The Contribution of Exon-Skipping Events on Chromosome 22 to Protein Coding Diversity
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
PARSANA-DISSERTATION-2020.Pdf
DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks. -
Genome-Wide Analysis and Characterization of F-Box Gene Family in Gossypium Hirsutum L Shulin Zhang1,2, Zailong Tian1, Haipeng Li1, Yutao Guo1, Yanqi Zhang1, Jeremy A
Zhang et al. BMC Genomics (2019) 20:993 https://doi.org/10.1186/s12864-019-6280-2 RESEARCH ARTICLE Open Access Genome-wide analysis and characterization of F-box gene family in Gossypium hirsutum L Shulin Zhang1,2, Zailong Tian1, Haipeng Li1, Yutao Guo1, Yanqi Zhang1, Jeremy A. Roberts3, Xuebin Zhang1* and Yuchen Miao1* Abstract Background: F-box proteins are substrate-recognition components of the Skp1-Rbx1-Cul1-F-box protein (SCF) ubiquitin ligases. By selectively targeting the key regulatory proteins or enzymes for ubiquitination and 26S proteasome mediated degradation, F-box proteins play diverse roles in plant growth/development and in the responses of plants to both environmental and endogenous signals. Studies of F-box proteins from the model plant Arabidopsis and from many additional plant species have demonstrated that they belong to a super gene family, and function across almost all aspects of the plant life cycle. However, systematic exploration of F-box family genes in the important fiber crop cotton (Gossypium hirsutum) has not been previously performed. The genome- wide analysis of the cotton F-box gene family is now possible thanks to the completion of several cotton genome sequencing projects. Results: In current study, we first conducted a genome-wide investigation of cotton F-box family genes by reference to the published F-box protein sequences from other plant species. 592 F-box protein encoding genes were identified in the Gossypium hirsutume acc.TM-1 genome and, subsequently, we were able to present their gene structures, chromosomal locations, syntenic relationships with their parent species. In addition, duplication modes analysis showed that cotton F-box genes were distributed to 26 chromosomes, with the maximum number of genes being detected on chromosome 5. -
Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R. -
GCAT|Panel, a Comprehensive Structural Variant Haplotype Map of the Iberian Population from High-Coverage Whole-Genome Sequencing
bioRxiv preprint doi: https://doi.org/10.1101/2021.07.20.453041; this version posted July 21, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GCAT|Panel, a comprehensive structural variant haplotype map of the Iberian population from high-coverage whole-genome sequencing Jordi Valls-Margarit1,#, Iván Galván-Femenía2,3,#, Daniel Matías-Sánchez1,#, Natalia Blay2, Montserrat Puiggròs1, Anna Carreras2, Cecilia Salvoro1, Beatriz Cortés2, Ramon Amela1, Xavier Farre2, Jon Lerga- Jaso4, Marta Puig4, Jose Francisco Sánchez-Herrero5, Victor Moreno6,7,8,9, Manuel Perucho10,11, Lauro Sumoy5, Lluís Armengol12, Olivier Delaneau13,14, Mario Cáceres4,15, Rafael de Cid2,*,† & David Torrents1,15,* 1. Life sciences dept, Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain. 2. Genomes for Life-GCAT lab Group, Institute for Health Science Research Germans Trias i Pujol (IGTP), Badalona, 08916, Spain. 3. Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, 08028, Barcelona, Spain (current affiliation). 4. Institut de Biotecnologia i de Biomedicina, Universitat Autònoma de Barcelona, Bellaterra, Barcelona, 08193, Spain. 5. High Content Genomics and Bioinformatics Unit, Institute for Health Science Research Germans Trias i Pujol (IGTP), 08916, Badalona, Spain. 6. Catalan Institute of Oncology, Hospitalet del Llobregat, 08908, Spain. 7. Bellvitge Biomedical Research Institute (IDIBELL), Hospitalet del Llobregat, 08908, Spain. 8. CIBER Epidemiología y Salud Pública (CIBERESP), Madrid, 28029, Spain. 9. Universitat de Barcelona (UB), Barcelona, 08007, Spain. -
Interoperability in Toxicology: Connecting Chemical, Biological, and Complex Disease Data
INTEROPERABILITY IN TOXICOLOGY: CONNECTING CHEMICAL, BIOLOGICAL, AND COMPLEX DISEASE DATA Sean Mackey Watford A dissertation submitted to the faculty at the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Gillings School of Global Public Health (Environmental Sciences and Engineering). Chapel Hill 2019 Approved by: Rebecca Fry Matt Martin Avram Gold David Reif Ivan Rusyn © 2019 Sean Mackey Watford ALL RIGHTS RESERVED ii ABSTRACT Sean Mackey Watford: Interoperability in Toxicology: Connecting Chemical, Biological, and Complex Disease Data (Under the direction of Rebecca Fry) The current regulatory framework in toXicology is expanding beyond traditional animal toXicity testing to include new approach methodologies (NAMs) like computational models built using rapidly generated dose-response information like US Environmental Protection Agency’s ToXicity Forecaster (ToXCast) and the interagency collaborative ToX21 initiative. These programs have provided new opportunities for research but also introduced challenges in application of this information to current regulatory needs. One such challenge is linking in vitro chemical bioactivity to adverse outcomes like cancer or other complex diseases. To utilize NAMs in prediction of compleX disease, information from traditional and new sources must be interoperable for easy integration. The work presented here describes the development of a bioinformatic tool, a database of traditional toXicity information with improved interoperability, and efforts to use these new tools together to inform prediction of cancer and complex disease. First, a bioinformatic tool was developed to provide a ranked list of Medical Subject Heading (MeSH) to gene associations based on literature support, enabling connection of compleX diseases to genes potentially involved. -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
Neddylation: a Novel Modulator of the Tumor Microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1*
Zhou et al. Molecular Cancer (2019) 18:77 https://doi.org/10.1186/s12943-019-0979-1 REVIEW Open Access Neddylation: a novel modulator of the tumor microenvironment Lisha Zhou1,2*†, Yanyu Jiang3†, Qin Luo1, Lihui Li1 and Lijun Jia1* Abstract Neddylation, a post-translational modification that adds an ubiquitin-like protein NEDD8 to substrate proteins, modulates many important biological processes, including tumorigenesis. The process of protein neddylation is overactivated in multiple human cancers, providing a sound rationale for its targeting as an attractive anticancer therapeutic strategy, as evidence by the development of NEDD8-activating enzyme (NAE) inhibitor MLN4924 (also known as pevonedistat). Neddylation inhibition by MLN4924 exerts significantly anticancer effects mainly by triggering cell apoptosis, senescence and autophagy. Recently, intensive evidences reveal that inhibition of neddylation pathway, in addition to acting on tumor cells, also influences the functions of multiple important components of the tumor microenvironment (TME), including immune cells, cancer-associated fibroblasts (CAFs), cancer-associated endothelial cells (CAEs) and some factors, all of which are crucial for tumorigenesis. Here, we briefly summarize the latest progresses in this field to clarify the roles of neddylation in the TME, thus highlighting the overall anticancer efficacy of neddylaton inhibition. Keywords: Neddylation, Tumor microenvironment, Tumor-derived factors, Cancer-associated fibroblasts, Cancer- associated endothelial cells, Immune cells Introduction Overall, binding of NEDD8 molecules to target proteins Neddylation is a reversible covalent conjugation of an can affect their stability, subcellular localization, conform- ubiquitin-like molecule NEDD8 (neuronal precursor ation and function [4]. The best-characterized substrates cell-expressed developmentally down-regulated protein of neddylation are the cullin subunits of Cullin-RING li- 8) to a lysine residue of the substrate protein [1, 2]. -
Extensive Characterization of IFN-Induced Gtpases Mgbp1 to Mgbp10 Involved in Host Defense
Extensive Characterization of IFN-Induced GTPases mGBP1 to mGBP10 Involved in Host Defense This information is current as Daniel Degrandi, Carolin Konermann, Cornelia of October 1, 2021. Beuter-Gunia, Alexandra Kresse, Jan Würthner, Stefanie Kurig, Sandra Beer and Klaus Pfeffer J Immunol 2007; 179:7729-7740; ; doi: 10.4049/jimmunol.179.11.7729 http://www.jimmunol.org/content/179/11/7729 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2008/03/10/179.11.7729.DC1 Material http://www.jimmunol.org/ References This article cites 56 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/179/11/7729.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Extensive Characterization of IFN-Induced GTPases mGBP1 to mGBP10 Involved in Host Defense1 Daniel Degrandi,2 Carolin Konermann,2 Cornelia Beuter-Gunia,2 Alexandra Kresse, Jan Wu¨rthner, Stefanie Kurig, Sandra Beer,3 and Klaus Pfeffer3 IFN-␥ orchestrates a potent antimicrobial host response. -
GCAT (NM 014291) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG204870 GCAT (NM_014291) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GCAT (NM_014291) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCAT Synonyms: KBL Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG204870 representing NM_014291 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCCTGGGAACGCCTGGCGCGCCGCACTCTTCTGGGTGCCCCGCGGCCGCCGCGCACAGTCAGCGC TGGCCCAGCTGCGTGGCATTCTGGAGGGGGAGCTGGAAGGCATCTGCGGAGCTGGCACTTGGAAGAGTGA GCGGGTCATCACGTCCCGTCAGGGGCCGCACATCCGCGTGGACGGCGTCTCCGGAGGAATCCTTAACTTC TGTGCCAACAACTACCTGGGCCTGAGCAGCCACCCTGAGGTGATCCAGGCAGGTCTGCAGGCTCTGGAGG AGTTTGGAGCTGGCCTCAGCTCTGTCCGCTTTATCTGTGGAACCCAGAGCATCCACAAGAATCTAGAAGC AAAAATAGCCCGCTTCCACCAGCGGGAGGATGCCATCCTCTATCCCAGCTGTTATGACGCCAACGCCGGC CTCTTTGAGGCCCTGCTGACCCCAGAGGACGCAGTCCTGTCGGACGAGCTGAACCATGCCTCCATCATCG ACGGCATCCGGCTGTGCAAGGCCCACAAGTACCGCTATCGCCACCTGGACATGGCCGACCTAGAAGCCAA GCTGCAGGAGGCCCAGAAGCATCGGCTGCGCCTGGTGGCCACTGATGGGGCCTTTTCCATGGATGGCGAC ATCGCACCCCTGCAGGAGATCTGCTGCCTCGCCTCTAGATATGGTGCCCTGGTCTTCATGGATGAATGCC ATGCCACTGGCTTCCTGGGGCCCACAGGACGGGGCACAGATGAGCTGCTGGGTGTGATGGACCAGGTCAC CATCATCAACTCCACCCTGGGGAAGGCCCTGGGTGGAGCATCAGGGGGCTACACGACAGGGCCTGGGCCC CTGGTGTCCCTGCTGCGGCAGCGCGCCCGGCCATACCTCTTCTCCAACAGTCTGCCACCTGCTGTCGTTG -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
Open Data for Differential Network Analysis in Glioma
International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes. -
Identification of Transcriptional Mechanisms Downstream of Nf1 Gene Defeciency in Malignant Peripheral Nerve Sheath Tumors Daochun Sun Wayne State University
Wayne State University DigitalCommons@WayneState Wayne State University Dissertations 1-1-2012 Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors Daochun Sun Wayne State University, Follow this and additional works at: http://digitalcommons.wayne.edu/oa_dissertations Recommended Citation Sun, Daochun, "Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors" (2012). Wayne State University Dissertations. Paper 558. This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. IDENTIFICATION OF TRANSCRIPTIONAL MECHANISMS DOWNSTREAM OF NF1 GENE DEFECIENCY IN MALIGNANT PERIPHERAL NERVE SHEATH TUMORS by DAOCHUN SUN DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2012 MAJOR: MOLECULAR BIOLOGY AND GENETICS Approved by: _______________________________________ Advisor Date _______________________________________ _______________________________________ _______________________________________ © COPYRIGHT BY DAOCHUN SUN 2012 All Rights Reserved DEDICATION This work is dedicated to my parents and my wife Ze Zheng for their continuous support and understanding during the years of my education. I could not achieve my goal without them. ii ACKNOWLEDGMENTS I would like to express tremendous appreciation to my mentor, Dr. Michael Tainsky. His guidance and encouragement throughout this project made this dissertation come true. I would also like to thank my committee members, Dr. Raymond Mattingly and Dr. John Reiners Jr. for their sustained attention to this project during the monthly NF1 group meetings and committee meetings, Dr.