DOCSLIB.ORG

Identification and Characterization of Thiamine Biosynthesis, Transport, and Regulation Elements Among Bacteroides Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Characterization of Thiamine Biosynthesis, Transport, and Regulation Elements Among Bacteroides Species IDENTIFICATION AND CHARACTERIZATION OF THIAMINE BIOSYNTHESIS, TRANSPORT, AND REGULATION ELEMENTS AMONG BACTEROIDES SPECIES BY ZACHARY ANDREW COSTLIOW DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Microbiology in the Graduate College of the University of Illinois at Urbana-Champaign, 2018 Urbana, Illinois Doctoral Committee: Assistant Professor Patrick H. Degnan, Chair Associate Professor Carin K. Vanderpool, Co-Chair Professor Gary J. Olsen Professor James A. Imlay ABSTRACT Thiamine (vitamin B1) is an essential cofactor for all organisms. Humans primarily acquire thiamine through their diet and thiamine deficiencies have adverse neurological effects. However, the role gut microbes play in modulating thiamine availability is poorly understood. In addition, little is known about how thiamine, the Bacteroidetes ability to biosynthesize and transport thiamine, or the regulation of biosynthesis and transport impacts the stability of microbial gut communities and human health as a whole. To investigate the role thiamine plays in the gut we leveraged in silico analyses of gut microbial species to determine prominent strategies utilized to attain thiamine. In addition, we have identified the genetic content and operon structure of thiamine transport and biosynthesis across the prominent gut phylum, Bacteroidetes. Along with the bioinformatic methods, RNAseq revealed differential responses to exogenous thiamine by three abundant Bacteroides species. This is highlighted by the global down- regulation of thiamine and amino acid biosynthesis, central, and purine metabolism when thiamine was present in Bacteroides thetaiotaomicron. In contrast Bacteroides uniformis and vulgatus show a much more reserved transcriptomic response to exogenous thiamine. In order to build upon these data, we leveraged genetic mutants of thiamine biosynthesis and transport loci in B. thetaiotaomicron. These analyses determined both systems were critical for growth in thiamine-deficient medium. The defect in the double transport mutant suggests an uncharacterized feedback mechanism between thiamine transport and biosynthesis in B. thetaiotaomicron. Along with the phenotypic analysis of ii thiamine acquisition operons in B. thetaiotaomicron we investigated how these deletions impacted its fitness in thiamine deplete and replete conditions. Building on the phenotypic analysis in B. thetaiotaomicron we turned our attention to the conserved regulatory TPP riboswitches preceding thiamine biosynthesis and transport genes in B. thetaiotaomicron, B. uniformis, and B. vulgatus utilizing transcriptional and translational reporter assays. These assays have shown a clear regulatory hierarchy between thiamine biosynthesis and transport pathways. In addition, trends in TPP riboswitch distance from their predicted regulon points to the mechanism of regulation (transcriptional or translational) and warrants further investigation. Together, these data show that thiamine acquisition mechanisms and their regulation are critical to physiology and fitness among the Bacteroidetes. In addition future work may provide insight into modeling how other gut microbes respond to the shifting availability of thiamine in the gut and how to therapeutically alter the gut microbiota from a dysbiotic state to a non-disease state. iii ACKNOWLEDGMENTS I would like to thank my advisors Dr. Patrick Degnan and Dr. Cari Vanderpool for instructing me in the matter microbial and providing the opportunity for me to work in their laboratories over the course of my Ph.D. at the University of Illinois in Urbana- Champaign. Patrick has been a driving force in developing my understanding of the gut microbiome and the development of my science communication skills and data presentation. I also owe Cari many thanks for fostering an interest in Microbiology and for encouraging me to pursue my doctorate, without her and the amazing community she has created in her laboratory I would not have made it this far. Both of my mentors have been crucial to my growth as a scientist and have encouraged me to pursue my dreams in the future. In addition to my advisors, I have to thank my committee members present and former, Dr. Gary Olsen, Dr. James Imlay, and Dr. Jeffrey Gardner, for the critical advice over the course of the year that helped shape my thesis over my time here at the University of Illinois. I am deeply thankful for all the members of the Degnan and Vanderpool laboratories for dealing with my daily shenanigans and being incredible people to talk about a wide variety of topics in the realms of life and science. In addition they provided a supportive and collaborative environment that enriched my time as a graduate student. Finally I would not have been able to attain my Ph.D. without the unconditional support and love of my parents, sister, extended family, and friends. They have all been incredible and have enriched the many years I have spent at the University of Illinois with joy, happiness, and many memories that I will cherish for the rest of my life. iv TABLE OF CONTENTS CHAPTER 1: INTRODUCTION ........................................................................................1 Thiamine and the microbiome: a crossroads of human health and disease .............1 The role of thiamine .................................................................................................3 Thiamine acquisition and biosynthesis ....................................................................7 The microbiome .....................................................................................................14 Thiamine, the microbiome, and disease .................................................................15 Conclusion .............................................................................................................20 Figures....................................................................................................................21 References ..............................................................................................................26 CHAPTER 2: THIAMINE ACQUISITION STRATEGIES IMPACT METABOLISM AND COMPETITION IN THE GUT MICROBE BACTEROIDES THETAIOTAOMICRON .........................................................................39 Abstract ..................................................................................................................39 Importance .............................................................................................................40 Introduction ............................................................................................................40 Results ....................................................................................................................43 Discussion ..............................................................................................................56 Methods..................................................................................................................60 Acknowledgments ..................................................................................................67 Figures....................................................................................................................68 Tables .....................................................................................................................84 References ..............................................................................................................97 v CHAPTER 3: TRANSCRIPTIONAL AND TRANSLATIONAL ACTING TPP RIBOSWITCHES IDENTIFIED AMONG BACTEROIDES SPECIES .........................101 Abstract ................................................................................................................101 Importance ...........................................................................................................102 Introduction ..........................................................................................................103 Results ..................................................................................................................106 Discussion ............................................................................................................114 Methods................................................................................................................119 Acknowledgements ..............................................................................................123 Figures..................................................................................................................125 Tables ...................................................................................................................133 References ............................................................................................................138 CHAPTER 4: SUMMARY AND FUTURE DIRECTIONS ..........................................143 Summary ..............................................................................................................143 Future Directions .................................................................................................146 References ............................................................................................................152 vi CHAPTER 1: INTRODUCTION Thiamine and the microbiome: a crossroads of human health and disease: Before scientists had shifted their attention to the microbiome in
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Uncovering the Trimethylamine-Producing Bacteria of the Human Gut Microbiota Silke Rath1, Benjamin Heidrich1,2, Dietmar H
    Rath et al. Microbiome (2017) 5:54 DOI 10.1186/s40168-017-0271-9 RESEARCH Open Access Uncovering the trimethylamine-producing bacteria of the human gut microbiota Silke Rath1, Benjamin Heidrich1,2, Dietmar H. Pieper1 and Marius Vital1* Abstract Background: Trimethylamine (TMA), produced by the gut microbiota from dietary quaternary amines (mainly choline and carnitine), is associated with atherosclerosis and severe cardiovascular disease. Currently, little information on the composition of TMA producers in the gut is available due to their low abundance and the requirement of specific functional-based detection methods as many taxa show disparate abilities to produce that compound. Results: In order to examine the TMA-forming potential of microbial communities, we established databases for the key genes of the main TMA-synthesis pathways, encoding choline TMA-lyase (cutC) and carnitine oxygenase (cntA), using a multi-level screening approach on 67,134 genomes revealing 1107 and 6738 candidates to exhibit cutC and cntA, respectively. Gene-targeted assays enumerating the TMA-producing community by quantitative PCR and characterizing its composition via Illumina sequencing were developed and applied on human fecal samples (n =50) where all samples contained potential TMA producers (cutC was detected in all individuals, whereas only 26% harbored cntA) constituting, however, only a minor part of the total community (below 1% in most samples). Obtained cutC amplicons were associated with various taxa, in particular with Clostridium XIVa strains and Eubacterium sp. strain AB3007, though a bulk of sequences displayed low nucleotide identities to references (average 86% ± 7%) indicating that key human TMA producers are yet to be isolated.
    [Show full text]
  • Progressive Increase in Mtdna 3243A>G Heteroplasmy Causes Abrupt
    Progressive increase in mtDNA 3243A>G PNAS PLUS heteroplasmy causes abrupt transcriptional reprogramming Martin Picarda, Jiangwen Zhangb, Saege Hancockc, Olga Derbenevaa, Ryan Golhard, Pawel Golike, Sean O’Hearnf, Shawn Levyg, Prasanth Potluria, Maria Lvovaa, Antonio Davilaa, Chun Shi Lina, Juan Carlos Perinh, Eric F. Rappaporth, Hakon Hakonarsonc, Ian A. Trouncei, Vincent Procaccioj, and Douglas C. Wallacea,1 aCenter for Mitochondrial and Epigenomic Medicine, Children’s Hospital of Philadelphia and the Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; bSchool of Biological Sciences, The University of Hong Kong, Hong Kong, People’s Republic of China; cTrovagene, San Diego, CA 92130; dCenter for Applied Genomics, Division of Genetics, Department of Pediatrics, and hNucleic Acid/Protein Research Core Facility, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; eInstitute of Genetics and Biotechnology, Warsaw University, 00-927, Warsaw, Poland; fMorton Mower Central Research Laboratory, Sinai Hospital of Baltimore, Baltimore, MD 21215; gGenomics Sevices Laboratory, HudsonAlpha Institute for Biotechnology, Huntsville, AL 35806; iCentre for Eye Research Australia, Royal Victorian Eye and Ear Hospital, East Melbourne, VIC 3002, Australia; and jDepartment of Biochemistry and Genetics, National Center for Neurodegenerative and Mitochondrial Diseases, Centre Hospitalier Universitaire d’Angers, 49933 Angers, France Contributed by Douglas C. Wallace, August 1, 2014 (sent for review May
    [Show full text]
  • Supplementary Information
    doi: 10.1038/nature06269 SUPPLEMENTARY INFORMATION METAGENOMIC AND FUNCTIONAL ANALYSIS OF HINDGUT MICROBIOTA OF A WOOD FEEDING HIGHER TERMITE TABLE OF CONTENTS MATERIALS AND METHODS 2 • Glycoside hydrolase catalytic domains and carbohydrate binding modules used in searches that are not represented by Pfam HMMs 5 SUPPLEMENTARY TABLES • Table S1. Non-parametric diversity estimators 8 • Table S2. Estimates of gross community structure based on sequence composition binning, and conserved single copy gene phylogenies 8 • Table S3. Summary of numbers glycosyl hydrolases (GHs) and carbon-binding modules (CBMs) discovered in the P3 luminal microbiota 9 • Table S4. Summary of glycosyl hydrolases, their binning information, and activity screening results 13 • Table S5. Comparison of abundance of glycosyl hydrolases in different single organism genomes and metagenome datasets 17 • Table S6. Comparison of abundance of glycosyl hydrolases in different single organism genomes (continued) 20 • Table S7. Phylogenetic characterization of the termite gut metagenome sequence dataset, based on compositional phylogenetic analysis 23 • Table S8. Counts of genes classified to COGs corresponding to different hydrogenase families 24 • Table S9. Fe-only hydrogenases (COG4624, large subunit, C-terminal domain) identified in the P3 luminal microbiota. 25 • Table S10. Gene clusters overrepresented in termite P3 luminal microbiota versus soil, ocean and human gut metagenome datasets. 29 • Table S11. Operational taxonomic unit (OTU) representatives of 16S rRNA sequences obtained from the P3 luminal fluid of Nasutitermes spp. 30 SUPPLEMENTARY FIGURES • Fig. S1. Phylogenetic identification of termite host species 38 • Fig. S2. Accumulation curves of 16S rRNA genes obtained from the P3 luminal microbiota 39 • Fig. S3. Phylogenetic diversity of P3 luminal microbiota within the phylum Spirocheates 40 • Fig.
    [Show full text]
  • Review Article Yersinia Enterocolitica: Mode of Transmission, Molecular Insights of Virulence, and Pathogenesis of Infection
    SAGE-Hindawi Access to Research Journal of Pathogens Volume 2011, Article ID 429069, 10 pages doi:10.4061/2011/429069 Review Article Yersinia enterocolitica: Mode of Transmission, Molecular Insights of Virulence, and Pathogenesis of Infection Yeasmin Sabina,1 Atiqur Rahman,2 Ramesh Chandra Ray,3 and Didier Montet4 1 Department of Genetic Engineering and Biotechnology, University of Dhaka, Dhaka 1000, Bangladesh 2 Department of Microbiology, University of Dhaka, Dhaka 1000, Bangladesh 3 Central Tuber Crops Research Institute, Bhubaneswar, India 4 Centre International de Recherche en Agronomie pour le Developpement (CIRAD), Montpellier, France Correspondence should be addressed to Yeasmin Sabina, y [email protected] Received 19 April 2011; Revised 28 May 2011; Accepted 5 June 2011 Academic Editor: Latiful Bari Copyright © 2011 Yeasmin Sabina et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Although Yersinia enterocolitica is usually transmitted through contaminated food and untreated water, occasional transmission such as human-to-human, animal-to-human and blood transfusion associated transmission have also identified in human disease. Of the six Y. enterocolitica biotypes, the virulence of the pathogenic biotypes, namely, 1B and 2–5 is attributed to the presence of a highly conserved 70-kb virulence plasmid, termed pYV/pCD and certain chromosomal genes. Some biotype 1A strains, despite lacking virulence plasmid (pYV) and traditional chromosomal virulence genes, are isolated frequently from humans with gastrointestinal diseases similar to that produced by isolates belonging known pathogenic biotypes. Y. enterocolitica pathogenic biotypes have evolved two major properties: the ability to penetrate the intestinal wall, which is thought to be controlled by plasmid genes, and the production of heat-stable enterotoxin, which is controlled by chromosomal genes.
    [Show full text]
  • WO 2018/064165 A2 (.Pdf)
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/064165 A2 05 April 2018 (05.04.2018) W !P O PCT (51) International Patent Classification: Published: A61K 35/74 (20 15.0 1) C12N 1/21 (2006 .01) — without international search report and to be republished (21) International Application Number: upon receipt of that report (Rule 48.2(g)) PCT/US2017/053717 — with sequence listing part of description (Rule 5.2(a)) (22) International Filing Date: 27 September 2017 (27.09.2017) (25) Filing Language: English (26) Publication Langi English (30) Priority Data: 62/400,372 27 September 2016 (27.09.2016) US 62/508,885 19 May 2017 (19.05.2017) US 62/557,566 12 September 2017 (12.09.2017) US (71) Applicant: BOARD OF REGENTS, THE UNIVERSI¬ TY OF TEXAS SYSTEM [US/US]; 210 West 7th St., Austin, TX 78701 (US). (72) Inventors: WARGO, Jennifer; 1814 Bissonnet St., Hous ton, TX 77005 (US). GOPALAKRISHNAN, Vanch- eswaran; 7900 Cambridge, Apt. 10-lb, Houston, TX 77054 (US). (74) Agent: BYRD, Marshall, P.; Parker Highlander PLLC, 1120 S. Capital Of Texas Highway, Bldg. One, Suite 200, Austin, TX 78746 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Lascolabacillus Massiliensis'': a New Species Isolated
    NEW MICROBES IN HUMANS “Lascolabacillus massiliensis”: a new consent, and the agreement of the National Ethics Committee of Senegal and the local ethics committee of the IFR48 species isolated from the human gut (Marseille, France) were obtained under numbers 11-017 and 09-022, respectively. The initial growth was obtained after 10 days of culture in a 5% sheep blood-enriched sheep rumen M. Beye, S. Bakour, S. I. Traore, D. Raoult and P.-E. Fournier medium in aerobic atmosphere at 37°C. The bacterium was Unité de Recherche en Maladies Infectieuses et Tropicales Emergentes, sub-cultured on 5% sheep blood-enriched Columbia agar Institut Hospitalo-Universitaire Méditerranée-Infection, Aix-Marseille (bioMérieux, Marcy l’Etoile, France) and grew in 24 hours at Université, Faculté de Médecine, Marseille cedex 5, France 37°C in both aerobic and anaerobic conditions. Agar-grown colonies were pale grey and 1.5 mm in diameter. Bacterial cells were Gram-negative, rod-shaped and polymorphic, ranginginlengthfrom1.5to10μm. Strain SIT8 was catalase- Abstract and oxidase-negative. The 16S rRNA gene was sequenced using the fD1-rP2 primers as previously described, using a 3130-XL sequencer (Applied Biosciences, Saint Aubin, We report here the main characteristics of “Lascolabacillus France). Strain SIT8 exhibited a 94.14% sequence identity with massiliensis” strain SIT8 (CSUR P1560) that was isolated from the Proteiniphilum acetatigenes strain TB107 (GenBank accession stool of a healthy 28-month-old boy. NR_043154), the phylogenetically closest species with New Microbes and New Infections © 2016 The Authors. Published standing in nomenclature (Fig. 1), which putatively classifies it by Elsevier Ltd on behalf of European Society of Clinical as a member of a new genus within the family Porphyr- Microbiology and Infectious Diseases.
    [Show full text]
  • Branched Chain A-Ketoacid Dehydrogenase to Thiamine and Thiamine Pyrophosphate
    Pediat. Res. 12: 235-238 (1978) Branched chain amino acids thiamine maple syrup urine disease vitamin responsiveness mitochondrial membranes In Vivo and in Vitro Response of Human Branched Chain a-Ketoacid Dehydrogenase to Thiamine and Thiamine Pyrophosphate DEAN J. DANNER,'27' FRANCES B. WHEELER, SANDRA K. LEMMON, AND LOUIS J. ELSAS I1 Department of Pediatrics, Division of Medical Genetics, Emory University School of Medicine, Atlanta, Georgia, USA Summary lability at 37"; and failure to respond to added NAD+, CoASH, and MgZ+. In a homozygous affected patient with maple syrup urine We propose that "excess" thiamine led to increased available disease, pharmacologic doses of thiamine lowered urinary excre- thiamine pyrophosphate which stabilized the branched chain a- tion of branched chain a-ketoacids and stimulated branched ketoacid dehydrogenase, decreased biologic turnover, increased chain a-ketoacid dehydrogenase (BCKAD) in his peripheral enzyme specific activity and produced in vivo tolerance to blood leukocvtes. Suvvlementation of his branched chain ami- branched chain aminoacids in these patients with maple syrup noacid restricted diei hth 100 mglday of thiamine eliminated urine disease. recurrent episodes of ketoacidosis.~heseclinical responses were Speculation studied in vitro using mitochondria1 inner membranes prepared from his cultured skin fibroblasts and those from another By studying the partially purified normal and mutant branched thiamine-responsive patient from Canada. BCKAD in both chain a-ketoacid dehydrogenases from cultured human fibro- mutant cell lines had similarities to normal enzyme including: blasts, direct in vitro effects of thiamine pyrophosphate can be identical apparent K,,, value for thiamine pyrophosphate; similar measured and related to in vivo clinical responses.
    [Show full text]
  • Structural Insights Into the Mechanism of Inhibition of AHAS by Herbicides
    Structural insights into the mechanism of inhibition of PNAS PLUS AHAS by herbicides Thierry Lonhiennea,1,2, Mario D. Garciaa,1, Gregory Pierensb, Mehdi Moblia,b, Amanda Nouwensa, and Luke W. Guddata,2 aSchool of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072, Australia; and bCenter for Advanced Imaging, The University of Queensland, Brisbane, QLD 4072, Australia Edited by María-Jazmin Abraham-Juarez, University of California, Berkeley, CA, and accepted by Editorial Board Member Gregory A. Petsko January 22, 2018 (received for review August 16, 2017) Acetohydroxyacid synthase (AHAS), the first enzyme in the FAD cofactor is required for the enzyme to be active (14). The branched amino acid biosynthesis pathway, is present only in reversible accumulative inhibition described here is not equivalent plants and microorganisms, and it is the target of >50 commercial to the “reversible time-dependent inhibition” described by herbicides. Penoxsulam (PS), which is a highly effective broad- Morrison and Walsh (15). Reversible time-dependent inhibition spectrum AHAS-inhibiting herbicide, is used extensively to control generally describes a process in which the inhibitor–enzyme weed growth in rice crops. However, the molecular basis for its complex requires time to acquire a conformation in which the inhibition of AHAS is poorly understood. This is despite the avail- inhibitor is fully effective. In that mode of inhibition, reversibility ability of structural data for all other classes of AHAS-inhibiting herbicides. Here, crystallographic data for Saccharomyces cerevisiae relates to the binding alone, with the inhibitor being able to AHAS (2.3 Å) and Arabidopsis thaliana AHAS (2.5 Å) in complex dissociate from the complex.
    [Show full text]
  • The Isolation of Novel Lachnospiraceae Strains and the Evaluation of Their Potential Roles in Colonization Resistance Against Clostridium Difficile
    The isolation of novel Lachnospiraceae strains and the evaluation of their potential roles in colonization resistance against Clostridium difficile Diane Yuan Wang Honors Thesis in Biology Department of Ecology and Evolutionary Biology College of Literature, Science, & the Arts University of Michigan, Ann Arbor April 1st, 2014 Sponsor: Vincent B. Young, M.D., Ph.D. Associate Professor of Internal Medicine Associate Professor of Microbiology and Immunology Medical School Co-Sponsor: Aaron A. King, Ph.D. Associate Professor of Ecology & Evolutionary Associate Professor of Mathematics College of Literature, Science, & the Arts Reader: Blaise R. Boles, Ph.D. Assistant Professor of Molecular, Cellular and Developmental Biology College of Literature, Science, & the Arts 1 Table of Contents Abstract 3 Introduction 4 Clostridium difficile 4 Colonization Resistance 5 Lachnospiraceae 6 Objectives 7 Materials & Methods 9 Sample Collection 9 Bacterial Isolation and Selective Growth Conditions 9 Design of Lachnospiraceae 16S rRNA-encoding gene primers 9 DNA extraction and 16S ribosomal rRNA-encoding gene sequencing 10 Phylogenetic analyses 11 Direct inhibition 11 Bile salt hydrolase (BSH) detection 12 PCR assay for bile acid 7α-dehydroxylase detection 12 Tables & Figures Table 1 13 Table 2 15 Table 3 21 Table 4 25 Figure 1 16 Figure 2 19 Figure 3 20 Figure 4 24 Figure 5 26 Results 14 Isolation of novel Lachnospiraceae strains 14 Direct inhibition 17 Bile acid physiology 22 Discussion 27 Acknowledgments 33 References 34 2 Abstract Background: Antibiotic disruption of the gastrointestinal tract’s indigenous microbiota can lead to one of the most common nosocomial infections, Clostridium difficile, which has an annual cost exceeding $4.8 billion dollars.
    [Show full text]
  • Targeting the Gut Microbiome in Allogeneic Hematopoietic Stem Cell Transplantation
    medRxiv preprint doi: https://doi.org/10.1101/2020.04.08.20058198; this version posted June 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Targeting the gut microbiome in allogeneic hematopoietic stem cell transplantation Marcel A. de Leeuw & Manuel X. Duval, GeneCreek List of Figures Contents 1 GM composition evolution across allo-HSCT . 2 I 2 Baseline GM composition and conditioning level . 3 NTRODUCTION 1 3 Top 10 variable importances estimated by the ran- dom survival forest models .............. 3 MATERIALS & METHODS 2 4 Biological safety level and aGvHD at onset . 3 DATA ANALYSIS .................. 2 5 Relative importance of regressors explaining the RESULTS 2 aGvHD status ...................... 3 OVERALL GM COMPOSITION EVOLUTION ACROSS 6 Co-exclusion by and co-occurrence with QPS species 4 ALLO-HSCT ................. 2 List of Tables CORRELATION BETWEEN CONDITIONING AND THE GM 2 BASELINE GM COMPOSITION AND SURVIVAL . 3 1 Prospective data sets used in the study . 1 AGVHD CASES, CONTROLS AND GM COMPOSITION 3 IMMUNO-MODULATING METABOLITES . 4 IN SILICO SCREENING OF THE ALLO-HSCT GM . 4 DISCUSSION 4 CONCLUSIONS 6 SUMMARY 6 DECLARATIONS 6 BIBLIOGRAPHY 7 NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. Revised manuscript medRxiv preprint doi: https://doi.org/10.1101/2020.04.08.20058198; this version posted June 9, 2020.
    [Show full text]
  • An Escherichiacoli Mutant Deficient in Pyruvate Oxidase Activity Due To
    Proc. Natl. Acad. Sci. USA Vol. 81, pp. 4348-4352, July 1984 Biochemistry An Escherichia coli mutant deficient in pyruvate oxidase activity due to altered phospholipid activation of the enzyme (lipid activation/lipid binding/hydrophobic site/conformational change/proteolytic activation) YING-YING CHANG AND JOHN E. CRONAN, JR. Department of Microbiology, University of Illinois, 131 Burrill Hall, 407 South Goodwin, Urbana, IL 61801 Communicated by Ralph S. Wolfe, April 4, 1984 ABSTRACT The pyruvate oxidase (pyruvate:ferricyto- lipid activation of an enzyme occurs in vivo and is physiolog- chrome b, oxidoreductase, EC 1.2.2.2) of Escherichia coli is ically significant. markedly activated by phospholipids in vitro. To test the phys- iological relevance of this activation, we isolated an E. coil mu- MATERIALS AND METHODS tant producing an oxidase that is deficient in activation by (and binding to) phospholipids. The mutant oxidase could be Bacterial Strains, Media, and Extract Preparation. Strains fully activated by a specific proteolytic cleavage, indicating CY265 (pox') and YYC124 (poxB3) are isogenic derivatives that the catalytic site is normal. The mutant enzyme functions (4) of E. coli K-12 that carry a deletion of the aceEF (pyru- poorly in vivo, indicating that activation of the oxidase by vate dehydrogenase) genes. Strain YYC124 is a pyruvate ox- phospholipids plays an important physiological role. idase mutant derived from strain CY265 (4). The strains were grown in broth containing 10 mM sodium acetate at 330C, Enzyme activation by membrane phospholipids in vitro has and cell extracts were prepared as described (3, 4). In some often been observed (1, 2) and is generally ascribed a physio- cases, the cell-free extract was heated to 600C for 5 min and logical role.
    [Show full text]