Clostridium Hathewayi Strain from a Continuous-ﬂow Exclusion Chemostat Culture Derived from the Cecal Contents of a Feral Pig

ARTICLE IN PRESS

Anaerobe 13 (2007) 153–160 www.elsevier.com/locate/anaerobe Veterinary anaerobes and diseases Characterization of an antibiotic resistant Clostridium hathewayi strain from a continuous-ﬂow exclusion chemostat culture derived from the cecal contents of a feral pig

N. Ramlachana, R.C. Andersona,Ã, K. Andrewsa, G. Labanb,c, D.J. Nisbeta aUnited States Department of Agriculture, Agricultural Research Service, Southern Plains Agricultural Research Center, Food & Feed Safety Research Unit, 2881 F&B Road, College Station, TX 77845, USA bDepartment of Forestry and Natural Resources, Pfender Hall, 715 W State Street Purdue University, West Lafayette, IN, USA cCenter for the Environment, 503 Northwestern Avenue, Purdue University, West Lafayette, IN 47907, USA

Received 8 March 2007; accepted 14 March 2007 Available online 23 March 2007

Abstract

The chemostat model has been an important tool in studying intestinal microflora. To date, several competitive exclusion products have been developed from such studies as prophylactic treatment against pathogenic bacteria. A continuous-flow chemostat model of a feral pig was developed using inocula from the cecal contents of a wild boar caught in East Texas. Several strains of antibiotic-sensitive bacteria were isolated including Bacteroides, Lactobacillus, Enterococcus and Clostridium sp. This study reports on the characterization of a multidrug-resistant Clostridum hathewayi strain that was isolated from this feral pig’s cecal contents maintained in a continuous-flow chemostat system showing high resistance to carbapenems and macrolides (including the growth promoter tylosin). Clostridium hathewayi has been documented to be pathogenic to both humans and animals. Feral pigs may be an important source of pathogenic and antibiotic resistant bacteria and may pose potential risk to domestic species. Further work is needed to elucidate the prevalence of these reservoirs and assess the contribution these may play in the spread of disease and resistance. Published by Elsevier Ltd.

Keywords: Clostridium hathewayi; Antibiotic resistance; Feral pig; Chemostat

1. Introduction the basis of 16S rRNA sequencing isolated from the human gastrointestinal tract [7]. Clostridium hathewayi has also Clostridium sp. are anaerobic, Gram-positive bacilli that been identiﬁed as the cause of various infections in fatal are common causes of enteritis and enterotoxemias in both clinical cases, including sepsis [8–11]. domestic animals and humans [1]. Outbreaks of multidrug- Ampicillin, metronidazole, tetracycline, erythromycin, resistant Clostridium spp. have caused serious illness and and tylosin appear to be effective antibiotics for the even death in both humans and livestock animals world- treatment of Clostridium spp. -associated diarrhea in wide with Clostridium spp. accounting for about 1% of all domestic animals [1]. Tylosin is also a macrolide antibiotic signiﬁcant blood culture isolates in bacteremia cases [2–5]. used as a growth promoter to prevent infections in young Many Clostridium species are pathogenic for humans and pigs [12]. Studies have shown transfer of macrolide animals, resulting in diseases such as tetanus, botulism, gas resistance elements occurring between several species of gangrene and pseudomembranous colitis due to the bacteria including Bacteroides, Enterococci, Lactobacilli production of potent extracellular toxins [6]. Clostridium and Clostridium in humans and animals [13–25]. Antibiotic hathewayi has recently been described as novel species on sensitivity to several feed-based antimicrobials, such as tylosin is of concern, as it has been proposed that the use of ÃCorresponding author. Tel.: +1 979 260 9317; fax: +1 979 260 9332. antibiotics for therapeutic and growth promotion in E-mail address: [email protected] (R.C. Anderson). livestock could lead to increasing resistance in bacteria of

1075-9964/$ - see front matter Published by Elsevier Ltd. doi:10.1016/j.anaerobe.2007.03.003 ARTICLE IN PRESS 154 N. Ramlachan et al. / Anaerobe 13 (2007) 153–160 human and animal origin to these drugs [26]. Competitive cultures achieved steady-state at a slightly lower pH exclusion (CE) cultures have been shown to inhibit the (between pH 5.7 and 6.0), than that of the RPCF which growth of pathogenic bacteria in chickens and swine stabilized between pH 5.9 and 6.1. [27–32]. Continuous-flow cultures have also been very useful as in vitro models of the ecology of intestinal flora 2.3. Bacterial isolation and biochemical characterization [33,34]. A recombined, porcine-derived, continuous-flow (RPCF) culture derived from a domestic pig has been After steady state conditions were achieved (approxi- shown to inhibit growth of pathogenic Salmonella enterica mately 7 550 ml culture turnovers), 1 ml samples were serovars Typhimuirum, Choleraesius and Escherichia coli taken from the chemostats. Detection of anaerobic bacteria strains in vitro [35]. was performed in a Bactron IV Anaerobic/Environmental Limited information is available on the presence of Chamber (5% Co2,5%H2, 90% N2) (Sheldon Manufac- antibiotic resistant strains of bacteria in wild/feral pigs. turing Inc., Cornelius, OR) by serial dilution and plating There is a concern that transfer of multidrug-resistant onto Anaerobic Brucella Blood Agar (BRU) (Anaerobe genetic elements in bacteria occurs readily between the Systems, Morgan Hill, CA) and Bacteroides Bile Esculin environment, domestic animals and humans [36–43]. The Agar (BBE) (Anaerobe Systems, Morgan Hill, CA) for possibility that feral pigs may be an additional pool for detection of Bacteroides. Serial dilutions of feral pig culture antibiotic-resistant bacteria exists, since these are a source were plated onto CHROMagarTM E. coli (CHROMagar, for direct transmission of bacterial infections [44,45]. Paris, France) for detection of E. coli, brilliant green agar Evidence of antibiotic resistance has been seen in organi- (Oxoid, Hampshire, England) for detection of Salmonella, cally raised, feral swine or swine without exposure to Modified Charcoal Cefoperazone Deoxycholate Agar antibiotics in feed [36,46–48]. Recent studies show slow (mCCDA) (Oxoid, Hampshire, England) for detection of dissipation of antibiotics in soil and presence of antibiotic- Campylobacter and M Enterococcus agar (Becton Dick- resistant strains in the environment which may also inson and Company, Sparks, MD) for detection of increase exposure to domestic and feral animals Enteroccoci. Specific identification of select colonies of [43,49–51]. In our attempts to comparatively study transfer bacteria was performed according to manufacturer’s of antibiotic resistance in chemostat cultures derived from instructions using rapid ID 32 STREP, rapid 20E, 20NE, cecal contents from domestic and feral pigs, we isolated 20A, and rapid ID 32 A identification strips (bioMe´rieux, multidrug-resistant anaerobic bacteria from the gut con- Hazelwood, MO). Indole spot tests (Anaerobe Systems, tents of a feral pig. This study describes establishment of a Morgan Hill, CA), EtestsTM (AB Biodisk, Piscataway, NJ) continuous-flow culture derived from a feral pig obtained and gas chromatography were also used in this analysis. in rural East Texas and characterizes an endogenous Detection of b-lactamase production was performed using antibiotic resistant strain of C. hathewayi. BD BBL DrySlideTM NitrocefinTM (Becton Dickinson and Company, Sparks, MD) as per manufacturer’s directions. 2. Materials and methods 2.4. Antibiotic susceptibility testing 2.1. Inoculum The antimicrobial susceptibility profiles of the aerobic Inoculum was obtained from cecal contents harvested at isolates were determined by the broth microdilution method slaughter from an adolescent feral boar, approximately 6–9 with cation-adjusted Mueller–Hinton broth (BD Diagnostic months of age and weighing 80 kg. Because slaughter Systems [BDDS], Sparks, MD, USA), as described in the occurred in the evening (20:00 h), freshly collected cecal National Committee for Clinical Laboratory Standards contents were placed into 160 ml serum vials containing (NCCLS, Wayne, PA, USA) (now known as the Clinical approximately 32 ml anaerobic glycerol until completely and Laboratory Standards Institute [CLSI]) publication full and then immediately sealed and frozen within 1 h of M7-A6 [53]. Tests were interpreted at 18–24 h. The Etestss collection at 80 1C until inoculation into the chemostat. (AB Biodisk, Piscataway, NJ) were performed as described by the manufacturer with BRU; Etestss were interpreted at 2.2. Chemostat culture 24–48 h. Sensititre microdilution plates (Trek Diagnostics System, UK) were used according to CLSI guidelines to The continuous-flow feral pig culture was developed determine minimum inhibitory concentrations (MIC) using published protocols for establishment of the pre- of the following antibiotics at NCCLS breakpoints [54]: viously developed redefined porcine continuous-flow ampicillin, ceftiofur, chlortetracycline, clindamycin, dano- (RPCF) culture [29,30,35,52]. Cultures were maintained floxacin, enrofloxacin, erythromycin, florfenicol, gentamicin, in 550 ml of Viande–Levure medium as previously de- neomycin, oxytetracycline, penicillin, spectinomycin, sulpha- scribed [29] and continuously stirred at 100 rpm, at a flow choloropyridazine, sulphadimethoxime, sulphathiazole, tia- rate of 0.8 ml/min and a vessel turnover time of 24 h. Feral mulin, tilmicosin, trimethoprim/ sulphamethoxazole. The pig chemostat cultures were sparged with oxygen-free CO2 MIC breakpoint used to define resistance to tylosin was at 39 1C as with the RPCF cultures. The pH of the feral pig 430 mg/ml [55]. ARTICLE IN PRESS N. Ramlachan et al. / Anaerobe 13 (2007) 153–160 155

2.5. PCR provider’s guidelines (MidiLabs, Newark, DE). Approxi- mately 1400 bp of sequence obtained from the C. hathewayi Bacteria were lysed with equal volume of 0.2% (w/v) of (Accession no. EF408203) isolate was used in BLAST [57] Triton X-100 and heated to boiling at 100 1C for 5 min in analysis using GenBank to analyze bacterial database sequence water bath, then allowed to cool and used as templates for comparison. The 16 s RNA sequence from our new specimen PCR. Specific primers were used for amplifications as (EF408243) and those obtained from GenBank for 19 other previously published for the following genes: Flost, spvC, Clostridium isolates previously published (AF028350.1, invA, int, sipB/C, PSE-1, cm1A/tetR, erm A, erm B, erm C, AF028352.1, X73450.1, M60491.1, NC008261, AB020191.1, erm F and erm Q (see Table 1). DNA amplification was EF197795.1, EF140981.1, EF051574.1, DQ071267.1, carried out on a MJ thermocycler Model PTC200 (Fisher M59109.1, AY552788.2, AJ311620.2, X71848.1, AB075772.1, Scientific, Hampton, NH) using the following conditions: AJ508452.1, M59089.1 and AY169422.1) and a S. Cholar- 5 min at 94 1C; 35 cycles of 94 1C for 1 min, 55 1C for 1 min aesuis (DQ344535.1). Multiple sequence alignment using and 72 1C for 2 min. A multiplex for detection of genes ClustalW [58] was performed and phylogenetic analyses determining streptogramin resistance as previously pub- performed using PAUP* v4.0b10 [59]. lished [56] using the following PCR conditions: 10 min A rooted neighbor-joining tree was produced using 94 1C, 35 cycles of 30 s at 95 1C, 30 s at 50 1C and 30 s at S. Cholaraesuis as an outgroup and bootstrap values (1000 72 1C followed by 10 min at 72 1C. All PCR products were iterations) are shown for each branch (Fig. 1). analyzed by gel electrophoresis (1% agarose in 1 TAE buffer), stained with ethidium bromide and visualized by 3. Results and discussion UV light. Sizes of products were determined by comparing them with 100 bp ladder (New England Biolabs, #N3271S). The feral culture parent contained at least the following species: Enterococcus hirae, Bacteroides uniformis, Strepto- 2.6. 16S rRNA gene sequencing and phylogenetic coccus bovis, Proteus mirabilis, Staphylococcus epidermidis, confirmation Alcaligenes denitrificans, E. coli and C. hathewayi. When tested for antibiotic susceptibility, none of these species PCR amplification followed by full-length direct sequen- showed tylosin resistance except the only isolated C. cing was performed using proprietary universal primers hathewayi strain, which was resistant at a concentration derived to 16S rRNA Enterobacter sp. according to service of 512 mg/ml. When EtestsTM were used the C. hathewayi

Table 1 Oligonucleotide primers used in PCR ampliﬁcation of Clostridium hathewayi isolate

Gene Primer sequence (50–30) Visible PCR Product Y/N Accession number Reference

ﬂost F: ACCCGCCCTCTGGATCAAGTCAAG No AF097407 [80] R: CAAATCACGGGCCACGCTGTATC spvC F: GGGGCGGAAATACCATCTACA No M64295 [80] R: GCGCCCAGGCTAACACG invA F: CGCGGCCCGATTTCTCTGGA No M90846 [80] R: AATGCGGGATCTGGGCGACAAG int F: GCCCTCCCGCACGATGAT No AF071555 [80] R: ATTGGCGGCCTTGCTGTTCTTCTA erm B F: TAACGACGAACCTGGCTAAAAT No AJ243541 [81] R: ATCTGTGGTATGGCGGGTAAG erm C F: AGTACAGAGGTGTAATTTCG No NC001386 [81] R: AATTCCTGCATGTTTTAAGG erm F F: GCCAACAATGTTGTTGTT Yes N/A [63] R: CGAAATTGTCCTGACCTG erm Q F: CACCAACTGATATGTGGC No N/A [63] R: CAATCTACACTAGGCATG cmlA/tetR F: CGCTCCTTCGATCCCGT Yes N/A [82] R: GCTGCGTTCATCTACAACAGAT PSE-1 F: TTTGGTTCCGCGCTATCTG Yes M69058 [82] R: TACTCCGAGCACCAAATCCG vatA F: ATAATGAATGGAGCAAACCATAGGATG Yes N/A [56] R: ACCAATCCAAACATCATTACC ARTICLE IN PRESS 156 N. Ramlachan et al. / Anaerobe 13 (2007) 153–160

C. perfringens NC008261 78

C. beijerinckii AB020191.1

100 C. pasteurianum EF140981.1 81

C. botulinum EF051574.1 100

C. sporogenes DQ071267.1

C. tepidiprofundum EF197795.1 98

C. purinolyticum M60491.1

C. difficile X73450.1

C. hathewayi AY552788.2 100 C. hathewayi AJ311620.2

74 88 97 C. hathewayi EF408243 *

C. celerecrescens X71848.1 100

96 C. sphenoides AB075772.1

C. boltei AJ508452.1 100

100 C. clostridiiformes M59089.1

C .clostridioforme AY169422.1

C. oroticum M59109.1

C. cocleatum AF028350.1 100

C. innocuum AF028352.1

S. Choleraesuis DQ344535.1 0.01 substitutions/site

Fig. 1. Neighbor joining tree illustrating C. hathewayi phylogeny. Phylogenetic relationships illustrated by an unrooted neighbor-joining tree analysis based on 16S rRNA sequences showing positions of the Clostridium hathewayi isolate (EF408203) (shown with *) from the feral pig culture and its grouping most closely with the two other C. hathewayi (bootstrap value 100) compared to the other Clostridium spp. The tree was constructed using neighbor joining based method on a comparison of approximately 1400 nucleotides on 19 Clostridium spp. sequences and one Salmonella Choleraesius 16S rRNA sequence used as an outgroup. Bootstrap values are annotated at the branch nodes and shown if greater than 60%. also showed resistance to erythromycin (4256 mg/ml), nem (432 mg/ml). The C. hathewayi strain was also chloramphenicol (64 mg/ml), ciprofloxacin (432 mg/ul), positive for b-lactamase production using the nitrocefin azithromycin (4256 mg/ml), ceftriaxone (432 mg/ul), cefti- DrySlideTM test (Becton Dickinson and Company, Sparks, zoxine (432 mg/ul), clindamycin (4256 mg/ml) and imipe- MD). There were three other Clostridium spp. isolated ARTICLE IN PRESS N. Ramlachan et al. / Anaerobe 13 (2007) 153–160 157 from the feral pig cecal culture, of which all three showed Table 2 resistance to ceftizoxine (432 mg/ml) and only one had Biochemical analysis results showing phenotypic characteristics of C. additional resistance to ciprofloxacin (432 mg/ml) and hathewayi from previously characterized samples and the feral pig isolate imipenem (32 mg/ml) of all 16 antibiotics tested. Of Phenotypic Clostridium Clostridium Clostridium hathewayi the other bacteria tested, only the Bacteroides spp. characteristic hathewayia hathewayib from feral pig showed resistance to gentamicin (41024 mg/ml), ciprofloxacin (32 mg/ml), ceftriaxone (32 mg/ml) and imipenem Gram stain Acetate fermentation ++ (432 mg/ml). product Similar to certain members of the genus Clostridium Gelatin hydrolysis (e.g., C. clostridioforme and C. ramosum), the C. hathewayi Esculin hydrolysis + + + has a propensity to stain Gram negative [60]. Results Starch hydrolysis + + obtained solely using commercially available, phenotypi- Indole production Nitrate reduction cally based bacterial identification systems were not useful Urea in confirmation of C. hathewayi as our isolate was identified as C. clostridioforme, as reported in another Oxidation/ fermentation of study [8]. Therefore it was necessary to compare the further Arabinose + + + biochemical characteristics and use 16S rRNA sequencing Cellobiose + + + for confirmation. Glucose + + + The isolated Clostridium sp. strain from the feral pig Glycerol cecal contents fermented arabinose, galactose, glucose, Lactose + + + Maltose + + + raffinose, trehalose and xylose. It did not hydrolyze gelatin Mannitol or urea and also did not produce indol or reduce nitrate. Mannose + + + These metabolic characteristics in addition to the profiles Melezitose + + + for other carbohydrate fermentation products and lack of Raffinose + + + amino acid fermentation products were similar to those Salicin + + + Sorbitol + defined for another C. hathewayi strain characterized by Sucrose + + + Steer et al. [60] (GenBank Accession no. AJ311620) and Trehalose + + + Woo et al. [11] for C. hathewayi isolates (Table 2). In Xylose + + + addition, the 16S rRNA sequence from our Clostridium a-Arabinosidase + + isolate (EF408243) was subjected to pair-wise analysis a-Galactosidase + + b-Galactosidase + + closely matching C. hathewayi (AJ311620) with a 98% b-Galactosidase-6- similarity score comparing a total of 1400 nucleotides phosphate and branching most closely with C. hathewayi (AJ311620) a-Glucosidase + + in a rooted neighbor-joining phylogenetic tree (Fig. 1). b-Glucosidase + + The branch dividing the two C. hathewayi (EF408243, b-Glucuronidase + + D-mannose AJ311620) and the only other C. hathewayi 16 s rRNA D-raffinose sequence deposited to date in GenBank AY552788.2) had N-acetyl ++ 100% bootstrap support showing that our sequence most glucosaminidase accurately grouped with the other C. hathewayi than to any Alanine arylamidase other Clostridium spp. Arginine arylamidase Glutamyl glutamic There was evidence by PCR of the presence of a cmlA- acid arylamidase like resistance element similar to the product size of cmlA Glycine arylamidase found in Salmonella DT104, which is known to encode Glycine arylamidase resistance to chloramphenicol [61] at similar levels seen in Histidine arylamidase the feral pig C. hathewayi isolate (64 mg/ml). Early studies Leucine arylamidase Leucyl glycine + showed that almost all Clostrium spp. tested were highly arylamidase susceptible to chloramphenicol [62] which implies a more Phenylalanine recent timeline for acquisition of resistance. No product arylamidase was observed when PCR was performed to investigate Proline arylamidase presence of the int, erm A, erm B or erm C genes or with the Pyroglutamic acid arylamidase Salmonella genes Flost, spvC, invA or sipB/C used as Serine arylamidase negative controls. However, a product of approximately Tyrosine arylamidase 250 bp was produced when the PSE-1 primer set was used a in a PCR amplification which was significantly higher As defined in Steer et al. [60], Accession no. AJ311620. bAs defined by Woo et al. [11]. than the expected product size of 132 bp, indicating the presence of a PSE-1 like element in the C. hathewayi isolate. There have been several erm genes identified that ARTICLE IN PRESS 158 N. Ramlachan et al. / Anaerobe 13 (2007) 153–160 confer resistance to erythromycin/tylosin [19]. An addi- It is possible that other naturally occurring environ- tional PCR performed with erm F primers produced a mental bacteria provide a source of antibiotic resistance product of the expected size (526 bp), which potentially is elements that could be transferred to such animals while the gene conferring resistance to tylosin/erythromycin in foraging. The erm G gene conferring resistance to the C. hathewayi isolate from the feral pig tested in this erythromycin/tylosin was first found in the soil bacterium study. Also, a product of the expected size (144 bp) was Bacillus sphaericus but later seen in Gram-positive bacteria also obtained for a PCR amplifying the vatA gene encoding isolated from the feces of domesticated swine [19]. Thus it acetylation of streptogramins A [63,64]. is possible similar elements are being transferred to Attempts to isolate a plasmid from the C. hathewayi foraging feral pigs in their natural environment. This study isolate were unsuccessful, but this does not eliminate the identifies feral pigs as a potential source for acquisition and possibility of a transposable genetic element containing transfer of antibiotic resistant bacteria and genetic elements multiple resistance determinants being located within the from the environment. Feral pigs may thus be a potential bacterial genome. In fact, the Tn5398 mobilizable non- source of antibiotic resistant strains and may pose potential conjugative element carrying the erm B resistance gene was risk to domestic species or humans as a source of direct or characterized in C. difficile isolates [65]. Previous studies indirect transmission by shedding these strains. Character- show that aerobic, facultative and anaerobic bacterium, ization of the intestinal microflora, antibiotic resistant including C. hathewayi are known to have efflux pumps strains and transfer of resistance found in feral animals will facilitating a high degree of fluoroquinolone resistance allow us to elucidate its prevalence and pathogenicity in [66–74]; the presence of which could explain the high potential sources of resistant pools of bacteria. resistance to ciprofloxacin (432 mg/ml), azithromycin (4256 mg/ml) and ceftriaxone (432 mg/ml) observed in the C. hathewayi from the feral pig. Also, it is possible since Acknowledgments C. hathewayi has been known to be the cause of clinical cases of bacteremia in humans [8,9,11] that it produces The authors would like to thank M. Reiley Street and toxins that may be linked to resistance elements perhaps Jim Snodgrass for technical support, Matthew Quattrini similar to C. difficile and C. perfringens [6,23]. for assistance with anaerobic plating and the National Although anaerobic bacteria resistant to the macrolide Pork Board for funding associated with this research. We antibiotics tylosin, clindamycin and erythromycin have also graciously thank J.C. Patton and B.P. Rinner for been commonly isolated from the feces of domestic swine assistance with PAUP and tree analysis. [75,76], there have been few reports for antibiotic resistant Mandatory disclaimer: Mention of a trade name, bacteria from feces of a feral pig [77]. In addition, it is the proprietary product or specific equipment does not first report of a cm1A-like and PSE-1 like element in constitute a guarantee or warranty by the US Department C. hathewayi isolate derived from the cecal contents of of Agriculture and does not imply its approval to the swine. No other bacteria isolated in the feral pig culture exclusion of other products that may be suitable. showed resistance to either chloramphenicol or tylosin. Interestingly, since this pig was caught in an area of East Texas devoid of intensive livestock operations, acquisition References of genetic elements or the transmission of antibiotic resistance strains due to direct contact with animals being [1] Marks SL, Kather EJ. Antimicrobial susceptibilities of canine Clostridium difficile and Clostridium perfringens isolates to commonly fed macrolide or other antibiotics as growth promoters or utilized antimicrobial drugs. Vet Microbiol 2003;94:39–45. therapeutics is unlikely. However, it remains possible that [2] Gould M. Number of C. difficile cases rises. Br Med J 2006;333:215. exposure to fecal material via irrigation or water supplies [3] Steinman A, Chaffer M, Elad D, Shpigel NY. Quantitative analysis from extensively reared cattle that have been administered of levels of serum immunoglobulin G against Botulinum Neurotoxin antibiotics cannot be eliminated. Also, feral hogs are Type D and association with protection in natural outbreaks of cattle botulism. Clin Vaccine Immunol 2006;13:862–8. occasionally fed domestic pig feed in Texas which may also [4] Climo MW, Israel DS, Wong ES, Williams D, Coudron P, be a source of exposure to growth promoting antibiotics. In Markowitz SM. Hospital-wide restriction of clindamycin: effect on a study comparing organic and feral pigs, baseline the incidence of Clostridium difficile-associated diarrhea and cost. tetracycline resistance in endogenous intestinal bacteria Ann Intern Med 1998;128:989–95. was 1000-fold higher in organic versus feral pigs [78], thus [5] Brett MM, McLauchlin J, Harris A, O’Brien S, Black N, Forsyth RJ, et al. A case of infant botulism with a possible link to infant formula indicating that factors other than consumption of anti- milk powder: evidence for the presence of more than one strain of biotic-supplemented feed are possibly playing a role in such Clostridium botulinum in clinical specimens and food. J Med persistence of antibiotic resistance. Feral hogs also have the Microbiol 2005;54:769–76. potential to be carriers of pathogenic bacterial strains. In a [6] Dupuy B, Matamouros S. Regulation of toxin and bacteriocin recent outbreak of E. coli O157:H7 in spinach in 2006, it synthesis in Clostridium species by a new subgroup of RNA polymerase sigma-factors. Res Microbiol 2006;157:201–5. was thought that the movement of wild pigs between a [7] Steer T, Collins MD, Gibson GR, Hippe H, Lawson PA. Clostridium nearby cattle ranch and the spinach fields could be a hathewayi sp. nov., from human faeces. Syst Appl Microbiol 2001; possible source for the contamination [79]. 24:353–7. ARTICLE IN PRESS N. Ramlachan et al. / Anaerobe 13 (2007) 153–160 159

[8] Linscott AJ, Flamholtz RB, Shukla D, Song Y, Liu C, Finegold SM. [29] Hume ME, Nisbet DJ, Buckley SA, Ziprin RL, Anderson RC, Fatal septicemia due to Clostridium hathewayi and Campylobacter Stanker LH. Inhibition of in vitro Salmonella typhimurium coloniza- hominis. Anaerobe 2005;11:97–8. tion in porcine cecal bacteria continuous-flow competitive exclusion [9] Elsayed S, Zhang K. Human infection caused by Clostridium culturest. J Food Prot 2001;64:17–22. hathewayi. Emerg Infect Dis 2004;10:1950–2. [30] Genovese KJ, Anderson RC, Harvey RB, Nisbet DJ. Competitive [10] Warren YA, Tyrrell KL, Citron DM, Goldstein EJ. Clostridium exclusion treatment reduces the mortality and fecal shedding aldenense sp. nov. and Clostridium citroniae sp. nov. isolated from associated with enterotoxigenic Escherichia coli infection in nursery- human clinical infections. J Clin Microbiol 2006;44:2416–22. raised neonatal pigs. Can J Vet Res 2000;64:204–7. [11] Woo PC, Lau SK, Woo GK, Fung AM, Yiu VP, Yuen KY. [31] Nisbet DJ. Use of competitive exclusion in food animals. J Am Vet Bacteremia due to Clostridium hathewayi in a patient with acute Med Assoc 1998;213:1744–6. appendicitis. J Clin Microbiol 2004;42:5947–9. [32] Hume ME, Hollister AG, Nisbet DJ, Corrier DE, DeLoach JR. [12] Willis RW. Diarrhea in growing-finishing swine. Vet Clin North Am Effect of a characterized continuous-flow culture of cecal bacteria on Food Anim Pract 2000;16:135–61. Salmonella typhimurium crop colonization in broiler chicks. Avian [13] Leener ED, Decostere A, De Graef EM, Moyaert H, Haesebrouck F. Dis 1996;40:391–7. Presence and mechanism of antimicrobial resistance among enter- [33] Jones D, Kojouharov HV, Le D, Smith H. The Freter model: ococci from cats and dogs. Microb Drug Resist 2005;11:395–403. a simple model of biofilm formation. J Math Biol 2003;47: [14] De Leener E, Martel A, Decostere A, Haesebrouck F. Distribution of 137–52. the erm (B) gene, tetracycline resistance genes, and Tn1545-like [34] Freter R, Stauffer E, Cleven D, Holdeman LV, Moore WE. transposons in macrolide- and lincosamide-resistant enterococci from Continuous-flow cultures as in vitro models of the ecology of large pigs and humans. Microb Drug Resist 2004;10:341–5. intestinal flora. Infect Immun 1983;39:666–75. [15] Gevers D, Huys G, Swings J. In vitro conjugal transfer of tetracycline [35] Harvey RB, Droleskey RE, Hume ME, Anderson RC, Genovese KJ, resistance from Lactobacillus isolates to other Gram-positive Andrews K, et al. In vitro inhibition of Salmonella enterica serovars bacteria. FEMS Microbiol Lett 2003;225:125–30. Choleraesuis and Typhimurium, Escherichia coli F-18, and Escher- [16] Kmet V, Javorsky P, Nemcova R, Kopecny J, Boda K. Occurrence of ichia coli O157:H7 by a porcine continuous-flow competitive conjugative amylolytic activity in rumen lactobacilli. Zentralbl exclusion culture. Curr Microbiol 2002;45:226–9. Mikrobiol 1989;144:53–7. [36] Lee C, Langlois BE, Dawson KA. Detection of tetracycline resistance [17] Shoemaker NB, Vlamakis H, Hayes K, Salyers AA. Evidence for determinants in pig isolates from three herds with different histories extensive resistance gene transfer among Bacteroides spp. and among of antimicrobial agent exposure. Appl Environ Microbiol 1993;59: Bacteroides and other genera in the human colon. Appl Environ 1467–72. Microbiol 2001;67:561–8. [37] Rahman H, Chakraborty A, Deka PJ, Narayan G, Prager R. An [18] Launay A, Ballard SA, Johnson PD, Grayson ML, Lambert T. outbreak of Salmonella enteritidis infection in pygmy hogs (Sus Transfer of vancomycin resistance transposon Tn1549 from Clos- salvanius). Trop Anim Health Prod 2001;33:95–102. tridium symbiosum to Enterococcus spp. in the gut of gnotobiotic [38] Kuhn I, Iversen A, Finn M, Greko C, Burman LG, Blanch AR, et al. mice. Antimicrob Agents Chemother 2006;50:1054–62. Occurrence and relatedness of vancomycin-resistant enterococci in [19] Wang Y, Wang GR, Shoemaker NB, Whitehead TR, Salyers AA. animals, humans, and the environment in different European regions. Distribution of the ermG gene among bacterial isolates from porcine Appl Environ Microbiol 2005;71:5383–90. intestinal contents. Appl Environ Microbiol 2005;71:4930–4. [39] Sapkota AR, Ojo KK, Roberts MC, Schwab KJ. Antibiotic [20] Gupta A, Vlamakis H, Shoemaker N, Salyers AA. A new Bacteroides resistance genes in multidrug-resistant Enterococcus spp. and conjugative transposon that carries an ermB gene. Appl Environ Streptococcus spp. recovered from the indoor air of a large-scale Microbiol 2003;69:6455–63. swine-feeding operation. Lett Appl Microbiol 2006;43:534–40. [21] Adams V, Lyras D, Farrow KA, Rood JI. The clostridial mobilisable [40] Aubry-Damon H, Grenet K, Sall-Ndiaye P, Che D, Cordeiro E, transposons. Cell Mol Life Sci 2002;59:2033–43. Bougnoux ME, et al. Antimicrobial resistance in commensal flora of [22] Stinear TP, Olden DC, Johnson PD, Davies JK, Grayson ML. pig farmers. Emerg Infect Dis 2004;10:873–9. Enterococcal vanB resistance locus in anaerobic bacteria in human [41] Petersen A, Andersen JS, Kaewmak T, Somsiri T, Dalsgaard A. faeces. Lancet 2001;357:855–6. Impact of integrated fish farming on antimicrobial resistance in a [23] Mullany P, Wilks M, Tabaqchali S. Transfer of macrolide–lincosa- pond environment. Appl Environ Microbiol 2002;68:6036–42. mide–streptogramin B (MLS) resistance in Clostridium difficile is [42] Chee-Sanford JC, Aminov RI, Krapac IJ, Garrigues-Jeanjean N, linked to a gene homologous with toxin A and is mediated by a Mackie RI. Occurrence and diversity of tetracycline resistance genes conjugative transposon, Tn5398. J Antimicrob Chemother 1995; in lagoons and groundwater underlying two swine production 35:305–15. facilities. Appl Environ Microbiol 2001;67:1494–502. [24] Spigaglia P, Barbanti F, Mastrantonio P. Horizontal transfer of [43] Manero A, Vilanova X, Cerda-Cuellar M, Blanch AR. Vancomycin- erythromycin resistance from Clostridium difficile to Butyrivibrio and erythromycin-resistant enterococci in a pig farm and its fibrisolvens. Antimicrob Agents Chemother 2005;49:5142–5. environment. Environ Microbiol 2006;8:667–74. [25] Jacobsen L, Wilcks A, Hammer K, Huys G, Gevers D, Andersen SR. [44] Robson JM, Harrison MW, Wood RN, Tilse MH, McKay AB, Horizontal transfer of tet(M) and erm(B) resistance plasmids from Brodribb TR. Brucellosis: re-emergence and changing epidemiology food strains of Lactobacillus plantarum to Enterococcus faecalis JH2-2 in Queensland. Med J Aust 1993;159:153–8. in the gastrointestinal tract of gnotobiotic rats. FEMS Microbiol [45] Seymour C, Lewis RG, Kim M, Gagnon DF, Fox JG, Dewhirst FE, Ecol 2007;59:158–66. et al. Isolation of Helicobacter strains from wild bird and swine feces. [26] Butaye P, Devriese LA, Haesebrouck F. Antimicrobial growth Appl Environ Microbiol 1994;60:1025–8. promoters used in animal feed: effects of less well known anti- [46] Stanton TB, Humphrey SB. Tetracycline resistant bacteria in biotics on gram-positive bacteria. Clin Microbiol Rev 2003;16: organically raised and feral swine. In: Abstract of the 104th American 175–88. Society for Microbiology General Meeting, 2004. Z:Z-029. [27] Genovese KJ, Anderson RC, Harvey RB, Callaway TR, Poole TL, [47] Thakur S, Gebreyes WA. Prevalence and antimicrobial resistance of Edrington TS, et al. Competitive exclusion of Salmonella from the gut Campylobacter in antimicrobial-free and conventional pig production of neonatal and weaned pigs. J Food Prot 2003;66:1353–9. systems. J Food Prot 2005;68:2402–10. [28] Nisbet D. Defined competitive exclusion cultures in the prevention of [48] Jackson CR, Fedorka-Cray PJ, Barrett JB, Ladely SR. Effects of enteropathogen colonisation in poultry and swine. Antonie Van tylosin use on erythromycin resistance in enterococci isolated from Leeuwenhoek 2002;81:481–6. swine. Appl Environ Microbiol 2004;70:4205–10. ARTICLE IN PRESS 160 N. Ramlachan et al. / Anaerobe 13 (2007) 153–160

[49] Halling-Sorensen B, Jacobsen AM, Jensen J, Sengelov G, Vaclavik E, [66] Malhotra-Kumar S, Lammens C, Chapelle S, Mallentjer C, Weyler J, Ingerslev F. Dissipation and effects of chlortetracycline and tylosin in Goossens H. Clonal spread of fluoroquinolone non-susceptible two agricultural soils: a field-scale study in southern Denmark. Streptococcus pyogenes. J Antimicrob Chemother 2005;55:320–5. Environ Toxicol Chem 2005;24:802–10. [67] Mamelli L, Prouzet-Mauleon V, Pages JM, Megraud F, Bolla [50] Andersen JT, Schafer T, Jorgensen PL, Moller S. Using inactivated JM. Molecular basis of macrolide resistance in Campylobacter: microbial biomass as fertilizer: the fate of antibiotic resistance genes role of efflux pumps and target mutations. J Antimicrob Chemother in the environment. Res Microbiol 2001;152:823–33. 2005;56:491–7. [51] Kuhn I, Iversen A, Burman LG, Olsson-Liljequist B, Franklin A, [68] Marquez B. Bacterial efflux systems and efflux pumps inhibitors. Finn M, et al. Epidemiology and ecology of enterococci, with special Biochimie 2005;87:1137–47. reference to antibiotic resistant strains, in animals, humans and the [69] Pletz MW, McGee L, Burkhardt O, Lode H, Klugman KP. environment. Example of an ongoing project within the European Ciprofloxacin treatment failure in a patient with resistant Strepto- research programme. Int J Antimicrob Agents 2000;14:337–42. coccus pneumoniae infection following prior ciprofloxacin therapy. [52] Nisbet DJ, Corrier DE, Scanlan CM, Hollister AG, Beier RC, Eur J Clin Microbiol Infect Dis 2005;24:58–60. DeLoach JR. Effect of a defined continuous-flow derived bacterial [70] Randall LP, Eaves DJ, Cooles SW, Ricci V, Buckley A, Woodward culture and dietary lactose on Salmonella typhimurium colonization in MJ, et al. Fluoroquinolone treatment of experimental Salmonella broiler chickens. Avian Dis 1993;37:1017–25. enterica serovar Typhimurium DT104 infections in chickens selects [53] NCCLS. Methods for dilution of microbial susceptibility tests for for both gyrA mutations and changes in efflux pump gene expression. bacteria that grow aerobically. Wayne, PA: National Committee for J Antimicrob Chemother 2005;56:297–306. Clinical Laboratory Standards; 2003. [71] Rolain JM, Raoult D. Genome comparison analysis of molecular [54] NCCLS. Performance Standards for Antimicrobial Susceptibility mechanisms of resistance to antibiotics in the Rickettsia genus. Ann Testing; Twelfth Informational Supplement M100-S12. Wayne, PA: N Y Acad Sci 2005;1063:222–30. NCCLS; 2002. [72] Rafii F, Park M, Wynne R. Evidence for active drug efflux in [55] Kaukas A, Hinton M, Linton AH. The effect of growth-promoting fluoroquinolone resistance in Clostridium hathewayi. Chemotherapy antibiotics on the faecal enterococci of healthy young chickens. 2005;51:256–62. J Appl Bacteriol 1988;64:57–64. [73] Miyamae S, Ueda O, Yoshimura F, Hwang J, Tanaka Y, Nikaido [56] Perrin-Guyomard A, Soumet C, Leclercq R, Doucet-Populaire F, H. A MATE family multidrug efflux transporter pumps out Sanders P. Antibiotic susceptibility of bacteria isolated from fluoroquinolones in Bacteroides thetaiotaomicron. Antimicrob Agents pasteurized milk and characterization of macrolide–lincosamide– Chemother 2001;45:3341–6. streptogramin resistance genes. J Food Prot 2005;68:347–52. [74] Miyamae S, Nikaido H, Tanaka Y, Yoshimura F. Active efflux of [57] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local norfloxacin by Bacteroides fragilis. Antimicrob Agents Chemother alignment search tool. J Mol Biol 1990;215:403–10. 1998;42:2119–21. [58] Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, [75] Cotta MA, Whitehead TR, Zeltwanger RL. Isolation, characteriza- et al. Multiple sequence alignment with the Clustal series of tion and comparison of bacteria from swine faeces and manure programs. Nucl Acids Res 2003;31:3497–500. storage pits. Environ Microbiol 2003;5:737–45. [59] Swofford DL. PAUP*. Phylogenetic analysis using parsimony [76] Whitehead TR, Cotta MA. Sequence analyses of a broad host-range (* and other methods). Version 4.0B10. Sunderland, MA Sinauer plasmid containing ermT from a tylosin-resistant Lactobacillus sp. Associates; 2002. Isolated from swine feces. Curr Microbiol 2001;43:17–20. [60] Steer T, Collins MD, Gibson GR, Hippe H, Lawson PA. Clostridium [77] Stanton TB, Stoffregen WC. Tetracycline resistant bacteria in hathewayi sp. nov., from human faeces. Syst Appl Microbio organically raised and feral swine. In: 104th American Society for 2001;24:353–7. Microbiology General Meeting, 2004. Z:029. [61] Butaye P, Cloeckaert A, Schwarz S. Mobile genes coding for efflux- [78] Stanton TB, Stoffregen, W. Searching for baseline resistance— mediated antimicrobial resistance in Gram-positive and Gram- organic and feral pigs. In: International conference on emerging negative bacteria. Int J Antimicrob Agents 2003;22:205–10. infectious diseases, 2004. p. 53. [62] Dutta GN, Devriese LA, Van Assche PF. Susceptibility of clostridia [79] Schuff S. E. coli sample’s a match. Feedstuffs 2006;78:5. from farm animals to 21 antimicrobial agents including some used for [80] Khan AA, Nawaz MS, Khan SA, Cerniglia CE. Detection of growth promotion. J Antimicrob Chemother 1983;12:347–56. multidrug-resistant Salmonella typhimurium DT104 by multiplex [63] Bendle JS, James PA, Bennett PM, Avison MB, MacGowan AP, polymerase chain reaction. FEMS Microbiol Lett 2000;182:355–60. Al-Shafi KM. Resistance determinants in strains of Clostridium [81] Frye JG, Jesse T, Long F, Rondeau G, Porwollik S, McClelland M, difficile from two geographically distinct populations. Int J Antimicro et al. DNA microarray detection of antimicrobial resistance genes in Agents 2004;24:619–21. diverse bacteria. Int J Antimicrob Agents 2006;27:138–51. [64] Fluit AC, Visser MR, Schmitz FJ. Molecular detection of anti- [82] Yang SJ, Park KY, Kim SH, No KM, Besser TE, Yoo HS, et al. microbial resistance. Clin Microbial Rev 2001;14:836–71. Antimicrobial resistance in Salmonella enterica serovars Enteritidis [65] Farrow KA, Lyras D, Rood JI. Genomic analysis of the erythromy- and Typhimurium isolated from animals in Korea: comparison of cin resistance element Tn5398 from Clostridium difficile. Microbio- phenotypic and genotypic resistance characterization. Vet Microbiol logy 2001;147:2717–28. 2002;86:295–301.