GPC3 gene the SGBS family and unrelated controls. PCR in the Dutch-Canadian SGBS family in amplification of exon 2 of the GPC3 gene was whom the trait was originally mapped. Our performed using the oligonucleotide primers analysis shows that a discrete GPC3 disa- EX2 A (5' gtttgccctgtttgccatg 3') and EX2 B (5' bling mutation is suYcient to cause SGBS. caaataatgatgccactaagc 3') producing a 329 bp Furthermore, our finding of a GPC3 nor- fragment in normal subjects.8 The reactions mal daughter of an SGBS carrier with contained 1 µg of DNA, 50 ng of each primer, skeletal abnormalities and Wilms tumour 0.2 mmol/l of each of the four dNTPs (dATP, raises the possibility of a trans eVect from dCTP, dGTP, and dTTP), and 1.2 U of Ta q the maternal carrier in SGBS kindreds.
  • Analysis of Gene Expression Data for Gene Ontology

    Analysis of Gene Expression Data for Gene Ontology

    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals

    Identification of the Binding Partners for Hspb2 and Cryab Reveals

    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
  • AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product Data

    AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA503371 AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product data: Product Type: Primary Antibodies Clone Name: OTI3A9 Applications: FC, WB Recommended Dilution: WB 1:2000, FLOW 1:100 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombinant protein of human AK4(NP_037542) produced in HEK293T cell. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 25.1 kDa Gene Name: adenylate kinase 4 Database Link: NP_037542 Entrez Gene 11639 MouseEntrez Gene 29223 RatEntrez Gene 205 Human P27144 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] – TA503371 Background: This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • AK3L1 Antibody - Middle Region Rabbit Polyclonal Antibody Catalog # AI12098

    AK3L1 Antibody - Middle Region Rabbit Polyclonal Antibody Catalog # AI12098

    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 AK3L1 antibody - middle region Rabbit Polyclonal Antibody Catalog # AI12098 Specification AK3L1 antibody - middle region - Product Information Application WB Primary Accession P27144 Other Accession NM_001005353, NP_001005353 Reactivity Human, Mouse, Rat, Rabbit, Zebrafish, Pig, Horse, Bovine, Guinea Pig, Dog Predicted Pig, Dog WB Suggested Anti-AK3L1 Antibody Titration: Host Rabbit 2.5μg/ml Clonality Polyclonal Positive Control: Jurkat cell lysate Calculated MW 25kDa KDa AK3L1 antibody - middle region - Additional Information AK3L1 antibody - middle region - References Gene ID 205 Noma,T.,Biochem.J.358(PT1),225-232(2001)Re Alias Symbol AK3, AK4, AK3L1, constitutionandStorage:Forshorttermuse,storea AK3L2 t2-8Cupto1week.Forlongtermstorage,storeat-2 Other Names 0Cinsmallaliquotstopreventfreeze-thawcycles. Adenylate kinase 4, mitochondrial {ECO:0000255|HAMAP-Rule:MF_03170}, AK 4 {ECO:0000255|HAMAP-Rule:MF_03170}, 2.7.4.10 {ECO:0000255|HAMAP-Rule:MF_03170}, 2.7.4.6 {ECO:0000255|HAMAP-Rule:MF_03170}, Adenylate kinase 3-like {ECO:0000255|HAMAP-Rule:MF_03170}, GTP:AMP phosphotransferase AK4 {ECO:0000255|HAMAP-Rule:MF_03170}, AK4 {ECO:0000255|HAMAP-Rule:MF_03170} Format Liquid. Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose. Reconstitution & Storage Add 100 ul of distilled water. Final anti-AK3L1 antibody concentration is 1 Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 mg/ml in PBS buffer with 2% sucrose. For longer periods of storage, store at 20°C. Avoid repeat freeze-thaw cycles. Precautions AK3L1 antibody - middle region is for research use only and not for use in diagnostic or therapeutic procedures.
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation

    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).