320.2-324 POSTERS Sunday

Kinesin is a motor protein that transports membrane-limited Myocytes were analyzed at a cellular level 4 days post gene organelles along a microtubule toward its plus end using the transfer. Non-transduced DD myocytes demonstrated a delay energy of ATP hydrolysis. In the previous study, to determine (p<0.001) in time to 'h relaxation compared to NL (179.6+5.5 ms, binding mode of kinesin under various nucleotide states, we n=85 vs. 145.1+4.0 ms, n=52; respectively). Myocytes expressing measured the unbinding force of single kinesin molecules attached Parv had a decreased (control vs. Parv, p<0.001; NL vs. DD, to a microtubule using single-headed heterodimer in addition to p>0.05) time to ¼4 relaxation in NL (93.9+3.7 ms, n=62) and DD conventional double-headed homodimer. The unbinding force was (92.1+3.5 ms, n=81). Myocytes overexpressing SERCA2a had a measured by pulling the kinesin-coated bead by optical tweezers at decreased (control vs. SERCA2a, p<0.001; NL vs. DD, p<0.01) a constant velocity along the microtubule, which was adsorbed to a time to 1/4 relaxation in NL (67.9+2.4 ms, n=67) and DD (85+2.8 cover slip. We have found that two binding states, ADP weak ms, n=85). SERCA2a caused a faster rate of relaxation (p<0.001) binding state having a smaller unbinding force 3pN and in comparison to Parv in NL but not in DD myocytes. We nucleotide-free (or AMP-PNP) strong binding state having a larger conclude that exogenous expression of SERCA2a or Parv unbinding force 7pN, exist in each head of kinesin. In the present significantly augments calcium sequestration during diastole with study, to observe the transition from weak to strong binding states, enhanced relaxation in NL and DD myocytes. the unbinding force was measured at various ADP concentrations. We found that, on decreasing the ADP concentration, the 323-Pos Board # B186 proportion of the weak binding state was decreased and the ADP FKBP12.6 OVEREXPRESSION ALTERS THE concentration at which the transition from weak to strong binding CHARACTERISTICS OF SR Ca2+ RELEASE IN occurs was smaller for the plus-end loading than for the minus-end PERMEABILIZED ADULT RABBIT CARDIAC loading, implying that the binding constant of ADP to kinesin- MYOCYTES microtubule complex depends on loading direction. Christopher Michael Loughrey', Aileen Rankin', Debbie F Reynolds', Gerd Hasenfuss2, Juergen Prestle2, Godfrey L Smith'; Cardiac Excitation-Contraction Coupling I 'University Of Glasgow, United Kingdom, 2Goettingen University, Germany 321-Pos Board # B184 FKBP12.6 is known to be tightly associated with the cardiac SR QUANTIFYING CARDIOTONIC DRUG EFFICACY ON Ca2+4release channel, and to regulate channel function. We have CYTOSOLIC [Ca2+] EXPENDITURE FOR CONTRACTION examined the characteristics of the SR in cultured rabbit myocytes PRE- AND POST-ISCHEMIA IN INTACT HEARTS. over-expressing FKBP12.6 (via adenoviral transfection) compared Sambita S Rhodes', David F Stowe2, Amadou K Camara2, Qun to a control adenovirus (LacZ). Myocytes were permeabilised by Chen2, Matthias L Riess2, Kristina Ropellal; 'Marquette brief exposure to 0.01mg P-escin and subsequently superfused with University, 1515 W Wisconsin Ave, Milwaukee, Wisconsin a mock intracellular solution with a [Ca2l of -350nM. SR Ca2+ 53233, 2Medical College ofWisconsin release was imaged using a confocal microscope withlOtM Fluo-3 The cyclic relationship between cytosolic [Ca21 and isovolumetric in the perfusion solution. At this [Ca2l, both untransfected and LVP is altered after ischemia/reperfusion injury. We quantified LacZ transfected cultured myocytes showed local, non-propagating this relationship using a novel index: efficiency index (El), defined SR Ca2+ release and partially propagating events. In contrast, fully as the ratio of LVP-[Ca21 loop area (LA) for an averaged beat to propagating events (Ca2+ waves) were evident in FKBP12.6 over- ICC (peak LVP-peak [Ca2l) i.e., the investment of [Ca21 for expressing cells at an identical intracellular [Ca24]. Preliminary contractility. We used El to compare different cardiotonic drug results using rapid application of caffeine (10mM) to assess SR effects on [Ca2+] utilization for contraction pre- and post-ischemia. Ca2+ content, suggest that FKBP12.6 over-expressing cells had Nine intact guinea-pig hearts were perfused with Krebs-Ringer's increased SR content when compared to the LacZ control cells. solution (I mM Ca24) containing either 1tM levosimenden (LEV), Thus FKBP12.6 over-expression in cultured rabbit myocytes has a troponin C Ca2+ sensitizer, or 1gM digoxin (DIG), a Na+ pump pronounced effects on the ability of spontaneous SR Ca + release to inhibitor. Drugs were given 30 min before and 30 min after 30 min generate propagating Ca2+ waves. of global ischemia. [Ca2l was measured ratiometrically by indo-l AM fluorescence using a fiber optic probe placed at the LV free 324-Pos Board # B187 wall. We calculated %EI = 100*LAIICC with and without (CON) THE ROLE OF F-ADRENERGIC STIMULATION ON drugs pre- and post-ischemia. %EI pre-ischemia was CON, 16+1, PROPERTIES OF EXCITATION-CONTRACTION LEV, 30+2* and DIG, 19+1 *; %EI post-ischemia was CON, COUPLING AND ACTION POTENTIALS IN THE 10+1*, LEV, 16*3 and DIG 14+2 (*p<0.05 vs pre-ischemia CON). CARDIAC MYOCYTE LEV and DIG increased %EI pre- and post-ischemia. Both drugs Joseph L Greenstein, Raimond L Winslow; The Johns Hopkins given post-ischemia returned %EI to pre-ischemia CON. University School of Medicine, 3400 N Charles Street, Baltimore, Improvement of contractility by the drugs came at a greater Maryland 21218 expenditure in cytosolic [Ca24. Recent reports have suggested a number of hypotheses regarding how alteration of microscopic mechanisms underlying the 322-Pos Board # B185 modulation of cardiac excitation-contraction (EC) coupling by J- COMPARATIVE ENHANCED RELAXATION WITH adrenergic (1-AR) stimulation may contribute to the observed PARVALBUMIN AND THE SARCOPLASMIC cellular phenotype of heart failure. In order to investigate the role RETICULUM CALCIUM PUMP (SERCA2a) IN CANINE of 3-AR stimulation on the interaction of the EC coupling DIASTOLIC DYSFUNCTION subsystem with whole cell electrophysiological properties, we have Jennifer Christel Hirsch, Andrea R Borton, Faris P Albayya, developed a new class of ventricular myocyte model based on local Mark W. Russell, Philip A. Wahr, Richard G. Ohye, Joseph M control theory which embeds Monte Carlo simulation of locally Metzger; University of Michigan, 1868 Lindsay Lane, Ann Arbor, apposed L-Type Ca2+ channels (LCCs) and SR Ca2' release Michigan 48104 channels (RyRs) into a system of differential equations describing Parvalbumin (Parv), a protein normally expressed in fast skeletal the full complement of cardiac membrane currents and intracellular muscle not in the heart, acts as a cytoplasmic Ca+2 sink. SERCA2a fluxes (Biophys J. 80:593a). Model simulations provide direct is an ATP-dependent pump that actively pumps Ca+2 into the insight into the mechanisms underlying the consequences of sarcoplasmic reticulum during relaxation. Canine diastolic specific ,B-AR stimulation related alterations in EC coupling dysfunction (DD) was created with an aortic coarctation model. properties such as LCC availability and open probability, Hypertrophic DD was confirmed by increased LV mass (g/m2) on RyR:LCC ratio, synchronization of Ca2+ release events, RyR Ca2+ ECHO (normal (NL) 78.6+3.1 vs. DD 117+13.3, p

66a Sunday POSTERS 324-329

Ca2+ cycling properties. This study was supported by the National reticulum (SR) Ca stores or triggers fbr Ca release. Release of Ca Institutes of Health (ROI HL60133-02) and the Whitaker can be initiated either by CICR or by the VSRM. The objective of Foundation. this study was to compare the effects of [Ca] . on these two mechanisms. Guinea pig ventricular myocytes were voltage- 325-Pos Board # B188 clamped with high resistance electrodes at 370C. When different COMPARISON OF EFFECTS OF ORGANIC AND [Ca] 0 were applied continuously during conditioning and test INORGANIC Ca CHANNEL BLOCKERS ON THE pulses, VSRM and CICR exhibited parallel changes in amplitude. CARDIAC VOLTAGE-SENSITIVE RELEASE In other experiments, different [Ca] o were rapidly applied only MECHANISM (VSRM) during test steps to preserve SR Ca stores. VSRM contractions Marc J.P. Richard, Susan E. Howlett, Gregory R. Ferrier; were observed at lower [Ca] . than CICR. CICR contractions Dalhousie University, 5859 University Ave, Halifax, Nova Scotia increased in proportion to L-type Ca current, whereas VSRM B3H 4H7 Canada showed no relation to inward current. However, rapid application The objective of this study was to compare the effects of different of 0 mM Ca abolished both CICR and VSRM contractions. The classes of Ca channel antagonists on the VSRM and Ca-induced amplitudes of VSRM contractions showed a direct relation to log Ca release (CICR). In guinea pig ventricular myocytes, sequential [Ca] o, while that of CICR exhibited an exponential relation. The voltage-clamp test steps to -40 and 0 mV were used to activate voltage dependence of the VSRM was independent of [Ca] . VSRM and CICR contractions separately (37°C, high resistance Thus, VSRM and CICR show distinctly different dependencies on microelectrodes). Rapid application of 100 AM cadmium, which [Ca].. blocks Ca permeation, inhibited Ca current and CICR. However, cadmium did not inhibit phasic or sustained VSRM contractions. 328-Pos Board # B191 Exposure of myocytes to 5 FM nitrendipine caused significant DIFFERENTIAL EFFECTS OF SPECIFIC inhibition of ICa-L and CICR (p<0.05), with no effect on phasic PHOSPHODIESTERASE (PDE) III AND IV INHIBITION VSRM contractions (n-10). Interestingly, sustained VSRM ON CONTRACTION IN CARDIAC MYOCYTES contractions were significantly inhibited. Longer exposure to Susan E. Howlett, Gregory R. Ferrier; Dalhousie University, Sir nitrendipine caused 80% inhibition of CICR but only 20% Charles Tupper Medical Bldg, Halifax, Nova Scotia B3H 4H7 inhibition of phasic VSRM contractions. With test steps from -65 Canada to 0 mV, which activate both VSRM and CICR, nitrendipine There is evidence that specific isoforms of PDE are markedly blocked IC.-L but only slightly inhibited contraction. The compartmentalized and may regulate different specific steps in insensitivity of contraction may represent continued operation of excitation-contraction (EC) coupling. Here we compare the effects the VSRM when ICa.L and CICR are inhibited by nitrendipine. of a specific PDE III inhibitor (indolidan) and a specific PDE IV inhibitor (rolipram) on EC-coupling in voltage-clamped guinea pig 326-Pos Board # B189 ventricular myocytes. Cell shortening was measured at 37°C. MUSCARINIC AGONISTS MODULATE THE CARDIAC Currents were measured with high resistance microelectrodes and VOLTAGE-SENSITIVE RELEASE MECHANISM (VSRM) with Na current blocked. At 1 to 50 FM, indolidan markedly IN THE ABSENCE OF ADRENERGIC STIMULATION increased amplitudes of contractions initiated by the voltage- Corey A. Felix, Susan E. Howlett, Gregory R. Ferrier; Dalhousie sensitive release mechanism (VSRM) with little effect on Ca2+ University, 5859 University Ave, Halifax, Nova Scotia B3H 4H7 current or Ca2+-induced Ca2+ release (CICR). Very high Canada concentrations (100 to 200 FiM) also caused a modest This study investigates whether the muscarinic agonist carbachol enhancement of CICR. In contrast, 100 tM rolipram had little modulates excitation-contraction coupling in voltage-clamped effect on contraction. At 200 jiM, rolipram inhibited Ca2+ current guinea pig ventricular myocytes, without prior adrenergic and both CICR and VSRM contractions. These observations stimulation. Studies were conducted with high resistance suggest that PDE III plays an important role in regulation of the microelectrodes, at 37°C with Na current blocked. Amplitudes of VSRM. Lack of effect on CICR may reflect compartmentalization contractions elicited by steps from -65 to OmV were significantly of PDE III. In contrast, PDE IV does not appear. to regulate the reduced by carbachol. In contrast, when muscarinic receptors were VSRM or CICR selectively. blocked with atropine (non-selective) or methoctramine (in2), carbachol significantly increased contraction. Carbachol did not 329-Pos Board # B192 affect Ca current in the presence or absence of blocker. Effects of MECHANISMS OF EXCITATION-CONTRACTION (EC) carbachol on the VSRM and Ca-induced Ca release (CICR) COUPLING IN MOUSE VENTRICULAR MYOCYTES contractions were separated with voltage-clamp protocols. OVEREXPRESSING N ADRENERGIC RECEPTORS. Carbachol had no significant effect on Ca current or CICR. In Scott A. Grandy, Gregory R. Ferrier, Susan E. Howlett; Dalhousie contrast, carbachol decreased VSRM contractions in the absence of University, Sir Charles Tupper Medical Bldg, Halifax, Nova Scotia m2 blockade, and increased VSRM contractions in the presence of B3H 4H7 Canada m2 blockade. Conditions which reduced activation of the VSRM Ventricular myocytes from transgenic mice (TG4) overexpressing eliminated inotropic effects of carbachol. Thus, carbachol human P2-adrenergic receptors exhibit enhanced contractility modulates cardiac contraction without prior adrenergic stimulation, without enhancement of Ca + current at 23°C. The present study through selective effects on the VSRM. Negative, but not positive compares EC-coupling in 6-7 month old TG4 and wild type (WT) inotropic effects of carbachol were mediated via muscarinic m2 littermates at 37°C. In cells field stimulated at 2 Hz in 1 mM Ca2 , receptors. fractional cell shortening was 2.6% and 4.2% of rest length in WT and TG4 respectively. In 2 mM Ca2+ fractional shortening 327-Pos Board # B190 increased to 5.4 and 7.3% respectively. Myocytes from WT mice EXTRACELLULAR CA DEPENDENCIES OF THE exhibited a neutral contraction-frequency relation (2-10 Hz), which CARDIAC VOLTAGE SENSITIVE RELEASE became positive when extracellular Ca + was reduced from 2 to I MECHANISM (VSRM) AND CA-INDUCED CA RELEASE mM. In contrast, myocytes from TG4 mice exhibited a negative (CICR) DIFFER contraction-frequency relationship which persisted when Ca2+ Robin H. Smith, Susan E. Howlett, Gregory R. Ferrier; Dalhousie concentration was reduced. In voltage-clamped TG4 cells, the University, 5859 University Ave., Halifax, Nova Scotia B3H 4H7 gain of Ca2+-induced Ca2+ release (CICR) was increased, whereas Canada the voltage-sensitive release mechanism (VSRM) was slightly Cardiac contraction is strongly affected by extracellular Ca depressed. Voltage steps from -70 to 0 mV, to activate both CICR concentration ([Ca] .). This may reflect effects on sarcoplasmic and the VSRM, elicited contractions which were not significantly

67a 329-334 POSTERS Sunday different between WT and TG4 cells. Thus, at 370C, enhanced transport and not by the pipette solution. After Na/K-pump contraction in TG4 cells may reflect increased gain ofCICR. blockade (10-12 min) to Na load the cells, the pump was abruptly reactivated and we measured Ip and d[Na]i/dt during [Na]i decline. 330-Pos Board # B193 Plotting Ip and d[Na]i/dt vs. [Na]i we find Vmax of 1.6 t 0.3 A/F SPATIAL INHOMOGENEITY OF Ca+ RELEASE FROM and 9.5 i 1.8 mM/min, respectively. Ip Vmax was translated to THE SARCOPLASMIC RETICULUM (SR) IN PIG mM/min using 6.44 pF/pL cytosol, yielding 19 mWmin. The VENTRICULAR MYOCYTES apparent Km for [Na]i was similar for Ip and d[Na]i/dt analyses Frank Heinzel, Virginie Bito, Karin Sipido; University of Leuven, (13±2 and 13.6±1.5 mM, respectively). The integrated Na flux Belgium from Ip (19 4 3 mM) was also higher than the change in [Na]i (14 The [Ca2l, transient of ventricular myocytes is the summation of ± 3 mM) as [Na]i declined from -21 mM to -7 mM. This suggests primary release events. Studies in rodents have shown a high that intracellular buffering of Na is slight (1.3 + 0.1). The higher density of release sites which may have variable activity, but little Vmax for Ip may be in part due to the impact of local is known of larger mammals with slower heart rates. We have submembrane [Na] (vs. bulk [Na]i) changes on the Na/K-pump studied pig ventricular myocytes during voltage clamp (225 ms current. We conclude that intracellular Na is very weakly steps from -70 to 0 mV at 1 Hz, K+-based pipette solutions, 3700) buffered, but that [Na]i gradients can exist which modulate Na/K- using confocal microscopy (line-scans at 300 Hz, fluo-3 as [Ca21, pump flux. indicator). In 29/43 cells, Ca2' release along the scanned line was 333-Pos Board # B196 inhomogeneous with areas of delayed release. The delay was on INHIBITION OF REVERSE Na+:Ca2+ EXCHANGE (NCX) average 644-8 ms; width of the areas could be up to 40 gm WITH KB-R7943 (KB) INCREASES ACTION POTENTIAL (nO,,Ik=6). The amplitude of the [Ca21 transient tended to be (AP) DURATION AND DECREASES CONTRACTION smaller (2.28 vs 2.71 F/Fo, P= 0.13), but decay times were (CON) IN CANINE VENTRICULAR MYOCYTES comparable. The spatial pattern was constant from pulse to pulse, Bela Szabo', Ralph Lazzara2; 'VAMC and OUHSC, 921 NE 13th, and was not changed by enhancing Ic.L and SR Ca2+ release Oklahoma City, Oklahoma 73104, 2OUHSC (isoproterenol 3 giM). Staining with Di-8-ANEPPS showed that the We inhibited reverse NCX with KB of 1-5 FM to determine its T-tubular system was not equally developed throughout the cell. role in the AP of "spike and dome" configuration, and CON in Early release was more likely to occur in areas of dense and ventricular myocytes of larger mammals. We recorded AP in intense T-tubular staining. whole cell current clamp, and CON with a video edge detector. In conclusion, in pig ventricular myocytes subcellular Ca2+ release Reverse NCX was augmented by increasing [Na+ 10,, to 10 is not homogeneous. This is most likely not of functional origin, or 16 mM, substituting 40 mM [Nal]0 with Li+, and increasing but may be related to a less developed T-tubular system. [Ca24]0 to 3.6 mM. Microelectrode solution contained (mM): KCI 130; HEPES 10; ATP 5; Mg 1.6, pH=7.3. External solution (mM): 331-Pos Board # B194 NaCl 140 or 100; KCI 4; CaC12 1.8; NaH2PO4 1; MgCI2 1; MODULATION OF CARDIAC EXCITATION- HEPES 10; glucose 1 1; pH=7.36; temperature 37°C. Ca2+ transport CONTRACTION COUPLING BY GLYCOLYSIS. in the SR was inhibited with IO,uM ryanodine, 0.3j±M thapsigargin Jens Kockskimper, Aleksey Zima, Lothar A Blatter; Loyola or 10 mM caffeine, Ic.L with 5S,M nifedipine. The data show that University Chicago, 2160 S. First Ave., Maywood, Illinois 60153 altering [Nal] and [Ca24] gradients to enhance reverse NCX The effects of glycolysis on cardiac excitation-contraction (E-C) activity decreases AP duration and increases CON. Inhibition of coupling were studied in field-stimulated cat cardiac myocytes. reverse NCX with KB-R7943 of 1 FM increases AP duration and Glucose deprivation did not significantly affect the [Ca21, transient decreases CON. KB of 23,uM decreased the duration of the AP. amplitude, whereas inhibition of glycolysis by 2-deoxyglucose (10 KB inhibited after-depolarization, after-CON and regular CON in mM) or iodoacetate (1 mM) decreased it to <30% of control. the presence of isoproterenol 5 0.1 I M. Conclusion: reverse Application of the glycolytic products pyruvate (10 mM) or L- activity of NCX is essential for normal CON and it has a lactate (10 mM) caused marked alterations of the [Ca21j transient significant effect on the repolarization in canine ventricular including a decrease in amplitude, a slowing of the kinetics, and myocytes. the occurrence of Ca2' alternans and [Ca21, waves. The changes in [Ca21i transient characteristics were accompanied by an increase in 334-Pos Board # B197 diastolic [Ca21, and an acidification of the cytosol as measured by GENERATION OF TRANSGENIC MICE EXPRESSING the pH indicator carboxy-SNARF-1. Single channel recordings LOW, MODERATE, AND HIGH LEVELS OF from rat cardiac ryanodine receptors (RyRs) incorporated into lipid PARVALBUMIN IN THE HEART. bilayers revealed that pyruvate (1 mM) inhibited RyR channel Joseph M Metzger, Phil A Wahr, Blair Richards, Pierre Coutu, activity (P.) by -70%. L-lactate (3 mM) decreased RyR activity by Katie Evans Hong; Univ. of Michigan, 1301 E. Catherine St., Ann -30%. By contrast, phosphoenolpyruvate (1 mM) did not affect Arbor, Michigan 48109-0622 RyR activity and fructose 1,6-bisphosphate (0.1-1 mM) increased Parvalbumin (Parv) is a calcium-binding protein expressed in fast it by a factor of 3-4. Thus, glycolysis may modulate cardiac E-C muscle where it serves as a delayed calcium buffer. The heart does coupling indirectly (via changes in pH and ATP) as well as directly not normally express Parv. In heart failure, an estimated 40% of through effects ofits intermediates on RyR activity. patients suffer from diastolic dysfunction, a condition of slow relaxation. We hypothesize that genetic engineering to direct 332-Pos Board # B195 expression of Parv in the heart could result in an acceleration in SIMULTANEOUS MEASUREMENTS OF [Nafl AND Na/K myocardial relaxation kinetics in vivo. We generated transgenic PUMP CURRENT IN RABBIT VENTRICULAR mice using the alpha myosin heavy chain promoter to drive MYOCYTES cardiac-restricted expression of the human Parv cDNA. Four Sanda Despa, Donald M Bers; Loyola University Chicago, 2160 independent lines of transgenic mice were established. Using fast- South First Avenue, Maywood, Illinois 60153 twitch muscle standards as a reference (EDL, 0.33 mM), Parv Intracellular [Na] ([Na]i) is important in modulating cardiac expression ranged from low (<.1 mM), to moderate (about 0.3 contractile and electrical activity. Low [Na]i is maintained by the mM), to high (about 0.6 mM). These animals are viable, fertile, Na/K-pump. We used the fluorescent indicator SBFI and whole- and display no overt phenotype. We hypothesize that in vivo cell voltage clamp to measure simultaneously [Na]i and the Na/K- hemodynamic function will be enhanced in a dose-dependent pump current (Ip) in myocytes at 370 C. High resistance fashion, and at very high [Parv] we speculate that systolic function electrodes assured that [Na]i was controlled mainly by membrane

68a Sunday POSTERS 334-339

may be altered owing to calcium buffering. Interline crosses U390, CHU A. de Villeneuve, MONTPELLIER, 34090 France, between high expressing lines have further increased [Parv] (>0.6 2University of Wisconsin-Madison, 1300 University Avenue, mM) in the heart, however, we have thus far found no overt Madison, Wisconsin 53706 deleterious effects in these mice. These transgenic animals can Aldosterone (Aldo) is a cardiovascular hormone. Recently we now be used to establish the Parv expression threshold, and reported that long-term exposure of rat ventricular myocytes to optimal expression range, required to exert physiological Aldo decreases I., density due to ICa.L increase and Ca2+ signaling enhancement ofheart performance in vivo. modulation. Here, we firther analyze this modulation. The Ca2+- dependent opening of the ryanodine receptors (RyR) was 335-Pos Board # B198 visualized with a confocal microscope as local [Ca2l] elevations, CELL CULTURE MODIFIES THE FUNCTIONAL ROLE Ca2+sparks. 48-hours exposure to 100-nM Aldo at 37°C increased OF RYANODINE RECEPTORS (RYRS) IN NEONATE by 2.5-fold the occurrence of spontaneous Ca2+sparks (in CARDIAC MYOCYTES Hz/100gm: 2.5±0.4 vs 6.5t0.7, 29 Cont vs. 29 Aldo-treated cells). Rose M. Snopkol, Yanxia Li', Claudia G. Perez', Jingpin Fan', The sarcoplasmic reticulum Ca2+content was unmodified (peak Marcel D. Halbach2, Donald M. Bers', Lothar A. Blatter', Rafael ratio of the fluorescence signal after and before 10-mM caffeine: Mejia-Alvarezl; 'Loyola University Chicago, 2University of 3.6*t0.9 vs 3.9±0.7, 14 Cont vs 14 Aldo-treated cells), but co- Cologne, Germany treatment with nifedipine blunted this effect. Ca2+sparks analysis Primary culture of neonate cardiac myocytes is a popular model to did not reveal any significant difference in their amplitude study a number of physiological and clinical signals. Nevertheless, (1.72+t0.01 [n=568] vs 1.74+0.01 [n=1287], Cont vs Aldo-treated changes in cell morphology and protein expression following cell cells). However, spread and decay of Ca2+sparks are significant culture may limit its value as a model of cardiac development. greater (13.3+0.15 vs 15.3±0.2 gm and 44.2+2.3 vs 59.6+2.5 ms, Culture-related changes of RyR contribution to excitation- Cont vs Aldo-treated cells). Some, especially long lasting contraction (EC) coupling were investigated in neonate rat. spontaneous Ca2+sparks occurred upon 48 hours application of [3H]ryanodine binding, Ca2+ currents (IC,), and Ca2+ transients were Aldo, which might underlie a modulation of RyRs. Functional and measured in freshly isolated (FIM) and cultured myocytes (CM) biochemical analyses of RyR are underway to fulrther test this from 1-day-old rats. Binding studies revealed a substantial increase hypothesis. in RyR density after 72 h of culture (B,,, = 379 in FIM, vs. 1,021 finol/mg protein in CM; n-4). The rising phase of the Ca2+ 338-Pos Board # B201 transient became faster in CM (time to peak = 159 ms in CM) than UNDERLYING MECHANISMS OF Ca2+ PROPAGATION in FIM (time to peak = 260 ms), and the ryanodine-sensitive DURING E-C COUPLING IN RAT ATRIAL MYOCYTES component of the Ca2+ transient was bigger in CM (26% of the Hideyuld Ishida', Yuki Hirota', Chokoh Genkal, Hiroe control) than in FIM (10% of the control). Ic. density was not Nakazawa', Noboru Aosaki2; 'Tokai University, Bohseidai, significantly different between CM and FIM. These data indicate Isehara, 259-1193 Japan, 2Kasumigaura National Hospital, Japan that the participation of neonate RyR in EC coupling is altered To investigate why Ca2+ is able to propagate in atrial myocytes but during culture, and that this change primarily results from a not in ventricular myocytes, we compared the properties of [Ca2li relative increase in RyR density (supported by NIH-HL62571-01 transient, RyR2 localization and Ca2+ buffering in atrial and to RMA). ventricular myocytes. 336-Pos Board # B199 In the t-tubular system lacking atrial myocytes, the increase in ALTERATION IN MYOFILAMENT Ca-SENSITIVITY [Ca2li first appeared in focal regions at the cell periphery before INFILUENCES Ca TRANSPORT IN VENTRICULAR spreading to the center. However, the time delay between the MYOCYTES. [Ca24]i peak and contraction peak in ventricular myocytes, was Jose L Puglisi; Loyola University Chicago, 2160 South First about 6-fold slower than in atrial myocytes. Moreover, the partial Avenue, Maywood, Illinois 60153 exposure of caffeine induced Ca2+ propagation in atrial myocytes, but not in ventricular myocytes. These results suggest a difference We tested whether changes in Ca-myofilament interactions alter in character of Ca2+ propagation, such as SR Ca2+-release and Ca2+ Ca-fluxes in heart cells. We measured shortening and Ca transients buffering, between the two cell types. The SR Ca2+-release with in myocytes from non-transgenic (NTG) and transgenic mice (TG), caffeine in atrial myocytes was significantly greater than that in in which cardiac TnI is quantitatively replaced by slow skeletal TnI ventricular myocytes. Distributions of RyR2 and actin were similar (ssTnl, which increases myofilament Ca sensitivity and prevents in both cells. However, the rate of mitochondria in atrial myocytes phosphorylation by PKA). Twitch and Ca transient amplitude were (15% of total area) was less than that in ventricular myocytes (28% significantly higher in TG mice (=30%). However, the t,,2 of of total area). Our results suggest that different functions of SR relaxation and t of [Ca]i decline (,Ca) was not different between Ca2+ content and the density of mitochondria in atrial myocytes TG and NTG. An age-dependent difference was seen between could explain the Ca2+ propagation in atrial myocytes during E-C young (Y, 5-7 mo) and old (0, >11 mo) NTG and TG mice, during coupling. relaxation of caffeine-induced contractures (attributed to Na/CaX function). In Y-TG relaxation and cc. in caffeine were 5 and 2 339-Pos Board # B202 times faster than in Y-NTG. In contrast, these values in O-TG MECHANISMS OF FREQUENCY-DEPENDENT Ca2+ were 2.6 and 2 times slower than in O-NTG. Thus, Ca extrusion RELEASE FROM THE SARCOPLASMIC RETICULUM by NaCaX is enhanced in Y-TG, but depressed in 0-TG mice (vs (SR) IN MOUSE VENTRICULAR MYOCYTES NTGs). Consistent with this, the O-TG also tend to have higher Gudrun Antoons, Kanigula Mubagwa, Inez Nevelsteen, Karin R. SR Ca content. This represents a striking difference in age with Sipido; University of Leuven, Herestraat 49, Leuven, 3000 respect to Ca-transporter adaptation to altered myofilament Belgium properties. Such a slow change in adaptation could contribute to In vitro contractility of mouse cardiac muscle increases with late onset of physiological dysfunction as seen in some increasing frequency of stimulation (Gao et al., J. Physiol., 1998). cardiomyopathies (e.g. FHC). We examined the mechanisms underlying the changes of [Ca21, 337-Pos Board # B200 with increasing frequency of stimulation in single myocytes during whole-cell voltage clamp. From 1 to 2 and 4 Hz, peak [Ca21, MODULATION OF SR-Ca2+ RELEASE BY ALDOSTERONE increased from to 2.94±0.11 to IN RAT VENTRICULAR MYOCYTES 2.59+0.08 3.31+0.13 (F/Fo, Jean-Pierre BENITAH', Emeline Perrier', Xinsheng Zhu2, mean±SEM, n=17).However, baseline [Ca2li also increased and Hector H. Valdivia2, Guy Vassort', Ana Maria Gomez'; 'INSERM thus the net amplitude of the [Ca21i transient increased only

69a 339-345 POSTERS Sunday modestly. Interposing a 1 s pause after conditioning trains at 2 and 342-Pos Board # B205 4 Hz, significantly increased the amplitude of the [Ca2li transient. DECREASED FREQUENCY OF SPONTANEOUS SR CA SR Ca2+ content increased significantly from I to 2 and 4 Hz RELEASE DURING METABOLIC INHIBITION IS (caffeine pulses, n=6), whereas measurements of Ic,L showed a PARTLY A RESULT OF INTRACELLULAR ACIDOSIS IN significant decrease in peak current (-28±6 % and -46±8 % of Io at RAT VENTRICULAR MYOCYTES resp. 2 and 4 Hz, n=6). This was related to incomplete recovery of Stephen C O'Neill', Ho Sook Choi', Andrew W Trafford2, David Ic,L (86±3 % at 250 ms and 91±3 % at 500 ms, following a single A Eisner'; 'Manchester University, Oxford Road, Manchester, pulse). M13 9PT United Kingdom, 2University of Manchester, Oxford In conclusion, in mouse ventricular myocytes SR Ca2+ content Road, Manchester, M13 9PT United Kingdom increases substantially at higher stimulation frequencies, but loss Metabolic inhibition increases the sarcoplasmic reticulum (SR) Ca Of ICaL and reduced fractional release result in a rather flat [Ca2+]i- content and decreases spontaneous Ca wave frequency (Overend et frequency relation. A variable balance between these opposing al Circ Res. 88, 181-187, 2001). These effects are attributed to changes may explain variability ofthe [Ca2li-frequency response. depression of ryanodine receptor (RyR) open probability. 340-Pos Board # B203 Metabolic inhibition has many effects including decreased [ATP] and pH both of which decrease RyR open probability. In the ACIDOSIS PRODUCES SUBCELLULAR ALTERNATION present work we investigate the extent to which changes of OF THE CALCIUM TRANSIENT IN SINGLE RAT of VENTRICULAR MYOCYTES intracellular pH contribute to the decreased frequency spontaneous Ca release. Mary E Diaz, David A Eisner, Stephen C O'Neill; Manchester Experiments were performed on isolated rat ventricular myocytes. University, Oxford Road, Manchester, M13 9PT United Kingdom Intracellular pH was measured with the fluorescent indicator Acidosis decreases the open probability (Po) of the ryanodine carboxy-SNARF (loaded as the acetoxymethyl ester). Spontaneous (RyR) and produces "alternans" where large and small contractions waves were induced by raising external Ca concentration to 10 result from successive stimuli (Orchard et al Circ. Res. 68, 69-76, mM. Metabolic inhibition (2 mM cyanide in a glucose-free 1991). We have found the local anaesthetic tetracaine, that also solution) resulted in decreased wave frequency associated with an decreases RyR Po, produces subcellular regional alternans of Ca intracellular acidification of the order of 0.3 pH units. A similar transient amplitude. In this study we have investigated whether degree of acidification was produced by adding sodium butyrate acidosis has similar subcellular effects. (at constant external pH). This acidification produced a similarly Experiments were performed on voltage-clamped rat ventricular decreased wave frequency. It appears, therefore, that much of the myocytes loaded with fluo-3. Calcium was measured confocally in changes in wave frequency in metabolic inhibition can be line scan mode along the length of the cell. Intracellular acidosis attributed to the accompanying fall ofintracellular pH. was imposed at constant external pH by application of 30 mM Na butyrate. Acidosis initially decreased Ca transient amplitude, 344-Pos Board # B206 which then recovered towards control levels. During acidosis the %yIRACK, A SELECTIVE PKCe ACTIVATING PEPTIDE, Ca transient was non-uniform. Clear regional alternans was seen CAUSES A POSITIVE INOTROPIC EFFECT IN FELINE with consecutive stimuli varying between large and small VENTRICULAR MYOCYTES transients. These regions were typically 10-20 Am in length and David M Harris', Valentino Piacentino III', Khuram Chaudharyl, their location varied between stimuli. Following the start of the Ca Daria Mochly-Rosen2, Kenneth B Margulies', Steven R. Houser'; transient, the rise of Ca propagated as a wave from the initial sites 'Temple University School of Medicine, 3400 North Broad Street, of large release to limited neighbouring regions of the cell. It is Philadelphia, Pennsylvania 19140, 2Stanford University likely that subcellular Ca alternation may be a general result of Agonists that activate Protein Kinase C (PKC) can display depressed RyR open probability. complex effects on the contractility of cardiac myocytes with both 341-Pos Board # B204 positive (Woo, 1999) and negative (Capogrossi, 1989) inotropic REGIONAL ALTERNATION OF CALCIUM RELEASE IN responses being observed. Our hypothesis is that this diversity is SINGLE VENTRICULAR MYOCYTES IS ENHANCED BY related to the selective activation of different PKC isozymes that TETRACAINE have unique effects on contractility. As a first step to test this Mary E Diaz, Stephen C O"Neill, David A Eisner; Manchester hypothesis, we examined the effects of a selective PKCe activating University, Oxford Road, Manchester, Ml 3 9PT United Kingdom peptide (WpeRACK) on the contractility of feline left ventricular myocytes. Methods: Cells were isolated from the left ventricular Depression of RyR Ca sensitivity with tetracaine produces a free wall and were either not treated for control purposes or treated transient decrease of systolic Ca that recovers as SR Ca content with 1 rises (Overend et al, J. Physiol. 507, 759-769, 1998). This study with the WSRACK peptide (1I M). The cells were perfused examines sub-cellular Ca signalling using line scan confocal mM Ca2' Tyrodes solution (37 degrees), field-stimulated at 0.5 Hz, microscopy. Experiments were performed on voltage-clamped, and contractions were recorded. Results: NISRACK treated fluo-3 loaded single ventricular cardiac myocytes. Depolarising myocytes (n=20) exhibited a significant increase in fractional pulses were applied from -40 to 0 mV. shortening as compared to control (n=19, 14.1% vs. 10.5%, In control, there is some variability in Ca transient amplitude at P<.001). The time to 50% of the peak contraction was also faster different release sites (Cannell et al, Biophys. J. 67, 1942-1956, in the WERACK treated myocytes as compared to control cells (72 1994). In tetracaine variability is dramatically increased. The ms vs. 86 ms, P<.001). Relaxation parameters were not position of sites with larger transients varies from pulse to pulse significantly altered. Conclusions: Selective activation of PKCE and often alternated in size. In regions with a large transient, the causes a positive inotropic response in feline ventricular myocytes. increase ofCa propagated as a wave from the initial release site. Regional alternating Ca release was associated with either no or a 345-Pos Board # B207 smaller degree of alternation in the whole line scan. This suggests YeRACK, A SELECTIVE PKCe ACTIVATING PEPTIDE, that alternating Ca release may occur more commonly at the sub CAUSES A POSITIVE INOTROPIC EFFECT IN FELINE cellular than the whole cell level. Alternans of contraction has been VENTRICULAR MYOCYTES linked to cardiac failure and ischaemia. The present study suggest David M Harris', Valentino Piacentino lIII, Khuram Chaudharyl, that this alternans may result from sub cellular alternations due to Daria Mochly-Rosen2, Kenneth B Margulies', Steven R. Houser'; depressed RyR Ca sensitivity and that subcellular alternans may be 'Temple University School of Medicine, 3400 North Broad Street, more common than previously thought. Philadelphia, Pennsylvania 19140, 2Stanford University

70a Sunday POSTERS 345-349

Agonists that activate Protein Kinase C (PKC) can display channel by pyruvate (0.5-2 mM) without affecting the conductance complex effects on the contractility of cardiac myocytes with both of the channel. This effect of pyruvate on channel activity was not positive (Woo, 1999) and negative (Capogrossi, 1989) inotropic dependent on Ca2' and [ATP]. These findings suggest that in responses being observed. Our hypothesis is that this diversity is cardiac tissue pyruvate has a dual effect on Ca2+release: a direct related to the selective activation of different PKC isozymes that inhibitory effect on the RyR channel and a mitochondria- have unique effects on contractility. As a first step to test this dependent positive inotropic effect, presumably mediated by an hypothesis, we examined the effects of a selective PKCe activating increase ofATP production. peptide (YeRACK) on the contractility of feline left ventricular myocytes. Methods: Cells were isolated from the left ventricular 348-Pos Board # B210 free wall and were either not treated for control purposes or treated MECHANISM OF ENHANCEMENT OF CARDIAC- with the YeRACK peptide (luM). The cells were perfused with I CALCIUM ACTIVATED FORCE BY ALLOPURINOL mM Ca2+ Tyrodes solution (37 degrees), field-stimulated at 0.5 Hz, Linda S Stull, Paul M.L. Janssen, Wei Dong Gao, Eduardo and contractions were recorded. Results: YeRACK treated Marban; Johns Hopkins University, 720 Rutland Avenue, 844 Ross myocytes (n=20) exhibited a significant increase in fractional Bldg, Baltimore, Maryland 21205 shortening as compared to control (n=19, 14.1% vs. 10.5%, Xanthine oxidase inhibitors including allopurinol and oxypurinol P<.001). The time to 50% of the peak contraction was also faster are known to boost maximal calcium-activated force (Fmax) in in the YeRACK treated myocytes as compared to control cells (72 intact heart muscle, without shifting the EC50 for calcium ms vs. 86 ms, P<.001). Relaxation parameters were not activation. We have explored the basis for this effect in right significantly altered. Conclusions: Selective activation of PKCe ventricular rat trabeculae. Maximal force was determined by causes a positive inotropic response in feline ventricular myocytes. tetanization in the presence of ryanodine and high [Ca2+] in intact muscles, or by exposure to activating solution containing 25 FM 346-Pos Board # B208 [Ca2+] after skinning with Triton X-100. Allopurinol (550±M) EFFECTS OF THAPSIGARGIN ON CONTRACTILITY IN was applied either directly to the muscles after dissection, or via ADULT RAT CARDIAC MYOCYTES TRANSDUCED the coronary circulation during Langendorff perfusion for 20 min WIT'H EITHER PARVALBUMIN OR SERCA2A prior to dissection. Allopurinol had no effect when applied to Pierre Coutu, Ali A Shakoor, Faris P Albayya, Joseph M isolated muscles, but increased maximal force by 60% (n=10) Metzger; University of Michigan, 7730 MS II, 1301 E. Catherine relative to drug-free controls (n=5) when applied via the intact St., Ann Arbor, Michigan 48109 coronary circulation (P- 0.01). The allopurinol-induced A well defined characteristic of cardiac myocytes in heart failure enhancement of Fmax could be blocked by concomitant (HF) is a marked slowing of the calcium transient and the application of the nitric oxide antagonist L-NAME (100jtM). The mechanical contraction. Adenovirus-mediated gene transfer (Ad- pronounced differences in Fmax between allopurinol and control GT) of parvalbumin (PV) and sarcoplasmic reticulum calcium groups persisted after skinning. Thus, nitric oxide generation in ATPase (SERCA) in isolated cardiac myocytes has recently been the coronary vasculature is required for allopurinol enhancement of shown to increase relaxation speed during unloaded contractions. Fmax. Once manifested, however, increase in Fmax depends However, little is known on how these transduced myocytes react entirely upon factors intrinsic to the myofilaments. with impaired calcium removal (characteristic of HF). In this study we used thapsigargin (TG), a SERCA inhibitor, to further evaluate 349-Pos Board # B211 genetic manipulation by PV or SERCA. First, the dose response of INTRACELLULAR Ca-BUFFERING, SR Ca LOAD AND TG on calcium transient (Fura-2) and unloaded sarcomere Na-Ca EXCHANGE RATE IN CARDIAC MYOCYTES IN 5 shortening (laser diffraction) was established in control adult rat SPECIES cardiac myocytes in primary culture. The Kd for the effect of TG Leif Hove-Madsen', Kenneth S Ginsburg2, Glen F. Tibbits3, on relaxation speed of the calcium transient was 170nM, with an Donald M Bers2; 'Univ. Aut6noma de Barcelona, Fac. Science, amplitude of -25% and a time from stimulus to l/2 relaxation of Bellaterra, 08193 Spain, 2Loyola University, Chicago, 3Simon -300% of the control myocytes at [TG]=500nM. Second, TG was Fraser University, Canada used at concentrations of 75nM and 150nM to produce mild and Na-Ca exchange (NCX) activity (VNCx), SR Ca-uptake and passive severe dysfunction in calcium removal 4 days after Ad-GT to Ca-buffering are central in regulating cardiac relaxation. To allow time for PV or SERCA to maximally express. Calcium detennine the NCX function in different species, rapid caffeine transient and sarcomere shortening experiments are on going to applications were used to measure simultaneously the Ca-transient assess functionality under these conditions. ([Ca],) and NCX current (INcx). VNCX was inferred from INCX while the amount of Ca extruded by NCX was taken from the INCX 347-Pos Board # B209 integral. Total extruded Ca indicated SR Ca load, and the total PYRUVATE-MEDIATED EFFECTS ON CARDIAC Ca2+ amount of cytosolic Ca at a given time (Ca,t) was derived from the SIGNALING progress of the running INCX integral. SR Ca load and the [Ca]i- Aleksey Zima, Jens Kockskamper, Lothar A Blatter; Loyola dependence of VNCX and Cat,, (buffering) were obtained for University Chicago, 2160 S. First Ave., Maywood, Illinois 60153 ventricular myocytes from mouse, rat, ferret and rabbit or atrial The effects of pyruvate on cardiac Ca2' release were studied by myocytes from rainbow trout. Ca buffering power between -100 fluorescence confocal microscopy of Ca2+ signals from intact and and 700 nM [Ca]i was 90, 79, 87, 50 & 129, respectively. The permeabilized rat ventricular myocytes and with single channel [Ca]-dependence of VNCX was linear up to I gM [Ca]i for all recordings from ryanodine receptors (RyR) incorporated into lipid species. At [Ca]i = 0.7 i±M, VNCX was 74, 26, 26, 36, and 222 idvVs bilayers. In intact cells extracellular pyruvate (10 mM) increased (same order). SR Ca load (in tLmolUl cytosol) was 103, 115, 72, 58 diastolic [Ca2l, increased the amplitude of the Ca2+ transient and & 325 (same order). Using published values for V,,.,, & Ko.5 for slowed its kinetics, and elevated sarcoplasmic reticulum Ca2+ SR Ca-uptake we can also infer a ratio VNCX /VSR-UPr at 700 nM content. The increase of diastolic Ca2+ was, in part, due to a [Ca]i: 0.31, 0.19, 0.24, 0.44 & 2.46 (same order). While moderate concomitant acidification of the cytosol. Inhibitors of variations in Ca buffering, NCX and SR Ca transport rates exist mitochondrial monocarboxylate transport (a-cyano-4- among mammals, trout exhibits higher Ca buffering, SR Ca load hydroxycinnamate) and nucleotide translocation (atractyloside) and a relatively powerful NCX which competes effectively with attenuated the effect of pyruvate on the amplitude of the Ca2+ the SR Ca-pump. transient. In permeabilized myocytes pyruvate (2 mM) reduced the frequency of spontaneous Ca + sparks. Single RyR channel recordings revealed a reduction of the open probability of the

71a 350-354 POSTERS Sunday

changing power levels was used as a diffraction-limited trigger for 350-Pos Board # B212 CICR. The Ca2' signals were simultaneously recorded with Fluo-3 APPLICATION OF METABOLIC CONTROL THEORY TO using laser-scanning confocal microscopy. The analysis of the CALCIUM FLUXES IN RAT CARDIAC MYOCYTES local Ca24 signals revealed that less power was required for Ca24 Charles Smith1, Sandor Gy6rke2, Theodore F. Wiesner'; 'Texas signals of similar amplitude after increasing the SR Ca24 load (by Tech University, 2Texas Tech University Health Sciences Center applying a variable number of L-type Ca2+ current pre-pulses). Calcium exists as at least 7 different species in the cardiac Furthermore, under high Ca2+ load the local signals showed more myocyte, and is distributed by a minimum of 13 fluxes. The flux spatial spread, presumably resulting from changes in the positive distribution is precisely controlled to unique values in both systole feedback of CICR. Therefore, this novel technique allows rapid and diastole for a given inotropic state. Since the number of fluxes estimates of the sensitivity of the RyRs towards Ca2+ triggers in exceeds the number of species, simple mass conservation cannot vivo. account for the uniqueness. We investigate calcium flux control by examining the metabolic control coefficient (MCC) matrix, which 353-Pos Board # B215 relates the sensitivity of a flux to a perturbation of a transport DEVELOPMENTAL CHANGES OF Ca+ SPARKS IN mechanism. The MCC arises from the analytical solution to a log- ACCUTELY ISOLATED RAT VENTRICULAR linear approximation of the governing nonlinear equations. The MYOCYTES matrix can be independently derived by two methods. The first Joseflna Ramos-Franco, Claudia G. P6rez, Rose M. Snopko, method employs perturbations in cells. Control coefficients thus Yanxia Li, Michael Fill, Rafael Mejia-Alvarez; Loyola University determined systemically include both direct and indirect effects of Chicago perturbing a transporter. The second method expresses the MCC in Despite the similarity of single-channel properties, significant terms of elasticities. Elasticities are established in preparations differences in density and location of ryanodine receptors (RyRs) where the transporter is experimentally isolated. This isolates the have been observed in adult (AD) and neonate (NB) cardiac perturbation and its effect from the indirect affects present in cells. myocytes. As a result, RyR contribution to excitation-contraction The existence and importance of a transport mechanism becomes coupling (ECC) in NB is minimal. In this study, we tested the evident in comparing the control coefficients derived from the 2 hypothesis that differences in density and/or location ofNB RyRs methods. We report the dominant flux control mechanisms impact the characteristics of local Ca2+ release events. Line-scan identified from this analysis. confocal microscopy was used to record spontaneous Ca2+ sparks in fluo-4 loaded acutely dissociated myocytes from NB and AD rat 351-Pos Board # B213 hearts. Ca2+ sparks were characterized by their intracellular FASTER RECOVERY OF SARCOPLASMIC Ca2+ RELEASE distribution, relative frequency, peak [Ca2l, duration and spatial FROM REFRACTORINESS AFTER P-ADRENERGIC spread. The effect of RyR-specific modulators (i.e. ryanodine, STIMULATION caffeine) was also explored. Results indicate that early after birth Christophe Pignier, Marcel Egger, Ernst Niggli; University of Ca2+ sparks (n=55) were sensitive to ryanodine and caffeine, and Bern, Switzerland exhibited lower amplitude (297t25 vs. 374±70 nM), shorter half We have observed that in cardiac myocytes coherent activation of duration (19t1 vs. 38t3 ms), and larger half width (20.1 vs. Ca2' release by flash-photolysis of caged Ca2+ unmnasks a 1.6i0.1 gm) than in AD (n=79). These findings suggest that early refractoriness of CICR. Recovery from refractoriness may depend after birth RyRs are organized in fiunctional units that generate on the SR Ca2+ content or on the Ca2e sensitivity ofCICR. Here we Ca2+ sparks. Their attributes however, are considerably different examined whether J-adrenergic stimulation could affect CICR. We from those found in AD (supported by NIH-HL57832-01 to MF & used UV-laser flash photolysis of caged Ca2+ (DM-nitrophen) in NIH-HL62571-01 to RMA). combination with the whole-cell patch clamp technique. Na-Ca exchange currents (INw,ca) were recorded from Guinea pig 354-Pos Board # B216 ventricular myocytes as estimates ofCa2+ concentration. Photolysis RYR SPATIAL ORGANIZATION IS INVOLVED IN Ca- ofDM-nitrophen activated IN,/Ca arising from photo-release of Ca2+ SPARKS TERMINATION and subsequent Ca2+ release from the SR. Pairs of UV-flashes were Carlos A. Villalba-Galea', Rafael A. Roasles2, Ariel L Escobar'; applied at various intervals to follow the time-course of recovery 'TTUHSC, 2IVIC, Venezuela from refractoriness. Application of Isoproterenol (IAM Iso) In cardiac myocytes, Ca-sparks occur randomly in time and in significantly reduced the refractoriness, such that complete space. It is accepted a single Ryanodine receptors (RyR) cluster recovery of Ca2+ release could be observed earlier. Recovery of activity underlie these events. However, how they terminate Ca2+ release from 8 cells was fitted with a monoexponential remains unclear. A possible factor involved in Ca-sparks function with a c of352 :k 45 ms (ctrl) and 195 + 21 ms (Iso). We termination is the dyadic space topology. The volume containing a conclude that J-adrenergic stimulation may modulate global CICR single RyR cluster is very small, then the number ofCa ions in this refractoriness. This might result from acceleration of SR refilling volume in resting will be very little. Under this condition or from a change of the steady-state Ca2+ sensitivity and/or gating homogeneous Markov Chains cannot be used for simulating the kinetics ofthe SR Ca2+ release channels. single channel behavior within the cluster. An inhomogeneous method was developed for resolving this problem. The method was 352-Pos Board # B214 tested using Monte Carlo simulations for a two-states channel. ESTIMATION OF EC-COUPLING EFFICIENCY IN VIVO Amazingly, because ligand molecules "wandering", simulations Nicolas Lindegger, Ernst Niggli; University ofBern, Switzerland showed a burst-like activity where shut dwell time distributions In cardiac muscle Ca2+ entering the cell via L-type Ca2+ channels were very different than the classical homogeneous expectation. triggers Ca2+ release from the sarcoplasmic reticulum (SR) through On the other hand, spontaneous Ca sparks were simulated using ryanodine receptors (RyRs) by Ca2t-induced Ca2+ release (CICR). this approach. Kinetic schemes for the RyR gating were obtained Changes in efficiency, amplification and positive feedback of the using Hidden Markov Model. Random movements of ions and CICR may result from regulatory mechanisms (e.g. ,8-stimulation, other molecules were used as local diffusion framework. Several SR Ca2+ load). In addition, several cardiac diseases may impair parameters such as number of channels, distances between CICR efficiency. We developed a technique to rapidly determine channels diffusion coefficients were explored. Surprisingly, the the efficiency of CICR and the Ca2+ sensitivity of the RyRs in amplitude of Ca-sparks didn't change for distance of 30 to 120 nm ventricular myocytes isolated from Guinea-pig hearts. Two photon between channels. However, the timing was dramatically affected, photolysis (TPP) of caged Ca2+ (DM-Nitrophen) at rapidly 5 times shorter for 120 nm respects to 30 nm

72a Sunday POSTERS 355-359

RyR2 after Asp-4365 in the divergent region 1. Cells expressing 355-Pos Board # B217 the fusion protein, RyR2(D4365-GFP), were readily identified by "STREAKS" AND "SCALLOPS" REVEAL A HIERARCHY their characteristic fluorescence, indicating that the overall OF Ca2+ RELEASE ORGANIZATION IN ATRIAL CELLS structure of the inserted GFP was retained. The RyR2(D4365- Leighton T. Izu', Malcolm Kirk2, Stephen R Shorofsky', C. GFP)-expressing cells also showed caffeine- and ryanodine- William Balke'; 'University of Maryland, 22 South Greene St., sensitive calcium release as determined using the fluorescent Baltimore, Maryland 21201-1595, 2Brown University calcium dye fluo-3, demonstrating that RyR2(D4365-GFP) forms a Atrial cells lack the extensive and well-organized t-tubular functional calcium release channel. Purification of RyR2(D4365- structure of ventricular cells so the mechanisms underlying GFP) was achieved in a single step by affinity chromatography excitation-contraction coupling must differ in these two cell types. using GST-FKBP12.6. Cryo-EM of the purified fusion protein Here we report that Ca2+ release appears to be organized at two showed that the receptors were structurally intact. Efforts to levels in rat atrial cells. In transverse linescans of fluo-4 loaded rat elucidate the location of the inserted GFP by 3D reconstruction atrial cells "streaks" of elevated fluorescence are often seen. The using single particle image processing are in progress. number of streaks are variable and are spaced 1.7±0.2 gim apart. Supported by NIH AR40615, RR01219 and MDA to TW, by Ca2+ sparks in the interior of the cell almost always occur on the CIHR and HSFA to SRWC. streak. Likewise, Ca24 waves starting in the interior are initiated on a streak. Therefore the structures underlying these streaks 358-Pos Board # B220 appear to be initiation sites for Ca2+ sparks and Ca2+ waves. MAGNESIUM INHIBITION OF SINGLE CARDIAC RYR Careful examination of the Ca2+ wave often shows that the wave CHANNELS front has a "scalloped" appearance. This scalloped wave front is Ricardo Bull, Alejandro Chamorro, Marcelo Catalan, Jos6 Pablo also predicted by numerical simulations of Ca2+ waves with Finkelstein; Universidad de Chile, Independencia 1027, Santiago, discrete Ca2+ release sites. These results suggest that in rat atrial 6530499 Chile cells Ca2+ release is initiated at sites spaced -1.7 gm apart along Cardiac Ryanodine receptor (RyR) channels - through calcium the transverse axis and there are also Ca2+ release sites more finely induced calcium release - are activated by calcium entering the cell space about 0.5 gm apart. at physiological cytoplasmic [Mg2l. We have shown (Biophys. J. 74: 1263, 1998) that RyR channels obtained from rabbit cardiac 356-Pos Board # B218 sarcoplasmic reticulum (SR) display two types of responses to MODELING CARDIAC Ca2+ SPARKS: INFLUENCES ON cytoplasmic [Ca2l. Reduced channels are inhibited by 0.5 mM THE Ca2+ SPARK SHAPE cytoplasmic [Ca2+] (MS channels) whereas oxidized channels are Eric A Sobiel, M Saleet Jafri2, W J Lederer'; 'University of not (C channels). In this study we compared Mg2+ inhibition of Maryland Biotechnology Institute, 725 W. Lombard St., Baltimore, single native channels incorporated in planar lipid bilayers that Maryland 21201, 2University ofTexas at Dallas spontaneously displayed either C or MS Ca2+ dependence. Mg2+ Previous computer modeling work from our group has suggested decreased the fractional open time of both channel types, but that the combined effects of coupled gating between ryanodine higher concentrations were needed to inhibit C channels. MS receptors (RyRs) and sarcoplasmic reticulum (SR) lumenal [Ca2l- channels had a Ko.s for Mg2+ inhibition of 43:16 ,M, measured at dependent gating of RyRs can account for the termination of 10 FM cis [Ca2+]. This value is within the same range as that cardiac Ca2+ sparks. In this model, a Ca2+ spark results from a described in vesicular calcium release studies for skeletal RyR decaying Ca2+ release flux, and significant local SR [Ca21 channels. In contrast, C channels had in the same recording depletion occurs during a Ca2+ spark. The objectives of the present conditions a Ko.s for Mg2+ inhibition > 1 mM. These results suggest study were to: 1) examine how the shape of the local Ca2+ release that cardiac RyR channels display two different responses to flux influences the shape of the Ca2+ spark, and 2) investigate how inhibition by Mg2+, which may be detenmined by channel redox simulated Ca2+ spark characteristics are modified by the Ca2+ state. Supported by Fondecyt Grant 8980009. diffusion/buffering model used. Ca2+ sparks were simulated with both a simple (S) model that ignored binding of the Ca2+ indicator 359-Pos Board # B221 fluo-3 (F3) to immobile proteins, and a complex (C) model in RYANODINE SENSITIZES THE CARDIAC RYANODINE which F3 interacted with proteins in a Ca2+-dependent manner. RECEPTOR (RYR2) TO Ca2+ ACTIVATION AND The following results were observed: 1) Sparks produced with the DISSOCIATES AS THE CHANNEL IS CLOSED BY Ca2+ S and C models had similar time courses if the affinity of F3 for DEPLETION Ca2+ was adjusted properly; 2) In either model, decaying Ca2+ Guo Guang Du, Xinghua Guo, Vijay K. Khanna, David H. release fluxes produced Ca + sparks with smoother peaks than did MacLennan; University ofToronto, Canada constant release fluxes; and 3) In either model, small maintained Rabbit cardiac RyR2 is converted to a fully open subconductance Ca2+ release fluxes produced extended sparks with proportionally state with -50% of full conductance by ,tM ryanodine in single larger maintained F/Fo. These results support the idea that cardiac channel recordings. At -30 mV (current from cytoplasm to lumen), Ca + sparks result from Ca2+ release fluxes that decay with time. the probability of opening (Po) was reduced to less than 0.27 at pCa 10 when EGTA was added to the cis (cytoplasmic) side with 357-Pos Board # B219 an EC50 value of pCa -8. At +30 mV, however, the Po of the INSERTION OF GREEN FLUORESCENT PROTEIN INTO ryanodine-modifled channel was only marginally altered at pCa CARDIAC RYANODINE RECEPTOR: FROM GENE 10. No significant Ca2+ inactivation was observed for ryanodine- FUSION TO STRUCTURE modified channels at either -30 mV or +30 mV. The opening of Zheng Liu', Jing Zhang2, Pin Li2, S.R. Wayne Chen2, Terence unmodified Ca2+ channels is Ca2+ sensitive, with an EC50 value Wagenknecht'; 'Wadsworth Center, New York State Dept. of of pCa -6 at both + and - 30 mV and IC50 values ofpCa 2.2 at - Health, Albany, New York 12201, 2Dept. of Physiology & 30 mV and 2.5 at +30 mV. Mg2+ decreased the Po of the Biophysics, Univ. ofCalgary, Canada ryanodine-modified channel at low Ca2+ concentrations at both - The type 2 ryanodine receptor (RyR2) is the major calcium release 30 and +30 mV. [3H]ryanodine dissociation from the high-affinity channel in cardiac muscle. In previous studies we purified binding site was found to be Ca2+ sensitive with an IC50 of pCa recombinant mouse RyR2 protein and analyzed its three- 7.1. High concentrations of unlabeled ryanodine prevented dimensional structure by cryo-electron microscopy and single [3H]ryanodine dissociation, but ruthenium red accelerated particle image processing. In the present study, we expressed a dissociation. These results suggest that ryanodine sensitizes Ca2+ green fluorescent protein (GFP)-tagged mouse RyR2 in HEK293 activation of the Ca2+ release channel through an allosteric cells. The GFP was inserted into the amino acid sequence of mouse

73a 359-364 POSTERS Sunday

interaction and high affinity ryanodine and Ca2+ binding sites are Calcium release from cardiac and skeletal muscle sarcoplasmic linked through either short- or long-range interactions. reticulum (SR) mediated by ryanodine-sensitive Ca channels (RyR) is a key step in EC coupling. RyR complexes are extremely 360-Pos Board # B222 sensitive to changes in local redox environment. We found that rat STATISTICAL ANALYSIS OF SINGLE RYANODINE cardiac SR rapidly oxidized NADH in the absence of exogenous CHANNELS electron acceptors (V,,,,, l0amolmg/min; K., 70.2,uM). Oxidation Rafael A Rosales', Carlos A Villalba-Galea2, Claudia Kettlun3, was very sensitive to structurally diverse inhibitors including Michael Fill3, Ariel L Escobar2; 'IVIC, Venezuela, 2TTUHSC, pyridaben, rotenone, and antimycin A (IC5o = 2.2, 3.3, and 13.1 3Loyola University Chicago nM, respectively), known blockers of mitochondrial electron Cardiac ryanodine receptor channels (RyRs) play a fundamental transfer. Identical preparations of rat skeletal SR exhibited >10- role in intracellular Ca2+ dynamics. The processes of activation, fold lower NADH oxidase activity. NADH oxidation was inactivation and regulation of these channels have been the subject correlated to inhibition of CICR in vesicle flux (IC50 = 120M) of intensive research and a focus recent debates (JGP 116:865-). and single channel measurements, and inhibitors eliminated the Typically, approaches to understand these processes involve suppressive effect of NADH on CICR. The photoaffinity probe statistical analysis of single RyRs, involving signal restoration, [3H]diazirinylpyridaben was utilized to localize the domain model estimation and selection. With few exceptions (Saftenku et. responsible for NADH oxidation. Surprisingly nanomolar al., BJ 80:2727-,2001) these tasks have been performed following [3H]diazirinylpyridaben specifically labeled a protein with an rather phenomenological criteria. Here, a thorough statistical apparent molecular mass of 21 kDa identified as PSST protein in treatment is applied using an extension of the Markov chain Monte cardiac but not skeletal SR. The present work reveals that in Carlo method described in Rosales et. al. (BJ 80:1088-,2001). This cardiac SR NADH is a specific negative modulator of CICR by a approach differs from Saftenku in several fundamental aspects. novel mechanism that appears to require electron transfer. This Channels are modeled and restored using aggregated hidden modulation appears to be mediated through PSST protein which Markov models. Inferences are then made using Bayesian appears to be closely associated with RyR2. statistics. This combination allows the temporal resolution of the analysis to extend far beyond the limits of previous approaches. 363-Pos Board # B225 Contrary to standard likelihood maximization, our approach THE INTERACTION OF A NEGATIVELY CHARGED provides a direct measure of the uncertainties associated with RYANOID WITH RYR2 IS VOLTAGE DEPENDENT every estimation step. Analyses of single RyR gating at several Bhavna Tannal, William Welch2, John Sutko2, Luc Ruest3, Alan J [Ca2+]?s are presented and likelihood of twelve different Williams'; 'National Heart & Lung Institute, Imperial College of Markovian schemes was evaluated and ranked. Supported by Science, Technology & Medicine, Dovehouse Street, London, TTUHSC SEED Grant to A.E. and NIH-HL57832 to M.F. SW3 6LY United Kingdom, 2University of Nevada, 3University of Sherbrooke, Canada 361-Pos Board # B223 The probability of channel modification (P,,,,m) by both a neutral MODULATION OF CARDIAC RYANODINE RECEPTORS ryanoid (ryanodol) and a ryanoid with a net charge of +1 (21- (RyR2) BY DIVALENT CATIONS M(2+) amino-9a-hydroxyryanodine) increases as holding potential is Paula L. Diaz-Sylvester', Maura Porta', Alma Nani', Ariel shifted from negative to positive values. The total voltage Escobar2, Michael Fill', Julio A Copello'; 'Loyola University dependence of the interaction of ryanodol is approximately 70% of Chicago, Maywood, IL 60187, 2Texas Tech University, Lubbock, that of 21-amino-9a-hydroxyryanodine (Tanna et al. (2000) JGP: 116 TX 1-9) indicating that the bulk of the observed voltage dependence is The interaction of M(2+) ions with cytosolic (cyt) and lumenal derived from a voltage-driven alteration in receptor affinity. We have (lum) RyR2 binding sites was studied. With 50 mM Ca (lum) as monitored the influence of voltage on the interactions of a ryanoid charge carrier, only cyt. Ca (EC50 -1 FM) and Sr (EC50 -20 gM), with a net charge of -1 (10-0-succinoyhyanodol). Application of not Mg or Ba, acted as RyR2 activators. Mg and Ba decreased Po [,uM] of this ryanoid to voltage clamped RyR2 channels reslts in the of Ca, Sr or caffeine activated channels. High cyt. Ca or Sr (200 occurrence of more than one nmodfied-conductance state. As with gM) reversed Mg and Ba inhibition, suggesting that all tested neutral and cationic ryanoids, P,,,d increases as voltage is raised M(2+) cations compete for the same high affinity cyt site(s). In from -40 to +80 mV, reflecting increased rates of association and addition, there are non-selective, low affinity cyt M(2+) sites as Po decreased rates of dissociation. At 0 mV k0n is 0.0022 aM's4l, k0ff decreased similarly at high levels (mM) of any of these M(2+) 0.082 s1 and Kd 35.62 gtM. The data demonstrate that the qualitative cations. Cation action from the lum side was also tested. Maximal influence of voltage on the interaction of ryanoids is independent of Po of Ca activated RyR2 channels was higher when any lum the net charge of the ryanoid and are consistent with the proposal ihat M(2+) (compared to Cs+) was charge carrier. The EC50 of cyt Ca the bulk of voltage dependence arises from changes in receptor activation also varied with lum M(2+) charge carrier identity: Mg affinity. Funded bythe BHF and Wellcome Tnzs - Ba > Cs - Sr > Ca. The EC50 of caffeine activation also varied with lum M(2+) charge carrier identity: Mg > Cs > Sr > Ca. These 364-Pos Board # B226 data can only be explained if lum M(2+) ions act at both lum and THE BINDING OF 13HI-RYANODINE TO RyR2 IS cyt M(2+) sites. Action at cyt M(2+) sites requires lum M(2+) ions INFLUENCED BY CHANNEL BLOCKING CATIONS to pass through the channel. The possibility of "feed through" Bhavna Tanna, Duncan J West, Alan J Williams; National Heart M(2+) regulation was also supported by occasional synchronized & Lung Institute, Imperial College of Science, Technology & gating of 2 or 3 RyR2 channels when lum Sr or Ca was charge Medicine, Dovehouse Street, London, SW3 6LY United Kingdom carrier (Supported by NIH HL57832 to MF and AHAO130142N to Variations in the voltage-dependence of the interaction of neutral JAC). and charged ryanoids with RyR indicate that the binding site for 362-Pos Board # B224 ryanoids may be within the voltage drop across the channel (Tanna NADH OXIDASE ACTIVITY REGULATES CARDIAC et al. (2000) JGP: 116 1-9). We have investigated this further by RYANODINE RECEPTOR THROUGH PSST PROTEIN monitoring the binding of (3H]-ryanodine to RyR2 in isolated Gennady Cherednichenko', Franz Schuler2, Wei Feng3, John E sheep cardiac sarcoplasmic reticulum vesicles in the presence of Casida2, Saul Schaefer3, Isaac N. Pessah3; 'University of blocking cations. TEA and TBA are voltage- and concentration- California, One Shields Ave, Davis, California 95616, dependent blockers of K' current in single channels. Both cations 2Environmental Chemistry and Toxicology Lab, Univ of CA, act from the cytosolic face of the channel but interact at different Berkeley, 3University ofCalifornia, Davis locations (TBA at the cytosolic extremity of the voltage drop; TEA

74a Sunday POSTERS 364-369

90% into the voltage drop), with different effective concentrations 367-Pos Board # B229 (TBA FM; TEA mM) and different kinetics (TBA yields well ADENINE NUCLEOTIDE STRUCTURE AND THE resolved reduced-conductance events; TEA block is seen as a MODULATION OF CARDIAC RYR CHANNEL GATING. reduction in current amplitude). Both TBA and TEA inhibit the Wei Mun Chan', William Welch2, Rebecca Sitsapesan1; binding of [3H]-ryanodine to RyR2. A 50% reduction in binding is 'University ofBristol, United Kingdom, 2University ofNevada observed with 31 mM TBA and 486 mM TEA. These data indicate We have previously demonstrated that the electrostatic charge on that the interaction of [3H]-ryanodine with its high affinity binding the phosphate groups plays a primary role in enabling ATP to site in RyR2 is inhibited by blocking cations and is consistent with activate the cardiac RyR to high Po values (Chan et al. 2000, 130, the proposal that the ryanoid binding site is within the voltage drop 1618-1626). We have now examined if the structural features across RyR2. Funded by the BHF. correlated with high effectiveness (or high efficacy) are also 365-Pos Board # B227 correlated with high affinity for the ATP sites on RyR. Adenine SIZE EXCLUSION CHROMATOGRAPHY AS A RAPID nucleotide activation of single RyR channels incorporated into METHOD OF PURIFYING FUNCTIONAL RYANODINE planar phospholipid bilayers demonstrates the following order of RECEPTORS. effectiveness as measured by Po: ATP >ADP >AMP-PCP Duncan J West, Eileen CJ Smith, Alan J Williams; National Heart >adenosine >adenine >AMP. This differs from the order of affinity & Lung Institute, Imperial College of Science, Technology & for RyR, as measured by the EC50 values, where AMP-PCP Medicine, Dovehouse Street, London, SW3 6LY United Kingdom exhibits the highest affinity (AMP-PCP >ATP >adenosine >adenine >ADP >AMP). Comparative molecular field analysis The large molecular mass (Mr -2.3 MDa) ofthe ryanodine receptor (CoMFA) indicates that the adenyl and sugar fragments primarily (RyR) has resulted in density gradient centrifugation being the provide energy for ligand binding to the ATP sites while the preferred method of purifying functional RyRs from solubilized charge on the 3 and y phosphate groups promotes channel opening. this a membranes. However, method requires minimum of 18 hrs This work was the BHF to complete. This increases the probability of RyR supported by proteolysis/degradation. We have developed an alternative strategy 368-Pos Board # B230 using size exclusion chromatography (SEC) that can be used to TRANSMEMBRANE TOPOLOGY OF CARDIAC TRIADIN isolate RyRs in less than 2 hours. Using a 25 ml column, packed Anthony H Caswell, Neil R Brandt; University of Miami, P.O. with a gel matrix with a high fractionation range, we have purified Box 016189, Miami, Florida 33136 RyRs from cardiac muscle. RyRs are easily separated from other solubilized with'- 93% solubilized Cardiac triadin is an alternately spliced, abbreviated form of components of protein eluting skeletal triadin that contains a hydrophobic domain (A domain, in later column fractions. SEC-purified RyRs are isolated as intact residues 48 - 68) that carries the peptide chain from the cytoplasm tetramers and display typical functional behaviours (e.g. sensitivity into the lumen. The nature and role of a second short hydrophobic of ryanodine binding and channel gating to Ca24). The receptors domain (Bl domain, residues 101 - 105) is not known. We have are also indistinguishable from those purified by density gradient expressed GFP- triadin fusion proteins heterologously in centrifugation in terms of their ryanodine binding, electrophoretic eukaryotic cells, which contain an enzyne at the C terniinus that and ion conduction properties. The fold purification and yield reacts with a substrate predominantly in the cytoplasm and allows achieved with SEC is also comparable to that achieved by the sidedness of the C terminus to be determined. Triadin 2-98 conventional means. Therefore, this technique represents a quick gives a C terminus that is completely luminal. When triadin 2-117 and easy method of obtaining RyRs in a structurally and or triadin 2-267 are expressed, part of the product is a glycoprotein functionally intact state. (Supported by the BHF). with a cytoplasmic C terminus and part a protein with a luminal C 366-Pos Board # B228 terminus. Expression of triadin 79-117 or 79-267 gives a peptide NEOMYCIN BLOCK OF RYR2 IS MODIFIED BY that is strongly associated with the membrane, but does not cross CHANGES IN IONIC STRENGTH it. The short and relatively hydrophilic nature of the Bi domain Fiona C Mead, Alan J Williams; NHLI, Imperial College of together with its two modes of membrane association can be Science, Technology and Medicine, Dovehouse St., London, SW3 modeled by a structure in which the A domain stabilizes a 6LY United Kingdom hydrophilic core in the membrane, while the Bi domain forms a helix that crosses half the bilayer. The peptide returns to the We have previously shown that the polyamine neomycin is a aqueous space either by continuing alongside the A domain or by useful tool for investigating putative regions of negative charge in looping back to the lumen the helix ofthe BI domain. the conduction pathway of RYR2. Single channel studies have alongside indicated that neomycin is a partial blocker of the ryanodine- 369-Pos Board # B231 modified channel at both cytosolic and luminal faces of the MOST Ca LEAVING THE DYAD CLEFT IN HEART channel with 210mM K+ as the permeant ion (Mead & Williams CELLS IS CARRIED BY ATP (2000) Biophys. J. A191). Block at both faces is voltage Robert Anthony Haworth, Sivan Vadakkadath Meethal, dependent, indicating that neomycin can enter the voltage drop. In Katherine T. Potter, David Redon; Univ. Wisconsin, Clinical the current study, we demonstrate that changing the ionic strength Science Center 600 Highland Avenue, Madison, Wisconsin 53792 of the permeant ion has a dramatic effect upon neomycin block of Measured rates of Ca efflux from the dyad cleft into the cytosol the ryanodine-modified channel. Preliminary data show that in after entry via Ca channels in rat heart cells indicate that the Ca is 610mM K+, neomycin becomes less effective. Neomycin can still induce a retarded little by Ca binding sites which may be present in the partial block at the cytosolic face, but the blocking cleft, much less than is predicted by our model if such sites were characteristics are altered. The KD calculated at +60mV in 610mM present (Vadakkadath Meethal et.al. (2001), J. Mol. Cell. Cardiol. K+ - to is 21 iLM, compared 51.2nM in 21OmM KW. Voltage 33(6): A76). Since work in skeletal muscle has suggested that ATP dependence of block gives Kb(0) of 1.2±0.6mM in 610mM KW, can alter Ca flux rates by 50% or so (Baylor & Hollingsworth compared to 535±35nM in 210mM K+. Preliminary data show that (1998), J. Gen. Physiol. 112: 297-316), we have incorporated ATP there is no luminal block up to 2tLM neomycin. A reduction in into our model. 10mM ATP with 1mM free Mg results in about blocking efficacy by neomycin at high ionic strength indicates that 0.59mM free ATP. Without ATP, the calculated time to efflux polycation block involves interactions with fixed negative charge the enters at the from cleft of half of the Ca which via a 0.5msec Ca surface of the channel. Supported by the British Heart channel opening is 14.5msec, even with 20M fura-2 Foundation. present. Including 0.59mM ATP in the model, this time is calculated to be reduced to 1.8msec, and 90% of the Ca leaves the

75a 369-374 POSTERS Sunday

cleft bound to ATP. This large effect of ATP accounts for the 372-Pos Board # B234 small extent to which entering Ca is retarded, as seen RYANODINE RECEPTOR MUTANTS C4958S AND C4961S experimentally. The magnitude of this effect of ATP appears to be ARE INCAPABLE OF ORTHOGRADE SIGNALING AND so large because the geometry of the dyad cleft, in combination ENHANCE DEPOLARIZATION-INDUCED Ca2+ ENTRY with the Ca binding sites, retards Ca like an ion exchange column. IN 1B5 MYOTUBES These results show that it is even more important to incorporate Alanna M Hurnel, Douglas Wingrove2, Paul D Allen2, Isaac N. ATP into models ofCa fluxes in heart than it is in skeletal muscle. Pessah'; 'University of California, Davis, Veterinary Medicine: Molecular Biosciences, Davis, California 95616, 2Brigham & 370-Pos Board # B232 Women's Hosp., Dept. ofAnes. Res., Boston, MA 02115 A MONTE CARLO MODEL OF RYANODINE RECEPTOR GATING IN THE DIADIC CLEFT OF CARDIAC MUSCLE Skeletal E-C coupling involves both retrograde and orthograde Christian Soeller, Mark B. Cannell; Univ. of Auckland, Park signaling between the dihydropyridine receptor (DHPR) and the Road, Auckland, 1 New Zealand ryanodine receptor (RyR). We studied the functional importance of invariant Cys residues within a TXCFICG motif common to all In cardiac muscle signaling between sarcolemmal Ca2+ channels RyR and IP3R isoforms. lB5 dyspedic myotubes were transduced and ryanodine receptors (RyRs) occurs via calcium-induced with C4958S; C4961S or wildtype (WT) RyRI virions and all calcium release (CICR) in the narrow diadic space between t- three proteins were targeted to junctions. WT RyRI restored E-C tubules and terminal sarcoplamisc reticulum (SR). To capture the coupling and responded to caffeine and 1,4-chloro-m-cresol stochastic fluctuations of diadic [Ca2l and gain insight into cardiac whereas both mutant RyRs failed to respond. The function of the excitation-contraction (EC) coupling we have constructed a Monte mutants could not be rescued with high concentrations of Carlo model of the movements and binding of Ca2+ in the diad. ryanodine as recently reported for RyRI E4032A. However, The simulation was combined with gating models of RyRs. Using expression of C4958S and C4961S significantly enhanced Ca2+ models that give rise to stable cardiac EC coupling (Stem et al., J. entry into 1B5 cells in response to depolarization to K+ that was Gen. Physiol. 113:469489, 1999) we compared the variability in inhibited by nifedipine and depended on the presence of the time course of simulated calcium spar.ks (due to stochastic extracellular Ca2+. Ca2+ entry with C4958S exhibited variability in SR release flux) with corresponding variations in significantly slower rise-times than E-C coupling and was experimental data. The experimental data was obtained by sustained until K+ was removed. WT RyRl treated with recording calcium sparks at fixed repetitively active sites in field micromolar ryanodine elicits a similar phenotype to that observed stimulated ventricular myocytes. Preliminary calculations indicate with C4958S. These results reveal that Cys within TXCFICG are that the variations in experimental sparks are smaller than that in required for RyRl function, and their absence produces abnormal simulations where RyRs interact only via CICR. We are currently retrograde signaling to the DHPR. investigating whether allosteric coupling between receptors can reduce the variation in the simulated sparks and also testing if the 373-Pos Board # B235 flutuactions in local calcium concentration have a significant LOCALIZATION OF DIHYDROPYRIDINE RECEPTOR 11- impact on RyR gating. III LOOP:RYANODINE RECEPTOR INTERACTION BY This work was supported by the AMRF, the HRC and the CRYO-ELECTRON MICROSCOPY Wellcome Trust (UK). Ramon Trujillo', Zheng Liu', Montserrat Samsol, Vikram Pattanayak', Daniel A. Pasek2, Gerhard Meissner2, Terence Skeletal Excitation-Contraction Coupling I Wagenknecht'; 'N.Y. State Dept. of Health, 2University of North Carolina 371-Pos Board # B233 The intracellular II-III loop that connects domains II and III of the EFFECT OF MUTATIONS IN THE RyRl CAM BINDING dihydropyridine receptor is thought to mediate communication SEQUENCE ON INTERACTIONS WITH DHPR with the skeletal muscle ryanodine receptor (RyR) in skeletal Serap Sencer, Hongwei Zhang, Wei Tang, Jia-Zheng Zhang, muscle excitation-contraction coupling. A cloned, expressed Susan L Hamilton; Baylor College of Medicine, One Baylor Plaza, peptide (SDCL) corresponding to the amino-acid sequence of the Houston, Texas 77030 Il-Ill loop has been shown previously to interact in vitro with RyR The region of RYRI between amino acids 3614 and 3643 binds and to modulate its ion channel activity. Here we have incubated both apocalmodulin and Ca2+ calmodulin (Moore et al, isolated SCDL with purified, solubilized RyRs, and have Biochemistry, 1999, 38, 8532-8537). We have shown that this determined by cryo-electron microscopy and single-particle image region can also bind to the DHPR al subunit (Sencer et al, J. Biol. processing that a complex forms between the two that is of Chem., 276(41):38237-41). CaM binding to a synthetic peptide sufficient stability for structural characterization. Quantitative representing this sequence increases the affinity of the two lobes of comparisons of averaged receptor images from the SDCL:RyR CaM for Ca2. Meissner and coworkers (Yamaguchi et al, J. Biol. mixtures with those of control RyRs (no SDCL present) show the Chem., 2001, 276 (25):22579-85) have recently demonstrated that presence of additional mass density in the images of SDCL:RyR mutations within this region abolish CaM binding to RYRI. We that we attribute to RyR-bound SDCL. To maximize the formation have prepared synthetic peptides with these mutations and have of SDCL:RyR complexes, the binding reactions were carried out shown that these mutations decrease the affinity of the peptides for using concentrated solutions of the purified components, and then CaM with the greatest effect occurring at low Ca2+. However, the the reaction mixtures were diluted, applied to specimen grids and mutations have only minor effects on the interaction of the frozen within 2 s. SDCL appears to bind to one of the domains peptides with the DHPR, but CaM can no longer block the present in the clamp regions (corners) of the square-shaped interaction of the R3609-43 peptide with the DHPR. We conclude cytoplasmic region ofRyR. that different determinants within the 3614-3643 region of RYRI Supported by NIH RR0129, AR40615 (TW) and AR18687 (GM). are involved in CaM binding and interactions with the DHPR al subunit. 374-Pos Board # B236 R9 REGION OF RYR1 AS A NEGATIVE MODULE IN THE CROSS TALK WITH DHPR Eun Hui Lee"3, Feliciano Protasil, Isaac N. Pessah2, Do Han Kim3, Paul D. Allen'; 'Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts 02115, 2University of California, Davis, 3Kwangju Institute of Science and Technology, Korea, Republic of

76a Sunday POSTERS 374-378

We examined the critical region of RyRI important for functional mRNA was altered by agonists of stretch-activated channels. coupling between RyRI and DHPR using RyRl-RyR2 chimeras. Gadolinium enhanced DHPR but did not affect RyR gene Four chimeras (R4, R9, RIO, R16) (Nakai et al., JBC 1998) were expression. Together, these results show that regulation of the expressed in IB5 dyspedic myotubes using helper-free HSV-1 DHPR and RyRI genes is not strictly coordinated in vitro. amplicon virions (Wang et al., 2000). Single cell imaging of fluo-4 (Supported by the Physiology Development Fund and the NIH) fluorescence in the presence of La3+ and Cd2+ to block Ca2+ entry revealed that sensitivity of wtRyRI to caffeine (Caf) was 377-Pos Board # B239 significantly enhanced (EC5o from 1.48 ± 0.04 to 0.83 ± 0.09 mM), Ca+-INDUCED Ca+ RELEASE (CICR) IN DYSPEDIC whereas the sensitivity of RyR2, RIO, and R16 remained (RyRI NULL) SKELETAL MYOTUBES INDUCED BY unaffected. R4 and R9 showed decreased sensitivity to Caf DHPR P2a approximately 2-fold; suggesting the R9 region contributes a David C. Sheridan, Lindsay Mortenson, Roberto Coronado; negative influence on RyRI Caf sensitivity. However, blockade of University of Wisconsin, 1300 University Avenue, Madison, DHPR by La3+ and Cd2+ may also affect RyR sensitivity. We Wisconsin 53706 therefore utilized the more specific DHPR blocker nifedipine and Ca2+sparks are detectable in dyspedic embryonic intercostal found a similar left- shift of the caffeine dose response curve with myotubes suggesting expression of other RyR isoforms in this KO, wtRyRl, no influence on RyR2, RIO and R16, and right shifts with most likely RyR3 (Conklin et al, BJ 78:1777, 2000). We R4 and R9. These results suggest that the R9 region of RyRI (aa investigated if DHPR 3 isoforms present in tissues expressing 2659-3720) could contribute negative modulation of RyRI channel RyR3 could recover CICR in primary cultures of limb myotubes sensitivity to ligands through a conformationally sensitive from dyspedic mice (kindly provided by P. Allen). Ca2+ transients interaction with DHPR. were studied by confocal fluo4 fluorescence in voltage-clamped RyRI KO myotubes transfected with either Pla, the endogenous 375-Pos Board # B237 skeletal isoform, or ,B2a, the cardiac/brain isoform. As expected, DHPR AND RyRI EXPRESSION DURING MATURATION Pla failed to recover Ca2+transients. Surprisingly, [2a recovered a OF SKELETAL MUSCLE IS MUSCLE TYPE-SPECIFIC robust slow L-type Ca2+current (peak ICa2+= 5.0 + 0.2 pA/pF) and T L Radzyukevich, M H Cougnon, A E Moseley, Judith A Heiny; ofCincinnati Ca2+transients sensitive to caffeine, ryanodine and external Ca2?. University P2a generated a slow-evolving Ca2+ transient with a bell-shaped Formation of the membrane structures of EC coupling is advanced voltage dependence (AF/F max.l°mv= 0.07 + 0.02; AF/F maxi+3"v= in the diaphragm (DIA) compared to limb muscles (Franzini- 0.34 + 0.09; AF/F max+90mv= 0.08 + 0.01). The kinetics of the Armstrong 1991). This suggests that expression of the Ca2+charge entering the cell and the kinetics of the Ca2+ transient dihydropyridine (DHPR) and ryanodine (RyRi) receptors in vivo is superimposed well over a wide range of potentials. These data coordinated in a muscle-specific manner. To examine this hypothesis we compared DHPR and RyRI protein and mRNA in strongly suggest that 02a, but not ,la, has a preferential ability to the DIA and hind limb (HL) muscles of mice from late embryonic implement CICR involving the skeletal DHPR and, presumably, through 6 weeks postnatal. DHPR and RyRI were expressed RyR3. Tissue-specific DHPR j isoforms might serve to colocalize concurrently in both muscles and increased steadily up to 6 weeks DHPRs and RyRs in different tissues. postnatal; this overall pattern was advanced in the DIA compared 378-Pos Board # B240 to HL. We examined whether motor innervation or contractile THE C-TERMINUS OF THE SKELETAL activity influences this pattern, since it is known that the DIA and and exhibit DIHYDROPYRIDINE RECEPTOR Pla SUBUNIT limb muscles become innervated spontaneous DETERMINES THE RATE OF RISE OF THE Ca+ contractile activity at different times. We subjected HL muscles to TRANSIENT. denervation or tenotomy at day P5 when DHPR and RyRl David C. expression are just starting to increase. DHPR and RyRI mRNA Sheridan, Weijun Cheng, Lindsay Mortenson, Roberto expression continued together under both conditions. These results Coronado; University of Wisconsin, 1300 University Avenue, indicate that muscle-specific regulatory mechanisms exist to direct Madison, Wisconsin 53706 DHPR and RyRI expression during early development and these Ca2+ transients were analyzed by confocal fluo-4 fluorescence in do not require motor innervation or contractile activity. (Supported voltage-clamped ,B1 KO myotubes expressing Pla, J2a, and by Physiology Development Fund and NIH) several chimeras. Ca2+ transients recovered by Pla have a sigmoidal AE/F vs. voltage curve (AF/F+30mv/AE/F+9Ov =1) 376-Pos Board # B238 independent of external Ca2+ and stimulus duration. Ca2+ transients REGULATION OF SKELETAL MUSCLE DHPR AND RyRl recovered by f2a varied with external Ca2+ and pulse duration and EXPRESSION IN VITRO produced a bell-shaped AF/F vs. voltage curve (AF/F+3omV/ M A Fuse, T L Radzyukevich, Judith A Heiny; University of AF/F+90mv =2.9) centered at +30 mV. A 02-j31 chimera with the Cincinnati last 54 residues of 1la ([2a 1-419 / JIla 470-524) recapitulates Skeletal muscle dihydropyridine (DHPR) and ryanodine (RyRl) full-length ,la. A reverse f31-f2 chimera (pla 1-325 / 52a 287- receptors are calcium channels of the triad junction that play a key 604) produces weak, Ca2+-dependent EC coupling. In 5la, the role in excitation-contraction coupling. We previously reported upstroke of the Ca2+ transient had two components: a fast, step-like that mechanical stretch is a potent stimulus of DHPR gene increase in fluorescence completed in -20 ms followed by a expression and that it may work in part through a calcium slower-rising component that persisted for the duration of the signaling pathway (Radzyukevich and Heiny, Biophysical J pulse. In 5 constructs analyzed, absence of the C-terminus of Pla 78:2554, 2001). Other studies have shown that these proteins are (last 54 residues), by either chimeric replacement or truncation, also regulated developmentally and by muscle activity, but the resulted in a loss of the fast component of the Ca2+ transient, regulatory mechanisms remain largely undefined. In the present bending of the AF/F vs. voltage curve, and external Ca2+ study we investigated whether RyRI gene expression is regulated dependence. These results strongly suggest the C-terminus region in parallel with DHPR expression in vitro. We measured DHPR of plays an active role in and RyR mRNA in primary adult EDL and soleus muscles that Pla structural/signaling fast, voltage- were maintained in culture and subjected to a manipulations that dependent, skeletal-type EC coupling. are known to modify DHP expression. We found that RyR gene expression is less sensitive to mechanical stretch and electrical stimulation than the DHPR, while it is more strongly affected by calcium channel blockers (nifedipine). Neither DHPR nor RyR

77a 379-383 POSTERS Sunday

receptor a, subunit into the TT-SR junction. The following types 379-Pos Board # B241 of GFP-tagged a, subunits were expressed in a,s-deficient GLT A NOVEL alS/Gla INTERACTION IN THE DHPR OF myotubes and compared with regard to their intracellular Ca SKELETAL MUSCLE RELEVANT TO EXCITATION- kinetics: aXs, aC, alA (brain, P/Q-type, lacking the targeting CONTRACTION COUPLING signal) and a,,11S92.dip) (a truncated axA-als chimera containing Weijun Cheng, Xiaojie Cao, David C. Sheridan, Roberto the targeting sequence). The total cytoplasmic Ca input flux Coronado; University of Wisconsin, 1300 University Ave., (originating from Ca current and SR Ca release) at 100 ms step Madison, Wisconsin 53706 depolarizations was calculated based on models for intracellular Ca Interactions between the alS and Pla subunits of the skeletal binding. Cells expressing als showed the fastest activation and the DHPR are critical for the function of this multi-protein complex largest flux peak followed by a distinct slowly decaying shoulder. and are, for the most part, unknown. We used a pull-down assay of Despite a much larger mean Ca inward current, the calculated flux recombinant GST-la and in-vitro translated alS fragments to of a,c expressing cells had less than half the amplitude consistent determine alS /lla binding domains. Full-length Pla (pla 1-524) with less effective TT-SR interaction (lack of conformational bound strongly to the I-Il loop (al S 334-432) and weakly to the II- coupling). a,A caused a still smaller input flux consistent with lack III loop (calS 666-799) and the C-terminus (calS 1380-1873) of of specific targeting to the TT-SR junction. On the other hand, in calS. The I-II loop interaction was mapped to two regions of Pla, alXAM(592.diprtransfected cells flux signals were larger than in a,A- the well-known BID region (pla 250-300) and a conserved SH3 cells in agreement with a restored focal Ca-induced Ca release domain in the P subunit (pla 130-180) not previously known to component due to ofthe channels to the bind to al subunits. Deletion of the BID region alone in a full- specific targeting junction. length Pla did not entirely abolish xalS/pla binding but deletion of 382-Pos Board # B244 critical residues in both regions abolished binding entirely. The RYANODINE AFFECTS DHPR POSITIONS VIA RYR: BID and SH3 fragments were expressed in normal cultured EVIDENCE FOR CONFORMATIONAL COUPLING. myotubes. Each had a strong negative-dominant effect inhibiting Cecilia Paolinil, J D Fessenden2, I N Pessah3, Clara Franzini- the voltage-activated Ca2+ transient. Similar inhibitory effects were Armstrong; 'University of Pennsylvania, 421 Curie Blvd, seen in PI KO myotubes expressing a full-length Pla lacking the Philadelphia, Pennsylvania 19104-6058, 2Brigham & Women SH3 domain. Thus, binding of the SH3 region to the I-II loop is Hosp., 3UCD functionally significant. This novel Pla SH3/alS I-II loop interaction could play a role in skeletal EC coupling given the alsDHPR and RyRI of skeletal muscle interact directly and are known participation of lIa in this process. linked in a stereo-specific manner four DHPR match the spatial organization of the four RyR subunits. RyR-associated DHPR are 380-Pos Board # B242 located at the corners of small squares, forming tetrads visible in EFFECTS OF Ti SUBUNIT DEFICIENCY ON DHP freeze-fracture replicas. Ryanodine induces substantial and RECEPTOR INACTIVATION AND RECOVERY. persistent conformational changes in RyR, locking it in a closed Daniel Ursu , Burkhard Dietze', Stephane Sebille', Doris Freise2, state by binding to first high and then low affinity sites. Since RyR Veit Flockerzi2, Werner Melzerl; 'University of Ulm, Albert and DHPR are linked, it is possible that a conformational change in Einstein Allee 11, Ulm, D-89069 Germany, 2University of RyR affects DHPR positioning. We tested this hypothesis using Homburg, Germany two cell lines, BC3H1 and RyR-expressing IB5, which develop extensive clusters of associated al sDHPR and RyRI. The cells Previous studies on myotubes of yl -deficient mice had shown a modest enhancement of L-type Ca inward current density (Freise were treated with 500 FM ryanodine for 24 hrs, freeze-fractured et al.2000) and intracellular calcium release rate (Ursu et al. 2001). and rotary shadowed. We compared the center to center distances In addition, a voltage-dependent suppression of Ca current between individual DHPR within tetrads of ryanodine-treated and inactivation has been reported. The present study focussed on untreated cells. Although distances are somewhat variable due to inactivation and recovery from inactivation. Properties of this minor distortion during fracturing, ryanodine treated tetrads process were investigated in both L-type current and excitation- consistently show a small decrease in intratetrad spacings. These contraction coupling. In myotubes derived from satellite cells of results suggest that ryanodine induces structural changes in the adult mice, the extent and time course of inactivation were studied cytoplasmic RyR domain that interacts with DHPR and further by inspecting the inward current during 15 to 30 s depolarizing indicate that the DHPR-RyR complex acts as a single unit, pulses. Recovery from inactivation after 30 s of depolarization to supporting a conformational coupling between the channels. +20 mV was determined by applying consecutive short (100 ms) 383-Pos Board # B245 pulses at various holding potentials. The kinetics of inactivation INTRAMEMBRANE CHARGE MOVEMENT AND L-TYPE and recovery were slower in the yyl-deficient cells at most of the CALCIUM CURRENT IN SKELETAL MUSCLE FIBERS investigated potentials. Fibre bundles dissected from mature ISOLATED FROM CONTROL AND MDX MICE extensor digitorum longus (EDL) muscle were stimulated by Vincent Jacquemond', Claude Collet', Laszlo Csernoch2; solutions containing 120 mM potassium. The potassium 'University Lyon 1, Bat. Darwin B, Villeurbanne, 69622 France, contracture increased 3-fold in the yl-I- preparations, possibly due 2University od Debrecen, Nagyerdei krt 98, Debrecen, H-4012 to a slowing of inactivation of the voltage sensor for EC coupling. Hungary Recovery from inactivation, tested by consecutive short (500 ms) tetani was Intramembrane charge movement and calcium current were slowed and substantially suppressed. measured in separate sets of experiments, in single skeletal muscle 381-Pos Board # B243 fibers from control and mdx mice, using the silicone-voltage clamp CELLULAR CA FLUXES DEPENDING ON THE TYPE OF technique. In control fibers, the voltage distribution of charge EXPRESSED CA CHANNEL ai SUBUNIT IN DYSGENIC followed a two-state Boltzmann distribution with values for MYOTUBES. maximal charge, mid-point voltage and steepness of 23 ± 2 nC4ItF, Ralph Peter Schuhmeier', Elodie Gouadon', Nicole Kasielke2, -37 ± 3 mV and 13 ± I mV (n=7). The voltage dependence ofthe Bernhard E. Flucher2, Manfred Grabner2, Werner Melzer'; decay time constant of the "on charge" was bell-shaped with a 'University of Ulm, Albert-Einstein-Allee 11, Ulm, 89069 mean maximum value of 5.7 ± I ms at a mid voltage of-31 ± 4 Gernany, 2University ofInnsbruck, Austria mV (n=6). The time constant of charge recovery from the In skeletal muscle, a C-terminal 70 aa sequence contains a inactivated state was -6 s. In mdx fibers, values for all these targeting motif responsible for the proper incorporation of the DHP parameters were essentially identical to those obtained in control fibers. The maximal amplitude of the slow calcium current was

78a Sunday POSTERS 383-388

also within the same range in the two populations. However, in Villeurbanne, F-69622 France, 2Dept of Physiology, Univ. of mdx fibers the half-activation voltage was -5 mV more negative, Wisconsin, Madison, WI 53706 and the apparent reversal potential was -10 mV more positive than Caveolae are surface membrane invaginations that form specific in control fibers, respectively. Overall results show that the microdomains and are thought to play an important role in silicone-clamp technique can be readily used for measuring charge myogenesis. Cholesterol is a major constituent of caveolae and movement and calcium current in skeletal muscle fibers, and that depletion of membrane cholesterol leads to caveolae disruption. some properties of the L-type calcium channels are modified in the We studied the effects of methyl-o-cyclodextrin, a cholesterol- mdx mouse model. sequestering agent, on the electrophysiological properties of 384-Pos mammalian skeletal muscle cells. Exposure of freshly isolated fetal Board #.B246 mouse myotubes to 3 mM cyclodextrin for 1 hour led to important The CaM BINDING SITE (IQ MOTIF) OF als MAY BE modifications of membrane properties. Action potentials could still INVOLVED IN EC COUPLING be evoked after cyclodextrin treatment. However, the ratio cell Katarina Stroffekova, Kurt G Beam; Colorado State University, membrane capacitance to cell surface was decreased. For a given W 315, A-Z Bldg., Fort Collins, Colorado 80523 cell size, the capacitance of treated cells was reduced by about Ca2+-dependent inactivation of cardiac L-type Ca2+ channels is 20% in the presence of cyclodextrin. L-type Ca2+ current density abolished by mutation of the "IQ motif', a calmodulin binding site (measured in pA/pF or pA/gm2) and total L-type Ca2+ current per in the carboxyl tail of a,c (J. Biol. Chem. 275: 21121-21129). cell were significantly reduced after exposure to cyclodextrin. In Here, we have investigated the role of the IQ motif in tXts on the contrast, the T-type current was not affected. In addition, treatment function of the skeletal muscle DHPR. In normal myotubes, the of cultured myotubes with 1 mM cyclodextrin for 60 minutes inactivation of L-type Ca2+ current during 800 ms depolarizations disrupted excitation-contraction coupling. These results suggest showed a bell-shaped voltage dependence with a maximum of that the removal of membrane cholesterol drastically affects -40% (n=20) at a potential close to that eliciting maximal current, dihydropyridine receptor function and that caveolae may play a suggesting a role of Ca2+ entry. To examine if the IQ motif is role in this function. involved in this inactivation, we mutated both residues of cxis to alanine (AA-als), followed by expression in dysgenic (ais-null) 387-Pos Board # B249 myotubes. Dysgenic myotubes expressing AA-als displayed THE 720-765 REGION OF THE DHPR II-III LOOP neither electrically evoked contractions (n=56) nor measurable L- MODULATES EXITATION-CONTRACTION COUPLING type Ca2+ current (n7=40). To determine if the mutation prevents BUT IS NOT ESSENTIAL targeting to the sarcolemma, we measured maximal, Chris A. Ahern, Dipankar Bhattacharya, Lindsay Mortenson, immobilization-resistant charge movement at +40 mV (Q,.). Q.,,X Roberto Coronado; University ofWisconsin, Madison, WI 53706. in dysgenic myotubes expressing AA-als (7.8 nC/jtF, n-l1) was We investigated the EC coupling signal produced by residues 720- substantially larger than in control dysgenic myotubes (4.1 nC/4F; 765 of the II-Ill loop previously identified by chimeric DHPRs. n = 10), suggesting that AA-als targets to the sarcolemma and that ml S expression was carried out in dysgenic als-null myotubes and the IQ mutation disables the function of ocis as Ca2+ channel and analyzed by voltage-clamp and confocal fluo-4 fluorescence. EC voltage sensor for EC coupling. Supported by NIH (AR44750 to coupling is entirely eliminated by deletion of residues 720-765 and KGB) and MDA (KGB, KS). by deletion or scrambling of residues 724-743. Deletion of residues 671-690 had no functional consequence. Ca2+ transients and Ca2+ 385-Pos Board # B247 currents of a moderate magnitude were recovered by the double ACTIVATION AND INHIBITION OF RYR GATING BY A deletion A671-690/A720-765. To test for Ca2'-entry independent DHPR II-III LOOP PEPTIDE EC coupling, a pore mutation (E1014K) known to entirely abolish Mark L Bannister', Alan J Williams', Rebecca Sitsapesan2; the inward Ca2+ current was introduced. A671-690/A720- 'NHLI, Dovehouse St., London, SW3 6LY United Kingdom, 765/E1014K expressed Ca2+ transients with Boltzmann parameters 2University ofBristol, United Kingdom identical to those of the Ca2t-conducting double deletion construct. Peptides based on the N-terminal region of the skeletal muscle Thus skeletal-type EC coupling is not uniquely controlled by dihydropyridine receptor (DHPR) have been shown to regulate residues 720-765. We suggest this region could be critical for the ryanodine receptor (RyR) channel activity in planar lipid bilayers. conformational state of the DHPR and may modulate EC coupling Since secondary structure is an important determinant of efficacy signals generated elsewhere. D744DEEDE749 and other residues in such model systems, we have selected a sequence of 26 residues could form a lattice of negative electrostatic charges stabilized by (Ala677-Asp692) whose helical content is predicted to match that of the positive charges provided by R68"KRRK685. Removal of 720- the corresponding protein sequence. 0.I-lItM cytosolic peptide 765 would thus require removal of 671-690 for maintenance of II- increased the open probability (Po) of RyR channels by 2 to 50- III loop stability. fold (n=5, skeletal) or 3 to 40-fold (n=3, cardiac) through increases in both the frequency and duration of opening events. Channel 388-Pos Board # B250 activity was inhibited by peptide concentrations of 1 0tm and A FRAME-SHIFT MUTANT OF THE DHPR PORE above. This effect was more evident for channels that had been SUBUNIT (als) EXPRESSING TWO COMPLEMENTARY activated to a high Po with the caffeine analogue EMD 41000: Po PROTEIN FRAGMENTS was then reduced by up to 96% (n=3, skeletal) or 98% (n=3, Chris A. Ahern, Lindsay Mortenson, Patricia A. Powers, Roberto cardiac). Traces for peptide-activated channels were also Coronado; University ofWisconsin, Madison WI 53706. characterized by the appearance of substates, typically at 30 or 70 We characterized a frame-shifted mutant of ais (fs alS) generated % of the full conductance level. Similarities and differences with by a PCR error in which an extra base became inserted next to the other published results will be highlighted. codon for Leu670 in the II-III loop of aclS. The change in reading Supported by the BHF frame introduced a mutant residue at position 671 followed by a 386-Pos stop codon. Truncation of the al S protein was confirmed by an Board # B248 immunoblot. When expressed in dysgenic myotubes, fs al S has CHOLESTEROL DEPLETION AFFECTS the unusual ability to function as EC coupling voltage sensor by DIHYDROPYRIDINE RECEPTOR FUNCTION IN virtue of expressing two complementary hemi-Ca2+ channel SKELETAL MUSCLE CELLS fragments. fs-als expressed the N-terminal half of a,s (Ml to Caroline Strube', Leah Carbonneau2, Sylvie Blaineaul, Roberto and Christine Berthier'; UMR UCB-Lyon L670) the C-terminal half starting at M701 separately. Coronado2, 'CNRS 5321, 1, Expression of the C-terminal fragment was confirmed by an

79a 388-393 POSTERS Sunday

immunoblot and was generated by a rare restart of translation of 391-Pos Board # B253 the fs-als message at M701. The C-terminal fragment was STRUCTURAL DOMAINS OF HUMAN SORCIN: A eliminated by a Met to Ile mutation at position 701. The data NOVEL CALCIUM- BINDING PROTEIN MODULATOR indicates that protein-protein complementation between the two OF RYANODINE RECEPTORS hemi-Ca2+ channel fragments produced recovery of skeletal-type Anaid Antaramian, Nancy A Benkusky, Christopher R. Bartley, EC coupling but not L-type Ca24 current, consistent with previous Patricia A Powers, Hector H. Valdivia; University of Wisconsin, results (Ahern et al, PNAS 98:6935, 2001). It is suggested that an 1300 University Av., Madison, Wisconsin 53706 intact II-111 loop is essential for coupling the DHPR voltage sensor Sorcin is widely expressed in mammalian tissues but its function to opening ofthe L-type Ca2+ channel but not for EC coupling. remains unknown. In ventricular myocytes, Sorcin modifies the 389-Pos Board # B251 kinetics of Ca2+ sparks and the amplitude of ICa, presumably by ROLE OF D2 DOMAIN IN SKELETAL-TYPE E-C undergoing a Ca2+-dependent conformational change that allows it COUPLING to translocate from cytosolic to membrane-bound components. In Claudio F Perez, P D Allen; Brigham and Women's Hospital, 75 vitro, this conformational change may be tracked by fluorescence Francis Street, Boston, Massachusetts 02115 quenching of its tryptophan residues. Sorcin is also phosphorylated by PKA, but the role of phosphorylation is unknown. We cloned Although the aa sequence identity among the three RyR subtypes and expressed human Sorcin and several Sorcin mutants to test the is 67-70%, there are three divergent regions (domains DI, D2, and role of specific amino acids on phosphorylation and Ca2+- D3). The D2 domain of RyRl (RI) corresponds to a sequence that dependent conformational changes. Wild-type Sorcin and the is almost entirely absent in RyR3 (R3). D2 has been implicated mutants F186L, F186D, E53Q, E94Q and T178A all undergo Ca2+- previously as a critical region for depolarization induced Ca2+ dependent conformational changes, however, F186D, where the release in the absence of extracellular Ca2+(skeletal-type E-C Phe is presumably responsible for sorcin dimerization, displays a coupling (Sk-ECC)). Although RI/R3 chimera lacking this domain 2-fold decrease in Ca2+ sensitivity. The Thr at position 178 is part can restore Sk-ECC to dyspedic myotubes they do not restore it as of a consensus sequence for PKA phosphorylation and its well as R2/RI chimeras or wtRl. We developed chimeric R3 replacement by Ala effectively decreases Sorcin phosphorylation receptors containing the D2 region of RI (aa 1271-1456) R3D2 by -66%, suggesting that the Ser in position 156 can also be and demonstrated that R3D2 significantly increased the number of phosphorylated. On the other hand, Ca2+-driven conformational dyspedic myotubes displaying de?olarization-induced Ca2+ release changes of Sorcin result from the concerted movement of several in the presence of extracellular Ca + (Cd-ECC) from 28%, in R3, to amino acids with dimerization playing an important role. 73.2% in R3D2. However, R3D2 did not restore Sk-ECC. Addition of D2 into chimera Ch4 (RI: 1681-3770), which was 392-Pos Board # B254 previously shown to restore Sk-ECC, significantly increased its HOMER REGUALTES GAIN OF RYANODINE efficiency. D2 increased the number of Ch4 expressing cells RECEPTOR COMPLEX displaying Sk-ECC from 36% to 81% and increased the average Wei Fenp1, Jiancheng Tu2, Tianzhong Yang3, Paul F Worley2, Paul intensity of the response to that displayed by myotubes expressing D. Allen, Isaac N. Pessah'; 'University of California, Davis, VM: wt-R1. These results indicate that although the D2 domain is not Molecular Biosciences, Davis, California 95616, 2The Johns sufficient to confer Sk-ECC to RyRI it does play a significant role Hopkins University School of Medicine, 3Brigham and Womens in its efficiency. Supported by NIH ARI 7605 Hospital 390-Pos Board # B252 The family of Homer proteins binds to proline-rich sequences ROLE OF THE TM2 SEQUENCE IN Ca2+ ACTIVATION within mGluR-1, IP3R and the Shank family of proteins. The OF RYRS association may play a role in regulating cross-linked protein Dawei Jiang', Pin Li', Katsuto Ebisawa', S.R. Wayne Chen2; complex involved in signal transduction. The Homer ligand 'University of Calgary, Canada, 2University of Calgary, 3330 sequence is present in RyRI (Beneken et al., 2000) and Homer Hospital Drive NW, Calgary, Alberta T2N 4NI Canada proteins are expressed in cardiac and skeletal muscle (Xiao et al., 1998). In this study we examined in vivo the association and direct We have shown previously that mutation to Ala of Glu3885 in interaction of Homer with RyRI by using co-immunoprecipitation RyR3 or Glu3987 in RyR2 located in the predicted transmembrane and GST pulldown assays. Specific [3H]Ry binding measurement segment TM2 reduced the sensitivity of RyR to Ca2+ activation and single channel recording showed that Homer 1 EVH1, HIC dramatically. Here we investigate the role of TM2 in RyR Ca2+ and its fusion protein GST-H1C significantly enhances [3H]Ry sensing by site-directed mutagenesis. Residues S3882, N3887, occupancy and channel open probability. The mechanism of HIC N3890, T3892, K3895, and D3899 in RyR3 were each mutated to involves a 6 to 8-fold increase in gain of RyRl toward known Ala. The effect of these mutations on Ca2+ activation was activators Ca2+ or caffeine. The specificity of HIC toward examined by [3H]ryanodine binding. All these mutants showed modulating RyRI was ascertained with synthetic "blocking" EC50s similar to that of wt. To examine the role of side chain peptide that mimic the homer binding domain within mGluR-l, charge and size, we replaced E3885 with Asp, Gln, Cys, Lys or and a point mutation of this blocking peptide. Intact myotubes Trp. [3H]ryanodine binding showed that E3885D had little effect expressing F1777R RyRI, a mutation within a putative Homer- on Ca2+ sensitivity; E3885Q and E3885C reduced the Ca2+ binding motif, exhibited the anticipated reduction in responses to sensitivity by -1,000 fold, similar to E3885A; while E3885K and caffeine. These findings taken together reveal the specific E3885W decreased the Ca2+ sensitivity by -10,000 fold. To assess protein:protein interaction between HI and RyRl that regulates the the importance of the positioning of the Ca2+ sensing glutamate, gain associated with RyRl-mediated Ca2+ release in normal muscle we relocated it to different positions within TM2 by generating cells. double mutants. Residue S3984, N3989, V3990, V3991 or T3994 in RyR2 mutant E3987A was changed to Glu. Ca2+ release assay 393-Pos Board # B255 revealed that mutations N3989E, V3990E, and V3991E but not TRANSMEMBRANE TOPOLOGY OF THE RYANODINE S3984E and T3994E in mutant E3987A restored caffeine-induced RECEPTOR. Ca2+ release in transfected HEK293 cells. Further investigation of Anthony H Caswell, Neil R Brandt; University of Miami, P.O. these double mutants is currently in progress (Supported by CIHR Box 016189, Miami, Florida 33136 and HSFA to SRWC). Although the ryanodine receptor (Ryr) is a major Ca2+ channel responsible for activating muscle, its membrane topology has not been fully determined. Each of the transits proposed by Zorzato et

80a Sunday POSTERS 393-397

al. (1990) was first tested individually for membrane association in [Ca21, increased to a plateau, reintroduction of 2.5 mM Ca2' GFP constructs by observation of their subcellular distribution. further increased [Ca21i. Pre-exposure to 1 mM lanthanum or 1 Transits 4 - 10 were localized to subcellular membranes. GFP- Ryr gM okadaic acid, but not 10 gM Xestospongin D (1P3 receptor fusion proteins have been expressed, which contain an enzyme at blocker) prevented increase in [Ca21,. In other cells, following IC.c the C terminus that reacts with a substrate predominantly in the activation, the SR was refilled by washing out CPA, nifedipine and cytoplasm and allows the sidedness of the C terminus to be KCI. When the protocol was repeated in the presence of halothane, determined. Expressed fusion peptides have been evaluated with there was no increase in [Ca2li when extracellular Ca2+ was this technique starting at the N terminal side of the first membrane introduced. These data demonstrate 1) I. in porcine ASM cells associated domain (MAD) and extending in sequential constructs are not linked to IP3 receptors, and 2) volatile anesthetics prevent through all the putative MADs to the C terminus and in addition SR refilling via I contributing to ASM relaxation. constructs that contain each single MAD have been assayed. We Supported by NIH grants GM56686 (GCS) and GM 57816 (YSP). have pieced together the following model of the MADs of the protein: Seven MADs are in roughly the position of transits 4 - 10 396-Pos Board # B258 of Zorzato et al. One (MAD 4) crosses the membrane to initiate EFFECTS OF DIDS ON SINGLE Ca2+ RELEASE CHANNEL luminal sequences. The others exit on the same side as their entry. BEHAVIOR OF SKELETAL MUSCLE MAD 4 does not cross the membrane as a simple a helix, but is In-Ra Seo, Do Han Kim; KJIST, Korea, Republic of segregated into two hydrophobic segments (A and B) hinged by a Evidence has suggested that an anion channel blocker, DIDS could 5 aa hydrophilic sequence of which A undergoes the full transit by trigger Ca release from skeletal sarcoplasmic reticulum (SR) by itself. binding to a 30 kDa protein (BBRC 210:1120, 1995). The present study examined the effects of DIDS on rabbit skeletal Ca release 394-Pos Board # B256 channel (CRC) in planar lipid bilayers. When junctional SR THE DANTROLENE BINDING SITE ON THE SKELETAL vesicles were used for channel incorporation, DIDS increased Po MUSCLE RYANODINE RECEPTOR COMPRISES AMINO without affecting unitary conductance. Analysis of lifetime for ACIDS 590-609 single CRC showed that DIDS induced a new open time Kalanethee Paul-Pletzerl, Takeshi Yamamoto2, Noriaki component (3rd), contributing to long-lived open states. DIDS Ikemoto2, Manjunatha Bhat3, Jianjie Ma4, Leslie S. Jimenez5, concentration-dependence on Po showed a hyperbolic saturation Hiromi Morimoto6, Philip G. Williams6, Jerome Parness'; curve with ECs0 = 10.2 + 5.5 FiM. DIDS shifted both ascending 'UMDNJ-Robert Wood Johnson Med School, 2Boston Biomedical and descending phases of the bell-shaped CRC activation and Research Institute, 3Case Western Reserve University, 4UMDNJ- inactivation curve upward with significantly increased Ca2+ affinity Robert Wood Johnson Medical School, 675 Hoes Lane, at the ascending phase. On the other hand, when purified CRC Piscataway, New Jersey 08854, 5Rutgers University, 6Lawrence was used for bilayer incorporation, DIDS became considerably less Berkeley Laboratory potent. However, both the purified CRC and native CRC showed a Dantrolene (DN) and azumolene (AZ) inhibit Ca2+ release from similar response to 3 mM caffeine (Po: 0.21 - 0.32), 10 mM skeletal muscle Sarcoplasmic Reticulum, likely by inhibiting the ryanodine (typical subconductance state) and 5 mM ruthenium red r7.anodine receptor Ca2+ release channel (RyRI). (complete blockage). These results suggest that the effects of [ H]Azidodantrolene (3HAZD), a DN photoaffinity analog, DIDS on CRC could be indirectly mediated by the 30 kDa protein. specifically photolabels RyRI and its n-calpain cleaved, N- terminal channel fragment composed of the first 1400 amino acids 397-Pos Board # B259 (Biochemistry 40:531-542, 2001). We now show specific 3HAZD CALMODULIN (CaM) BINDING TO THE 3614-3643 photolabeling of recombinant full-length RyR1 (-565 kDa), stably REGION OF RYR1 DOES NOT PLAY A CRUCIAL ROLE expressed in Chinese Hamster Ovary cells, in an AMP-PCP IN SKELETAL MUSCLE EC COUPLING dependent manner. Expressed RyRI C-terminus and GFP-tagged, Kristen M.S. O'Connell', Naohiro Yamaguchi2, Gerhard N-terminus are not photolabeled. Photolabeling experiments Meissner2, Robert T. Dirksen'; 'University of Rochester School of performed with synthetic domain peptides from RyRl and the Medicine and Dentistry, 601 Elmwood Ave, Box 711, Rochester, DHPR showed that 3HAZD specifically labeled only those New York 14642, 2University ofNorth Carolina peptides containing the RyRI sequence 590-609 (DPI). CaM is a ubiquitous Ca2+ binding protein that modulates RyRl Scrambled synthetic peptides were not specifically labeled. activity in vitro. CaM interacts with RyRl at residues 3614-3643 Monoclonal antibody (mAb) anti-RyRi specifically recognizes and mutation of two residues within this region results in the loss DPI and RyRi by both Western blot and immunoprecipitation. of high affinity CaCaM binding (both W3620A and L3624D) This antibody specifically inhibits 3HAZD photolabeling of RyRi. and/or apoCaM binding (L3624D) (Yamaguchi et al., JBC Our data demonstrate that the dantrolene binding site on RyRI 276:22579). In order to investigate the role of CaM binding to this comprises amino acids 590-609 and show that the epitope for mAb region in modulating EC coupling in intact skeletal muscle, we anti-RyRI is this sequence. compared the effects of wtRyRl, W3620A and L3624D following expression in dyspedic myotubes. Expression of wtRyRI, 395-Pos Board # B257 W3620A and L3624D each restored robust L-channel activity and INHIBITION OF Ca2+ RELEASE ACTIVATED Ca2+ (IC,SC) voltage-gated SR Ca2+ release. W3620A-expressing myotubes CHANNELS IN AIRWAY SMOOTH MUSCLE BY exhibited a significant increase in L-current density and a slight VOLATILE ANESTHETICS hyperpolarizing shift in the V1,2 of activation of L-currents and Christina M. Pabelick, Larry W. Hunter, Y. S. Prakash, Gary C. Ca2+ release. However, RyRl- and L3624D-expressing myotubes Sieck; Mayo Clinic, 4-184 W Jos SMH, Rochester, Minnesota exhibited L-currents and Ca2+ release of similar magnitude and 55905 voltage dependence. While W3620A-expressing myotubes In airway smooth muscle (ASM), anesthetics decrease [Ca2li by responded normally to 10 mM caffeine, L3624D-expressing cells increasing sarcoplasmic reticulum (SR) Ca2+ "leak via IP3 and exhibited a bimodal response to caffeine, with a large proportion of ryanodine receptor channels. When SR Ca2+ stores are depleted, cells (-65 %) failing to respond to caffeine. These data suggest Ca2+ influx via I. channels is triggered. IP3 receptors may be that CaM binding to the 3614-3643 region of RyRI is not essential involved in I, activation. We hypothesized that anesthetics for voltage sensor activation ofSR Ca2+ release. inhibit I, triggered by increased SR Ca2+ "leak", thus preventing SR replenishment. In enzymatically-dissociated porcine ASM cells, SR Ca2+ was depleted by 1 jM cyclopiazonic acid (CPA) in 0 extracellular Ca2+, 1 FM nifedipine and 10 mM KCl. When

81a 398-402 POSTERS Sunday

(RYRI). The addition of three amino acids (G-H-S) to the N- 398-Pos Board # B260 terminus of CaM, alters both it affinity for and its functional ALTERATIONS IN SKELETAL MUSCLE EC COUPLING effects on RYR1. At nM Ca2+ the (N+3) CaM has a higher affinity BY CHIMERIC CALMODULINS AND A CALMODULIN for RYRI than CaM without the three N-terminal amino acids (4.7 INHIBITOR ± 0.4 nM versus 26 ± 1 nM, respectively). At jM Ca2+ the Kristen M.S. O'Connell', Sanjeewa Goonasekeral, Anthony (N+3)CaM also has a higher affinity than the nonextended CaM Persechini2, Robert T. Dirksen'; 'University of Rochester School (2.5 ± 0.5 nM for (N+3)CaM versus 17 ± 1 nM for CaM). There is of Medicine and Dentistry, 601 Elmwood Ave, Box 711, no significant difference in the number of binding sites on RYRI Rochester, New York 14642, 2University of Missouri - Kansas for (N+3)CaM and CaM at either nM or jxM Ca2+. Despite its City higher affinity (N+3)CaM has a greatly decreased ability to Studies using cell-free systems have demonstrated that calmodulin enhance [3H]ryanodine binding at nM Ca2+. In contrast, both (CaM) activates RyRI at low Ca2+ and inhibits RyRI activity at (N+3)CaM and CaM inhibited [3H]ryanodine binding at high Ca2e, high Ca2+. However, a large gap of knowledge exists with regard with differences in IC50 attributable to their different affinities. to the precise role of CaM in modulating Ca2' release during Recently, it was demonstrated that a similar N-terminal extension skeletal muscle EC coupling in intact cells. To explore the global of FKBP12 had a slight destabilizing effect on this protein and role of CaM in EC coupling, normal skeletal myotubes were generated a folding intermediate not seen with the nonextended treated for 0.5 hr to 6 hr with the Ca2+CaM inhibitor W7 (20 gM). protein (Korepanova et al, Protein Science 10:1905-1910). Subsequent patch clamp experiments revealed that W7 treatment Alterations in folding or interconversions between conformational resulted in time-dependent reductions in L-current density and states, particularly when CaM is in its Ca2+ free form, may maximal voltage-gated Ca2+ release. We also evaluated the contribute to the observed differences in affinity and efficacy functional effects of overexpressing chimeric CaM molecules that observed with the (N+3)CaM. contain either 4 high-affinity Ca2+ binding sites (CaMCC) or 4 low-affinity Ca2+ binding sites (CaMNN) by duplication of the C- 401-Pos Board # B263 or N-terminal lobes. In RyRI-expressing dyspedic myotubes, REGULATION OF RYANODINE RECEPTOR BY expression of CaMCC caused a 60% decrease in L-current and a CALMODULIN ANTAGONISTS 50% decrease in SR Ca2+ release, while no effects were observed Le Xu, Daniel A Pasek, Gerhard Meissner; Univ. of North following expression of either wtCaM or CaMNN. WtCaM-, Carolina, 422 MEJ Buliding, Chapel Hill, North Carolina 27599- CaMNN-, and CaMCC-expressing myotubes all exhibited similar 7260 resting Ca2+ levels and robust caffeine-activated Ca2+ transients. Calmodulin (CaM) activates the skeletal muscle Ca2+ release Our results suggest that W7 and CaMCC act by altering voltage channel/ryanodine receptor (RyRI) at submicromolar [Ca2+] while sensor activity, expression, or coupling with RyRI. inhibiting the channel at higher [Ca2l, by binding with nM affinity 4 CaM molecules per RyR tetramer, both in the presence and 399-Pos Board # B261 absence of Ca2+. Here we assessed the effects of CaM antagonists SURAMIN INTERACTS WITH THE CALMODULIN on regulation of RyR1 in [3H]ryanodine binding and single BINDING SITE ON RYR1. channel measurements. In addition, we determined their effects on Rao V.L. Papinenil, Kristen M.S. O'Conelly?, Robert T. Dirksen2, (35S]CaM binding to RyRl at submicromolar (apoCaM) and Susan L. Hamilton'; 'Baylor College of Medicine, One Baylor micromolar (CaCaM) Ca2+. In [35S]CaM binding assays, the CaM Plaza, Houston, Texas 77030, 2University of Rochester School of antagonist W7 was more effective in inhibiting CaCaM than Medicine and Dentistry apoCaM binding. At [Ca2l <2 FM, W7 increased [3H]ryanodine In skeletal muscle the transverse tubule L-type calcium channel binding to RyRl both in the absence and presence of CaM, with a (DHPR) is physically and functionally coupled to the RYRI of the peak of binding at -100 jM W7. At [Ca 1 > 2gM, W7 inhibited sarcoplasmic reticulum. One site of interaction involves the [3H]ryanodine binding in the absence of CaM while an increase carboxy-terminal tail of the DHPR and the calmodulin (CaM) was observed in the presence of CaM. In lipid bilayer binding site on RYRI (Sencer et al, JBC 2001,276(41):38237-41). experiments, W7 also activated the submaximally activated RyRI Suramin inhibits both [35S]Ca2+CaM (2.5nM) and [35S]apoCaM in the absence of CaM using Ca2+ as current carrier. Parallel (2.5nM) binding to RYRI with an IC50 of 1.93 ± 0.14 and 1.40 ± experiments with the CaM antagonist calmidazolium and the 0.05 gM, respectively. FRET and non-denaturing gel-shift assays cardiac muscle isoform (RyR2) will also be presented. The results demonstrate that suramin binds to a synthetic peptide representing suggest that CaM antagonists may interact with RyRl and RyR2 the CaM binding site of RYRI (R-3609-43). In addition, suramin both thru CaM or directly, activating and inhibiting the channels binding to R-360943 blocks the interaction of the peptide with the depending on Ca2+ concentration. DHPR. These findings suggest that suramin may uncouple the DHPR-RYR interaction specifically at this site. Moreover, the 402-Pos Board # B264 DHPR interaction at the CaM binding site on RYRI may be ACTION OF METHYLBROMOEUDISTOMIN ON SINGLE functionally important since voltage-gated Ca2' release in patch RYANODINE RECEPTOR CHANNELS clamped mouse myotubes is increased 1.5-fold following dialysis Maura Portal, Paula L. Diaz-Sylvester', Alma Nanil, Carlos A. with 50 FM suramin. Our data are consistent with a model in Villalba-Galea2, Rafael Rosales2, Ariel Escobar2, Michael Fill', which the interaction of the DHPR with the CaM binding site on Julio A Copello'; 'Loyola University Chicago, 2160 S. First Ave, RYRI serves to either stabilize the resting closed state of the Maywood, Illinois 60153, 2Texas Tech University, Lubbock, TX channel or facilitate release channel closure (inactivation) during 9-Methyl-7-bromoeudistomin D (MBED) activates Ca release depolarization. Additionally, suramin can be used to competitively from ryanodine-sensitive intracellular stores. MBED is inhibit this interaction. structurally similar to caffeine and it is thought that these two compounds activate RyRs via a similar mechanism. Here, MBED 400-Pos Board # B262 action on single RyRI and RyR2 channels reconstituted in planar N-TERMINAL EXTENSION OF CALMODULIN bilayers was defined. In simple salt solutions, MBED reversibly INCREASES ITS AFFINITY BUT DECREASES ITS activated most RyR2 channels (-95%) but only about 50% of EFFICACY FOR ACTIVATION OF RYR1. RyRI channels. The gating kinetics of MBED-activated RyRs George R Rodney, Liangwen Xiong, Oluwatoyin Thomas, Susan were different than those of Ca-activated RyRs. The Ca-activated L Hamilton; Baylor College ofMedicine RyRs displayed modal gating (periods of "low and high Po"). The Calmodulin (CaM) is a ubiquitous Ca2+ binding protein and is an MBED-activated RyRs were essentially locked in the "high Po" important regulator of the skeletal muscle calcium release channel mode. Ca and MBED acting together had additive ability for

82a Sunday POSTERS 402-407

reversing Mg or ruthenium red inhibition of RyRs. MBED action 405-Pos Board # B267 was very similar to that of caffeine. Its EC50, however, was -0.5 EF-HAND CALCIUM BINDING SITES IN C. ELEGANS gM compared to -5 mM for caffeine. In the presence of near RYANODINE RECEPTORS physiological levels of resting Ca, Mg and ATP, MBED and Ed B Maryon', Phil Anderson2, Amy E Riek'; 'University of caffeine had similar actions (i.e. strongly activated only a subset of Wisconsin, 445 Henry mall, Madison, Wisconsin 53705, RyR2 channels). At super-resting Ca levels (300-500 nM), MBED 2university ofWisconsin and caffeine activated most RyR2 channels. The high potency of We are investigating the role of Ca2+-binding sites in ryanodine MBED makes it an attractive experimental probe for RyR- receptor (RyR) channels in C. elegans. C. elegans has a single RyR mediated Ca release in a variety of experimental systems gene (unc-68) that encodes a 5074 amino acid protein. UNC-68 (Supported by NIH HL57832 to MF and AHA0130142N to JAC). channels are localized in body-wall muscle cells in SR-like 403-Pos Board # B265 vesicles between the surface membrane and the myofilament FUNCTIONAL CHARACTERIZATION OF A lattice. unc-68 null mutants are viable, but have defective CALMODULIN BINDING SITE IN SKELETAL locomotion. The predicted UNC-68 protein has two EF-hand RYANODINE RECEPTORS motifs at amino acids 4198-4246 We eliminated one or both EF Xinsheng Zhu, Anaid Antaramian, Jyothi Ghanta, Jeffrey W. hands using alanine substitution, and analyzed 45Ca2t-binding to Walker, Hector H. Valdivia; University of Wisconsin-Madison, wild type (WT) and mutant fusion proteins. Both EF hand motifs 1300 University Avenue, Madison, Wisconsin 53706 bind 5(a2+ We transformed unc-68 null mutant animals with GFP-tagged unc-68 genes containing WT or mutant EF-Hands. A synthetic 30-a.a peptide (CaMBP) matching a. a. 3614-3643 of Proper expression of the GFP-tagged RyRs was confirmed using in the skeletal RyR (RyRI) binds to both Ca2+-free CaM and Ca2+- vivo localization of the GFP tag and western blot analysis. The WT bound CaM with nanomolar affinity (Rodney et al, J Biol Chem gene rescues normal locomotion, whereas the two genes with one 2001, 276:2069). We tested CaMBP on RyRI and found that it or the other EF hand eliminated confer partial rescue. Animals increases [3H]ryanodine binding in a dose- and Ca2+-dependent expressing the gene lacking both EF-hands exhibit the unc-68 manner, induces Ca2+ release from SR vesicles, and increases P0 of null phenotype. We have purified and solubilized WT and mutant single RyRi channel reconstituted in lipid bilayers. To test whether RyR channels to investigate whether the EF-hands are involved in the RyRI 361443 region acts as the CaM binding site in vivo, two activation or inhibition ofthe channels. ryrl mutants (RyRI-A3614-3643 & RyR1-L3624D) were constructed and functionally expressed in HEK293 cells. Both 406-Pos Board # B268 recombinant RyRs were unable to interact with CaM but remained MOLECULAR CLONING AND CHARACTERIZATION OF responsive to other modulators such as caffeine. To further define RYANODINE RECEPTOR FROM UNFERTILIZED SEA the subdomain(s) of CaMBP that interacts with CaM, we URCHIN EGGS. synthesized different fragments of CaMBP and found that its N- Takashi Murayama, Mieko Shiwa, Yasuo Ogawa; Juntendo terminus (3614-3633) activates while its C-terminus (3631-3644) University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo, inhibits RyRs. Thus, a single peptide contains inhibitory and 1 13-8421 Japan activatory domains. This finding helps explain the mechanism by Unfertilized eggs of Hemicentrotus pulcherrimus sea urcins which Ca2+-free CaM activates and Ca2+-bound CaM inhibits RyR demonstrated cyclic ADP-ribose (cADPR)-induced Ca2' release activity. By binding to different motifs of the CaMBP region, CaM and caffeine-induced Ca2' release, both of which were considered exerts different regulatory effects on RyRI at different Ca24 to be mediated through ryanodine receptor (RyR). We isolated concentrations. cDNAs for sea urchin egg RyR (suRyR) which encode a protein of 404-Pos Board # B266 5,317 amino acids with molecular mass of597 kDa. suRyR shares LOCALIZATION OF KEY DETERMINANTS ON THE common structural features with known RyRs: the well conserved RYANODINE RECEPTOR TYPE 1 (RyRI) REQUIRED C-terminal domain which may form a functional Ca2* channel, and FOR ACTIVATION BY 4-CHLORO-m-CRESOL a large hydrophilic N-terminal domain. suRyR shows similar James D. Fessenden', Claudio F. Perez', Isaac N. Pessah2, Paul amino acid sequence identity (43-45 %) with the three mammalian Allen'; 'Brigham & Women's Hosp., Dept. of Anes. Res., Boston, RyR isoforms. Phylogenetic analysis indicates that suRyR Massachusetts 02115, 2University of California, Davis, Vet. Med., branched from three isoforns of vertebrates before they were Dept. Mol. Biosci., Davis, CA 95616 diverged, suggesting that suRyR may be a only RyR isoform in sea urchins. Four in-frame insertions were found in suRyR cDNAs, 4-chloro-m-cresol (4-CmC), a preservative found in commercial one of which was novel and unique in having a cluster of serine preparations of succinylcholine directly activates the skeletal residues. The transcripts with and without these insertions were muscle intracellular Ca2+ release channel, RyRI. (Zorzato et al., found in the egg RNA. These results suggest that suRyR may be Mol. Pharm., 44:1192-1201, 1993). However, the region(s) within expressed as functional Ca2+ release channels, which might also be the RyRI primary sequence that are required for activation by 4- involved in cADPR-induced Ca2' release. CmC are not known. We have utilized the fact that RyR3 (first described in brain) expressed in the lB5 dyspedic skeletal muscle Voltage-gated Na Channels cell line is not activated by 4-CmC (Fessenden et al., Biophys. J. 79:2509-2525, 2000). To define the site(s) of action of 4-CmC on 407-Pos Board # B269 RyRI, we have constructed a series of RyRI-RyR3 chimeras STATE DEPENDENT-ISOFORM INDEPENDENT BLOCK encompassing the C-terminal third of the RyR primary sequence OF Na CHANNELS BY MIBEFRADIL and tested their ability to restore 4-CmC-induced Ca2+ release in Megan M McNulty, Dorothy A. Hanck; University of Chicago, intact IB5 myotubes. We found that substitution of 409 amino 5841 S. Maryland Ave, Chicago, Illinois 60637 acids between position 37684178 of the RyRI primary sequence into the corresponding region of RyR3 is sufficient to impart 4- Cross reactivity of the T-type Ca channel blocker mibefradil with CmC sensitivity to RyR3. In addition, substitution of the other voltage gated channels can be used to identify its site of corresponding region of RyR3 (a.a. 3621-4030) into RyRl disrupts action. Block of Na channels has been recently observed in GH3 4-CmC activation of RyRI. This data reveals that the determinants cells (Br Jr Pharm 130:669, 2000), raising the question of isofonn for activation of RyRI by 4-CmC lie between amino acids 3768- and state specificity of drug action. Using whole cell voltage 4178 of the RyRl primary sequence. Support: NIH ROIAR43640 clamp, we examined mibefradil block of three Na channel and lF32 HL67572-01. isoforms: heart (hHla, rHI) and brain (BrIl A). Trains of 20ms depolarizations to -3OmV from various holding potentials were

83a 407-412 POSTERS Sunday

used to assess block. In all isoforms the concentration of slowed gld and neuronal Na channel fast inactivation, but was less extracellular Na+ had no effect on degree of block. At a negative effective at slowing hHl inactivation. No use-dependent current holding potential (-130mV), INa was poorly blocked, while at reduction of INa was observed. BMK 11(2) is most effective at more positive potentials at which 1040% of the channels were slowing skeletal muscle and neuronal inactivation. inactivated more block developed, e.g. for hHla [Na was blocked with an ED50 of 4.4l±M (-130 mV) and 0.7FM (-100 mV). In 410-Pos Board # B272 addition, drug off-rate was slowed at depolarized holding EFFECTS OF OXALIPLATIN ON DIFFERENT SODIUM potentials, koff was 0.026/s at -130 mV and 0.008/s at -100 mV. CHANNEL ISOFORMS Despite the dependence on holding potential, neither the degree or Bibiane Steinecker-Frohnwieser, Christine Pojer, Wolfgang time course of block was dependent on duration of the Schreibmayer, Stefan Quasthoff; University Graz, Harrachgasse depolarizations, which dramatically increased the number of 21/4, Graz, 8010 Austria channels inactivating from the open state (5-100 ms). Our results Oxaliplatin, a platinum-based chemotherapeutic agent, displays a suggest that mibefradil blocks Na channels in an isoform and characteristic pattern of neurotoxic side effects, with an acute onset concentration independent manner and implicate a pre-open closed of distal dysesthesia and/or paresthesia. Application to dorsal root state in controlling affinity. ganglion neurons increases Na+ current, blocks maximal current amplitude and shifts the IV-curve towards more negative potential 408-Pos Board # B270 (Adelsberger, et al., 2000, Eur. J. Pharm., 406; 25-32). In rat, INHIBITION OF INa+ CURRENT BY ANTIMALARIAL oxaliplatin slows down the inactivation kinetics of Na+-currents in DRUG PRIMAQUINE IN XENOPUS LAEVIS OOCYTED specific neurons suggesting its effect on particular Na+-channel TRANSFECTED WITH hHl and rsklq SODIUM isoforms (Gamelin, et al., 2001 Seminars in Oncology (in press)). CHANNELS To test for isoform specific effects of the chemotherapeutic agent, Gerardo J Orta-Salazar, Eduardo M Salinas; Instituto de Xenopus laevis oocytes expressing different types of Na+ channels Fisiologia-BUAP, Mexico were superfiused with oxaliplatin. A significant reduction in current Primaquine (PQ), an aminoquinoline, is a potent inhibitor of could be observed in oocytes overexpressing the human heart Na+- sodium channel in rat cardiac myocytes. Here we studied the channel (hNavl.5, hHl) as well as the neuronal Na+ channel from effects of PQ on human cardiac (hHll) and rat skeletal muscle (i 1) mouse (mNavl.6, mScn8a), while the IV-characteristics were sodium channels expressed in Xenopus oocytes. At IOAM, PQ unchanged. The alpha subunit of the rat skeletal muscle (rNavl.4, caused a use dependent inhibition of hHl Na+ current (INa+) by rSkml) reflected an increase in gmax but no changes in peak 62% after 20 pulses at 1Hz. At I00M PQ only decreased p I INa+ current and inactivation kinetics under the influence of oxaliplatin. by 7. In control condition, recovery from inactivation ocurred with In contrast mNavl.4 showed a highly significant slow-down of the two times constants in hHIl channels: a fast time constant (?f) of inactivation kinetics indicating that this channel isoform may be 6.23 ms and slow time constant (?s) of 83 ms. After PQ (10 ,tM) one of the targets for oxaliplatin and effectuates the observed tfast was 14.5 ms and tslow 354ms. Recovery from inactivation neurotoxic effects. time constants fbr pt 1 channels were 3.4 ms and 65.2 ms in control conditions and 6.8 ms and 72.8ms after the exposure to PQ (100 411-Pos Board # B273 AM). The h (?) curve had a VV2 of?55.2 mV and k=5.2 for hHIl in ROLE OF THE Arg-14 LOOP OF THE NEUROTOXIN control conditions and ?59.9 mV and k=6.2 after exposure to ANTHOPLEURIN B IN REGULATING AFFINITY FOR 10FtM PQ. We did not find any changes on steady-state VOLTAGE SENSITIVE SODIUM CHANNELS. inactivation curves for IL1 channels in control conditions and after Anna L. Seibert', J.R. Liu2, Dorothy Hanck2, Kenneth M. exposure to 100 gM PQ . We tested other mutant, Y401C of 1I Blumenthal'; 'SUNY@Buffalo, 140 Farber Hall, 3435 Main St., that confers to skeletal mucle channels the cisteine residue Buffalo, New York 14214, 2University ofChicago naturally present in hHl channels. At 10 and 100 tM induced a Anthopleurin B (ApB) is a 49-residue polypeptide neurotoxin that use-dependent inhibition of Y401C Na+ current, blocking the binds with high affinity to toxin site 3 of voltage sensitive sodium current by 25% after 20 pulses at lHz, without any significant channels (VSSCs) delaying channel inactivation. ApB displays a changes in the steady state inactivation curve. strong preference for cardiac isoforms which is not shared by the close homologue Anthopleurin A (ApA). Previous mutagenesis 409-Pos Board # B271 identified three residues contributing significantly to toxin activity; A TOXIN THAT PREFERENTIALLY ALTERS MUSCLE & two of these (Arg-12 and Leu-18) are in an unstructured region of NERVE Na CHANNELS the toxin, the Arg-14 loop. We have investigated the importance of Richard Hahin', Andrei Kondratiev2, Gordon F. Tomaselli2, Ziyi other residues of this loop and of loop orientation and flexibility to Chen3; 'Northern Illinois University, Montgomery Hall, DeKalb, ApB activity by site-directed mutagenesis. While substitutions at Illinois 60115, 2Johns Hopkins Medical Institutes, 3Monsanto Thr-17 (T17A/S) do not alter activity, the mutations N16D and A polypeptide (BMK 1(2)) that prolongs action potentials at S19D decrease ApB affinity considerably, perhaps due to nanomolar doses in frog nerve was purified from Buthus martensii electrostatic repulsion by proximal channel carboxylates. While the Karsch venom. The toxin was purified using gel filtration, ion three glycines of the Arg-14 loop are not essential individually, it exchange, FPLC, and HPLC chromatography. Similarity is hypothesized that they may contribute combinatorially to ApB's comparisons of the N-terminal sequence (VRDGYIADDKD-AYF- preference for cardiac VSSCs. Quantitative analysis of the GRDAYYDDDEKKKDxx) suggest that the blanks are cysteines. functional effects of Gly to Ala substitutions at these positions, The molecular weight was found by LC/MS/MS to be 7216 Da. currently in progress, will also be reported. Supported by Whole cell voltage-clamp experiments conducted on a plasmid- AHAO1 101 13T and GM60582 transfected cell line (HEK 293) expressing the rat skeletal muscle (1tL) a and brain P1 subunits of the Na channel showed that BMK 412-Pos Board # B274 1(2) slows Na channel inactivation. 100 nM BMK 1(2) induces BLOCKING EFFECT OF CLENBUTEROL ON NATIVE a non-inactivating Na current when the membrane was depolarized SKELETAL MUSCLE SODIUM CHANNELS from -120 mV. Inactivation slowing is voltage dependent. We Jean-Fran9ois Desaphy, Annamaria De Luca, Bodvael Fraysse, also applied BMK 11(2) to human heart (hil1) x Na channel Diana Conte Camerino; Div. of Pharmacology, Dept. of subunits expressed in HEK 293 cells, and to native neuroblastoma Pharmacobiology, Faculty ofPharmacy, University ofBari, Italy Na channels. BMK 11(2) increased the peak Na current of ,l and Agonists of P2-adrenergic receptors contrast the paralysis in neuronal channels by 40 and 20% respectively, but reduced the patients suffering from hyperkalemic periodic paralysis, a muscle peak current ofhHI Na channels by 15%. BMK 11(2) dramatically disorder due to mutations in the SCN4A gene encoding the u-

84a Sunday POSTERS 412-416

subunit of the skeletal muscle sodium (SkMl) channel. We inactivated channels, and may interact with the same site as previously showed that membrane-permeant cyclic AMP lidocaine. analogues block sodium currents (INa) in rat skeletal muscle fibers (Desaphy et al., Am. J. Physiol. 275: C1465, 1998). Here we 415-Pos Board # B277 investigated whether stimulation of P-adrenoceptors may act on A SPIDER TOXIN THAT INHIBITS ACTIVATION OF SkMI channels through such a mechanism. INa were recorded in VOLTAGE-GATED SODIUM CHANNELS freshly dissociated rat flexor digitorum brevis muscle fibers by Richard L Kraus', Vivien A Warren', McHardy M Smith', cell-attached patch-clamp. Isoproterenol (100, 500 gm) had no Richard E Middleton', Kenneth M. Blumenthal2, Charles J Cohen'; significant effect on INa amplitude, nor the more specific P2- 'Merck and Co., 2SUNY@Buffalo agonist, salbutamol (500 FM). In contrast, an other p2-agonist, We isolated a peptide toxin, ProTx-II, from Proshapalopus clenbuterol, dose-dependently blocked IN, with an ICso of 250 FM. anomalous venom. ProTx-Il shifts the voltage dependence of This effect was independent of protein kinase A activation, since it activation of cardiac Navl.5 to more positive voltages, acting like persisted in presence of 10 FtM H89, a selective inhibitor of the hannatoxin and co-Aga-IVA on Kv2.1 and Cav2.1, respectively. kinase. These results suggest that stimulation of P2-adrenoceptors Like these toxins, ProTx-II conforms to the inhibitory cystine knot have no effect on SkMl channels and that the inhibitory effect of motif. The structure and inhibition of channel activation suggest clenbuterol is due to direct interaction with the channels, maybe that the toxin binds to an S3-S4 linker. ProTx-II blocks NavI.5 because of the high lipophilic profile of the drug (Telethon-Italy channels that are already modified by Anthopleurin B, a quasi- fellowship 396/bs). irreversible toxin that slows inactivation of Nav1.5. This additive effect and the lack of effect on inactivation indicate that ProTx-II 413-Pos Board # B275 does not bind to IV(S3-S4). The P-scorpion toxin CssIV binds to VOLTAGE-DEPENDENT DISSOCIATION OF II(S3-S4) and is about 20-fold more potent on neuronal Na TITYUSTOXIN FROM SODIUM CHANNELS channels (Navl.2) than on Navl.5. Likewise, ProTx-Il is 15-fold Paulo S. L. Beirio, Fabiana V. Campos, Jader S. Cruz, Tasso more potent on neuronal Navl.7 then on Navl.5 (IC50 1.2 nM Moraes-Santos; UFMG, Av. Antonio Carlos, 6627, Belo and z 19 nM, respectively). Our results suggest that toxins Horizonte, 31270-901 Brazil binding to II(S3-S4) can either inhibit activation (ProTx-II) or Tityustoxin (TsTx), an x-type scorpion peptide toxin, inhibits facilitate it (CssIV). Remarkably, the toxin also inhibits activation sodium channel inactivation, and have its affinity decreased upon of T-type Ca channels and is isoform specific (IC50: Cav3.1, ~150 depolarization. We have investigated the kinetics of TsTx nM; Cav3.2 ; 2.4 jiM), revealing a structural motif conserved dissociation from sodium channels of GH3 cells using the whole among Na and Ca channels. Supported by the Austrian FWF, cell patch clamp technique. In the presence of TsTx, the time J2007-MED to RLK. course of inactivation of the sodium current was best fitted with two exponential components, with time constants (at 0 mV) of 1.38 416-Pos Board # B278 ± 0.09 ms and 12.5 ± 1.0 ms. The relative contribution of the slow it-CONOTOXIN BLOCK OF Na+ CHANNELS DEPENDS component was dependent on the toxin concentration, and was ON IONIC STRENGTH BUT NOT THE PERMEANT [Na+J absent in control currents. We used the proportion of the slow Ronald A Li', Kwokyin Hui2, Robert J French3, Kazuki Sato4, component as a measure of the fraction of toxin-modified Charles A Henrikson', Gordon F Tomaselli', Eduardo Marban'; channels. Depolarization to 0 mV (where peak activation occurred) 'Johns Hopkins University, 720 Rutland Ave / Ross 844, or +60 mV failed to remove significantly TsTx. Higher Baltimore, Maryland 21205, 'SUNY at Bufralo, 124 Sherman Hall, depolarizing pulses of 20 ms duration produced voltage-dependent Buffalo, New York 14214, 3University of Calgary, Canada, removal of bound TsTx. Single pulses to +200 mV could remove 4Fukuoka Womeni:s University, Japan most of the toxin-modified component. We conclude that TsTx t-Conotoxins (t-CTX) are 22-amino-acid peptides produced by dissociation from sodium channels is dependent on voltage and the sea snail Conus geographus. Although it is known that K+ independent of the activation process. Supported by FAPEMIG channel pore-blocking toxins block their targets with strong and CNPq. dependence on both the ionic strength (1) and the permeant ion concentration, no such dependence has been reported for lt-CTX 414-Pos Board # B276 and Na+ channels. We studied the effects of I and permeant ion COMMON MOLECULAR DETERMINANTS OF HUMAN concentration ([Nal) on i-CIX block of rat skeletal muscle (Al) CARDIAC Na+ CHANNEL (HH1) BLOCK BY LIDOCAINE Nae channels. The A-CTX sensitivity of wild-type (WT) and E758Q AND A NEUTRAL FLECAINIDE ANALOG channels increased significantly (by up to 2 orders of magnitude) Huajun Liu, Joshua Atkins, Robert S Kass; Columbia University, when I was lowered by substituting eqwimolar of extemal Nae with 630 w 168th Stree, New York, New York 10032 sucrose (140 -* 35 mM [Nal). In contrast, toxin block was not High-affinity binding of lidocaine (pKa 7.6-8.0, - 50% neutral at altered when Nae was replaced by NMG+ (p>0.05) Singlechanel pH 7.4) to the inactivated state of cardiac sodium channels requires recordin reveal that the enhanced toxin sensitivity in low ionic two critical amino acid residues, F1760 and Y1767 located on strnagth results chiefly from accelerated association rates, with the segment IVS6. Similar state-dependent interactions with flecainide dissociation rates relatively unaffected Further expeaments with At- (pKa 9.3, 99% charged at physiological pH) are less clear. To test CTX derivatives identified toxin residues RI, R13 and K16 as whether the charge on flecainide might determine its state important components for sensing changes in external ionic specificity of Na+ channel blockade, we developed a flecainide strength. Taken together, our present findings indicate that t-CTX analogue, J2A073, (pKa 6.4, 90% neutral at pH 7.4), and examined block of Na+ channels depends critically on I but not permeant ion the effects of flecainide, J2A073, and lidocaine on hHl channels concentration, contrasting the known properties of pore-blocking expressed (with h(l) in HEK 293 cells. Channel availability is K+ channel toxins. These data reveal fundamental differences in shifted by J2A073 (-9.2 mV, 100 uM) or lidocaine (-17.7 mV, 300 toxin-channel interactions between Na+ and K+ channels. uM), while flecainide (10uM), has no effect. The mutations F1760A and Y1767A, which disrupt lidocaine action, greatly reduce the J2A073-induced shift in channel availability to -1.6 mV and -4.9 mV, respectively. Consistent with this result, we found that the mutations decreased the affinity of the inactivated channel for J2A037 (IC50 at -4OmV: 6.6uM (WT); 124 uM (F1760A); 48uM (Y1767A). These results indicate that, unlike flecainide but like lidocaine, J2A073 binds directly and preferentially to closed-

85a 417-421 POSTERS Sunday

Gonyautoxin 1,4 (GTX1 ,4) is a C-il sulfkted derivatives of 417-Pos Board # B279 neoSTX. Using the GTXI,4/neoSTX and TTX/I i-deoxyTTX BINDING OF THE ANTICONVULSANT DRUG pairs with mutations in all four domains of the outer vestibule in LAMOTRIGINE PRODUCES A CONFORMATIONAL mutant cycles, we determined more points of interactions between CHANGE IN THE VOLTAGE-DEPENDENT SODIUM the toxins and the channel to provide insights into the docking CHANNEL STRUCTURE. orientation, mechanism of block, and channel structure. The rat N. Cronin', A. O'Reilly', H. Duclohier2, B. A. Wallace'; 'Birkbeck skeletal muscle Na+ channel (rNa,1.4) was expressed in Xenopus College, Univ. of London, United Kingdom, 2Univ. of Rennes-l, oocytes and studied using two-electrode voltage clamp. The C-Il France S04 of STX had maximal interaction with domains III and IV Sodium channels in excitable membranes are dynamic molecules (MG kcallmol: D1241-1.0 + 0.1; D1532N-2.3 ± 0.1). The C-li characterized by dramatic rapid voltage-driven conformational OH of TTX had maximal interaction with Domain II and none changes that switch the molecule between activated, inactived and with domain IV (MG kcal/mol: T759D-0.6±0.1; D1532-0.0±0.1). closed resting states. Voltage-dependent sodium channels are These results suggest different docking orientations of TTX and specifically blocked by the anticonvulsant drug lamotrigine, which STX in the pore and are consistent with outer vestibule models preferentially binds to channels in the inactivated open state. Using with a clockwise arrangement ofthe domains. circular dichroism spectroscopy on purified sodium channels from Electrophorus electricus which were reconstituted into lipid 420-Pos Board # B282 vesicles, we have compared the secondary structures of the mixture A SODIUM CHANNEL LONG-QT MUTATION ALTERS of states present at equilibrium in the absence of the drug with the DRUG-PATHS AND INCREASES USE-DEPENDENT inactived state that exists in its presence. As the mixture shifts to BLOCK BY FLECAINIDE the inactivated state, there appears to be a decrease in ordered Peter J Lee, Kristen A Andersen, Ian W. Glaaser, John W Kyle, structure, suggesting the unfolding of helical residues, a result that Harry A. Fozzard; University of Chicago, 5841 S. Maryland Ave, is consistent with a change in the conformation of the MC 6080, Chicago, Illinois 60637 transmembrane helical segment 111S6 to which lamontrigine has A recently reported long-QT (LQT3) mutation of the sodium been shown to bind. (Supported by grant B15499from the BBSRC) channel, DI79OG (D/G), caused increased use-dependent block (UDB) by flecainide without affecting tonic block. One possible 418-Pos Board # B280 mechanism for an increase in UDB is by alteration of the drug EFFECTS OF SITE-3 SCORPION u-Toxins (LqhaIT) ON access/egress path. When the drug access/egress paths become S4D4 SEGMENT MOVEMENTS INVOLVED IN hSkMl more restricted, the steady-state level of UDB increases because of SODIUM CHANNEL (NaCh) INACTIVATION slower off-rates, although the onset-rate for UDB is slowed. We Zhongming Ma, Weiping Zhang, Jun Kong, Roland G. Kallen; U tested this possibility by comparing the kinetics of UDB by ofPenn Sch ofMed QX314, a membrane impermeable analog of local anesthetics, in One voltage sensor, S4 in Domain 4 (D4), is preferentially HEK293 cells. UDB from the cytoplasmic side by pipette involved in NaCh fast inactivation (JGP, 114:167-183, 1999). As application of QX314 was slowed in the D/G mutant as judged by S4 moves in response to depolarization, two charged S4D4 the time constant for onset-kinetics; 3.7±0.3 seconds (sec) at 2 Hz residues (R2C and R3C, (Arg'45' and Arg"454)) move from for the wild type (WT) and 7.9±0.2 sec for the D/G channels internally to externally accessible positions as deduced by (p<0.01). UDB from the external side showed a larger difference reactivity to internally or externally applied MTS reagents at in onset-kinetics. The D/G channel was not efficiently blocked by hyperpolarizing and depolarizing voltages (Neuron, 15:213-218, external QX314 unlike the WT channel; the fractional block at the 1995; Neuron 16:113-122, 1996). Scorpion a-toxins bind to 150" pulse (2 Hz) was 0.612±0.017 for WT and 0.237±0.019 for receptor Site-3, partially comprised of residues in the extracellular D/G channels (p<0.01). The estimated time constants were 79±6 S3-S4D4 loop (J Biol Chem 1996;271(27):15950-62; J Biol Chem sec for the WT and 258±22 sec for the D/G channels (p<0.05). 1998;273(l):80-4) and appear to impede S4D4 segment movement Thus, the LQT3 mutation made the drug-paths less accessible, during inactivation. We find that the modification of R3C in resulting in altered onset-kinetics for QX314 and increased UDB. hSkMl to MTSET+ and BPMTS-) are both > 10-fold slowed suggesting that the accessibility of this site to modification is 421-Pos Board # B283 restricted either due to failure of this segment to move outward to AUGMENTATION IN CLOSED STATE TO INACTIVED the normal extent or due to direct or indirect blockage of access of STATE KINETICS IN THE LQT SODIUM CHANNEL this site to reagent in the presence of toxin. Preliminary MUTATION, AKPQ, BY SITE-3 TOXINS measurements of availability of R3C to internally applied reagent Tiehua Chen, Michael F Sheets; University of Utah, 95 South show reciprocally increased access (faster rates of reaction) 2000 East, Salt Lake City, Utah 84112 providing further evidence for encumbered S4D4 movement in the The LQT syndrome human Na channel mutation, AKPQ, has a presence ofSite-3 toxins. deletion of three amino acids in the intracellular linker between Domains III & IV (the inactivation lid). During step 419-Pos Board # B281 depolarizations that result in channel openings, AKPQ has been ENERGETIC LOCALIZATION OF SAXITOXIN AND shown to develop a persistent current because inactivation is no TETRODOTOXIN IN THE SODIUM CHANNEL OUTER longer absorbing. We investigated the effects of AKPQ on VESTIBULE inactivation that occurred directly from closed states (C-I Gaurav Choudhary', Mari Yotsu-Yamashita2, Lisa Shang', inactivation) by studying negative membrane potentials where Xiufeng Li', Samuel C. Dudley'; 'Emory University, 1670 channels do not Clairnont Rd, Rm #4A 176, Atlanta, Georgia 30033, 2Tohoku open. Development of inactivation protocols University, Japan showed that C-I inactivation was similar between AKPQ and WT in control solutions suggesting that the inactivation lids for AKPQ Saxitoxin (STX) and Tetrodotoxin (TTX), selectively block the and WT had similar affinities for their inactivation lid receptors. voltage-gated sodium channels at the outer vestibule of ion Modification of both Na channels by site-3 toxins slowed the permeation pathway lined by P-loops of four domains of the a- decay of INa in response to step depolarizations as expected subunit. Both toxins have critical guanidinium groups pointing because the toxins have been shown to inhibit inactivation from the towards the selectivity filter. 1-DeoxyTTX has a methyl group as open state by modification of the inactivation receptor. After site-3 the C6-equatorial substitution, instead of TTX's hydroxymethyl toxin, the rate and magnitude of C-I inactivation for AKPQ was group. Neosaxitoxin (neoSTX) has an additional -OH group at the markedly increased while minimal changes for WT occurred. We NI position of the 1,2,3 guanidinium (NI-OH) compared to STX.

86a Sunday POSTERS 421-426 conclude that site-3 toxins cause the mutated inactivation lid in examined the effect of lidocaine on embryonic Nav 1.3 expressed APKQ to have a higher affinity for its modified receptor compared with P1 and P3 subunits in Xenopus oocytes. Oocytes were to WT, and results in augmentation ofC-I inactivation for AKPQ. microinjected with NavI.3 with and without P1 and P3 cRNA and two-electrode voltage clamp recordings performed using ND96 422-Pos Board # B284 solution. Data are means 4 S.E.M. Lidocaine (1mM) inhibited MECHANISM OF ACTION AND THE MOLECULAR NavI.3, NavI.3+13 and Navl.3+01 with EC50 of 1.2 1: 0.3mM, BASIS OF Na+ CHANNEL ISOFORM SELECTIVITY OF 4.9 * 2.4mM (P<0.05) and 10.7 * 2.9mM (P<0.05) respectively. SITE-3 TOXINS Lidocaine (1001lM) also shifted V1,2 for Nav 1.3, Navl.3+03 and Sorin Lazar, Lucian Ionescu, Roland G. Kallen; U of Penn Sch of Navl.3+01 by -9.2 4 2.7mV. -12.1+t3.8mV and -22.0 * 2.lmV Med (P<0.01) respectively. Lidocaine (1mM) reduced the percentage of Site-3 toxins bind to vertebrate Na+ channels (NaChs) to prolong fast mode recovery of Navl.3 by 39.5+1.3%, Navl.3+131 by the time course of Nae current decay by slowing fast inactivation 63.5*3.2%, (P<0.01) and Navl.3+13 by 62.2+1.2% (P<0.01). with little or no effect on activation, a phenotype seen in some Lidocaines (1mM) use-dependant actions were to reduce the human muscle diseases. Na+ currents of WT and chimeric proportion of slow gating. Slow gating of Nav 1.3 was reduced mammalian (rSkMl) and insect (Para) a-subunits coexpressed from 93 ± 10% to 63 ± 12%, Navl.3 +13 from 94 ± 11% to 66 ± with 3- or [3-like subunits (hp3I or tipE) in X laevis oocytes have 8% and Navl.3 + 131 from 36 ± 17% to 15 ± 17%. In conclusion, been measured in two-electrode voltage clamp mode. The LqhaIT, lidocaines effects were more pronounced with 11 compared to 133. an insect-selective scorpion a-toxin, concentration dependence of Since, P1 and P3 mRNA have different patterns of distribution in the magnitude of the slow current decay exponential or normalized rat brain, DRG and spinal cord it is possible that lidocaine may be peak or residual current enabled estimates of Kd values for toxin- used specifically to target certain types of sodium channel NaCh complex formation. In contrast to SkMI, which showed the complex. previously described behavior (K, = 50 nM), the toxin effect on Para (Kd = 0.3 nM) is a greater destabilization of the closed- and 425-Pos Board # B287 open-inactivated states relative to the open state, which results in EFFECTS OF LINOLEIC ACID METABOLITES ON virtually complete failure of current decay via fast-inactivation and CARDIAC Na+ CURRENT an increase in peak current of 3 to 5-fold. Studies with rSkMl/Para Maddison D Harrell', Joseph R Stimers2; 'Tulane University, chimeras showed the importance of D1S5-S6, and D4S3-S4 D4S5-S6 2Univ. Arkansas for Medical Sciences, 4301 W. Markham St., in toxin binding. rSkMI {ParaD4Ss-S6} exhibited Para-like #61 1, Little Rock, Arkansas 72205 behavior. Coexpressed h,Bl or tipE increases toxin affinity by Recent studies on epoxide and diol metabolites of linoleic acid, -102-fold. Site-3 structure in NaCh isoforms and toxin-induced with or without methylation of the carboxy terminal, have shown conformation changes will be detailed. conflicting evidence for effects on cardiac muscle. The whole-cell patch-clamp technique was used to measure the effects of these 423-Pos Board # B285 compounds on Na+ current (IN.) in rat ventricular myocytes. Dose CHARGE-DEPENDENT TRANS-CHANNEL dependent inhibition of peak IN. by 9,10-epoxy-12-octadecenoic INTERACTIONS BETWEEN INTERNAL AND EXTERNAL acid (EOA), 9,10-dihydroxy-12-octadecenoic acid (DHOA) and BLOCKERS OF SODIUM CHANNELS their respective methyl esters (EOM and DHOM) yielded estimates Evgeny Pavlov, Tatiana Britvina, Ivan E.C. Sierralta, Gerald W. for inhibitory constants of 25 ± 2 FM EOA, 88 ± 12 pM EOM, 122 Zamponi, Robert J French; University ofCalgary, Canada ± 15 pM DHOA and 33 ± 6 pM DHOM (n=4-9). None of the Diethylammonium (DEA) and derivatives of ,L-conotoxin GIIIA compounds had effects on the voltage dependence of activation. (g-CTX) are well-characterized blockers of voltage-dependent 50 ,M EOM, EOA and DHOM significantly hyperpolarized the sodium channels. DEA produces fast (blocked time <<1 ms), steady-state inactivation curve by -5 to -7 mV; however DHOA voltage-dependent block of the channel from the cytoplasmic side, had no effect. 50 ,pM EOA and DHOM also significantly slowed reducing the apparent single-channel amplitude, whereas RI 3X the recovery from inactivation, while EOM and DHOA did not. derivatives of x-CTX cause discrete, incomplete slow block (-sec) Recovery time constants were 14.3 ± 2.4 ms in control and 32.4 ± of single channels from the extemal side. We have studied the 8.2 and 33.6 ± 5.6 ms in EOA and DHOM respectively. This effect of the R13E (nominal net charge, +4) and R13Q (+5) suggests that EOA and DHOM act to stabilize the inactivated state derivatives of ,u-CTX on the DEA-block of BTX-activated Na of the channel. These results demonstrate the variable channels in lipid bilayers. Residue 13 is thought to enter most effectiveness of these compounds and suggest that they may have deeply into the channel, suggesting that modification of this structure specific interactions with cardiac Na channels. (Support residue might have a strong impact on DEA-block. We found that from NIH Grant HL60174 and ASPET SURF program) when R13Q or R13E was concomitantly blocking the channel, a plot of fractional block by DEA shifted 25mV (R13Q) or l7mV 426-Pos Board # B288 (R13E) towards more depolarizing potentials, without a substantial ELECTROSTATIC EFFECTS ON PROTON BLOCK OF change in slope. The charge dependence suggests that the shifts Naj1.4 SODIUM CHANNEL CONDUCTANCE reflect an electrostatic repulsion between i-CTX. derivatives and Asma N Khan, Luba F Romantseva, Gregory M. Lipkind, Harry DEA. The difference in shifts between R13E and R13Q is greater A. Fozzard; University of Chicago, 5841 S. Maryland Ave, than expected from the simple change of the total charge of the Chicago, Illinois 60637 toxin from +5 to +4, implying that the distribution of charge on The sodium channel outer vestibule is ringed by carboxyl residues, ,u-CTX is an important determinant ofthe interaction. presumably creating a local negative field. Last year we reported that neutralization of these carboxylates changes the pKa for 424-Pos Board # B286 proton block . If this effect is truly electrostatic, then substitution MODULATION OF LIDOCAINE BLOCK OF NAV 1.3 BY of positively charged lysines should have a larger effect. Using the BETA SUBUNITS 2-micropipette voltage clamp in Xenopus oocytes to measure Bhaval S Shah', Andrew E Din2, Paul W Lenkowski2, James E maximal conductance with 90 mM Na+, I mM Ca2+, and 1 mM John2, Robert D Pinnock', Kevin Lee', Manoj Kumar Patel2; Mg2+, we find the wild-type channel has a pKa = 5.77, E403K has 'Pfizer Global Research and Development, United Kingdom, pKa = 5.0, E758K has pKa = 5.06, D1532K has pKa = 5.26, and 2University ofVirginia HSC N404R has pKa = 5.54. Calculations of change in pKa from Lidocaine blocks Na channels via a tonic and phasic mechanism. electrostatic effects using our vestibule model (Lipkind & Fozzard, These processes may be modulated by beta subunits. We have 2000) are close to these experimental results. Decreasing pH

87a 426-431 POSTERS Sunday

shifted VhaJf of the activation curve, but the shifts with each mutant 429-Pos Board # B291 were almost the same as for the wild type channel, implying that DRUG-INDUCED LONG-QT SYNDROME ASSOCIATED charges in the outer vestibule do not significantly affect the WITH A SUBCLINICAL SCN5A MUTATION membrane field influencing the voltage sensors. We suggest that Naomasa Maidtal, Hideo Otani2, Akira Kitabatakel, Minoru carboxylates in the sodium channel outer vestibule generate a Horie2; 'Hokkaido University, Kita-15, Nishi-7, Sapporo, 060- significant local negative electric field that concentrates protons in 8638 Japan, 2Kyoto University, Japan the vicinity of the selectivity filter, where they compete with sodium for the critical permeation site. Subclinical mutations in genes associated with the congenital long- QT syndromes (LQTS) have been suggested as a risk factor for 427-Pos Board # B289 drug-induced LQTS and accompanying life-threatening UVA LIGHT MODIFIES HUMAN CARDIAC SODIUM arrhythmias. Recent studies have identified genetic variants of the CHANNEL GATING VIA REACTIVE OXYGEN cardiac K+ channel genes predisposing affected individuals to METABOLITES acquired LQTS. We have identified a silent gene carrier of a novel Sho-Ya Wang', Ging Kuo Wang2; 'SUNY at Albany, 1400 SCN5A mutation (L1825P) who exhibited QT prolongation and Washington Avenue, Albany, New York 12222, 2Brigham and torsade de pointes during treatment with the prokinetic drug Women's Hospital, Harvard Medical School cisapride. The L1825P channel heterologously expressed in tsA- 201 cells showed Na+ current with slow UVA irradiation has been shown to generate a variety of decay and a prominent reactive tetrodotoxin-sensitive persistent component, similar to the gain-of- oxygen metabolites. We found that UVA (340-380X) light function phenotype most commonly observed for LQT3. In produced profound gating changes of human cardiac Navl.5 Na+ addition, LI 825P exhibited loss-of-function features characteristic channels. First, UVA irradiation hampered the fast inactivation of of Brugada syndrome. Peak Na+current density observed in cells cardiac Na+ channels expressed in HEK293t cells; as a result, a expressing LI 825P was significantly diminished. Voltage- maintained current became conspicuously evident during dependence of activation and inactivation were shifted towards depolarization. The increase in maintained current reached steady more positive and negative potentials, respectively, resulting in state within 5-7 min. Second, the activation time course was stabilizing channels in the inactivated state. This study first slowed by UVA light albeit the rate of this modification was demonstrates that subclinical mutations in SCN5A may be slower than that for the fast inactivation. Modification on the associated with drug-induced cardiac arrhythmia. activation gating by UVA irradiation continued for up to 20 min without reaching steady state. Third, along with the slowed 430-Pos Board # B292 activation time course the peak current was reduced progressively. MOLECULAR CALIBRATION OF THE Na+ CHANNEL Most Na+ currents were abolished after 20 min of UVA irradiation. PORE BY ELECTROSTATIC COMPLIANCE ANALYSIS Fourth, UVA light increased the holding current nonlinearly; this Ronald A Li', Kazuki Sato2, Kyoko Kodama2, Tian Xue', Robert J phenomenon was slow at first but abruptly fast after -20 min. French3, Gordon F Tomasellil, Eduardo Marban'; 'Johns Hopkins Interestingly, a reactive oxygen metabolite, H202 (1.5%), also University, 720 Rutland Ave / Ross 844, Baltimore, Maryland modified Na+ channel gating in an UVA-resembling, yet non- 21205, Fukuoka Womenis University, Japan, 3University of identical, manner. These results suggest that UVA modifications Calgary, 3330 Hospital Dr NW, Calgary, Alberta T2N4NI Canada of Na+ current are mediated by reactive oxygen metabolites, which target amino acid residues important for the Na+ channel activation Voltage-gated Na+ channels are critical signaling proteins. g- and inactivation gating. Conotoxin (g-CTX) inhibits Na+ flux by blocking the Na+ channel pore, whose structure is unknown. In contrast, the L-CTX 3D 428-Pos Board # B290 structure is well-defined. Mutant cycle analysis has identified THE S5-P-S6 SEGMENTS OF THE SODIUM CHANNEL several critical toxin-channel interaction charge pairs (i.e. R14- FORM A TOXIN-ACTIVATABLE IONOPHORE DII-762, R14-DII-E765, R19-DII-762, R19-DII-E765, and K16- Zhenhui Chen', Benjamin A Suarez-Isla2, Carmen Alcayaga2, DIII-D1241) but the nature of these interactions is undefined. Here Brian O'Rourke', Gordon F. Tomaselli', Eduardo Marban'; 'Johns we sought to calibrate the geometry of the toxin receptor on the Hopkins University Sch of Med, 720 Rutland Ave, Ross 844, pore. We identified novel molecular interactions around the central Baltimore, Maryland 21205, 2ICBM, Faculty of Medicine, axis of the toxin-bound channel complex (R14-DI-E403, K16-DIJ- University ofChile, Chile D762 and K16-DII-E765, D12-DIII-D1241 and D12-DIV-D1532). With the goal of determining the minimum structure of the Na The physical separations for all aforementioned pairs were channel permeation pathway, we created stable cell lines calibrated using electrostatic compliance analysis by inserting expressing a full-length MlI Na channel with a polyhistidine tag at positive, neutral or negative charges at each of the toxin and the C-terminus (gHis), and a pore-only channel with SI-S4 channel interacting sites and studying all pairwise combinations. segments removed in all domains (MPore). Western blots showed The results place specific constraints on the toxin-channel that proteins expressed from both constructs were recognized by a interface, leading us to propose a novel Na+ channel pore model. Na channel specific antibody. iHis channels exhibited the same DEKW, in place of the conventional DEKA ring, comprises the functional properties as wild type Al. MPore did not display selectivity filter in the new model. Although the Na+ channel pore voltage-activated Na currents, nor 3H-STX binding. Nevertheless, shares several similarities with that of the bacterial KcsA KI 24 hour exposure to veratridine (200 AM) caused accelerated cell channels, they differ substantially in their size, molecular death in MHis and MPore cells, but not in control HEK cells. arrangement and working mechanism. Veratridine-induced cell death could be blocked by TTX in MHis cells but not in cells. 431-Pos Board # B293 MPore Intracellular Na+ changes induced by DOMAIN 2 OF DROSOPHILA PARA VOLTAGE-GATED veratridine (150 MM) and brevetoxin (100 nM) were measured SODIUM CHANNEL with the fluorescent Na-sensitive dye, CoroNa Red. These toxins CONFERS INSECT PROPERTIES TO elicited 35% and 31% AF A RAT BRAIN SODIUM CHANNEL increments in MHis and MPore cells, Dalia Gordon', Nicolas Gilles2, Walter Stuhmer, Ilana Lotan'; respectively, relative to those elicited by gramicidin. Toxin- 'Tel Aviv University, Ramat Aviv, 69978 induced AF could be blocked with 1MM TTX in MHis cells but not TelAviv, Israel, 2CEA, in MPore cells. Control HEK cells had no response to brevetoxin + Saclay, France, 3Max-Plank, Gottingen, Germany veratridine. In conclusion, although lacking STX/TTX sensitivity, The ability of the excitatory anti-insect selective scorpion toxin, S5-P-S6 segments of Au channels form an ionophore which can be AahIT, to exclusively bind to and modify insect voltage gated activated by brevetoxin + veratridine. sodium channels (NaChs) makes it a unique tool to unravel structural differences between mammalian and insect NaChs, a

88a Sunday POSTERS 431-435

prerequisite in the design of selective pesticides. To localize the oasOLI, INaT/C amounted 68±6% (n=41, mean*SE, P<0.01), and insect NaCh domain that binds AahIT, we constructed a chimera IN.I/C was 59s6% (P<0.018, n=38) compared to ns OLI. At the composed of rat brain NaCh (rBIIA) in which domain-2 (D2) was same time, ,asOLI accelerated IN.L ('r&,y=45119ms replaced by that of Drosophila Para, as D2 plays essential role in vs.526+13ms, n=32, P<0.01) and reduced IN.aJC (by-25%) but not [beta]-toxins binding-site on mammalian NaChs and AahIT is INaT/C. Conclusion: In adult heart, Na+ channel asubunit (Nal1.5) similar in action and binding to [beta]-toxins. Expression of the generates INaL, whereas PI subunit modulates its kinetics. chimera rBIIA-ParaD2 in Xenopus oocytes gave rise to voltage gated and TTX sensitive NaChs regulated by [beta]l subunit and 434-Pos Board # B296 sensitive to scorpion [alpha]-toxins. Notably, unlike rBIIA, the SUBSTITUTED CYSTEINES IN THE OUTER PORE OF chimera gained sensitivity to AahIT, indicating that AahIT THE Na CHANNEL ARE EQUALLY ACCESSIBLE IN selectivity is due to differences in the insect NaCh D2. The FAST- AND SLOW-INACTIVATED STATES chimera acquired additional insect NaCh properties; right-shift in Arie F. Struyk', Stephen C. Cannon2; 'Massachusetts General activation voltage and potentiation of [alpha]-toxins effect. Our Hospital, Fruit Street, Boston, Massachusetts 02114, 2Harvard results highlight the key role of D2 in the selective recognition of Medical School anti-insect excitatory toxins and in the modulation of NaCh gating. The molecular mechanisms of slow inactivation (SI) in voltage- The work also provides a methodological approach to the study of gated Na channels are not well understood. Mutations or chimeric ion channels that are difficult to express in model systems. exchanges of the P-loops and the concentration of extracellular permeant ions all influence SI, suggesting a rearrangement in the 432-Pos Board # B294 outer mouth of the pore accompanies this gating process. We POLYMORPHISMS OF HUMAN CARDIAC SODIUM sought to determine whether such a conformational change could CHANNEL ALPHA SUBUNIT CLONES RESCUE LQT3 be detected. Cysteine residues were substituted at sites in all four MUTANT M1766L CURRENT DENSITY outer pore-lining P-regions of the rat skeletal muscle Na channel. Bin Ye', Carmen R. Valdivia', Michael J. Ackerman2, Jonathan C. The reaction rates between these introduced Makielski'; 'University of Wisconsin, 1300 University Avenue, cysteines and the Madison, Wisconsin 53706, 2Mayo Clinic/Mayo Fundation charged sulfhydryl-modifying reagent MTS-ET were measured in outside-out Xenopus oocyte macropatches using a rapid-switching The cardiac Na channel a subunit gene (SCN5A) plays an perfusion apparatus. As expected, a pattern of incrementally important role for cardiac excitation. Two complete SCN5A clones slower reaction rates was observed for substituted sites at hHI and hHIa have been reported to differ in structure by 9 amino increasing depth in the pore. We found no change in reaction rates, acids. We cloned a third complete Na channel a subunit and thus no change in aqueous accessibility, between fast- (designated hHlb) using RT-PCR from human heart mRNA. We inactivated (-1OmV, <200 msec) and slow-inactivated states (- resequenced hHI and hHl a. Only 3 amino acid variants were 1OmV, 10 sec), in P-region residues located in all four domains, found because of six changes from the published sequence for including residues adjacent to the narrow DEKA selectivity filter hHl. hHlb differed from hHI by 4 amino acids confined to (401C and 1530C). These results suggest that the outer mouth of domain I-II and domain II-III linkers. hHlb differed from hHla by the Na channel pore remains open while the channel is slow only 3 amino acids confined to domain I-II linker. The three inactivated. (Supported by NINDS and NIAMS) human cardiac Na channel a subunit clones were expressed in the HEK-293 cell line. Whole cell patch-clamp study showed no 435-Pos Board # B297 obvious kinetic differences in steady state activation, inactivation CYTOPLASMIC LOOPS ALTER Na+ CHANNEL GATING and recovery from inactivation. A novel LQT3 missense mutation, - ISOFORM-SPECIFIC EFFECTS ARE LIMITED M1766L, had reduced expression of Na current when expressed in PRIMARILY TO CHANNEL ACTIVATION the hHl and hHIa background compared to wild type by 90% and Eric S. Bennett; U. South Florida, College of Medicine, 12901 97% respectively. In hHlb, however, the expression level of the Bruce B. Downs Blvd., Tampa, Florida 33612 M1766L mutation was normal. Polymorphisms in SCNSA may The isoform-specific role of cytoplasmic loops in voltage-gated influence profoundly the functional properties of putative disease- Na+ channel gating was investigated through expression and causing mutations. chimeric analysis of two human isoforms, Nav,.4 (hSkMl), and Nav,.s (hHl). The hHl cytoplasmic loops that join domains I to II 433-Pos Board # B295 and II to IIL, (loop A and B, respectively), together impose a MOLECULAR BASIS FOR LATE Na+ CURRENT. depolarizing shift in channel half-activation voltage (V,), and KNOCKDOWN OF Na+ CHANNEL SUBUNITS IN ADULT conversely, hSkMl loops A and B together impose a CARDIOMYOCYTES BY ANTISENSE hyperpolarizing shift in channel Va (J. Physiol., 535.2, 371-381). OLIGONUCLEOTIDES Here we show that each loop is responsible for a portion of these Albertas I Undrovinas, Victor A Maltsev; Henry Ford Heart and V. shifts. The voltage of half inactivation and the time constants Vascular Institute, 2799 West Grand Boulevard, Detroit, Michigan for recovery from inactivation were measured and compared for 48202 hHl, hSkMI, and hSkMl/hHl chimeras in order to determine Here we studied molecular identity of ultraslow inactivating Na+ more completely the effect of specific cytoplasmic loops on current (IN&L) involved in cardiac repolarization in man and dog. channel gating. The data show that only channel V. is consistently Cultured mid-myocardial ventricular cardiomyocytes (VC) of 5 altered by these loops. Together, the data indicate that the adult dogs were exposed to 0.98gM 25-mere antisense significant effect of these two loops on voltage dependent gating is morpholino-based oligonucleotides (OLI) targeting regions around limited primarily to the activation mechanism. In addition, the the start codon of mRNA encoding human cardiac Na+ channel a data do not support an electrostatic hypothesis that predicts that the subunit (Na,1.5) 5'ccgaggtaataggaagtttgccatc (ocasOLI), j3 subunit loop-dependent shifts in channel Va are caused by differences in 5'atgigggaggctgctggccttagtgg (pasOLI), or nonsense internal surface charge effects among the loops. 5'cctcttacctcagttacaatttata (nsOLI). Our experimental design was Supported by NIH R01AR45169, and a Grant-In-Aid, American based on high homology between the mRNAs of human and dog. Heart Assoc., FL Affil. VC uptake of fluorescein-tagged OLI was monitored by confocal microscopy. Density of whole-cell transient current (INaT/C) and IN.LJC reduced slightly (-1%/o/day up to 5 days) in both nsOLI- treated and untreated VC. asOLI resulted in identical exponential decreases of IN.T/C and INdLC (r=48h). Four days after exposure to

89a 436-440 POSTERS Sunday

only a single channel different gating modes of sodium-channel 436-Pos Board # B298 action (Bohle et al., 1998, Biophys. J. 75, 1740-1748) were INVOLVEMENT OF AN EXTRACELLULAR RESIDUE IN discovered. For this purpose blocks of single-channel current PORE FUNCTIONS AND GATING OF ENaC traces were reidentified from the plot of the long-time course of the Stephan Kellenberger, Ivan Gautschi, Laurent Schild; Institut de averaged current per part of the trace. The mean single-channel Pharmacologie et de Toxicologie, Bugnon 27, Lausanne, CH-1005 current amplitude (,ean) was identical in atrial and ventricular Switzerland myocytes and was not altered by mode-switching. In two distinct The epithelial Na channel (ENaC) is a heterotetramer of gating modes, one with fast macroscopic activation and homologous subunits, each containing two transmembrane inactivation and the other with slow macroscopic activation and domains. Mutation to larger amino acids of a conserved ser residue inactivation, only a short mean open-channel life time (rO= 0.1 ms, in the extracellular part of the channel, the "DEG" residue, leads to 40 mV) was found. In contrast, in a gating mode with fast hyperactivity of ENaC. The DEG residue is located 7 residues macroscopic activation but slow inactivation a long mean open- upstream of the binding site of the pore blocker amiloride in the channel life time (rO= 1 ms, -40 mV) was found. We conclude that sequence and is thought to lie external to this site. We have a single native human cardiac sodium channel may change its combined mutation to the small residue cys and chemical gating-properties at a time scale of milliseconds, which may lead modification of the mutated DEG residue in the three ENaC to various arrhythmias in human atrium and ventricle under subunits. MTSET modification of the DEG mutants ccS576C and pathophysiological conditions. PS518C resulted in an increase in the open probability. Kinetic analysis of PS518C showed that this was due to a 5-10-fold 439-Pos Board # B301 slowing of the open -+ closed transition and a destabilization of RESTORATION OF GATING CHARGE BY the closed state. Modification of PS518C but not aS576C slightly MODIFICATION OF DIV/S4 OUTERMOST POSITION IN decreased the Li, but not the Na conductance. The modification A R-C MUTANT VOLTAGE GATED Na CHANNEL was not voltage-dependent. Modification of the DEG cys mutants Dorothy Hanckl, John W Kyle', Michael F Sheets2; 'University of by reagents as large as MTS-PTrEA (-7A diameter) did not affect Chicago, 2University ofUtah the access of amiloride to its binding site and modification was Experiments with multiple isoforms of voltage gated Na channels unaffected by the presence of amiloride. This indicates that either in which arginines in domain IV were neutralized have the pore is wide at the DEG site or that the DEG residue is oriented demonstrated a key role for this domain in inactivation from the away from the conduction pathway towards an extracellular open state, recovery from inactivation, and the coupling of surface. activation to inactivation. Gating current studies have suggested that the outermost arginine contributes approximately 19% of the 437-Pos Board # B299 overall gating charge of the channel if it is assumed that charge USE-DEPENDENT CURRENT POTENTIATION OF THE neutralization does not perturb the movement of other voltage rNa,1.6 SODIUM CHANNEL sensors (Sheets et al., BJ 77:747, 1999). A strong prediction of Wei Zhou, Alan L. Goldin; Univ. ofCalifornia, Irvine this interpretation is that restoration of gating charge should be The voltage-gated sodium channel Navl.1, 1.2 and 1.6 a subunits achieved if the positive charge were restored at this position. We are all expressed in the adult central nervous system. Previous studied the human heart Na channel (hHla, C373Y/R1622C) studies have shown that currents through rNalI.l or 1.2 decrease before and after modification of the cysteine with MTSEA, a with rapid stimulation. Channels expressed from the rNaI1.l or positively charged thiol reagent. Voltage dependence of ON- 1.2 a and [1 subunits also show decreased currents with rapid gating charge was measured and maximum ON-gating charge stimulation, but to a lesser extent than for the a subunits alone. The (Qmax) compared before and after exposure to 2 mM MTSEA in attenuation with NaIl.l and 1.2 is positively correlated with the the bath. In four cells Qmax increased after modification with frequency of depolarization. In this report, we show that rNa,1.6 a MTSEA by 25% +/- 4.6%. This increase in charge predicts that subunit channels demonstrate use-dependent attenuation similar to the restored charge contributes 19.9% +/- 3.1% to overall Qmax, that of Nav1.1 and 1.2. However, the current through rNa,1.6 a the value predicted by earlier studies. plus PI channels increases with rapid stimulation. This potentiation effect is different from that seen following PKA phosphorylation 440-Pos Board # B302 of the channel. Potentiation can be as large as 35% after a single COOPERATIVE EFFECT ON FAST INACTIVATION OF train of depolarizations, and it returns towards the original level S4-S5 LOOPS OF DOMAINS III AND IV OF THE Na+ with the extent depending on the recovery time. Potentiation is CHANNEL (hNavl.4) positively correlated with the frequency of depolarization, and it Mariana 0 Pops, Alexi K Alekov, Snezana Maljevic, Nenad does not require ionic flow through the channel. This unique Mitrovic, Frank Lehmann-Hom, Holger Lerche; University of property of Na,1.6 with [31 during rapid stimulation might be UlI, Germany important in understanding the special functional role of Nal1.6 in The cytoplasmic S4-S5 loops of domain III and IV of voltage- vivo. gated Na+ channels are important for fast channel inactivation. We investigated four cysteine mutations in III/S4-S5 (Ni151C, 438-Pos Board # B300 A1152C, 11160C, N1162C), two in IV/S4-S5 (F1473C, L1482C) SODIUM CHANNEL GATING MODES IN HUMAN and two double mutations (N1 151C/F1473C, 11 160C/L1482C). All ATRIAL AND VENTRICULAR CARDIOMYOCYTES mutations could be modified by intracellular applied MTSES Thomas Boeble, Mathias C. Brandt, Dirk J. Beuckelmann; changing both activation and fast inactivation of the channel. University of Cologne, Josef-Stelzmann-Str. 9, Cologne, D-50924 Steady-state activation was shifted by -5 to -2OmV and Germany inactivation curves by up to +2OmV compared to wild type. In the Low noise patch-clamping (bandwidth 10 kHz; sampling presence of MTSES inactivation was slowed up to 4-fold and a frequency 100 kHz; thick-walled patch pipettes: outer diameter 2 persistent Na+ current of 1-10% of peak current occurred for all mm, inner diameter 0.25 mm of the raw material) was performed single mutations. N1151C/F1473C showed a 20-fold slowing of with ultra-clean patch-pipette tips, obtained only seconds before inactivation and 5% of persistent current with MTSES. the actual gigaseal formation. Single native cardiac sodium I1 160C/11482C even more drastically disrupted fast inactivation channels were recorded (pulse frequency 10 Hz) in cells isolated with a persistent current of 27% increasing to 67% after MTSES from normal and diseased (Ischemic/dilated cardiomyopathy) application. Thermodynamic cycle analysis using inactivation atrium and ventricle of human myocardium. In patches containing parameters revealed an additive effect for Nl 151C/F1473C and a significant cooperative effect for I1160C/11482C (coupling energy

90a Sunday POSTERS 440-445

of 1.5 kcal/mol). We conclude that both S4-S5 loops play excitable tissues. The functional role of sodium channel B-subunits important roles for channel activation and fast inactivation and that in the heart is still uncertain. The aim of this study was to the two domains act interdependently concerning fast inactivation. investigate the role of the recently discovered member of the B- subunits, SCN3b, in the heart. Northern blot studies using 441-Pos Board # B303 radiolabeled cDNA probes from sheep heart show that SCN3b is MODULATION OF HSKM1 SODIUM CHANNEL BY G- more highly expressed in the ventricles and purkinje fibers PROTEIN P2Y3 SUBUNITS compared to atrial tissue. This is in contrast to the uniform Vanesa Muncan, Alexey Kuzmenkin, Holger Lerche, Frank expression of SCNIb throughout the heart. Co-expression of Lehmann-Horn, Nenad Mitrovic; University of Ulm, Helmholtzstr. SCN3b with the cardiac specific a-subunit, SCN5a in Xenopus 8/1, Ulm, 89081 Germany oocytes resulted in a three-fold increase in the level sodium current G-protein P2'y3 subunits (GI32y3) were reported to affect gating ofrat density, similar to that observed when SCNIb was coexpressed brain type IIA (rbhlA) sodium channel when coexpressed into with SCN5a. There were only minor differences in the kinetics of mammilian tsA cells. G32-y3 modulate the properties of inactivation SCN5a+SCN3b compared to SCN5a+SCNlb channels when resulting in increased persistant sodium current and destabilization measured using two electrode voltage clamp techniques. In of inactivated state. The C-terminal part of rbIIA channel contains conclusion, both SCNlb and SCN3b increase the efficiency with a sequence (1876QXXER) that has been implicated for direct which SCN5a is targeted to the plasma membrane. SCN3b is likely binding of GI32Y3 subunits. The skeletal muscle sodium channel to contribute to the diversity and heterogeneity of sodium channel (hSkMl) has 69 QTMEEK sequence in the C-tenninal part and its function in the heart. inactivation cannot be modulated by GP2Y3. To investigate weather 444-Pos Board # B306 resistance of hSkMI to modulation by Gp2y3 is due to a missing G- protein binding motif, we produced mutations to derive C-TERMINAL HELICAL STRUCTURES IN THE 1699QMEER sequence. Mutant sodium channels alone or with CARBOXY (C-) TERMINUS OF THE HUMAN HEART Na+ CHANNEL a SUBUNIT (SCN5A) MODULATE coexpressed G12'y3 were studied using whole-cell patch-clamp INACTIVATION technique. In contrast to rbIlA channels, Gr2Y3 stabilized steady- Joseph W Cormier, Ilaria Rivolta, Michihiro Tateyama, An-Suei state fast inactivation in hSkMl containing 699QMEER sequence. Yang, Robert S Kass; Columbia University, 630 W. 168th Street Consistent with the hyperpolarizing shift of steady-state PH 7W-318, New York, New York 10032 inactivation, recovery from inactivation was dramatically slowed. Opposite effects of G-proteins in hSkMl and rblIA could be due to Homology modeling of the 244 amino acid SCN5A C-terminus a different conformation of C-tenrinus in these two channels with predicts predominant a-helical structure (6 helices) in the proximal attached to it. half of this intracellular tail, but little structure in the distal half. G32-y3 Circular dichroism of isolated and purified C-terminus supports 442-Pos Board # B304 this prediction. Whole cell and single channel patch clamp MOLECULAR REGIONS OF THE Pl SUBUNIT recordings of wild type (WT) and mutant a subunits co-expressed INVOLVED IN THE MODULATION OF THE HUMAN with the hpl subunit in HEK 293 cells indicate that truncation of HEART SODIUM CHANNEL (hH1) EXPRESSED IN the distal, non-structured, C-terminus (LI921stop mutant) reduces Xenopus OOCYTES current density but does not affect channel gating (n=6,). In Thomas Zimmer, Klaus Benndorf; Friedrich Schiller University contrast, truncation of the 6th helix containing a concentration of Jena, Teichgraben 8, Jena, 07740 Germany positively charged residues along with the distal C-tenninus (SI885stop mutant), also reduces current density, but, in addition, The PI subunit, but not the P2 subunit of voltage-gated sodium has channels profound and selective effects on inactivation (no effect on accelerates recovery from inactivation and increases the activation). Channel availability is shifted (-Il + 0.6 mV) and amplitude of human heart sodium channel (hHl) currents in there is a 10-fold increase in the percentage of channels that burst Xenopus oocytes. We used p1/P2 subunit chimeras to identify (fail to inactivate) during prolonged depolarization (0.025% molecular regions of the P1 subunit involved in the modulation of S1885stop, n=7 vs. 0.0028% WT, n=9, p<0.005). We conclude hHl and rat brain hIA channels. As a result, all chimeras that the charged structured region of the C-terminus plays a major containing the PI extracellular domain modulated IIA channels role in channel inactivation, stabilizing the inactivated state similarly as the wild-type ,B1 subunit, whereas the presence of the possibly by long-range electrostatic interactions. extracellular domain of the P1 subunit was not sufficient to respectively modulate hHl channels. Instead, the putative 445-Pos Board # B307 membrane anchor plus either the extracellular or the intracellular VOLTAGE-DEPENDENT CONFORMATIONAL CHANGES domain of the P1 subunit were required to modify current AROUND AN S3 SEGMENT OF A SODIUM CHANNEL amplitude and recovery from inactivation of hHl channels. When Thao P. Nguyen', Richard Horn2; 'University of Pennsylvania, fused to the extracellular and intracellular domain of the P2 2Jefferson Medical College, 1020 Locust Street, Philadelphia, subunit, the P,1 membrane anchor alone did not produce pI-like Pennsylvania 19107 effects on hHI currents. We conclude that hH1I and IIA channels interact specifically with different molecular regions of the PI Voltage sensing is due mainly to the movement of positively subunit. charged S4 segments through the membrane electric field during changes of membrane potential. The role of other transmembrane 443-Pos Board # B305 segments is under study. The S3 segment of domain 4 (D4/S3) in THE SODIUM CHANNEL BETA SUBUNIT, SCN3B, the sodium channel NavI.4 carries two negatively charged residues INCREASES THE EXPRESSION LEVELS OF SCN5A AND and has been implicated in voltage-dependent gating. L1433 is IS HETEROGENEOUSLY EXPRESSED IN SHEEP located near the extracellular end of D4/S3 whereas S1427 is CARDIAC TISSUE postulated to reside at a kink between the external and internal Ahmed Ismat Fahmi, Jamie Vandenberg; University of helices of this segment. We measured the modification rates of Cambridge, Tennis Court road, Cambridge, CB2 1QW United L1433C and S1427C. Independent of the charge on the Kingdom extracellular cysteine reagents, depolarization increases the of The sodium channel is a multi-subunit protein complex composed reactivity these two residues. Thus, the direction of the voltage B- dependence is opposite of that expected for a negatively charged of a single large a-subunit along with smaller additional voltage sensor moving inward. The magnitudes of estimated subunitsl. There are at least three different B-subunit genes, electrostatic potentials near both of these residues decrease with SCNIb, SCN2b and SCN3b2, all of which are widely expressed in depolarization, suggesting that either the extracellular crevice

91a 445-450 POSTERS Sunday

surrounding D4/S3 widens, or D4/S3 moves outward, during 448-Pos Board # B310 depolarization. The more conserved negative charge of D4/S3 FUNCTIONAL CONSEQUENSES OF THE IN-VITRO PKA (D1420) also plays a role. Neutralization of this negative charge PHOSPHORYLATION SITES IN THE INTRACELLULAR (D1420N) reduces the voltage dependence of the modification rate ID I-II LOOP OF THE HUMAN CARDIAC SODIUM ofS1427C. CHANNEL a SUBUNIT Birgit Lohberger, Bibiane Steinecker-Frohnwieser, Wolfgang 446-Pos Board # B308 Schreibmayer; University Graz, Harrachgasse 21/4, Graz, 8010 FUNCTIONAL CONSEQUENCES OF A S906T SODIUM Austria CHANNEL MUTATION COMMON FOUND IN PATIENTS WITH HYPOKALEMIC PERIODIC PARALYSIS The voltage dependent human cardiac sodium channel (hHl) is Alexey Kuzmenkdn, Chao Hang, Vanesa Muncan, Holger Lerche, responsible for a stable transmission of the cardiac pulse. In Karin Jurkat-Rott, Frank Lehmann-Horn, Nenad Mitrovic; previous studies coexpression of the alpha-hHl with the beta- University ofUlm, Helmholtzstr. 8/l, Ulm, 89081 Germany adrenergic receptor in Xenopus laevis oocytes issued in an increase in sodium current upon Hypokalemic periodic paralysis (HypoPP) is a hereditary receptor stimulation.We demonstrated that neurological disorder characterized by muscle weakness and a low this modulation works via adenylate-cyclase and PKA, on the potassium serum level during paralytic attacks. This disease was intracellular loop IDI-II of alpha-hHl (Frohnwieser B., et al. 1997, found to be caused by mutations in dihydropyridine receptor and J. Physiol. 498,2: 309-318). It is not known whether this regulation effect is brought about by direct phosphorylation of the channel by skeletal muscle sodium channel a-subunit. For HypoPP causing PKA or if the effect is due to regulatory protein(s). The removal of sodium channel mutations a stabilization of fast and slow stretches of aminoacids in IDI-II, containing PKA consensus sites inactivation has been reported. This may reduce the number of provoke a slight decrease in response to PKA. In in vitro excitable sodium channels in the muscle membrane and cause phosphorylation studies, IDI-II fused to GST was an excellent paralysis. Recently we found a mutation S906T in the a-subunit of substrate for PKA. Analysis of different segments of IDI-II shows the sodium channel in 5 from 118 families with HypoPP, seven a high level of phosphorylation by PKA at the N-terminal region times more often compared to the healthy control (1 in 150 and the section in the middle of IDI-II, respectively. No families). Considering possible consequences of this finding we phosphorylation can be detected within the C-terminal region. The performed whole-cell patch-clamp experiments and studied the withdrawal of consensus sites for PKA in the N-terminal region electrophysiological properties of S906T. The kinetics of reduces the phosphorylation signal significantly. The effect of activation and the rate of recovery from slow inactivation were removal of these in-vitro PKA phosphorylation sites on PKA 1.5-fold slower for the mutant when compared to the WT. In regulation ofhHI channel activity was investigated. addition, sodium current density was 2-fold reduced for S906T Supported by the Austrian Research Foundation (SFB 708 and mutation. Although lower channel density and slightly slower T124) activation can not be decisive for the generation of HypoPP, they may contribute to the pathophysiology of the disease by reducing Cardiac Electrophysiology I the excitability ofthe muscle tissue. 447-Pos Board # B309 449-Pos Board # B311 VARIATIONS IN THE EFFECTS OF Na1.1 MUTATIONS RELATIONSHIP BETWEEN ION CHANNEL DYNAMICS THAT CAUSE GENERALIZED EPILEPSY WITH FEBRILE AND ACTION POTENTIAL ALTERNANS AND MEMORY SEIZURES PLUS TYPE 2 IN CARDIAC CELLS Jay Spampanato, Alan L. Goldin; Univ. ofCalifornia, Irvine Mingyi Li, Niels F Otani; Case Western Reserve Univ. Several mutations that cause generalized epilepsy with febrile The exact chain of events at the ion channel level responsible for seizures plus type 2 (GEFS+2) have previously been identified in alternans (alternation of action potential properties from one the SCNIA gene encoding the a subunit of the Na .1 voltage- stimulus to the next) is currently not known. Clarification of gated sodium channel. These mutations are in many regions of the which ion currents and ion channel properties are involved in the channel, including transmembrane segments, intracellular linkers formation of alternans could help direct the development of drug and the carboxy terminus. To determine the mechanisms by which treatment plans targeting several cardiac arrhythmias. The these mutations alter channel function, we have separately cloned a difficulty in analysis stems from the simultaneous presence of number of them into rNal1.1, the rat ortholog of the human other confounding rhythm patterns, including short time scale channel. The mutant channels were expressed in Xenopus oocytes memory effects. The present computer study applies a in the absence and presence of the PI subunit, and the mathematical eigenmode method to separate these effects from one electrophysiological properties were examined using the cut-open another, allowing each to be studied individually. When the oocyte and two-electrode voltage clamps. One mutation in the S4 method was applied to the Beeler-Reuter model, alternans was segment of Domain IV (R1648H) dramatically accelerated found to be caused by the enhancement of the potassium current recovery from inactivation and reduced the use-dependence of coupled with a reduction in the calcium current, followed by the current amplitudes, consistent with a phenotype of opposite pattern on the next beat. In contrast, a weak memory hyperexcitability. In contrast, a mutation in the S4 segment of effect in the same model was found to be characterized by either Domain II (T875M) enhanced slow inactivation and increased use- the prolongation or shortening of both currents simultaneously on dependence, consistent with a phenotype of hypoexcitability. each beat. Studies employing the more realistic Luo-Rudy These two mutations have very different effects on channel dynamic (LRd) ion channel model show the presence of six function and still cause the same disease phenotype. A complete distinct memory effects plus one alternans mode at short cycle analysis of the effects of these and additional mutations will be length. One of the memory effects is directly related to charge presented. conservation, while others appear to be related to calcium handling and ion concentration drifts. 450-Pos Board # B312 ASSESSING THE MECHANISMS UNDERLYING THE STABILIZATION OF VORTICES OF EXCITATION IN THE HEART Jacques Beaumont', Andrzej Krol', Robert L Price2; 'Upstate Medical University of SUNY, 750 East Adams Street, Syracuse,

92a Sunday POSTERS 450-454

New York 13210-2339, 2University of South Carolina School of followed by superfusion of the injury zone with only isoproterenol. Medicine This protocol delayed the return of excitability from elevated to Vortices developed by electrical impulses, referred to as vortices of normal values, which occurred rapidly during the regular excitation, underlie the majority of lethal arrhythmias including injury/reperfusion protocol, and allowed us to observe the fibrillation. In this last case, vortices of excitation have a finite life progression of ectopic activity into prominent spiral waves span, but are constantly reinitiated at a pace equal or exceeding encompassing the entire injury zone. For up to a minute, spiral their rate of termination. The mechanism underlying this waves in the injury zone and a uniform propagation pattern in the phenomenon is still unclear. We have previously proposed that one control network existed independently. Upon restoration of cell-to- or few vortices functionally anchored in the myocardium may be at cell coupling, spirals within the injury zone broke out into the the origin of the disorganized excitation pattern observed during control network causing arrhythmias. Similar autonomous fibrillation. The mechanisms underlying such functional anchoring behavior of control and recovering injury zones was often involves several factors. Here we present a computer model which observed during basic injury/reperfusion protocols, albeit for much will allow to elucidate them. shorter periods. Supported by the AHA 014023 IN The model incorporates an accurate description of the: heart geometry, its microanatomic structure , and the kinetics of the 453-Pos Board # B315 major membrane channels. Two imaging modalities were A NOVEL METHOD TO DETECT PHASE SINGULARITY employed to obtain the anatomical data. A new soft x-ray imaging DURING ATRIAL FIBRILLATION modality and confocal microscopy. X-ray imaging enabled us to Renqiang Zoul, James Kneller', L. Joshua Leon2, Stanley Nattel'; collect anatomical data on the heart geometry at high resolution 'Montreal Heart Institute, 5000 Belanger St. E., Montreal, Quebec and without performing any dissections. In addition the definition HIT 1C8 Canada, 2University ofCalgary, Canada of the geometry with x-ray data facilitated the registration of the Atrial fibrillation (AF) is a common cardiac arrhythmia, but its confocal images. The Processing of these data involves nonlinear mechanisms are incompletely understood. Due to the dynamic filtering, edge detection, parametric surface fitting, automatic properties of AF, phase singularities (PSs) play an important role features detection, and registration. We present procedures which in arrhythmia maintenance. The precise definition of PSs is enables to readily perform all these tasks. Preliminary simulations important in analyzing atrial activity and mechanisms of AF. A enabled us to identify sites where vortices may stabilize at high method has been described for automated PS detection (J frequency. Cardiovasc Electrophysiol. 2001;12:716-22), but in applying it we encountered many false positives. We therefore developed a new 451-Pos Board # B313 method combining image processing algorithms with the previous A DYNAMICAL MECHANISM FOR CONDUCTION electrophysiologic PS detection algorithm. Possible PS positions BLOCK are first located by calculating contour angles, then these positions Jeffrey J Fox, Mark L Riccio, Fei Hua, Eberhard Bodenschatz, are validated with line integral and other mathematical rules. Both Robert F Gilmour; Cornell University, VT 7012 Vet Research methods were applied to AF simulations obtained with a realistic Tower, Ithaca, New York 14853 computerized atrial ionic/conductive model. Preliminary results Interruption of periodic wave propagation by the nucleation and show that the new method has an average detection precision of subsequent disintegration of spiral waves is thought to mediate the 93%, compared to the 81% precision of the electrophysiologic transition from normal sinus rhythm to ventricular fibrillation. method alone. The automated method has been applied to the This sequence of events may be precipitated by a period doubling analysis of PSs in the mathematical model, and provides novel bifurcation, manifest as a beat-to-beat alternation, or alternans, of insights into the relationship between atrial size and PS number cardiac action potential duration and conduction velocity. How and lifespan in AF. We conclude that our approach is superior to alternans causes the local conduction block required for initiation the previously-described method and will be useful for analysis of of spiral wave reentry remains unclear, however. In the present PS trajectory and lifespan during AF, as well as in understanding study a dynamical mechanism for conduction block was derived AF mechanisms. from experimental studies in linear strands of cardiac tissue and from computer simulations in ionic and coupled maps models of 454-Pos Board # B316 homogeneous one-dimensional fibers. In both the experiments and ANATOMICALLY AND BIOPHYSICALLY DETAILED the computer models, rapid periodic pacing induced marked COMPUTER MODEL OF RABBIT SINO-ATRIAL NODE spatiotemporal heterogeneity of cellular electrical properties, PACEMAKING culminating in paroxysmal conduction block. These behaviors Alan F. Garny', Peter J. Hunter2, Peter Kohl', Denis Noble'; resulted from a non-uniform distribution of action potential 'University of Oxford, Parks Road, Oxford, OXI 3PT United duration alternans, secondary to alternans of conduction velocity. Kingdom, 2University ofAuckland, New Zealand The link between period doubling bifurcations of cellular electrical Anatomico-physiological computer models of the heart are now properties and conduction block identified by these studies may detailed enough to be used in fundamental and clinical research. provide a generic mechanism for the onset of tachycardia and Existing models, however, tend to ignore or unduly simplify atrial fibrillation. function. Here, we present an anatomically and biophysically detailed model ofsino-atrial node (SAN) pacemaking. 452-Pos Board # B314 Our models are based on the rabbit, where most PROPAGATION OF ECTOPIC ACTIVITY FROM THE electrophysiological (1) and structural (2) data have been obtained. ISCHEMIC BORDER LAYER Electrophysiological descriptions of central and peripheral Ara Arutunyan, Narine Sarvazyan; Texas Tech University Health SAN (3) and atrial (4) cells are used to construct strands of SAN Sciences Center and atrial cells (ID) or networks representing a typical cross- Monolayers of neonatal rat cardiomyocytes were used to observe section ofthe right atrium in the region ofthe SAN (2D). the initiation and propagation of calcium transients during in vitro For reproduction of physiological pacemaking patterns in 1D and protocols of ischemia/reperfusion (Arutunyan et al, AJP 2000). 2D, intercellular conductivity has to increase from SAN centre to Our previous studies have suggested an existence of a transient SAN periphery, and atrium. Cutting SAN-atrial connections causes border layer through which an ectopically triggered activity peripheral pacemaker shift, as in native tissue. The implemented propagates. To model the conditions associated with such a cell structural information is also sufficient to explain the area of layer we employed 2 microM isoproterenol as a tool to increase conduction block between SAN and atrial septum. cell excitability and 1 mM heptanol to decrease cell coupling. Supported by British Heart & Boehringer Ingelheim Foundations. Local superfusion with the uncoupler and isoproterenol was I) Boyett MR et al. Cardiovasc Res 2000;47:658-687.

93a 454-459 POSTERS Sunday

2) Coppen SR et al. JHistochem Cytochem 1999;47:907-91 8. Recordings of field potentials (FPs) from multicellular 3) Zhang H et al. Am JPhysiol 2000;279:H397-H421. preparations of cardiac myocytes are influenced by the 4) Hilgemann DW & Noble D. Proc R Soc Lond (B) electrophysiological properties of the single cell as well as by the 1987;230:163-205. characteristics of the cellular aggregate e.g. propagation velocity. We measured transmembrane action potentials (APs) and FPs 455-Pos Board # B317 simultaneously to gain insights into their interdependence. Cardiac STIMULATING ELECTRIC FIELD ORIENTATION myocytes isolated from embryonic mouse heart were cultivated on AFFECTS RAT ATRIA THRESHOLD a multi electrode array (MEA) consisting of 60 substrate-integrated Carlos Marcelo Gurjio Godoy, Kleber Magalhpes Galvao, electrodes, simultaneous current clamp recordings were performed Tatiana Almeida Bacarin, Gisela Rosa Franco; Universidade de close to single MEA electrodes. Mogi das Cruzes, Av. Dr. Candido A. X. e Souza, 200, Mogi das The FP rise time correlates well with the AP upstroke velocity Cruzes, 08790-570 Brazil enabling the identification of pacemaker activity inside the Cardiac excitability is determined by the direction of the electric preparation. Perfusion with nimodipine (50 nM) changed the field, which is defined by the positioning of electrodes. However, upstroke velocity of the AP and the FP rise time by a factor of 12.4 important morphological and physiological modifications that and 11.3 respectively. Another clear correlation of APD90 and FP happen during the postnatal development of the heart may affect spike duration, sensitive to 4-AP could be demonstrated. the cardiac threshold. In this work we have evaluated the effect of Additional perfusion of the preparation with varying electrolyte electric field orientation on the threshold of isolated wistar rat atria solutions and ion channel blockers allowed us to identify the during post-natal development. This was performed by contribution ofspecific ionic currents to the FP. determining the parameters of strength-duration curves for stimuli MEA recordings enabled the analysis of two-dimensional (rheobasis, chronaxie and normalized minimum pulse energy) of excitation spread combined with insights into the atria from rats at ages (days) 5, 15, 30, 60, 90, and 120. These electrophysiological properties offunctionally differentiated cells. parameters were determined using electric field stimulation in four different orientations (apex-basis, basis-apex, left-right and right- 458-Pos Board # B320 left). Atrial rheobasis decreased by 1.5- to 4-fold with animal age EFFECT OF SUBSURFACE SIGNALS ON CARDIAC and was altered by electric field orientation in a diversified way, OPTICAL ACTION POTENTIALS whereas atrial chronaxie increased only with animal age. The Christopher J. Hratt', Sergey F. Mironov', Marcel Wellnerl, minimum pulse energy decreased 2- to 9-fold with aging. This was Frederick J. Vetter, Alois K. popp2, David Weitz2, Arkady M mainly due to rheobasis dependence with electric field direction. It Pertsovl; 1SUNY Upstate Medical University, 750 E. Adams St., is concluded that the appropriate cardiac stimulation depends on at Syracuse, New York 13224, 2Harvard University least three factors: pulse parameters, stimulating electric field Due to significant light scattering, optical action potentials (OAPs) orientation and animal age. recorded from a point on the heart surface represent a weighted sum of fluorescence originating from widely distributed sites 456-Pos Board # B318 beneath the surface. A composite model was developed ABSENCE OF TRANSIENT ACTIVATION OF Na/K PUMP incorporating both optical and electrical properties of heart tissue CURRENT (Ip) FOLLOWING ACTIVATION OF INA - DOES to predict OAP morphology during normal propagation and A FUZZY SPACE EXIST IN GUINEA-PIG VENTRICULAR reentry. Light scattering and absorption parameters were measured MYOCYTES? in pig heart by inserting a 60 l±m laser-coupled optical fiber at Benjamin d.Z. Silverman', Alice Warley', Andrew F James2, different depths. Using these parameters, optical point spread Michael J. Shattock'; 'King's College London, Lambeth Palace functions were derived and then integrated into 3-dimensional Road, London, SEI 7EH United Kingdom, 2University of Bristol, simulations of heart electrical activity (simplified Beeler-Reuter University Walk, Bristol, BS8 lTD United Kingdom kinetics). The model predicted significant variations in OAP The existence for a limited subsarcolemmal compartment, in which upstroke morphology and duration depending on the direction of Na influx (IN.) raises local Na concentration ([Na] ,,) above that of propagation with respect to the surface. The predictions were in the bulk cytoplasm, is controversial. We have used electron probe excellent agreement with experimental OAP morphologies during X-ray microanalysis (EPXMA) and voltage-clamping to different pacing protocols. The model also reproduced dual- investigate changes in subsarcolemmal Na following activation of humped OAPs observed during shock-induced intramural reentry INa. EPXMA did not show a significant difference in (Efimov et al. 1999). Simulations of anatomical reentry at different subsarcolemmal Na between peak systole (n=4) and end diastole subsurface depths suggested that dual-humped OAPs occur only if (n=7: p>0.05). In voltage-clamped guinea-pig myocytes we the obstacle is <1 mm beneath the surface. In conclusion, the examined whether there is transient activation of the Na/K pump model accurately predicts OAP morphology and may be useful for current (Ip) following INa. Cells were voltage-clamped at 35°C with interpreting optical mapping experiments. [Na] 0=I40mM and [Na] pip=lOmM. Ip was measured as the ouabain-sensitive current (lOOAM). A square-step voltage protocol 459-Pos Board # B321 was used from a holding potential of -8OmV to OmV. IN. did not ROLE OF INWARD RECTIFICATION AND Na+ IN transiently activate Ip during a 40ms depolarisation (p>0.05), and CARDIAC PURKINJE FIBER DISCHARGE neither was a transient activation measured over 2000ms (p>0.05). Marcello Rota, Mario Vassalle; State University of New York, A rapid train of nineteen 40ms depolarisations (5Hz) was used to Downstate Medical Center load firther the fuzzy space but still no change in Ip was seen In low [K10, gradually increasing voltage oscillations initiate during the last in the train of depolarisations. These results do not spontaneous discharge in cardiac Purkinje fibers. In canine single support the concept of a common "fizzy space" seen by both Na Purkinje cells studied by means of a whole-cell patch-clamp channels and the Na/K pump in guinea-pig ventricular myocytes. technique, during increasing diphasic ramps (simulating voltage oscillations) from a Vh of -80 mV, outward currents were smaller 457-Pos Board # B319 than inward currents. At Vh -60/40 mV, currents and slope EXPERIMENTAL CHARACTERIZATION OF FIELD conductance decreased markedly. At Vh -50 and 40 mV, during POTENTIALS RECORDED FROM CARDIAC MYOCYTES the initial ramp a slow inward component (threshold -60 mV) Marcel D. Halbach', Ulrich Egert2, Jurgen Hescheler', Kathrin appeared in the range of negative slope of the I-V relation, as Banach'; 'Univ. Cologne, Robert Koch Str. 39, Koln, 50931 shown by reversal of small superimposed current steps. Gernany, 2Univ. Freiburg, Gernany Tetrodotoxin and lidocaine markedly reduced the inward component and negative slope suggesting that the inward

94a Sunday POSTERS 459-464

component is carried by Na+. Low [K10 (2.7 mM) and Ba2" 462-Pos Board # B324 markedly reduced the currents and high had opposite effects. [K+]. THE EFFECT OF [Na I 1, [CA 2+ 1 o AND fl-ADRENERGIC During current-clamp tests, voltage oscillations induced action RECEPTOR ACTIVATION ON Na/CA EXCHANGE potentials when applied at less negative Vh, step voltage Junyuan Gao, Ruixuan Guo, Ira S Cohen, Richard T. Mathias; displacements increasing markedly near the threshold. Thus, SUNY at Stony Brook, Nicols Road, Stony Brook, New York initiation of spontaneous discharge by voltage oscillations requires 11794/8661 depolarization into a voltage range where a marked inward rectification shows a negative slope and an inward sodium The whole cell patch clamp of acutely isolated the guinea pig ventricular myocytes was employed to study Na/Ca exchange component: low [KW]o facilitates discharge by negatively shifting current (INa/Ca). Blockers were used to inhibit K-conductance, this voltage range. Ca-channels, Na/K pump current and intracellular Ca-storage. 460-Pos Board # B322 Cells were held at the calculated reversal potential (VR) of INa/Ca, RELATIONSHIPS BETWEEN Na+ PUMP CURRENT and a voltage ramp was applied to record the membrane I-V INHIBITION AND INOTROPY DIFFER FOR DIFFERENT relationship. In our experimental conditions, the Ni-sensitive OUABAIN ANALOGS. current reversed at the calculated VR, suggesting it was INa/Ca. J. Andrew Wasserstrom; Northwestern Medical School, 303 E. The slope of INa/Ca-V curve became steeper when [Ca2+]o was Chicago Ave., Chicago, Illinois 606011 increased, and became shallower when [Na+]i was increased. The P-agonist, Isoproterenol (1 jiM), increased INa/Ca by about a The toxic and inotropic actions of cardiac glycosides are thought to factor of 2 at all voltages and all [Na+]i and [Ca2+]o studied. This arise from inhibition of the sarcolemmal Na,K-ATPase. Na" pump effect was a in cat ventricular with whole completely prevented by frantagonist, propranolol (1- current (Ip) was measured myocytes 10 ItM), suggesting it was mediated via 13-receptors. Our results cell voltage clamp techniques in order to determine if different suggest that 1-activation increases either the max cycle rate of each ouabain analogs produce similar degrees of pump inhibition at Na/Ca exchanger protein or the number of proteins. This effect similar levels of inotropy. ICso values were compared to inotropic was not due to changes in ionic concentrations, although these EC50 values we reported previously (Ruch et al., Biophys J changes can also alter the slope of the INa/Ca-V relation. This 78:99A, 2000). Results include 1) pump inhibition at the inotropic work was supported by HL28958, HL54301 and HL20588 from EC5o differs for different agents; 2) the ratio of IC50 to EC50 differs the National Heart, Lung and Blood Institute, and by American markedly; 3) the extent of pump inhibition at toxicity is the same; Heart Association. 4) the ratio of pump inhibition at toxicity to inotropy varies widely. These data suggest that other mechanisms are involved in the toxic 463-Pos Board # B325 and/or inotropic effects of different OUA analogs, such as PROTECTION AGAINST OXIDATIVE STRESS IN activation of cardiac RyRs that we and others have reported PATIENTS WITH CARDIAC SURGERY AND IN previously. A higher relative toxicity of OBG may result from HEALTHY VOLUNTEERS BY VERY HIGH greater lipid solubility and therefore enhanced access to and SUPPLEMENTATION WITH VITAMIN C activation of RyRs. These data demonstrate the variability of Wolfgang E. Trommerl, Silke Mrosek2, Andreas Miihlhofer3, effecis between different OUA analogs and suggest that direct Dieter U. Preiss4, Fabian Rozariol, Beate Schlegel2, Hans K. activation of SR Ca' release might contribute to the cellular actions Biesalski2; 'University of Kaiserslautern, P.O.Box 3049, ofcardiac glycosides in addition to Na,K-ATPase inhibition. Kaiserslautern, D-67653 Germany, 2University of Hohenheim, Germany, 3Katharinenhospital Stuttgart, Germany, 4Herzzentrum 461-Pos Board # B323 Bad Krozingen, Germany ELECTROPHYSIOLOGICAL CHARACTERIZATION OF MOUSE ATRIAL HL-1 CELLS Healthy volunteers and patients with bypass surgery were Joseph R Stimers, Joomi Ha, Stephanie L Hastings; Univ. intraveniously given 0.75 or 7.5 g of vitamin C. Serum levels of Arkansas for Medical Sciences, 4301 W. Markham St., #611, Little vitamins C and E as well as parameters indicative of oxidative Rock, Arkansas 72205 stress including TBARS, MDA and 8-oxoguanine were measured with time and correlated with the ascorbate free radical A cardiac cell line that retains as many properties of normal cardiac myocytes as possible is desirable because of the expense of concentration as determined by EPR spectroscopy. obtaining freshly isolated cardiac myocytes. A tumor derived 464-Pos Board # B326 mouse atrial cell line, HL-1, was studied with whole-cell patch- SUBCELLULAR ELEMENTAL DISTRIBUTION clamp techniques. Confluent cultures of HL-1 cells electrically FOLLOWING RAPID ATRIAL PACING couple and become spontaneously active with visible contractions. Joseph G Akarl, Thomas H Everett, IV2, Ruoya Ho', David E Current clamp in physiological solutions reveals that HL-l cells Haines', Andrew P Somlyo', Avril V Somlyo'; 'University of have rapidly rising action potentials with overshoots to +40 mV, a Virginia, 1300 Jefferson Park Ave, Charlottesville, Virginia 22908, plateau phase of about 100 ms and a resting membrane potential of 2Indiana University -75 mV. Voltage clamp reveals that HL-4 cells have Na+, Ca+ and K+ currents. Na+ current has normal voltage dependence and Electron probe microanalysis (EPMA) was used to assess changes activation kinetics; however, recovery from inactivation was very in ultrastructural distribution of biological elements following rapid. Na+/K+ pump current in these cells has a density of 0.8 rapid pacing in vivo. EPMA enables detection of signals due to pA/pF and is half activated by K. at 1.1 mM. HL-1 cells were atomic shell excitation of elements, thus providing accurate stained with isoform specific antibodies for the different subunits subcellular elemental concentrations. The left atrial appendage of the a2, and developed using (LAA) was frozen in vivo after 30 min (n=3 dogs) or 48 hrs (n=5) Na+/K+ pump (al, or3, 01, J2) of atrial pacing at 10 Hz. Dogs in sinus rhythm were used as rhodamine conjugated secondary antibodies. Expression of the al, control (n=3). The LAA effective refractory period (ERP) was o3 and 01 subunits was evident, with al and 01 being the most measured pre- and post pacing. Elemental whole cell (wc), cytosol defined membrane stain. There was no staining for the a2 or 02 (cyto), and mitochondrial (mito) distributions were determined subunits above background levels. Further experiments are needed after cryosectioning. LAA ERP did not change after 30 min pacing to fully characterize these cells. (NIH Grant HL60174). but it decreased after 48 hrs (1 16±10 to 93415 ms, p=0.004). After 30 min pacing, wc and cyto Cl increased by 90 and 80% respectively (p<0.002), while Na increased by only -11% (p=NS). However after 48 hrs, Na was reduced by 33-62% in each compartment (p<0.01) and cyto S levels increased by 14%

95a 464-469 POSTERS Sunday

(p<0.002). Calcium concentrations did not change significantly 467-Pos Board # B329 after 48 hrs and the distribution of K, Mg, and P remained EFFECTS OF HALOTHANE ON MEMBRANE CURRENTS unchanged in the 3 groups. IN SUB-EPICARDIAL AND SUB-ENDOCARDIAL RAT Conclusion: After 30 min pacing, Cl increased significantly out of LEFT VENTRICULAR CELLS proportion to Na. After 48 hrs pacing, Na was significantly Amber Rithalia, Mark R Boyett, Philip M Hopkins, Simon M reduced and there was no Ca overload despite the presence of Harrison; University ofLeeds, United Kingdom electrical remodeling. Halothane has a greater abbreviating effect on the action potential 465-Pos Board # B327 of cells isolated from the sub-endocardium (ENDO) than the sub- IMPORTANCE OF THE T-TUBULES IN THE RESPONSE epicardium (EPI) of the rat left ventricle, suggesting differences in OF CARDIAC MYOCYTES TO f-ADRENERGIC halothane-sensitive currents in the two cell types. Ic, and I.o were STIMULATION recorded in the absence and presence of 0.6 mM halothane in EPI Fabien BRETTE, Kimiaki KOMUKAI, Clive H ORCHARD; and ENDO cells (n = 7-10 cells in each group) from male Wistar University of Leeds, School of Biomedical Sciences, Leeds, LS2 rats (-250 g wt). Ic, (mean 4 SEM) was not significantly different 9NQ United Kingdom in EPI and ENDO cells (-0.52 4A 0.08 nA vs -0.59 + 0.05 nA). Halothane decreased EPI + Introduction. Ica to -0.38 0.07 nA (P<0.001) and Formamide has been used previously to detubulate ENDO Ica to -0.45 4- 0.04 nA (P=0.004). The degree of inhibition rat ventricular myocytes [1]. We have used this technique to of Ic, was not significantly different between the two cell types. Ito investigate the role of the t-tubules in the response to P-adrenergic (mean + SEM) was greater (PP<0.001) in EPI than ENDO stimulation. Methods. Experiments were performed on cells (4.07 I 0.70 nA vs 0.97 I 0.27 nA). Halothane decreased Lo to 3.74 enzymatically isolated rat ventricular cells using the whole cell t 0.71 nA in EPI cells (P=0.003) but had no significant effect on configuration of the patch clamp technique to record L-type Ca current in ENDO cells. In EPI cells, simultaneous inhibition of current (Ica). TEA/Cs containing solutions were used; isoproterenol inward (Ica) and outward (Ito) currents by halothane would be (Iso) was superfused at 0.5 AM. Results. Detubulation induced a expected to lead to only a small change in action potential 27% decrease of cell capacitance and decreased the amplitude of duration. However, in ENDO cells, where only inward current is Ic. measured at 0 mV by 42 % (n=10-16). [so induced a leftward inhibited by halothane, a greater abbreviation of the action shift of the peak of the ICE-V curve in control and detubulated cells. potential would be induced. However, the amplitude of Ic. increased less in response to Iso in detubulated cells than in control cells (+46% vs +91% at 0 mV, 468-Pos Board # B330 n=7). Discussion. The 13-adrenergic pathway still functions in DIFFERENTIAL EFFECTS ON ELECTRICAL ACTIVITY cardiac cells after detubulation but appears less effective. These IN ADULT RAT VENTRICULAR MYOCYTES BY data are consistent with a report that key proteins of the P- LINOLEIC ACID METABOLITES: EFFECTS OF HEAD adrenergic cascade are localized at the t-tubule [2], and with GROUPS localized signalling within the cardiac cell. Joomi Ha, Joseph R. Stimers; University of Arkansas for Medical 1. Kawai, M. et al. (1999). Amer J Phys; 277; H603-609. Sciences, 4301 West Markham Street, Slot 611, Little Rock, 2. Laflamme, M. and Becker, P. (1999). Amer J Phys; 277; Hi 841- Arkansas 72205 H1848. Linoleic acid (LA), the most abundant essential fatty acid in Supported by British Heart Foundation and Wellcome Trust. mammals, is metabolized during traumatic injury such as severe 466-Pos Board # B328 burns or blunt wounds. Metabolites have been associated with the MECHANISMS BY WHICH CAFFEINE ALTERS SINO- pathological effects of severe trauma leading to systemic ATRIAL NODE DISCHARGE inflammation and organ failure. These compounds are also Mario Vassalle, Michael P. Nett, John Catanzaro, Marcello Rota; suggested to be mediators of toxicity in the heart. Effects of free State University of New York, Downstate Medical Center, 450 LA metabolites 9,10-epoxy-octadecenoic acid (9,10-EOA) and Clarkson Ave., Brooklyn, New York 11203 9,10-dihydroxy-octadecenoic acid (9,10-DHOA) and esterified LA metabolites (EOM and DHOM) were measured in adult rat Changes in discharge induced by caffeine were studied in guinea ventricular pig isolated sino-atrial node (SAN) by means of a microlelectrode myocytes. At 50 FM, EOA inhibited Na+/fK pump current (Ip) by 61%, whereas only 20% Ip inhibition was observed technique. High [Klo slows SAN until an oscillatory potential for EOM. An (Vos) is unmasked. During diastolic depolarization (DD), opposite trend was observed for the diols of free LA oscillations and esterified LA. Action potential (AP) measurements increasing voltage (ThVos) appear in a given voltage demonstrated a dose-dependent effect of EOA and DHOM on both range ('oscillatory zone") and induce slow discharge. Caffeine (1 the duration mM) may increase discharge by increasing Vos size. and overshoot potential. EOM and DHOA elicited High caffeine little or no response to Ip and AP measurements. This study (10-20 mM) (which depletes SR calcium) may increase the rate that free through a steeper but then Vos showed linoleic acid epoxides and methyl ester diols were DD, is suppressed and quiescence most efficacious inhibitors of Lp and on the action potential in follows. In slowly driven SAN, caffeine shifts ThVos in a negative cardiac in direction, and they fail to attain the threshold. In caffeine's myocytes. (Supported part by NIH grants HL60174 and presence, a fast drive shifts ThVos to maximum diastolic potential. GM56708 and AHA fellowship 0120686Z.) Fast drive increases ThVos size, thereby initiating a spontaneous 469-Pos Board # B331 rhythm (overdrive excitation). A premature beat may cause a VOLTAGE-DEPENDENT INCREASE OF NUCLEAR temporary arrest. Caffeine changes force pattems consistently with ETHIDIUM FLUORESCENCE IN RABBIT VENTRICULAR a smaller calcium uptake into the SR. Spontaneous discharge MYOCYTES ceases when ThVos fail to attain the threshold. Thus, low caffeine Yumei Song, Rikuo Ochi; Juntendo University School of may increase SAN rate by enhancing Vos. High caffeine Medicine, Japan suppresses discharge by decreasing Vos (reduced SR calcium stores), but it shifts the oscillatory zone to more negative values. How membrane pore-formation is involved in physiological or Caffeine causes overdrive excitation by increasing ThVos size, pathological activity of cells have been little known. Ethidium+ apparently through a further increase in cytoplasmic calcium. cation (Et+, 314 Da) increases nuclear fluorescence after permeating through membrane pores in dead cells. We used patch clamp and fluorometric techniques to study whether low K+- induced hyperpolarization produces pores to penneate Et+ in rabbit ventricular myocytes. Ethidium bromide (EtBr) was applied at 10

96a Sunday POSTERS 469-474

g/ml. Rectangular hyperpolarization to -160 - -200 mV from HP broad-spectrum channel block by THI 177 may provide insights of -20 mV elicited inward current and increased nuclear into the structural basis of channel block by small molecules and fluorescence. K+-free perfusion induced hyperpolarization and may also have important therapeutic implications for the treatment sustained action potential. Glibenclamide (5 M) prolonged the ofatrial arrhythmias. duration of action potential often to longer than 10 min. The K+- free perfusion gradually increased nuclear fluorescence, thereby 472-Pos Board # B334 the increase was slow during plateau phase of action potential. In CELLULAR BASIS OF CONTRACTILE DYSFUNCTION IN the presence of EtBr, mean membrane potential during 10 min and CHRONIC CORONARY STENOSIS. Et fluorescence increase in 10 min were; normal Tyrode, -82.4+1.8 Virginie Bito, Frank Heinzel, Frank Weidemann, Christoph mV (mean+SE, n=17) and 1.74+0.15 U; K+-free, -71.4+8.2 mV Dommke, Ivan De Scheerder, Bart Bijnens, George Sutherland, (N=26) and 4.16+0.70 U; K+-free + glibenclamide, 43.7+7.0 mV Karin R. Sipido; University of Leuven, O&N, Herestraat 49, (N=15) and 1.98+0.33 U. These results suggest that K+-free- Leuven, 3000 Belgium induced hyperpolarization produces minute pores through which Chronic coronary stenosis induces decreased and dyssynchronous Et+ cations flow in driven by negative membrane potential. wall thickening.We investigated whether this is related to intrinsic remodeling of the myocardium. A copper stent inducing a 95% 470-Pos Board # B332 stenosis was implanted into the RCX of young adult pigs. SALICYLALDOXIME BLOCKS THE CALCIUM AND Ventricular myocytes isolated from this area (STEN) were ULTRA-RAPID COMPONENT OF POTASSIUM CURRENT compared to cells isolated from the same area of control animals IN MURINE VENTRICULAR CELLS (CON). During field stimulation (1 Hz), the amplitude of Allison A Ivy, Mohit L Bhattacharyya; Meharry Medical College, contraction was reduced in STEN cells (3.30/o+0.5 vs 5.50/ol1.1) 1005 D. B. Todd Blvd, Nashville, Tennessee 37217 with a markedly prolonged time to peak: 372*21 ms vs 501*23 In our laboratory, we found that salicylaldoxime, 2- ms. Rate of relaxation was not different. The peak of [Ca2+ ]i (OH)C6H4CH=NOH, displays multi-ion channel blocking effects transient tended to be smaller in STEN (1.9 ± 0.3 vs 1.4*0.1, in rat ventricular myocytes and bi-phasic actions on contractile fluorescence ratio units). APD90 at 1 Hz was significantly force in rat ventricular muscle. Our studies in canine Purkinje prolonged in the cells from STEN: 429123 ms vs 359 *19 ms. Cell fibers have also revealed that salicylaldoxime (sali) exhibited some size of myocytes isolated from STEN was significantly larger. In anti-arrhythmic properties. This motivated us to look at the multi- conclusion, chronic coronary stenosis leads to remodeling of the ion channel blocking effects of Sali in mouse ventricular cells. In ventricular myocytes with hypertrophy, action potential this study we looked at a current that appeared to be a mixture of prolongation and slower contractions, which can contribute to the I. and lcr. We also tested the effects of this drug on slow inward contractile dysfunction in vivo. The slower contraction is only calcium current (ICa). In the control It, was 32.0 ± 3.5 pA/pF in partly due to altered Ca handling, and metabolic alterations and/or cells for a potential step to +70 mV (from a holding potential of- changes in myofilament properties are likely to contribute as well. 80 mV). With 0.01 andl.0 mM sali, the current decreased to 23.6 ± 0.3 and 14.3 ± 6.2 pA/pF, respectively. IKur was also decreased 473-Pos Board # B335 from a control value of 56.1 ± 15.2 pA/pF to 41.5 ± 14.4 and 4.5 _ CHANGES IN [Na+jI INDUCED BY ISCHEMIA-LIKE 2.1 pA/pF for 0.01 and 1.0 mM sali (for a potential step to +60 mV CONDITIONS IN MOUSE CARDIAC MYOCYTES from a holding potential of-40 also to ± Francesco Moccia, Regina Macianskiene, Gudrun Antoons, Karin mV). Ic. decreased 15.0 of 6.2 and 6.7 ± 3.9 pA/pF from a control value of 15.4 ± 8.3 pA/pF Sipido, Kanigula Mubagwa; University Leuven, Belgium for 0.01 and 1.0 mM sali (for a potential step to 0 mV from a Intracellular Na+ (Nai) accumulation during myocardial ischemia holding potential of -40 mV). The I-V relationship for IK.r shows plays a key role in the Ca overload responsible for that the maximal decrease of the current occurs around +60 mV, ischemia/reperfusion injury. However, the contribution of the and the decrease is almost linear. For Ica the I-V relationship various Na transport process (Na/K pump, Na/H exchanger, etc.) in shows that the maximal current and maximal decrease occurs the Nai rise are not fully clear. We have investigate the role played around 0 mV. We conclude that this monoxime-containing by the Na/H exchanger (NHE) in the Na1 changes elicited by extra- compound has dual channel blocking effect. and intra-cellular acidosis and by metabolic inhibition in mouse ventricular myocytes loaded with SBFI. Lowering of extracellular 471-Pos Board # B333 pH to 6.4 caused a decrease in Nai, while the application of20 mM BROAD-SPECTRUM BLOCK OF IONIC CURRENTS IN NH4Cl caused an increase in Nai. These changes were abolished by ATRIAL MYOCYTES BY TH1177, A NOVEL CALCIUM 3 ,uM cariporide (HOE 642), an inhibitor of NHE. The combined CHANNEL ANTAGONIST inhibition of glycolysis and oxidative phosphorylation by 10 mM Hsuan-Tsung J Wang, Joseph G Akar, Timothy Macdonald, 2-deoxyglucose and I mM NaCN induced an increase in Nai, that Gabor Szabo; University ofVirginia was not significantly affected by cariporide, which only caused a THI 177 is a novel compound that significantly reduces calcium small reduction in the rate of rise. Removal of extracellular entry into cells. We studied the effects of TH1177 on the ionic K+prevented the Nai increase induced by metabolic inhibition (MI). currents of guinea pig atrial myocytes. After enzymatic Therefore, while the block of the Na/K pump is the major dissociation by Langendorff perfusion, isolated cells were patch- determinant of the Na, rise during metabolic inhibition, NHE can clamped using the whole cell recording mode and exposed to contribute until the latter is complete. increasing amounts of THI 177. Ionic currents were studied under 474-Pos Board # B336 voltage clamp in 3 to 5 cells for each concentration increment. PACEMAKER Concentrations of half-maximal channel block (IC55) were ACTIVITY AND EXCITATION SPREAD IN determined by fitting the Hill equation to the data. The IC50 of Cx43(-/-) CARDIAC MYOCYTES DERIVED FROM channel EMBRYONIC STEM (ES) CELLS block by TH1 177 were (in tLM): L-type calcium current Kathrin Banach', Jufrgen Hescheler', Ulrich Egert2; lUniv. (Ic,.j) 0.9; T-type calcium current (Ic.T) 3.1; delayed rectifier Koch Str. potassium current (IK) 3.3. THI 177 also blocked the sodium Cologne, Robert 39, Koln, 50931 Germany, 2Univ. current (IN.) with a potency that decreased for hyperpoarizing Freiburg, Germany holding potentials (ICso = 0.37 lAM and 0.06 ttM for Vh = -1 15 and Spontaneous pacemaker activity was recorded from ES cell -85 mV respectively), suggesting an action on the inactivated state derived cardiac myocytes (ESCs) by the help of a multi electrode of the channel. In contrast, there was no significant effect on the array. During time in culture the beating frequency of the ESCs inwardly rectifying potassium channel (IKI). This specific but increases from 1 to 5 Hz, AP duration shortens from 220 ms to 120 ms and the upstroke velocity of the APs increases by a factor of 5.

97a 474-478 POSTERS Sunday

Furthermore the conduction velocity inside the beating aggregate enhanced SR Ca storage capacity provide coordinated decreases. The data demonstrate that ESCs differentiate in culture cardioprotective mechanisms by preventing Ca overload during thereby recapitulating the developmental steps known from true hibernation. embryonic mouse heart. ESCs deficient to express the gap junction protein Cx43 undergo 477-Pos Board # B339 the same developmental time course as wild type ES cells, A MOUSE MODEL OF METABOLIC indicated by the time course of the developmental change of the CARDIOMYOPATHY SHOWS ALTERATIONS OF beating frequency and the APD. However, APDs are shortened by VENTRICULAR ELECTROPHYSIOLOGY 40% and conduction velocity inside the beating aggregate remains Eva Bernhart', Christa Noehammer2, Philipp Staber2, Peter slow (30% increase). Schaffer2, Gerald Hoefler', Bernd Koidl2; 'Inst. of Medical Physics Besides a time dependent change of the electrophysiological and Biophysics, Harrachgasse 21/lV, Graz, 8010 Austria, 2Karl properties a spatial differentiation inside the beating area could be Franzens University Graz, Austria observed in wild type cells. Different electrophysiological We developed a mouse model for metabolic cardiomyopathy by properties could be characterized along the path of excitation overexpressing human lipoprotein lipase in skeletal and cardiac spread. In contrast no spatial organization of the tissue seems to muscle while simultaneously inactivating the transcription factor occur in Cx43(-/-) cells, indicating the necessity of Cx43 peroxisome proliferator-activated receptor alpha (PPARa-/-hLPL). expression in functional tissue differentiation. Male animals had a drastically reduced life span while both genders showed significantly lower left ventricular developed 475-Pos Board # B337 pressure. Deceased animals exhibited cardiopulmonary congestion ELECTRICAL REMODELING OF VENTRICULAR but had no increase of lipid in the heart. To gain insight into MYOCYTES FROM THE ONSET OF PRESSURE underlying mechanisms we isolated ventricular myocytes from OVERLOAD: EVOLUTION OVER TIME male control and PPARa-/-hLPL mice. Benoit-Gilles Kerfant, Jean-Pierre Benitah, Guy Vassort, Ana M Cell membrane capacitance was slightly enhanced in PPARa-/- Gomez; INSERM, France hLPL mice (p=NS). Field stimulated contraction revealed no Hypertensive disease leads to cardiac hypertrophy, which increases differences in the time-course of the onset or relaxation of the risk of arrhythmia and sudden death. Studies over the years are contraction. Outward potassium current density was slightly difficult to integrate since the differences in data could be due to reduced (p=NS) in PPARc-/-hLPL males. L-type calcium current different stages of disease. We have used a rat model of abdominal (1c.L ) recordings showed a significantly decreased peak current aortic constriction (AAC) and followed the evolution of ionic density, voltage dependence of IcL activation and steady state currents over time. Ventricular myocytes were enzymaticaly inactivation was shifted towards more depolarized potentials in isolated and Ic. and I.,, were recorded by whole-cell patch-clamp PPARa-/-hLPL mice (p<0.05). Our data fiurther suggest a technique. Experiments were performed on AAC rats at 1, 3, 6 & depressed Ic.L activation by beta-adrenoreceptor stimulation in 12 weeks after aortic banding. Sham-operated rats were used as PPARa-/-hLPL mice. The observed effects may be an initial step controls. Cardiac hypertrophy started to develop from the 3rd week for ventricular dysfunction and subsequent mortality. and was well established at 6 weeks after the AAC. Cell capacitances followed the same pattern. As soon as I week after 478-Pos Board # B340 surgery, AAC myocytes showed an increased Ic. and a decreased INJURY CURRENT INDUCES SPONTANEOUS ACTIVITY Il.. With cell hypertrophy after 3 weeks current densities became IN RABBIT PURKINJE MYOCYTES. normal but I., density was reduced again from the 6h week. In Delilah Huelsing', Kenneth W Spitzer2, Andrew E Pollard3; conclusion, from the beginning of a pressure increase, first cardiac 'University of Alabama at Birmingham, Volker Hall B140; 1670 myocytes ionic currents are remodeled, and then they hypertrophy. University Blvd., Birmingham, Alabama 35294, 2University of Thus, electrophysiological remodeling was evident before the Utah, 3 physical remodeling (heart and cellular hypertrophy). Ventricular arrhythimias arising during the first 30 minutes after an ischemic episode may be associated with injury current flowing 476-Pos Board # B338 from depolarized myocytes to normally polarized myocytes. CHANGES IN CELULAR Ca HANDLING IN Within this time frame, local [K1IO accumulation caused by the HIBERNATING MYOCARDIUM disruption in coronary flow depolarizes ventricular myocytes, Ritsu Honda, Raymond K Kudej, Song-Jung Kim, Stephen F while neighboring Purkinje myocytes are less affected. To Vatner, Atsuko Yatani; UMDNJ-New Jersey Medical School, 185 determine if injury current flowing from depolarized ventricular South Orange Avenue, Newark, New Jersey 07103 myocytes induced spontaneous activity in Purkinje myocytes, we Hibernating myocardium, due to ischemia has been studied represented ischemic, depolarized ventricular myocytes with a extensively, but little is known regarding true hibernation. To passive resistor-capacitor model cell that had a variable rest investigate the cellular mechanisms responsible for altered left potential (V,). We electronically coupled this model cell to ventricular (LV) fiunction during true mammalian hibernation, we rabbit Purkinje myocytes, which do not normally demonstrate examined L-type Ca currents in LV myocytes from hibernating automatic activity. We represented the cell-to-cell uncoupling that woodchuck (HB) (heart rates <25 bpm, body temperature <140C) also occurs during ischemia by varying the junctional resistance and from non-hibernating woodchuck (NHB). The Ca current (Rd) between the Purkinje myocyte and the model cell. Repetitive density was reduced in HB compared with NHB (4.4 + 0.2 vs. 6.5 spontaneous activity was induced in the Purkinje myocytes by an + 0.3 pA/pF, p< 0.01), but Ca current inactivation in HB was injury current that flowed during coupling to the model cell with significantly faster compared with NHB. The difference in Ca V,, = -50 mV and Rj ranging from 2 Gil to 300 MO. Greater current inactivation was abolished when the sarcoplasmic V,.,, depolarization generated spontaneous activity at higher Rj reticulum (SR) Ca was depleted by ryanodine (10 FM). SR Ca values, while repetitive spontaneous activity only occurred within content, as estimated from caffeine-induced Na/Ca exchange a range of injury current magnitudes that depended in part upon the current, was increased in HB compared with NHB (2.2 + 0.2 vs. diastolic membrane resistance ofthe Purkinje myocyte. 0.9 0.1 pA/pF, p<0.01), supporting the concept that Ca current inactivation was enhanced in HB due to enhanced SR Ca release. P-AR agonist, isoproterenol increased Ca current in both groups with a similar EC50, but the maximal response in HB was reduced to 55 % of NHB. These data suggest that downregulation of basal and P-AR-promoted L-type Ca currents, and significantly

98a Sunday POSTERS 479-483

they contribute to pacemaker activities and are involved in the 479-Pos Board # B341 pathogenesis of epilepsy. Proper elucidation of their cellular A NOVEL HEART RATE TIME SERIES MEASURE functions has been hampered by the lack of selective USEFUL IN THE EARLY DIAGNOSIS OF NEONATAL pharmacology as well as the absence of generic endogenous SEPSIS regulations. We report here that both cloned (alG, alH and all Hanqing Cao, Douglas E. Lake, M. Pamela Griffin, J. Randall subunits) and native T-channels are blocked by the endogenous Moorman; University ofVirginia cannabinoid, anandamide. Anandamide, known to exert its Prior to clinical signs of sepsis, newborn infants have reduced physiological effects through cannabinoid receptors, inhibits T- heart rate variability and transient decelerations. Previously, we currents at submicromolar concentrations independently from the found that a measure of the symmetry of distributions of RR activation of CB1/CB2 receptors, G-proteins, phospholipases and intervals (skewness) and a measure of complexity (Sample protein kinase pathways. Inside-out excised patch recordings Entropy; SampEn) were significantly associated with sepsis in the further indicates that anandamide acts directly on T-channels. next 24 hours. We have developed new measures based on Block of anandamide membrane transport by AM404 prevents T- analysis of empirical cumulative distribution functions (ECDFs) of current inhibition, suggesting that anandamide acts intracellularly. random pairs of short epochs. We reasoned that when only one of Anandamide preferentially binds and stabilizes T-channels in the the pair included a deceleration, the area between the ECDFs inactivated state and is responsible for a significant decrease of T- would increase. Thus the distribution of areas from many pairs of currents associated with neuronal firing activities. Our data epochs within a data set with decelerations would itself be demonstrate that anandamide inhibition of T-channels can regulate asymmetric. We tested the hypothesis that a measure of the neuronal excitability and account for CB receptor-independent asymmetry of ECDF areas would be significantly associated with effects ofthis signaling molecule neonatal sepsis using logistic regression analysis of a data set comprised of 73,000 records of 4096 beats (about 20 min each) 482-Pos Board # B344 from 89 infants who had 20 episodes of sepsis. We found highly GATING OF CAv1.2 CHANNELS IN HIGH significant association (ROC area 0.73, p<0.0001). The measure INTRACELLULAR CALCIUM: EVIDENCE FOR was not strongly correlated with prior measures, and added A UNIFIED THEORY OF INACTIVATION independent information to SampEn, sample asymmetry, and Dmytro Isaev, Karisa Solt, Roman Shirokov; New Jersey Medical clinical measures of birth weight and gestational age. We School - UMDNJ conclude that this novel analysis of ECDFs may be a useful Ca influx and transmembrane voltage have been suggested to measure in the early detection of neonatal sepsis using heart rate be the proximate causes of the same inactivation transitions in monitoring. Cav1.2 channels (Shirokov 1999, J.Physiol. 518.3:697). Because [Ca2lj near a functional channel rapidly changes in the 0.1-100 480-Pos Board # B342 1tM range, it is difficult to characterize the interaction. Here we ISCHEMIA ALTERS CALCIUM TRANSIENTS IN S-A describe the voltage-dependent gating at a high steady-state [Ca21,. NODE PACEMAKER CELLS alC, P2a and .a2a subunits were expressed in tsA201 cells. Oleksiiy Gryshchenko, Jihong Qu, Richard D. Nathan; Texas The whole cell patch clamp pipette contained 500 ,uM free Ca. Tech University Health Sciences Center, 3601 Fourth Street, Although Ca currents ran down completely in about 5 min, the ON Lubbock, Texas 79430 gating current transients recorded from Vh = -90 mV were not Previously we reported that rabbit S-A node pacemaker cells (PCs) affected. At the same time, the OFF transients moved significantly exhibit a reversible depolarization of the maximum diastolic less charge. The reduction was due to a large negative shift of the potential and reduction of the action potential (AP) when exposed Q-V distribution. After a 10 ms pulse to 20 mV, the half transition to an ischemia-like Tyrode solution for 5 min or less (Biophys. J. voltage changed from +7±6 mV to -544-1 1 mV (n=3). The 80: 641a, 2001). In the present study we monitored AP-induced QOFF/QON ratio decreased to = 0.1 in a time- and voltage- intracellular calcium (Cai) transients under those conditions. dependent manner (x = 10.2s41.4 ms at 20 mV, n=3). Freshly isolated or cultured PCs were loaded with 2.5 FM indo- Thus, Ca ions entering through and/or accumulating near the 1/AM and exposed to an "ischemic" Tyrode solution (glucose free, channel accelerate inactivation of gating currents by a 100-fold. pH 6.6, bubbled with 100% N2) at 35 'C. Systolic Cai declined in The results suggest that the voltage-operated gate must be open for 12/14 PCs after 4 or 5 min, but diastolic Cai did not change. After calcium to affect the voltage sensor. Supported by NIH 10 min, diastolic Cai still had not changed in 6/9 cells, but had (MH62838). increased in 2 cells and decreased in another. By 20 min, diastolic Ca, had increased in 5/7 cells, and the time constant for decay of 483-Pos Board # B345 the Cai transient (X) had increased from 150 ± 23 ms to 215 31 MUTATIONS IN IVS5 REGION OF HUMAN Cay 1.2 ms, although not significantly (P = 0.06). PCs exposed to 2.5-5.0 EFFECT INACTIVATION AND USE-DEPENDENT BLOCK jxM thapsigargin for 14 min exhibited reductions of systolic Cai, Ilona Bodil, Sheryl E Koch', Hiroshi Yamaguchi', Gyula Peter + Szigeti2, Gyula Varadi', Arnold Schwartz'; 'University of increases in diastolic Ca1 and an increase in X from 204 20 ms to Cincinnati, College of Medicine, 231 Albert Sabin Way, 570 + 91 ms (P < 0.01, n = 6). Similar changes were observed with Cincinnati, Ohio 45267-0828, 2University of Debrecen, College of ryanodine. The results suggest that the short-term (5-10 min) Medicine, Hungary effects of "ischemic" Tyrode are not due to alterations of Ca uptake and/or release from the sarcoplasmic reticulum. Previously we identified a segment in the IVS5 domain of Caj1.2 (FVLFL-HHT-541 1) that is a deterninant of voltage-dependent Voltage-gated Ca Channels I inactivation. In the recent study we have undertaken a systematic analysis of the role of individual amino acids in chimera HHT- 481-Pos Board # B343 5411 of Cajl.2 to establish a correlation between the use- THE ENDOGENOUS CANNABINOID ANANDAMIDE dependent block by Diltiazem and the incomplete inactivation. DIRECTLY INHIBITS T-TYPE CALCIUM CHANNELS With site-directed mutagenesis we substituted each of the amino Jean Chemin', Amaud Monteil', Edward Perez-Reyes2, Joel acids from HHT-5411 with the corresponding residues from the Nargeot', philippe lory'; 'IGH-CNRS, France, 2Univ. of Virginia - wild-type (WT) Cajl.2. After expressing the mutants in Xenopus Charlottesville, VA USA oocytes some mutants (HHT-5421, HHT-L1341V) showed enhanced use-dependent block, steady-state inactivation and Low-voltage-activated or T-type Ca2+ channels (T-channels) are slowed the recovery from inactivation compared with HHT-541 1. widely expressed, especially in the central nervous system where Mutants HHT-V1339F increased use-dependent block compared

99a 483-488 POSTERS Sunday with WT. We also found that in single channel recordings the 486-Pos Board # B348 mean open time was longer for HHT-5411 (6.9t1.3 ms) and HHT- CONCENTRATION JUMP EXPERIMENTS REVEAL 5421 (11.2t1.3 ms) but it was shorter for HHT-L1341V (3.1±0.4 STATE-INDEPENDENT MODULATION OF Cav2.1 BY ms) than for WT (3.8±0.4 ms) at +30 mV. We conclude that MIBEFRADIL Phe342 and Val'4' in close vicinity within one mutant may be Stanislav Sokolov, Steffen Hering; University of Innsbruck, linked to the impaired inactivation but can not confirm just one Austria critical amino acid being responsible for channel gating. However we have to take into consideration the possible intramolecular It is widely believed that calcium (Ca2+) antagonists such as interaction of mibefradil (Mib) interact with their target molecules in a state- transmembrane segment IVS5. dependent manner. According to this hypothesis, "use-dependent" 484-Pos Board # B346 inhibition of Ca,2.1 by Mib results from high affinity drug binding BLOCK OF CaV1.2 CHANNELS BY DIHYDROPYRIDINES to open and/or inactivated channels and slow drug unbinding at DEPENDS ON INTRACELLULAR CALCIUM rest. To elucidate state-dependency of Mib action we made use of a Dmytro Isaev, Roman Shirokov; New Jersey Medical School - specifically designed Ca,2.1 mutant M181 IQ inactivating 75-fold UMDNJ, 185 South Orange Ave, Newark, New Jersey 07103 faster than wild type. This construct and wild type Ca,2.1 were expressed in Xenopus oocytes and barium currents (IB.) studied Affinity of the dihydropyridine (DHP) binding to CaVl.2 with two microelectrode voltage clamp. Mib was applied in channels increases in the presence of Ca ions (Gould et al. 1982 concentration PNAS 79(11):3656; Striessnig et al. jumps to either resting channels (before activation) 1998 Trends Pharmacol. or to completely inactivated channels during a test pulse. This Sci.19(3):108) at an extracellular site (Ebata et al. 1990 JBC approach enabled a discrimination between drug action on open 265(1):177), or in the pore (Peterson & Catterall 1995 JBC and inactivated channels. The analysis of subsequent IBa recovery 270(31):18201). However, block of ionic currents through CaV1.2 revealed that Mib is neither particular selective for the open nor for channels by nisoldipine is not affected by calcium in the the inactivated state. We suggest that Mib interacts with the extracellular medium (Kass et al. 1991 J.Gen.Phys. 98:63). channel in a state-independent manner and promotes fast voltage- Here we report that intracellular Ca at a 10 AiM level enhances dependent inactivation. Our experimental findings are reproduced blockade of CaVl.2 channels by nifedipine. alC, P2a, a28a by a mathematical model describing the mibefradil-Ca,2.1 subunits were expressed in tsA201 cells. The whole cell patch interaction as drug-induced inactivation. clamp pipette contained either 10 mM EGTA in control Supported by FWF grants P12828-MED and FWF P12649-MED. experiments, or 20-100 jAM of free Ca. Nifedipine was applied 5- 10 min after establishing whole-cell conditions. We studied tonic 487-Pos Board # B349 (pulses from -90 to 20 mV, at 0.1 Hz) and voltage-dependent block pH DEPENDENCE OF HUMAN Cav2.1 CHANNELS AND (a 2.5 s conditioning at -40 mV preceded test pulse to 20 mV). For ITS ALTERATION BY A FAMILIAL HEMIPLEGIC tonic block, calcium decreased IC50 from 350140 nM (n=5) to MIGRAINE MUTATION 12±5 nM (n=6). For voltage-dependent block, IC50 decreased Tommaso Fellin, Siro Luvisetto, Stefano Pagnutti, Daniela from 21I4 nM (n=3) to 2.3±0.8 nM (n=6). Pietrobon; University of Padova, Via G. Colombo n.3, Padova, Our data demonstrate that Ca ions potentiate block of functional 35100 Italy channels by DHP. The regulatory site is accessible from the intracellular side. Supported by We have previously shown that i. three of the mutations linked to NIH (MH62838). familial hemiplegic migraine located in the pore region of human 485-Pos Board # B347 CaV2.1 channels decrease the single channel conductance for INTRACELLULAR CALCIUM-DEPENDENT Ba2+ ions, and ii. the two mutations T666M and V1457L, located MODULATION OF EXPRESSED VOLTAGE-GATED near glutamate residues forming the high-affinity Ca2+ binding CALCIUM CHANNELS IN XENOPUS OOCYTES site in the pore, decrease the selectivity of the channel for divalent Daguang Chen, Ganesan L Kamatchi, Carl Lynch III; Univ. of with respect to monovalent ions, whereas mutation V714A, at the Virginia, 1877 Lane Rd., Hospital West, Charlottesville, Virginia intracellular end of IIS6, does not affect selectivity. We now report 22908-0710 that, with both Na+ and Li+ as charge carriers, mutation T666M Modulation (but not V1457L) introduces a subconductance state, whose by Ca2+of voltage-gated Ca channels (CaV) expressed occupancy probability is pH dependent, being higher at acidic pH in combination of auxiliary PI1b,cc2/8 subunits in Xenopus oocytes and lower at basic pH. The pH dependence is biphasic, suggesting was studied. Inward current ('Ba/Ca) was recorded using either the presence of two protonation sites in the pore (pKs 8.2 and 6.5). Ba24 or Ca2+ (10 mM) as the charge carrier employing voltage- With Na+ as charge carrier, wild-type human CaV2.1 channels do clamp technique. Currents were measured in Ca containing buffer not show any pH-dependent subconductance state in the pH 9 to following control measurements obtained with Ba containing 6.1 range, in contrast with CaVI.2 channels. However, the main solution. Measurements of peak (- 80 ms) and late (830 ms) conductance of the wild-type channel is smaller at pH 6.5 than current and late/peak (L/P) ratio were determined. Peak current 7.4. These data suggest that mutation T666M alters the three through CaV1.2, 2.2 or 2.3 channels were decreased with Ca2+ dimensional arrangement of the four glutamates in the selectivity while, late ICa was increased in or 2.3 filter, affecting both the selectivity and the Kd of protonation of the CaV2.2 channels, an pore. indication that these channels are inactivated more slowly, leading to a significant increase in the L/P ratio. In CaV1.2, the late 488-Pos Board # B350 current also increased initially. In contrast, peak CaV2.1 current POTENTIATION OF CAV 23 CURRENTS BY ACETYL4- METHYLCHOLINE (MCH) OR PHORBOL 12- was increased in addition to an increase in inactivation, leading to MYRISTATE 13-ACETATE (PMA) ARE MODULATED a decrease in the L/P ratio. This modulation of CaV channels is DIFFERENTIALLY BY PKC PHOSPHORYLATION SITES dependent on the extracellular as well as intracellular concentration Ganesan L Kamatchi, Daguang Chen, Julianne J Sando, Carl of Ca [Ca2l. Administration of BAPTA to buffer [Ca2+], led to Lynch III; Univ. of Virginia, 1877 Lane Rd., Hospital West, the attenuation of these changes in all types of Ca channels Charlottesville, Virginia 22908-0710 examined. Gating of these various channels shows distinct Wild type Cav 2.3 channels and its mutants involving selected variations, reflecting multiple direct and indirect effect of [Ca2+],. serine residues of II-III linker or the C-tenninal were expressed in Xenopus oocytes in combination with 31b,a2/6 subunits and muscarinic Ml receptors. Inward Ba2+-current (VBa) was recorded

1 OOa Sunday POSTERS 488-493

using Ba2+ as the charge carrier. The kinetic characteristics Of 'Ba depolarized 10 mV compared to wild-type, although after 5s through the mutant channels were not significantly different from channel availability was similar, and recovery from inactivation at the wild type. Activation of PKC directly with PMA (100 nM) or -120 mV was only modestly slowed. In summary data from charge indirectly with MCh (1 FM) potentiated the peak IBa through wild neutralizations suggest that domain IV, S4 charges play a role in activation and that the RI position is largely outside of the voltage type Cav 2.3 channels to 66 ± 5 and 75 ± 10 % respectively. In field. contrast, mutants 888A, 892A or 894A led to a potentiation of45 ± 2, 36 ± 8 and 36 ± 5 % respectively, a significant decrease 491-Pos Board # B353 compared to the wild type. None of the above mutants affected CO-EXPRESSION OF A NOVEL y SUBUNIT WITH Ca2+ PMA response significantly. Similarly, mutants 1987A or 1995A CHANNEL Cav3.1 IN HEK-293 CELLS significantly reduced the response to MCh whereas PMA response Po-Ju Chu, Jared P Hansen, Philip M. Best; University ofIllinois was unaffected. MCh response was altogether absent (10 ± 9 %/o) Currents arising from Ca2+ channel Cav3.x subunits are similar, in a triple mutant containing 888A, 892A and 894A whereas PMA but not identical to, low voltage-activated currents in cardiac still had its response intact. Effect of double mutations involving myocytes. We recently described a novel y subunit, y6, that is serine 888/892, 888/894, 892/894 or 1987/1995 is being examined. expressed in cardiac and skeletal muscles and has a sequence It is possible that phosphorylation sites have differential homologous to the yl subunit. We generated a bicistronic vector suceptibility. containing GFP and this recently described rat y6 subunit. This 489-Pos Board # B351 vector was transiently transfected into HEK-293 cells, which had ELECTROPHYSIOLOGICAL CHARACTERIZATION OF been stably transfected with Cav3.1 subunits. Current TWO NEW ISOFORMS OF RAT CaV3.3 T-TYPE characteristics from cells expressing Cav3.1 alone, Cav3.1 plus CALCIUM CHANNEL vector containing GFP only and Cav3.1 plus vector containing Janet Murbartian', Juan C Gomora2, Edward Perez-Reyes'; GFP and y6 are as follows: voltage peak=-17.5±2.5, -11.6±1.6, and 'University of Virginia, 1300 Jefferson Park Ave, Charlottesville, -10+2.8 respectively; voltage dependence of activation using a Virginia 22908-0735, 2Instituto de Fisologia Celular-UNAM, non-isochronic activating step V0.5=- Mexico 24.9±0.26, -17.4_0.66, -21.8±2.60 respectively; voltage The low voltage-activated, or T-type, Ca2+ channel family has dependence of inactivation V0.5=- three members: Ca,3.1 (a,3.1, %lG), Ca,3.2 (a,3.2, aIH) and 34.3±4.85, -57.3±3.10, -59.5±3.61 respectively; and time to peak Ca,3.3 (a,3.3, alI). In this study we report the cloning from a rat current at -20 mV=6.85±0.85, 8.43±2.72, 8.70±2.22 ms brain cDNA library of two new isoforms of rat at3.3. These respectively. There appeared to be no difference in the measured isoforms differ from the original cDNA cloned (a,3.3a) in the properties of Ca2+ currents from cells expressing either Cav3.1, splicing at a single exon boundary. In the human genomic Cav3.1 plus GFP or Cav3.1 plus GFP and 'y6. Supported by NIH sequence this would coffespond to the 5' end of exon 34. Both AR44352 to PMB and AHA predoctoral fellowships to PJC and new variants splice further upstream than in a13.3a, and in a JPH. different frame. In fact, the a13.3b variant appears to splice in the 492-Pos Board # B354 homologous site used in the human sequence, adding 404 amino COMMON INACTIVATION DETERMINANTS IN LOW acids to the carboxy terminus that are 84% identical to the human. AND HIGH THRESHOLD CALCIUM CHANNELS The a13.3c variant appears to splice at an acceptor 81 bp further Rainer Marksteiner', Paulus Schurr', Stanislav Berjukow', Eva upstream and in the same frame as a,3.3b, adding 27 amino acids. Margreiterl, Edward B Perez-Reyes2, Steffen Hering'; 'University The electrophysiological properties of the isoforms were studied ofInnsbruck, Austria, 2University ofVirginia after transient transfection into 293 cells using 5 mM Ca2+ as Low threshold (T-type, Ca,3) Ca2+ channels display the fastest charge carrier. The kinetics of channel activation, inactivation, inactivation kinetics among all voltage-gated Ca2+ channels. The deactivation, and recovery from inactivation were quite similar to molecular inactivation deterninants of this channel family are those reported previously for rat a13.3a, with only minor largely unknown. Here we investigate the role of segment 111S6. differences in the development of inactivation. These data suggest Amino acids that are identical in IIIS6 segments of all known Ca2+ that the distal carboxy terminal region does not play a major role in channel subtypes were mutated to alanine (FI505A, F1506A, T-type channel gating. N1509A, FiSllA, V1512A, F1519A, FV1511/1512AA). Additionally M1510 was mutated to isoleucine and alanine. The 490-Pos Board # B352 kinetic properties of the mutants were analyzed with the two ROLE OF DIV/S4 OUTER CHARGES IN DETERMINING microelectrode voltage clamp technique after expression in KINETICS OF T-TYPE CA CHANNELS Xenopus oocytes. Compared to barium current inactivation of Alice D. Lam, Ian W. Glaaser, Dorothy A. Hanck; University of (IE,) Chicago wild type at -2OmV (rj,a= 9.5±0.4ms) the corresponding time constants of the mutants ranged from 9.2±0.4ms in V1512A to In contrast to high voltage-gated Ca channels, T-type channels 45.7±5.2ms (4.8-fold slowing) in M1510. IB, recovery at -8OmV activate at negative potentials, and these channels express well was most significantly slowed by V1512A but accelerated by with alpha subunits alone. Kinetics resemble more closely voltage FiSi lA. We conclude that amino acids M1510, F1511 and V1512 gated Na channels. For Na channels charges in domain IV/S4 play corresponding to previously identified inactivation determinants in a critical role in inactivation from the open state. We investigated 1IIS6 of Ca,2.l have a significant role in Ca,3.1 inactivation. These the role of the outermost two charged residues in alphalH data suggest common elements in the molecular architecture of the (CaV3.2) with substitutions to glutamine (good size match), inactivation mechanism in high and low threshold Ca2+ channels. cysteine (smaller, but allowing for restoration of size and charge Supported by FWF grants P12828-MED and FWF P12649-MED. with MTS reagents), and histidine (charge controlable with pH). Stable cell lines in HEK293FLP cells were created, and channels 493-Pos Board # B355 studied with whole cell voltage clamp. Channel kinetics were BLOCK OF NEURONAL T-TYPE CALCIUM CURRENTS essentially insensitive to neutralization of RI, although R1715H BY NEUROACTIVE STEROIDS: STRUCTURE-ACTIVITY modestly slowed both macroscopic activation and inactivation. In STUDIES AND LACK OF CORRELATION WITH contrast, R2 neutralization produced currents for which voltage ANESTHETIC POTENCY IN TADPOLES dependence of conductance was reduced almost 1 e, and both Slobodan M. Todorovic1, Doug F Covey2, Charles F Zorumski3; macroscopic activation and inactivation were markedly slowed. 'University of Virginia, Mail Box 800710, Charlottesville, Virginia Half point of voltage dependent channel availability at 200 ms was

lOla 493-497 POSTERS Sunday

22908, 2Washington University St. Louis, MO, 3Washington cells without significant T-current expression (glioma C6; IC50 = University St. Louis 5 and 8 tM for pimozide and mibefradil respectively). However, A novel neuroactive steroid, (3p, 5a)-1 7-hydroxyestrane-3- several results suggest that both drugs inhibit cell growth via carbonitrile, ((+)- ECN) produces enantioselective loss of righting independent pathways: 1) Pimozide and mibefradil had additive reflex (LRR) in tadpoles, an indicator of potential anesthetic effects on T-current inhibition, while the antiproliferative activity actions. This steroid is a potent blocker of neuronal T-type calcium of the drugs was synergistic. 2) Y79 differentiated cells (without currents but unlike many other steroids does not affect GABAA T-current), as well as Y79 cells transfected with alG antisense currents. To test whether actions on T-currents may be important were inhibited to a greater extent by pimozide than by mibefradil. in the anesthetic effects of these agents we examined a series of 3) An increase in the number of apoptotic Y79 and MCF-7 cells, as related 5a-and 53-reduced steroids for their ability to induce LRR well as a decrease on the anti-apoptotic gene Bc12 was detected in tadpoles and their effects on T-currents in rat sensory neurons. only in pimozide treated cells. These results show that pimozide Like (+)-ECN, we found that most Sa reduced steroids blocked T- and mibefradil inhibit cell proliferation, but it is unlikely that this currents partially and that some 5p-reduced steroids blocked T- effect is mediated solely by T-channel inhibition. currents more completely, but less potently than Sa-reduced steroids. A poor correlation was found between the ability of 496-Pos Board # B358 steroids to suppress T-currents and their anesthetic potency CROSS-SIGNALING BETWEEN L-TYPE Ca2+ CHANNELS suggesting that inhibition of T-currents can not per se account for AND NON-SELECTIVE CHANNELS IN A7r5 SMOOTH their anesthetic effects in tadpoles. Structure-activity studies MUSCLE CELLS. suggest differential requirement for effects on neuronal T-currents Michael Poteserl, Ichiro Wakabayashi2, Klaus Groschner'; 'Karl- and GABAA currents. Furthermore, identification of neuroactive Franzens University Graz, Universititsplatz 2, Graz, 8010 Austria, steroids that produce LRR but have no effects on GABAA 2Yamagata University, Japan receptors makes it important to identify other cellular targets that We investigated the possible cross-talk between L-type Ca2+ contribute to steroid anesthesia. channels and voltage-independent Ca2+ channels during intracellular alkalosis in vascular smooth muscle cells. Membrane 494-Pos Board # B356 currents of A7r5 cells were measured using the perforated patch COMPARISON OF ENDOGENOUS AND technique, and intracellular pH was elevated by extracellular OVEREXPRESSED T-TYPE CALCIUM CURRENTS IN administration of 20 mM ammonium chloride. Intracellular A7r5 CELLS: BLOCK BY Ni2+ AND MIBEFRADIL alkalinization resulted in inhibition of L-type currents and Lioubov I Brueggemann, Leanne L Cribbs, Kenneth L Byron; activation of a cation conductance which allowed perneation of Loyola University Chicago, 2160 South First Ave., Maywood, both Na+ and Ca2+. When Ca2+ was chelated with EGTA, and Ba2+ Illinois 60153 or Na+ was used as charge carrier, intracellular alkalinization In fura-2-loaded A7r5 vascular smooth muscle cell monolayers, clearly augmented L-type currents, while pH-dependent activation vasopressin-stimulated Ca2+ spiking was inhibited by low of currents through voltage-independent cation channels was concentrations of mibefradil, a selective inhibitor of low voltage- negligible. 2-Aminoethoxy-diphenylborate (2-APB), an inhibitor activated T-type Ca2+ channels. Using RT-PCR, we detected of store-operated Ca2+ entry channels, suppressed alkalosis- expression of al G and alI (two of three known T-type Ca2+ induced currents through voltage-independent channels and channel genes) in A7r5 cells. Endogenous T-type currents were concomitantly reduced the inhibition of L-type Ca2+ currents. We detected in 33% of A7r5 cells tested using whole cell voltage suggest that pH regulated, 2-APB-sensitive Ca2+ enty channels are clamp techniques. We compared activation and inactivation tightly coupled to L-type channels, to forn a functional unit in the parameters of endogenous T-type currents with exogenous currents plasma membrane of smooth muscle. Supported by the FWF-F715, derived from recombinant alH channels overexpressed using FWF-14950 and ONB-8216 adenoviral infection. The steady-state window current, computed 497-Pos Board # B359 from overlap of the voltage range for current activation and MAPPING OF INHIBITORY GATING ELEMENTS IN THE inactivation, was similar for both uninfected and infected cells. N-TERMINUS OF aic SUBUNIT OF THE L-TYPE Ca2+ Mibefradil (1 rM) caused a negative shift of the inactivation curve CHANNEL reducing the window current. As expected, exogenous and Nataly Kanevsky, Nathan Dascal; Tel Aviv University, Israel different sensitivities to endogenous T-type currents displayed Ca2+ channel has NiCG (20 VM NiCk blocked 78.3% of exogenous and 200 FM The N-terminus of the voltage-dependent L-type NiCI2 blocked 54.6% of endogenous T-type current). Inhibition of an inhibitory effect on gating. By studying the expressed rabbit aic endogenous and exogenous T-type currents by mibefradil is in Xenopus oocytes, we have previously shown that the deletion of equivalent and strongly dependent on holding potential (ICso = 370 46 amino acids (a.a.) of the initial segment or of the whole N- nM at -70 mV holding potential for exogenous T-type current). terminus (139 a.a.) diminishes the inhibitory effect of N-terminus by increasing the open probability of a single channel. Using two- 495-Pos Board # B357 electrode voltage clamp, we now demonstrate that the removal of T-TYPE CA 2+ CHANNEL BLOCKERS, PIMOZIDE AND the first 20 a.a. already has a maximal effect on all current MIBEFRADIL, INHIBIT PROLIFERATION OF parameters: it increases the amplitude, shifts the voltage-dependent RETINOBLASTOMA AND BREAST CANCER CELLS inactivation and reduces the modulation of the channel by 12A- Gabriel E. Bertolesi, Chanjuan Shi, Lindsy Elbaum, Christine subunit. Further deletions do not produce any additional effects, Jollimore, Gabriella Rozenberg, Steven A. Barnes, Melanie E.M. suggesting that the major inhibitory gating element is contained Kelly; Dalhousie University, Canada within the first 20 a.a. Removal of the first five a.a., known as T-channel currents and mRNA expression of alG and alH T-type indispensable for protein kinase C effect in the rabbit aic subunit, Ca2+ channels predominate in undifferentiated retinoblastoma have little or no effect on gating parameters. The 16 a.a. crucial for cells and disappear in differentiated cells. We studied the effects of gating, mapped in this way, are partially conserved in long- and T-channel blocking drugs, pimozide and mibefradil, on cell growth short- N terminal isoforms of rabbit, rat and human aic. These inhibition and apoptosis on Y79 and WERI, breast cancer MCF-7 results are the first step to a functional mapping of the gating and glioma C6 cells. Cells showing higher expression of T-current element of the N-terminus of aic subunit in rabbit and human L- and mRNA expression (retinoblastomas and MCF-7 cell lines) type Ca2+ channels. were more sensitive to the antiproliferative activity of pimozide and mibefradil (IC50 between 0.6 and 1.5 AM for both drugs) than

102a Sunday POSTERS 498-502

500-Pos Board # B362 498-Pos Board # B360 ROLE OF THE IIIS5-S6 LINKER OF L-TYPE Ca2+ FRET IMAGING OF STATE-DEPENDENT CHANNEL aic SUBUNIT IN THE ACTION OF Ca2+ REARRANGEMENTS IN a,c SUBUNIT OF HUMAN Ca2+ CHANNEL AGONIST CHANNEL Shinji Yamaguchi, Satomi Adachi-Akahane; University of Tokyo, Evgeny Kobrinsky, Elena Schwartz, Darrel R. Abemethy, Nikolai 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-0033 Japan M. Soldatov; National Institute on Aging, NIH, 5600 Nathan Shock Drive, Baltimore, Maryland 21224-6825 We previously showed that SI 115 in IS5-S6 linker of the L-type Ca2+ channel aic subunit is a critical determinant of the action of L-Type Ca2+ channel inactivation is affected by multiple parts of DHP agonists. To elucidate the role of IIIS5-S6 linker in the the alc subunit including cytoplasmic pore region and C-terminal modulation of gating properties by Ca2+ channel agonists, we performed alanine-scanning mutagenesis in IIIS5-S6 linker of Ca2+ sensors, thus suggesting that substantial conformational mutated are involved. To study state-dependent molecular rbCII (rat brain L-type Ca2+ channel aic subunit). The aic rearrangements subunits were transiently expressed in BHK6 cells that stably motions in the functionally expressed wild-type (a0C,77) and non- express Pt. and a2/6 subunits. We found that Fl 112A was inactivating (alC,IS.IV) isoforms of Ca2+ channel, we combined markedly less sensitive to Ca2+ channel agonist. Sensitivity of fluorescence resonance energy transfer (FRET) and patch clamp F1112A channel to DHP antagonist was also modestly reduced, techniques. FRET between eCFP and eYFP attached to the although its sensitivity to verapamil and diltiazem was the same as cytoplasmic termini of alc was confirmed by the analysis of that of rbCIl. Therefore, two amino acids (Fl 112, S1115) in I1IS5- S6 linker turned out to be critical sites for agonistic effect. acceptor or donor photobleaching and sensitized acceptor Interestingly, in the double mutant F112A/S11I5A channel, the emission. Cells expressing single-labeled alC did not show FRET. enhancement of peak Ica and the prolongation of tail current by The role of termini flexibility was assessed by their releasable Ca2+ agonist were completely absent. The channel was rather anchoring to the plasma membrane via attached PH-domain. slightly inhibited by FPL-64176 (96±1.3% at IlM and 80±4.7% at Differential imaging at -90 mV and +40 mV provided strong I0gM). These results suggest that the action of Ca2+ channel evidence that the efficiency of FRET is state-dependent. The agonists requires, in addition to its binding to the binding pocket, apparent distance between N- and C-termini significantly the interaction with IIIS5-S6 linker via Fl 112 and S1l15. decreased in the open state (alC,IS-IV at +40 mV) as compared to the closed (-90 mV) and inactivated states (alC,77 at +40 mV) of 501-Pos Board # B363 PHENYLALKYLAMINE (PAA) INTERACTION WITH Ca2+ channel and was not affected by the deletion of 330 amino TRANSMEMBRANE SEGMENT IIIS5 OF L-TYPE Ca2+ acids of the C-terminus suggesting critical role of its central region CHANNEL (LTCC) alC SUBUNITS in the relative displacement of the al C termini associated with Irene Huber, Martina J Sinnegger, Alexandra Koschak, Jorg channel gating. Striessnig; University of Innsbruck, Peter-Mayr-StraBe Ia, Innsbruck, 6020 Austria 499-Pos Board # B361 In LTCC al subunits the high affinity binding pocket for (PAA) SIMULTANEOUS FRET MICROSCOPY AND WHOLE- Ca2+ channel blockers is formed by residues in the S6 segments CELL PATCH CLAMP MONITOR INTERACTIONS OF and the pore region glutamates of repeats III and IV. Thr-1039 FLUORESCENCE LABELED alc AND P SUBUNITS OF L- (alC-II) in IIIS5 is an important determinant of DHP sensitivity. TYPE Ca2+ CHANNEL DHP affinity is reduced >100-fold after mutation to tyrosine. We Greg S. Harms', Heike Kahr2, Gerhard A Blab3, Piet H.M. investigated if this mutation also affects PAA binding affinity Lornmerse3, Zhenguo Zhang4, Laurent Cognet5, Dirk L Ypey3, using brain membranes of al CDHIP mice in which this mutation has Nikolai M. Soldatov6, Thomas Schmidt3, Christoph Romanin7; been introduced in vivo. Equilibrium binding of [3H]devapamil 'PNNL, PO Box 999, MSIN: K8-88, Richland, Washington 99352, (DEV) to alCDHPI brain membranes (up to 0.3 mg protein/ml) was 2Univ. of Linz, Austria, 3Leiden University, Niels Bohrweg 2, 2-fold higher than in wildtype. For the (-)enantiomers of DEV and Leiden, 2333 CA Netherlands, 4NIH, 5CPMOH - CNRS, 351 cours verapamil the IC50 values for inhibition of [3H]DEV binding de la liberation, Talence, 33405 France, 6National Institute on decreased 2-4-fold whereas no change in apparent affinity was Aging, NIH, 5600 Nathan Shock Drive, Baltimore, Maryland detected for the less active (+)enantiomers. Thus increased binding 21224, 7lnstitut for Biophysics, University ofLinz, Austria accounts for increased affinity rather than an increase of B.n. This The accessory P subunit of the voltage gated Ca2+ channel was confirmed by saturation analysis. The Ca2+ channel blocker interacts with the cytoplasmic loop between repeats I and II of the (*)isradipine inhibited binding to wildtype but not to alCDH pore-forming at subunit and affects kinetics of the current membranes confirming loss of DHP binding affinity. Our data inactivation. The Psubunit may represent one of the moving parts demonstrate that replacement of Thr-1039 by a tyrosine increases of the channel. To test the hypothesis, we used dual color binding affinity for PAAs indicating that PAAs interact with fluorescence resonance energy transfer (FRET) microscopy as residues in segment IIIS5. Supported by FWF P14820, EC HPRN- molecular ruler to compare relative distances between a,c and PI CT20000082. subunits in closed and inactivated states of the channel supported by holding the transmembrane voltage during the FRET 502-Pos Board # B364 measurements at -90 and +20 mV, respectively. N-Terminally THE DHP-INSENSITIVE L-TYPE-LIKE Ca2+ CHANNEL labeled eYFPN-a,c.77 and eCFPN-P, subunits were functionally OF ASCIDIAN ACQUIRES THE DHP-SENSITIVITY BY A expressed in tsA-HEK cells. 11C.77 and P2& subunits were SINGLE-SITE SUBSTITUTION IN THE DOMAIN III P- colocalized in the plasma membrane showing cluster-formation in REGION. -20% of cells studied. Static FRET measurements at cells'resting Hiroko Nakaseko-Izumi', Shinji Yamaguchi2, Yukio Ohtsuka3, potential revealed FRET occurring in the plasma membrane. Satomi Adachi-Akahane2, Yasushi Okamura3; 'University of Dynamic FRET images were recorded in whole cell patch clamp Tokyo, Institute of Medical Science, 4-6-1 Shiroganedai, Minato- configuration at membrane potentials of -90 and +20 mV using a ku, Tokyo, 1084639 Japan, 2University of Tokyo, Japan, 3National customized dichroic wedge mirror. Results of the measurements Institute ofAdvanced Industrial Science and Technology, Japan demonstrated increased FRET with prolonged depolarization TuCal is an ascidian homolog of the a1-subunit of L-type Ca2+ suggesting that nxc and PI subunits dislocate and approach when channels, but is insensitive to DHP. Amino acids known to be inactivated. critical for DHP binding in L-type Ca2+ channels are mostly

103a 502-507 POSTERS Sunday

conserved in TuCal except that several amino acid changes are changed consistent with the C-type inactivation model suggesting found in P-regions. We have shown that a substitution of alanine constriction of the pore as the main mechanism. The outlined for serine 11 15 in IIIS5-S6 linker of a mammalian neuronal L-type annular determinant of slow inactivation appears to be functionally Ca2+ channel (rbCII), based on its sequence comparison with targeted by f-subunit and C-terminal Ca2+ sensors ofinactivation. TuCal, led to the impairment of its sensitivity to DHPs (Yamaguchi et al., JBC 275, 2000). In this study, we performed the 505-Pos Board # B367 reverse experiment, in which alanine 1016 of IIIS5-S6 linker of REGULATION OF L-TYPE Ca CURRENT IN CARDIAC TuCal was replaced by serine. Currents were recorded from MYOCYTES BY AN INTERACTION BETWEEN Xenopus oocytes under the two-microelectrode voltage clamp CYTOSOLIC Ca2+ and Mg2+ following injection of cRNAs of wild-type or mutated TuCal with Min Wang, Joshua R Berlin; UMDNJ-New Jersey Medical a2/8 and P2b. The mutated TuCal showed an increase of Ba2+ School, 185 S. Orange Ave., Newark, New Jersey 07103 current by 1.5-fold in response to 8 FM S-(-)-BayK8644 and was Cytosolic Mg2+ (Mg,) is a potent regulator of L-type Ca2+ current inhibited to about 30% by 8 gM nitrendipine or 4 FiM nifedipine. 8 (Ic.); however, the mechanism of this regulation is unknown. To pM verapamil had no effect on the mutated TuCal or the wild-type investigate the effect of Mgi on Ice, rat cardiac myocytes were channel. These results reinforce the view that the serine residue in voltage-clamped using patch electrodes containing a salt solution the P-region of domain III is a critical determinant of DHP in which pipette [Mg2+] (Mg,) was controlled with citrate/ATP sensitivity in L-type Ca2+ channels. buffers and pipette [Ca24] (Cap) was buffered with EGTA. Peak Ic. measured with 2.0 mM Mgp was 55 ± 3% of Ice observed with 0.2 503-Pos Board # B365 mM Mg., in nominally 0 Ca2+ pipette solutions, but was only 31 + MECHANICAL PROPERTIES OF HUMAN NEURONAL L- 5% of Ic, with 0.2 mM Mgp at 100 nM Cap. The VI,2 for current TYPE Ca+ CHANNELS TRANSIENTLY EXPRESSED IN inactivation shifted -11 + I mV as Mgp was increased from 0.2 to HEK293 CELLS 2.0 mM; however, this shift did not explain the observed decrease Shuangqing Peng, Ravindra K Hajela, William D Atchison; in ICa. Experiments with 100 nM Ca, showed that 10 ,tM Michigan State University ryanodine, inhibitors of Ca/Calmodulin Kinase II and Protein Flow-induced shear forces can alter the gating of ion channels in Phosphatase 2B did not significantly affect the Mgp-dependent endothelial and muscle cells. However, there have been no reports decrease in Ice, nor did increasing pipette Ca2+ buffering capacity about these properties in neurons. Characteristics of current with 5 mM BAPTA/15 mM EGTA (100 nM Cap). These data through human neuronal L-type voltage-gated Ca2+ channels to indicate that Mgi regulates Ice by (1) an effect independent of Ca24, flow-induced mechanical stress were examined in transfected possibly block of the ion permeation pathway, and (2) an HEK293 cells. cDNA clones of(xlC subunit along with a28 and P3 interaction with local cytosolic Ca2+ that does not depend on SR Ca2+ channel subunit were transfected into HEK293 cells. Current Ca2+ release, nor Ca2t-dependent kinases and phosphatases. The through the transiently -expressed channels was measured using mechanism of this novel Mg2+/Ca2+ interaction remains under whole cell recording. Transfected cells were exposed to fluid flow investigation. from pipettes, which produced a constant hydrostatic pressure. Current from alC containing channels was sensitive to fluid flow, 506-Pos Board # B368 which increased peak current amplitude by --50% of control TYROSINE KINASE-INDEPENDENT INHIBITION OF under constant flow conditions, with no change in end current CARDIAC L-TYPE Ca2+ CURRENT BY GENISTEIN amplitude. The increased current recovered to control values after Andriy E Belevych, Sunita Warnier, Robert D Harvey; Case stopping fluid flow. The current-voltage relationship was not Western Reserve Univ altered by fluid flow, but the steady-state inactivation curve was Inhibition of the cardiac L-type Ca2+ current (Ice.L) by genistein, a shifted to more negative potentials with fluid flow. The flow- non-selective tyrosine kinase inhibitor, was studied in isolated induced Ca2+ current showed fast inactivation, which was not guinea pig ventricular myocytes using the whole-cell patch-clamp voltage-dependent. These results indicate that L-type voltage-gated technique. Bath application of genistein (50 FM) inhibited basal Ca2+ current from human neurons was sensitive to fluid flow- ICe-L by about 50%. This inhibitory effect could be explained in induced pressure. cDNA clones were provided by Merck Research part by a hyperpolarizing shift in the voltage dependence of ICS-L Labs. Supported by NIH grant ES05822. inactivation. At room temperature, the inhibitory effect developed rapidly, with a time constant of about 10 s, suggesting that 504-Pos Board # B366 regulation of a phosphorylation dependent mechanism might not ANNULAR DETERMINANT AND CRITICAL be involved. Pervanadate (100 jiM, a tyrosine phosphatase COMPONENTS OF Ca2+ CHANNEL SLOW inhibitor, had no effect on basal Ice.L, and it did not antagonize the INACTIVATION inhibitory effect of genistein. Internal perfusion of cells with Nikolai M. Soldatov; National Institute on Aging, NIH, 5600 ATPyS (5 mM), to prevent reversibility of phosphorylation Nathan Shock Drive, Baltimore, Maryland 21224 dependent processes, enhanced basal Ic.-L by about 60% and Slow inactivation of L-type Ca2+ channel is found to be mediated resulted in irreversible protein kinase A dependent stimulation, but by an annular detenninant composed of hydrophobic amino acids it did not alter the inhibitory effect of genistein. Furthermore, bath located at analogous positions near the cytoplasmic ends of application of lavendustin A (5 gM), another non-selective transmembrane segments S6 of each repeat of the aic subunit. tyrosine kinase inhibitor, did not affect basal Ice-L amplitude. It is Critical interventions completely obstructing slow inactivation concluded that the ability of genistein to inhibit basal Ic.-L in include simultaneous substitution of A752T in IIS6, VI 165T in cardiac ventricular myocytes is not due to inhibition of tyrosine IIIS6 and 11475T in IVS6, each preventing an increasing fraction kinase activity. of Ba2+ current from fully inactivating, as well as S4051 in IS6 playing a distinct role in inactivation. Fractional inhibition of slow 507-Pos Board # B369 inactivation in the tested mutants caused an acceleration of fast DOWN-MODULATION OF L-TYPE CALCIUM CHANNEL inactivation, suggesting that fast and slow mechanisms are linked. ACTIVITY BY BRADYKININ IN NG108-15 CELLS The channel lacking slow inactivation showed - 45% of the Mauro Toselli, Valeria Parente, Vanni Taglietti; University of sustained Ba2+ or Ca2+ currents with no indication of decay. The Pavia, Italy remaining fraction of the current inactivated with single- Bradykinin (BDK) excites dorsal root ganglion cells, leading to the exponential decay ('rf - 10 ms) in Ca2+- and 3 subunit-independent sensation of pain. The actions of BDK are thought to be mediated manner, and completely recovered from inactivation within 100 by heterotrimeric G protein-regulated pathways. In the present ms. No voltage-dependent characteristics were significantly study we examined the effects of BDK receptor activation on L-

104a Sunday POSTERS 507-512

type voltage-dependent Ca2+ channels in NG108-15 cells. BDK cells. We hypothesize that cAMP is stimulating the L-type Ca2+ reversibly down modulated whole-cell L-type Ca2+ channel channels expression by a mechanism that is probably dependent on currents in a voltage-independent fashion. This inhibition was CRE recruitment. mainly mediated by activation of pertussis toxin-insensitive G This work was supported by CNPq and CAPES. proteins. The inhibitory action of single L-type Ca2+ channels by BDK was also investigated in cell-attached patches. Our single 510-Pos Board # B372 channel data indicate that the inhibitory action of BDK mainly UBIQUITOUS Ca2+-DEPENDENT REGULATION ACROSS shows up in a significant reduction of the probability of channel THE ENTIRE FAMILY OF HIGH-VOLTAGE-ACTIVATED opening (po) and in an increase of the frequency of null sweeps. (HVA) Ca2+ CHANNELS Furthermore, L-type channel down modulation seems to occur Carla D. DeMaria, Michael G. Erickson, Tracy S. Morrison, through activation of a cytoplasmic second messenger system David T. Yue; Johns Hopkins Sch Med, 720 Rutland Avenue, rather than through a direct membrane delimited mechanism. Our Baltimore, Maryland 21205 results might suggest that the interaction of the final inhibitory Among the family of HVA Ca2+ channels, L-type (aic) channels molecule with the L-type Ca2+ channel causes a transition of have long been renown for prominent Ca2+-dependent regulation. channel gating from a high- to a low-po by favoring a switch Only recently have P/Q-type (alA) channels been shown to between gating modes. manifest variant forms of such regulation, while the other neuronal HVA channels (N-type (aaB) and R-type (aoE)) have appeared 508-Pos Board # B370 devoid of Ca2+ regulation. Intriguingly, calmodulin (CaM) is the A NOVEL, LONG-N-TERMINUS (NT) ISOFORM OF L- sensor for TYPE Ca2+ CHANNEL IS UP-REGULATED BY PROTEIN Ca2+ regulation of both aic and alA (DeMaria et al., KIINASE C (PKC) Nature 411, 2001), and CaM "preassociates" with both channel Yakov Blumenstein, Nataly Kanevsky, Gideon Sahar, Tatiana types (Erickson et al., Neuron 31, 2001) to enhance detection of Ivanina, Nathan Dascal; Tel Aviv University, Israel local Ca2 . Surprisingly, we here report that FRET experiments demonstrate robust CaM preassociation with both a1B and alE Rat L-type voltage dependent Ca2+ channel (aic) has two NT channels, hinting that these channels might actually be subject to isoforms, long and short, with variable initial segments of 46 and Ca2+ regulation. In fact, with near physiological buffering of 16 amino-acids, respectively. Only a short-NT isoform is known in intracellular Ca2+, we now demonstrate robust Ca2+-dependent humans, and only a long-NT isoform in rabbit. The long-NT of inactivation (CDI) of both channel types. By contrast, buffering rabbit aic is crucial for PKC regulation. Human Ca2+ channels are with several mM EGTA blunts or abolishes CDI, explaining the regulated by PKC, thus a long-NT isoform of human aic should failure of previous studies to detect such inactivation. The advent exist. By homology screening of the human genomic DNA, we of widespread Ca2+-dependent regulation across the HVA family identified a stretch (termed exon la) highly homologous to rabbit broadens enormously the biological contexts of Ca2+ feedback, and long-NT, separated from the next known exon of aic (exon Ib; provides potentially important structure-function clues about the codes for the alternative, short-NT) by -800 kb-long exon. The regulatory mechanisms specific to each channel type. predicted 46 amino acid protein sequence is highly homologous to rabbit long-NT. Reverse transcriptase PCR showed the dominant 511-Pos Board # B373 presence of exon I a sequence in human cardiac RNA, and a weak PHOSPHORYLATION-DEPENDENCE OF signal for exon I b. Western blot with an antibody against the rabbit DIHYDROPYRIDINE ACTION ON L-TYPE CALCIUM long-NT detected a -240 kDa protein (the size expected for aic) in CHANNELS IN A RAT PITUITARY CELL LINE, GH3 human atrium and ventricle. Expression of human long-NT aic in David L Armstrong, Melisa WY Ho, Christian Erxleben; NIEHS Xenopus oocytes directed Ca2+ channel enhanced by a PKC L-type calcium channels in the membrane are often complexed activator, whereas the short-NT aic was PKC-inhibited. The long- with protein kinases and phosphatases that modulate channel NT isoform may underlie the Ca2+ current enhancement by PKC- activation by membrane depolarization. Although dihydropyridines activating transmitters in human tissues. have been shown to interact directly with the channel proteins, we investigated the hypothesis (Armstrong et al. 1991 Ann. N.Y 509-Pos Board # B371 Acad. Sci. 635:26-34) that dihydropyridines produce their effects CALCIUM CURRENTS IN GH3 CELLS ARE on gating by altering the channels' susceptibility to modulation by UPREGULATED BY CHRONIC EXPOSURE TO cAMP protein phospho-rylation. We show here that prior exposure to the Andreia P Rodrigues', Paulo S Beir&ol, Jader S. Cru2; agonist BAY K8644 is dramatically more effective than 'Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, stimulation of the cAMP-dependent protein kinase (PKA) at Belo Horizonte, 31270-901 Brazil, 2UFMG, Brazil preventing loss of channel activity when phosphorylation is The gene expression of some ion channels are modulated by blocked subsequently by removing ATP. However, after rundown second messengers such as cAMP and calcium. Genes that encode is complete, only PKA, not BAY K8644, can restore mode I (short ion channels may have, within the promoter region either the opening) activity when ATP is added back, and both are required cAMP (CRE) or Ca-response elements (CaRE). The goal of this for restoring mode 2 (long opening) activity. Conversely, maximal work was to test the hypothesis that a sustained exposure to cAMP stimulation of PKA reduces the effictiveness and eliminates the increases the expression of functional Ca2+ channels in voltage-dependence of channel inhibition by nimodipine (BAY neuroendocrine cells. Total Ca24 currents were examined in E9736), a dihydropyridine antagonist. These results are isolated GH3 cells with the whole-cell patch clamp technique. The inconsistent with conventional explanations of dihydropyridine cells were previously incubated with 200 ,tM DBcAMP for periods action, and suggest a new mechanism for therapeutic drug action. of 24 and 48 h. After cAMP incubation the L-type Ca2+ current density increased from -4.75 + 0.71 pA/pF (Control, N=5) to - 512-Pos Board # B374 10.21* 1.91 pA/pF (24 h cAMP, N=5) and to -16.5 ± 1.86 pA/pF A COMBINED APPROACH OF PATCH CLAMP AND AFM (48 h cAMP, N=8). There is no significant changes in the cell FOR STUDYING Ca2+ - DEPENDENT INACTIVATION OF capacitance indicating that there is not an increase in the cell size. CLASS C-TYPE Ca2+ CHANNELS We did similar experiments using forskolin which is a well known Gamsjiger Roland', Klaus JF Kepplinger', Rong Zhu', Yves adenilate-ciclase activator and we noticed a 30% increase in Maulet2, Klaus Groschner3, Nikolai M. Soldatov4, Peter current density (N=l0). So far, our results suggest that a sustained Hinterdorfer', Christoph Romanin'; 'University of Linz, Austria, increase in the intracellular concentration of cAMP leads to a 2INSERM U 464, Bd Pierre Dramard, Marseille, 13916 France, substantial increase in the L-type Ca24 current density in GH3 3Karl-Franzens University Graz, Universititsplatz 2, Graz, 8010

105a 512-516 POSTERS Sunday

Austria, 4National Institute on Aging, NIH, 5600 Nathan Shock subunit were determined by GST-pull-down assay. Both the C- Drive, Baltimore, Maryland 21224 terminus- and the N-terminus lobe of CaM exhibited binding to the Ca24-dependent binding of CaM to an IQ CaM binding motif in the carboxyl tail in the absence as well as presence of Ca2+. However, carboxyl-tail of a,c has been sufficiently established, while the overexpression of the respective lobe in tsA-Hek293 cells functional involvement of the recently identified site tethering transiently transfected with Ca,1.277 and auxiliary subunits did not CaM (CBR) at resting cell Ca2+ is less understood. Quantitative significantly inhibit Ca2+-dependent inactivation. Although the N- analysis of the molecular mechanism of calmodulin (CaM) terminal lobe may particularly have the potential to function as a mediating Ca2+dependent inactivation of class C-type Ca24 dominant negative mutant, a substantially lower affinity probably channels will be performed using a combined approach of impedes its competition with endogenous CaM. Supported by electrophysiology and atomic force microscopy. Using the FWF 15387. conventional a1c,77 and the mutant 04C,77L where most of CBR has 515-Pos Board # B377 been substituted, Ca2+-dependent inactivation will be studied in the EFFECT OF Ca2+ CHANNEL IQ PEPTIDES ON Ca2+ inside-out patch. Then, single channel current parameters recorded BINDING TO CALMODULIN from aC,i77 as well as mutant aIC,77L and single molecule interaction D. J. Black', D. Brent Halling2, Patricia Pate2, David V. Mandich3, forces between CaM and the respective carboxyl-tail protein are Susan L. Hamilton2, Ruth A. Altschuld3; 'University of Missouri, correlated, both in dependence of increasing Ca2+ concentrations. 2Baylor College ofMedicine, 3Ohio State University Furthermore, conformational changes of carboxyl tail proteins induced by Ca2+/CaM are measured by force sensing, and studying The Ca2+ sensor for both Ca2+ dependent inactivation and protein mechanics may allow to resolve additional structural facilitation of the cardiac L-type voltage dependent Ca2' channel is details (supp. by: P15387-MOB; Austrian Academy ofScience). calmodulin (CaM). Several CaM binding sequences have been identified in the carboxytail of the a, subunit of this channel, but 513-Pos Board # B375 the highest affinity interaction is with a sequence designated the IQ SECONDARY STRUCTURAL PREDICTIONS OF THE motif. We find that the binding of CaM to the IQ peptides from the CaM TETHERING AND Ca2+-SENSING DOMAIN OF THE P/Q, Lc, Lsk, and R-type, but not the N-type, voltage dependent L-TYPE Ca2+ CHANNEL Ca2+channels increases the Ca2+ affinity of both lobes of CaM. The Geoffrey S Pitt, Jae Y. Oh, Benjamin I. Beamot; Columbia two lobes of CaM, bound to the Lc-IQ or P/Q- IQ peptides, have University, 630 W. 168th St. PH7W-318, New York, New York similar affinities for Ca2 . When CaM is bound to the IQ peptides, 10032 Ca2+ associates and dissociates much faster with the N-terminal lobe than with the C-terminal lobe of CaM. A relatively stable, Calcium dependent inactivation (CDI) of L-type voltage-gated partially Ca2+ saturated state (C-terminal lobe only) of CaM bound Ca2+ channels depends upon a tethered calmodulin (CaM) to PQ-IQ or Lc-IQ can be detected kinetically. These findings molecule that acts as the Ca2+ sensor, and multiple distinct domains suggest that the ability of CaM to function as a Ca2+ sensor for within the cytoplasmic tail of the Ca24 channel's pore-forming aic both facilitation and inactivation reflects its unique ability when subunit. These domains include: the IQ motif, a consensus CaM bound to the IQ motif of these channels to assume a variety of binding site which serves as the CDI effector; the CaM tethering conformational states depending upon its Ca2+ saturation state. sites (two non-contiguous sites N-terminal to the IQ motif; and an EF-hand. This 160 amino acid domain appears to form the Ca2+- 516-Pos Board # B378 sensing and the effector domain for this form of channel CALMODULIN BINDING MOTIFS OF THE L-TYPE inactivation. We have begun to explore the role ofthis domain and CALCIUM CHANNEL the relationship among these distinct entities. We have expressed Patricia Pate', Wael Mourad', Jia-Zheng Zhang', Wei Tang', Yili and purified recombinant proteins corresponding to this domain Wu2, Susan L Hamilton'; 'Baylor College of Medicine, 2Bayor and to sub-domains and perfbrmed circular dichroism spectroscopy College ofMedicine, I Baylor Plaza, Houston, Texas 77030 to assess secondary structure. Further, we have used these proteins Calmodulin and the C-terminus of the al subunit of the to map the interactions of CaM at various concentrations of Ca2+. (CaM) cardiac L-type Ca2+ channel are involved in both Ca2+dependent In addition, we have used these constructs to begin to explore the inactivation and facilitation of this channel. Two sequences Ca2+ binding site within this domain. involved in these regulatory events are CB [amino acids 1627 - 514-Pos Board # B376 1652, cardiac, CCAC_HUMAN (Q13936)] and IQ [amino acids EFFECTS OF N- AND C-TERMINAL LOBE OF 1665 - 1685, cardiac, CCAC_HUMAN (Q13936)]. Synthetic CALMODULIN ON Ca24- DEPENDENT INACTIVATION peptides representing the CB and the IQ regions both bind partially OF Cavl.2 CHANNEL Ca2+-saturated CaM. The CB peptide preferentially binds the C- Heike Kahr', Rainer Schindl2, Klaus Groschner3, Nikolai M terminus of Ca2+calmodulin and has low affinity for the N- Soldatov4, Christoph Romanin2; 'Institute of Biophysics, terminal lobe. Binding of CB to CaM is significantly reduced if Altenbergerstr. 69, Linz, 4040 Austria, 2Institut for Biophysics, CaM's 4" EF hand is mutated. The IQ peptide binds both the N- University of Linz, Altenbergerstral3e 69, Linz, 4040 Austria, and C-terminal lobes of calmodulin. A longer peptide (CB-IQ), 3University ofGraz, Austria, 4NIA, NIH, Maryland containing both the CB and IQ sequences, is able to bind Ca2+free CaM, suggesting that both motifs are necessary for apoCaM L-type calcium channel Ca,1.2 undergoes Ca2+-dependent binding. The CB-IQ peptide binds Ca2+ CaM with higher affinity inactivation with calmodulin (CaM) as its mediator. The critical than either peptide alone. Movement of one or both lobes of CaM molecular determinant for Ca2+-dependent inactivation is the between binding sites within the CB-IQ sequence may explain the carboxyl-terminal tail of Cad1.2 subunit containing two CaM ability of this molecule to function as a Ca2+ sensor for both binding domains, a CaM binding region (CBR) close to an IQ like inactivation and facilitation. To test this hypothesis we have also CaM binding motif During resting state of the cell, apoCaM is tethered to the CBR. Following channel opening and Ca2+ influx expressed fragments of the DHPR alc carboxy terminal tail, CaM binds also to the IQ motif. It has been suggested that the N- including two or more of the following motifs: the EF hand, A and C-tenninal lobe of CaM bind to the CBR and IQ motif, sequence, CB sequence, and IQ sequence, and are comparing their respectively. Therefore, we tested whether the N- or C-terminal interactions with CaM and CaM mutants. lobe have the capability to function as a dominant negative mutant. For this, the polymerase chain reaction was used to amplify in separate the N- and C-terminus lobe of CaM. In vitro binding properties of respective CaM lobes to the carboxyl tail of Ca,1.2

106a Sunday POSTERS 5 17-521

current recorded by TEVC was regulated by NGF in a biphasic 517-Pos Board # B379 way. After an initial increase of 9±6% (mean±SD), the current FRET-BASED TWO-HYBRID MAPPING OF THE was inhibited by 34±19% 18 min after application of 100 ng/ml MOLECULAR CONTACTS UNDERLYING Ca2+ NGF (n=31). Activation of a TrkA mutant (Y499F) uncoupled INACTIVATION OF L-TYPE Ca+ CHANNELS from the MAPK pathway showed similar current regulation Michael G Erickson, David T Yue; Johns Hopkins Sch Med, 720 (10±4% increase followed by 16±11% inhibition, n=15). Rutland Ave, Ross 713, Baltimore, Maryland 21205 However, activation of another TrkA mutant (Y794F) that is The sensor for Ca2+-dependent inactivation of L-type Ca2+ channels unable to stimulate PLC-y and hence PIP2 breakdown had no effect is calmodulin (CaM), which when activated by inflowing Ca2+ on P/Q-type current (n=10). Preincubation with thapsigargin (100- binds to an IQ-like domain in the axc carboxyl terminus. We now 300 nM) abolished NGF-induced increase in [Ca +i but had no know that Ca2+-free CaM "preassociates" with the L-type channel effect on channel regulation (11±1 0% increase followed by complex even before channel opening (Erickson et al., Neuron 31, 43±25% inhibition, n=8). Activation of PKC by PMA (10-500 2001) to enhance rapid detection of local Ca2+, but the molecular nM) produced a similar effect on P/Q-type channels as NGF did contacts underlying preassociation are only beginning to be (8±4% increase followed by 30±18% inhibition, n=14). But while uncovered. To directly characterize these contacts in living cells, PMA-induced regulation was blocked by the PKC inhibitor we developed a two-hybrid assay based on 33-FRET for screening bisindolylmaleimide I (10 gM) in 17 out of 22 oocytes, the NGF associations among CaM and short segments of aic. We detect effect remained unchanged in 12 out 14 oocytes (8±4% increase significant, Ca2+-independent associations between CaM and an IQ followed by 30±18% inhibition). Our data indicate that P/Q-type peptide, based on robust FRET between CaM-CFP and IQ-YFP channels coexpressed in resting cells. Elevating intracellular Ca2+ Ca2+ can be directly regulated by receptor-mediated substantially increases FRET coupling, indicating a Ca2+- breakdown ofPIP2. dependent conformational change in the CaMIIQ complex. These 520-Pos Board # B382 findings demonstrate that the IQ region not only coordinates INTERDEPENDENCE OF PUTATIVE Gl INTERACTION binding of Ca2+-CaM, but also can support preassociation. SITES WITH P/Q-TYPE CA CHANNELS PROBED BY Furthermore, the Ca2+-induced shift between the two CaM/IQ MUTANT-CYCLE ANALYSIS configurations could provide a revealing glimpse of the molecular Heather L Agler, Jenafer Evans, Henry M Colecraft, David T movements coupling Ca2+ detection to inactivation. This approach Yue; Johns Hopkins Sch Med, 720 Rutland Ave./ 713 Ross may prove widely applicable to high-throughput mapping of Building, Baltimore, Maryland 21205 protein-protein interactions in mammalian cells. Mutant-cycle analysis has proved widely useful in probing many 518-Pos Board # B380 ligand-channel interaction surfaces. Here, we explore the BIDIRECTIONAL REGULATION OF P/Q-TYPE Ca2+ applicability of this analysis for investigating the Go interaction CHANNELS BY PIP2 surface with P/Q-type channels. We recently developed a Li Wu, Claudia Bauer, Tao Lu, Xiaoguang Zheng, Cheng Xie, kinetic/electrophysiological method to extract relative GPl-channel Jian Yang; Columbia University, Biological Sciences, New York, dissociation constants over a wide voltage range. Applying this New York 10027 method to wild-type GP,, along with single- and double-point We studied regulation of P/Q-type Ca2+ channels expressed in mutants, provided an opportunity to examine whether mutant-cycle analysis could distinguish if specific GP, residues acted Xenopus oocyte by PIP2. In inside-out patches, application of 10 independently or cooperatively in mediating GP-channel jiM PIP2 to the intracellular solution speeded up channel rundown interaction. For two mutations located in close proximity, by 60%. When PIP2 was added during spontaneous rundown, it GPL55A and GPI80A, the apparent binding energy of the double produced marked inhibition of the current, the speed of which mutant was clearly different than that deduced from simple depended on [PIP2]. This inhibitory effect was strongly dependent of on membrane With 30 the activation and addition energy changes associated with individual mutations, voltage: FM PIP2, peak- as if both residues formed part of a single binding unit with the current voltages were both shifted to the positive direction by 10- channel. Reassuringly, with physically separated mutants, 15 mV and the activation curve obtained from tail currents and the of even when was GPL55A GPW332A, energetics the corresponding displayed larger positive shifts. Interestingly, PIP2 double mutant appeared consistent with energy-additive effects. applied together with reagents that facilitate PKA phosphorylation, Mutant-cycle analysis may therefore provide a useful approach to its inhibitory effect was largely alleviated. Furthermore, rundown probe Ca channel interactions with GP and other modulatory was dramatically attenuated, as reflected by an increase in the ligands. percentage of nondecaying current from 4.0±5.7% (mean±SD, n=8) in control to 61±11% (n=3) with 10 pM PIP2. This 521-Pos Board # B383 stabilizing effect was also dependent on [PIP2], raging from GATING OF LVA CA CHANNELS: GATING CURRENTS, 37+17% (n=3) with 1 FIM PIP2 to 68±9% (n=3) with 30 ILM PIP2. MODELING, AND PH MODIFICATION These results indicate that PIP2 exerts a bidirectional modulation Don E Burgess', James Booth2, Brian P Delisle3, Jonathan Satin2; on P/Q-type Ca2+ channels and PKA phosphorylation serves as a 'Asbury College, 2University of Kentucky, 3University of molecular switch to regulate the action of PIP2. These complex Wisconsin, 1300 University Ave, Madison, Wisconsin 53706 modulatory pathways set up a dynamic mechanism thereby the Recovery from inactivation (RFI) of LVA Ca channels is slow and activity of P/Q-type channels could be fine tuned by various saturates at moderate hyperpolarization compared to Na channels. neurotransmitters, hormones and trophic factors. We measured gating and ionic currents to quantify this unique 519-Pos Board # B381 pattern of LVA channel gating. Gating current recovers from RECEPTOR-MEDIATED BREAKDOWN OF PIP2 inactivation before ionic current. The rate of ionic current RFI REGULATES P/Q-TYPE Ca2+ CHANNELS saturates at - -90 mV compared to gating RFI, which does not Li Jian saturate. There is a lag in the onset of gating current RFI at -80 Claudia Bauer, Wu, Yang; Columbia University, mV, but no lag is discemable at -120 mV. The delay in RFI of Biological Sciences, New York, New York 10027 ionic current is much more evident at all voltages. The time We studied the effect of neural growth factor (NGF) on P/Q-type constant of OFF gating current decay is very similar to the time Ca2+ channels coexpressed in Xenopus oocytes with TrkA constant of deactivation of open channels, and both are strongly receptors. TrkA stimulates the MAPK pathway and PLC-^y, voltage dependent. These results suggest that movement of gating leading to PIP2 hydrolysis into IP3 and diacylglycerol. P/Q-type charge occur for inactivated states quickly. In contrast, the

107a 521-526 POSTERS Sunday

transitions from inactivated to available states are orders of 524-Pos Board # B386 magnitude slower, not voltage-dependent, and are the rate-limiting SUR2B - A CANDIDATE FOR THE REGULATORY step for ionic recovery. We have developed an eight-state model SUBUNIT OF KATP CHANNELS IN CARDIAC to help interpret our experimental results. Currently, we are using MITOCHONDRIA our model to determine which gating steps are most strongly Jielin Pul, Tomoyuki Wadal, Kevin Galles', Carmen R. Valdivia', influenced by changes in external pH (Delisle & Satin, 2000, William A Chutkow2, Charles F Burant3, Jonathan C. Makielskil; Biophys J, 1895-1905). We find that acidification slows and 'University of Wisconsin, 1300 University Avenue SMI 24, reduces the voltage dependence ofLVA Ca channel activation. Madison, Wisconsin 53706, 2University of Chicago, 3University of Michigan Mitochondrial Channels ATP sensitive channels have been recorded in the inner 522-Pos Board # B384 mitochondria membrane (mKATP) by patch clamp (Inoue et al, Nature 1991), but the molecular nature of mKATP has not been HEAT RELEASE IN PLANT MITOCHONDRIA: THE determined. Opening of mKATP (by for example Diazoxide) EFFECTS OF FATTY ACIDS, K+ AND THE played an important role in protection from cardiac ischemia. We ALTERNATIVE OXIDASE used cells isolated from ventricles of wildtype (WT) and an SUR2 Paula Bresciani Martins de Andrade', Alicia Juliana knockout mouse Kowaltowskil, Maria Lucia Bianconi2, Hernan Chaimovich; gene model (KO) to study mKATP activity. 'Universidade de Sao Paulo, Avenida Lineu Prestes 748, Sao Diazoxide (100J. M) sensitive mitochondria flavoprotein Paulo, 0559970 Brazil, 2Universidade Federal do Rio de Janeiro, fluorescence was determined by confocal microscopy. The Brazil fluorescence intensity was normalized to the maximal intensity elicited by Dinitrophenol (DNP, 10Og M) which uncoupled Heat release in isolated potato tubers mitochondria (Solanum respiration from ATP synthesis and induced maximal oxidation. In tuberosum) was measured employing isothermal titration 15 WT cells, Diazoxide increased the fluorescence intensity from a microcalorimetry (ITC). Here we show that heat release is base line of 26.2± 3.7 to 62.8± 6.2 %. In 15 KO cells, however, no dependent on mitochondrial respiration and can be modulated by chemical regulators, as well as by the activation of alternative Diazoxide sensitive fluorescence was elicited (21.2± 3.1 % at base pathways. Our results demonstrate that Plant Uncoupling line vs. 22.8± 3.6 % in Diaz). Fluorescence intensity at base line Mitochondrial Protein (PUMP), the Alternative Oxidase (AltOx) and at maximum showed no difference between WT and KO cells and the K+ channel promote 02 consumption and, thus, plant indicating mitochondria in both cell groups were functionally mitochondrial heat release. Parallel oxygen consumption rates comparable. This result suggests that SUR2 is a subunit of were determined in order to calculate heat production per oxygen mKATP. Diazoxide sensitivity suggests SUR2b to be the most consumed. Mitochondrial heat release was linearly correlated to likely candidate. the fatty acid and K+ stimulated 02 consumption (65 kcal/mol 02). 525-Pos Board # B387 AltOx promoted the same heat exchange relative to oxygen EFFECTS OF MITOCHONDRIAL ATP-SENSITIVE consumption, as long as succinate was mantained as respiratory POTASSIUM CHANNEL (MKA.T) ACTIVATION ON substrate. Our results are the first direct confirmation that fatty MITOCHONDRIAL MEMBRANE POTENTIAL AND acids and K+ regulate heat release in plant mitochondria, a process APOPTOSIS that may play a role in cold adaptation, fruit ripening, blossoming Hemamalini I Gursahani, Linda Simmennan, Robert W Hadley; and senescence. University of Kentucky, 800 Rose Street, Lexington, Kentucky 523-Pos Board # B385 40536 pH-DEPENDENT MODULATIONS OF THE PROTEIN Pharmacological activation of the mKATp is cardioprotective, TRANSLOCATING TOM AND TIM CHANNELS OF however, studies in isolated mitochondria suggest that mKATh MITOCHONDRIA opening can result in release of pro-apoptotic mediators. The aim Serguel Grigoriev, Kathleen W Kinnally; NYU, 345 East 24th of this study was to investigate if mKATp-mediated mitochondrial Street, New York, New York 10010 depolarization was coupled to apoptotic signaling pathways. The Most mitochondrial proteins are synthesized in the cytosol and are effects of pharmacological activation of the mKATp were evaluated imported into mitochondria through protein-translocating channels using diazoxide (0.1 mM) to activate and 5-hydroxydecanoate (0.5 called TOM and TIM, located in the mitochondrial outer and inner mM) to block the mKAW. We previously showed, that under membranes, respectively. The single channel behaviors of TOM physiological conditions, diazoxide induces a significant and TIM complexes were investigated using patch-clamp mitochondrial depolarization in HepG2 cells and hippocampal techniques on proteoliposomes containing purified outer and inner neurons but not in cardiac myocytes. mKATp -mediated membranes prepared from wild type yeast mitochondria. While mitochondrial depolarization was associated with a reduction in acidic pH decreased the open probability (P.) of both TIM and staurosporine-induced apoptosis in HepG2 cells and ,-amyloid- TOM channels, the pH dependence was not identical. Increasing induced apoptosis in hippocampal neurons. mKA-w activation in [HI decreased Po more dramatically for TIM then TOM. guinea pig ventricular myocytes enhanced mitochondrial Typically, the TIM and TOM channels exhibit transitions between depolarization under conditions of metabolic stress and reduced the the fully open and subconductance states at pH 7.4 and 20 mV. percentage of caspase-3 positive myocytes during Under acidic conditions, the TOM channel predominantly hypoxia/reoxygenation. These data suggest that mKATp activation remained in the half-open subconductance state while TIM more results in anti-apoptotic effects in various cell types. We frequently occupied the fully closed state. No changes in activity hypothesize that mitochondrial depolarization could be a potential were detected for TIM and TOM channels at alkaline pH. signaling event in the cytoprotective effects ofmKATp activators. However, after perfusion with media with pH>9, the TIM channel 526-Pos Board # B388 activity lost its sensitivity to targeting peptides (yCOX,.13). These VOLATILE ANESTHETIC ISOFLURANE ACTIVATES findings show that pH modulates the channel activity of the HUMAN AND RAT MITOCHONDRIAL KATP CHANNELS protein-transporting complex of the mitochondrial inner and outer RECONSTITUTED IN LIPID BILAYERS membranes. This work was supported by NSF grants MCB- Yuri Nakae, Ming Tao Jiang, Wai-Meng Kwok, Zeljko Bosnjak; 9513439 and MCB-0096206. Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee, Wisconsin 53226

108a Sunday POSTERS 526-531

The mitochondrial ATP-sensitive K channel (mitoKATp) plays a 529-Pos Board # B391 critical role in myocardial preconditioning by brief ischemia or PURIFICATION OF THE BRAIN MITOCHONDRIAL volatile anesthetics. Our previous studies have shown that Na+ICa24 ANTIPORTER isoflurane induced riboflavin oxidation, an indirect index of Petr Paucekl, Martin Jaburek', Petr Jezek2, Jan Jezek3, Keith D. mitoKA-m activation. In this study, we have examined the direct Garlid'; 'OGI School of Science and Enpineering at OHSU, P.O. activation of mitoKAw channels by isoflurane after reconstitution Box 91000, Portland, Oregon 97291, Institute of Physiology, in lipid bilayers. Isolated mitochondria and fractions enriched in Academy of Sciences, Czech Republic, 3Charles University, Czech inner membranes were isolated from rat and human ventricles and Republic fused into the lipid bilayers in the presence of symmetrical 150 We identified and purified the beef heart mitochondrial Na+/Ca2+ mM potassium glutamate and 50 FM K2ATP. Isoflurane (ISO, 1 antiporter (NCA) and studied its transport properties in liposomes mM) was administered to the cis chamber. At a holding potential loaded with appropriate ion-selective fluorescent probes. NCA of +40 mV (trans/cis), ISO increased cumulative open catalyzed both electroneutral and electrophoretic Na+- dependent probability (Po) of rat mitoKAWm channels from 0.03±0.01 to Ca2+ fluxes and also catalyzed Ca2+ - dependent Na+ flux. In the 0.44±0.15 (P < 0.05, n=4). In human mitoKATp channels, ISO also absence of Ca2+, NCA also catalyzed electroneutral Na+/K+ flux, increased the cumulative Po and reversed their inhibition by ATP but K+ was not competent to exchange with Ca2+. Diltiazem and (0.4-0.8 mM). The activation of mitoKAmp channels by ISO was TPP+ inhibited Na+/Ca2+ and Na+/K+ exchange with Kl/2 values inhibited by 5-hydroxydecanoic acid (-200 FM), a putative of 10 FM and 0.6 ,tM, respectively. The Vmax for Na+/Ca2+ specific blocker for mitoKAW. These results suggest that isoflurane exchange was increased 4-fold by BSA. NCA activity was directly activates mitoKATp channels and that this mechanism is associated with a 110 kD protein band on SDS-PAGE. Western- likely to contribute to anesthetic-induced myocardial blot analysis showed that this band also contains 110 kD preconditioning. transhydrogenase. To purify NCA to homogeneity, we collected and concentrated several active eluates from DEAE columns, 527-Pos Board # B389 precipitated the protein, and subjected it to 10% SDS-PAGE. The PURIFICATION OF MitoKATP SUBUNITS FOR AMINO 110 kD proteins were excised, run on a Dowex column, ACID SEQUENCING precipitated, solubilized with urea and CHAPS, and subjected to Petr Paucek, Elena Crucerescu, Keith D. Garlid; OGI School of 2DE. The final SDS-PAGE was stained by SYPRO Ruby, and the Science and Engineering at OHSU, P.O. BOX 91000, Portland, 110 kD / pI 8.2 spot was excised, digested and analyzed using Oregon 97291 MALDI. (Supported by AHA-G60027 and NIH-GM55324). Brain mitochondria, solubilized by Triton TX-100, were purified on columns of DEAE-cellulose and ATP-agarose. The ATP- 530-Pos Board # B392 affinity column eluate was concentrated and subjected to 2-D gel VOLUME ACTIVATION OF MITOCHONDRIAL electrophoresis (2DE). 2DE gels reveal that mitoKATP subunits ELECTRON TRANSPORT migrate together during IEF at one pi (7.2), indicating that the Subramaniam Seetharaman, Valery Zinchenko, Petr Paucek, subunits remain associated during IEF, as they do during Keith D. Garlid; OGI School of Science and Engineering at purification in Triton TX-100. Visualization of the final 2DE gel OHSU, P.O. Box 91000, Portland, Oregon 97291 shows two spots - mitoSUR (7.2/63) and mitoKlR(7.2/55). These Over the years, a number of laboratories have reported that bands were excised from the gel and subjected to MALDI-MS. expanding the volume of the mitochondrial matrix stimulates Each band was found to contain only one protein, and each protein respiration [e.g., Halestrap, Biochem J 244, 159, 1987]. This is a novel protein. Efforts to obtain amino acid sequence are phenomenon has been called "volume activation"; however true underway. (Supported by AHA-G60027 and NIH-GM55324). activation has not heretofore been demonstrated. We studied the relationship between membrane potential and respiration as 528-Pos Board # B390 respiration is increased with the protonophore, FCCP. The slope PURIFICATION AND RECONSTITUTION OF KATP of the line measures the internal resistance of the electron transport CHANNEL (pmitoKATP) OF PLANT MITOCHONDRIA system (ETS). Inhibition of the ETS increases the slope, and Petr Paucek Ludmila Dolgacova, Keith D. Garlid; OGI School of activation can be defined as a decrease in the slope. We observed Science and Engineering at OHSU, P.O. Box 91000, Portland, that matrix expansion, caused by lowering the osmotic strength of Oregon 97291 the medium, decreased the internal resistance from 0.42 to 0.23, Pastore, et al. [JBC 274, 26683,1999] have described a K+ uniport and increased the Vmax from 124 to 154 ngatomsO/mg.min. pathway in plant mitochondria that possesses characteristics of a These findings show for the first time that matrix expansion causes KATP channel. K+ flux catalyzed by pmitoKATP was sufficient a true activation of electron transport. We propose that opening to collapse membrane potential, and it was inhibited by ATP and the mitochondrial ATP-sensitive K+ channel, which causes the activated by diazoxide or GTP. These authors proposed a K+ matrix to expand to a higher steady state volume, may regulate the cycle similar to that which we previously reported for mammalian efficiency of electron transport in vivo. (Supported by AHA- mitochondria [Paucek et al., JBC 267, 26062, 1992]. At the recent G60027 and NIH-GM55324). Congress of the Italian Society of Plant Physiology, Chiandussi, et al. reported that pmitoKATP is inhibited by glyburide and 5-HD. 531-Pos Board # B393 We have undertaken to purify and reconstitute pmitoKATP from COENZYME Q IS NOT AN OBLIGATORY COFACTOR OF potato, using our methods for mammalian mitoKATP. Like the UCP2- AND UCP3-CATALYZED PROTON TRANSPORT. mammalian mitoKATP [Bajgar, et al., JBC 276, 33369, 2001], the Martin Jaburek', Petr Jezek2, Keith D. Garlid'; 'OGI School of active fraction contains both 55 kD and 63 kD proteins. ATP Science and Engineering at OHSU, P. 0. Box 91000, Portland, inhibited K+ flux with Kl/2 = 183 gM; diazoxide activated with Oregon 97291, 2Institute of Physiology, Academy of Sciences, K1/2 = 7 ruM; and gliburide or 5-HD inhibited with K1/2 = 150 Czech Republic nM or 50 FM, respectively. We conclude that the structure and The newly discovered uncoupling proteins UCP2 and 3 dissipate regulation of plant and mammalian mitoKATP are remarkably energy by catalyzing back-flux of protons into the mitochondrial similar. (Supported by AHA-G60027 and NIH-GM55324) matrix. We showed that bacterially expressed UCP2 and UCP3 catalyze electrophoretic proton flux when reconstituted into lipid vesicles. These fluxes exhibited an obligatory requirement for fatty acids (FA) [Jaburek et al. (1999) JBC 274, 26003]. It has since been reported that coenzyme QI0 (CoQ), in addition to FA,

109a 531-536 POSTERS Sunday

is also an obligatory cofactor for UCP-catalyzed H+ transport The Permeability Transition Pore (PTP) is a mitochondrial inner [Echtay et al. (2001) PNAS 98, 1416]. We examined this membrane Ca2'-sensitive channel that plays a key role in different contention in liposomes containing UCP2 and UCP3. In the models of cell death. Since functional links between the PTP and absence of CoQ, the Km for laurate-induced H+ flux was about 40 the respiratory chain complex I have been reported, we have nmolUmg of lipid. In the presence of CoQ (5 nmol/mg lipid), the investigated the effects of rotenone on PTP regulation in U937 and Km decreased about 2-fold. The Vmax remained unchanged. We KB cells. We show that rotenone was more potent than cyclosporin conclude that CoQ is not obligatory for UCP-mediated proton A (CsA) at inhibiting Ca2+-induced PTP opening in digitonin- transport and that the small effect of CoQ on the Km for laurate is permeabilized cells energized with succinate. Consistent with PTP probably due to a minor physicochemical effect within the bilayer. regulation by electron flux through complex I, the effect of (This research was supported by NIH grant DK 56273) rotenone persisted after oxidation of pyridine nucleotides by duroquinone. Tert-butylhydroperoxide induced PTP opening in 532-Pos Board # B394 intact cells (as shown by mitochondrial permeabilization to calcein THE MITOCHONDRIAL RYANODINE RECEPTOR IN and cobalt), as well as cytochrome c release and cell death. All RAT HEART: CHARACTERIZATION OF THE SUBTYPE these events were prevented by rotenone or CsA. These data Gisela Beutner, Virendra K Sharma, Lin Lin, Robert T Dirksen, demonstrate that respiratory chain complex I plays a key role in Shey-Shing Sheu; University of Rochester, 601 Elmwood Avenue, PTP regulation in vivo, and confirm the importance of PTP Rochester, New York 14642 opening in the commitment to cell death. Rat heart mitochondria contain a ryanodine receptor (RyR) in the inner mitochondrial membrane. The subtype of the mitochondrial 535-Pos Board # B397 ryanodine receptor (mRyR) is not characterized yet. RT-PCR from MITOCHONDRIAL ENERGY DISSIPATION BY FATTY whole heart tissue showed that all 3 described RyR are expressed. ACIDS: MECHANISMS AND IMPLICATIONS FOR CELL Western blot analysis with subtype specific antibodies, applied to DEATH the SR-fraction, isolated mitochondria, separated outer and inner Daniele Penzo, Chiara Tagliapietra, Raffaele Colonna, Valeria mitochondrial membrane, showed that mRyR is not RyR2. Using Petronilli, Paolo Bemardi; University ofPadova, Italy a RyRI-specific antibody a weak signal was obtained in isolated Fatty acids (FA) can lead to energy dissipation through two mitochondria and the IMM. This signal was suppressed in mechanisms i.e. (i) selective protonophoric action mediated by mitochondria isolated fromRyRl knock out mice. The kinetic of coupling of transmembrane movement of the fatty acyl anion (via [3H]ryanodine binding to isolated rat heart mitochondria shows the adenine nucleotide translocator or the uncouplign proteins) similarities with the RyRI in skeletal muscle and maximal binding with the flip-flop of the undissociated fatty acid and (ii) opening of in presence of caffeine occurred at pCa 4.8, compared to pCa 5.3 the permeability transition pore (PTP). Because the PTP is voltage- without caffeine. In addition, in presence of 1 mM AMPPCP, dependent, opening by FA can be caused by the protonophoric which enhances ryanodine binding to RyRI and RyR3 but not action or by a direct effect on the PTP. In order to address this RyR2, [3H]ryanodine binding was increased about 50 %. mechanistic issue, and its relationships with FA-induced cell death, Dantrolene, which interacts with RyRI and not RyR2, inhibits we have investigated the effects of FA of increasing chain length calcium-induced mitochondrial swelling (IC50 7.4 AM). In and degree of unsaturation on respiration, PTP opening, summary, our data provide evidence that the mRyR is not RyR2 mitochondrial membrane potential in situ and death of Morris and indicates that different RyR isoforms may have their specific Hepatoma ICC cells. We found that there is no correlation between intracellular localization. Supported by AHA 9920244T, AHA the protonophoric and PTP-inducing activities of FA, indicating 0050839T and HL-33333. that FA have a direct effect on the PTP. In situ depolarization and cell death matched the FA effects on the PTP rather than those on 533-Pos Board # B395 respiration, indicating that PTP opening is a key factor in this INTERACTION OF MITOCHONDRIAL CREATINE model. KINASE WITH VDAC Malgorzata Tokarska-Schlattner, Max Dolder, Theo Wallimann, 536-Pos Board # B398 Uwe Schlattner; Swiss Fed Inst Technol, Hoenggerberg HPM F44, CALCIUM-INDUCED CYTOCHROME C RELEASE FROM Zurich, CH-8093 Switzerland CNS MITOCHONDRIA IN VITRO AND IN SITU. A direct interaction between mitochondrial creatine kinase (MtCK) Nickolay Brustovetsky, Tatiana Brustovetsky, Ronald and VDAC (voltage dependent anion channel) was demonstrated Jemmerson, Janet M Dubinsky; University of Minnesota, 6-145 by using surface plasmon resonance spectroscopy. Interaction of Jackson 321 Church St SE, Minneapolis, Minnesota 55455 MtCK with vesicles containing reconstituted VDAC was The mechanism of Ca2+-induced release of Cytochrome c (Cyt c) significantly higher as compared to pure phosphatidylcholine from rat CNS mitochondria was examined using a capture ELISA. vesicles. The response was dependent on VDAC concentration and In 75 or 125 mM KCI-based media 1.4umol Ca2+/mg protein modified by micromolar calcium concentrations. Similar results caused depolarization and mitochondrial swelling. This resulted in were obtained independent of the immobilized binding partner partial Cyt c release only in 75 mM KCI. The release was inhibited (liposomes with reconstituted VDAC or MtCK) or the VDAC by Ru360, an inhibitor of the Ca2+ uniporter, and by cyclosporin preparation (human recombinant VDAC or VDAC purified from A (CsA)+ADP, a combination of mitochondrial permeability beef heart mitochondria). The significance of these findings for transition (mPT) inhibitors. Transmission electron microscopy structure and fanction of mitochondrial contact sites is discussed. revealed that Ca2+-induced swelling ruptured the outer membrane (This work was supported by grants of Sandoz Family Office, (OM) only in 75 mM KCI. Koenig's polyanion, an inhibitor of Novartis Stiftung, Wolfermann-Nageli Stiftung and mitochondrial porin (VDAC), enhanced swelling and amplified Schweizerische Herzstiftung). Cyt c release. Dextran T70 that enhances contact site formation did not prevent Cyt c release. Elevated Ca2+ activated respiration with 534-Pos Board # B396 succinate+glutamate but inhibited respiration with ROTENONE INHIBITS THE MITOCHONDRIAL pyruvate+malate. In the latter case, succinate, added after Ca2+, PERMEABILITY TRANSITION-INDUCED CELL DEATH reactivated respiration. Exogenous Cyt c did not affect respiration. IN U937 AND KB CELLS Exposure of cultured cortical neurons to 500uM glutamate for 5 Christiane Chauvin', Frederic De Oliveira', Xavier Ronot2, min caused increase of cytosolic Ca2+ and mitochondrial Mireille Mousseau3, Xavier Leverve', Eric Fontaine'; 'LBFA, depolarization followed by Cyt c release into the cytosol 30 min 2280 rue de la piscine, Grenoble, 38041 France, 2Lab de after glutamate removal. MK-801 or CsA inhibited this release. Dynamique Cellulaire, France, 3Oncologie Medicale, France Thus, the release of Cyt c from CNS mitochondria induced by

1Oa Sunday POSTERS 536-541

Ca2+ in vitro as well as in situ involved the mPT and appeared to the ER and mitochondria. Since the outer mitochondrial membrane require the rupture ofthe OM. (0M ) has been thought to be freely permeable to Ca2', the investigations have been focused on the IP3-driven Ca2+ transport 537-Pos Board # B399 through the inner mitochondrial membrane (IMM). Here we ANALYTICAL QUANTITATION OF CYTOCHROME C demonstrate that selective permeabilization of the OMM by tcBid, RELEASE FROM RAT LIVER MITOCHONDRIA a proapoptotic protein results in an increase in the magnitude ofthe Martha E. Gadd, Mark W. Julian, Elliott D. Crouser, Douglas R IP3-induced mitochondrial [Ca2l signal. This effect of tcBid was Pfeiffer; The Ohio State University, 1645 Neil Avenue, 313 due to promotion of activation of Ca2+ uptake sites in the inner Hamilton Hall, Columbus, Ohio 43210 mitochondrial membrane, and in turn, to facilitation of The release of cytochrome c from mitochondria is an early step in mitochondrial Ca2+ uptake. By contrast, tcBid failed to control the apoptosis because cytochrome c binds to apoptosis protease delivery of sustained and global Ca2+ signals to the mitochondria. activating factor-I resulting in the activation of caspases. The Furthermore, for facilitation of IP3-driven Ca2+ signaling more amount of cytochrome c required to initiate apoptosis is unclear. tcBid was required than for cytochrome c release, consistent with Picklo et al. (Anal. Biochem. 1999: 276(2):166-70) described a the idea that the former effect depends on increased OMM reverse-phase high-pressure liquid chromatography method for permeability in the particular regions of local [Ca2l rise. Thus, our quantitative determination of cytochrome c. We are further data support a novel model that Ca2+ permeability of the OMM at developing this method to quantitate cytochrome c release from the ER-mitochondrial interface is an important determinant of local isolated mitochondria following exposure to chemical agents, Ca2+ signaling and Ca2+ dependent mitochondrial functions. including ionic strength, calcium, and phosphate, that promote the mitochondrial permeability transition (MPT). This method is very 540-Pos Board # B402 sensitive, with a 0.5 pmol lower limit of detection, and is REACTIVE OXYGEN SPECIES SYNCHRONIZE insensitive to media components, unlike immunoblotting. We MITOCHONDRIAL OSCILLATIONS IN HEART CELLS measure in parallel the release of cytochrome c and adenylate Miguel A Aon, Sonia Cortassa, Eduardo Marban, Brian O'Rourke; kinase (AK), and upon outer membrane rupture, all cytochrome c Johns Hopkins University, School of Medicine, 720 Rutland Ave, and AK are released. Without perturbation, mitochondria retain Ross Bldg 844, Baltimore, Maryland 21205 cytochrome c and AK for hours. With CsA present to block the We have previously described spontaneous oscillations in MPT pore and perturbants present, mitochondria swell by 10% and sarcolemmal K,ATP currents and mitochondrial function of release 10% cytochrome c with 20% AK in low ionic strength substrate-deprived cardiomyocytes. To examine the media. However, high ionic strength media results in a 40% release synchronization and propagation of such responses in the presence of cytochrome c and AK with 20% swelling. (Supported by K08 of substrates, we employed two-photon laser excitation to generate HL04335 and T32 HL07946.) reactive oxygen species (ROS) and depolarize mitochondrial membrane potential (AyIm) in a small focal volume ofthe myocyte. 538-Pos Board # B400 In 10 mM glucose and I mM Ca2' at 37°C, a local flash triggered TEMPORAL AND SPATIAL RELATIONSHIP BETWEEN synchronized and self-sustained periodic oscillations in A'lm, the CYTOCHROME C RELEASE AND MITOCHONDRIAL NAD(P)H redox pool, and ROS (CM-DCF fluorescence). The DEPOLARIZATION IN CARDIAC MYOCYTES triggered oscillations involved up to 90% of the total mitochondrial Masaharu Akao, Brian O'Rourke, Jegatheesan Seharaseyon, volume and had a period of 104±12s(n=15). Synchronization of Eduardo Marban; Johns Hopkins University, 720 Rutland Ave. mitochondrial clusters depended on the substrate(s) and was /Ross844, Baltimore, Maryland 21205 particularly evident when glycolysis was active. Propagation of Release of cytochrome c from mitochondria to the cytoplasm is a AT.m waves involved mitochondrial ROS-induced ROS-release crucial step in the apoptotic pathway of a cell. It has been arising from the respiratory chain at complex I and/or III. suggested to be associated with the loss of mitochondrial Mitochondrial transitions were insensitive to cyclosporin A, but membrane potential (AT), but the precise mechanisms remain were blocked by two inhibitors of mitochondrial inner membrane elusive. To examine the temporal and spatial relationship between anion channels (IMAC), PKI 1195 and DIDS. These data suggest cytochrome c release and mitochondrial depolarization in primary that mitochondrial energetics in heart cells can be synchronized by cultured cardiac myocytes, we have monitored both events in real ROS and that IMAC may mediate both ROS efflux from the time in cardiomyocytes using time-lapse confocal microscopy. A' matrix and AVIm depolarization. was monitored with tetramethylrhodamine ethyl ester (TMRE). To visualize cytochrome c release, we made an adenovirus construct 541-Pos Board # B403 which contains green fluorescent protein-tagged cytochrome c IDENTIFICATION OF BASIC RESIDUES INVOLVED IN (cyto. c/GFP). We confirmed that cyto. c/GFP colocalizes with MEMBRANE BINDING OF MITOCHONDRIAL mitochondria under optimized infection conditions. In response to CREATINE KINASE oxidative stress by exposure to 100 ,tM hydrogen peroxide, Uwe Schlattner, Florian Gehring, Malgorzata Tokarska- isolated neonatal rat cardiac myocytes undergo AT loss in less than Schlattner, Theo Wallimann; Swiss Fed Inst Technol, 60 minutes. However, cyto. c/GFP was not released within the Hoenggerberg HPM F44, Zurich, CH-8093 Switzerland same time period. Similar findings were obtained in cardiac Octameric mitochondrial creatine kinase (MtCK) binds to myoblast, H9c2 cells. Since previous experiments showed that membranes by its two identical opposite faces that display 4-fold cyto. c is released by at least 16 hours post hydrogen peroxide rotational symmetry. We have analyzed the importance of exposure, the results indicate that cytochrome c release may not be conserved basic amino acids within a putative C-terminal obligatorily linked with depolarization ofAT. membrane binding motif for interaction of MtCK with negatively charged phospholipids. Using site-directed mutagenesis, lysines 539-Pos Board # B401 were replaced by alanine, glutamine or glutamate. Mutant proteins tcBID PROMOTES Ca2+ SIGNAL PROPAGATION TO THE showed conserved secondary structure, oligomeric state and full MITOCHONDRIA enzymatic activity. However, when probing for membrane binding Gyorgy Csordas', Muniswamy Madesh', Bruno Antonsson2, and lipid vesicle crosslinking with surface plasmon resonance Gyorgy Hajnoczky'; 'Thomas Jefferson Univ, 2SPRI Geneva, spectroscopy and a static light scattering assay, mutant proteins Switzerland revealed a strongly reduced binding capacity for Calcium spikes established by IP3 receptor-mediated Ca2+ release phosphatidylcholine membranes containing 16% cardiolipin. from the ER are effectively transmitted to the mitochondria, While the effect of Lys379/Lys380 mutants was still moderate, utilizing local Ca2+ interactions between adjacent subdomains of additional replacement of Lys369 with alanine or glutamate

Illa 541-546 POSTERS Sunday

reduced binding to about 10% of wild type. These results system is the absence of the sarcolemma. Accordingly, the model demonstrate that phospholipid interaction of MtCK is mainly due does not need a flux term through the sarcolemma. Hence, the total to the three C-terminal lysines and involves ionic interactions for amount of calcium in the system is a constant. Our model includes initial attraction and anchoring at the membrane surface. Residual the kinetics of heterogeneously distributed ryanodine (RyR)- binding of mutant proteins points to a minor contribution of other sensitive receptors as well as the calcium buffering of residues, possibly including an exposed hydrophobic stretch or mitochondria. We end up with a reaction-diffusion system which additional basic residues. is solved numerically by the method of lines and Krylov time integration. We propose an algorithm for the computation of Intracellular Channels propagation velocity of spreading waves depending on several parameters. 542-Pos Board # B404 INTERACTION BETWEEN BAX AND CYTOCHROME C 545-Pos Board # B407 Mitsuyoshi Saito, Paul H. Schlesinger; Washington University CHROMOGRANIN B MODULATES INSP3-GATED Medical school CHANNEL ACTIVITY Mitochondria dependent apoptosis requires translocation of Edwin C. Thrower', Hee Yun Park2, Seung Hyun yoo2, Barbara cytochrome c from the intermembrane space to the cytosol. In E. Ehrlich'; 'Yale University, 333 Cedar St, New Haven, liposomes Bax can form a pore that releases cytochrome c. We Connecticut 06520-8066, 2KAIST, Korea, Republic of hypothesized that cytochrome c selectively interacts with the Bax The Ca2+ storage proteins, chromogranins A and B (CGA and pore. Dextran block of the Bax pore in liposomes is size and CGB) associate with the inositol (1,4,5) trisphosphate receptor diffusion dependent. Cytochrome c block of this pore shows a (InsP3R) when intravesicular pH is 5.5, as found in vivo. This micromolar binding constant. Using the Hummel-Dreyer method interaction has been shown to be functional for CGA, both in terms we have established that cytochrome c interacts with the monomer of flux studies and single channel measurements, although a Bax species and not the dimer. The interaction is not competed by functional interaction remains to be demonstrated for CGB. In Bcl-XL. We conclude that the Bax dimer occludes the cytochrome order to address this question, purified mouse InsP3R type I were c binding site consistent with the inability of the Bax dimer pore to fused to planar lipid bilayers and activated by 2gM InsP3. The transmit cytochrome c. The membrane forms of Bax occur as CGB/IP3R interaction requires a pH 5.5; at physiological pH 7.4 pores having dimer and tetramer stoichiometry. The tetramer form there is only partial dissociation. InsP3-gated channel activity was reveals a binding site for cytochrome c and expands its diameter to observed in the presence of a pH gradient (5.5 luminal/7.4 accomodate cytochrome c. Interaction with the tetramer pore and cytoplasmic) and activity was similar to that observed at Bcl-XL indicate that the oligomerization binding site is distinct symmetrical pH 7.4. Upon addition of CGB to the luminal from that ofcytochrome c. compartnent, channel activity increased dramatically, comparable to the effect of CGA on InsP3R function. Changing the luminal 543-Pos Board # B405 pH to 7.4 only partially reduced channel activity, presumably due CLIC-2 IS A POTENT INHIBITOR OF SKELETAL AND to the incomplete dissociation of CGB from the IP3R at this pH. CARDIAC MUSCLE RYANODINE RECEPTOR CHANNEL These results support a physiological role for IP3R-CGB coupling. ACTIVITY. Angela F Dulhunty, Sarah Watson, Gerlinde Lenz, Philip Board, 546-Pos Board # B408 Peter W Gage; JCSMR, PO Box 334, Canberra, 2601 Australia FUNCTIONAL INTERACTION OF VESL-1L/HOMER-1C CLIC-2 is a newly discovered member of the chloride intracellular WITH THE INSP3 RECEPTOR TYPE I channel (CLIC) family. The function of CLIC-2 is unknown, Juliana Rengifo', Tobias Janowitz2, Edwin C. Thrower', Xin Yu', although the CLIC protein family is thought to either form ion Brenda DeGray', Kaoru Inokuchi3, Peter Koulen4, Barbara E. channels in cell membranes or to modulate ion channel activity. Ehrlich'; 'Yale University, 333 Cedar St, New Haven, Connecticut We have previously shown that ion channel forming CLIC-1 06520-8066, 2Cambridge University, United Kingdom, 3Mitsubishi proteins belong to the glutathione transferase (GST) structural Kasie Institue ofLife Sciences, Japan, 'University ofNorth Texas family and that GSTOl-I inhibits cardiac RyR activity. We have Proteins of the VesV/Homer family bind to synaptic proteins and been unable to demonstrate ion channel activity of CLIC-2. play a role in signaling by coupling metabotropic glutamate However CLIC-2, at concentrations of 1 0-60mg/ml, causes a receptors to inositol (1, 4, 5)-triphosphate-sensitive intracellular marked, reversible depression of cardiac and skeletal RyR activity calcium channels (InsP3 receptors). Our experiments demonstrate when added to the cytoplasmic (cis) side of channels in lipid a direct functional effect of Vesl-lL/Homer-lc on the InsP3 bilayers. The mean current flowing through cardiac RyRs receptor type I (InsP3R-I). The interaction of these two proteins decreased from 3.5+0.7pA (12 experiments with bilayers was studied using radioligand binding, fluorometric calcium containing 1-2 channels) under control conditions to 0.35±0.07pA release, and electrophysiological techniques. Vesl-1L/Homer-Ic after addition of CLIC-2 (60mg/ml), while mean Po (8 single increases the sensitivity of InsP3R-I for its ligand (InsP3) and channel experiments) fell from 0.25±0.06 to 0.02+0.01, due to a enhances channel activity. In order to identify the domain of the decrease in channel open time and an increase in closed times. Vesl-lL/Homer-lc which regulated its interaction with the Similar results were obtained with skeletal RyRs. Channels InsP3R-I, we investigated InsP3R-I activity in the presence of inhibited by CLIC-2 could no longer be activated by either 10- VesI/Homer protein isoforms. Vesl-lS/Homer-la, an isoform that 100[mu]M Ca2+ or by 2mM ATP. Thus CLIC-2 is a potent lacks the regulatory domain formultimerization had no effect on inhibitor of RyR channels and their activation by physiologically InsP3R-I function. Our data indicates that only Vesl-lLlHomer-lc important agonists. specifically regulates the activity of InsP3R-I. These results are the first evidence showing a functional regulation of InsP3R by 544-Pos Board # B406 Vesl/Homer. This mechanism could be used by neurons as to NUMERICAL SIMULATION OF CALCIUM WAVES IN AN specifically regulate calcium signaling in synapses and to AGAROSE GEL SYSTEM differentially activate intracellular calcium stores at postsynaptic Helmut Podhaisky, Kirsten Krannich, Manfred H. P. Wussling; sites. Martin Luther University, Theodor-Lieser-Str. 5, Halle, 06099 Germany We describe a mathematical model for calcium waves observed in an agarose gel system with resuspended SR vesicles. Compared with cardiac myocytes, an important property of the agarose gel

112a Sunday POSTERS 547-551

The intriguing similarities of amino acid sequence, structure, and 547-Pos Board # B409 function between the recently elucidated E. coli glycerol channel SYNTHESIS AND CHARACTERIZATION OF A RYR1- protein (GlpF) and the MIP/AQP family of proteins are correlated SELECTIVE ACTIVATOR through the use of topology maps of known structural and Keshore R Bidasee', Le Xu2, Gerhard Meissner2, Henry R Besch, functional domains. Using amino acid sequence alignment Jr', Karuna Nallani'; 'Indiana University School of Medicine, 635 programs and topology models, we correlate aligned human Barnhill Drive, MS A417, Indianapolis, Indiana 46202-5120, aquaporin sequences (0 through 12) with our laboratory's recently 2University ofNorth Carolina published X-ray crystallographic structure of E. coli GipF. Ryanodine receptor calcium-release channels (RyR) are essential Analysis of the sequence, putative topology, and, structure for releasing calcium ions from internal sarcoplasmic reticulum. highlight significant structure/function correlations within the Three isoforms of RyR have been identified, RyRI (skeletal aquaporin family of proteins. Sequence and structure alignments muscle), RyR2 (cardiac muscle) and RyR3 (predominant in provide important structural and functional insights into this family diaphragm). Few ligands exist that bind to and modulate RyR in of proteins. Our topology models and structure information an isoform-selective manner. The present study describes indicates that the AQP family shares similar overall fold and other synthesis and initial characterization of. a pyrrole-derived molecule tertiary arrangements. Similar helix assignments are having selectivity for RyRi. 2-cyclohexyl-3-cyclohexylimino-2,3- straightforward due to numerous constraints. In addition, highly dihydro-pyrrolo[1,2-c] imidol-1-one was synthesized by reacting conserved key residue identity and locations that are required to pyrrole-2-carboxylic acid with N,N'dicyclohexylcarbodiimide. form and stabilize the characteristic channel architecture are This product which we termed RyRl selective activator (RSA1) identified and validated. was purified and characterized using standard analytical/ physiochemical methods. In binding assays, RSAI enhanced the 550-Pos Board # B412 binding of [3H]ryanodine to RyRI in concentration-dependent ANALYZING THE PORE OF THE RYANODINE manner (250% over control with 50gM) with a smaller effect on RECEPTOR RyR2. The ability of RSA1 to increase [3H]ryanodine was not Georgia Anyatonwul, Edmond D. Buck2, Barbara E. Ehrlich'; dependent on [calcium] and reduced glutathione (2mM) was 'Yale University, 333 Cedar St, New Haven, Connecticut 06520- unable to blunt its effect. While RSA1 increased the Bmax of 8066, 2Warner Instrumnents, Inc [3H]ryanodine, it did not alter the affinity of ryanodine, ryanodol The tetrameric structure of the ryanodine receptor (RyR) suggests and pyridyl ryanodine for RyRI. At the single channel level, that either the four subunits of the receptor combine to form a RSA1 increased the frequency of openings of RyRI in a dose- single conducting pathway or each receptor subunit forms an dependent manner but had little or no effect on RyR2. Supported independently conducting pore. Previously, we showed that by NIH and Showalter Trust. MTSEA+ (a sulfhydryl-reacting agent) covalently modifies the RyR to reduce current amplitudes. Published reports (Tinker and 548-Pos Board # B410 Williams, JGP 102:1107, 1993) have shown that the organic COOPERATIVE BINDING AND EFFECT KINETICS OF cations methylamine and dimethylamine are permeant through the C4, C12-DIKETO PYRIDYL RYANODINE ON CARDIAC RyR, but with reduced amplitude. To determine the number of CALCIUM-RELEASE CHANNEL conducting pores in the RyR, the effect of MTSEA+ on conduction Henry R Besch, Jr', Le Xu2, Gerhard Meissner2, Keshore R of Cs and monovalent organic cations of different sizes were Bidaseel; 'Indiana University School of Medicine, 635 Barnhill examined using a planar lipid bilayer containing cardiac RyR. Drive, MS A401, Indianapolis, Indiana 46202-5120, 2University of Comparison of the degree of inhibition of these currents due to North Carolina MTSEA+ modification allows differentiation between the two Ryanodine triggers multiple functional effects on its binding to models of channel architecture. Experiments using these calcium-release channels (RyR). However, its high intrinsic compounds show that application *of MTSEA+ reduced the affinity has hindered detailed kinetic studies. Ryanoids with lower amplitude of both Cs and organic cation currents. High affinities (faster dissociation kinetics) that are capable of concentrations of MTSEA+ coupled with long exposure times discriminating functional effects could be useful tools to resulted in complete block of the channel to both Cs and organic characterize ryanoids' interaction with RyR. Here we use lipid cation. At intermediate levels of inhibition, currents carried by bilayer technique to characterize the interactions of pryidyl organic cations were inhibited to a larger extent than those of Cs. ryanodine and its modified congener, C4, C12-diketo pryidyl These results support the hypothesis that the RyR forms a single ryanodine on binding to RyR2. When added to the cis chamber, conducting pore. 500nM pyridyl ryanodine increases the open probability (Po) of RyR2 while higher concentrations (1-20tM) induce a reversible 551-Pos Board # B413 sub-conductance state of 32%. Concentrations of C4, C12-diketo REDOX REGULATION OF GOLGI ANION CHANNELS pyridyl ryanodine ranging from 50 to 10OOnM increase channel Po Roger J Thompson, Kathryn E Howell, John H Caldwell; with Ka = 82nM and nH = 1.6. Higher concentrations (1-50IM) University ofColorado Health Sciences Center of C4, C12-diketo pyridyl ryanodine induce two reversible sub- Anion channels of the Golgi complex are thought to maintain conductances, of 52% and of 75% with dissociation kinetics faster charge balance during lumenal acidification. We have recently than its parent. Hill slope greater than 2 was obtained with a ztotal described an anion channel, GOLAC, which is endogenous to the of 0.17, suggesting that C4, C12-diketopyridyl ryanodine activates Golgi complex. Cyclohexamide treated rat liver microsomes and modifies RyR2 by cooperative interactions involving at least enriched for the Golgi complex were incorporated into planar lipid two binding sites. Supported by NIH and Showalter Trust. bilayers to study the regulation of GOLAC by reduced glutathione (GSH) and N-ethylmaleimide (NEM). In symmetrical 150 mM 549-Pos Board # B411 KCI, GOLAC exhibited five open (L1-L5) and one closed (LO) CORRELATION OF PROTEIN SEQUENCE, TOPOLOGY, states, was open -90% of the time and the L3 state was occupied STRUCTURE, AND FUNCTION IN THE HUMAN the most. Addition of 10-20 mM GSH to the trans side of the AQUAPORIN FAMILY OF PROTEINS bilayer increased conductance of L3 from the initial value of 125.2 William E. C. Harries', Peter Nollert2, Robert M. Stroud2; ± 3.8 pS (n=8) to 176.8 ± 12.8 pS (n=3). Similarly, 10-20 mM 'University of California - San Francisco, 513 Parnassus Ave., San GSH added to the cis chamber increased conductance to 165.8 + Francisco, California 94143-0448, 2University of California, San 16.0 pS (n=3). In contrast, NEM (10-20 mM) did not affect Francisco conductance, but increased the mean dwell times of the LO-L2 states, suggesting that GOLAC was inhibited. GSH did not appear

113a 551-556 POSTERS Sunday

to change mean dwell times. These data suggest that GOLAC may To determine if Ca2+ uptake by mitochondria might be involved be regulated by changes in cellular redox status. This work was limitation of propagation of Ca2+ release, we studied mouse supported by NIH grant GM59987. ventricular myocytes after abrupt exposure of one end of myocytes to caffeine(C) with rapid switcher device. Cytosolic Ca2+ ([Ca2+] Intracellular Calcium Signaling: i ) was imaged by fluo-3AM and a Nipkow-type confocal Mitochondrial Contributions microscope. C consistently produced a local Ca2+ release without propagation (n=10). After exposure to 5.0μM Ru360, a 552-Pos Board # B414 mitochondrial Ca2+ uniporter inhibitor, propagation of the Ca2+ RECEPTOR-MEDIATED STIMULATION OF ICRAC: waves induced by C was consistently observed (n=9). Resting ROLE FOR MITOCHONDRIA. [Ca2+]i increased after Ru360 from 100 to 133.7t4.5 nM (n=9, Juan Antonio Gilabert, Anant B. Parekh; University of Oxford, p<0.05) and SR Ca2+ content (peak Ca2+ after whole cell C) Parks Road, Oxford, OXI 3PT United Kingdom increased by 40%. However, elevation of [Ca2+]o from 1.08 to 3.24mM caused a similar increase in resting [Ca2+]i from 100 The most widely distributed and best characterized store-operated to129.5+t3.3nM (n=10, p<0.05) and SR Ca2+ content, but did not Ca2+ current is the Ca2t-release activated Ca2+ current (IcR,Ac), result in Ca2+ wave propagation(n=10). Propagation was also which can be easily monitored using the whole-cell patch-clamp observed in Ru360 after a decrease of [Ca2+]o from 1.08 to technique. Traditionally, IcRAc has been measured using very high 0.54mM in 5 of 8 myocytes, when resting [Ca2+]i did not change concentrations (several mM) of Ca2+ chelators in the recording significantly. These findings show that inhibition of the pipette. Under more physiological conditions of weak buffering, mitochondrial Ca2+ uniporter can cause a slight elevation in InsP3 generally fails to activate any detectable IcRAc, unless either resting [Ca2+]i and enhances propagation of Ca2+. Effects of SERCA pumps are blocked or conditions are designed to support Ru360 on [Ca2+]i propagation do not appear to be solely due to mitochondrial calcium uptake. alterations of resting [Ca2+]i or SR Ca2+ content. We now find that stimulation of muscarinic receptors, which engage the phosphoinositide pathway, with carbachol, generally 555-Pos Board # B417 fails to activate any detectable IcRAc under standard conditions (- MITOCHONDRIAL CA UPTAKE INFLUENCES THE 0.2510.08 pA/pF). However, if a cocktail (malate, pyruvate, PROPERTIES OF CARDIAC CA WAVES NaH2PO4, cAMP and GTP) was included in the pipette to maintain Valeriy I. Lukyanenko, Sandor Gyorke; Texas Tech University functional respiring mitochondria, carbachol evokes a larger IcR'c HSC, 3601 4th St. STOP 6551, Lubbock, Texas 79430-6551 (-0.83h0.21 pA/pF; p<0.05). This potentiating effect of the cocktail Mitochondria are known to take up cytoplasmic Ca via an is less prominent when mitochondrial Ca2' uptake is compromised. electrogenic Ca uniporter and toreleaseitthroughtheNa- Our findings suggest that ability of an agonist to activate IcRAc Caexchanger(mNCX) andthepermeabilitytransitionpore (PTP). The seems to be determined, at least in part, by the functional state of impact of these transport mechanisms on E-C coupling and Ca- mitochondria. induced Ca release from the sarcoplasmic reticulum in cardiac 553-Pos Board # B415 muscle remain largely unknown. We used confocal microscopy to NOVEL ANTI-PROLIFERATIVE STRATEGY: study the effects of mitochondrial Ca cycling on the properties of TARGETING MITOCHONDRIA-DEPENDENT ICRAC spontaneous self-propagating Ca waves in rat ventricular myocytes Ekhson L Holmuhamedov', Lionel Lewis2, Martin loaded with fluo3-AM. A complete inhibition mitochondrial Ca Bienengraeber3, Madina E Holmuhamedova3, Arshad Jahangir 3, transport by the uncouplers rotenone and FCCP increased the Andre Terzic Terzic3; 'Mayo Clinic, Mayo Foundation, 200 First velocity of the Ca waves in longitudinal and transversal directions St SW, Rochester, Minnesota 59005, 2Dartmouth Medical School, by -40% and -60%, respectively, thereby making circular waves 3Mayo Clinic elongated transversally. In addition, the frequency and duration of Ca waves were increased by 70% and 20%, respectively. Selective Mitochondria are central in modulating store-operated Ca2+ influx inhibition of Ca release via mNCX and PTP by CGP-37157 and (ICRAC) in malignant lymphoid cells, a key signaling event in cyclosporin-A had no significant effects on any of the wave cellular proliferation. However, no therapeutic strategy has so far parameters above. We conclude that mitochondria influence both been developed to exploit this pathway. Here, we demonstrate a the spatial and temporal characteristics of cardiac Ca waves by powerful anti-proliferative property of the prototypic sequestering cytosolic Ca and by interfering with the Ca-induced mitochondrial potassium channel opener, diazoxide, in acute Ca release process. leukemic cell lines associated with arrest of cell cycle progression. Diazoxide targeted mitochondrial function leading to increase in 556-Pos Board # B418 oxygen consumption and mitochondrial membrane depolarization, MODULATION OF MITOCHONDRIAL CALCIUM BY which resulted in inhibition of ICRAC aN"mediated Ca2+ influx NITRIC OXIDE IN VASCULAR ENDOTHELIAL CELLS and reduced intracellular Ca2+ levels. In tumor cells lacking Elena N Dedkoval, Lothar A Blatter2; 'Loyola University mitochondrial DNA and a functional respiratory chain, diazoxide Chicago, 2Loyola University Chicago, Dept. Physiology, 2160 S. was unable to modulate ICRAC§e'mediated Ca2+ influx and was First Ave., Maywood, Illinois 60153 deprived of its anti-proliferative property. Thus, our data indicate We have investigated the role of nitric oxide (NO) in the regulation that modulation of the permeability of the inner mitochondrial of mitochondrial Ca2+ concentration ([Ca21m) in single membrane with a potassium channel opener regulates intracellular permeabilized vascular endothelial (CPAE) cells. [Ca2+l was Ca2+ homeostasis through an ICRAC-dependent pathway, and measured by loading the cells with Ca2+ indicator fluo-3/AM and may serve as a novel anti-tumor strategy. subsequent removal of cytosolic fluo-3 by plasma membrane 554-Pos Board # B416 permeabilization with digitonin. Addition of 2 ,uM Ca2+ to the DOES THE MITOCHONDRIAL Ca2+ UNIPORTER intracellular solution induced a profound increase in fluo-3 CONTRIBUTE TO LOCAL CONTROL OF Ca2+ fluorescence due to mitochondrial Ca2+uptake which was sensitive RELEASE? to ruthenium red and FCCP. Application of the NO donor Hidetaka Seguchil, Michael Ritter', Fenghua Li', Hideyuki spernine NONOate (SNO) resulted in dose-dependent inhibition Ishida2, Noboru Aosaki3, William H Barry'; 'University of Utah, of mitochondrial Ca2+ uptake. Inhibition of nitric oxide synthase 657 Wintrobe Building, 50 N. Medical Drive, Salt Lake City, Utah with L-NIO (10 jiM) resulted in a significant decrease of [Ca2l,,1n 84132, 2Tokai Univ, Japan, 3Ntl Kasumigaura Hosp, Japan suggesting that endogenous NO production facilitated Ca2+ uptake by mitochondria. The inhibitory effect of SNO on Ca2+ uptake correlated with mitochondrial membrane depolarization as

114a Sunday POSTERS 556-561 measured with the potential-sensitive dye TMRE. SNO produced a 559-Pos Board # B421 rapid and reversible dose-dependent depolarization. These results JUNCTATE INTERACTS WITH THE InsP3R AND reveal that NO has a dual effect on [Ca2lm: endogenous NO MODULATES Ca2+ ENTRY activated Ca2+ uptake by the mitochondria, while higher NO Luca Moccagattal, Susan Treves2, Michel Ronjat3, Katsuhiko concentrations induced mitochondrial membrane depolarization Mikoshiba4, Xi Zhu5, Francesco Zorzatol; 'University of Ferara, and a decrease of [Ca2l]m, presumably by reducing the driving Italy, Kantonsspital Basel, Switzerland, 3CNRS Grenoble, France, force for Ca2+ entry into the mitochondria. 4University ofTokyo, Japan, 5Ohio State University 557-Pos Board # B419 Junctate is a novel integral Ca2+-binding protein of MODELING MITOCHONDRIAL Ca2+ DYNAMICS AND sarco(endo)plasmic reticulum membranes which may be involved ENERGY METABOLISM in Ca2+ storage and/or release from the ER of a variety of tissues. Sonia Cortassa, Miguel A. Aon, Raimond L Winslow, Eduardo In order to study the role of junctate in vivo, we made several Marban, Brian O'Rourke; Johns Hopkins University, School of cDNA constucts tagged with the green fluorescent protein and Medicine, 720 Rutland Ave, Ross Bldg 844, Baltimore, Maryland expressed the recombinant protein in COS-7 cells. Expression of 21205 junctate caused a significant increase in the total amount of calcium released by ATP, an agonist which releases Ca2+ via We developed a model that incorporates the tricarboxylic acid InsP3 formation. This increase was paralleled by an enhancement (TCA) cycle, oxidative phosphorylation, and mitochondrial matrix of calcium entry via a channel blocked by lanthanum. Expression Ca2+ dynamics. NADH and FADH2 production by the TCA cycle of the lumenal calcium-binding domain of junctate did not is coupled to the respiratory chain to establish a protonmotive force influence either ATP-induced calcium release or calcium entry. (A.m + ApH), which drives ATP synthesis by the FlF0-ATPase. However, we observed stimulated calcium entry to an extent The model also includes the influence of other membrane transport similar to that observed with the full lengthjunctate protein processes such as the proton leak, the Ca2+ uniporter and though the expression of the cytoplasmic domain of junctate had Na+/Ca2+ exchange. The Ca2+-dependence of TCA cycle flux is no effect on ATP-induced calcium release. Pull-down experiments explicitly described in the equations for isocitrate dehydrogenase unambigously demonstrate that the cytoplasmic domain ofjunctate and a-ketoglutarate dehydrogenase. The mathematical model interacts with the InsP3R. The later experiments are consistent consists of twelve ordinary differential equations, representing with immunocytochemistry data which indicated that in COS-7 AT.m and the matrix concentrations of Ca2+, NADH, ADP, and cells junctate co-localises with the InsP3R. Altogether these results TCA cycle intermediates. suggest that junctate modulates Ca2+ entry via an interaction with We simulated the effect on respiration rate by uncouplers and the InsP3R. respiratory inhibitors, substrate delivery, and rate of adenine nucleotide exchange. Under these conditions, the relationship Transcription between AT and respiration rate as a function of the mitochondrial energetic status, i.e. state 3 or 4, was analyzed. The model 560-Pos Board # B422 accurately reproduces, qualitatively and semi-quantitatively, PROMOTER MELTING BY RNA POLYMERASE: reported experimental data concerning the function of DETECTION AND ANALYSIS BY SINGLE-MOLECULE mitochondria on the basis ofwell known bioenergetic principles. DNA NANOMANIPULATION Andrey G Revyaldn', Terence R Strick2, Richard H Ebright; 558-Pos Board # B420 'Rutgers University, 191 Frelinghuysen Rd, Piscataway, New MODELING Ca2+ SIGNALING IN MITOCHONDRIA: Ca2+ Jersey 08854, Cold Spring Harbor Laboratory, 3Howard Hughes AS A MEDIATOR OF MATCHING BETWEEN ENERGY Medical Instititue SUPPLY AND DEMAND Sonia Cortassa, Miguel A. Aon, Raimond L Winslow, Eduardo We have adapted the single-molecule DNA nanomanipulation Marban, Brian O'Rourke; Johns Hopkins University, School of procedure of Strick and co-workers (Nature 404:901, 2000) to Medicine, 720 Rutland Ave, Ross Bldg 844, Baltimore, Maryland permit analysis of promoter melting by Escherichia coli RNA 21205 polymerase. By monitoring the overall extension of a mechanically stretched, negatively supercoiled, single DNA A model of mitochondrial energetics that takes into account TCA molecule containing a single promoter, we have been able to cycle, oxidative phosphorylation and calcium dynamics was directly observe the relaxation of -1 negative supercoil associated analyzed for steady state and transient behavior of Ca2+ dynamics. with melting of -10 bp of promoter DNA upon formation of the The response of mitochondrial matrix Ca2+ (Ca2+m) to steady or RNA polymerase-promoter open complex. The assay enables us transient changes in cytoplasmic Ca2+ (Ca2+i), which would occur to define--at the single-molecule level, and in real time-the extent during adaptation to normal myocardial work were simulated. In of melting, the kinetics of melting, and the lifetime and dynamics response to increasing Ca2+, levels and a consequent rise in Ca2+m, of the melted state. In addition, the assay enables us to define the rate of oxygen consumption (Vo2), NADH levels, and effects of promoter sequence, temperature, salt, nucleotides, and mitochondrial ATP synthase activity were increased when Ca2+- transcriptional activators. Straightforward extensions of the assay sensitive a-ketoglutarate dehydrogenase exerted 45% or 73% should enable analysis of ATP-dependent promoter melting by control of respiration. When either isocitrate dehydrogenase or eukaryotic RNA polymerase II. malate dehydrogenase were the most rate-controlling enzymes of respiration, respiratory flux was not stimulated and ATP synthesis 561-Pos Board # B423 was inhibited rather than stimulated by an increase in Ca2+i. STRUCTURAL TRANSITIONS IN TRANSCRIPTION: When mitochondria were challenged with 500 ms pulses of Ca2+1, FLUORESCENCE RESONANCE ENERGY TRANSFER Ca2+m responded as an integrator of Ca2i, whose final steady state ASSAY FOR MOVEMENT OF A MOLECULE RELATIVE level reflected the frequency component of the signal. Evolution of TO DNA Ca2 m toward steady state depended on the rate constants of the Jayanta Mukhopadhyayl, Achillefs N. Kapanidis2, Vladimir Ca2+ uniporter and the Nae/Ca2+ antiporter. The results are Meklerl, Ekaterine Kortkhonjial, Olivier Leroy', Yon W. Ebright', discussed in terms of how mitochondrial Ca2+ signaling mediates Shimon Weiss2, Richard H. Ebright'; 'Howard Hughes Medical the matching between energy supply and demand. Institute, Waksman Institute, and Department of Chemistry, Rutgers University, Piscataway, New Jersey 08854, 2Lawrence Berkeley National Laboratory, Berkeley, CA 94720

115a 561-565 POSTERS Sunday

We have developed a fluorescence resonance energy transfer polymerase holoenzyme and in the context of the RNA (FRET) method to monitor movement of a molecule relative to polymerase-promoter open complex. DNA. The method involves two complementary sets of The results permit construction of detailed models for the experiments: (i) "trailing-edge-FRET" experiments, which monitor structural organization of RNA polymerase holoenzyme and the movement of a fluorescently labelled molecule relative to a RNA polymerase-promoter open complex, and define differences fluorescent probe at the upstream end of DNA; and (ii) "leading- in the core-o7 interface in RNA polymerase holoenzyme and the edge-FRET" experiments, which monitor movement of a RNA polymerase_romoter open complex (substantial difference in fluorescently labelled molecule relative to a fluorescent probe at the position of a region 1.1; minimal or no differences in the the downstream end ofDNA. positions of °70 regions 1.2, 2, 3, and 4). We have been able to adapt this method to permit ensemble, ensemble kinetic, and single-molecule kinetic analysis of 564-Pos Board # B426 translocation by RNA polymerase. STRUCTURAL ORGANIZATION OF THE RNA In current work, we are using this method to address the following POLYMERASE-PROMOTER OPEN COMPLEX: issues relevant to translocation by RNA polymerase: INTERACTIONS BETWEEN RNA POLYMERASE a (i) Determination of the point at which RNA polymerase breaks SUBUNIT AND UPSTREAM DNA its interactions with promoter DNA in promoter escape. Nikolai A. Naryshldn', Sergei Druzhinin2, Claudio Rivetti3, (ii) Determination of the point at which RNA polymerase breaks Richard H. Ebright'; 'HHMI-Rutgers University, 190 its interactions with initiation factors in promoter escape. Frelinghuysen Rd, Piscataway, New Jersey 08854, 2Rutgers (iii) Determination of the point at which RNA polymerase breaks University, 3Istituto di Scienze Biochimiche, Italy its interactions with activators in promoter escape. RNA polymerase holoenzyme (RNAP) has subunit composition (iv) Analysis of effects of NTPs on the translocational state of 'PaIuIIloa. Each a subunit consists of an N-terminal domain RNA polymerase. responsible for interaction with the remainder of RNAP (aNTD), a (v) Analysis of effects of pausing signals on the translocational C-terminal domain responsible for protein-DNA interactions with state ofRNA polymerase. upstream promoter DNA and protein-protein interactions with (vi) Analysis of effects of termination signals on the transcriptional regulators (aCTD), and an interdomain linker. In translocational state ofRNA polymerase published work, we have shown that, in the RNAP-promoter DNA open complex in the absence of specific upstream DNA sequences 562-Pos Board # B424 or transcriptional regulators, aCTD makes alternative nonspecific STRUCTURAL ORGANIZATION OF THE RNA interactions with the first six DNA minor grooves upstream of the POLYMERASE-PROMOTER OPEN COMPLEX AND THE core promoter (the minor grooves centered at positions -43, -53, - RNA POLYMERASE-DNA ELONGATION COMPLEX:RNA 63, -73, -83, and -93 relative to the transcription start site). POLYMERASE-DNA FLUORESCENCE RESONANCE Here, using site-specific protein-DNA photocrosslinking, ENERGY TRANSFER chemoselective protein cleavage, and atomic force microscopy, we Ekaterine Kortkhonjia', Jayanta Mukhoapadhyay2, Achillefs N. define: Kapanidis3, Vladimir Meklerl, Andrey G Revyakin', Yon W. (i) the roles of the two a subunits of RNAP-al and aIl-in Ebright4, Richard H. Ebright4; 'Rutgers University, 190 aCTD-DNA interactions; Frelinghuysen Rd., Piscataway, New Jersey 08873, 2Waksman (ii) the role of the aNTD-CTD linker in permitting aCTD-DNA Institute/ HHMI, 190 Frelinghuysen Rd, Piscataway, New Jersey interactions; 08854, 3Lawrence Berkeley National Laboratory, Berkeley, CA (iii) the orientation of aCTD relative to DNA in aCTD-DNA 94720, 4Howard Hughes Medical Institute, Waksman Institute, and interactions; Departnent ofChemistry (iv) the effects of a transcriptional activator on aCTD-DNA We are using fluorescence resonance energy transfer (FRET) to interactions; and measure, systematically, distances between each of 25 sites within (v) the contributions of aCTD-DNA interactions to wrapping of RNA polymerase (RNAP) and each of 4 sites within DNA in the DNA around RNAP. RNAP-promoter open complex and in the RNAP-DNA elongation complex. The results permit construction of models for the 565-Pos Board # B427 structural organization of the RNAP-promoter open complex and BINDING-FREE-ENERGY CONTRIBUTIONS OF the RNAP-DNA elongation complex, and provide baseline data for INDIVIDUAL RNAP-RNA INTERACTIONS IN THE "trailing-edge-FRET" and "leading-edge-FRET" experiments TRANSCRIPTION ELONGATION COMPLEX assessing RNAP translocation in promoter escape, elongation, Amal Kumar Bandyopadhyay', Richard H. Ebright2; 'Howard pausing, arrest, and ternination. Hughes Medical Institute, Waksman Institute, and Department of Chemistry, Rutgers University, 190 Frelinghuysen Road, 563-Pos Board # B425 Piscataway, New Jersey 08854, 2Howard Hughes Medical STRUCTURAL ORGANIZATION OF RNA POLYMERASE Institute, Waksman Institute, and Department of Chemistry, HALOENZYME AND THE RNA POLYMERASE- Rutgers University PROMOTER OPEN COMPLEX: COREa7O We are performing equilibrium binding experiments, using the FLUORESCENCE RESONANCE ENERGY TRANSFER methods of von Hippel and co-workers (J. Mol. BioL, 289: 1179, Vladimir Mekler, Ekaterine Kortkhornjia, Jayanta 1999), to quantify, systematically: (i) the incremental binding-free- Mukhopadhyay, Andrei Revyakin, Yon W. Ebright, Richard H. energy contribution of each RNA nucleotide in the RNA exit Ebright; Howard Hughes Medical Institute, Waksman Institute, channel of RNAP in the transcriptional elongation complex (i.e., and Department of Chemistry, Rutgers University, 190 nucleotides -10 through -14 [where the nucleotide at the RNA 3' Frelinghuysen Road, Piscataway, New Jersey 08854 end is defined as -1) (ii) the incremental binding-freeenergy We are using fluorescence resonance energy transfer (FRET) to contribution of each RNA nucleotide distal to the RNA exit measure, systematically, distances between each of five sites channel of RNAP in the transcription elongation complex (i.e. within RNA polymerase core enzyme (3' residue 1377, P residue nucleotides -15 through -39). (iii) the incremental binding-free- 224, P residue 643, P residue 937, and an residue 235) and each of energy contribution of each RNA nucleotide in the secondary twenty sites within d°0 (a70 residues 14, 59, 132, 211, 241, 312, channel of RNAP in the reverse translocated ("back-tracked") 329, 366, 376, 396, 440, 442, 459, 496, 517, 560, 569, 578, 583, transcription elongation complex (i.e., nucleotides at the first and 596). We are measuring distances both in the context of RNA through fifth positions within the secondary channel of RNAP). We are performing experiments, in parallel, with bacterial RNAP

116a Sunday POSTERS 565-571

(Escherichia coli) and with eukaryotic RNAP II (Saccharomyces abortive transcripts. The site specific placement of fluorescent cerevisiae). The result provide essential parameters for the nucleotide analogs has allowed us to map the size and extent of the computational modeling of the energetics and kinetics of transcription bubble as the enzyme translocates within and beyond transcriptional elongation, pausing, arrest, and termination. this initial region. The results strongly support a model in which upstream DNA "scrunches" as the enzyme translocates 8 566-Pos Board # B428 nucleotides forward. Beyond this point, the initially melted bubble IDENTIFICATION OF PROTEIN INTERACTION collapses, and presumably, promoter contacts are lost. With respect SURFACES IN IRF4/PU.1 BY MUTAGENESIS AND to the latter, experiments are in progress to determine whether the BIOPHYSICAL TECHNIQUES. loss of these upstream duplex contacts is necessary for progression Nuria E Assa-Munt, Scott McKercher, Christian R. Lombardo, to a stably elongating complex. Finally, we have developed a novel Xin Jia; The Burnham Institute, 10901 North Torrey Pines Road, fluorescence approach to map the length of the RNA/DNA La Jolla, California 92037 heteroduplex during the transition from abortive cycling to a more PU. I and IRF4 are hematopoietic-specific transcription factors that stable elongation complex. The 5' end of the RNA is first regulate processes in myeloid and B cell maturation. The DNA displaced from the heteroduplex after the initial bubble collapses, binding sites are adjacent to each other. Binding of PU. 1 at about 11 nucleotides from the start site. The implications of phosphorylated on serine 148 is essential for the recruitment and these results will be discussed. subsequent DNA binding of IRF4. Data from experiments where both proteins were truncated to only their DNA-binding domains 569-Pos Board # B431 (eliminating PU.I S148) show that IRF4 still shows cooperative STOCHASTICITY IN GENE EXPRESSION binding to PU.1, suggesting that other protein-protein interactions Jason R. Pirone, Timothy C. Elston; North Carolina State are important for the binding process. University, Campus Box 8203, Raleigh, North Carolina 27695 A cluster of 29 N-terminal residues in the PU.I DBD exhibited Genetic regulation occurs through the action of complex networks increased residue-specific chemical exchange values. These values of interacting proteins. Elements of these networks converge upon were calculated from 1 SN spin relaxation data for free PU. 1 regulatory sites on the organism's DNA, resulting in changes in binding domain protein in solution. These residues may constitute transcription rates of specific genes. The reacting species are a previously unreported surface of the protein involved in protein- often present at extremely low concentrations. Consequently, protein interactions. This region of the domain was not involved in transcriptional regulation is subject to considerable stochasticity. DNA binding in the crystal structure. Mutagenesis, EMSA, surface Stochasticity arises from intrinsic fluctuations in the reactions plasmon resonance and fluorescence quenching methods have governing the synthesis and degradation of protein and RNA shown that a specific amino acid residue on this surface of PU.1 components, as well as from random transitions between the provides a stabilizing effect on the PU.1/DNA binary complex and chemical states of the operators that control the transcription rate. probably interacts with IRF4 in the process of ternary complex Here, we present mathematical models that consider the sources formation. and implications of fluctuations in transcriptional regulation. These models are compared against experimental results from 567-Pos Board # B429 engineered gene networks. STRUCTURAL STUDY OF SP1 TRANSCRIPTION ACTIVATION MECHANISM Transladon Patricia Meurer-Grob', Andreas G. Ladumerl, Carla Inouye', Robert Tjian', Eva Nogales2; 'HHMI, UC Berkeley, LSA #355, 570-Pos Board # B432 Berkeley, California 94720-3200, 2HHMI, UC Berkeley, Berkeley, DISCRIMINATION BETWEEN COGNATE AND NEAR- California 94720-3200 COGNATE CODON-ANTICODON PAIRS INVOLVING The general factor TFIID is an essential element of the eukaryotic tRNA-Phe BY THE RIBOSOME gene transcription initiation machinery. It binds to specific sites Kevin Y. Sanbonmatsul, Simpson Joseph2; 'Los Alamos National upstream of the gene and recruits other TFs. The proper expression Lab, MS K710, Los Alamos, New Mexico 87545, 2University of of eukaryotic genes is controlled by other sequence specific DNA- California San Diego binding proteins. The transcription factor Spl, general activator of The mechanism by which the ribosome discriminates between housekeeping genes controlled by TFIID, recognizes GC-rich cognate and near-cognate codon-anticodon pairs involving tRNA- regulatory sites. Its mechanism of activation is yet unknown. Phe was investigated by examining the stability of codon- Probably cooperative, it involves transient interactions between anticodon pairs in the decoding site of the ribosome. All-atom several Spl and TFIID bound to DNA. Spl is generally believed to explicit solvent molecular dynamics simulations were performed be a proximal factor, but can also interact with distal elements for cognate and several near-cognate codon-anticodon pairs which downstream of the expressed gene. The 3D structure of the have been shown to survive the GTP hydrolysis proofreading step complex formed by purified human TFIID and Spl bound to in biochemical and kinetic experiments. All near-cognate cases different DNA sequences in vitro should allow us to address this studied show a net loss of hydrogen bonds involving rRNA relative question. We propose to compute 3D reconstructions of these to the cognate case. The ribosomal pair G530-A1492 forms for complexes from cryo-electron microscopy images, in close to cognate cases but does not form for the near-cognate cases which native conditions. To that effect we will have to set-up different have more stable codon-anticodon base pairs. The 16S ribosomal techniques such as gold-labeled DNA probes and/or statistical RNA base A1493 and mRNA kink between A- and P-site classification methods to select identical complexes suited for destabilize the less stable codon-anticodon pairs. The simulations structural studies. The resulting 3D map will then be compared to are consistent with three-step proofreading: (1) GTP hydrolysis, the known structure of human TFIID to identify Spl binding sites (2) A1493 and mRNA kink stability test, and (3) G530-A1492 and possible conformational change of TFIID that would minor groove test. participate in the activation mechanism. 571-Pos Board # B433 568-Pos Board # B430 AN ALL-ATOM HOMOLOGY MODEL OF THE PROMOTER ESCAPE BY T7 RNA POLYMERASE ESCHERICHIA COLI 30S RIBOSOMAL SUBUNIT Cuihua Liu, Edward A. Esposito, Craig T Martin; University of Chang-Shung Tung', Kevin Sanbonmatsu2, Simpson Joseph3; Massachusetts, 710 N Pleasant St., Amherst, Massachusetts 01003 'Los Alamos National Laboratory, T-10, MS K710, Los Alamos, After the initiation of transcription, RNA polymerases appear to New Mexico 87544, 2LANL, MS K710, Los Alamos, New Mexico retain promoter contacts while reiteratively transcribing short, 87545, 3University ofCalifornia, San Diego

117a 571-576 POSTERS Sunday

Ribosome is the molecular entity that translates genetic codes into domain-ssDNA complex is strongly affected by Mge2. In the proteins. Its detailed structure is the information necessary for absence of Mge2, the domain occludes 13 4 0.7 nucleotides, while understanding the translational step of the protein biosynthesis. in the presence of Mge2 it decreases to 9 i 0.6 nucleotides. The The solving of the Thermus thermophilus 30S ribosomal subunit site-size decrease results from the Mge2 binding to the domain. The crystal structure(IFJF in PDB) makes it possible to predict site-size of the isolated domain - ssDNA complex is larger than structures of 30S ribosomal subunits from other organisms. Here, the 5 ± 2 site-size of the (pol s)5 binding mode formed by the we describe the modeling of the Escherichia coli 30S ribosomal intact enzyme, indicating that only the intact enzyme has the subunit using a homology modeling approach. The template (T. ability to use only part ofthe domain DNA-binding site to bind the thermophilus) and the target (E. coli) 16S RNAs are highly DNA. Salt effect on the intrinsic interactions of the domain with homologous with a 76% sequence identity. We have developed a the ssDNA indicates that the domain forms as many as 7 ionic homology modeling algorithm utilizing a motif modeling protocol contacts with the ssDNA. The data indicate a continuous structure for predicting the Escherichia coli 16S RNA structure. The of the DNA-binding site, with contacts between the protein and the sequences of the target and the template ribosomal proteins (S2 to DNA evenly distributed over the entire site that shows little base S20) are having sequence identities range from 30% to 75%. These specificity. The domain has an intrinsic affinity and site-size with ribosomal protein structures were also constructed using a the dsDNA conformation, similar to the ssDNA. homology modeling approach. The resulting structure of the Escherichia coli 30S ribosomal subunit is subjected to energy 575-Pos Board # B437 minimization using AMBER. The energy minimized model RECOGNITION OF TEMPLATE-PRIMER AND GAPPED structure compared favorably with experimental observations (e.g., DNA BY MAMMALIAN DNA POLYMERASE P A-site NMR structure, cryo-EM structure). Wlodek M. Bujalowsid, Surendran Rajendran, Maria M. Jezewska; University Texas Medical Branch, 301 University Blvd, 572-Pos Board # B434 Galveston, Texas 77555-1053 LINEAR AND NONLINEAR STATISTICAL Interactions between mammalian polymerases 13 and the template- CHARACTERIZATION OF DNA primer, and gapped DNAs, have been studied using the Nestor Norio Oiwal, Carla Goldman', James A Glazier2; 'Instituto quantitative fluorescence titration technique. Stoichiometries of de Fisica/Universidade de Sao Paulo, Caixa Postal 66318, Sao pol 1 complexes with template-primer DNA are much higher than Paulo, 05315-970 Brazil, 2University ofNotre Dame predicted on the bases of co-crystals with DNA. The data can be We find spatial order in the distribution of protein-coding understood in the context of two binding modes which the enzyme (including RNAs) and control segments of GenBank genomic uses to bind the ssDNA, the (pol 13) 16, and (pol 1) 5 binding modes, sequences, irrespective of ATCG content. This is achieved by that differ by the number of occluded nucleotides. The statistical correlations, histograms, fractal dimensions and singularity thermodynamic model is formulated to extract all interaction and spectra. Estimates of these quantities in complete nuclear genome spectroscopic parameters. The 8-kDa domain of the enzyme binds indicate that coding sequences are long-range correlated and their the dsDNA down-stream from the primer, while the 31-kDa disposition are self-similar (multifractal) for eukaryotes. These domain has similar affinity for the ss-dsDNA junction and the characteristics are absent in prokaryotes, where there are few dsDNA. The affinity and stoichiometry of pol P binding to the noncoding sequences, suggesting the 'junk' DNA play a relevant gapped DNA is not affected by the decreasing size ofthe gap. The role to the genome structure and function. Conceming the genetic results indicate a plausible model for recognition of the gapped message of ATCG sequences, we build a random walk (Levy DNA by pol P that explains a large amplification of the affinity for flight), using DNA symmetry arguments, where we associate A, T, the gap. The 5' terminal phosphate, down-stream from the primer, C and G as left, right, down and up steps, respectively. Nonlinear has moderate effect on the affinity, but significantly affects the analysis of mitochondrial DNA walks reveal multifractal pattern ssDNA conformation ofthe gap. based on palindromic sequences, which fold in hairpins and loops. 576-Pos Board # B438 573-Pos Board # B435 MULTIPLE-STEP KINETIC MECHANISMS OF THE IDENTIFICATION OF TRNA-RIBOSOME CONTACTS ssDNA RECOGNITION PROCESS BY MAMMALIAN 1 DURING ELONGATION CYCLE POLYMERASES IN DIFFERENT ssDNA BINDING MODES Ozlem A Tastan, Sebastian Patzke, Knud H Nierhaus; Max- Surendran Rajendran, Maria J. Jezewska, Roberto Galletto, Planck, Ihnestr 73, Berlin, D-14197 Germany Wlodek M. Bujalowski; University of Texas Medical Branch, 301 The recent elucidation of the structure of the ribosome at atomic University Blvd, Galveston, Texas 77555-1053 resolution signifies a milestone in translation research and opens The kinetics of mammalian polymerase ,B binding to the ssDNA the way to the analysig of the functional steps of at the atomic has been examined, using the fluorescence stopped-flow technique. level. Here, we apply the phosphorothioate technique to identify The experiments were performed with the 20-mer ssDNA, which tRNA-ribosome contacts thought to be responsible for binding of engages the polymerase in the (pol 1)16 binding mode and tRNA to the P site. Comparison with the 70S structure allows us to encompasses the total DNA-binding site of the enzyme, and the deduce which ribosomal components interactions with protected I 0-mer, which exclusively forms the (pol ,B)s binding mode, phosphates in the P-site tRNA. Furthermore, we have used this engaging only the 8-kDa domain of the enzyme. The data indicate technique in structural-functional analysis of ribosomes arrested in that for rat pol 1, the (pol 13)16 formation occurs by a minimum defined states ofthe elongation cycle. three-step, sequential mechanism: kl k2 k3 Replication & Recombination Pol 3 + ssDNA *4 (P6- ssDNA)1 -*(P16 -ssDNA)2 *-*(P16 -ssDNA)3 k-I k-2 1L3 574-Pos Board # B436 For human pol 1, the binding mechanism includes an additional INTERACTIONS OF THE 8-kDa DOMAIN OF DNA slow step. Although the formation of the (pol P)s binding mode POLYMERASE 0 WITH DNA proceeds with the same mechanism as the corresponding (pol 1)16 Maria J. Jezewska, Surendran Rajendran, Wlodek M. binding mode, the modes differ in the energetics of partial Bujalowski; University Texas Medical Branch, 301 University reactions and in the structure of intermediates. The (pol 1)16 Blvd, Galveston, Texas 77555-1053 binding mode formation is initiated by the association of the 8-kDa Interactions between the isolated 8-kDa domain of DNA domain with the DNA, followed by subsequent transitions, polymerase P and DNA have been studied, using the quantitative stabilized by the 31-kDa domain binding. First order transitions of fluorescence titration technique. The site-size of the 8-kDa the enzyme-DNA complex in both modes are induced at the

118a Sunday POSTERS 576-581 interface of the 8-kDa domain and the DNA. The sequential nature recombination pathway, the RecQ helicase does not facilitate the of the mechanism indicates the lack of a conformational pre- binding of RecA protein to SSB-coated ssDNA. In this pathway, equilibrium ofthe enzyme, prior to ssDNA binding. the RecF, 0 and R proteins (RecFOR) are needed for RecA binding to SSB-coated ssDNA. 577-Pos Board # B439 We investigated the binding of RecA protein to SSB-coated DYNAMIC INTERACTIONS OF THE E.COLI RecA ssDNA in the presence of RecFOR by following the ATPase NUCLEOPROTEIN FILAMENT WITH DOUBLE- activity of RecA protein. An efficient stabilisation of the RecA- STRANDED DNA: RAPID DNA CONFORMATIONAL ssDNA complex was observed when RecF, 0 and R proteins were CHANGES ACCOMPANY HOMOLOGY TESTING included in the reaction, suggesting an involvement ofthe RecFOR Jie Xiao, Scott F Singleton; Rice University, 6100 S.Main, proteins in the RecA-loading reaction. Houston, Texas 77005 RecA protein also has an intrinsic binding activity to naked The RecA protein mediates DNA strand exchange between single- ssDNA and dsDNA. If the dsDNA is stained by a fluorescence stranded and homologous double-stranded DNA molecules in dye, such as DAPI, the binding of the RecA protein to the dsDNA vitro, a reaction that serves as a model for the protein's role in can be monitored. We are now using this property of RecA protein homologous recombination. In this study, RecA-mediated DNA to study its DNA binding using a single molecule detection (SMD) strand exchange was monitored using both steady- and transient- system. The results of SMD experiments for the DNA-binding state spectrofluorimetry. Steady-state measurements of dynamics of RecA protein with and without RecFOR proteins will interfluorophore distances using fluorescence resonance energy be shown and discussed. transfer (FRET) revealed the helical structures of the three DNA strands in a post-exchange intermediate. Furthermore, changes in 580-Pos Board # B442 the intrinsic fluorescence of a base analog incorporated in each one VISUALIZATION OF RecA FILAMENT UNDER AN of the three DNA strands confirmed the structural conclusions. A OPTICAL MICROSCOPE presteady-state kinetic analysis of time-dependent changes of total Taro Nishinaka; Japan Science and Technology Corporation, and polarized emission from the fluorophore demonstrated at least Teikyo Univ Biotech Res Cent 3F, 907 Nogawa, Miyamae-ku, three mechanistic phases. DNA sequence identity was tested Kawasaki, 216-0001 Japan during the fastest phase, which likely also represents the RecA protein plays an important role in homologous biomolecular association step. In addition, presteady-state global recombination and DNA repair in Escherichia coli. RecA protein conformational changes were inferred from time-dependent polymerizes along single-stranded DNA in the presence of ATP, relative changes of interfluorophore distances. Based on these forming helical nucleoprotein filament. Next, homologous duplex data, a structural and mechanistic model for RecA-mediated strand DNA is aligned with single-strand DNA within the filament, and pairing was constructed. the RecA filament exchanges homologous DNA strands between duplex DNA and single-stranded DNA. In order to investigate the 578-Pos Board # B440 mechanism of the RecA-catalyzed reactions by single molecular THE MECHANISTIC STRATEGY FOR HOMOLOGOUS measurements, immobilization of the RecA filament on the glass DNA STRAND EXCHANGE BY THE E. COLI RECA surface is necessary. We attached linear single-stranded Ml 3 PROTEIN: INFLUENCE OF HOMOLOGY DISRUPTION phage DNA on the glass slip, and infused reaction buffer ON THE KINETICS OF SEQUENCE-SPECIFIC DNA containing RecA protein into a flow chamber. The RecA filament PAIRING was stained by RecA antibody and fluorescence-labeled antibody. Andrew M. Lee, Scott F. Singleton; Rice University About 3 micron length of RecA filament was observed. The length The RecA protein of E. coli directs strand exchange between of the filament was gradually shortened after washing by reaction single-stranded (ssDNA) and homologous double-stranded DNA buffer without RecA protein, indicating that the RecA filament (dsDNA) molecules that serves as a model for the in vivo process disassembled from one end. of recombinational repair. Oligonucleotides containing a fluorescent nucleoside analog were used to report on the short- 581-Pos Board # B443 range interactions and local environment of the DNA during the RecA FORCE GENERATION OF HYDROLYSIS WAVES strand exchange process. Previous work using this system showed Kevin D. Klapstein', Robijn Bruinsma2; 'UCLA Department of at least three distinct events for strand exchange, the first of which Biomathematics, P. 0. Box 951766, Los Angeles, California appeared to be homology dependent. Base substitutions, insertion, 90095-1766, 2UCLA Department ofPhysics and deletions were incorporated into ODNs to probe the effects of The E. coli. protein RecA and its homologs in other species play a such DNA alterations on the rates of homology searching and key role both in DNA repair and in the exchange of genetic pairing by the RecA protein. The data obtained from studies using material through their ability to promote DNA strand exchange. these dsDNA alterations suggests that the RecA protein detects This strand exchange activity requires an ability to generate a secondary structure abnormalities in the dsDNA in addition to rotary torque on DNA strands. Even though RecA protein has testing homology to the ssDNA strand. Furthermore, RecA can been extensively investigated, the mechanism by which RecA accommodate altered conformations of the ssDNA bound within generates torque is poorly understood. We present a simple theory the nucleoprotein filament in order to facilitate the strand pairing of the dynamics of force generation by RecA during homologous process. Both these events occur within the fastest phase of strand strand exchange and a continuous, detenniistic mathematical exchange, as the remaining phases are not impacted by any change model of the proposed process. Calculations show that force to the dsDNA within this system. generation is possible in this model for certain reasonable values of the parameters. We predict the shape of the force-velocity curve 579-Pos Board # B441 for the Holliday junction, which exhibits a distinctive kink at large INTRINSIC AND RECFOR-FACILITATED BINDING OF retarding force, and suggest experiments which should distinguish RECA PROTEIN TO DNA between the proposed model and other models in the literature. Katsumi Morimatsu, Stephen C. Kowalczykowski; Section of Microbiology, University ofCalifornia, Davis, California 95616 The initial step of homologous DNA recombination in E. coli includes the formation of a RecA-ssDNA complex. In the RecBCD-recombination pathway, the RecBCD helicase allows RecA protein to bind to SSB-coated ssDNA whereas RecA alone cannot efficiently bind. On the other hand, in the RecF-

119a 582-586 POSTERS Sunday

primed DNA and loads the accessory sliding clamp (PCNA), 582-Pos Board # B444 which in turn provides processivity for the replicative DNA INVESTIGATING STRUCTURAL CHANGES INDUCED polymerases. Interestingly, sequences of all five RFC subunits BY NUCLEOTIDE BINDING TO RecA: AN INFRARED have a detectable similarity to each other. Thus we produced 3D STUDY models for all subunits using recently determined structures for the Gina MacDonald, Penny M Drown, Catherine M. Schwartz, Ian subunits from corresponding clamp loading complexes in archeal M Firkin, Gina Owusu-Asiedu; James Madison University, Miller and prokaryotic organisms. The quaternary structure of the Hall, MSC 7701, Harrisonburg, Virginia 22807 pentameric RFC complex was modeled by analogy to the E. coli The Escherichia coli protein RecA is a nucleotide binding clamp loading complex ('y-complex). Constraints derived from protein that catalyzes the DNA strand exchange reaction essential available structural, biochemical and genetic data verify the for homologous genetic recombination and DNA repair. RecA is a feasibility of the predicted 3D structure for the RFC complex and DNA dependent ATPase that binds various nucleotide cofactors as allow us to determine the order of the individual subunits within well as single-stranded and double-stranded DNA. The binding of the complex. The modeling results also include a prediction of the ADP results in an inactive, low DNA affinity form of RecA while arrangement of RFC, PCNA, DNA and ATP during the clamp the binding of ATP stabilizes the protein's active, high DNA loading process. affinity form. Nucleotide and/or DNA binding to RecA also affect the pitch of the RecA, nucleoprotein filament. Molar DNA-binding Proteins concentrations of salt allow RecA to adopt the active, extended protein filament structure and hydrolyze ATP in the absence of 585-Pos Board # B447 DNA. We have utilized difference infrared spectroscopy to isolate PREFERENTIAL BINDING OF Ff G5P TO A G- changes associated with nucleotide binding to RecA under a QUADRUPLEX STRUCTURE IN THE PRESENCE OF variety of conditions. Here we present data associated with SODIUM ION. nucleotide binding to the high-salt RecA filaments and to RecA- Donald M. Gray, Jin-Der Wen; University of Texas at Dallas, DNA filaments. Difference infrared data associated with P.O. Box 830688, Richardson, Texas 75083-0688 nucleotide binding to these more "active-like" RecA filaments The Ff gene 5 protein (g5p) is an ssDNA binding-protein that can contain unique vibrations not observed in the low salt, RecA also bind to structured DNA. For example, g5p binds with high spectra. The data presented help identify important amino acids affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, and secondary structures associated with converting RecA between that forms a unimolecular G-quadruplex. A discrete intermediate its "active" and "inactive" conformations. complex is a precursor to forming a saturated g5p:I-3 complex [Wen et al., Biochemistry 40, 9300-9310 (2001)]. We have studied 583-Pos Board # B445 the binding of g5p to the truncated 26-nucleotide core of 1-3, KINETIC MECHANISM OF MANT-ATP AND MANT-ADP GGGGTCAGGCTGGGGTTGTGCAGGTC, called I-3c26. (1) CD BINDING TO THE E.COLI REPLICATION FACTOR and gel electrophoresis experiments show that only one complex is DNAC PROTEIN formed when g5p binds to I-3c26 in 200 mM NaCl, 37°C. (2) 1- Roberto Galletto, Wlodek M Bujalowski; University of Texas 3c26 and the core of 1-3 form similar unimolecular G-quadruplex Texas 77555- University Blvrd, Galveston, - Medical Branch, 301 structures, with two positive CD bands at 255 and - 290 nm, in 1053 the absence of g5p. (3) Both DNAs maintain G-quadruplex The kinetic mechanism of the binding of MANT-ATP and MANT- structures, slightly altered from the free structures, when bound by ADP to the Ecoli DnaC protein has been studied, using the g5p. (4) The intermediate complex of g5p:I-3 is formed by the fluorescence stopped-flow technique. The experiments have been binding of g5p to the core sequence of 1-3. (5) Time-dependent CD performed under pseudo-first order conditions with respect to changes at 255 nm show that I-3c26 folds in two stages when the nucleotide or DnaC concentration. The number of observed normal NaCI concentration is abruptly increased to 200 mM, and the modes of reaction depends on the pseudo-first order conditions quadruplex formed in the first stage of folding is similar to the applied. The simplest kinetic mechanism that can describe the data g5p-bound structure. includes a two-step binding of the nucleotide to the DnaC protein that exists in two different conformations prior to the nucleotide 586-Pos Board # B448 binding. Both, MANT-ATP and MANT-ADP obey the same SOLUTION STRUCTURAL STUDIES OF THE kinetic mechanism with similar rate constants. Quantitative SACCHAROMYCES CEREVISIAE TATA BINDING amplitude analysis allowed us to determine the molar fluorescence PROTEIN (TBP), FREE AND COMPLEXED WITH DNA parameters for each intermediate of the reaction. The data indicate Sergei Khrapunov , Michael Brenowitz; Albert Einstein College that in the first binding step the nucleotide is placed in a relatively ofMedicine, 1300 Morris Park Avenue, Bronx, New York 10461 polar environment and is moved into a higher hydrophobic one in The TATA Binding Protein (TBP) recognizes and binds to the the second step of reaction. The significance of these results in the TATA box sequence and is thus central to assembly of the context of the interaction of the DnaC protein with the DnaB transcription pre-initiation complex (PIC). Although TBP binds helicase is discussed. specific sites as a monomer, it oligomerizes in solution to octamers under the experimental conditions of the present studies. The 584-Pos Board # B446 crystal structure of the highly conserved C-domain of TBP PREDICTION OF THE THREE-DIMENSIONAL responsible for the interaction with DNA has been solved alone STRUCTURE FOR REPLICATION FACTOR C USING and complexed to DNA. The N-domain of TBP is variable in MODELING BY COMPARISON length and sequence and its structure and structural relationship to Ceslovas Venclovas, Michael Colvin, Michael Thelen; Lawrence the C-terminal domain are unknown. The intrinsic fluorescence of Livermore National Laboratory, 7000 East Ave, Livermore, the six tyrosines located within the C-domain of the California 94550 Saccharomyces cerevisiae TBP and the single tryptophan located Due to the conservative nature of protein three-dimensional (3D) in the N-domain has been used to compare the structural changes structure, modeling by comparison can be extensively applied to associated with each domain upon self-assembly or structurally and functionally characterize individual proteins or oligomerization of the protein. The results of this study show that protein complexes with as yet unknown structures. We present an (i) the structure of the C-domain structure is unchanged upon TBP example of comparative modeling to predict the structure for the oligomerization in contrast to the previously observed differences eukaryotic protein complex known as Replication Factor C (RFC). [Daugherty, M. et al. (2000) Biochemistry, 39, 4869 - 4880] in the RFC is an essential, hetero-pentameric ATPase that binds to confornation of the N-domain in TBP monomers and octamers;

120a Sunday POSTERS 586-591

(ii) the C-domain of TBP has a compact rigid structure in solution for a specific subtype. These potencies are discussed based on the that is unaffected by DNA binding; (iii) effective energy migration molecular structure of these agonists and the known structure of from the TBP tyrosines to DNA occurs consistent with uniform the receptors hormone-binding domains. close proximity of the macromolecules; and (iv) the conformation ofthe N-terminal domain ofTBP changes upon DNA-binding. 589-Pos Board # B451 COMMUNICATIONS AMONG CYCLIC NUCLEOTIDE 587-Pos Board # B449 BINDING SITES IN E. COLI CYCLIC AMP RECEPTOR PURIFICATION AND SELF-ASSOCIATION PROPERTIES PROTEIN: EFFECT OF SINGLE SITE MUTATIONS OF TrwB, THE DNA TRANSPORTER IN PLASMID R388 Shwu-Hwa Lin, Ching J. Lee; UTMB CONJUGATION The cyclic AMP receptor protein (CRP) from E. coli is a global Itziar Alkortal, Itsaso Hormaeche', Ana Ruiz-Manzanol, Jose transcriptional regulatory protein. The first step in the mechanism Maria Valpuesta2, F6lix Maria Gofii', Fernando de la Cruz; of CRP activity involved an allosteric activation of the protein by 'Unidad de Biofisica CSIC-UPV/EHU, P.O. BOX 644, Bilbao, cAMP binding. CRP is a dimer of two identical subunits, and X- 48080 Spain, 2Centro Nacional de Biotecnologia, CSIC. ray crystallographic data indicate the presence of different cAMP Universidad Aut6noma de Madrid, Spain, 3Departamento de binding sites per dimer. An understanding of the regulatory Biologia Molecular (Unidad Asociada al CIB). Unidad de mechanism of CRP requires knowledge on the interaction of CRP Cantabria. Santander, Spain with cAMP which was investigated by fluorescence titration and TrwB is an integral membrane protein implicated in conjugative isothermal titration calorimetry. The combined results suggest transfer of plasmid R388. It belongs to the family of "coupling that there is positive cooperativity between the 2 high affinity sites proteins" which have been proposed to be responsible for coupling but negative between the weak ones. To identify the structural the relaxosome to the machinery of DNA transport in the elements that modulate cAMP binding, eight CRP mutants (K52N, membrane. In this situation, TrwB could pump the DNA through D53H, S62F, T127L, G141Q, L148R, and K52N/H159L) were the transmembrane pore by tracking along the displaced DNA investigated. Although these mutants, expect T127L, do not make strand. A soluble version of this protein, TrwBAN70, binds DNA direct contacts with cAMP, the cooperativity of cAMP binding was non-specifically and also binds NTPs. significantly affected by these mutations. The energy of site-site Wild type TrwB was overproduced from Escherichia coli interaction was linearly correlated to DNA binding affinity. The BL21C41(DE3) strain and it behaves as an integral membrane current study demonstrates the importance of long range protein. Solubilization of TrwB was accomplished using different communication in effecting function in CRP. detergents. Subsequently, a purification protocol was developed and two different peaks of TrwB were obtained. The first peak 590-Pos Board # B452 corresponded to an hexameric form, as judged by electron GLOBAL EFFECTS OF RESIDUE 53 ON E. COLI CYCLIC microscopy, while the second peak corresponded to the monomeric AMP RECEPTOR PROTEIN form. Computer processing of electron microscopy pictures clearly Shwu-Hwa Lin, Ching J. Lee; UTMB, 5.136 MRB, Galveston, showed that the hexameric form of TrwB has a mushroom shape, Texas 77555-1 055 as predicted by the model presented with the 3D structure of E. coli cAMP receptor protein, CRP, regulates the expression of TrwBAN70, recently published. The fact that TrwBAN70 purifies many catabolite-sensitive genes upon activation by cAMP binding. always as a monomer, unlike the wild type TrwB used in this The number of binding sites and cooperativity among them work, suggests that interactions between the transmembrane indicate that an understanding of the regulatory mechanism of segments ofTrwB are important for stability ofthe hexamers. CRP-DNA interaction requires a determination of the energetics of AAA CRP-DNA interaction to each CRP-cAMP complex. The D53H CRP mutant was chosen in conjunction with WT CRP for study 588-Pos Board # B450 because the cooperativity of cAMP binding to CRP is altered by ESTROGEN RECEPTORS DIMERIZATION AND this point mutation. DNA-CRP binding isotherms were INTERACTION WITH DNA AND COACTIVATORS determined in over 30 different cAMP concentrations ranging from Emmanuel MARGEAT, Nicolas POUJOL, William 0 - 80 mM. These isotherms were further analyzed to define the BOURGUET, Catherine A ROYER; Centre de Biochimie binding affinities of CRP with different number of cAMP bound. Structurale, 29, rue de Navacelles, MONTPELLIER, 34090 France The singly liganded D53H CRP-cAMPI species has the highest Estrogen receptors are ligand dependant transcription factors. They affinity for the Lac26 DNA sequence. In contrast, both the CRP- are involved in the growth, development, and function of cAMPl and CRP-cAMP2 complexes exhibit equal affinity for the reproductive tissues. Estrogen receptor exists as two subtypes (cc Gal26 sequence. The consequence of this mutation is apparently a and [) displaying different expression patterns among tissues. ERa shift in the various thermodynamically linked equilibria without a and ER[ share 97% homology in their DNA-binding domain, and change in the basic mechanism that governs CRP activities. only 59% in their ligand-binding domain, allowing for ligand Although Asp53 is located neither at the cNMP binding pocket nor subtype specificity. the DNA binding domain, it significantly affects the selectivity for In this work, fluorescence spectroscopy has been used for the in- ligand and the specificity for DNA. depth investigation of the interaction between full length Estrogen Receptors (ERa and ER[), ligands, fluorescently labeled DNA, 591-Pos Board # B453 and two nuclear receptor coactivators (SRC-1 and TIF2) labeled TEMPERATURE AND SALT DEPENDENCE OF DNA with Alexa dyes. BINDING BY TAQ AND KLENOW DNA POLYMERASES We address the influence of different ER agonists or antagonists on Kausild Datta, Vince J. LiCata; Louisiana State University DNA binding of the Pol 1 type DNA polymerases from Thermus - The affinity between ERa and [, and DNA Estrogen Response aquaticus (Taq, Klentaq) and Escherichia coli (Klenow) has been Elements, and the dimerization properties of estrogen receptors examined as a function of temperature and [KCI]. Full length Taq coupled to DNA binding. polymerase and its Klentaq "large fragment domain" behave - The affinity between SRC-1 (or TIF-2) and ER a and [. We similarly in all assays. DNA binding in the -10-300 nM Kd range show that ER agonists, independently of their own affinity for the occurs at salt concentrations an order of magnitude higher for receptor, display different potencies for the high affinity Klenow than for Taq/Klentaq, indicating that at similar [KCI] the recruitment of coactivators. Moreover some ligands, which bind binding of Klenow is significantly tighter than the binding of the two receptor isoforms, are more potent in SRC-I recruitment Taq/Klentaq. Linkage analysis of the [KCI] dependence reveals a release of only -2.7 ions upon DNA binding of Taq/Klentaq and

121a 591-595 POSTERS Sunday

-4.1 ions upon binding of Klenow. The two polymerases show saturating Ca2+ levels. Ca2+-regulated oligomerization by DREAM similar patterns of temperature dependence, up until -40°C where may serve as a switch in the control of transcription. Klenow denatures. van't Hoff analysis of binding shows distinct curvature with temperature dependent enthalpies (AH) and 594-Pos Board # B456 negative ACp's. The ACp of Taq/Klentaq DNA binding is higher TITLE: PEROXYNITRITE IS AN ESSENTIAL than that for Klenow, suggesting a higher hydrophobic COMPONENT OF CYTOKINE PRODUCTION contribution in TaqlKlentaq DNA binding relative to Klenow. MECHANISM IN HUMAN MONOCYTES VIA Although the temperature dependencies of binding for the two MODULATION OF NF-icB DNA-BINDING ACTIVITY. polymerases are similar, at their physiological temperatures (37°C Bashir Mnene Matata, Manuel Galifianes; University of and 75°C), the binding of Klenow is entropy driven, while the Leicester, Groby Road, Leicester, LE3 9QP United Kingdom binding ofTaq/Klentaq is enthalpy driven. We investigated modulation of cytokine release by human monocytes and whether there is a role for ONOO-. Cells were 592-Pos Board # B454 suspended in HBSS with nutrient F12 Ham and 0.25% BSA TETHERED MOLECULAR BEACONS FOR DETECTING supplements. Monocytes were incubated for 6 h in air/5% C02 SEQUENCE-SPECIFIC DNA BINDING PROTEINS with different doses of ONOO-. ONOO- induced a dose-dependent Eric D. Knoll', Tomasz Heyduk2; 'St. Louis University, 1402 S. release of TNF-a and IL-6, maximal at between 2 and 20 FtM Grand Blvd., St. Louis, Missouri 63104-1079, 2Biochemistry and (TNF-a: 311+72 to 3039s49; IL-6: 370+60 to 1410+110 pg/mL; Molecular Biology P<0.05 in both) The basal release of TNF-a and IL-6 was Recently, we developed a simple, rapid and homogeneous completely suppressed by ONOO- decomposition catalyst fluorescence assay for the detection and quantification of 5,10,15,20-Tetrakis (4-sulfonatophenyl) prophyrinato iron (III) sequence-specific DNA binding proteins. At the heart of the assay chloride (200 ItM FeTPPS) to 40±9 and 7st2 pg/mL respectively; are novel fluorescent DNA reporters designed to simultaneously P<0.05); but was increased by the protein nitration inhibitor recognize and report recognition of the protein with an optical epigallocatechin gallate (l0I1M EGCG) to 1303176 and 1300+73 signal (Heyduk, T., and Heyduk, E. Nature Biotechnology, pg/mL (P<0.05). Cells treated with 2O0,M of the proteasome submitted). Here we report on a variant of the assay, in which inhibitor (Z-Ile-Glu(OtBu)-Ala-Leu-CHO) in the absence or components of the assay - fluorescent DNA reporters - were presence of 10 FM ONOO- also almost completely abolished the covalently tethered by a non-DNA linker. We investigated the release of TNF-a (to 45117 and 22s11 pg/mL; P<0.05) and IL-6 effect of the tether length on the performance of the assay. (to 48s115 and 50±15 pg/mL; P<0.05). Transcriptional role of Quantitative titrations with DNA-binding protein and rapid ONOO- was evaluated by assessmnet of the NF-kB activity by kinetics stopped-flow experiments were conducted to obtain Western blot and EMSA of nuclear extracts. ONOO- and EGCG detailed thermodynamic and kinetic characterization of the assay. induced nuclear translocation of Rel A/p65 an effect inhibited by Molecular model explaining the behavior of the assay was FeTPPS. 10AM ONOO- and EGCG had the greatest increase in proposed based on these data. The tethered molecular beacons, DNA-binding activity. Additional studies showed that ONOO- similar to the original design, exhibit the same flexibility in mode modulates IkB-a degradation by nitration and phosphorylation. The of signal detection and are compatible with multicolor findings indicate an essential role for ONOO- on cytokine release simultaneous detection of several proteins. The major advantage via nitration and phosphorylation ofthe Rel/NF-kB pathway. of this new assay format is the faster response time for the detection allowing the higher throughput of the analysis. DNA Repair Additionally, it will be possible to attach tethered beacons to a solid support. This will allow preparation of arrays containing 595-Pos Board # B457 molecular beacons for many different DNA binding proteins. RATIONAL ENGINEERING OF A DNA GLYCOSYLASE SPECIFIC FOR UNNATURAL CYTOSINE:PYRENE BASE 593-Pos Board # B455 PAIRS Ca2+-REGULATED DNA-BINDING AND James T. Stivers, Keehwan Kwon, Yu Lin Jiang; Johns Hopkins OLIGOMERIZATION OF THE NEURONAL Ca2+ SENSING Medical School, 715 North Wolfe St., Baltimore, Maryland 21205- PROTEIN, CALSENILIN/DREAM 2185 Masanori Osawa', Kit I Tong2, Mitsuhiko Ikura2, James B Ames'; Uracil DNA glycosylase (UDG) is a powerful DNA repair enzyme 'University of Maryland Biotechnology Institute, 2University of that specifically excises uracil bases from single stranded and Toronto, Toronto, Ontario M5G 2C1, Canada duplex DNA substrates using a uracil flipping mechanism that Calsenilin/DREAM, a new member of the EF-hand superfamily, involves the pushing action of a conserved leucine residue interacts with presenilin-2, serves as a Ca2+-regulated (Leul91). Attempts at rational engineering of UDG to recognize transcriptional repressor and interacts with A-type potassium other naturally occurring DNA bases have been thwarted because channels. Here we report Ca2+ binding, oligomerization and DNA specificity mutations have been found to be extraordinarily toxic to binding studies of the 256-residue protein, calsenilin/DREAM. bacterial cells, thereby preventing isolation and characterization of Ca2+-binding studies indicate that the protein binds 3 Ca2+ with a these interesting new activities. To overcome this technical dissociation constant (Yd) of 14 jM and Hill coefficient of 0.7. problem, we have developed a novel chemical rescue strategy. Hydrodynamic measurements determine that the Ca2+tbound The first step is to generate the specificity mutation in a L191A protein exists as a dimer in solution, whereas the Ca2+-free protein background. The L191A second-site mutation allows is a tetramer. Isothermal titration calorimetry studies reveal that overexpression of the specificity mutant in bacterial cells because the Ca2+-free tetramer binds endothermically (AH = +25 kcal/mol) the double mutant is unable to flip target bases and degrade the to four molecules of DNA derived from the downstream regulatory bacterial DNA. We then rescue the L191A mutation in in vitro element (DRE) of either the prodynorphin or c-fos genes. One assays by using engineered DNA substrates in which the target DRE binds tightly (Kd = 75 nM) and the other three bind more base is located opposite to an unnatural pyrene base. Pyrene serves weakly (Kd = 640 nM). No DNA binding was observed for the to push the target base from the duplex thereby fully replacing the Ca2+-bound protein. N-terminal protein fraginent (residues 1-70) function of Leul9l. We demonstrate the utility of this approach to binds non-specifically to DRE in a Ca2+-independent manner, generate a mutant of UDG that is exquisitely specific for while a C-terminal fragment containing the four EF-hands cytosine:pyrene base pairs. (residues 65-256) binds DRE (Kd = 200 nM) in a Ca2+-regulated and sequence-specific fashion. The C-tenninal fragment is a tetramer in the Ca2+-free state and dissociates into dimers at

122a Sunday POSTERS 596-600 -~~~~~~~~~ -~

Previously, a detection assay for DNA alterations induced by 596-Pos Board # B458 genotoxic substances was developed. This assay functions similar CRYSTAL STRUCTURE OF EXONUCLEASE RECJ to an ELISA system with a comparable detection sensitivity. BOUND TO MANGANESE ION To further characterize the mechanism of DNA repair, the single Atsushi Yamagata, Yoshimitsu Kakuta, Ryoji Masui, Keiichi molecule technique of fluorescence correlation spectroscopy can Fukuyama; Osaka University, 1-1 Machikaneyama, Toyonaka, be employed. Labelled with Alexa 546, the sole cysteine residue in 560-0043 Japan UvrB allows the observation of changes in diffusion time when RecJ is a 5' to 3' exonuclease specific for single-stranded DNA, UvrB complexes with damaged DNA. The introduction of a and is involved in DNA repair and recombination systems. second label with Alexa 633 may allow for conformational Recently, RecJ has been highlighted as a key enzyme for the changes to be measured. replication-recombination relationship. RecJ can interrupt the This work may provide a new highly sensitive detection system for replication accompanied with RecQ helicase, when replication fork DNA alterations on a single molecule scale that can be used in encounters DNA damage. In addition, RecJ has five characteristic high throughput screening for genotoxic effects ofnew drugs. motifs. The homologues containing these motifs are ubiquitous in archaea, prokaryotes, and higher eukaryotes. They form a large 599-Pos Board # B461 family of the predicted phosphoesterases, named by DHH family. COOPERATIVITY AND OTHER PROPERTIES OF THE However, the structure neither RecJ proteins nor the homologues DNA BINDING ACTIVITY OF HUMAN 06- in the DHH family was available. We here describe the crystal ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) structure of RecJ bound to Mn2+ ion essential for its activity. RecJ Joseph J. Rasimas, Sreenivas Kanugula, Michael G. Fried, has a novel fold, in which two domains are interconnected with a Anthony E. Pegg; Penn State College of Medicine, Milton S. long helix to form a central groove. This groove is composed of Hershey Medical Center, 500 University Drive, Hershey, conserved residues and positively charged, which may be involved Pennsylvania 17033 in DNA binding. Mn2+ is coordinated by amino acid residues in the AGT is a small, monomeric protein which is responsible for the motifs characteristic to the DHH family. repair of potentially mutagenic and cytotoxic alkyl and haloalkyl adducts of DNA at the 06-position of guanine and, to a lesser 597-Pos Board # B459 degree, at the 04-position of thymine. While some details of the THE WEAK INTERDOMAIN COUPLING OBSERVED IN stoichiometric and irreversible alkyltransfer process have been THE 70 kDa SUBUNIT OF HUMAN REPLICATION elucidated, comparatively little is known of the mechanisms by PROTEIN A is UNAFFECTED BY ssDNA BINDING which AGT binds DNA, recognizes repairable lesions, and Gary Daughdrili', Jennifer Ackerman2, Nancy Isern3, Maria V. dissociates to undergo degradation. Employing electrophoretic Botuyan4, Cheryl Arrowsmith4, Marc S. Wold5, David F. Lowry3; mobility assays and analytical ultracentrifugation, we have found 'University of Idaho, Life Science South 161, Moscow, Idaho the AGT-DNA interaction to be highly cooperative with Xo well in 83844-3052, 2Stanford University, 3Pacific Northwest National excess of 100. The AGT binding site size varies from over 9.5 Lab, 4University ofToronto, Canada, 5University ofIowa base pairs with linearized plasmid DNA to a mere 4 base pairs with Replication protein A (RPA) is a heterotrimeric protein that is short oligonucleotides. And although modifications such as essential for eukaryotic DNA metabolism. Using heteronuclear alkylation and mutation result in appropriate changes in binding NMR methods, we have investigated the domain interactions and affinities, the magnitude of the affinity differences is far too small ssDNA binding of a fragment from the 70-kDa subunit of human to allow AGT to partition effectively to lesions embedded in the RPA (hRPA70). This fragment contains an N-terminal domain human genome. We conclude, therefore, that since cooperativity (NTD), which is important for hRPA70/protein interactions, strongly influences the in vitro behavior of the protein, it may also connected to a single stranded DNA binding domain (SSBI) by a influence the in vivo functions of AGT-a protein whose well- flexible linker (hRPA70,326). High correlation coefficients were studied homologs in other species lack a cooperative mode of observed when the amide 'H and r5N chemical shifts of the NTD macromolecular assembly. and SSB1 in hRPA70,326 were compared with two smaller fragments that corresponded to the individual domains, indicating 600-Pos Board # B462 weak interdomain coupling. We also examined the structure of ANALYSIS OF DNA DOUBLE-STRAND BREAK REPAIR hRPA70t.326 after the addition of three different ssDNA substrates, CAPABILITIES IN PROKARYOTES: ROLE OF DNA which induced specific amide 'H and/or t5N chemical shift changes FRAGMENT DIFFUSION. in both the NTD and SSB1. A similar analysis of an hRPA70 Shwetal S Patel, Jeremy S Edwards; University ofDelaware fragment containing the NTD and the flexible linker (hRPA701,.68) Eubacteria of the genus Deinococcus have the ability to mend up revealed the NTD interacts directly with ssDNA. Based on this to one hundred double-strand DNA breaks per chromosome. This relationship, and other available data, we propose a model where ability is remarkable since most prokaryotes can mend no more binding between the NTD and ssDNA interferes with than two or three double strand DNA breaks per chromosome by hRPA70/protein interactions. RecA-mediated homologous recombination. Although several novel pathways have been suggested to explain this observation, 598-Pos Board # B460 the analysis of the complete genome of these organisms did not A NEW DETECTION SYSTEM FOR GENOTOXIC reveal their presence. Because RecA-mediated strand exchange SUBSTANCES USING EXCINUCLEASE UvrAB WITH requires that two homologous chromosomal fragments come in FLUORESCENCE CORRELATION SPECTROSCOPY close proximity to each other, favorable encounters between Guido Boese, Petra Schwille; Max-Planck-Institute for diffusing homologous DNA fragments is likely to play a dominant Biophysical Chemistry, Am FaBberg 11, Goettingen, 37077 role in the process of DNA double strand break repair. To explore Germany this phenomenon we performed Brownian Dynamics Simulations The bacterial UvrABC excinuclease system specifically recognizes (BDS) of the individual fragments resulting from DNA double various types of chemically induced DNA damage, such as strand breaks. The effect of cell size, genome size, genome copies, dimerization of nucleotides, base modifications and intercalation. temperature and fragment size on the DNA repair capabilities were The A2B-heterotrimer of UvrA and UvrB actively scans genomic assessed. To assess the role of diffusion in the overall rate of DNA DNA while hydrolyzing ATP. UvrB forms a highly specific double-strand break repair, the results of the simulations were complex with DNA exclusively at the damaged sites that can be compared with experimentally observed time courses of the DNA used as a marker for primary DNA alterations. double-strand break repair process in Deinococcus radiodurans.

123a 601-606 POSTERS Sunday

By combining UV spectroscopy with a separation method based on 601-Pos Board # B463 gel electrophoresis we quantify the presence of intermediate states THE PROBLEM, MOLECULAR MECHANISM AND TIME- (partially open molecules) throughout the melting transition of DEPENDENT DYNAMICS OF CONTROLLED DNA SELF- DNA oligomers. We find that the transition can be continuous or REPAIRING discontinuous, depending on the base sequence. In the first case, Vladimir I. Vysotskdi', A. A. Pinchuk', A. A. Kornilova2, L. V. the relative length of melted segments (the "bubble size") is seen to Scherbakov2, I. I. Samoylenko3; 'Kiev Shevchenko University, increase smoothly to 1 (bubble size = molecule size) with Radiophysical Faculty, Vladimirskaya St., 64, Kiev, 01033 increasing temperature; in the second case, the bubble size reaches Ukraine, 2Moscow State University, Physical Faculty, Russian a limiting value < 1 , then abruptlyjumps to I (strands separate). Federation, 3Gamaleya Institute of Epidemiology and Microbology, Moscow, Russian Federation 604-Pos Board # B466 The investigations have been aimed at determining the conditions TOWARD UNDERSTANDING MULTIPLEX under which all double breaks of DNA become self-eliminable. HYBRIDIZATION REACTIONS: MELTING STUDIES OF Quantum-electrodynamic considerations suggest that the energy of HETEROMORPHIC DUPLEX DNA COMPLEXES interaction V(L) between end-pairs of DNA nucleotides on the Timothy S. Hall, Peter V Riccelli, Petr Pancoska, Kathleen E opposite sites of a double break are under the control of: 1) the Mandell, Albert S. Benight; University of Illinois at Chicago, 845 width L of the break; 2) Coloumb interaction of surface charges of W Taylor, Chicago, Illinois 60607 the nucleotides; 3) Van-der-Waals-like interaction and, dispersion Heteromorphic hybrid duplex DNA complexes are duplex states, of dielectric permeabilities of the nucleotides and intercellular other than perfectly matched duplexes, that can form when single liquid. It was shown that at low (natural) concentration of hydrated strands of several different perfect matched duplexes are electrons B in intercellular liquid the energy of interaction of two simultaneously present in solution. Such cross-hybridization end-pairs (AT-AT, CG-CG) has the anti-repair barrier V(L)=(2- "side-reactions" are a nuisance in multiplex reactions where many 3)kT at L=7-8 A. If B is increasing the barrier is reducing. All strands are designed to hybridize in parallel fashion with only their other transversal end-pairs experience only attraction. One of the corresponding perfect complement strands. Consideration of the results of irradiation of intercellular liquid is hydrated electrons sequence dependent features of these heteromorphic duplex states and heavy ions creation. From one hand it leads to additional DNA and their thermodynamic stability relative to the perfect match breaks. From the other one it leads to the controlled reducing of duplexes, is important in multiplex hybridization reaction design. anti-repair barrier and possible double breaks autorepairing. The We have collected UV absorbance and heat capacity melting time-dependent dynamics of DNA depolymerization, self-repairing curves for different mixtures of eight different 24 base single and hormesis phenomenon at separated and combined action of strands. When mixed with their perfect complement, four perfect free radicals, slight and intensive irradiation and low-dose action is matched duplexes form. When mixtures of non-perfect matched studied. strands are prepared and analyzed, clear evidence for heteromorphic duplexes is found and the thermodynamics are DNA, RNA Structure & Conformation evaluated. A new analytical tool for treating heterogeneous, multiplex hybridization mixtures is presented and employed to 602-Pos Board # B464 interpret the acquired melting data. PREDICTING UV EXTINCTION COEFFICIENTS FOR DNA AND RNA 605-Pos Board # B467 Michael J. Cavaluzzi, Philip N. Borer, Deborah J. Kerwood; BEAD-BASED BIOSENSORS FOR QUANTITATIVE DNA Syracuse University, 111 College PI. Rm. 1-014 CST, Syracuse, HYBRIDIZATION ASSAYS New York 13244-4100 Mukta Singh-Zocchi, George Gruner, Giovanni Zocchi; Accuracies within 10.01% can often be achieved in chemical University of California, 405 Hilgard Avenue, Los Angeles, analyses, but most biochemical measurements are far less precise. California 90095-1547 A highly quantitative basis has many advantages, e.g., for drug We describe a new DNA hybridization assay that utilizes the design, binding equilibria, and predicting free energies by conformational and elastic changes of oligonucleotides in the thermodynamic cycles. The primary barrier is accurate process of hybridization. The detection method is based on bead- measurement of concentrations; most interesting substances cannot tagging. We will discuss advantages of this technique as applied to be weighed as pure crystalline material, the method behind most DNA-microarray devices. chemical analyses. Instead, measurements by UV absorbance are common. Estimates for nucleic acid extinction coefficients, e, from 606-Pos Board # B468 mono- and dinucleotides may have 20% errors when there is UNFOLDING OF DNA HAIRPINS CONTAINING BULGES extensive secondary structure. We are building a database from AND MISMATCHES 14mer and 16mer hairpins with linearly independent combinations Ronald A. Shildya, Luis A. Marky; University of Nebraska of the ten unique arrangements of neighboring base pairs in double Medical Center, 986025 Nebraska Medical Center, Omaha, strands. The e values come from UV absorbance measurements Nebraska 68198-6025 and (1) integration of proton NMR spectra or (2) hydrolysis to The energetic contributions for the incorporation of bulges and monomers. Predicted e values should be accurate within 2-5%. We mismatches in short DNA hairpins are investigated as a function of present NMR methods for concentration measurements with about the flanking sequence. Specifically, UV and DSC melting 1% accuracy for nearly any biomolecule. Further development techniques were used to investigate the unfolding of DNA hairpins may improve the accuracies by 10-fold. This work should have containing bulges (dC and dA) and mismatches (dC*dC, dA*dA). wide application in quantitative biology and biochemistry. The lesions were incorporated in the middle of the TA/AT and AG/TC base-pair stacks located in the stem of a DNA hairpin with 603-Pos Board # B465 sequence d(GTAGCT5GCTAC). We have obtained transition INTERMEDIATE STATES IN THE MELTING temperatures, TM, and standard thermodynamic profiles (AG', TRANSITION OF DNA OLIGOMERS AHK, AHVH, AS, ACp, and AnNa+) for the helix-coil transition of 15 Giovanni Zocchil, Kazimierz Grzeskowiak', Ales Omerzu', hairpins. All hairpins melt in two-state transitions with an average George Gruner2; 'University of California Los Angeles, 405 ACP of 30 cal/K-mol. The TM's are independent of strand Hilgard Avenue, Los Angeles, California 90095-1547, University concentration, which is consistent with their intramolecular ofCalifornia folding. Relative to the parent hairpin, the inclusion of a lesion

124a Sunday POSTERS 606-611 lowers both the TM and the release of counterions. The unfolding 609-Pos Board # B471 heat is also lowered but the actual magnitude depended on both the CD SPECTRA OF DNA DUMBBELLS WITH flanking sequence and nature of the bases. In terms of MG', the DINUCLEOTIDE REPEAT STEMS PROVIDE EVIDENCE inclusion of mismatches were more destabilizing than bulges; FOR LONG RANGE SEQUENCE DEPENDENT however, the mismatches were equally destabilizing in these two INTERACTIONS IN SHORT DUPLEX DNA base-pair environments while the bulges were more destabilizing Kathleen E Mandell', Petr Pancoska2, Albert S Benight'; when inserted into the more stable AG/TC base-pair stack. 'University of Illinois, 845 West Taylor St., Chicago, Illinois Supported by Grant 42223 from the NIH. 60607, iUniversity of Illinois at Chicago, 845 W Taylor, Chicago, 607-Pos Board # B469 Illinois 60607 THERMODYNAMIC ANALYSIS OF HAIRPIN DNAS CD spectra of DNA dumbbells were measured for six dumbbells CONTAINING TANDEM MISMATCHES whose stems contain the central sequences: (AA)io, (AC)lo, (AG)1o, Brooke N. Bourdelat-Parks, Roger M Wartell; Georgia Institute (AT)Io, (GC),o and (GG),o. These represent the minimal set of 10 ofTechnology, 315 Ferst Drive, Atlanta, Georgia 30332-0363 possible dinucleotide repeats. In addition, dumbbells with the central sequence (AG). and (RN),., n = 5,10,20, were studied. The thermodynamics of DNA hairpins containing tandem (RN). are dumbbells with a random central sequence. The central mismatches has been examined. UV melting and differential sequence of each dumbbell was flanked on both sides by the same scanning calorimetry (DSC) studies were carried out and the data 12 base pairs and T4 end-loops. CD spectra were collected from 20 analyzed to determine enthalpy, entropy, and free energy. DSC to 450C and [Nal from 25 to 115 mM. The spectral database was examined heat capacity differences between helix and coil states. analyzed by singular value decomposition (SVD) and revealed no DNAs were designed to form hairpin strutures in order to apparent temperature dependence within the pre-transition melting eliminate the duplex docking energy factor. The sequence of each region. SVD analysis of the six dumbbells with repeat length of 10 DNA was 5'-GATCXYGCTGATCTACAGCWZGATC-3', where (as a set) revealed two major sub spectra. The first sub spectrum is XY and WZ represent mismatched bases. Each DNA contained interpreted as the average spectra that of the random sequence eight base pairs, two internal mismatched pairs, and a five-member dumbbell. Analysis of second sub spectrum suggests interactions hairpin loop. The following hierarchy of stability was determined beyond nearest-neighbors as a function of sequence and length. based on AG37 values using the nomenclature 5'-XY-3'/5'-WZ-3': Variations of the second sub spectrum with [Na+] suggest a partial GA/GA>AA/GC>CA/GC>TC/TC>TA/AC. This hierarchy disruption ofsolvent structure as a function ofsequence. occurred in both IM and 0.1M Na+. Results from UV and DSC studies in 0.1M Na+ gave similar enthalpy values for hairpin DNAs 610-Pos Board # B472 examined. This indicates a two-state model for the transitions of DNA UNWINDING: ANALYSIS BY NEAR-INFRARED these hairpins. The parameters were in qualitative but not RAMAN SPECTROSCOPY OF ETHIDIUM-DNA quantitative agreement with data obtained from tandem COMPLEXES. mismatches in linear duplexes. These studies provide parameters James M. Benevides, George J. Thomas, Jr.; University of enabling more accurate predictions for DNA hybridization-type Missouri-Kansas City, 5100 Rockhill Road, Kansas City, Missouri assays including antisense, microarrays, and DNA computing. 64110 608-Pos Board # B470 Protein-directed unwinding of B DNA significantly alters the IS DNA HAIRPIN FORMATION DIFFUSION LIMITED? torsion angles of the helix backbone. Although such changes are Serguei V. Kumnetsov, Yiqing Shen, Anjum Ansari; University of expected to perturb the Raman spectrum of B DNA, specific Illinois at Chicago, 845 W. Taylor St. (M/C 273), Chicago, Illinois Raman bands diagnostic of helix unwinding have not yet been 60607 identified, largely because protein-induced unwinding is accompanied by additional structural perturbations. Therefore, it is Time-resolved absorbance measurements are used to monitor the of interest to investigate alternative mechanisms for unwinding unwinding of DNA hairpins after a laser temperature-jump. We DNA. Ethidium intercalation, which localizes helix unwinding to find that the hairpin closing times scale with the length of the loop the DNA intercalation sites, provides an excellent model for with an exponent of -2 near the melting temperatures, in close assessing the sensitivity of the DNA Raman signature to changes agreement with the theoretical scaling exponent of 1.8. The hairpin in helix winding angle. Raman analysis of ethidium-DNA using closing time (-10 lis at 25°C) is more than two orders of laser excitation wavelengths in the visible region is not feasible, magnitude slower than the diffusion limited time (-40 ns) for owing to the strong fluorescence of the complexes. However, we forming a contact between the two ends of a single-stranded DNA have succeeded in obtaining and comparing Raman spectra of -12 bases long. There are two possible explanations for this ethidium-free and ethidium-bound DNA using a near-infrared difference: 1) hairpin formation is reaction limited; 2) transient (NIR) laser Raman system of high sensitivity. The NIR-Raman traps from misfolded loops impede hairpin formation.1,2 To spectrum of ethidium-DNA is both fluorescence free and rich in address this issue, we have monitored the kinetics with varying Raman bands of the DNA base, sugar and phosphate moieties, solvent viscosity. We find that the characteristic opening/closing enabling identification of ethidium binding sites and effects of times are nearly independent of the viscosity. These results binding on local conformation. Raman markers of ethidium- contradict earlier measurements on the viscosity dependence of induced helix unwinding will be reported. [Supported by NIH equilibrium fluctuations of DNA hairpins,3 where the grant GM54378]. opening/closing times were found to scale with the viscosity with 611-Pos Board # an exponent of -0.8. Incorrect compensation of changes in stability B473 from addition of viscogenic cosolvents is most likely the reason for UV RESONANCE RAMAN SPECTROSCOPY OF A DNA the discrepancy between the two sets ofmeasurements. TRIPLE HELIX I . Ansari et al., PNAS 98, 7771 (2001). Eliana Tsukroff, Ishita Mukerji; Wesleyan University 2. Shen et al., J. Phys. Chem. B (in press). UV resonance Raman (UVRR) spectroscopy has been used to 3. Wallace et al., PNAS 98, 5584 (2001). investigate an intramolecular DNA triple helix, d(5'-AGAGAGAA-CCCC-TTCTCTCT-TTT-TCTCTCTT-3). Because of the potential ability to influence gene regulation, either by blocking protein binding to DNA or by affecting global DNA structure, the structure and stability of intramolecular triple helices are of interest . To specifically probe the stability of a TA*T triad

125a 611-616 POSTERS Sunday

in this triplex, an 15N-labelled adenosine was incorporated at the folding of GTG is accompanied by a small increase in the uptake 5th position. The frequency and intensity of the adenine vibrational of counterions. These effects are consistent with a decrease in modes measured by UVRR spectroscopy as a function of stacking interactions when the environment of the GTA triplet is temperature, reveal changes in H-bonding and stacking of the considered. Supported by Grant GM-42223 from the NIH. TA*T triad. Assignment of adenine vibrational modes was accomplished by comparing the UVRR spectrum of 9- 614-Pos Board # B476 methyladenine with ab initio calculations performed using DNA QUADRUPLEXES STABILIZED BY DIVALENT Gaussian98 at the B3LYP/6-31G* level. Spectra and calculations METAL IONS were performed at several different pH values to record the Richard H Shafer, Ivan Smirnov, Chung-Fei Tang; Univeristy of changes that ensue as a function of protonation. At lower pH California, San Francisco, 513 Parnassus Ave, San Francisco, values an adenine mode at 1693 cm-l is observed in the UVRR California 94143-0446 spectra and assigned to a C6=N stretching vibration. Calculated We have characterized the ability of the divalent metals Pb2+, modes correlate well with the observed spectra and support the Sr2+, and Ba2 to stabilize DNA quadruplex structures. assignment of the 1693 cm-l mode. The UVRR spectra and Quadruplex-forming sequences examined include structure of the DNA triple helix are discussed within the context d(G2T2G2TGTG2GT2G2), d(G3(TTAG3)3), and d(G3(CAG3)3), ofthese mode assignments. representative of the thrombin binding aptamer, the human telomere and a mouse satellite repeats. Significant effects in the 612-Pos Board # B474 CD spectra of these sequences in the presence of the three divalent PROTON NMR STRUCTURAL STUDIES OF 5'-D- cations have been observed, and correlate roughly with the strength (TC)3(CT)3(AG)3-3' - A "PAPER CLIP" TRIPLEX - of binding. UV melting curves have been measured, permitting CHARACTERIZATION OF A NOVEL "PYRIMIDINE thermodynamic analysis of these systems. At low ionic strength, FOLD" MOFIF these cations bind very tightly with each of these sequences, Lou-sing Kan', L. Pastemack2, D.-H. Huang2, S.-B. Lin3, T.-M. resulting in 1:1 metal:strand stoichiometric complexes being Chin4; 'Academia Sinica, 128, Academic Road, Sec. 2, Taipei, formed. In all cases, addition of metal ions results in the 11529 Taiwan, 2Scripps Research Institute, 3National Taiwan appearance of imino protons characteristic of guanine quartets. In University, Taiwan, 4Chinese Culture University, Taiwan comparison to K+, the most effective monovalent cation at We like to present the structural analysis of the 5'-d- stabilizing quadruplexes, all three divalent cations bind TCTCTCCTCTCTAGAGAG-3' (18) by NMR spectroscopy and substantially more tightly. In line with the difference in affinities, molecular modeling. The H3+ resonances of cytosines and NOEs the CD maximum is shifted to longer wavelengths for the divalent of base triads are consistent with characteristics for DNA triplex. cations compared to K+. EXAFS results on some of these cation A 3D model for the triplex is developed based on data obtained complexes provide molecular details concerning the coordination from 2D NMR studies and molecular modeling. We find that 18 geometry surrounding the metal ion and the guanine bases. forms an intramolecular "paper-clip" py-pu-py triplex. The central Differences in thermodynamic parameters for metal binding are triads resemble typical Hoogsteen and Watson-Crick base pairing. discussed in terms ofcharge, steric and desolvation effects. One of turns is comprised of a hairpin turn in the Watson-Crick base pairing portion of the 18 with the third base coming from the 615-Pos Board # B477 Hoogsteen pairing strand. The other end is comprised of a turn in A COMPARATIVE STUDY OF M-DNA AND B-DNA the continuous pyrimidine portion of 18, stabilized by a hydrogen- COMPLEXES WITH I)IVALENT METAL CATIONS BY bond from a purine. These two make notably different triad FTIR DIFFERENCE SPECTROSCOPY formations and are compared in this study. Knowledge of the Heidar-Ali - Tajmir-Riahi, Michael - Ramette, Robert - Rouillon, structural features of triplex formation will aid in our Robert - Carpentier; UQTR, 3551 Boul. des Forges, Trois- understanding of the biological function and potential therapeutic Rivieres, Quebec G9A 5H7 Canada uses oftriplex forming DNA. M-DNA is a unique DNA conformation, which forms in the presence of metal cations at high pH (pH 9). Metal cation, which 613-Pos Board # B475 can replace the protons the G-C and A-T base pairs forms M-DNA. THERMODYNAMIC CONTRIBUTIONS FOR THE This study was designed to examine the complexation of divalent INCORPORATION OF GTA MISMATCHES IN DNA Zn, Ni, Co, Mn, Ca and Mg with calf-thymus DNA at pH 9 using TRIPLEXES constant DNA concentration (25 mM ) and various cation Ana Maria Soto, Luis A. Marky; University of Nebraska Medical concentrations 1, 2, 4, 10, 25 and 50 mM. Similarly, the Center, 986025 Nebraska Medical Center, Omaha, Nebraska interactions of divalent cations Zn, Ni, Co, Mn, Ca and Mg with 68105 calf-thymus DNA were investigated at pH 7, using similar DNA Nucleic acid triple helices may be used to control gene expression. concentration (25 mM) and cation concentrations of 1 to 50 mM. One limitation in their use as therapeutic agents is that their target Spectroscopic evidence showed Zn, Ni and Co forms M-DNA at sequences are limited to homopurine tracts. To increase the pH 9, while Mn, Ca and Mg cations do not form M-DNA repertoire of sequences that can be targeted it has been postulated complexes. Although major structural modifications were observed that a guanine can target a thymidine forming a stable GTA triplet. for the sugar-phosphate geometry in the M-DNA, the deoxyribose In this work, we have used a combination of optical and remains in the C2-endo/anti pucker. Similarly, the B-DNA calorimetric techniques to determine the stability and energetic remains in the B-family structure with C2-endo/anti conformation profiles of two triplexes containing a GTA triplet: upon cation complexation. The DNA bases are the main targets of d(A3TA3C5T3AT3C5T3GT3) (ATA) & cation interactions in M-DNA, while in B-DNA both phosphate d(AGTGAC5TCACTC5TCGCT) (GTG) and their control triplexes: and the bases are involved in metal complexation. This study d(A7CsT7CsT7) (TAT7) & d(AGAGAC5TCTCTCsTCTCT) shows that M-DNA conformation can be stabilized in the presence (AG5T). Relative to the control triplexes, the inclusion of a GTA of metal ion at high pH, which is rather different from B, A, C and mismatch is destabilizing. This destabilization is greater when the Z-DNA structures stabilized by metal ions at pH 7. mismatch is placed between 2 CGC+ base-triplets than when placed between 2 TAT triplets, and consistent with previous 616-Pos Board # B478 literature reports. The destabilization is accompanied by a reduced DNA BENDING IN ADENINE-THYMINE TRACT OF folding enthalpy of - 10 kcal/mol and suggests a decrease in base HUMAN PAPILLOMAVIRUS E2-DNA stacking contributions. Relative to their control triplexes, ATA Suzie Byun, David L Beveridge; Wesleyan University, Hall- folding is accompanied by a lower uptake of counterions while the Atwater Laboratories, Middletown, Connecticut 06459

126a Sunday POSTERS 616-621

Molecular dynamics simulations are presented to explore the was reached, after which point the fluorescence intensity increased mechanism of DNA bending in the ACCGAATTCGCT sequence with temperature. Fluorescence melting profiles analyzed in the of human papillomavirus E2-DNA. These calculations are based first derivative, show a premelting transition for A-tract sequences on the 2.2A resolution crystal structure reported by Shakked and but not for the non A-tract sequences. co-workers,l which provides the first example of DNA bending by an adenine-thymine tract in which the global direction and 619-Pos Board # B481 magnitude of curvature is in accord with solution data. The MD DNA PERSISTENCE LENGTH REVISITED calculations, which begin at the unbiased canonical form of the Nancy C. Stellwagen, Yongjun Lu, Brock Weers; University of sequence, were analyzed in terms of DNA-bending parameters, Iowa, Department ofBiochemistry, Iowa City, Iowa 52242 e.g. dinucleotide roll and tilt. The current work sheds light on the DNA PERSISTENCE LENGTH REVISITED. ability of MD to compare with experiment, and provides an Transient electric birefringence has been used to characterize 15 interpretation of the experimental results. The simulations suggest DNA fragments ranging in size from 79-789 bp, in four different that the bending in the sequence follows most closely to a junction low ionic strength solutions. The DNA fragments migrate with model ofDNA-bending. normal electrophoretic mobilities in polyacrylamide gels, 1) Hizver, J., Rozenberg, H., Frolow, F., Rabinovich, D., and indicating that they do not contain sequence-specific bends. The Shakked, Z., "DNA bending by an adenine-thymine tract and its persistence length (p) and hydrodynamic radius (r) of DNA were role in gene regulation", PNAS (2001) 98(15) 8490-8495. determined as a function of temperature and buffer composition, using global fits of the terminal relaxation times of the DNA 617-Pos Board # B479 fragments to five different hydrodynamic models. The various A HIGH THROUGHPUT APPROACH FOR THE models fit the data equally well; however, the specific values ofp DETECTION OF DNA BENDING AND FLEXIBILITY and r are model-dependent. The wormlike-chain model of BASED ON DNA CYCLIZATION Hagerman and Zimm, combined with the revised Broersma Yongli Zhang, Donald M Crothers; Yale University, 260 Whitney equation, appears to be the most suitable for determining the Avenue, New Haven, Connecticut 06520-8114 hydrodynamic parameters of DNA. The values ofp and r obtained DNA cyclization is an important method for investigating DNA in solutions containing 1 mM Tris-EDTA buffer plus 1 mM NaCl bending and flexibility. In this approach DNA sequences of about are 560 A and 15.3 A, respectively, at 20 'C. The values ofp and r 160 bp are tested for their rates of circularization catalyzed by decrease to 440 A and 14.5 A, respectively, in solutions containing DNA ligase, which is affected by bending and flexibility. Its 0.2 mM Mg++ ions. The persistence length appears to go through a traditional implementation involves radioactive labeling of DNA shallow maximum at 20 IC, decreasing -10% when the constructs and separation of ligation mixture by PAGE to obtain temperature is decreased to 4 'C or increased to 43 IC. [Supported the ligation kinetics. Cyclization data are interpreted by Monte by NIH grant 29690.] Carlo simulation to determine curvature and flexibility parameters. It's not uncommon to take several years to analyze a single piece 620-Pos Board # B482 of DNA sequence. A high throughput approach based on FINITE ELEMENT CALCULATION OF BIREFRINGENCE fluorescent resonance energy transfer has been developed to A DNA COMPLEX IN SOLUTION automate the DNA cyclization. Three main improvements are Diana L Shem, Sergio R. Aragon, Don Eden; San Francisco State made, which include: (a) utilization of fluorescence change to University, 1600 Holloway Ave., San Francisco, California 94132 monitor the kinetics of ligation; (b) an efficient and economical DNA can be studied using transient electric birefringence (TEB) method to make a set of DNA constructs needed for the and the optical Kerr effect. The amount of birefringence observed cyclization; (c) a new theory based on statistical mechanics and the dynamics of DNA reorientation are sensitive to nucleic developed for the data analyses. With all these advances on the acid structure. Our objective is to computationally correlate methodology, it has been a routine to obtain the information of structure to observed properties of DNA in solution. We have DNA shapes for multiple DNA sequences within one day. extended our previous studies to the case of a complex of DNA Depending on the instruments, a large scale screening for DNA and the cancer drug cisplatin. The binding distorts the structure of shapes is possible. DNA significantly from a linear conformation with a bend introduced at the binding site. Our simplified model of DNA 618-Pos Board # B480 allows for the calculation of dielectric properties of DNA in EXAMINATION OF A-TRACT BENDING USING A solution. Each of the DNA bases is represented by an optically FLUORESCENT ADENOSINE ANALOGUE anisotropic rectangular slab with a volume equal to that enclosed Ishita Mukerji', Katherine Augustyn', Kristi Wojtuszewski', M. by the Van der Waals surface of the molecule. The rest of the E. Hawkins2; 'Wesleyan University, Lawn Ave., Middletown, optically sensitive material within DNA is represented by an Connecticut 06459-0175, 2NCI, Bethesda, MD enveloping cylinder, similar in height and width to a helical stack Numerous studies have indicated that DNA A-tracts, consisting of of DNA bases. The dielectric properties of the DNA solution are two or more consecutive adenosine residues, have an altered calculated using Maxwell software (Ansoft Corp.), which employs structural conformation (B'-DNA). When A-tracts appear in a finite element methods and adaptive 3D meshes. We discuss the sequence in phase with the DNA helix, bending is observed. The changes in computed birefringence in comparison to a linear model fluorescent adenosine analogue, 6MAP, was substituted for a ofDNA without cisplatin. single adenosine residue in DNA A-tract and non A-tract sequences to directly probe the environment of a specific site 621-Pos Board # B483 within the A-tract. To assess the cooperativity of A-tract bending, MEASURING LONG-RANGE INTERNUCLEAR the local environment of adenosine residues in phased and non- DISTANCES WITH A TRIFLUOROMETHYL GROUP IN phased A-tracts was also examined. Quantum yield measurements BIOMOLECULES USING "P-"'F REDOR NMR reveal that two adjacent purine residues quench 6MAP Elizabeth A. Louie, Panadda Chirakul, Snorri Th. Sigurdsson, fluorescence to a greater degree than either pyrimidine-pyrimidine Gary P. Drobny; University of Washington, Box 351700, Seattle, or purine-pyrimidine neighbors. Iodide quenching experiments Washington 98195 reveal that adenosines in the middle of the A-tract experience are "P-'9F REDOR (rotational-echo double resonance) is a solid state the most exposed, consistent with the propeller twisting previously nuclear magnetic resonance (NMR) method that has been used to observed by X-ray crystallography. Temperature-dependent measure internuclear distances in biomolecules such as in a protein fluorescence measurements of the duplexes showed an initial binding site (Schaefer et al., 1996) and in a DNA decrease in fluorescence intensity until the melting temperature (deoxyribonucleic acid) oligomer (Merritt et al., 1999). The

127a 621-626 POSTERS Sunday

reported 31P-'9F internuclear distances were 16 and 12 A, Our group analyzed the distribution of right-handed double- respectively. By incorporating a trifluoromethyl (-CF3) group into stranded (ds-) B-DNA sequences within the nucleated cells of the a molecule, simulations show that an internuclear distance on the adult ocular bovine lens. We employed histochemical (Feulgen) order of 20 A can be measured. A -CF3 group has been and immunohistochemical procedures to quantitate the B-DNA incorporated into two DNAs where the phosphorous and -CF3 content and distribution. This was achieved using a computerized labels are 12 and 20 A apart. We show experimentally the image analysis system. Several difrerent types of anti-ds-B-DNA dephasing curve of the DNA with the -CF3 group exhibits more monoclonal antibodies (MAb) and polyclonal antibodies (PAb) dephasing than the DNA with a single fluorine. Thus, a longer were employed: antibodies specific for unmethylated guanine- distance can be measured by utilizing a -CF3 group instead of a cytosine (G-C) sequences, those for methylated G-C sequences single fluorine label. This result is encouraging and allows one to and some which recognize all types of sequences. All ocular attempt to measure distances up to 20 A in large molecular weight lenses were examined prior to fixation (Davidson's ) for the biomolecules such as RNA, proteins, or ligand-receptor systems presence of cataractous elements. Our results reveal that the for structure determination. secondary ocular lens fiber cells decrease in B-DNA content as they undergo terminal differentiation (denucleation). Within the 622-Pos Board # B484 nucleated anterior epithelium, we observed the least SMALL ANGLE NEUTRON SCATTERING STUDIES OF immunoreactivity in the central zone epithelial cells (withdrawn PNA & DNA SYSTEMS from cell cycle) and the most in the germinative zone ( cell All Deyhim', Jing Zhou', Fredrick Schwartz2, Susan Krueger3, division).The most methylated sequences were identified within Susan Gregurick'; UMBC, 2CARB/NIST, 3NIST the outermost fiber cells. We conclude that during terminal Small Angle Neutron Scattering (SANS) measurements were differentiation the amount of ds-B-DNA gradually decreases as employed to investigate the structural differences between the cells are displaced from the cortex to the inner nucleus region. PNA and DNA. The SANS intensities were then modeled using Supported by an NYIT-AAUP grant. (SIMUL), which generated both a three-dimensional cylindrical and a helical model ofPNA/DNA systems. 625-Pos Board # B487 This program uses a Monte Carlo method to generate points within MECHANISM OF BRANCHED DNA FORMATION BY defined sub-volumes in order to rotate and shift the structure to a HOMOLOGOUS DUPLEXES desired position. Furthermore, the program subtracts points Victoria K. Marldna, Anna A. Neschastnova, Olesya A. belonging to overlapping sub-volumes. We then utilize a Danilova, Gennady A. Belitsky, Marianna G. Yakubovskaya; simulation program, (SCAT), to determine the structural and Blokhin Cancer Research Center RAMS, Kashirskoye shosse 24, neutron scattering intensity of the systems. The information from Moscow, 115478 Russian Federation both cylindrical and helical models was compared to produce an Interaction of homologous linear duplexes with formation of fbur- appropriate model for the experimental systems. With these way and branched DNA structures was analysed on the model of models we are able to make further inferences into the structural purified PCR products. DNA-DNA interaction has been confirmed differences between PNA and DNA. These differences have to occur via Holliday junction formation by the fragment ends prompted various thermodynamic studies that compare the followed by DNA strand spooling down between branches until structure of double stranded DNA/DNA and PNA/DNA duplexes complete back resolution into linear duplexes. We have at normal to melting temperatures. In support of this research, a demonstrated strand exchange process between homologous SANS temperature study was made to make a direct comparison of fragments. It was performed using biotin- and 32P - labelled the single strand to the double strand. The SANS results indicate duplexes. After incubation of biotinilated duplexes with 32P- that there is a definite change in the single strand structure of both labelled ones the first duplexes become P32-labelled and the time- PNA and DNA from low to high temperatures, in aggreement with dependence of P32-labelling intensity of biotinilated fragments on the concurrent thermodynamic measurements. duration of mixture incubation was demonstrated. DNA-DNA interaction was found to depend on sequence of the fragment 623-Pos Board # B485 flanks: the attachment of GC rich sequences decreased the RADIATION TARGET ANALYSIS OF DNA STRUCTURE interaction and the effect of AT rich sequence attachment was Ellis S. Kempnerl, Thomas J. Anchordoquy2, Nicholas Sluis- direct opposite. Free energy of Holliday junction formation by the Cremer, Michael Parniak3; 'NIH, Bldg 6 Room 140, Bethesda, fragments with GC- and AT-rich flanks differed by 0,6 kcal/mol. Maryland 20892, 2University of Colorado, 3University of Revealed mechanism of homologous linear duplex interaction Pittsburgh extends our understanding of different DNA rearrangement Frozen samples of high (3.3 MDa, supercoiled) and low (15 kDa, processes and the findings are of practical use for better linear double-stranded) mass DNAs were exposed to high energy interpreting and optimisation ofPCR-based analysis. electrons. After thawing, the supercoiled DNA was separated by agarose gel electrophoresis and stained with ethidium bromide; the 626-Pos Board # B488 smaller DNA was treated with picogreen fluorescent dye; the CONDENSATION OF ).,DNA BY OLIGO- AND POLY-L- surviving molecules were quantified by fluorescent techniques. LYSINES The data were analyzed by target theory and indicate that a single Irina Nayvelt, Veena Vijayanathan, Thresia Thomas, T.J. radiation interaction anywhere in these frozen molecules resulted Thomas; UMDNJ - RWJMS, 125 Paterson Street, New Brunswick, in a loss of structure. The calculated target sizes corresponded to New Jersey 08903 the mass of the polynucleotide chains, independent of any Condensed DNA particles can be used to deliver genetic material associated water or protein. into cells, thus bypassing the need for viral vectors. Using light- scattering technique, we studied the ability of tetra-, penta- and 624-Pos Board # B486 poly-L-lysines to condense DNA. The EC5o values (at which half DISTRIBUTION OF B-DNA IN NORMAL ADULT BOVINE of the DNA is in the condensed form) were 20 +/- 1.53 gtM, 2.07 OCULAR LENSES +/- 0.15 FM, 3.43 +/- 0.02 nM for and tetra-, penta- and poly-L- Claude E. Gagnal, Claude E. Gagna2, Hon Reen Kuo2, Charles A. lysines, respectively, in 10mM [Na+] cacodylic buffer. The plot of Lemken3, W. Clark Lambert4; 'New York Institute Of log vs. log showed for both Technology, 2New York institute Of Technology, NYCOM 2, Old [ECso] [Nal positive slopes tetralysine (slope = 1.09) and pentalysine (slope = 1.72), and a negative slope Westbury, New York 11568-8000, 3Fairleigh Dickinson for = University, 4UMDNJ-New Jersey poly-L-lysine (slope -0.0993). Under similar ionic conditions, Medical School DNA melting temperature (Tm) rose from 73.4°C to 88.3°C with increasing positive charge of condensing agents (10 g±m trilysine-

128a Sunday POSTERS 626-631 pentalysine). These findings indicate that oligo- and poly-L- hexamine analogs of spermine to induce and stabilize liquid lysines are exellent agents for condensing DNA, and may have crystalline DNA, using polarizing microscope. In the absence of applications in gene therapy. polyamines, calf thymus DNA (20 mM in 10 mM Na cacodylate buffer) assumed a planar cholesteric phase when incubated on a 627-Pos Board # B489 glass slide at 37 IC. Finger print texture of cholesteric phase, DNA CONDENSATION BY PENTA- AND HEXA-VALENT adopting a hexagonal order, was obtained in the presence of 1 mM POLYAMINE ANALOGS spermine. An oblique hexagonal columnar phase was observed Veena Vijayanathan', Thresia Thomas', Akira Shirahata2, T.J. when DNA was incubated at 37 'C for 48 h in the presence of a Thomas'; 'UMDNJ - RWJMS, 125 paterson street, New hexamine (100 gtM) This structure changed to a hexagonal Brunswick, New Jersey 08903, 2Josai University, Japan dendrimer with fluidity on further incubation of the DNA- DNA condensation by natural polyamines has been extensively hexamine complex for 72 h. We found distinctive differences of studied.We recently synthesized a series of polyamine analogs, liquid crystalline DNA formed in the presence of polyamines with NH2 (CH2) ,NH(CH2) nNH(CH2) nNH(CH2) nNH(CH2) nNH2 and free amino end groups and bis(ethyl) substituted compounds. NH2 (CH2) nNH(CH2) nNH(CH2) nNH(CH2) nNH2 n= 3or 4 and These data indicate that a possible cellular function of polyamines studied their ability to collapse )DNA using light scattering might be in the liquid crystalline organization ofDNA. technique. (Polyamine analogs are abbreviated by the number of methylene groups between the amino and imino groups). 630-Pos Board # B492 Polyamine concentration for 50% DNA condensation (EC5o) were DNA COMPACTION INDUCED BY THE YEAST 0.25, 0.4, 0.4, 0.6, 0.7and 0.7 FiM for 3-3-3-3-3, 3-4-3-4-3, 3-34- MITOCHONDRIAL PROTEIN ABF2P 3-3, 3-3-3-3, 3-44-3 and 4-3-3-4, respectively, in 10 mM Na+ Larry Brewer', Alex Nor], J. Klare', Jeff Lengyel2, M. Corzett', cacodylate buffer. Plots of log [ECso] against log [Na+] were S. Martin2, Rod Balhorn, Enoch Baldwin2, Ronald J. Baskin2; straight lines for spermidine and spermine with slopes of I and 1.3 'Lawrence Livermore Laboratory, 2University ofCalifornia, Davis respectively. However, such plots could be resolved into two We have studied the compaction of individual double stranded linear regions (slope: 0.67±0.2 and 3.4) for hexamines and 1.1 and DNA molecules by the putative yeast mitochondrial packaging 4.6 for pentamines respectively. Thus, pentamines and hexamines protein, Abf2p, using both laser trapping and atomic force are 20 fold more potent than spermine in provoking DNA microscopy (AFM). Abf2p is a high mobility group (HMG) protein condensation. These agents might be useful for developing non- that is the major constituent of yeast mitchondrial nucleoids. Using viral gene delivery vehicles. a flow cell and an optical trap, the length of single lambda DNA molecules stained with YOYO-l decreased by up to 50% in the 628-Pos Board # B490 presence of Abf2p. Compaction was observed to proceed DNA CONDENSATION AND RESOLUBILIZATION IN uniformly along the length of the DNA molecule, indicating that GLYCINE BUFFERS the mechanism of condensation is distinct from that of polyamines Jeffrey J Schwinefus, Victor A Bloomfield; University of and other small basic peptides (Brewer,et al,Science,286,120), Minnesota AFM images of Abf2 bound to single plasmid DNA molecules Counterion correlation attractive forces are believed to play a revealed that compaction was due to bending and folding of DNA major role in DNA condensation by multivalent cations. molecules and not to supercoiling. On the AFM mica surface, Counterion correlation theory also predicts a positive compaction proceeded to a greater extent, beyond the 50% "overcharging" of the DNA helix at sufficiently high multivalent shortening observed under flow, continuing until the DNA cation concentrations. Under these conditions, positively charged molecule was folded into a spherical,"nucleoid-like" structure. DNA helices undergo a resolubilization or reentrant condensation. These results suggest a two-stage process for condensation by As a test of the electrostatic nature of DNA condensation and Abf2p, in which the DNA is first shortened through strong local resolubilization predicted by counterion correlation theory, we protein-induced DNA distortions, and subsequently becomes have used total intensity light scattering to determine pUCI 18 folded through weak long range intra-complex interactions. plasmid spermidine, spermine, and poly-L-lysine condensation and resolubilization thresholds as a function of bulk dielectric constant 631-Pos Board # B493 in low salt buffer. Since glycine is only mildly excluded from the ACCURATE REPRESENTATION OF DNA DOUBLE DNA surface, we have chosen this dipolar ion to adjust the bulk HELICAL STRUCTURE WITH IMPLICIT SOLVENT AND solution dielectric constant. We use a pUCl 18 concentration of 1.0 COUNTERIONS. jig/ml in an effort to minimize DNA aggregation and to study Libua Wang', Brian E. Hingerty2, A. R. Srinivasan3, Wilma K. DNA condensation under dilute conditions. The concentration of Olson3, Suse Broydel; 'New York University, 2Oak Ridge National condensing agent needed to reach the condensation threshold Laboratory, 3Rutgers University increases exponentially with increasing bulk dielectric constant, We have employed high-resolution NMR and crystallographic data while the concentration at the resolubilization threshold decreases to refine the force field used in the torsion angle space nucleic linearly. Our experimental observations are discussed within the acids molecular mechanics program DUPLEX. The population framework of counterion correlation attractive forces. This balance deduced from NMR studies of two 2-aminofluorene- research was supported by a NIH grant to VAB and a NRSA award modified DNA conformers in equilibrium was used to fine-tune to JJS. the dielectric function so that reasonable relative energies could be obtained. In addition, the base-pair geometry from high-resolution 629-Pos Board # B491 crystal structures of the "Dickerson-Drew dodecamer" (DDD) was LIQUID CRYSTALLINE DNA IN THE PRESENCE OF used to re-evaluate the deoxyribose pseudorotation profile and the NATURAL AND SYNTHETIC POLYAMINES Lennard-Jones non-bonded energy terms. With a modified T.J. Thomas', Muthusamy Saminathan', Akira Shirahata2, Thresia sigmoidal distance-dependent dielectric function which assumes a Thomas'; 'UMDNJ-RWJ Med. School, 125 Paterson St. CAB very steep form, a deoxyribose pseudorotation profile with reduced 7090, New Brunswick, New Jersey 08903, 2Josai University, Japan energy barriers between C2'- and C3'-endo minima, and a shift of DNA undergoes condensation, conformational transitions, the Lennard-Jones potential energy minimum to a distance -0.4 A aggregation and resolubilization in the presence of polyamines, greater than the sum of the van der Waals' radii, the sequence- positively charged organic molecules present in all cells. Under dependent structural features of the DDD in both the solid state carefully controlled environmental conditions, DNA can also and the aqueous liquid crystalline phase are well reproduced. This transform to a liquid crystalline state. We undertook the present work is supported by NIH. work to examine the ability of a group of tetra-, penta-, and

129a 632-636 POSTERS Sunday

amide-3 backbone modification on the duplex structure and 632-Pos Board # B494 stability was studied in the hybrid SIMULATIONS OF DNA d(T*TT*TT*MT*MT*MT*MT*MT /mr(A5(GA)5) where * Paul S. Crozier, Mark J Stevens; Sandia National Laboratories, indicates the amide-3 backbone modification, M indicates the 5'- P.O. Box 5800, MS 0316, Albuquerque, New Mexico 87185-0316 methyl C and mr indicates the 2'-OMe RNA strand. Evaluation of A simple coarse-grained model of DNA has been developed and binding stability by thermal dissociation and affinity studies were previously shown to produce the basic elements of DNA performed on the unnatural oligonucleotide and compared to the condensation. This model primarily focuses on the Coulomb properties of the corresponding non-modified oligonucleotide. interactions. DNA is treated as a bead-spring polymer with each Two 3 ns molecular dynamics simulations were performed on the bead singly charged. Single, charged beads represent counterions modified and nonmodified oligonucleotides with full (and salt). New results of molecular dynamics (MD) simulations representation of DNA and RNA charges, solvent and counterions. using this model as well as more complex models will be The population of structures sampled, the hydration pattern and presented. MD simulations have been performed that model the local ion distribution around each oligonucleotide were pulling the ends of a condensed DNA by single molecule probes. analysed and results were compared to experimental structural data The images of the dynamics show that the separation of each loop when feasible. Structural and biochemical studies were performed of the DNA toroid is visible within the calculated work. The in an effort to rationalize the observed differences in properties for images also show that the remaining toroidal condensate rocks the amide-3 backbone modification against a RNA strand. back and forth as each loop is peeled away. Results of a set of related simulations of ssDNA and dsDNA with one end grafted to 635-Pos Board # B497 a surface and the other end free will also be presented. The A STRUCTURE TRANSITION INVOLVING conformations and orientation with respect to the surface of both DIMERIZATION OF A 79 NT RNA types ofDNA will be discussed and contrasted. Xueguang Sun, Saras Abhiraman, Roger M Wartell; Georgia Institute ofTechnology 633-Pos Board # B495 A 79nt RNA with central 30 bases from the HIV reverse DYNAMICS OF ABASIC DNA: TIME-RESOLVED transcriptase gene was found to form a dimer after transcription. FLUORESCENCE OF 2-AMINOPURINE AND The dimer is enhanced in presence of Mg(2+) and low MOLECULAR DYNAMICS SIMULATIONS temperature. RNA structural prediction (mfold 3.1) suggests that Gintaras Deikus, E. Seibert, W. R. Laws, R. Osman, J. B. A. the first 21 nt from the 5' end of the 79 mer are critical for the Ross; Mount Sinai School of Medicine, One Gustave L. Levy dimerization. This region changes from an intramolecular stem- Place, New York, New York 10029 loop to an intermolecular duplex. A RNase H assay for accessible The glycosylase-specific step of DNA excision repair produces an sites was carried out by using 8 ODNs. Only two ODNs show a abasic site, which alters the structure of damaged DNA. To assess different RNA degradation pattern between the monomer and local structure and dynamics, we measured fluorescence intensity dimer. The results were consistent with the single strand region decay of the adenine (A) analogue 2-aminopurine (P) incorporated predicted to be involved in dimerization. Hybridization studies in oligonucleotides either adjacent (5' or 3') or opposite the abasic involving segments of the 79 mer verified the essential role of this site. The fluorescence quenching was caused both by stacking region for dimerization. CD spectra show differences around 270 interactions between P and adjacent bases (static quenching) and nm between the monomer and dimer forms. The fractions of base by collisions (dynamic quenching). MD simulations of the same pairs and single bases were calculated by a guided regression sequences with A in place of P showed that A 5' to the abasic site analysis of the CD and UV data (Johnson & Gray 1991). The has a larger average rise compared to A 3' to the abasic site. The results were also consistent with the prediction. This structural rise difference results in a larger average distance between abasic transition is different from the kissing-complex mediated 2-deoxyribose and the 5' A, which forces the A closer to it's 5' dimerization observed with several RNAs, indicating another base. Consistent with these simulations, static quenching was mechanism for dimerization. A 3-D model of the 79 mer was greatest and dynamic quenching was least for P 5' to the abasic constructed to help provide insight on how this transition occurs. site while the opposite behavior was observed for P 3' to the abasic site. Calcium had no effect on static quenching (stacking) but 636-Pos Board # B498 increased dynamic quenching (collision rate) for P adjacent to the STRUCTURAL FEATURES OF SLlI FROM THE 5'- abasic site. When P was opposite the abasic site, calcium LEADER OF HIV-1 RNA increased the base population in the "flipped out" state, reduced Yiqiong Yuan, Deborah J. Kerwood, Philip N. Borer; Syracuse stacking in the "flipped in" state, and lowered the rate of University, Il1 College Place, Rm. 1-014 CST, Syracuse, New quenching collisions in both ofthese states. York 13244-4100 Supported by NIH grant CA-633 17. Packaging of genomic RNA into the virion is an essential step in the retroviral replication cycle. Four stem-loops from the 5'-leader 634-Pos Board # B496 of HIV-1, which are usually referred to as SLI, SL2, SL3 and SL4, EFFECTS OF THE INTRODUCTION OF ALTERNATED have been shown to play roles in packaging. While SL3 provides AMIDE BACKBONE MODIFICATIONS: BIOCHEMICAL most of the specificity, SL3 knockouts are still packaged. Our lab AND STRUCTURAL STUDIES OF THE 15mer has shown that an internal loop in SLI binds the mature 55mer DNA/2'OMe-RNA d(T*TT*TT*MT*MT*MT*MT*MT nucleocapsid protein with 25% of the affinity it has for SL3. A /r(A5(GA) 5) 23mer RNA hairpin construct, SLli, models this loop in NMR Mafalda Nina', Marcel J.J. Blommers2, Lars Prade', Habiba studies that are reported here. The four-residue (I + 3) asymmetric Chekatt', Renaud Beaudegnies', Sebastian Wendeborn', Fiona internal loop has properties consistent with marked flexibility. All Murphy-Kessabi', Xavier Leroy', Raymonde Fonne-Pfisterl; of the loop's sugars have populations of S-puckered states >20%, 'Syngenta Crop Protection, WRO-1060.2.36, Basel, 4002 and all of its unpaired G imino protons exchange rapidly with Switzerland, 2Novartis Pharma, Switzerland water at room temperature. The single unpaired G on one side of The amide-3 backbone modification in which -CH2-NH-CO-CH2- the loop stacks upon both its sequential neighbors, but not as in A- replaces -C5'H2-05'-PO2-03'- has shown a significant increased RNA. The opposite side has unpaired A-G-G, with both G-residues affinity to a complementary RNA strand (DTm/modification = having large populations of syn conformers and S-puckered sugars. +0.4o) compared with the corresponding DNA strand and results The unpaired A stacks on its 5'-neighbor, but weakly upon its in resistence to 3'-exonucleases. In this work, the effects of an unpaired G-neighbor. This middle G in the loop has few NOE alternated substitution of the phosphodiester linkages by the

130a Sunday POSTERS 636-641

connectivities with residues adjacent to it in the sequence. 639-Pos Board # B501 Resonance assignments and structural refinement will be reported. PERTURBATIONS OF PKA IN RNA STRUCTURES: A SURVEY USING A MONTE CARLO APPLICATION OF 637-Pos Board # B499 THE NLPB EQUATION NMR DETERMINATION OF THE SECONDARY Chris L Tang, Emil Alexov, Anna Marie Pyle, Barry Honig; STRUCTURE OF SELENOCYSTEINE INSERTION Columbia University, 630 West 168th St, Rm 221, New York, SEQUENCES New York 10032 Teresa W-M. FAN', Andrew N Lane2, Andres Ramos3, David Hollingworth3; 'University of California, One Shields Avenue, RNA molecules have varied and complex structures. Recent Davis, California 95616, University of Louisville, 3NIMR, United literature has shown that some RNAs contain nucleotides that Kingdom exhibit pKa shifts from their solution values. Such shifts are analogous to pK shifts observed in proteins, where the Selenocysteine (SeCys) is known as the 21 st amino acid, and is microenvironment of each residue serves to perturb the solution found in redox enzymes such as glutathione peroxidase (GPX) and pK of certain residues. We used a Monte Carlo approach to sample thioredoxin reductase (TR) in mammals. SeCys is inserted by the relative occupation of multiple conformations for each titration decoding the UGA stop codon in the appropriate context with site using computed solutions to the nonlinear Poisson-Boltzmann charged tRNAsec. In eukaryotes, the decoding system involves a equation (NLPB) to evaluate relative energies. By separating the region of the 3' untranslated region of the transcript, known as the solutions of the NLPB into additive and non-linear components, selenocysteine insertion sequence (SECIS), which is recognized and using a mean field approximation of the latter, we maintained by at least two proteins including nucleolin and DNA-B. The accuracy of the calculations while performing them with high minimal functional size of the SECIS is 50-60 nt. All SECIS have efficiency. We apply our technique to several solution structures internal sequence complementarity but only three regions are and obtain good agreement with experimentally measured pKs. We conserved: AAA , AUGA and a GU sequence. Structure-prediction discuss our approach and present a comparison of the calculation programs and mutational analysis has lead to different proposals with experimentally derived data. about there conformations. We have synthesized milligram amounts of the minimal 640-Pos Board # B502 SECIS of both human GPX and human TR to determine the CHEMICAL RESCUE IMPLICATES THE IMPORTANCE secondary structure and determine the structural similarity of these OF SOLVENT DURING GROUP II INTRON SELF- two sequences using NMR spectroscopy. Although the SECIS SPLICING elements are large by NMR standards (51 nt and 58 nt), we Peter M Gordon, Joseph A Piccirilli; University of Chicago, 5841 obtained well resolved NOESY spectra at high (14.1 T to 18.8 T) S. Maryland, Chicago, Illinois 60615 magnetic field strengths. Reliable models of the secondary To develop a detailed understanding of the structures have been derived, which is essential for understanding catalytic repertoire and the regulation ofSeCys incorporation. strategies by which RNA catalysts (ribozymes) accelerate chemical reactions, it is necessary to identify and characterize the chemical 638-Pos Board # BSOO role of individual functional groups and metal ions essential for A CONSERVED PSEUDOURIDINE INDUCES A catalysis. The first step of group II intron reverse splicing served as CONFORMATIONAL SWITCH IN THE SPLICEOSOMAL a model system for investigating the role of a 2'-OH in catalysis as BRANCH SITE HELIX the cleavage site 2-OH contributes -1 0-fold to catalysis through Meredith Hann Newby', Nancy L. Greenbaum2; 'Institute of transition state stabilization. The first step of reverse splicing is Molecular Biophysics, Florida State University, Tallahassee, also biologically relevant as determining any inherent preferences Florida 323064390, 2Department ofChemistry and Biochemistry of the group II ribozyme for reverse splicing into RNA or DNA substrates may provide insight into the pathways of intron The first step of eukaryotic pre-mRNA splicing is the nucleophilic dispersal. To investigate the chemical nature of this effect, we attack by the 2'OH of an adenosine residue within the intron, called extended current approaches of atomic level mutagenesis and the branch site, upon the 5' splice site. Prior to splicing, the developed new approaches for probing the role of a 2'-OH group unpaired branch site adenosine is situated within a short in catalysis. The ambivalence of the 2-position to hydrogen complementary helix formed by pairing of the U2 small nuclear bonding, metal ion chelation, sugar pucker, and charge coupled RNA with the intron sequence. A pseudouridine (%i) modification, with chemical rescue by ethanol suggests that the 2'-OH may be which differs from its unmodified uridine analogue by the presence important for positioning an important water molecule within the of a single additional hydrogen bond donor, is highly conserved in active site. the region opposing the branch site. We have solved the solution structures of unmodified (U) and x'-modified RNA duplexes 641-Pos Board # B503 representing the branch site pairing. In the unmodified duplex, the SPECTROSCOPIC PROBES FOR METALS AND unpaired adenosine is stacked within the helix, and forms a CATALYSIS IN RIBOZYMES hydrogen bond with the opposing U. In marked contrast, the Victoria J. DeRose, Laura M. Hunsicker, Matthew Vogt, Alyson presence of v induces the extrusion of the unpaired adenosine into Kirchner, Shannon Burns, Edith Osborne, Nak-Kyoon Kim; Texas an extrahelical position, packing into the minor groove of the A&M University, P.O. Box 30012, College Station, Texas 77842- duplex. The conformation of the adenosine in each construct was 3012 confirmed the relative fluorescence of in which 2- by duplexes Nearly 20 years after the initial discovery that RNA can perform aminopurine was substituted for the unpaired adenosine. The 'V chemical reactions, the catalytic mechanisms used by RNA remain modification also results in overwinding of the helix and widening Under moderate ionic metal ions are of the We that this overt enigmatic. strengths, required major groove. speculate confornational for catalysis in most known ribozymes. We have focused on switch effected by the modified base provides a mechanism for developing methods to directly measure RNA-metal interactions specific recognition ofthe branch site in splicing. with a goal of understanding the participation of metals in RNA chemistry. In the hammerhead ribozyme, magnetic resonance and X-ray absorption spectroscopic techniques as well as thermodynamic and activity studies have been applied to obtain relative metal binding affinities for specific sites, and understand in detail changes accompanying mutations that affect catalysis. Metal binding to the hairpin ribozyme and the P5abc core of the

131a 641-646 POSTERS Sunday

P4-P6 Domain of Group I have also been characterized, and spin drive the folding process, RNA requires counterions to neutralize labeling studies demonstrate changes in dynamics with addition of the electrostatic repulsion of negatively charged phosphates in metals. The picture emerging from these studies illustrates a order to form the tertiary structure. Non-specific binding of surprising level of sophistication in the mechanisms by which counterions around the RNA reduces the phosphate charge by 75- metal ions influence RNA function. 95%, triggering a collapse of the chain to a more compact state that contains some native and some non-native structures. The fully- 642-Pos Board # B504 native state is stabilized by the divalent metal ions Mge2 or Mn2+. SITE-SPECIFIC BINDING OF METAL IONS BY A GNRA To understand the mechanism of the formation of the tertiary TETRALOOP structure from the denatured state, an investigation of the role Claudius Mundoma, Jon D Epperson, Nancy L Greenbaum; played by counterions is required. We used small angle neutron Florida State University, 243 DLC, Tallahassee, Florida FL32306- scattering to study the structure of the Azoarcus ribozyme in the 4390 presence of cations with +1, +2 and +3 charge. The radius of RNA tetraloops of the GNRA family (where N = any base and R = gyration of the RNA as a function of charge and counterion any purine) bind metal ions of different chemical and geometric concentration will be discussed and compared with theoretical properties. We have probed the metal-binding properties of a predictions. Structural models will be presented for the native, GNRA tetraloop by isothermal titration calorimetry (ITC), laser intermediate and denatured states, based on distance distribution induced lanthanide(III) luminescence, and solution NMR. Binding analysis ofthe data. of Eu(III) to the loop was accompanied by endothermic changes, consistent with removal of the inner hydration sphere of Eu(III). 645-Pos Board # B507 By comparison, binding of Mg(II) or Mn(II) to the RNA loop, ROLE OF SITE-BOUND METAL IONS IN TERTIARY were associated with exothermic changes, implying predominantly FOLDING OF U6 snRNA water-mediated coordination. The excitation spectrum of the LauraJane Upham Phelps, Nancy L. Greenbaum; Department of Eu(IlI)-RNA loop complex was broad and blue shifted, and was Chemistry and Biochemistry, Florida State University, best fit by the sum of two curves, suggesting distinct ion-binding Tallahassee, Florida 32306-4390 microenvironments. Eu(III) titration studies resulted in a Kd of Tertiary folding of small nuclear (sn)RNAs is an integral step in -12 mM, and the rate of luminescence decay indicated removal of spliceosomal assembly and function. As a model for snRNA 7-8 (of 9) water molecules upon binding. Mg(II) and Mn(II) folding, we are investigating the metal dependent changes in competed with Eu(III) for the site with affinities of -300 and -100 structure of U6 snRNA. Thermal denaturation ofthe 69-base RNA less than for Eu(III), respectively. Shifts in 31P and 1H NMR stem loop in the absence of divalent metal ions are sigmoidal, with resonances induced by binding of paramagnetic Ln(III) ions were a Tm -62 'C. In the presence Mg(Il) of 1-10 fold times the RNA most pronounced on the 5' side of the loop. These ITC, NMR, and concentration, the melting transitions were broader, and included luminescence data support a model in which the metal ion is bound both higher and lower Tm components, consistent with formation predominantly by inner sphere coordination to the unstacked 5' of additional interactions. In accordance with these data, circular side ofthe loop. dichroism spectra indicated additional helicity upon the addition of Mg(II). Individual binding sites in the U6 snRNA are being 643-Pos Board # B505 characterized by luminescence of Eu(III) ions substituted for MONOVALENT CATIONS MEDIATE FORMATION OF Mg(II). Titration of Eu(IIl) into U6 snRNA solutions indicated up NATIVE TERTIARY CONTACTS WITHIN THE to three site bound metal ions. Luminescence decay curves are TETRAHYMENA THERMOPHILA L-21 Sca I RIBOZYME consistent with 4-5 direct coordinations (of a possible 9) to the IN THE ANSENCE OF DIVALENT CATIONS RNA. These data imply a role for specific metal binding in the Keiji Takamoto, Qin He, Mark R Chance, Michael Brenowitz; tertiary structural formation ofU6 snRNA. Albert Einstein College of Medicine, 1300 Morris Park Ave, Ullman BLDG room 315, Bronx, NY, New York 10461 Conformation & Dynamics I Hydroxyl radical footprinting has been used to probe the solvent accessible surface of the Tetrahymena L-21 Sca I ribozyme and its 646-Pos Board # B508 isolated P4-P6 domain as a function of NaCI concentration in the SIMULATED ROTATION OF Fi ATP SYNTHASE absence of MgC12. A novel single-band peak-fitting analysis has CENTRAL STALK been used to accurately and comprehensively quantitate the Barry Isralewitz, Emad Tajkhorshid, Klaus J. Schulten; Beckman variations in hydroxyl radical reactivity. These studies demonstrate Institute, University of Illinois at Urbana-Champaign, 3121 that at high monovalent cation concentrations, the ribozyme Beckman Institute, Urbana, Illinois 61801 acquire elements of ordered structure equivalent to those observed ATP synthase is a large (100,000 atom) protein, which includes a for the catalytically active, divalent ion induced folded structure. transmembrane Fo unit coupled to a solvent-exposed F1 unit via a Two monovalent ion induced structural transitions indicated by the central stalk. The F1 unit can be considered a torque-driven rotary changes in solvent accessibility are observed. The first transition machine that depends on the interaction and deformation of its occurs between 500 and 800mM NaCl with the second transition elastic subunits to accomplish its function: synthesize ATP from between I and 2M NaCI. These results suggest that monovalent ADP and Pi by coupling an applied torque to the cyclic cations facilitates formation of native tertiary contacts and transformation of specific binding sites. We perform steered destabilizes nonnative tertiary contacts that may constitute kinetic molecular dynamics (SMD) simulations to investigate details of traps that inhibit ribozyme folding. structural dynamics and elastic/conformational properties of F1 subunits that are not available to experiment. The simulations 644-Pos Board # B506 provide the means to directly examine the interaction forces in all FOLDING PATHWAYS OF RNA BY CATION BINDING parts of F, and observe how the interactions between the subunits Ursula A PerezSalas', Susan Krueger', Sarah Woodson2, evolve as a torqued rotation progresses. The simulated system Prashanth Rangan2, Elena Georgieva2, Devarajan Thirumalai3, involves 327,000 atoms of the F, unit, bound nucleotides, and Robert M Briber3; 'NIST, 100 Bureau Drive Stop 8562, solvent. Torque is applied to rotate the central stalk 2x/3 radians Gaithersburg, Maryland 20899, 2Johns Hopkins University, during a 5 ns simulation. To characterize mechanical coupling 3University ofMaryland between the stalk and the F, subunits during rotation, we examine Like proteins, certain RNA molecules adopt well-defined three- patterns of hydrogen bond breaking/formation, interaction dimensional tertiary structures that are essential for biological energies, changes to active site conformation, elastic energy of the activity. In contrast to proteins, where hydrophobic interactions protein chains, and individual domain motions.

132a