Extensive Characterization of IFN-Induced Gtpases Mgbp1 to Mgbp10 Involved in Host Defense

Extensive Characterization of IFN-Induced GTPases mGBP1 to mGBP10 Involved in Host Defense

This information is current as Daniel Degrandi, Carolin Konermann, Cornelia of October 1, 2021. Beuter-Gunia, Alexandra Kresse, Jan Würthner, Stefanie Kurig, Sandra Beer and Klaus Pfeffer J Immunol 2007; 179:7729-7740; ; doi: 10.4049/jimmunol.179.11.7729 http://www.jimmunol.org/content/179/11/7729 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2008/03/10/179.11.7729.DC1 Material http://www.jimmunol.org/ References This article cites 56 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/179/11/7729.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Extensive Characterization of IFN-Induced GTPases mGBP1 to mGBP10 Involved in Host Defense1

Daniel Degrandi,2 Carolin Konermann,2 Cornelia Beuter-Gunia,2 Alexandra Kresse, Jan Wu¨rthner, Stefanie Kurig, Sandra Beer,3 and Klaus Pfeffer3

IFN-␥ orchestrates a potent antimicrobial host response. However, the underlying molecular basis for this immunological defense system is largely unknown. In a systematic approach to identify IFN-␥-regulated host effector molecules, a notable number of transcripts with consensus GTP-binding motives were obtained. Further extensive transcriptome and genome analyses identified five novel family members of murine guanylate-binding proteins (mGBPs) now designated mGBP6, 7, 8, 9, and 10. Moreover, in this study, all 10 mGBP members (mGBP1–10) were extensively characterized. mGBPs are selectively up-regulated in vitro by a set of proinflammatory cytokines and TLR agonists as well as in vivo after Listeria monocytogenes and Toxoplasma gondii infection. After IFN-␥ stimulation, mGBP1, 2, 3, 6, 7, and 9 are associated with intracellular Toxoplasma parasites and, interestingly, Downloaded from virulent Toxoplasma interfere with mGBP recruitment. Taken together, mGBPs comprise an important set of host defense molecules. The Journal of Immunology, 2007, 179: 7729–7740.

nterferons and TNF factors are essential for control of intra- intracellular pathogens, such as Listeria monocytogenes and Tox- cellular pathogens (1–3). Moreover IFN-␥ has been shown to oplasma gondii in mice (6, 9). Although IRGs exist in several be important for survival in polymicrobial sepsis (4). IFNs mammalian species, the gene family appears to be degenerated in I http://www.jimmunol.org/ regulate the expression of several hundred genes, including three humans (10). families of GTPases: Mx proteins, p47 GTPases, and p65 guany- In contrast, the 65-kDa GBPs are highly conserved throughout late-binding proteins (GBPs)4 (5, 6). The p65 GBPs and the im- the vertebrate lineage. After the first description of human GBP1 munity-related GTPases (IRGs), formerly named as p47 GTPases, (hGBP1) (11, 12), closely related genes have been found in mice, are among the most abundantly activated transcripts induced by humans, and several other species (13–18). IFN-␥. Together with type I IFN-induced Mx proteins, IRGs were GBPs have been assigned to the superfamily of dynamin-related described as playing important roles during pathogen infections GTP-binding proteins (19). Although diverse in their primary se- (7). Mx proteins have been shown to possess a potent antiviral quences, dynamin-related GTP-binding proteins have common activity against a wide range of RNA viruses, e.g., influenza and structural features comprising a large GTP-binding domain, a mid- by guest on October 1, 2021 vesicular stomatitis virus (VSV). Recent studies have attributed dle domain, and a GTPase effector domain as well as the common this effect to direct interaction of the protein with viral particles, biochemical property of oligomerization-dependent GTPase activ- ␥ thereby inhibiting viral replication (8). The IFN- induced IRGs ity (19). have been the subject of extensive studies in recent years (6, 9). Despite that 65-kDa GBPs have been known for Ͼ20 years, most Currently 23 IRG genes are known in mice (10). Through the aspects of their functions remain enigmatic. Recent studies have investigation of gene-deficient mouse strains, members of the shown that hGBP1 and murine GBP2 (mGBP2) are involved in cell IRGs, such as Irgm1 (LRG-47), Irgd (IRG-47), and Irgm3 (IGTP), growth regulation. Overexpression of mGBP2 promotes cell prolifer- have been established as essential proteins during infection with ation in NIH 3T3 fibroblasts (20), whereas retroviral expression of hGBP1 inhibits proliferation of human endothelial cells (21). Al- though these findings seem contradictory at first, the effects of Institute of Medical Microbiology and Hospital Hygiene, Heinrich-Heine-University, Dusseldorf, Germany mGBP2 and hGBP1 mirror the respective proliferative activities of IFN-␥ on these cell lines. hGBP1 also has been shown to negatively Received for publication June 27, 2007. Accepted for publication August 22, 2007. regulate expression of matrix metalloproteinase 1 in endothelial cells, The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance leading to reduced invasive capabilities of the cells into collagen I with 18 U.S.C. Section 1734 solely to indicate this fact. matrices (22). Additionally, hGBP1 expression has been associated 1 This work was supported by Grants PF259/3-3, FOR729, and Leibniz (to K.P.) and with paclitaxel resistance in ovarian cancer cell lines (23). GRK1045/1 (to S.B. and K.P.) from Deutsche Forschungsgemeinschaft and MUGEN Furthermore, with respect to immune function, hGBP1 and (to K.P.). mGBP2 have been shown to mediate antiviral activities in HeLa 2 D.D., C.K., and C.B.-G. contributed equally to this study. cells and NIH 3T3 fibroblasts, respectively, after infection with 3 Address correspondence and reprint requests to Dr. Sandra Beer or Dr. Klaus Pfef- fer, Institute of Medical Microbiology and Hospital Hygiene, Universitaetsstrasse 1, VSV or encephalomyocarditis virus (24, 25). However, this anti- Geb. 22.21, Dusseldorf, Germany. E-mail addresses: [email protected] viral activity was significantly lower than that measured for Mx or [email protected] proteins. The viral growth inhibition by mGBP2 was dependent on 4 Abbreviations used in this paper: GBP, guanylate-binding protein; IRG, immunity- GTP binding for encephalomyocarditis virus but not for VSV, sug- related GTPase; PV, parasitophorous vacuole; VSV, vesicular stomatitis virus; IRG, immunity-related GTPase; hGBP, human GBP; mGBP, murine GBP; DAPI, 4Ј,6- gesting different effector mechanisms of the protein depending on diamidino-2-phenylindole; iNOS, inducible NO synthase; MEF, murine embryonic the type of virus. However, the biological functions of GBPs in fibroblast. host defense against bacterial and protozoan infections have been Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 elusive up to now. www.jimmunol.org 7730 CHARACTERIZATION OF mGBP1 TO mGBP10

In an effort to screen for IFN-␥-initiated antimicrobial mecha- For stimulation experiments, the following reagents were used: 10 ng/ml nisms in immune cells, five cDNAs were identified that encode recombinant mouse IFN-␤ (PBL Biomedical Laboratories), 10 ng/ml re- ␥ novel members of the 65-kDa mGBP family, extending its number combinant mouse IFN- (R&D Systems), 10 ng/ml recombinant murine IL-1␤ (R&D Systems), 10 ng/ml recombinant murine IL-2 (R&D Sys- to 10 highly homologous genes. All mGBPs were the subject of tems), 10 ng/ml recombinant murine TNF-␣ (R&D Systems), 1 ␮g/ml extensive mRNA and protein expression analyses demonstrating a lipoteichoic acid (derived from L. monocytogenes; provided by T. Hartung, strong induction in vitro under proinflammatory conditions and in Konstanz, Germany), 100 ng/ml LPS E. coli 055:B5 (Sigma-Aldrich), 1 vivo after infection of mice with L. monocytogenes or T. gondii. ␮M CpG1668 (TIB MOLBIOL), and 1 ␮g/ml poly(I:C) (Sigma-Aldrich). At the indicated time points, cells were harvested for preparation of RNA. Additionally, an enclosure of intracellular T. gondii by distinct Unstimulated cells served as control. mGBP family members could be shown. Interestingly, highly virulent T. gondii were able to interfere with the enclosure by mGBPs. Taken Real-time RT-PCR analyses together, this is the first report that indicates a role for mGBPs in host Total RNA from cells or tissues was isolated using TRIzol reagent (In- defense in bacterial and protozoan infections. vitrogen Life Technologies) according to the manufacturer’s protocol. First-strand cDNA synthesis was performed using 1 ␮g of total RNA with Materials and Methods Moloney murine leukemia virus reverse transcriptase and oligo(dT) primer Transcriptome profiling (Invitrogen Life Technologies). Real-time RT-PCRs were performed using primers and probes listed in Table I and based on conventional TaqMan Synthesis of biotin-labeled cRNA samples was performed using standard Probe finder (TIB MOLBIOL) for mGBP6/10, mGBP8, and mGBP9 or protocols supplied by the manufacturer (Affymetrix). Briefly, double- UniversalProbeLibrary (Roche). RT-PCR specificity was verified by using stranded cDNA was synthesized from total RNA using a T7-tagged oli- cloned cDNAs as templates. go(dT) primer (Eurogentec). The double-stranded cDNA was directly used The PCR primer sets used were designed to be intron overspanning to in an in vitro transcription reaction with T7 polymerase in the presence of avoid detection of genomic DNA. All cDNAs were assayed in duplicate Downloaded from biotin-labeled nucleotides (BioArray High-Yield RNA Transcript Labeling and results are expressed relative to expression in unstimulated cells or Ϫ⌬⌬CP Kit; Enzo Biochem). Biotin-labeled cRNA samples were used for hybrid- uninfected mice (2 ), and normalized to ␤-actin. ization of Affymetrix MG-U74v2 high-density oligonucleotide arrays. Hy- bridization, staining, and washing of the arrays were performed according In vitro passage of T. gondii to the manufacturer’s specifications using a Affymetrix GeneChip Fluidics Tachyzoites from T. gondii strain ME49 and BK were maintained by serial Station 400. passage in confluent monolayers of human foreskin fibroblasts as host cells

Scanning of the arrays was performed on an Agilent GeneArray Scanner. http://www.jimmunol.org/ (HS27, ATCC CRL-1634). After infection of fibroblasts, parasites were Scanned raw data images were processed with Affymetrix MAS 5.0 software. harvested from culture supernatant and purified from host cell debris by Arrays were normalized using invariant set features and the dChip software differential centrifugation (5 min, 50 ϫ g; 15 min, 500 ϫ g) 3 days after (www.dchip.org; 26). Identification of differentially expressed genes was done infection. Parasites were resuspended in medium, counted, and immedi- with the SAM software (www-stat.stanford.edu/tibs/SAM/; 27), using non- ately used for inoculation of the host cells. parametric, permutation-based methods. Alignment and phylogenetic analysis Infection of murine embryonic fibroblasts and RAW 264.7 macrophages with T. gondii The software ClustalW (28) was used for the alignment and JalView (www.jalview.org) was used for the alignment-layout. The phylogenetic Cells were stimulated with 100 U/ml IFN-␥ (R&D Systems) 16 h before infection, whereas control cultures were left untreated. Macrophages were analysis was accomplished by use of the maximum likelihood method and by guest on October 1, 2021 Treepuzzle (www.tree-puzzle.de) for construction of the phylogenetic tree. transfected via electroporation (GenePulser; Bio-Rad) with the indicated The Treepuzzle software was run with the option for exact parameter es- expression constructs 1 day before IFN-␥ stimulation. For immunostaining, timates using the neighbor-joining method. Finally, the software Drawtree cells were cultured in 24-well plates (Falcon; BD Biosciences) on cover- from the Phylip package (www.phylip.com) was used to plot the tree data. slips and inoculated with freshly harvested T. gondii at a ratio of 50:1. To All software was run on a Linux PC workstation. remove extracellular parasites, cells were washed with PBS. Cell culture and stimulation Generation of mGBP-specific antisera The macrophage cell line ANA-1 (29) was cultured in very low endotoxin Rabbits were immunized with specific peptides RQEIEKIKNMPPPRSC RPMI 1640 (Biochrom) supplemented with 10% heat-inactivated, low en- (mGBP1), EVNGKPVTSDEYLEHC (mGBP2), CLREEMERTRRKPSLF dotoxin FCS (Cambrex), and 50 ␮M 2-ME (Invitrogen Life Technologies). (mGBP3), CNIKEMKQNGDSLVES (mGBP4), CEQLKANYRQQPGK

Table I. Primers and probes used to perform real-time RT-PCRs

Target Gene Forward Primer Reverse Primer Hybridization Probe Amplicon (bp)

␤-actin TGACAGGATGCAGAAGGAGA CGCTCAGGAGGAGCAATG CTCTGGCTa 75 mGBP1 CAGACTCCTGGAAAGGGACTC CTTGGATTCAAAGTATTTTCTCAGC GGCTGAAGa 60 mGBP2 TGAGTACCTGGAACATTCACTGAC AGTCGCGGCTCATTAAAGC AGGAGCTGa 75 mGBP3 GGCTGAGGACTGTCCCTGT CATGGTCCACTCGGAAGC CAGAGCCAa 64 mGBP4 GCCAAGATCAAGACCCTCAG CCACGTAGGTTGTCACCAGA ACTGGGAAa 76 mGBP5 TCACTGAAGCTGAAGCAAGG GCGTCAAAAACAAAGCATTTC ACTGGGAAa 107 mGBP5a GGAAACTCAGCCTCAGGACTC TCCTGCTCTGCCTTGATTCT CTGTCTCCa 107 mGBP6/10 ATATTTCAACATTTTTTGTTCCTTGT GAAATGGGAGAAAAAATAAATGAAGC AGTCATGTTCAATCTTCT 117 CCCTCTTGTCC mGBP7 GCAGAGAATCCGGTGCAG TTTCCACTAGGCACACAGGA TCTGGTCCa 92 mGBP8 AAGAAGCTGAAGGAACAAAAGGC GAAATGGGAGAAAAAATAAATGAAGC TGTTTCAGTTGCTGTAT 176 CTCTCCATCCA mGBP9 TTCCAAAACTTTCTCCAGTCACAGTA GGCACGCTCCTCTGCAA CCAGCAGTGAGGGCTCT 101 ATCTGCCT GTPBP1 GGTGCAGAGCAAAGATGATG ATCTGGAATATCGGGCACAT CAGCCTCCa 75 IFN-␥ TCTGGAGGAACTGGCAAAAG TTCAAGACTTCAAAGAGTCTGAGG CAGAGCCAa 89 INOS CTTTGCCACGGACGAGAC TCATTGTACTCTGAGGGCTGAC AGGCAGAGa 66 IL-12p40 ATCCAGCGCAAGAAAGAAAA CTACGAGGAACGCACCTTTC GGAGACAGa 70

a These hybridization probes were made with LNA. The Journal of Immunology 7731

Table II. Novel GTPases identiﬁed in Affymetrix analysis of IFN-␥-stimulated ANA-1 cells

Affymetrix Accession Fold Identiﬁcation Description No. of EST Assignment Induction

117108_at ve16c05. x1 Soares mouse NbMH Mus musculus cDNA clone IMAGE:818312 AI595338 mGBP6 ϳ35 3-, mRNA sequence 107939_at ub07g08. r1 Soares_mammary_gland_NbMMG Mus musculus cDNA clone AI021374 mGBP7 ϳ12 IMAGE:1366334 5-, mRNA sequence 109369_at ua77a02. r1 Soareslowen]thymus_2NbMT Mus musculus cDNA clone IMAGE:1363466 AI006929 mGBP8 ϳ10 5- similar to gb:M81128 mouse putative guanylate binding protein mRNA, complete (MOUSE); mRNA sequence

Expressed sequence tag (EST)-derived target sequences of Affymetrix GeneChip Array MG-U74v2, which were detected as differentially expressed in our experimental setting, were blasted against the GenBank nonredundant database. Three ESTs could be assigned to cDNAs with high homology to published members of the 65-kDa mGBPs.

GTQA (mGBP5), and CGGKSSMNTNSDNSDKVRK (mGBP7; Euro- on ice, lysates were cleared at 4500 ϫ g for 15 min. Supernatants were gentec). Polyclonal sera were tested in Western blot analyses with lysates again centrifuged at 23,000 ϫ g at 4°C for 15 min. Protein concentrations of 293T cells transfected with each mGBP and, additionally, cross-reac- of the supernatants were measured using the BCA protein assay kit tivity was excluded by testing each serum on all 10 mGBPs expressed in (Pierce). Thirty-five micrograms of protein was separated by SDS-PAGE 293T cells. Subsequently, the specific sera were affinity purified on the and transferred to a nitrocellulose membrane (Protran; Whatman). Western corresponding peptide (Eurogentec). blot analyses were performed with mGBP-specific antisera and detected with a goat anti-rabbit-POX secondary Ab (BD Biosciences) and ECL Downloaded from Immunofluorescence analyses reagent (GE Healthcare). Cells were fixed in 3% paraformaldehyde in PBS for 20 min at room temper- Generation of expression constructs ature. Cells were permeabilized with 0.02% saponin (Calbiochem-Merck) for 15 min and blocked with 2% normal goat serum (DakoCytomation) for 20 The coding regions of mGBP1–10 were amplified from full-length cDNAs min. For staining of endogenous mGBP1, 2, 3, and 5, anti-mGBP affinity- out of IFN-␥-stimulated ANA-1 cells using the Expand High Fidelity PCR purified antisera were used at a concentration of 1/200. Anti-SAG1 (Ab- System from Roche. The PCR fragments were engineered into pDsRed- cam) at a concentration of 1/500 visualized the outer membrane of T. monomer-N1 and -C1 (Clontech-Takara Bio Europe) in frame with the http://www.jimmunol.org/ gondii. The cells were incubated with the antisera for1hatroom temper- DsRed-coding sequence. All constructs were verified by sequencing ature. After washing three times with 0.002% saponin in PBS, cells were (GATC). incubated with secondary antisera for 45 min. As secondary reagents, Cy2- conjugated AffiniPure goat anti-rabbit IgG or Cy2- or Cy3-conjugated Confocal microscopy AffiniPure goat anti-mouse IgG plus IgM (1/200; Jackson ImmunoResearch Mounted cells were analyzed using a LSM510 Meta confocal microscope Laboratories) were used. After washing two times, nuclei were stained with (Zeiss). To avoid cross-talk in the detection of the used fluorophores, mul- 4Ј,6-diamidino-2-phenylindole (DAPI; Invitrogen Life Technologies). The titracking scanning mode was used. Image analyses and processing was coverslips were fixed on glass slides with FluoromountG (Southern Bio- performed with the LSM software (Zeiss). technology Associates).

Results by guest on October 1, 2021 Infection of mice with L. monocytogenes or T. gondii Identification of five novel members of the 65-kDa mGBP family C57BL/6 mice were purchased from Charles River Breeding Laboratories and maintained in the animal facility of the Heinrich-Heine-University un- Gene expression profiles of the murine C57BL/6-derived macro- der specific pathogen-free conditions. All procedures performed on animals phage cell line ANA-1 (29) stimulated with murine IFN-␥ com- in this study have been approved by the Animal Care and Use Committee pared with unstimulated cells were examined in triplicates using of the local government of Dusseldorf and were in accordance with the Affymetrix GeneChip arrays (MG-U74v2). Systematic sequence German animal laws. ␥ L. monocytogenes infection in C57BL/6 mice was performed by i.p. analysis of 102 genes induced by IFN- revealed three transcripts ϫ (AI595338.1, AI021374.1, and AI006929.1) that showed high injection of 0.1 LD50, and organs were removed at the indicated time points after infection. C57BL/6 mice were injected i.p. with 0.2 ml of PBS similarities to previously published members of the 65-kDa mGBP containing 20 cysts of the T. gondii strain ME49. The cysts were prepared family (14, 16, 18, 31) (Table II). In particular, the cDNA clone out of brains of infected CD1 mice as described previously (30). The or- AI595338.1 showed 100% identity to mpa2l and is now referred to gans were removed at the indicated time points after infection. mGBP6 (accession no. BK005759). AI021374.1 and AI006929.1 Western blot analyses were annotated in the GenBank database and are now named Organs of infected and control mice were homogenized in PBS containing mGBP7 (accession no. BK005760) and mGBP8 (accession no. protease inhibitor mixture tablets (complete Mini Protease Inhibitor Cock- DQ295175), respectively. Full-length cloning of mGBP6 and tail; Roche) and lysed with 2% Triton X-100. After incubation for 15 min mGBP7 out of cDNA from IFN-␥-stimulated ANA-1 cells and

Table III. Synopsis of murine 65-kDa GBP members

Name mRNA Accession No. Protein Accession No. Synonyms, Expressed Sequence Tags, etc. Ref.

mGBP1 NM_010259 EF494422 NP_034389 ABO88215 mpa1, mag1 (15; this study) mGBP2 NM_010260 NP_034390 (31) mGBP3 NM_018734 AAA86645 Purine nucleotide-binding protein, mGBP4 (14, 55) mGBP4 M81128 NP_032646 mpa2, mag2, AW228052, KIAA4245 (56) mGBP5 NM_153564 NP_705792 5330409J06Rik (16) mGBP6 BK005759 DAA05845 mpa2l, AI595338 This study mGBP7 BK005760 DAA05846 AI021374 This study mGBP8 DQ295175 ABB90898 AI006929 This study mGBP9 DQ985742 ABJ51941 This study mGBP10 DQ985743 ABJ51942 This study 7732 CHARACTERIZATION OF mGBP1 TO mGBP10 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 The Journal of Immunology 7733 sequencing confirmed the deposited expressed sequence tag sequences. Cloning and sequencing of the complete cDNA of mGBP8 revealed that the corresponding exon 6 of the other mGBP family members was absent. Analysis of the mgbp8 genomic locus corroborated this finding (A.K., C.K., J.W., D.D., C.B.-G., S.B., and K.P., manuscript in preparation). Comprehensive homology and motif searches against public databases (Ensembl and National Center for Biotechnology Information) yielded two additional putative members of the 65-kDa mGBP gene family on chromosome 5. Cloning and sequencing of the corresponding full-length cDNAs confirmed them as novel IFN-␥-inducible family members. These two genes were subsequently termed mgbp9 (accession no. DQ985742) and mgbp10 (accession no. DQ985743) (Table III). Based on amino acid sequences derived from all known and ␥ newly identified mGBPs, a sequence alignment was performed us- FIGURE 2. Kinetics of mGBP induction upon IFN- stimulation. ANA-1 macrophages were stimulated for 2 (Ⅺ),6(u), and 16 (f)h,RNA ing the ClustalW algorithm (28) (Fig. 1a). As shown in the align- was prepared, and real-time RT-PCR was performed as described in Ma- ment, all GTP-binding motifs are highly conserved among the terials and Methods. iNOS and GTPBP1 were used as positive and nega- mGBP family members. Strikingly, the N-terminal parts of all tive controls, respectively. All cDNAs were assayed in duplicate and ex- mGBPs show higher identities than the C-terminal parts. Making pression levels were normalized to ␤-actin. Induction of mRNA is depicted Downloaded from use of the maximum likelihood method, a phylogenetic analysis of as ratio values comparing stimulated to unstimulated cells. One of three the mGBP family was established, revealing two predominant ho- experiments is shown. mology clusters (Fig. 1b). Interestingly, these homology clusters correlate with the genomic localization of mGBPs on chromosomes 3 and 5. Within the cluster on chromosome 3, a subcluster Therefore, one induction value for mGBP6 and mGBP10 consisting of mGBP1, 2, and 5 is characterized by the substitution (mGBP6/10) is depicted in the following analyses. of V–L in the G3 GTP binding site and by the existence of a As shown in Fig. 2, an induction of mGBP1–10 transcripts in http://www.jimmunol.org/ C-terminal isoprenylation site (CaaX), which has been described to IFN-␥-stimulated ANA-1 cells as compared with untreated cells enhance membrane binding of proteins (32) (Fig. 1a). The C-ter- was observed in a time-dependent manner. All mGBPs were minal parts of mGBP1, 2, and 5 differ clearly from mGBP3 and readily induced after2hofIFN-␥ stimulation and their expression mGBP7, which form the second subcluster on chromosome 3. levels constantly increased up to 16 h of stimulation. Induction The homology cluster located on chromosome 5 consists of ratios of mGBPs by IFN-␥ varied over a wide range: highest induction mGBP4, 6, 8, 9, and 10. These proteins are highly conserved could be demonstrated for mGBP2 and mGBP5, whereas mGBP9 over almost the entire sequence, especially with mGBP6 and was induced the least 10-fold as compared with untreated cells. mGBP10 differing only in 14 aa. An extended homology analysis of Interestingly, in contrast to previous studies, we were able to by guest on October 1, 2021 Dynamin-related mGBPs and Mx proteins, dynamins, and IRGs is detect induction of mGBP1 mRNA in ANA-1 cells, which was shown in Fig. 1c and the sequence alignment in supplementary described to be expressed only in some mouse strains, e.g., 5 Fig. 1. BALB/c (16, 31, 33), but not in C57BL/6, which is the source of the ANA-1 cell line (29). The specificity of the PCR was con- Induction of mGBP family members firmed by using cloned cDNAs of mGBP1 as positive control and To independently confirm the induction of mGBP6, 7, and 8 found its closest homolog mGBP2 as negative control. in the microarray experiments and to determine the inducibility of Taken together, our data confirm the newly identified mGBP6, mGBP9 and mGBP10 by IFN-␥, mRNA expression levels were 7, 8, 9, and 10 as novel members of the 65-kDa family of measured by real-time RT-PCR using specific probes and primers IFN-␥-inducible GBPs. (see Materials and Methods). Because of the very high homology between mGBP6 and mGBP10, it was not possible to distinguish Influence of TLR agonists and proinflammatory cytokines on between the two transcripts in a satisfactory manner by real-time mGBP expression RT-PCR. However, RT-PCR analyses of the full-length cDNA of Previous studies on mGBP1, 2, and 5 showed that these mGBPs mGBP6 and mGBP10 identified their inducibility by IFN-␥ in are not induced exclusively after IFN-␥ stimulation. Other proin- ANA-1 cells unequivocally, as confirmed by cloning and sequenc- flammatory cytokines, which are important for host resistance to ing of the resulting amplicons (data not shown). Thus, RT-PCR intracellular pathogens, such as IFN-␤, IL-1␤, TNF-␣ (1, 3, 14, conditions were established for combined detection of mGBP6 and 34–36), as well as the TLR 4 agonist LPS have been shown to mGBP10 transcripts with equal efficiencies (data not shown). induce expression of mGBP1, 2, and 5 (14, 16). Based on the discovery of the new mGBP family members, a comprehensive 5 The online version of this article contains supplemental material. study on the regulation of all mGBP genes was conducted in

FIGURE 1. a, ClustalW alignment of amino acid sequences for the ten 65-kDa mGBP members. The alignment-layout was edited with the JalView software. Amino acids identical in all 10 GBPs are marked in dark blue, identical in Ն75% in medium blue, and identical in Ն50% in light blue. Red boxes highlight the conserved main GTP-binding motifs: P-loop (G1), switch I (G2), switch II (G3), and G4. Accession no. of the depicted proteins are: ABO88215 (mGBP1), NP_034390 (mGBP2), AAA86645 (mGBP3), ABO88216 (mGBP4), NP705792 (mGBP5), DAA05845 (mGBP6), DAA05846 (mGBP7), ABB90898 (mGBP8), ABJ51941 (mGBP9), and ABJ51942 (mGBP10). b, Phylogenetic tree of 65-kDa mGBPs. Branch lengths are measured relative to the estimated number of substitutions. The gray boxes enclose genes that are clustered on two loci on chromosomes 3 and 5. Punctuated lines mark two subclusters on chromosome 3. c, Phylogenetic tree of 65-kDa mGBPs, Mx proteins, dynamins, and selected IRGs. Branch lengths are measured relative to the estimated number of substitutions. 7734 CHARACTERIZATION OF mGBP1 TO mGBP10 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 3. Induction of mGBPs after stimulation with a selected set of cytokines and TLR agonists. ANA-1 macrophages were stimulated for 16 h with the indicated cytokines or TLR agonists and real-time RT-PCR analyses were performed. As controls for the stimulation conditions, IL-12p40 and iNOS mRNA induction was determined.

ANA-1 cells using a selected set of TLR agonists and cytokines in lation of the ANA-1 cells, IL-12p40 and inducible NO synthase addition to IFN-␥ (Fig. 3). (iNOS) induction were quantified. IFN-␤ increased the expression of all mGBP members except These results indicate that the regulation of mGBP1–10 by for mGBP1. The highest IFN-␤-mediated transcriptional response IFN-␥ and IFN-␤ is similar throughout the gene family, yet with could be determined for mGBP2 and mGBP6/10. TNF-␣ was only pronounced quantitative differences. However, the patterns of re- able to induce mGBP4. IFN-␥ and TNF-␣ costimulation had a sponse to other proinflammatory cytokines and TLR agonists are synergistic effect on the induction of mGBP6/10, whereas only heterogeneous. Interestingly, among the IFN-␥ response genes, some cooperation for mGBP2, 4, 5, and 7 could be detected. IL-1␤ mGBPs appear to be massively transcribed as compared with IL- showed only a marginal effect on mGBP expression in ANA-1 12p40 and iNOS. cells, except for mGBP6/10. Furthermore, LPS-induced expression was restricted to mGBP2 and to mGBP6/10. Immunostimu- latory CpG oligodeoxynucleotide induced mGBP1 and mGBP6/ Up-regulation of mGBP members in vivo after 10, without affecting expression of the other family members. The L. monocytogenes infection other tested TLR agonists poly(I:C) and lipoteichoic acid showed IFN-␥ is essential for survival of L. monocytogenes-infected mice no effect on mGBP expression levels, as did the negative control (2). Previously, we could show that mGBP2 and mGBP4 mRNAs IL-2. GTPBP1 was found to be highly homologous in the N-ter- were induced in the liver of C57BL/6 mice 24 h after L. monocy- minal part to mGBPs (data not shown). GTPBP1 was previously togenes infection (14). Now, with more members of the mGBP described as a GTPase induced in human THP-1 monocytes by family identified, the patterns of mRNA and protein expression in IFN-␥ (37). However, no inducibility in murine ANA-1 cells by spleen and liver of C57BL/6 mice infected i.p. with L. monocyto- IFNs or TLR agonists was found. As controls for efficient stimu- genes were subjected to a comparative analysis. The Journal of Immunology 7735 Downloaded from

ϫ FIGURE 4. Expression of mGBPs in L. monocytogenes-infected mice. C57BL/6 mice were infected i.p. with L. monocytogenes (0.1 LD50). After 8, 24, 48, and 72 h of infection, organs were removed and split for measurement of RNA and protein amounts. RNA from liver (a) and spleen (b) was prepared, reverse-transcribed, and real-time RT-PCR was performed as described. All cDNAs were assayed in duplicate and expression levels were normalized to ␤-actin. Mean values with SD (n ϭ 3 mice) are depicted as fold induction comparing infected to uninfected mice. Protein lysates from liver (c) and spleen (d) were prepared and Western blot analyses with anti-mGBP1, anti-mGBP2, anti-mGBP3, anti-mGBP5, and anti-mGBP7 Ab were performed (molecular http://www.jimmunol.org/ mass: 65 kDa). ␤-actin served as a loading control (molecular mass: 42 kDa). One of three experiments is shown.

mRNA expression of mGBP1–10 as well as the positive con- yses of infected mouse tissues (data not shown). Further sequence trols iNOS and IFN-␥ were measured by real-time RT-PCR during analyses of cDNA clones of mGBP4 derived from infected mouse the course of infection (Fig. 4). Only slight induction of some tissues and, additionally, stimulated ANA-1 cells revealed two dif- mGBPs was observed 8 h postinfection, which was consistent with ferentially spliced mGBP4 transcripts (57). One of these splice the IFN-␥ levels in liver (Fig. 4a) and spleen (Fig. 4b). All mGBP variants resulted in a premature stop codon at 312 bp (accession by guest on October 1, 2021 members were clearly up-regulated after 24 and 48 h of L. mono- no. EF494424). The second variant (accession no. EF494423) was cytogenes infection in these organs. Confirming our results with not expressed in amounts detectable in Western blot analyses (data ANA-1 cells, mGBP1 mRNA induction was measured in C57BL/6 not shown). Due to the high homologies of mGBP6, 8, 9, and 10, tissues and showed a remarkably different expression kinetic com- no specific antisera could be generated, because the selected pared with mGBP2 in the spleen, which provides clear evidence unique peptide sequences were only weakly immunogenic. for the specificity of the PCR conditions used. These experiments clearly show that the mGBPs are highly up- In accordance with the in vitro stimulation data, substantial regulated on both mRNA and protein levels, indicating an impor- quantitative differences of transcription induction throughout the tant role during L. monocytogenes infection. mGBP family were observed. To address the possibility that these differences are due to diverse constitutive expression levels of Induction of mGBPs in response to T. gondii infection mGBP members, the respective absolute protein amounts in liver This and previous publications (14, 16) suggest an important role (Fig. 4c) and spleen (Fig. 4d) of C57BL/6 mice after L. monocy- of mGBPs during bacterial infections. Analyses of hGBP1 and togenes infection were analyzed. For this purpose, peptide-affinity mGBP2 revealed a modest antiviral activity (24, 25). To our purified polyclonal sera of rabbits immunized with unique peptides knowledge, no data are available for the in vivo regulation of from mGBP1, 2, 3, 5, and 7 were generated. In both organs, the mGBPs in response to protozoan infections. Thus, mRNA expres- quantity of mGBP1, 2, and 7 proteins was dramatically increased sion patterns of mGBPs upon T. gondii infection in C57BL/6 mice after infection. Unexpectedly, mGBP3 and mGBP5 were found to were measured in lung (Fig. 5a) and spleen (Fig. 5b) after 5, 7, and be constitutively expressed in uninfected mice. mGBP3 protein 12 days. The course of infection was monitored by determination amounts remained steady, which is consistent with the in vivo of iNOS and IFN-␥ mRNA induction. In the lung, expression of all RT-PCR data where only a minor induction of mGBP3 mRNA mGBP members was increased at day 5 of infection. The mRNA after 24 h was detectable (Fig. 4, a and b). Western blot analyses levels of mGBP1, 2, 4, 5, and 6/10 were further increased at day with anti-mGBP5 Ab revealed a specific splice variant of ϳ68 kDa 7, followed by a decrease of expression observed for mGBP4 and in the liver 24 h after infection, whose size corresponds to the mGBP5 at day 12. Expression of mGBP7, 8, and 9 dropped con- published splice variant of mGBP5a (16). Relative amounts of this stantly from day 5 after infection. In the spleen, both mGBP1 and splice variant mGBP5a were even increased after 48 h. These data mGBP2 were significantly induced at day 5 with further increase were confirmed by real-time RT-PCR using splice variant-specific at day 7. Induction of mGBP3 to mGBP8 was less pronounced and primers and probes (data not shown). However, this splice variant no induction was measurable for mGBP9. Interestingly, mGBP1 could not be detected in the spleen of L. monocytogenes-infected induction was most prominent throughout all family members mice. Although an Ab specific for the C-terminal part of mGBP4 upon infection, whereas the effect of T. gondii infection on mGBP9 was generated, no protein could be detected in Western blot anal- expression was rather weak. 7736 CHARACTERIZATION OF mGBP1 TO mGBP10 Downloaded from

FIGURE 5. Expression of mGBPs in T. gondii-infected mice. C57BL/6 mice were infected i.p. with T. gondii (20 cysts of strain ME49) and 5, 7, and 12 days after infection organs were removed. RNA from lung (a) and spleen (b) was prepared and real-time RT-PCR was performed. Protein lysates from lung (c) and spleen (d) were prepared as described in Fig. 4. http://www.jimmunol.org/ Subsequently, expression of mGBP1, 2, 3, 5, and 7 proteins was The N-terminal and C-terminal DsRed fusion proteins of mGBP6, detected with specific antisera. Expression of all five GTPases was 7, and 9 localized also in discrete vesicle-like structures in IFN- induced during infection with T. gondii in lung (Fig. 5c) compared ␥-stimulated cells. with uninfected C57BL/6 mice. In the spleen (Fig. 5c), mGBP1, 2, The effect of parasite infection on the subcellular distribution of and 7 were readily induced upon infection, whereas mGBP3 and mGBPs was determined by IFN-␥ stimulation of cells and subse- mGBP5 were constitutively expressed and showed only minor up- quent infection with the T. gondii strain ME49. Interestingly, al- regulation during infection. The splice variant of mGBP5 that oc- ready after 30 min of infection, a first accumulation of mGBP1, 2, curred upon infection with L. monocytogenes could not be found 3, 6, 7, and 9 was observed around the parasitophorous vacuole by guest on October 1, 2021 after T. gondii challenge in lung, spleen (Fig. 5, c and d), and liver (PV). After 2 h. most of the parasites were completely surrounded (data not shown). Whether this splice variant is pathogen-specifi- by the bulk of the mGBPs, whereas only few mGBPs were found cally induced has to be further addressed. in vesicular structures (Fig. 6, right panel). However, mGBP5 Taken together, a coordinated mGBP response was induced af- showed no colocalization in T. gondii-infected cells neither with ter T. gondii infection in mice. endogenous staining nor with a fusion construct. Without IFN-␥ prestimulation, no protein colocalization with the PV was detect- Localization of mGBPs in T. gondii-infected cells able for any of the analyzed mGBPs (data not shown). Little is known about the molecular functions of mGBPs, partic- These data show for the first time that mGBP1, 2, 3, 6, 7, and 9 ularly with regard to their role in pathogen defense. In consider- associate with intracellular T. gondii upon IFN-␥ stimulation, sug- ation of the fact that mGBP proteins were up-regulated after T. gesting an important function of mGBPs in the defense against T. gondii infection, we investigated whether mGBPs show a direct gondii. interaction with the parasite. Intracellular immunostainings were performed with the antisera specific for mGBP1, 2, 3, and 5 in murine embryonic fibroblasts Virulent T. gondii antagonized enclosure by mGBPs (MEFs) stimulated with IFN-␥ (Fig. 6, left panel). Each mGBP T. gondii type II strain ME49 is known to establish a chronic member showed a discrete vesicle-like structure inside the cyto- infection in C57BL/6 mice. In contrast, the type I strain BK leads plasm. This localization was concordant with the subcellular dis- to rapid lethality in infected mice (40, 41). To elucidate whether tribution described for mGBP2 previously (38). Staining of the virulence of T. gondii influences the localization of mGBPs, RAW264.7 macrophages revealed the same distribution. Without fibroblasts were infected with either the strain of T. gondii ME49 IFN-␥ stimulation, no staining in MEFs or RAW264.7 cells was or BK. After 2 h, staining of endogenous mGBPs in T. gondii- visible (data not shown). Moreover, the subcellular distribution of infected MEFs revealed a clear difference in localization (Fig. 7a). N-terminal DsRed fusion proteins for mGBP1, 2, 3, and 5 in mGBP1 and mGBP2 readily accumulated at the PV of T. gondii RAW264.7 macrophages was consistent with the staining of the ME49, whereas hardly any accumulation of mGBP1 and mGBP2 endogenous proteins (data not shown), which is in contrast to the could be detected at the PV of T. gondii BK. To quantify this IRG proteins, where large fluorescent tags impaired multimeriza- difference, all intracellular T. gondii and the mGBP-associated T. tion and localization (39). Because antisera for the other mGBP gondii ME49 and BK were counted (Fig. 7b). In ME49-infected family members could not be successfully established, fusion pro- cells, ϳ50% of parasites were surrounded by mGBP1 and 53% by teins of mGBP6, 7, and 9 with an N-terminal (Fig. 6, left panel) mGBP2. Strikingly, only 4.5 and 6.7% of virulent T. gondii BK and C-terminal (data not shown) DsRed-monomer were trans- were enclosed by mGBP1 and mGBP2, respectively. This effect fected into RAW264.7 macrophages or fibroblasts, respectively. was likewise observed for mGBP3 and mGBP6 (data not shown). The Journal of Immunology 7737

FIGURE 6. Colocalization of 65-kDa mGBP mem-

bers with T. gondii. Subcellular localization of mGBPs Downloaded from was analyzed by immunostaining of mGBP1, mGBP2, mGBP3, and mGBP5 in MEFs (rows 1–4) and by trans- fection of mGBP6 and mGBP7-DsRed fusion proteins in RAW264.7 macrophages (rows 5 and 6) and mGBP9-DsRed in MEFs (row 7). Cells were stimulated with IFN-␥ for 16 h. Subsequently, cells were infected with T. gondii strain ME49 for 2 h, ﬁxed, and T. gondii http://www.jimmunol.org/ were stained with anti-SAG1 and the cell nuclei with DAPI. Glass slides were analyzed by confocal microscopy. Bars, 5 ␮m. by guest on October 1, 2021

These observations clearly indicate that virulent Toxoplasma GBPs are characterized by their distinct GTP-binding mo- can interfere with the cellular mGBP host response. tives G1-G4. The known 65-kDa mGBPs have canonical G1 and G3 GTP binding sites, but possess an RD in G4 instead of Discussion the N/T KXD motif found in other GTPases, such as Rab, Ras, In this study, comprehensive analyses of murine 65-kDa GBPs in and 47-kDa GTPases (12, 15). Mutational analysis of hGBP1 host defense were performed. In addition to the five known revealed that in the G4-binding motif of GBPs the amino acids mGBPs, five novel murine 65-kDa GTPases were identified by RD are functionally sufficient for GTPase activity (42). The newly microarray and in silico analyses. Interestingly, all 10 mGBPs identified mGBP6-10 proteins bear the characteristic GTP-binding were up-regulated in vitro by IFN-␥, selected proinflammatory domains G1-G4 also found in mGBP1–5. All 10 mGBPs are stimuli, and TLR agonists as well as in vivo upon infection with L. highly homologous in their amino acid sequences, particularly in monocytogenes or T. gondii. Importantly, a set of mGBPs were the N-terminal parts of the proteins. The C-terminal parts of mG- found to enclose intracellular T. gondii parasites, defining them as BPs are divergent, which suggests nonredundant functions of each key effector molecules at the interface of host pathogen interaction. mGBP against different pathogens in host defense. Remarkably, Strikingly, virulent T. gondii interfered with the accumulation of mGBPs are encoded by 10 exons, except mGBP8, which lacks a mGBPs around the PV. corresponding exon 6, leading to an in frame deletion of 82 aa 7738 CHARACTERIZATION OF mGBP1 TO mGBP10

FIGURE 7. Quantification of mGBP1 and mGBP2 colocalization with T. gondii strain ME49 and BK. a, MEFs were stimulated with IFN-␥ for 16 h. Then cells were infected for 2 h either with the avirulent T. gondii strain ME49 or the virulent strain Downloaded from BK, fixed, and mGBP1 (upper panel) and mGBP2 (lower panel) were stained with the specific Abs. T. gondii were stained with anti-SAG1 and the cell nuclei with DAPI. Bars, 5 ␮m. b, T. gondii stained by SAG1 (n ϭ 350) and T. gondii additionally surrounded by mGBP1 or mGBP2 were counted and percentages are depicted. Data of three experiments http://www.jimmunol.org/ are included. by guest on October 1, 2021

C-terminally of the GTP-binding motives. Whether this is associ- ities between mGBPs on chromosome 5 are higher than those on ated with distinctive features of mGBP8 is not known so far. chromosome 3. After submission of the novel mGBP6–10 to the GenBank da- The regulation of mGBPs by pathogens and inflammatory con- tabase, an in silico study identified a novel mGBP on chromosome ditions was demonstrated by in vitro analyses with ANA-1 cells 3 (43), termed mGBP6, which corresponds to mGBP7 in this pub- employing TLR agonists and a selected set of proinflammatory lication. The same study identified a cluster of mGBP pseudogenes cytokines. As described for the previously published mGBP1–5 on chromosome 5. In contrast, our in silico analyses based on BAC transcripts, mGBP6–10 transcripts are highly up-regulated by clones (RP23-329M7, RP24-210D14) revealed a mistake in the IFN-␥ in comparable time kinetics. For up-regulation of mGBPs, electronic assembly of the mGBP locus on chromosome 5 within the expression of the transcription factor IFN regulatory factor 1 is the database. Based on updated genomic information, cDNA clon- required (Refs. 14, 44, and 45; our observations). Promoter studies ing, and expression analyses performed in this study, it was now of hGBP1 revealed an IFN-stimulated response element and IFN-␥ possible to define a new cluster of functional mGBP genes on activated site sequence explaining the inducibility by type I and II chromosome 5 comprising mGBP4, 6, 8, 9, and 10. Phylogenetic IFNs (46), which was also shown for mGBP2 (38). Moreover, an analysis of the mGBP protein sequences and comparison of NF-␬B-binding motif within the promoter region of hGBP1 was genomic data (A. Kresse, C. Konermann, J. Wu¨rthner, D. Deg- shown to be responsible for its inducibility by TNF-␣ and IL-1␤ randi, C. Beuter-Gunia, S. Beer, and K. Pfeffer, manuscript in (47). The induction of most of the mGBPs, except mGBP1 and preparation) indicated that this gene cluster on chromosome 5 mGBP5, upon IFN-␤ stimulation indicates IFN-stimulated re- arose from gene locus duplications. Likely, this situation in mice is sponse element and IFN-␥ activation sites, whereas the lack of a result of recent evolutionary events, since an orthologous GBP TNF-␣-mediated up-regulation suggests that NF-␬B-binding mo- cluster has not been found in humans so far (43) and the similar- tives are missing. To clarify whether the promoters of the murine The Journal of Immunology 7739

GBPs contain these binding motives as well, extensive sequence STIL led to the disintegration of the vesicle-like structure of and EMSA studies are necessary, which is however beyond the mGBP2 (38) and mGBP5 (data not shown). Astonishingly, al- scope of this study. A heterogeneous pattern of mGBP expression though the other mGBPs lack this putative isoprenylation site, they was observed after IL-1/TLR signaling. mGBP6 and mGBP10 were distributed in vesicles. Preliminary results indicate that this could be induced by IL-1␤, whereas only a marginal effect on the vesicular distribution is due to heterodimerization (data not other mGBPs was found, which is consistent with previously pub- shown), which may suggest that mGBP1 or mGBP2 recruit the lished data using RAW cells (16). Furthermore, sustained LPS- other mGBPs to these vesicle-like structures. induced expression was restricted to mGBP2, 6, and 10, suggesting An infection with L. monocytogenes did not change the subcel- a complex control of mGBP transcription after pathogen- associ- lular distribution of mGBP2, 6, and 7. In contrast, an infection with ated molecular pattern recognition. T. gondii led to a relocalization of mGBP1, 2, 3, 6, 7, and 9, but To elucidate the in vivo role of the differentially induced not mGBP5. Already 30 min after infection, an accumulation of mGBPs, the regulation of mGBPs during infection was studied in the mGBPs around the PV was observed. Interestingly, recent re- C57BL/6 mice. In the investigated organs of L. monocytogenes- ports indicated that members of the IRG family, such as Irgm3 and T. gondii-infected C57BL/6 mice, all 10 mGBP mRNAs (IGTP), Irgm2 (GTPI), Irgb6 (TGTP), Irgd (IRG-47), and Irga6 were rapidly up-regulated, including mGBP1. In contrast, pre- (IIGP) accumulate at the avirulent T. gondii ME49 PV in IFN-␥- vious studies showed that after poly(I:C) or LPS injection stimulated astrocytes, suggesting the requirement of a direct mGBP1 is only expressed in some mouse strains, e.g., BALB/c, GTPase-pathogen interaction for antimicrobial effects to take place but that a functional allele is absent in C57BL/6 mice (16, 33). (49). In contrast, in bone marrow-derived macrophages, no colo- Thus, poly(I:C) or LPS injection/stimulation are not sufficient calization of Irgm1 (LRG-47) or Irgm3 with the ME49 PV could for mGBP1 induction in vitro and in vivo, but full activation be demonstrated (50). However, it has been shown that Irgm1- and Downloaded from during pathogen infection is essential for mGBP1 expression in Irgm3-deficient mice readily succumb to T. gondii, L. monocyto- a C57BL/6 background. genes,orM. tuberculosis infections (9, 51, 52). Remarkably, the In vivo analysis unambiguously showed induced expression of majority of IRGs have not been conserved in humans (10), mGBP1 in all investigated organs of L. monocytogenes- and T. whereas seven paralogous genes of mGBPs have been identified in gondii-infected C57BL/6 mice. Specificity of the mGBP1 anti- humans (53, 54), which compartmentalize into distinct vesicular serum was verified by Western blot analysis of mGBP1-trans- structures in human cells (53). However, the molecular role of http://www.jimmunol.org/ fected cells, and no cross-reactivity was detected with lysates of GBPs in T. gondii infection is not clear. Though the accumulation mGBP2–10- transfected cells. Furthermore, mGBP2, 3, 5, and 7 of the mGBPs seems to be relevant for defense against T. gondii were strongly up-regulated after L. monocytogenes and T. gondii since virulent T. gondii can circumvent the accumulation of infection. Surprisingly, the mGBP5-specific Ab detected a second mGBPs. Thus, mGBPs are highly induced after microbial infection species of mGBP5 in the liver of L. monocytogenes- but not T. and associate with the intracellular pathogen T. gondii in a cell gondii-infected mice. This might be due to a pathogen-specific autonomous manner. Further studies will be needed to analyze immune response pattern, where Listeria induce additional signals whether mGBPs directly interact with T. gondii or whether un- required for differential splicing of mGBP5. Recently, it was known molecules act as bridging factors. Currently, gene-targeting by guest on October 1, 2021 shown that differential expression of Iigp2 splice variants corre- studies are performed in our laboratory which will be necessary to lates with Chlamydia spittaci susceptibility (48). Some mGBPs, clarify the molecular requirements of the individual mGBPs in such as mGBP3 and mGBP5, were basally expressed in spleen and bacterial, protozoan, and viral infections. liver, which suggests differing promoter activities among the Taken together, mGBPs are highly transcriptionally and trans- mGBP genes. In contrast, in the lung, no basal protein amounts lationally induced IFN response genes that appear to be intricately of mGBP3 and mGBP5 could be observed, implying that either involved in host pathogen interactions, defining them as interesting mGBP3- and mGBP5-expressing cells migrate to the lung due to targets for future immunological and cell biological studies as host the infection or that resident cells up-regulated these mGBPs. De- effector proteins of the immune response toward intracellular spite the induction of mGBP4 mRNA, protein expression of pathogens. mGBP4 could not be detected with a specific mGBP4 antiserum. Extensive cDNA cloning from infected mice and genomic analy- Acknowledgments ses revealed one mGBP4 variant with a premature stop codon We thank Karin Buchholz, Nicole Krafzik, and Stephan Schmidt for ex- (57). A second variant was not detectable in quantitative amounts perimental assistance; Stefanie Kutsch and Gaby Reichmann for assistance in infected tissues indicating that mgbp4 is not a functional locus with the infection of mice with L. monocytogenes and T. gondii, respec- at least in C57BL/6 mice. tively; and Heike Weighardt and Stefanie Scheu for critical reading of this The subcellular localization of functional mGBPs was analyzed manuscript. by expression of fluorescent fusion proteins or stainings for en- Disclosures dogenous mGBPs in IFN-␥-stimulated cells followed by confocal The authors have no financial conflict of interest. microscopy. All investigated mGBPs were located in vesicle-like structures distributed throughout the cytoplasm. Coexpression of References markers for subcellular structures, such as endoplasmic reticulum 1. Endres, R., A. Luz, H. Schulze, H. Neubauer, A. Futterer, S. M. Holland, (calreticulin), Golgi (human ␤ 1,4-galactosyltransferase), endo- H. Wagner, and K. Pfeffer. 1997. Listeriosis in p47(phoxϪ/Ϫ) and TRp55Ϫ/Ϫ somes (RhoB), and (plasma) membranes (neuromodulin), did not mice: protection despite absence of ROI and susceptibility despite presence of RNI. Immunity 7: 419–432. colocalize with mGBPs and were therefore unable to identify the 2. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, character of the mGBP vesicles (data not shown). This is in ac- J. Vilcek, R. M. Zinkernagel, and M. Aguet. 1993. Immune response in mice that ␥ cordance with extensive studies on mGBP2 (38). In contrast to lack the interferon- receptor. Science 259: 1742–1745. 3. Pfeffer, K., T. Matsuyama, T. M. Kundig, A. Wakeham, K. Kishihara, previous observations (38), mGBP1 was also localized in intracel- A. Shahinian, K. Wiegmann, P. S. Ohashi, M. Kronke, and T. W. Mak. 1993. lular vesicles. This can be explained by the presence of a C-ter- Mice deficient for the 55 kDa tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73: 457–467. minal isoprenylation sequence CaaX, which is also found in 4. Zantl, N., A. Uebe, B. Neumann, H. Wagner, J. R. Siewert, B. Holzmann, mGBP2 and mGBP5. Interestingly, mutation of the CTIL motif to C. D. Heidecke, and K. Pfeffer. 1998. Essential role of ␥ interferon in survival of 7740 CHARACTERIZATION OF mGBP1 TO mGBP10

colon ascendens stent peritonitis, a novel murine model of abdominal sepsis. 32. Stickney, J. T., and J. E. Buss. 2000. Murine guanylate-binding protein: incom- Infect. Immun. 66: 2300–2309. plete geranylgeranyl isoprenoid modification of an interferon-␥-inducible 5. Boehm, U., T. Klamp, M. Groot, and J. C. Howard. 1997. Cellular responses to guanosine triphosphate-binding protein. Mol. Biol. Cell 11: 2191–2200. interferon-␥. Annu. Rev. Immunol. 15: 749–795. 33. Staeheli, P., M. Prochazka, P. A. Steigmeier, and O. Haller. 1984. Genetic control 6. Martens, S., and J. Howard. 2006. The interferon-inducible GTPases. Annu. Rev. of interferon action: mouse strain distribution and inheritance of an induced pro- Cell. Dev. Biol. 22: 559–589. tein with guanylate-binding property. Virology 137: 135–142. 7. Taylor, G. A. 2007. IRG proteins: key mediators of interferon-regulated host 34. Bogdan, C., J. Mattner, and U. Schleicher. 2004. The role of type I interferons in resistance to intracellular pathogens. Cell. Microbiol. 9: 1099–1107. non-viral infections. Immunol. Rev. 202: 33–48. 8. Haller, O., and G. Kochs. 2002. Interferon-induced Mx proteins: dynamin-like 35. Dinarello, C. A., and S. M. Wolff. 1993. The role of interleukin-1 in disease. GTPases with antiviral activity. Traffic 3: 710–717. N. Engl. J. Med. 328: 106–113. 9. Taylor, G. A., C. G. Feng, and A. Sher. 2004. p47 GTPases: regulators of im- 36. Karaghiosoff, M., H. Neubauer, C. Lassnig, P. Kovarik, H. Schindler, H. Pircher, munity to intracellular pathogens. Nat. Rev. Immunol. 4: 100–109. B. McCoy, C. Bogdan, T. Decker, G. Brem, et al. 2000. Partial impairment of 10. Bekpen, C., J. P. Hunn, C. Rohde, I. Parvanova, L. Guethlein, D. M. Dunn, cytokine responses in Tyk2-deficient mice. Immunity 13: 549–560. E. Glowalla, M. Leptin, and J. C. Howard. 2005. The interferon-inducible p47 37. Senju, S., and Y. Nishimura. 1997. Identification of human and mouse GP-1, a (IRG) GTPases in vertebrates: loss of the cell autonomous resistance mechanism putative member of a novel G-protein family. Biochem. Biophys. Res. Commun. in the human lineage. Genome Biol. 6: R92. 231: 360–364. 11. Cheng, Y. S., R. J. Colonno, and F. H. Yin. 1983. Interferon induction of fibro- 38. Vestal, D. J., V. Y. Gorbacheva, and G. C. Sen. 2000. Different subcellular blast proteins with guanylate binding activity. J. Biol. Chem. 258: 7746–7750. localizations for the related interferon-induced GTPases, MuGBP-1 and 12. Cheng, Y. S., M. F. Becker-Manley, T. P. Chow, and D. C. Horan. 1985. Affinity MuGBP-2: implications for different functions? J. Interferon Cytokine Res. 20: purification of an interferon-induced human guanylate-binding protein and its 991–1000. characterization. J. Biol. Chem. 260: 15834–15839. 39. Uthaiah, R. C., G. J. Praefcke, J. C. Howard, and C. Herrmann. 2003. IIGP1, an 13. Asundi, V. K., R. C. Stahl, L. Showalter, K. J. Conner, and D. J. Carey. 1994. interferon-␥-inducible 47-kDa GTPase of the mouse, showing cooperative enzy- Molecular cloning and characterization of an isoprenylated 67 kDa protein. Bio- matic activity and GTP-dependent multimerization. J. Biol. Chem. 278: chim. Biophys. Acta 1217: 257–265. 29336–29343. 14. Boehm, U., L. Guethlein, T. Klamp, K. Ozbek, A. Schaub, A. Futterer, K. Pfeffer, 40. Gross, U., W. A. Muller, S. Knapp, and J. Heesemann. 1991. Identification of a and J. C. Howard. 1998. Two families of GTPases dominate the complex cellular

virulence-associated antigen of Toxoplasma gondii by use of a mouse monoclonal Downloaded from ␥ response to IFN- . J. Immunol. 161: 6715–6723. antibody. Infect. Immun. 59: 4511–4516. 15. Cheng, Y. S., C. E. Patterson, and P. Staeheli. 1991. Interferon-induced guany- 41. Sibley, L. D., and J. C. Boothroyd. 1992. Virulent strains of Toxoplasma gondii late-binding proteins lack an N(T)KXD consensus motif and bind GMP in ad- comprise a single clonal lineage. Nature 359: 82–85. dition to GDP and GTP. Mol. Cell. Biol. 11: 4717–4725. 42. Praefcke, G. J., M. Geyer, M. Schwemmle, K. H. Robert, and C. Herrmann. 1999. 16. Nguyen, T. T., Y. Hu, D. P. Widney, R. A. Mar, and J. B. Smith. 2002. Murine Nucleotide-binding characteristics of human guanylate-binding protein 1 GBP-5, a new member of the murine guanylate-binding protein family, is coor- (hGBP1) and identification of the third GTP-binding motif. J. Mol. Biol. 292: dinately regulated with other GBPs in vivo and in vitro. J. Interferon Cytokine 321–332. Res. 22: 899–909. 43. Olszewski, M. A., J. Gray, and D. J. Vestal. 2006. In silico genomic analysis of 17. Schwemmle, M., B. Kaspers, A. Irion, P. Staeheli, and U. Schultz. 1996. Chicken the human and murine guanylate-binding protein (GBP) gene clusters. J. Inter- http://www.jimmunol.org/ guanylate-binding protein: conservation of GTPase activity and induction by cy- feron Cytokine Res. 26: 328–352. tokines. J. Biol. Chem. 271: 10304–10308. 44. Briken, V., H. Ruffner, U. Schultz, A. Schwarz, L. F. Reis, I. Strehlow, T. Decker, 18. Staeheli, P., R. J. Colonno, and Y. S. Cheng. 1983. Different mRNAs induced by and P. Staeheli. 1995. Interferon regulatory factor 1 is required for mouse Gbp interferon in cells from inbred mouse strains A/J and A2G. J. Virol. 47: 563–567. gene activation by ␥ interferon. Mol. Cell. Biol. 15: 975–982. 19. Praefcke, G. J., and H. T. McMahon. 2004. The dynamin superfamily: universal 45. Ramsauer, K., M. Farlik, G. Zupkovitz, C. Seiser, A. Kroger, H. Hauser, and membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. 5: T. Decker. 2007. Distinct modes of action applied by transcription factors STAT1 133–147. and IRF1 to initiate transcription of the IFN-␥-inducible gbp2 gene. Proc. Natl. 20. Gorbacheva, V. Y., D. Lindner, G. C. Sen, and D. J. Vestal. 2002. The interferon Acad. Sci. USA 104: 2849–2854. (IFN)-induced GTPase, mGBP-2: role in IFN-␥-induced murine fibroblast pro- 46. Decker, T., D. J. Lew, and J. E. Darnell, Jr. 1991. Two distinct ␣-interferon- liferation. J. Biol. Chem. 277: 6080–6087. dependent signal transduction pathways may contribute to activation of transcrip- 21. Guenzi, E., K. Topolt, E. Cornali, C. Lubeseder-Martellato, A. Jorg, K. Matzen, tion of the guanylate-binding protein gene. Mol. Cell. Biol. 11: 5147–5153. C. Zietz, E. Kremmer, F. Nappi, M. Schwemmle, et al. 2001. The helical domain by guest on October 1, 2021 of GBP-1 mediates the inhibition of endothelial cell proliferation by inflamma- 47. Naschberger, E., T. Werner, A. B. Vicente, E. Guenzi, K. Topolt, R. Leubert, C. Lubeseder-Martellato, P. J. Nelson, and M. Sturzl. 2004. Nuclear factor-␬B tory cytokines. EMBO J. 20: 5568–5577. ␣ 22. Guenzi, E., K. Topolt, C. Lubeseder-Martellato, A. Jorg, E. Naschberger, motif and interferon- -stimulated response element co-operate in the activation R. Benelli, A. Albini, and M. Sturzl. 2003. The guanylate binding protein-1 of guanylate-binding protein-1 expression by inflammatory cytokines in endo- GTPase controls the invasive and angiogenic capability of endothelial cells thelial cells. Biochem. J. 379: 409–420. through inhibition of MMP-1 expression. EMBO J. 22: 3772–3782. 48. Miyairi, I., V. R. Tatireddigari, O. S. Mahdi, L. A. Rose, R. J. Belland, L. Lu, 23. Duan, Z., R. Foster, K. A. Brakora, R. Z. Yusuf, and M. V. Seiden. 2006. GBP1 R. W. Williams, and G. I. Byrne. 2007. The p47 GTPases Iigp2 and Irgb10 overexpression is associated with a paclitaxel resistance phenotype. Cancer Che- regulate innate immunity and inflammation to murine Chlamydia psittaci infec- mother. Pharmacol. 57: 25–33. tion. J. Immunol. 179: 1814–1824. 24. Anderson, S. L., J. M. Carton, J. Lou, L. Xing, and B. Y. Rubin. 1999. Interferon- 49. Martens, S., I. Parvanova, J. Zerrahn, G. Griffiths, G. Schell, G. Reichmann, and induced guanylate binding protein-1 (GBP-1) mediates an antiviral effect against J. C. Howard. 2005. Disruption of Toxoplasma gondii parasitophorous vacuoles vesicular stomatitis virus and encephalomyocarditis virus. Virology 256: 8–14. by the mouse p47-resistance GTPases. PLoS Pathog. 1: e24. 25. Carter, C. C., V. Y. Gorbacheva, and D. J. Vestal. 2005. Inhibition of VSV and 50. Butcher, B. A., R. I. Greene, S. C. Henry, K. L. Annecharico, J. B. Weinberg, EMCV replication by the interferon-induced GTPase, mGBP-2: differential re- E. Y. Denkers, A. Sher, and G. A. Taylor. 2005. p47 GTPases regulate Toxo- quirement for wild-type GTP binding domain. Arch. Virol. 150: 1213–1220. plasma gondii survival in activated macrophages. Infect. Immun. 73: 3278–3286. 26. Li, C., and W. W. Hung. 2001. Model-based analysis of oligonucleotide arrays: 51. Collazo, C. M., G. S. Yap, G. D. Sempowski, K. C. Lusby, L. Tessarollo, model validation, design issues and standard error application. Genome Biol. 2: G. F. Woude, A. Sher, and G. A. Taylor. 2001. Inactivation of LRG-47 and 0032.1–0032.11. IRG-47 reveals a family of interferon ␥-inducible genes with essential, pathogen- 27. Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of microar- specific roles in resistance to infection. J. Exp. Med. 194: 181–188. rays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98: 52. MacMicking, J. D. 2004. IFN-inducible GTPases and immunity to intracellular 5116–5121. pathogens. Trends Immunol. 25: 601–609. 28. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal W: improving 53. Tripal, P., M. Bauer, E. Naschberger, T. Mortinger, C. Hohenadl, E. Cornali, the sensitivity of progressive multiple sequence alignment through sequence M. Thurau, and M. Sturzl. 2007. Unique features of different members of the weighting, position-specific gap penalties and weight matrix choice. Nucleic Ac- human guanylate-binding protein family. J. Interferon Cytokine Res. 27: 44–52. ids Res. 22: 4673–4680. 54. Vestal, D. J. 2005. The guanylate-binding proteins (GBPs): proinflammatory cy- 29. Cox, G. W., B. J. Mathieson, L. Gandino, E. Blasi, D. Radzioch, and L. Varesio. tokine-induced members of the dynamin superfamily with unique GTPase activ- 1989. Heterogeneity of hematopoietic cells immortalized by v-myc/v-raf recom- ity. J. Interferon Cytokine Res. 25: 435–443. binant retrovirus infection of bone marrow or fetal liver. J. Natl. Cancer Inst. 81: 55. Han, B. H., D. J. Park, R. W. Lim, J. H. Im, and H. D. Kim. 1998. Cloning, 1492–1496. expression, and characterization of a novel guanylate-binding protein, GBP3 in 30. Reichmann, G., W. Walker, E. N. Villegas, L. Craig, G. Cai, J. Alexander, and murine erythroid progenitor cells. Biochim. Biophys. Acta 1384: 373–386. C. A. Hunter. 2000. The CD40/CD40 ligand interaction is required for resistance 56. Wynn, T. A., C. M. Nicolet, and D. M. Paulnock. 1991. Identification and char- to toxoplasmic encephalitis. Infect. Immun. 68: 1312–1318. acterization of a new gene family induced during macrophage activation. J. Im- 31. Vestal, D. J., J. E. Buss, S. R. McKercher, N. A. Jenkins, N. G. Copeland, munol. 147: 4384–4392. G. S. Kelner, V. K. Asundi, and R. A. Maki. 1998. Murine GBP-2: a new IFN- 57. Konermann, C., A. Kresse, C. Beuter-Gunia, J. Wu¨rthner, D. Degrandi, K. Pfef- ␥-induced member of the GBP family of GTPases isolated from macrophages. fer, and S. Beer. 2007. In silico and in vitro characterization of mGBP4 splice J. Interferon Cytokine Res. 18: 977–985. variants. DNA Cell Biol. In press.