Supplementary Data

Total Page:16

File Type:pdf, Size:1020Kb

Load more

SUPPLEMENTAL INFORMATION A study restricted to chemokine receptors as well as a genome-wide transcript analysis uncovered CXCR4 as preferentially expressed in Ewing's sarcoma (Ewing's sarcoma) cells of metastatic origin (Figure 4). Transcriptome analyses showed that in addition to CXCR4, genes known to support cell motility and invasion topped the list of genes preferentially expressed in metastasis-derived cells (Figure 4D). These included kynurenine 3-monooxygenase (KMO), galectin-1 (LGALS1), gastrin-releasing peptide (GRP), procollagen C-endopeptidase enhancer (PCOLCE), and ephrin receptor B (EPHB3). KMO, a key enzyme of tryptophan catabolism, has not been linked to metastasis. Tryptophan and its catabolites, however, are involved in immune evasion by tumors, a process that can assist in tumor progression and metastasis (1). LGALS1, GRP, PCOLCE and EPHB3 have been linked to tumor progression and metastasis of several cancers (2-4). Top genes preferentially expressed in L-EDCL included genes that suppress cell motility and/or potentiate cell adhesion such as plakophilin 1 (PKP1), neuropeptide Y (NPY), or the metastasis suppressor TXNIP (5-7) (Figure 4D). Overall, L-EDCL were enriched in gene sets geared at optimizing nutrient transport and usage (Figure 4D; Supplementary Table 3), a state that may support the early stages of tumor growth. Once tumor growth outpaces nutrient and oxygen supplies, gene expression programs are usually switched to hypoxic response and neoangiogenesis, which ultimately lead to tumor egress and metastasis. Accordingly, gene sets involved in extracellular matrix remodeling, MAPK signaling, and response to hypoxia were up-regulated in M-EDCL (Figure 4D; Supplementary Table 4), consistent with their association to metastasis in other cancers (8, 9). Together, these data show that EDCL offer a relatively reasonable model to investigate gene expression patterns associated with localized and metastatic ES, and further support the notion that CXCR4 associates with metastatic ES, as shown in both cell lines and primary tumors. References 1. Ino K, Yamamoto E, Shibata K, et al. Inverse correlation between tumoral indoleamine 2,3-dioxygenase expression and tumor-infiltrating lymphocytes in endometrial cancer: its association with disease progression and survival. Clin Cancer Res 2008;14: 2310- 7. 2. Chao C, Ives K, Hellmich HL, Townsend CM, Jr., Hellmich MR. Gastrin-releasing peptide receptor in breast cancer mediates cellular migration and interleukin-8 expression. J Surg Res 2009;156: 26-31. 3. Holmberg J, Genander M, Halford MM, et al. EphB receptors coordinate migration and proliferation in the intestinal stem cell niche. Cell 2006;125: 1151-63. 4. Wu MH, Hong TM, Cheng HW, et al. Galectin-1-mediated tumor invasion and metastasis, up-regulated matrix metalloproteinase expression, and reorganized actin cytoskeletons. Mol Cancer Res 2009;7: 311-8. 5. Sobolik-Delmaire T, Katafiasz D, Keim SA, Mahoney MG, Wahl JK, 3rd. Decreased plakophilin-1 expression promotes increased motility in head and neck squamous cell carcinoma cells. Cell Commun Adhes 2007;14: 99-109. 6. Ogasawara M, Murata J, Ayukawa K, Saiki I. Differential effect of intestinal neuropeptides on invasion and migration of colon carcinoma cells in vitro. Cancer Lett 1997;119: 125-30. 7. Goldberg SF, Miele ME, Hatta N, et al. Melanoma metastasis suppression by chromosome 6: evidence for a pathway regulated by CRSP3 and TXNIP. Cancer research 2003;63: 432-40. 8. Wu WS, Wu JR, Hu CT. Signal cross talks for sustained MAPK activation and cell migration: the potential role of reactive oxygen species. Cancer metastasis reviews 2008;27: 303-14. 9. Larsen M, Artym VV, Green JA, Yamada KM. The matrix reorganized: extracellular matrix remodeling and integrin signaling. Curr Opin Cell Biol 2006;18: 463-71. 10. Su AI, Cooke MP, Ching KA, et al. Large-scale analysis of the human and mouse transcriptomes. Proceedings of the National Academy of Sciences of the United States of America 2002;99: 4465-70. SUPPLEMENTARY FIGURES Supplementary Fig. 1. Flow chart of Ican bioinformatic procedures. Additional details and references are within the Materials and Methods section of the paper. Supplementary Fig. 2. Chemokine receptors other than CXCR4 and CXCR7 are not modulated by EWS-FLI1 knockdown in EDCL. Gene expression of chemokine receptors was assessed by gene expression profiling before and after EWS-FLI1 knockdown in six EDCL. Mean ratio of gene expression in the two experimental setups are shown. The six EDCL were considered as six biological replicates and standard deviations were less than 20% for all genes tested. SUPPLEMENTARY TABLES Supplementary Table 1. Gene Ontology (GO) of gene sets enriched in L-EDCL. Ranking of GO functional groups was based on statistical significance (p values) of LogFD, the Log2 fold difference between M-EDCL and L-EDCL. Only those with a LogFD < -1.5 are listed. Supplementary Table 2. Gene Ontology (GO) of gene sets enriched in M-EDCL. Ranking of GO functional groups was based on statistical significance (p values) of LogFD. Only those with a LogFD > +1.5 are listed. Supplementary Table 3. Chemokine-expressing normal tissues. Gene expression profiles derived from two individuals and comprising 75 normal tissues (10) were retrieved from GEO. Highest expressing NT are shown. Supplementary Table 4. Chemokine receptor-expressing normal tissues. As in Table 1, highest expressing NT are listed herein. Supplementary Table 5. Clinical variables of tumor samples tested. Ewing's sarcoma (Ewing's sarcoma) patient tumor sample characteristics are listed. Abbreviations are as in Figure 5. Name LogFD P. Value Group gene list RESPONSE TO NUTRIENT -4.903 4.617E-05 TP53,SREBF1,CDKN2D,CHMP1A,OGT,NUAK2,ENPP1,STC2,FADS1,GNAI2,ENSA,STC LEVELS 1,ASNS,NPY SECONDARY ACTIVE -4.555 6.132E-05 SLC25A11,SLC9A6,SLC12A2,SLC12A9,SLC20A1,SLC13A2,SLC20A2,SLC12A4,SLC3A TRANSMEMBRANE 2,SLC22A7,SLC17A7,SLC9A1,SLC6A8,SLC6A2,SLC5A3,SLC12A7,SLC5A6,SLC7A11 TRANSPORTER ACTIVITY METAL ION TRANSPORT -4.057 1.687E-04 ATP2A3,KCNH2,CCS,RYR1,KCNN4,KCNQ2,ATP2C1,KCNJ4,SCNN1A,KCNN1,SLC30A 5,KCNK4,STIM1,KCNF1,ATP7A,ATOX1,KCNJ5,CACNB3,SCN10A,TRPC4,SCN1B,SLC1 1A2,KCNJ15,HFE,SLC31A2,CHP,KCNS1,COX17,KCNK1,KCNJ6,SLC31A1,SGK1,NPY RECEPTOR COMPLEX -4.108 2.178E-04 MYH9,ITGB7,ITGB3,GRIN1,BCL10,IL13RA1,CHRNB2,SRP9,CHRNE,TRIP6,SDCBP,CD 79A,SYK,ITGAE,ADRB3,TGFBR2,ITGB4,ITGA5,SRPR,ACVR1,SMAD3 CATION TRANSPORT -3.851 3.250E-04 ATP2A3,KCNH2,SLC39A1,NNT,CCS,RYR1,KCNN4,KCNQ2,ATP6AP1,ATP2C1,KCNJ4, SCNN1A,KCNN1,SLC30A5,UCP2,KCNK4,STIM1,ATP6V1E1,KCNF1,TCIRG1,ATP7A,AT OX1,KCNJ5,PKD2,CACNB3,SCN10A,TRPC4,SCN1B,SLC11A2,KCNJ15,ATP6V0B,ATP 6V1F,HFE,UCP3,SLC31A2,CHP,ATP6V0E1,KCNS1,ATP6V1C1,ATP6V0C,COX17,KCN K1,KCNJ6,SLC31A1,SGK1,NPY AUXILIARY TRANSPORT -4.133 4.326E-04 ARPP-19,SRI,TNNI3,KCNAB2,NNAT,SGK2,CHP,KCNS1,ENSA,SMAD3,NPY PROTEIN ACTIVITY RESPONSE TO -4.005 4.715E-04 TP53,CDKN1A,RPS19,SREBF1,CDKN2D,CHMP1A,OGT,NUAK2,ENPP1,STC2,FADS1, EXTRACELLULAR GNAI2,ENSA,STC1,ASNS,NPY STIMULUS GTPASE ACTIVITY -3.770 4.859E-04 RAC3,RRAS,RAC2,MX2,DNM1,RAB27A,GNA13,RAB1A,RAB33A,ARL4C,RAB5B,RAB35 ,RAB7A,RAB5C,OPA1,EIF2S3,GNAI1,ARFRP1,ARL1,RAP1A,TGM3,SEPT9,RAB5A,RAP 2A,SEPT5,GNAQ,GNB1,ARHGAP5,TRIM23,GNAS,RAB13,ARF6,RAB3A,RAB6C,RAB28 ,RAB6A,RHOD,RHEB,RHOA,RAB2A,RABL2A,RABL2B,GTPBP4,ARF1,GNA11,GNA12, GNB2,ARF5,RAB7L1,RAN,RRAS2,RND2,ARF3,DNM1L,ARL4A,ARL4D,RAB9A,RAB11B, RHOG,GNAI2,RAB4A,GNAI3,GSPT1,RRAGC,GNG11,ARF4,RHOB,EIF5,RAB22A,RAC1, CDC42,RAB31,NUDT1,RAB3B,RND3,GNA14 REGULATION OF -3.594 6.773E-04 CXCR4,HCLS1,PROS1,IFI6,TGFB2,MYC,FOXO3,APOE,EDNRA,C3AR1,COPA,PEX6,C BIOLOGICAL QUALITY ALR,GRIK2,ISOC2,TP53,BNIP3,EIF2B5,IQCB1,CDC42EP1,CAPRIN2,CDKN1A,PABPC4 ,IHPK2,FLI1,RPS19,RHOT1,SERTAD2,DERL1,BARD1,BCL2L1,SMAD4,TFPI,STX12,YW HAH,AURKA,CALCB,APP,BCL6,GCLC,ATP6AP2,MYH9,HPS4,MAFB,BCL2,SRI,NPC2,N DUFA13,SERTAD3,ABCA2,CLN5,CDKN2D,MPV17,CDKN2C,NCK1,DRD1,CCR5,ITGB3, EP300,RB1,FBXO7,HIF1A,GPX1,AKT1,NOTCH2,CENTD2,F2R,NPTN,GPI,NF1,PABPC1 ,SEPT5,NDUFS3,ATP2C1,GNAQ,GP1BA,CHGA,TGFB1,GRM4,SLC30A5,ARF6,EIF2B4, BAX,APBB1,CDC42EP4,ATP1A1,RPS6,LMAN1,PAIP1,RAB3A,NPR2,BAK1,LIMA1,TMP RSS6,ATP7A,PPARD,CLCN3,GCHFR,ATOX1,GLRX2,TSPYL2,BCL10,CDKN2A,CACNA 1A,PLAT,ABCG1,CALCA,ATP1A3,CAV1,SLC4A1,RASA1,NPR1,AVPR1B,CLN3,AGT,FT H1,FGD1,CDKN2AIP,ENTPD1,HPRT1,A1CF,ACVR1B,GTPBP4,EIF2B2,APBB2,TAOK2, PTEN,GNA12,SOD1,FXN,HFE,SLC12A4,NPPA,DYRK3,GGCX,FRAP1,EGLN2,CDKN1B, NOL8,ENO1,CDC2L2,NDUFS1,SLC9A1,ABCA1,DDIT3,CD59,TARBP2,APOA1,GCH1,S YT1,GUCA1B,EGLN1,CAPG,APTX,PML,DERL2,ACIN1,RHOT2,CLN6,ACVR2A,TMSB4Y ,CD24,CCL2,SLC1A3,PTGS1,BIN3,MT2A,GSN,NCK2,FTL,CD55,LYN,CEBPG,AKR1C1, PPT1,TXNDC4,COG7,TPP1,GCLM,NPC1,ALDH9A1,DLC1,SMAD3,STC1,UBB,THY1,CD 9,CXCL12,UTS2,NPY POSITIVE REGULATION OF -3.701 9.330E-04 SCG2,TGFB2,IL8,CD1D,EEF1E1,MAP3K7,CFHR1,FYN,TRAF2,TNFRSF1A,LAT2,IKBKG RESPONSE TO STIMULUS ,CD79A,UBE2N,CADM1,CEBPG,MALT1,SLIT2,THY1,NPY ION TRANSPORT -3.524 9.459E-04 ATP2A3,KCNH2,TRPA1,SLC34A2,SLC39A1,SLC26A2,NNT,TSPO,GLRB,CCS,RYR1,KC NN4,LASP1,KCNQ2,ATP6AP1,P2RX1,CLIC1,ATP2C1,KCNJ4,SCNN1A,KCNN1,SLC30A 5,UCP2,KCNK4,CLIC5,VDAC2,STIM1,ATP6V1E1,KCNF1,TCIRG1,ATP7A,VDAC1,ATOX 1,KCNJ5,SLC4A1,PKD2,CACNB3,SCN10A,TRPC4,FXYD3,PLP2,SCN1B,SLC11A2,KCN J15,ATP6V0B,ATP6V1F,HFE,SLC22A7,UCP3,SLC31A2,CHP,ATP6V0E1,KCNS1,SLC17 A7,ATP6V1C1,ATP6V0C,COX17,KCNK1,AKAP7,KCNJ6,SLC31A1,SLC4A2,SGK1,WNK 1,NPY REGULATION OF -3.553 1.184E-03 SCG2,TGFB2,IL8,CD1D,EEF1E1,APOBEC3G,APOBEC3F,UBE2V2,MAP3K7,CFHR1,FY RESPONSE TO STIMULUS N,TRAF2,UBE2V1,TNFRSF1A,LAT2,IKBKG,PTGDS,CD79A,UBE2N,TARBP2,CADM1,C EBPG,MALT1,SLIT2,THY1,NPY LIPID RAFT -3.668 1.300E-03 FLOT1,STX12,PIP5K3,CAV2,LAT,PRNP,CAV1,CLN3,LAT2,ABCA1,CD79A,PI4K2A,CD2
Recommended publications
  • Dominantly Acting Variants in ARF3 Have Disruptive Consequences on Golgi Integrity and Cause Microcephaly Recapitulated in Zebra�Sh

    Dominantly Acting Variants in ARF3 Have Disruptive Consequences on Golgi Integrity and Cause Microcephaly Recapitulated in ZebraSh

    Dominantly acting variants in ARF3 have disruptive consequences on Golgi integrity and cause microcephaly recapitulated in zebrash Giulia Fasano Ospedale Pediatrico Bambino Gesù Valentina Muto Ospedale Pediatrico Bambino Gesù Francesca Clementina Radio Genetic and Rare Disease Research Division, Bambino Gesù Children's Hospital IRCCS, Rome, Italy https://orcid.org/0000-0003-1993-8018 Martina Venditti Ospedale Pediatrico Bambino Gesù Alban Ziegler Département de Génétique, CHU d’Angers Giovanni Chillemi Tuscia University https://orcid.org/0000-0003-3901-6926 Annalisa Vetro Pediatric Neurology, Neurogenetics and Neurobiology Unit and Laboratories, Meyer Children’s Hospital, University of Florence Francesca Pantaleoni https://orcid.org/0000-0003-0765-9281 Simone Pizzi Bambino Gesù Children's Hospital Libenzio Conti Ospedale Pediatrico Bambino Gesù, IRCCS, 00146 Rome https://orcid.org/0000-0001-9466-5473 Stefania Petrini Bambino Gesù Children's Hospital Simona Coppola Istituto Superiore di Sanità Alessandro Bruselles Istituto Superiore di Sanità https://orcid.org/0000-0002-1556-4998 Ingrid Guarnetti Prandi University of Pisa, 56124 Pisa, Italy Balasubramanian Chandramouli Super Computing Applications and Innovation, CINECA Magalie Barth Céline Bris Département de Génétique, CHU d’Angers Donatella Milani Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico Angelo Selicorni ASST Lariana Marina Macchiaiolo Ospedale Pediatrico Bambino Gesù, IRCCS Michaela Gonantini Ospedale Pediatrico Bambino Gesù, IRCCS Andrea Bartuli Bambino Gesù Children's
  • Recombinant Human ARFIP2 Protein Catalog Number: ATGP1695

    Recombinant Human ARFIP2 Protein Catalog Number: ATGP1695

    Recombinant human ARFIP2 protein Catalog Number: ATGP1695 PRODUCT INPORMATION Expression system E.coli Domain 1-341aa UniProt No. P53365 NCBI Accession No. NP_036534 Alternative Names Arfaptin 2, POR1 PRODUCT SPECIFICATION Molecular Weight 40.2 kDa (364aa) confirmed by MALDI-TOF Concentration 0.25mg/ml (determined by Bradford assay) Formulation Liquid in. 20mM Tris-HCl buffer (pH 8.0) containing 0.2M NaCl, 40% glycerol, 1mM DTT Purity > 90% by SDS-PAGE Tag His-Tag Application SDS-PAGE Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description Arfaptin 2, also known as ARFIP2, is a Rac1 binding protein necessary for Rac-mediated actin polymerization and the subsequent formation of membrane ruffles and lamellipodia. ARFIP2 has also been shown to interact with the ADP ribosylation factor ARF6, a GTPase that associates with the plasma membrane and intracellular endosome vesicles, in a GTP dependent manner. Arfaptin 2 also regulates the aggregation of mutant Huntingtin protein by possibly impairing proteasome function. Expression of ARFIP2 was shown to be increased at sites of neurodegeneration. Recombinant human ARFIP2 protein, fused to His-tag at N-terminus, was expressed in E. coli 1 Recombinant human ARFIP2 protein Catalog Number: ATGP1695 and purified by using conventional chromatography techniques. Amino acid Sequence MGSSHHHHHH SSGLVPRGSH MGSMTDGILG KAATMEIPIH GNGEARQLPE DDGLEQDLQQ VMVSGPNLNE TSIVSGGYGG SGDGLIPTGS GRHPSHSTTP SGPGDEVARG IAGEKFDIVK KWGINTYKCT KQLLSERFGR GSRTVDLELE LQIELLRETK RKYESVLQLG RALTAHLYSL LQTQHALGDA FADLSQKSPE LQEEFGYNAE TQKLLCKNGE TLLGAVNFFV SSINTLVTKT MEDTLMTVKQ YEAARLEYDA YRTDLEELSL GPRDAGTRGR LESAQATFQA HRDKYEKLRG DVAIKLKFLE ENKIKVMHKQ LLLFHNAVSA YFAGNQKQLE QTLQQFNIKL RPPGAEKPSW LEEQ General References D'Souza Schorey C., et al.
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Analysis of Gene Expression Data for Gene Ontology

    Analysis of Gene Expression Data for Gene Ontology

    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Expression Gene Network Analyses Reveal Molecular Mechanisms And

    Expression Gene Network Analyses Reveal Molecular Mechanisms And

    www.nature.com/scientificreports OPEN Diferential expression and co- expression gene network analyses reveal molecular mechanisms and candidate biomarkers involved in breast muscle myopathies in chicken Eva Pampouille1,2, Christelle Hennequet-Antier1, Christophe Praud1, Amélie Juanchich1, Aurélien Brionne1, Estelle Godet1, Thierry Bordeau1, Fréderic Fagnoul2, Elisabeth Le Bihan-Duval1 & Cécile Berri1* The broiler industry is facing an increasing prevalence of breast myopathies, such as white striping (WS) and wooden breast (WB), and the precise aetiology of these occurrences remains poorly understood. To progress our understanding of the structural changes and molecular pathways involved in these myopathies, a transcriptomic analysis was performed using an 8 × 60 K Agilent chicken microarray and histological study. The study used pectoralis major muscles from three groups: slow-growing animals (n = 8), fast-growing animals visually free from defects (n = 8), or severely afected by both WS and WB (n = 8). In addition, a weighted correlation network analysis was performed to investigate the relationship between modules of co-expressed genes and histological traits. Functional analysis suggested that selection for fast growing and breast meat yield has progressively led to conditions favouring metabolic shifts towards alternative catabolic pathways to produce energy, leading to an adaptive response to oxidative stress and the frst signs of infammatory, regeneration and fbrosis processes. All these processes are intensifed in muscles afected by severe myopathies, in which new mechanisms related to cellular defences and remodelling seem also activated. Furthermore, our study opens new perspectives for myopathy diagnosis by highlighting fne histological phenotypes and genes whose expression was strongly correlated with defects. Te poultry industry relies on the production of fast-growing chickens, which are slaughtered at high weights and intended for cutting and processing.
  • Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed

    Podocyte Specific Knockdown of Klf15 in Podocin-Cre Klf15flox/Flox Mice Was Confirmed

    SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1: Podocyte specific knockdown of Klf15 in Podocin-Cre Klf15flox/flox mice was confirmed. (A) Primary glomerular epithelial cells (PGECs) were isolated from 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice and cultured at 37°C for 1 week. Real-time PCR was performed for Nephrin, Podocin, Synaptopodin, and Wt1 mRNA expression (n=6, ***p<0.001, Mann-Whitney test). (B) Real- time PCR was performed for Klf15 mRNA expression (n=6, *p<0.05, Mann-Whitney test). (C) Protein was also extracted and western blot analysis for Klf15 was performed. The representative blot of three independent experiments is shown in the top panel. The bottom panel shows the quantification of Klf15 by densitometry (n=3, *p<0.05, Mann-Whitney test). (D) Immunofluorescence staining for Klf15 and Wt1 was performed in 12-week old Podocin-Cre Klf15flox/flox and Podocin-Cre Klf15+/+ mice. Representative images from four mice in each group are shown in the left panel (X 20). Arrows show colocalization of Klf15 and Wt1. Arrowheads show a lack of colocalization. Asterisk demonstrates nonspecific Wt1 staining. “R” represents autofluorescence from RBCs. In the right panel, a total of 30 glomeruli were selected in each mouse and quantification of Klf15 staining in the podocytes was determined by the ratio of Klf15+ and Wt1+ cells to Wt1+ cells (n=6 mice, **p<0.01, unpaired t test). Supplementary Figure 2: LPS treated Podocin-Cre Klf15flox/flox mice exhibit a lack of recovery in proteinaceous casts and tubular dilatation after DEX administration.
  • Seq2pathway Vignette

    Seq2pathway Vignette

    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
  • Product Data Sheet

    Product Data Sheet

    Product Data Sheet ExProfileTM Human AMPK Signaling Related Gene qPCR Array For focused group profiling of human AMPK signaling genes expression Cat. No. QG004-A (4 x 96-well plate, Format A) Cat. No. QG004-B (4 x 96-well plate, Format B) Cat. No. QG004-C (4 x 96-well plate, Format C) Cat. No. QG004-D (4 x 96-well plate, Format D) Cat. No. QG004-E (4 x 96-well plate, Format E) Plates available individually or as a set of 6. Each set contains 336 unique gene primer pairs deposited in one 96-well plate. Introduction The ExProfile human AMPK signaling related gene qPCR array profiles the expression of 336 human genes related to AMPK-mediated signal transduction. These genes are carefully chosen for their close pathway correlation based on a thorough literature search of peer-reviewed publications, mainly including genes that encode AMP-activated protein kinase complex,its regulators and targets involved in many important biological processes, such as glucose uptake, β-oxidation of fatty acids and modulation of insulin secretion. This array allows researchers to study the pathway-related genes to gain understanding of their roles in the different biological processes. QG004 plate 01: 84 unique gene PCR primer pairs QG004 plate 02: 84 unique gene PCR primer pairs QG004 plate 03: 84 unique gene PCR primer pairs QG004 plate 04: 84 unique gene PCR primer pairs Shipping and storage condition Shipped at room temperate Stable for at least 6 months when stored at -20°C Array format GeneCopoeia provides five qPCR array formats (A, B, C, D, and E) suitable for use with the following real- time cyclers.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Supplementary Materials

    Supplementary Materials

    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks

    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.