Genetic Variation of Oratosquilla Oratoria (Crustacea: Title Stomatopoda) Across Hong Kong Waters Elucidated by Mitochondrial DNA Control Region Sequences
Total Page：16
File Type：pdf, Size：1020Kb
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by HKU Scholars Hub Genetic variation of Oratosquilla oratoria (Crustacea: Title Stomatopoda) across Hong Kong waters elucidated by mitochondrial DNA control region sequences Author(s) Lui, KKY; Leung, PTY; Ng, WC; Leung, KMY Journal Of The Marine Biological Association Of The United Citation Kingdom, 2010, v. 90 n. 3, p. 623-631 Issued Date 2010 URL http://hdl.handle.net/10722/130033 Journal of the Marine Biological Association of the United Rights Kingdom. Copyright © Cambridge University Press. Journal of the Marine Biological Association of the United Kingdom, 2010, 90(3), 623–631. # Marine Biological Association of the United Kingdom, 2009 doi:10.1017/S0025315409990841 Genetic variation of Oratosquilla oratoria (Crustacea: Stomatopoda) across Hong Kong waters elucidated by mitochondrial DNA control region sequences karen k.y. lui, priscilla t.y. leung, w.c. ng and kenneth m.y. leung The Swire Institute of Marine Science, and Division of Ecology & Biodiversity, School of Biological Sciences, University of Hong Kong, Pokfulam, Hong Kong, People’s Republic of China The population genetic structure of the mantis shrimp, Oratosquilla oratoria, in Hong Kong waters was determined using 923 base pairs of mitochondrial DNA control region sequences. Samples were collected from six localities including the open- waters and sheltered bays in both the eastern and western waters of Hong Kong. Twenty-seven haplotypes were detected in 99 individuals. A high overall haplotype diversity (h ¼ 0.886), with a low nucleotide diversity (p ¼ 0.0026), was observed, and the haplotype minimum spanning network suggested that rapid expansion might have occurred among the total stoma- topod population. Genetic homogeneity was observed over a meso-scale distance (80–100 km) whilst there were significant genetic differentiations between all pairs of the six samples. Partition of genetic variability based on hydrographic conditions did not reveal significant differentiations between: (1) eastern and western waters; and (2) open-waters and sheltered bays; but showed high levels of variation both within groups and within samples. Unexpectedly, genetic distance did not correlate with hydrographic distance among the samples. Results demonstrated a genetic patchiness pattern of O. oratoria in Hong Kong waters that may be attributable to the interplay between hydrographic conditions (e.g. salinity) and the species’ life history traits. Keywords: stomatopod, genetic patchiness, Hong Kong waters, Crustacea, control region Submitted 23 March 2009; accepted 18 July 2009; first published online 19 October 2009 INTRODUCTION Stomatopods are widely distributed in both temperate and tropical regions (Ahyong, 2001), and the planktonic stage of Many marine invertebrates have planktonic larvae which their larvae can last for 2–3 months (Provenzano & are dispersed by ocean currents (McEdward, 1995). These Manning, 1978; Morgan & Goy, 1987). Whilst the dispersal species are likely characterized by low levels of genetic differen- potential of stomatopod larvae is expected to be high (Barber tiation (i.e. high homogeneity) among populations over broad et al., 2002a), Reaka & Manning (1981) believed that such spatial scales, but it has become apparent that significant larvae do not appear to disperse over long distances as reflected genetic differentiation does exist among different populations by their limited geographical ranges. Haptosquilla glyptocercus, in some species (see Palumbi, 2003 for a review). This could for example, showed larval dispersal and recruitment over large be linked to a restricted larval dispersal ability (Tzeng et al., spatio-temporal scales, resulting in high genetic diversity 2004), mostly by selection (Hedgecock, 1986) or behavioural (Barber et al., 2002a). Conversely, Barber et al. (2002b) used differences (Burton & Feldman, 1982), and environmental genetic techniques to infer dispersal history among popu- factors, such as oceanic circulation patterns and hydrographic lations of the benthic reef stomatopod, Haptosquilla pulchella, conditions, which create physical barriers and subsequently and detected significant genetic differentiation over relatively limit gene flow (Palumbi, 1994; Perrin et al., 2004). Studies short distances (300 km) in the Indo-Pacific, despite an esti- on the relative importance of these factors on population mated long planktonic larval period (4–6 weeks). These afore- genetic structure are crucial to our understanding of the mentioned studies suggest that larval dispersal scales and impact of environmental changes on the ecological functioning genetic variation among populations are likely to be species of different populations, as well as the management of marine specific in the Stomatopoda. However, with limited data, the resources (Palumbi, 2003). In particular, the significance of genetic structure and larval dispersal potential of many stoma- intraspecific genetic diversity, including diversity among topods remains largely unknown. and within populations, has been emphasized with a view to Oratosquilla oratoria (Squillidae) is a common, commer- conserving genetic resources (Kenchington et al., 2003). cially important, stomatopod in the Indo-West Pacific region (Ahyong, 2001). A recent field study showed that it is Corresponding author: one of the most abundant benthic crustaceans in Hong P.T.Y. Leung Kong waters (Lui et al., 2007). In Hong Kong, the abundance Email: [email protected] of O. oratoria in western waters was consistently higher than 623 624 karen k.y. lui et al. in eastern waters, i.e. 4-fold difference in average monthly DNA extraction abundance. The reduced abundance in eastern waters could be ascribed to episodic hypoxia events during August and Approximately 100 mg muscle tissues were dissected from October (Lui, 2005). Laboratory-reared larvae of O. oratoria the fifth abdominal somite of each individual. Tissues were have a planktonic stage of between 36 and 59 days washed with sterile distilled water, cut into small pieces, (Hamano & Matsuura, 1987). Larvae may be able to disperse and transferred to 1.5 ml centrifuge tubes containing 500 ml over great distances during such a relatively long planktonic lysis buffer (100 mM Tris–HCL, pH 8.0, 20 mM EDTA, period and, thus, the degree of genetic differentiation among 1.4 M NaCl, 2.0% hexadecyltrimethylammonium bromide (CTAB)). Each tissue sample was incubated and digested populations is expected to be low. There is, however, a lack 21 of field-based population genetic studies to verify this postula- overnight at 558C with 45 ml proteinase K (1 mg ml ), and tion. Sequencing analysis of mitochondrial (mt) DNA is one the total genomic DNA was then extracted using the phenol- of the most common methods to detect genetic differentiation chloroform extraction method (Hoelzel & Green, 1992). The (Bagley & Gall, 1998; Refseth et al., 1998), and the mtDNA extracted DNA pellets were resuspended in 50 ml TE buffer control region with a generally high rate of base substitutions (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) and stored makes it a suitable marker for studies of intraspecific popu- at 48C before DNA amplification. lation genetics (Meyer, 1994). The present study aimed to examine the genetic structure within and among six samples DNA amplification and sequencing of O. oratoria in Hong Kong waters, using mtDNA control region sequences. A DNA segment of 1100-base pairs (bp; including the control region) was amplified by polymerase chain reaction (PCR) using apairofprimers,CR-F1(50 –TAACCGCGACTGCTGGCAC– 30) and CR-F2 (50 –GGGTATGAGCCCATTAGCTT–30) MATERIALS AND METHODS which were designed from the corresponding position of 13298 and 14772, respectively, of the blue crab Portunus tritu- Sample collection berculatus mt sequence (from GenBank—Accession number: AB093006). PCR amplifications were carried out in a Individuals of Oratosquilla oratoria were collected from the PTC-100 Thermocycler (MJ Research, USA). Thirty amplifica- eastern (two stations in Tolo Harbour, E1 and E2, N ¼ 34) tion cycles, each consisting of an initial DNA denaturation and western (two stations off southern Lantau Island, W1 step of 2 minutes at 948C, denaturation at 948Cfor1minute, and W2, N ¼ 35) waters of Hong Kong using a commercial annealing at 568C for 45 seconds, and extension at 728Cfor shrimp trawler (beam size: 1.5 m; stretched mesh size: 75 seconds, were performed. A 5 minute extension at 728C 2 cm), from June to July 2004 (Figure 1). Oratosquilla oratoria was included in the final cycle. Reagents (50 ml in volume) con- individuals were also collected from two locations in Hong tained 20 ng of template DNA, 1 unit of Taq DNA polymerase Kong’s surrounding waters (N ¼ 30), i.e. near Neilingding (InvitrogenTM Life Technologies Co.), 0.5 mMofeachprimer, Island (China-West, CW) and Dalu Wan (China-East, CE) 0.2 mM of each dNTPs (dATP, dCTP, dGTP and dTTP), (Figure 1). Samples were kept alive in the aquarium before 1.5 mM MgCl2 and 1ÂPCR buffer (200 mM Tris-HCl, pH DNA extraction. 8.4, 500 mM KCl). Fig. 1. Sampling locations for Oratosquilla oratoria in Hong Kong and surrounding waters: eastern waters: E1, E2 and CE; western waters: W1, W2 and CW. genetic structure of oratosquilla oratoria 625 An aliquot of 2 ml of each amplification was electrophor- stomatopod samples, those from eastern waters showed high esed on a 1.5% agarose gel to check for the correct fragment to moderate h values (0.588 to 0.952)