DOCSLIB.ORG

Generation of Astrocytes from Embryonic Stem Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Generation of Astrocytes from Embryonic Stem Cells Generation of astrocytes from embryonic stem cells Dissertation zur Erlangung des akademischen Grades Dr. rer. nat. vorgelegt von Philipp Balthasar Kügler an der Tag der mündlichen Prüfung: 14.12.2011 1. Referent: Prof. Dr. Marcel Leist 2. Referent: PD Dr. Edward Málaga Trillo Prüfungsvorsitz: Prof. Dr. Jörg Hartig Mathematisch-Naturwissenschaftliche Sektion Fachbereich Biologie Konstanz 2011 Astrocytes astron [greek]: star cyte [greek]: cell DANKSAGUNG Danksagung Diese Arbeit wurde zwischen Juni 2008 und Dezember 2011 am Doerenkamp-Zbinden Lehrstuhl für in vitro Toxikologie und Biomedizin an der Universität Konstanz durchgeführt. Mein besonderer Dank gilt Marcel Leist für die Möglichkeit meine Arbeit in seiner Arbeitsgruppe unter hervorragenden Bedingungen durchführen zu können, meine Arbeit auf internationalen Konferenzen präsentieren zu dürfen und die insgesamt außergewöhnliche Förderung. Suzanne Kadereit danke ich für die Ihre Betreuung, vor allem in den Anfängen. Für viel Input, Ideen, Kritik und Hilfe, für Begegnungen mit interessanten Menschen und dass Sie immer hinter mir stand. Aber auch für Verpflegung, verschiedenste gute Getränke und sehr viel Spaß. Edward Málaga-Trillo möchte ich für die bereitwillige Übernahme des Zweitgutachtens sehr danken. Allen Mitarbeitern und ehemaligen Mitarbeitern des Lehrstuhls danke ich für die schöne gemeinsame Zeit, Tipps und Tricks, Unterstützung, Übernahme von Wochenenddiensten und Spaß und Spiel. Mein besonderer Dank gilt hier Marion Kapitza, der guten Fee des Stammzelllabors. Für finanzielle Unterstützung danke ich der Konstanz Research School Chemical Biology der Universität Konstanz und der Professor-Rhein-Stiftung der Stadt Königswinter. Meiner Vespa, die mich all die Jahre immer treu an die Uni gefahren hat. Ich danke meinen Freunden und Kommilitonen dafür, dass alles so ist wie immer, auch wenn wir uns lange nicht gesehen haben. Meiner Freundin Silvia dafür, dass Sie immer für mich da ist. Meinen Eltern Ruth und Peter und meinem Bruder Johannes, für den Rückhalt, Kraft und Ansporn den sie mir, auch während des Studiums, gaben und geben. PUBLICATIONS List of Publications Publications integrated in this thesis: Chapter 2.1 and 3.1 Philipp B. Kuegler, Bastian Zimmer, Tanja Waldmann, Birte Baudis, Sten Ilmjärv, Jürgen Hescheler, Phil Gaughwin, Patrik Brundin, William Mundy, Anna K. Bal-Price, André Schrattenholz, Karl-Heinz Krause, Christoph van Thriel, Mahendra S. Rao, Suzanne Kadereit and Marcel Leist, Markers of murine embryonic and neural stem cells, neurons and astrocytes: reference points for developmental neurotoxicity testing, ALTEX, 2010, 27(1), 17-42; Review Chapter 3.2 Bastian Zimmer, Philipp B. Kuegler, Birte Baudis, Andreas Genewsky, Vivek Tanavde, Winston Koh, Betty Tan, Tanja Waldmann, Suzanne Kadereit, and Marcel Leist, Coordinated waves of gene expression during neuronal differentiation of embryonic stem cells as basis for novel approaches to developmental neurotoxicity testing, Cell Death Differ, 2011;18, 383-95 Chapter 3.3 Philipp B. Kuegler, Bettina A Baumann, Bastian Zimmer, Suzanne Kadereit, Marcel Leist, GFAP-independent inflammatory competence and trophic functions of astrocytes generated from murine embryonic stem cells, GLIA, 2011; doi: 10.1002/glia:Epub ahead of print. Unpublished manuscripts integrated in this thesis: Chapter 3.4 Philipp B. Kuegler, Dominik Pöltl, Christiaan Karreman, Stefan Schildknecht, Suzanne Kadereit and Marcel Leist, Rapid derivation of GFAP-positive, functional astroglia from embryonic stem cells to enable longterm human neuronal cultures PUBLICATIONS Papers published during the thesis timeperiod that are not integrated in this thesis: Bastian Zimmer, Stefan Schildknecht, Philipp B Kuegler, Vivek Tanavde, Suzanne Kadereit, Marcel Leist, Sensitivity of dopaminergic neuron differentiation from stem cells to chronic low-dose methylmercury exposure, Toxicol. Sci., 2011; 121; 357-67 E. Dilip de Silva, Anna-Skrollan Geiermann, Maya I. Mitova, Philipp Kuegler, John W. Blunt, Anthony L. J. Cole, and Murray H. G. Munro, Isolation of 2-Pyridone Alkaloids from a New Zealand Marine-Derived Penicillium species. J. Nat. Prod., 2009, 72(3), 447-9 PRESENTATIONS Oral presentations: “Generation of functional astrocytes from murine embryonic stem cells”, EU 7th Framework ESNATS Summer School, Zermatt, Switzerland, September 2009 “Generation of functional astrocytes from murine embryonic stem cells”, EU 7th Framework ESNATS Program SP2 Meeting, Geneva, Switzerland, August 2009 “Generation of functional astrocytes from murine embryonic stem cells”, 1. Joint Congress of the Swiss and German Societies of Cell Biology (32nd Annual Meeting of the German Society for Cell Biology), Konstanz, Germany, March 2009 “Glial Toxicants”, EU 7th Framework ESNATS Program SP2 Meeting, Konstanz, Germany, June 2008 Poster Presentations: Bastian Zimmer, Philipp B. Kuegler, Suzanne Kadereit and Marcel Leist, Transcriptional markers for ESC-based testing of developmental neurotoxicity (DNT), ISCCR 8th Annual Meeting, San Francisco, CA, USA, June 2010 Philipp B. Kuegler, Bastian Zimmer, Bettina A. Baumann, Suzanne Kadereit and Marcel Leist, Generation of functional astrocytes from murine embryonic stem cells, ISCCR 8th Annual Meeting, San Francisco, CA, USA, June 2010 Philipp B. Kuegler, Bettina A. Baumann, Bastian Zimmer, Suzanne Kadereit and Marcel Leist, Generation of functional astrocytes from murine embryonic stem cells, 9th European Meeting on Glial Cells in Health and Disease, Paris, France, September 2009 Philipp B. Kuegler, Bettina A. Baumann, Bastian Zimmer, Suzanne Kadereit and Marcel Leist, Generation of functional astrocytes from murine embryonic stem cells, VII World Congress on Alternatives & Animal use in the Life Sciences, Rome, Italy, August 2009 Marcel Leist, Florian Matt, Bastian Zimmer, Sheree Pfeiffer, Birte Baudis, Philipp B. Kuegler, Bettina A. Baumann and Suzanne Kadereit: An integrated test strategy to detect neurotoxicants and developmental neurotoxicants, VII World Congress on Alternatives & Animal use in the Life Sciences, Rome, Italy, August 2009 TABLE OF CONTENTS 1 SUMMARY.....................................................................................................................................1 ZUSAMMENFASSUNG..........................................................................................................................3 2 GENERAL INTRODUCTION......................................................................................................5 2.1 MARKERS OF MURINE EMBRYONIC AND NEURAL STEM CELLS, NEURONS AND ASTROCYTES: REFERENCE POINTS FOR DEVELOPMENTAL NEUROTOXICITY TESTING...................................................................................................................... 5 2.1.1 Introductory remarks and overall summary of 2.1.............................................................5 2.1.2 Introduction to ESC-based test systems..............................................................................5 2.1.3 Towards new test systems for developmental neurotoxicity ...............................................7 2.1.4 Markers for DNT testing ..................................................................................................11 2.1.5 In vitro DNT testing and validation: ESDNT V1.0 vs. ESDNT V2.0 ................................17 2.2 ASTROCYTES............................................................................................................ 20 2.2.1 Astrocytes – underappreciated cells of the brain .............................................................20 2.2.2 Astrocyte function.............................................................................................................21 2.2.3 In vitro cultures of astrocytes ...........................................................................................23 2.3 AIM OF THIS STUDY.................................................................................................. 25 3 RESULTS......................................................................................................................................26 3.1 MARKERS OF MURINE EMBRYONIC AND NEURAL STEM CELLS, NEURONS AND ASTROCYTES: REFERENCE POINTS FOR DEVELOPMENTAL NEUROTOXICITY TESTING.................................................................................................................... 26 3.1.1 The definition of stem cell genes.......................................................................................27 Transcription-based markers......................................................................................................................27 Gene annotation .........................................................................................................................................29 GO categories ............................................................................................................................................30 Standardisation and statistical issues..........................................................................................................31 3.1.2 What are stem cell genes? ................................................................................................32 Definition of mESC markers......................................................................................................................35 Neurodevelopmental biology and definition of neural stem cell markers ..................................................38 Definition
Load more

Recommended publications
  • Final Copy 2018 09 25 Gaunt
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School.
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Integrated Bioinformatic Analysis of RNA Binding Proteins in Hepatocellular Carcinoma
    www.aging-us.com AGING 2021, Vol. 13, No. 2 Research Paper Integrated bioinformatic analysis of RNA binding proteins in hepatocellular carcinoma Ling Wang1,*, Zhen Zhang2,3,*, Yuan Li1, Yanyan Wan1, Baocai Xing1,& 1Key Laboratory of Carcinogenesis and Translational Research, Ministry of Education, Hepatopancreatobiliary Surgery Department I, Peking University Cancer Hospital and Institute, Beijing 100142, China 2Department of Gastroenterological Surgery, Peking University People’s Hospital, Beijing 100044, China 3Laboratory of Surgical Oncology, Beijing Key Laboratory of Colorectal Cancer Diagnosis and Treatment Research, Peking University People’s Hospital, Beijing 100044, China *Equal contribution Correspondence to: Baocai Xing; email: [email protected] Keywords: RNA binding protein, hepatocellular carcinoma, biomarker, transcriptomics, proteomics Received: June 8, 2020 Accepted: November 3, 2020 Published: December 19, 2020 Copyright: © 2020 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT RNA binding proteins (RBPs) are aberrantly expressed in a tissue-specific manner across many tumors. These proteins, which play a vital role in post-transcriptional gene regulation, are involved in RNA splicing, maturation, transport, stability, degradation, and translation. We set out to establish an accurate risk score model based on RBPs to estimate prognosis in hepatocellular carcinoma (HCC). RNA-sequencing data, proteomic data and corresponding clinical information were acquired from the Cancer Genome Atlas database and the Clinical Proteomic Tumor Analysis Consortium database respectively. We identified 406 differentially expressed RBPs between HCC tumor and normal tissues at the transcriptional and protein level.
    [Show full text]
  • Supplementary Figure 1
    Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown siRNA Sequence nucleotides Source GCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3 knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat. # L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our laboratory using the siDESIGN center from the Dharmacon website (www.dharmacon.com) by inputting the Genbank accession number NM_000598 (IGFBP-3). Supplementary Table 2 Transcripts Activated by NKX3.1 in PC-3 Cells PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up- or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as IGFBP-3.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
    (19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
    [Show full text]
  • Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery
    Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Duygu Ucar Graduate Program in Computer Science and Engineering The Ohio State University 2009 Dissertation Committee: Srinivasan Parthasarathy, Advisor Yusu Wang Umit Catalyurek c Copyright by Duygu Ucar 2009 ABSTRACT Many biological datasets can be effectively modeled as interaction networks where nodes represent biological entities of interest such as proteins, genes, or complexes and edges mimic associations among them. The study of these biological network structures can provide insight into many biological questions including the functional characterization of genes and gene products, the characterization of DNA-protein bindings, and the under- standing of regulatory mechanisms. Therefore, the task of constructing biological interac- tion networks from raw data sets and exploiting information from these networks is critical, but is also fraught with challenges. First, the network structure is not always known in a priori; the structure should be inferred from raw and heterogeneous biological data sources. Second, biological networks are noisy (containing unreliable interactions) and incomplete (missing real interactions) which makes the task of extracting useful information difficult. Third, typically these networks have non-trivial topological properties (e.g., uneven degree distribution, small world) that limit the effectiveness of traditional knowledge discovery al- gorithms. Fourth, these networks are usually dynamic and investigation of their dynamics is essential to understand the underlying biological system. In this thesis, we address these issues by presenting a set of computational techniques that we developed to construct and analyze three specific types of biological interaction networks: protein-protein interaction networks, gene co-expression networks, and regulatory networks.
    [Show full text]
  • Rrna Types in Zebrafish Development
    UvA-DARE (Digital Academic Repository) Distinct maternal and somatic rRNA types in zebrafish development Locati, M. Publication date 2017 Document Version Final published version License Other Link to publication Citation for published version (APA): Locati, M. (2017). Distinct maternal and somatic rRNA types in zebrafish development. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:04 Oct 2021 DISTINCT MATERNAL AND SOMATIC rRNA TYPES IN ZEBRAFISH DEVELOPMENT MAURO LOCATI DISTINCT MATERNAL AND SOMATIC rRNA TYPES IN ZEBRAFISH DEVELOPMENT MAURO LOCATI Distinct Maternal and Somatic rRNA Types in Zebrafish Development ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. ir. K.I.J. Maex ten overstaan van een door het College voor Promoties ingestelde commissie, in het openbaar te verdedigen in de Aula der Universiteit op woensdag 6 december 2017, te 13:00 uur door Mauro Locati geboren te Palermo, Italië Promotiecommissie: Promotor: Prof.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Intersections Spring Symposium
    INTERSECTIONS SPRING SYMPOSIUM APRIL TH, 8 Last Name First Name Project Title Page Analyzing the Effect of Urbanization on Abboud Bissan Phylogenetic signal in the Species Columba 1 Abouzahra Sharifah Peripheral IV Catheter Sterilization Device 2 Development of a Liquid Crystal Based Electron Adkins Raymond Shower Detector 2 Purification of Secreted Protein, Acidic and Rich in Cysteine (SPARC) Implicated for its Effects on Al Bahrani Zaid Intraocular Pressure 3 A Window into Metabolite Changes of Live Aljawad Yaqeen Bacteria Following Drug Infusion 3 Anderson Emily In-situ Resource Utilization on Mars 4 The Relationship Between Subjective and Objective Language Assessments For Second- Arredondo Kaitlynn Language Learners 4 Atkinson Scott MotionSense Wave: Toucheless Faucet 5 Ayyar Aneeka Hand Tremor Reduction Device 6 Modifying Low-Emissivity Glass for Use with Bailey Jessica Surface Enhanced Raman Spectroscopy 5 Automated Segmentation and Radiomic Characterization of Visceral Fat on Bowel MRIs for Barbur Iulia Crohn's Disease 6 Periodic Liquid Crystal Order: Theory and Barnaby Gavin-Rae Simulations 7 The Role of Dentistry in the U.S. Opioid Epidemic: Basore Makenna A Literature Review 7 Berends Hannah A Leader’s Role in a Nation’s Stability 8 A Study on Daily Cycles in Activity Levels of Bhatia Shireen Coyotes (Canis latrans) 8 Co-creation of an Intervention with African American Older Adults to Manage Stress Blackshire Gabrielle Associated with Self-management of 9 Developing to Developed: Entrepreneurship in Blatt Noah Latin America
    [Show full text]
  • The Epigenome in Pluripotency and Differentiation
    Review Review The epigenome in pluripotency and differentiation The ability to culture pluripotent stem cells and direct their differentiation into Rathi D Thiagarajan1, Robert specific cell types in vitro provides a valuable experimental system for modeling Morey1 & Louise C Laurent*1 1 pluripotency, development and cellular differentiation. High-throughput profiling of Department of Reproductive Medicine, The University of California, San Diego, the transcriptomes and epigenomes of pluripotent stem cells and their differentiated La Jolla, CA, USA derivatives has led to identification of patterns characteristic of each cell type, *Author for correspondence: discovery of new regulatory features in the epigenome and early insights into the [email protected] complexity of dynamic interactions among regulatory elements. This work has also revealed potential limitations of the use of pluripotent stem cells as in vitro models of developmental events, due to epigenetic variability among different pluripotent stem cell lines and epigenetic instability during derivation and culture, particularly at imprinted and X-inactivated loci. This review focuses on the two most well-studied epigenetic mechanisms, DNA methylation and histone modifications, within the context of pluripotency and differentiation. Keywords: differentiation • DNA methylation • epigenome • histone modification • imprinting • pluripotency • sequencing • stem cells • X inactivation Early mammalian development involves genetic mechanisms in the regulation of the precise orchestration
    [Show full text]
  • Multifaceted Deregulation of Gene Expression and Protein Synthesis with Age
    Multifaceted deregulation of gene expression and protein synthesis with age Aleksandra S. Anisimovaa,b,c,1, Mark B. Meersona,c, Maxim V. Gerashchenkob, Ivan V. Kulakovskiya,d,e,f,2, Sergey E. Dmitrieva,c,d,2, and Vadim N. Gladyshevb,2 aBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow 119234, Russia; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; cFaculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow 119234, Russia; dEngelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia; eVavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia; and fInstitute of Protein Research, Russian Academy of Sciences, Pushchino 142290, Russia Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved May 27, 2020 (received for review January 30, 2020) Protein synthesis represents a major metabolic activity of the cell. RNA polymerase I, eIF2Be, and eEF2, decrease with age in rat However, how it is affected by aging and how this in turn impacts tissues (10). Increased promoter methylation in ribosomal RNA cell function remains largely unexplored. To address this question, genes and decreased ribosomal RNA concentration during aging herein we characterized age-related changes in both the transcrip- were also reported (11). In addition, down-regulation of trans- tome and translatome of mouse tissues over the entire life span. lation with age was confirmed in vivo in the sheep (12) as well as We showed that the transcriptome changes govern those in the in replicatively aged yeast (13).
    [Show full text]