DOCSLIB.ORG

Calcium/Calmodulin-Dependent Protein Kinase Mediates a Pathway for Transcriptional Regulation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Calcium/Calmodulin-Dependent Protein Kinase Mediates a Pathway for Transcriptional Regulation Proc. Nadl. Acad. Sci. USA Vol. 88, pp. 3710-3714, May 1991 Biochemistry Calcium/calmodulin-dependent protein kinase mediates a pathway for transcriptional regulation (Rous sarcoma virus/long terminal repeat/CAAT/enhancer binding protein/prolactin gene) MICHAEL S. KAPILOFF*t, J. MICHAEL MATHIS*, CHARLES A. NELSON*t, CHIJEN R. LIN*, AND MICHAEL G. ROSENFELD*t tHoward Hughes Medical Institute, and *Eukaryotic Regulatory Biology Program, School of Medicine, University of California, San Diego, La Jolla, CA 92093-0648 Communicated by Morris E. Friedkin, January 17, 1991 ABSTRACT Calcium influx in response to extracellular prepare soluble extracts (17). Binding of antibody and cal- signals can modulate gene transcription. A constitutive, calci- modulin to nitrocellulose blots of SDS/PAGE size- um/calmodulin-independent mutant of type H calcium/ fractionated whole-cell protein was performed as described calmodulin-dependent protein kinase was capable ofincreasing (17). CaMKa activity in bacterial soluble extracts was as- the transcription rate ofspecific genes independently ofprotein sayed by using microtubule-associated protein 2 (MAP-2) as kinase C activation. This increase was mediated by transfer- a substrate (18). MAP-2 was separated from other radiola- nable cis-active elements capable of binding the transcription beled proteins by SDS/PAGE. factor CAAT/enhancer binding protein. Therefore, the acti- Transfectional Analyses. RSV CaMKa mutants were con- vation oftype II calcium/calmodulin-dependent protein kinase structed by substituting the appropriate sequence into a in response to stimuli that increase intracellular calcium is RSV-neor expression vector (19, 20). Rat prolactin [-3 proposed to represent a distinct second messenger pathway in kilobase pairs (kbp) or -422 bp to +36 bp] and growth calcium-mediated regulation of gene transcription. hormone (-316 to +7 bp) promoter reporter plasmids were described (21, 22). The mouse primase p49 promoter reporter Second messengers such as cAMP and calcium ions can plasmid was the generous gift of B. Tseng and C. Prussak activate serine/threonine protein kinases that modulate gene (University ofCalifornia San Diego, La Jolla, CA). One copy transcription (1, 2). In contrast to cAMP, calcium seems of the cAMP response element (CRE) from the a-chorionic capable of stimulating multiple signaling pathways (3, 4), gonadotropin gene (-208 to -185 bp) (1) or two copies of a including protein kinase C (5, 6). Brain-specific type II phorbol ester response element (PRE) (23) were inserted into calcium/calmodulin-dependent protein kinase (CaM-kinase) a -36- to +34-bp rat prolactin reporter plasmid (22). is a member of a family of evolutionarily conserved, widely An RSV LTR luciferase reporter plasmid was constructed expressed isozymes (7) implicated in exocytosis, long-term for expression studies. After conversion to Xho I of the Nde potentiation, and induction of oocyte maturation (8-10). I site of RSV-chloramphenicol acetyltransferase (24), the Because calmodulin antagonists can affect the rate of tran- Xho I to HindIII fragment (RSV LTR included) was sub- scription of the prolactin, fos, and proopiomelanocortin cloned into pBluescript. After conversion to Not I ofthe Aat genes, a calmodulin-dependent protein kinase may regulate II site in a pSV2ALA5'luciferase derivative (25), the com- gene transcription (5, 6, 11-13). To investigate a role for plete luciferase cDNA and simian virus 40 (SV40) termination CaM-kinase in transcriptional regulation, constitutively ac- sequences were transferred to pBluescript RSV LTR as a tive CaM-kinase mutants were engineered to isolate the HindIII/Not I fragment. Sequencing showed that the LTR potential effects of CaM-kinase from other calcium- fragment was of the nearly identical Schmidt-Ruppin strain dependent events. Calcium/calmodulin-independent forms A. The deletion series of the RSV LTR was designed as of the brain CaM-kinase a subunit (CaMKa) specifically follows: a unique Bgl II restriction site was introduced at activated the rat prolactin promoter and the Rous sarcoma -59, -111, -169, -285, and -488 bp with subsequent virus long terminal repeat (RSV LTR) promoter in cotrans- transfer of the appropriate Xho I/Bgl II and Bgl II/HindIII fection assays with cultured GC rat pituitary tumor cells. A fragments to form the complete set of10 deletion mutants. All CaM-kinase response element (CaMRE) is described that is deletions affected baseline activity, in agreement with pub- capable ofselectively conferring induction oftranscription by lished data (26). Double-stranded oligonucleotides (see Fig. activated CaM-kinase. 3C) corresponding to RSV strain D were inserted into the -36- to +34-bp prolactin promoter (22) and/or the Bgl II site of the -169-bp RSV LTR reporter plasmids. METHODS GC cells were transfected with DEAE-dextran as de- Bacterial Expression of CaMKa. The complete cDNA for scribed by using 10 ug ofplasmid DNA per 3 x 106 cells (20). CaMKa was constructed by fusing overlapping C3 and C31 After transfection, cells were incubated for 2 days in Dul- clones encoding partial rat sequences (14). After introduction becco's modified Eagle's medium containing 10%o fetal bo- of a Nde I site overlapping the codon for the initiator vine serum. Cells were induced with dibutyryl cAMP (1 mM methionine by site-directed mutagenesis, the bacterial final concentration) or phorbol 12-myristate 13-acetate expression vectors for CaMKa were constructed by insertion ofthe coding sequences into plasmid pT7-7 (15). pT7-CaMKa Abbreviations: CaM-kinase, type II calcium/calmodulin-dependent was expressed as described (16), and induced cells were protein kinase; CaMKa, CaM-kinase brain a subunit; C/EBP, either lysed into SDS/PAGE sample buffer or were used to CAAT/enhancer binding protein; RSV LTR, Rous sarcoma virus long terminal repeat; CaMRE, CaM-kinase response element; PMA, phorbol 12-myristate 13-acetate; MAP-2, microtubule-associated The publication costs of this article were defrayed in part by page charge protein 2; CRE, cAMP response element; PRE, phorbol ester payment. This article must therefore be hereby marked "advertisement" response element; SV40, simian virus 40. in accordance with 18 U.S.C. §1734 solely to indicate this fact. tTo whom reprint requests should be addressed. 3710 Downloaded by guest on September 27, 2021 Biochemistry: Kapiloff et al. Proc. Natl. Acad. Sci. USA 88 (1991) 3711 (PMA; 1 ,4M final concentration) when appropriate. Harvest- mutant proteins was assayed with the substrate MAP-2. As ing and luciferase assays were performed as described (25). shown in Fig. 1C, truncation mutants at residues 326 and 316 DNA Binding Protein Assays. A cDNA encoding CAAT/ displayed wild-type activity, while truncation at residue 290 enhancer binding protein (C/EBP) (27) was isolated from a resulted in constitutive calcium-independent MAP-2 phos- GC library and expressed in bacteria as described above (16). phorylation. Catalytic function was eliminated by the muta- GC nuclear extracts were prepared by the method of Sealey tion oflysine residue 42 to methionine (M42) in the consensus and Chalkley (28), and gel-shift mobility assays were per- ATP binding site (32). formed as described (29). For competition assays, CaMKa 1-290 Specifically Activates Gene Transcription. (NH4)2SO4-fractionated 530 mM nuclear extract (29) was The potential for CaM-kinase to modulate gene transcription bound to 70 pM end-labeled double-stranded oligonucleotide was investigated by cotransfection analyses in GC rat pitu- containing the RSV LTR sequence from -231 to -193 bp, in itary tumor cells (Fig. 2). Expression ofrat prolactin and RSV the presence of the indicated concentration of unlabeled LTR fusion genes was induced 2.7- and 14-fold, respectively, competitor oligonucleotide. DNase I footprinting (29) of the by cotransfection with the constitutive CaMKa 1-290 trun- RSV LTR from -285 to -52 bp was performed with excess cation protein (Fig. 2A). The expression of the rat growth (NH4)2SO4-fractionated 530 mM nuclear extract. hormone and mouse primase promoters was not altered. This induction was dependent on the presence of active CaM- kinase, since transcriptional effects were not observed when RESULTS cells were cotransfected with either unstimulated, wild-type Analysis of CaMKa Mutants. Bacterially expressed mu- enzyme or an inactivated CaMKa 1-290 (lysine to methionine tants of the rat brain CaMKa (Fig. lA) truncated prior to or at residue 42) mutant [1.1 ± 0.1- and 1.2 + 0.3-fold induction following the putative calmodulin-binding domain (14) were of RSV LTR, respectively (n = 3)]. RSV LTR inductions characterized by using a specific antibody or biotinylated were also obtained in cotransfections by using two full-length calmodulin (Fig. 1B). All mutant proteins migrated at the mutant forms of CaMKa containing constitutive activity expected molecular weight; an additional band at Mr 32,000 (M.S.K., unpublished data). (lanes WT and M42), resulting from a bacteria-specific trun- Reporter plasmids containing either CREs (1) or PREs (23) cation (31), was not detected with in vitro translation prod- were not regulated by the addition of constitutive CaMKa. ucts (F. Cruzalegui and M.S.K., unpublished data). Of the These results suggest that CaMKa does not regulate specific four mutations assayed, only truncation at residue 290 abol- gene induction via activation of protein kinase A or protein ished calmodulin binding (Fig. 1B, lane 13). Calcium- kinase C, even though bacterially expressed CRE binding dependent phosphorylation activity of the wild-type and protein is an effective in vitro CaM-kinase substrate (M.S.K., unpublished observations). Consistent with distinct func- A. Ca+l/CaM Dependent Protein Kinase tions of protein kinase C and CaM-kinase, addition of the Type 11 Brain cx-subunit phorbol ester PMA to cells cotransfected with CaMKa 1-290 activated the RSV LTR reporter plasmid approximately c CM Ca A. Z Luaferase SV40 ATP DFG SPE CaM cDNA splice polyA Fold-Induction by CaMKa 1-290 Binding Site Box Box Binding 5 10 15 Protein Kinase Regulatory Association (-3 kbp Domain Domain Domain Prolactin -422 bp Hormone B.
Load more

Recommended publications
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • GPCR Signaling Inhibits Mtorc1 Via PKA Phosphorylation of Raptor
    RESEARCH ARTICLE GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor Jenna L Jewell1,2,3*, Vivian Fu4,5, Audrey W Hong4,5, Fa-Xing Yu6, Delong Meng1,2,3, Chase H Melick1,2,3, Huanyu Wang1,2,3, Wai-Ling Macrina Lam4,5, Hai-Xin Yuan4,5, Susan S Taylor4,7, Kun-Liang Guan4,5* 1Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, United States; 2Harold C Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, United States; 3Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 4Department of Pharmacology, University of California, San Diego, La Jolla, United States; 5Moores Cancer Center, University of California San Diego, La Jolla, United States; 6Children’s Hospital and Institutes of Biomedical Sciences, Fudan University, Shanghai, China; 7Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, United States Abstract The mammalian target of rapamycin complex 1 (mTORC1) regulates cell growth, metabolism, and autophagy. Extensive research has focused on pathways that activate mTORC1 like growth factors and amino acids; however, much less is known about signaling cues that directly inhibit mTORC1 activity. Here, we report that G-protein coupled receptors (GPCRs) paired to Gas proteins increase cyclic adenosine 3’5’ monophosphate (cAMP) to activate protein kinase A (PKA) and inhibit mTORC1. Mechanistically, PKA phosphorylates the mTORC1 component Raptor on Ser 791, leading to decreased mTORC1 activity. Consistently, in cells where Raptor Ser 791 is mutated to Ala, mTORC1 activity is partially rescued even after PKA activation. Gas-coupled GPCRs *For correspondence: stimulation leads to inhibition of mTORC1 in multiple cell lines and mouse tissues.
    [Show full text]
  • The Control of Phosphorylase Phosphatase by Camp-Dependent Protein Kinase
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Volume 82, number 2 FEBS LETTERS October 1977 THE CONTROL OF PHOSPHORYLASE PHOSPHATASE BY CAMP-DEPENDENT PROTEIN KINASE Pi1 GERGELY and Gyijrgy BOT Institute of Medical Chemistry, University of Medicine, H-4026 Debrecen, Bern t& 18/B, Hungary Received 22 July 1977 1. Introduction tissues which inhibits the phosphatase reaction is heat- stable [ 11 ,121. This heat-stable inhibitor protein is The enzymes of glycogen metabolism are regulated phosphorylated by CAMP-dependent protein kinase by interconversion between phosphorylated and dephos- [ 131. Recently, T&h et al. demonstrated the reversible phorylated forms. Contrary to our well-defined knowl- phosphorylation and dephosphorylation of this heat- edge of the phosphorylation processes of different stable inhibitor protein in vivo [ 143. Huang and Glins- enzymes and their role in glycogen breakdown and mann demonstrated the existence of two heat-stable synthesis, the phosphatases catalyzing the reverse inhibitor proteins for phosphatase [ 15,161. processes are only now being understood. The regula- Enzymic chemical modification of phosphorylase tion of dephosphorylation reactions is still unclear. phosphatase has not been established as a means of Phosphorylase phosphatase converts ‘active’ phos- regulation [ 171. phorylase a (EC 2.4.1.1) into ‘inactive’ phosphorylase In the present communication the effect of CAMP- b by cleavage of the phosphate groups from the serine dependent protein kinase on the phosphatase reaction residues. For the control of phosphorylase phospha- (i.e., on the dephosphorylation of phosphorylase a) tase the following mechanisms are possible: has been investigated.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]
  • Activation of Mtorc1 Is Essential for Β-Adrenergic Stimulation of Adipose Browning
    Downloaded from http://www.jci.org on May 2, 2016. http://dx.doi.org/10.1172/JCI83532 The Journal of Clinical Investigation RESEARCH ARTICLE Activation of mTORC1 is essential for β-adrenergic stimulation of adipose browning Dianxin Liu,1 Marica Bordicchia,1 Chaoying Zhang,1 Huafeng Fang,1 Wan Wei,1 Jian-Liang Li,1 Adilson Guilherme,2 Kalyani Guntur,2 Michael P. Czech,2 and Sheila Collins1 1Diabetes and Obesity Research Center, Sanford Burnham Prebys Medical Discovery Institute, Orlando, Florida, USA. 2Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, Massachusetts, USA. A classic metabolic concept posits that insulin promotes energy storage and adipose expansion, while catecholamines stimulate release of adipose energy stores by hydrolysis of triglycerides through β-adrenergic receptor (βARs) and protein kinase A (PKA) signaling. Here, we have shown that a key hub in the insulin signaling pathway, activation of p70 ribosomal S6 kinase (S6K1) through mTORC1, is also triggered by PKA activation in both mouse and human adipocytes. Mice with mTORC1 impairment, either through adipocyte-specific deletion of Raptor or pharmacologic rapamycin treatment, were refractory to the well-known βAR-dependent increase of uncoupling protein UCP1 expression and expansion of beige/brite adipocytes (so-called browning) in white adipose tissue (WAT). Mechanistically, PKA directly phosphorylated mTOR and RAPTOR on unique serine residues, an effect that was independent of insulin/AKT signaling. Abrogation of the PKA site within RAPTOR disrupted βAR/mTORC1 activation of S6K1 without affecting mTORC1 activation by insulin. Conversely, a phosphomimetic RAPTOR augmented S6K1 activity. Together, these studies reveal a signaling pathway from βARs and PKA through mTORC1 that is required for adipose browning by catecholamines and provides potential therapeutic strategies to enhance energy expenditure and combat metabolic disease.
    [Show full text]
  • AMP-Activated Protein Kinase: a Potential Therapeutic Target for Triple
    Cao et al. Breast Cancer Research (2019) 21:29 https://doi.org/10.1186/s13058-019-1107-2 REVIEW Open Access AMP-activated protein kinase: a potential therapeutic target for triple-negative breast cancer Wei Cao1,2, Jieqing Li2,3, Qiongyu Hao2, Jaydutt V Vadgama2* and Yong Wu2* Abstract Triple-negative breast cancer (TNBC) is an aggressive subset of breast carcinomas that lack expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER2). Unlike other breast cancer subtypes, targeted therapy is presently unavailable for patients with TNBC. In spite of initial responses to chemotherapy, drug resistance tends to develop rapidly and the prognosis of metastatic TNBC is poor. Hence, there is an urgent need for novel-targeted treatment methods or development of safe and effective alternatives with recognized mechanism(s) of action. AMP-activated protein kinase (AMPK), an energy sensor, can regulate protein and lipid metabolism responding to alterations in energy supply. In the past 10 years, interest in AMPK has increased widely since it appeared as an attractive targeting molecule for cancer therapy. There has been a deep understanding of the possible role of abnormal AMPK signaling pathways in the regulation of growth and survival and the development of drug resistance in TNBC. The increasing popularity of using AMPK regulators for TNBC- targeted therapy is supported by a considerable development in ascertaining the molecular pathways implicated. This review highlights the available evidence for AMPK-targeted anti-TNBC activity of various agents or treatment strategies, with special attention placed on recent preclinical and clinical advances in the manipulation of AMPK in TNBC.
    [Show full text]
  • The Role of GSK-3 in the Regulation of Protein Turnover, Myosin
    International Journal of Molecular Sciences Review The Role of GSK-3β in the Regulation of Protein Turnover, Myosin Phenotype, and Oxidative Capacity in Skeletal Muscle under Disuse Conditions Timur M. Mirzoev * , Kristina A. Sharlo and Boris S. Shenkman Myology Laboratory, Institute of Biomedical Problems RAS, 123007 Moscow, Russia; [email protected] (K.A.S.); [email protected] (B.S.S.) * Correspondence: [email protected] Abstract: Skeletal muscles, being one of the most abundant tissues in the body, are involved in many vital processes, such as locomotion, posture maintenance, respiration, glucose homeostasis, etc. Hence, the maintenance of skeletal muscle mass is crucial for overall health, prevention of various diseases, and contributes to an individual’s quality of life. Prolonged muscle inactivity/disuse (due to limb immobilization, mechanical ventilation, bedrest, spaceflight) represents one of the typical causes, leading to the loss of muscle mass and function. This disuse-induced muscle loss primarily results from repressed protein synthesis and increased proteolysis. Further, prolonged disuse results in slow-to-fast fiber-type transition, mitochondrial dysfunction and reduced oxidative capacity. Glycogen synthase kinase 3β (GSK-3β) is a key enzyme standing at the crossroads of various signaling pathways regulating a wide range of cellular processes. This review discusses various important roles of GSK-3β in the regulation of protein turnover, myosin phenotype, and oxidative capacity in skeletal muscles under disuse/unloading conditions and subsequent recovery. According Citation: Mirzoev, T.M.; Sharlo, K.A.; to its vital functions, GSK-3β may represent a perspective therapeutic target in the treatment of Shenkman, B.S. The Role of GSK-3β muscle wasting induced by chronic disuse, aging, and a number of diseases.
    [Show full text]
  • MTOR Signaling and Metabolism in Early T Cell Development
    G C A T T A C G G C A T genes Review MTOR Signaling and Metabolism in Early T Cell Development Guy Werlen, Ritika Jain and Estela Jacinto * Department of Biochemistry and Molecular Biology, Robert Wood Johnson Medical School, Rutgers University, Piscataway, NJ 08854, USA; [email protected] (G.W.); [email protected] (R.J.) * Correspondence: [email protected]; Tel.: +1-732-235-4476 Abstract: The mechanistic target of rapamycin (mTOR) controls cell fate and responses via its func- tions in regulating metabolism. Its role in controlling immunity was unraveled by early studies on the immunosuppressive properties of rapamycin. Recent studies have provided insights on how metabolic reprogramming and mTOR signaling impact peripheral T cell activation and fate. The contribution of mTOR and metabolism during early T-cell development in the thymus is also emerging and is the subject of this review. Two major T lineages with distinct immune functions and peripheral homing organs diverge during early thymic development; the αβ- and γδ-T cells, which are defined by their respective TCR subunits. Thymic T-regulatory cells, which have immunosup- pressive functions, also develop in the thymus from positively selected αβ-T cells. Here, we review recent findings on how the two mTOR protein complexes, mTORC1 and mTORC2, and the signaling molecules involved in the mTOR pathway are involved in thymocyte differentiation. We discuss emerging views on how metabolic remodeling impacts early T cell development and how this can be mediated via mTOR signaling. Keywords: mTOR; mTORC1; mTORC2; thymocytes; T lymphocytes; early T cell development; T-cell metabolism Citation: Werlen, G.; Jain, R.; Jacinto, E.
    [Show full text]