DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 9,476,099 B2 Spinella Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 9,476,099 B2 Spinella Et Al US009476.099B2 (12) United States Patent (10) Patent No.: US 9,476,099 B2 Spinella et al. (45) Date of Patent: Oct. 25, 2016 (54) METHOD FOR DETERMINING FOREIGN PATENT DOCUMENTS SENSTIVITY TO DECTABINE WO WO 2012/031008 A2 3, 2012 TREATMENT WO WO 2012, 11885.6 A1 9, 2012 (71) Applicant: TRUSTEES OF DARTMOUTH COLLEGE, Hanover, NH (US) OTHER PUBLICATIONS (72) Inventors: Michael Spinella, Hanover, NH (US); Tsai et al Cancer Cell. Mar. 20, 2012. 21(3):43.0-446 and Supple Maroun J. Beyrouthy, Lebanon, NH mental pages 1-18. (US) Agilent Technologies. DNA Oligo Microarray Gene Lists and Annotations, available via url: <chem.agilent.com/cag?bSp? gene (73) Assignee: Trustees of Dartmouth College, lists.asp printed on Mar. 1, 2016.* Hanover, NH (US) Abele et al. “The EORTC Early Clinical Trials Cooperative Group Experience with 5-Aza-2'-deoxycytidine (NSC 127716) in Patients (*) Notice: Subject to any disclaimer, the term of this with Colo-rectal, Head and Neck, Renal Carcinomas and Malignant patent is extended or adjusted under 35 Melanomas' European Journal of Cancer and Clinical Oncology U.S.C. 154(b) by 0 days. 1987 23(12): 1921-1924. Adewumi et al. “Characterization of Human Embryonic Stem Cell (21) Appl. No.: 14/416,142 Lines by the International StemCell Initiative” Nature Biotechnol ogy 2007 vol. 25(7):803-816. (22) PCT Filed: Jul. 31, 2013 Al-Hajj et al. "Prospective Identification of Tumorigenic Breast Cancer Cells' Proceedings of the National Academy of Sciences (86). PCT No.: PCT/US2013/052899 2003 100(7):3983-3988 with correction. Berger et al. “Evaluation of Three mRNA Markers for the Detection S 371 (c)(1), of Lymph Node Metastases' Anticancer Research 2006 26:3855 (2) Date: Jan. 21, 2015 3860. Beyrouthy et al. “High DNA Methyltransferase 3B Expression (87) PCT Pub. No.: WO2014/025582 Mediates 5-Aza-Deoxycytidine Hypersensitivity in Testicular Germ Cell Tumors' Cancer Research 2009 69(24):9360-9366. PCT Pub. Date: Feb. 13, 2014 Biswal et al. "Acute Hypersensitivity of Pluripotent Testicular Cancer-derived Embryonal Carcinoma to Low-dose 5-Aza (65) Prior Publication Data Deoxycytidine is Associated with Global DNA Damage-associated US 2015/O197813 A1 Jul. 16, 2015 p53 Activation, Anti-pluripotency and DNA Demethylation”. PLOS ONE 2012 7(12):E53003. Related U.S. Application Data Chaudhary, U.B. and Haldas, J.R. “Long-Term Complications of Chemotherapy for Germ. Cell Tumours Drugs 2003 63(15): 1565 (63) Continuation of application No. 13/571,482, filed on 1577. py 9. (15) Aug. 10, 2012, now abandoned. Clark, A.T. “The StemCell Identity of Testicular Cancer' StemCell Review 2007 3:49-59. (51) Int. C. Clarke et al. “Cancer Stem Cells—Perspectives on Current Status CI2O I/68 (2006.01) and Future Directions: AACR Workshop on Cancer Stem Cells' A6 IK 33/24 (2006.01) Cancer Research 2006 66(19):9339-9344. GOIN 33/53 (2006.01) Clavel et al. “5-Aza-2'-deoxycytidine (NSC 127716) in Non A6 IK3I/7068 (2006.01) Seminomatous Testicular Cancer. Phase II from the EORTC Early GOIN 33/574 (2006.01) Clinical Trials Cooperative Group and Genito-Urinary Group” Annals of Oncology 1992 3(5):399-400. (52) U.S. Cl. Curtin et al. “Retinoic Acid Activates p53 in Human Embryonal CPC ......... CI2O 1/6886 (2013.01); A6IK3I/7068 Carcinoma Through Retinoid Receptor-Dependent Stimulation of (2013.01); A61K 33/24 (2013.01); G0IN p53 Transactivation Function' Oncogene 2001 20:2559-2569. 33/57484 (2013.01); C12O 2600/106 Dichtel-Danjoy et al. “SoxF is Part of a Novel Negative-feedback (2013.01); CI2O 26OO/154 (2013.01); CI2O Loop in the Wingless Pathway the Controls Proliferation in the 2600/158 (2013.01); C12O 2600/16 (2013.01); Drosophila Wing Disc” Development 2009 136:761-769. G0IN 2333/4703 (2013.01); G0IN 2333/4706 (Continued) (2013.01); G0IN 2333/70596 (2013.01) (58) Field of Classification Search Primary Examiner — Carla Myers None (74) Attorney, Agent, or Firm — Licata & Tyrrell P.C. See application file for complete search history. (57) ABSTRACT (56) References Cited The present invention is a gene expression panel of chemo U.S. PATENT DOCUMENTS therapeutic drug-resistant cancer stem cells comprising RIN1, SOX15 and TLR4. In one embodiment the cancer 6,613,753 B2 92003 Rubinfeld et al............... 514,49 stem cells are testicular cancer germ cells. The present 238329 A. 1 2994 ball al. ... as: invention provides for a kit and method for determining 2007/0287676 A 12/2007 Guo'etal. .514.43 response to treatment with decitabine at low doses. 2009, 0214420 A1 8, 2009 Brown ......... 424,149 2012/0156312 A1 6/2012 Spinella et al. .............. 424,649 3 Claims, 17 Drawing Sheets US 9,476,099 B2 Page 2 (56) References Cited Qin et al. “Mechanisms of Resistance to 5-aza-2'-deoxycytidine in Human Cancer Cell Lines’ Blood 2009 113(3):659-667. Schlosser et al. “Dissection of Transcriptional Programmes in OTHER PUBLICATIONS Response to Serum and c-Myc in Human B-Cell Line” Oncogene Einhorn, L.H. “Curing Metastatic Testicular Cancer' Proceedings of 2005 24:520-524. the National Academy of Sciences 2002 99(7):4592-4595. Schuhmacher et al. “The Transcriptional Program of a Human B El-Helw, L. and Coleman, R.E. "Salvage, Dose Intense and High Cell Line in Response to Myc” Nucleic Acids Research 2001 Dose Chemotherapy for the Treatment of Poor Prognosis or Recur 29(2):397-406. rent Germ. Cell Tumours' Cancer Treatment Reviews 2005 31: 197 Senda et al. “Analysis of RIN1 Gene Expression in Colorectal 209. Cancer” Oncology Reports 2007 17:1171-1175. Garcia-Manero, G. “Demethylating Agents in Myeloid Malignan Shen et al. “Drug Sensitivity Prediction by CpG Island Methylation cies’ Current Opinion in Oncology 2008 20:705-710. Profile in the NCI-60 Cancer Cell Line Panel' Cancer Research Giuliano et al. “Testicular Germ Cell Tumors: A Paradigm for the 2007 67(23): 11335-11343. Successful Treatment of Solid Tumor Stem Cells' Current Cancer Singh et al. “Identification of Human Brain Tumour Initiating Cells' Therapy Reviews 2006. 2(3):255-270. Nature 2004 432:396–401. Hermann et al. “Distinct Populations of Cancer Stem Cells Deter Skotheim et al. “Differentiation of Human Embryonal Carcinomas mine Tumor Growth and Metastatic Activity in Human Pancreatic in vitro and in vivo Reveals Expression Profiles Relevant to Normal Cancer Cell Stem Cell 2007 1:313-323. Development” Cancer Research 2005 65(13):5588-5598. Houldsworth et al. “Biology and Genetics of Adult Male Germ Cell Sperger et al. “Gene Expression Patterns in Human Embryonic Tumors” Journal of Clinical Oncology 2006 24(35):5512-5518. StemCells and Human Pluripotent Germ Cell Tumors' Proceedings Huang et al. “Toll-like Receptors on Tumor Cells Faciliate Evasion of the National Academy of Sciences 2003 100(23): 13350-13355. of Immune Surveillance Cancer Research 2005 65:5009-5014. Streitet al. “Northern Blot Analysis for Detection and Quatification Issa, J.J. “DNA Methylation as a Therapeutic Target in Cancer Clin of RNA in Pancreatic Cancer Cells and Tissues' Nature Protocols Cancer Res 2007 13(6):1634-1637. 2009 4(1):3743. Jones, P.A. and Baylin, S.B. “The Epigenomics of Cancer Cell Zhang et al. “Expression and Significance of TLR4 and HIF-1C. in 2007 128:683-692. Pancreatic Ductal Adenocarcinoma’ World J. Gastroenterol. 2010 Kantarian et al. “Results of a Randomized Study of 3 Schedules of 16(23):2881-2888. Low-dose Decitabine in Higher-Risk Myelodysplastic Syndrome Office Communication dated Nov. 20, 2012 from U.S. Appl. No. and Chronic Myelomoncytic Leukemia' Blood 2007 109(1):52-57. 13/393,290, filed Feb. 29, 2012. Kerley-Hamilton et al. “The Direct p53 Target Gene, FLJ11259, Office Communication dated Jan. 14, 2013 from U.S. Appl. No. DRAM, is a Member of a Novel Family of Transmembrane Pro 13/393,290, filed Feb. 29, 2012. teins’ Biochimica et Biophysica Acta 2007 1769(4):209-219. Office Communication dated Aug. 14, 2013 from U.S. Appl. No. Kerley-Hamilton et al. “A p53-Dominant Transcriptional Response 13/393,290, filed Feb. 29, 2012. to Cisplatin in Testicular Germ Cell Tumor-Derived Human Office Communication dated Sep. 23, 2013 from U.S. Appl. No. Embyronal Carcinoma” Oncogene 2005 24:6090-6100. 13/393,290, filed Feb. 29, 2012. Kondagunta et al. “Etoposide and Cisplatin Chemotherapy for Office Communication dated Jul. 3, 2014 from U.S. Appl. No. Metastatic Good-Risk Germ. Cell Tumors' Journal of Clinical 13/393,290, filed Feb. 29, 2012. Oncology 2005 23(36): 9290-92.94. Office Communication dated Nov. 6, 2014 from U.S. Appl. No. Korkola et al. "Down-Regulation of Stem Cell Genes, Including 13/393,290, filed Feb. 29, 2012. Those in a 200-kb Gene Cluster at 12p13.31, is Associated with in Office Communication dated Aug. 26, 2013 from U.S. Appl. No. vivo Differentiation of Human Male Germ. Cell Tumors' Cancer 13/571,482, filed Aug. 10, 2012. Research 2006 66(2):820-827. Office Communication dated Dec. 2, 2013 from U.S. Appl. No. Li et al. “Distinct Regulatory Mechanisms and Functions for 13/571,482, filed Aug. 10, 2012. p53-Activated and p53-Repressed DNA Damage Response Genes Office Communication dated Apr. 18, 2014 from U.S. Appl. No. in Embryonic Stem Cells' Molecular Cell 2012 46:30-42. 13/571,482, filed Aug. 10, 2012. Lin et al. “p53 Induces Differentiation of Mouse Embryonic Stem Office Communication dated Jul. 22, 2014 from U.S. Appl. No. Cells by Suppressing Nanog Expression” Nature Cell Biology 2005 13/571,482, filed Aug. 10, 2012. 7(2):165-171. Office Communication dated Oct.
Load more

Recommended publications
  • Final Copy 2018 09 25 Gaunt
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School.
    [Show full text]
  • A Gene Expression Resource Generated by Genome-Wide Lacz
    © 2015. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2015) 8, 1467-1478 doi:10.1242/dmm.021238 RESOURCE ARTICLE A gene expression resource generated by genome-wide lacZ profiling in the mouse Elizabeth Tuck1,**, Jeanne Estabel1,*,**, Anika Oellrich1, Anna Karin Maguire1, Hibret A. Adissu2, Luke Souter1, Emma Siragher1, Charlotte Lillistone1, Angela L. Green1, Hannah Wardle-Jones1, Damian M. Carragher1,‡, Natasha A. Karp1, Damian Smedley1, Niels C. Adams1,§, Sanger Institute Mouse Genetics Project1,‡‡, James N. Bussell1, David J. Adams1, Ramiro Ramırez-Soliś 1, Karen P. Steel1,¶, Antonella Galli1 and Jacqueline K. White1,§§ ABSTRACT composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Knowledge of the expression profile of a gene is a critical piece of Furthermore, there were 1207 observations of expression of a information required to build an understanding of the normal and particular gene in an anatomical structure where Bgee had no essential functions of that gene and any role it may play in the data, indicating a large amount of novelty in our data set. development or progression of disease. High-throughput, large- Examples of expression data corroborating and extending scale efforts are on-going internationally to characterise reporter- genotype-phenotype associations and supporting disease gene tagged knockout mouse lines. As part of that effort, we report an candidacy are presented to demonstrate the potential of this open access adult mouse expression resource, in which the powerful resource. expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter KEY WORDS: Gene expression, lacZ reporter, Mouse, Resource gene.
    [Show full text]
  • Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis
    cells Article Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis Han-Yu Wang 1,2, Chun-Hsiang Lin 1, Yi-Ru Shen 1, Ting-Yu Chen 2,3, Chia-Yih Wang 2,3,* and Pao-Lin Kuo 1,2,4,* 1 Department of Obstetrics and Gynecology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] (H.-Y.W.); [email protected] (C.-H.L.); [email protected] (Y.-R.S.) 2 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] 3 Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan 4 Department of Obstetrics and Gynecology, National Cheng-Kung University Hospital, Tainan 704, Taiwan * Correspondence: [email protected] (C.-Y.W.); [email protected] (P.-L.K.); Tel.: +886-6-2353535 (ext. 5338); (C.-Y.W.)+886-6-2353535 (ext. 5262) (P.-L.K.) Abstract: Septins are GTP-binding proteins that form heteromeric filaments for proper cell growth and migration. Among the septins, septin7 (SEPT7) is an important component of all septin filaments. Here we show that protein kinase A (PKA) phosphorylates SEPT7 at Thr197, thus disrupting septin filament dynamics and ciliogenesis. The Thr197 residue of SEPT7, a PKA phosphorylating site, was conserved among different species. Treatment with cAMP or overexpression of PKA catalytic subunit (PKACA2) induced SEPT7 phosphorylation, followed by disruption of septin filament formation. Constitutive phosphorylation of SEPT7 at Thr197 reduced SEPT7-SEPT7 interaction, but did not affect SEPT7-SEPT6-SEPT2 or SEPT4 interaction.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Supplementary Figure 1
    Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown siRNA Sequence nucleotides Source GCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3 knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat. # L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our laboratory using the siDESIGN center from the Dharmacon website (www.dharmacon.com) by inputting the Genbank accession number NM_000598 (IGFBP-3). Supplementary Table 2 Transcripts Activated by NKX3.1 in PC-3 Cells PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up- or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as IGFBP-3.
    [Show full text]
  • Protein Interactions in the Cancer Proteome† Cite This: Mol
    Molecular BioSystems View Article Online PAPER View Journal | View Issue Small-molecule binding sites to explore protein– protein interactions in the cancer proteome† Cite this: Mol. BioSyst., 2016, 12,3067 David Xu,ab Shadia I. Jalal,c George W. Sledge Jr.d and Samy O. Meroueh*aef The Cancer Genome Atlas (TCGA) offers an unprecedented opportunity to identify small-molecule binding sites on proteins with overexpressed mRNA levels that correlate with poor survival. Here, we analyze RNA-seq and clinical data for 10 tumor types to identify genes that are both overexpressed and correlate with patient survival. Protein products of these genes were scanned for binding sites that possess shape and physicochemical properties that can accommodate small-molecule probes or therapeutic agents (druggable). These binding sites were classified as enzyme active sites (ENZ), protein–protein interaction sites (PPI), or other sites whose function is unknown (OTH). Interestingly, the overwhelming majority of binding sites were classified as OTH. We find that ENZ, PPI, and OTH binding sites often occurred on the same structure suggesting that many of these OTH cavities can be used for allosteric modulation of Creative Commons Attribution 3.0 Unported Licence. enzyme activity or protein–protein interactions with small molecules. We discovered several ENZ (PYCR1, QPRT,andHSPA6)andPPI(CASC5, ZBTB32,andCSAD) binding sites on proteins that have been seldom explored in cancer. We also found proteins that have been extensively studied in cancer that have not been previously explored with small molecules that harbor ENZ (PKMYT1, STEAP3,andNNMT) and PPI (HNF4A, MEF2B,andCBX2) binding sites. All binding sites were classified by the signaling pathways to Received 29th March 2016, which the protein that harbors them belongs using KEGG.
    [Show full text]
  • Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery
    Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Duygu Ucar Graduate Program in Computer Science and Engineering The Ohio State University 2009 Dissertation Committee: Srinivasan Parthasarathy, Advisor Yusu Wang Umit Catalyurek c Copyright by Duygu Ucar 2009 ABSTRACT Many biological datasets can be effectively modeled as interaction networks where nodes represent biological entities of interest such as proteins, genes, or complexes and edges mimic associations among them. The study of these biological network structures can provide insight into many biological questions including the functional characterization of genes and gene products, the characterization of DNA-protein bindings, and the under- standing of regulatory mechanisms. Therefore, the task of constructing biological interac- tion networks from raw data sets and exploiting information from these networks is critical, but is also fraught with challenges. First, the network structure is not always known in a priori; the structure should be inferred from raw and heterogeneous biological data sources. Second, biological networks are noisy (containing unreliable interactions) and incomplete (missing real interactions) which makes the task of extracting useful information difficult. Third, typically these networks have non-trivial topological properties (e.g., uneven degree distribution, small world) that limit the effectiveness of traditional knowledge discovery al- gorithms. Fourth, these networks are usually dynamic and investigation of their dynamics is essential to understand the underlying biological system. In this thesis, we address these issues by presenting a set of computational techniques that we developed to construct and analyze three specific types of biological interaction networks: protein-protein interaction networks, gene co-expression networks, and regulatory networks.
    [Show full text]
  • The Biological Function of Human Epididymis Protein 4 in Epithelial Ovarian Cancer
    University of Rhode Island DigitalCommons@URI Open Access Dissertations 2018 THE BIOLOGICAL FUNCTION OF HUMAN EPIDIDYMIS PROTEIN 4 IN EPITHELIAL OVARIAN CANCER Nicole Elizabeth James University of Rhode Island, [email protected] Follow this and additional works at: https://digitalcommons.uri.edu/oa_diss Recommended Citation James, Nicole Elizabeth, "THE BIOLOGICAL FUNCTION OF HUMAN EPIDIDYMIS PROTEIN 4 IN EPITHELIAL OVARIAN CANCER" (2018). Open Access Dissertations. Paper 753. https://digitalcommons.uri.edu/oa_diss/753 This Dissertation is brought to you for free and open access by DigitalCommons@URI. It has been accepted for inclusion in Open Access Dissertations by an authorized administrator of DigitalCommons@URI. For more information, please contact [email protected]. THE BIOLOGICAL FUNCTION OF HUMAN EPIDIDYMIS PROTEIN 4 IN EPITHELIAL OVARIAN CANCER BY NICOLE ELIZABETH JAMES A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN PHARMACEUTICAL SCIENCES UNIVERSITY OF RHODE ISLAND 2018 DOCTOR OF PHILOSPHY DISSERTATION OF NICOLE ELIZABETH JAMES APPROVED: Dissertation Committee: Major Professor Clinton Chichester Jennifer Ribeiro Stephen Kogut Joan Peckham Nasser H. Zawia DEAN OF THE GRADUATE SCHOOL UNIVERSITY OF RHODE ISLAND 2018 ABSTRACT Epithelial ovarian cancer (EOC) is the most common gynecologic malignancy worldwide. EOC has a notably poor prognosis, owing to the fact that patients are frequently diagnosed at a late stage after the disease has significantly progressed. While many patients typically respond well to frontline platinum-based chemotherapy, the tumor becomes chemoresistant when a recurrence follows within five years. Therefore, there is an urgent need for the discovery of non-invasive early detection biomarkers and novel targeted therapies.
    [Show full text]
  • Multifaceted Deregulation of Gene Expression and Protein Synthesis with Age
    Multifaceted deregulation of gene expression and protein synthesis with age Aleksandra S. Anisimovaa,b,c,1, Mark B. Meersona,c, Maxim V. Gerashchenkob, Ivan V. Kulakovskiya,d,e,f,2, Sergey E. Dmitrieva,c,d,2, and Vadim N. Gladyshevb,2 aBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow 119234, Russia; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; cFaculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow 119234, Russia; dEngelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia; eVavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia; and fInstitute of Protein Research, Russian Academy of Sciences, Pushchino 142290, Russia Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved May 27, 2020 (received for review January 30, 2020) Protein synthesis represents a major metabolic activity of the cell. RNA polymerase I, eIF2Be, and eEF2, decrease with age in rat However, how it is affected by aging and how this in turn impacts tissues (10). Increased promoter methylation in ribosomal RNA cell function remains largely unexplored. To address this question, genes and decreased ribosomal RNA concentration during aging herein we characterized age-related changes in both the transcrip- were also reported (11). In addition, down-regulation of trans- tome and translatome of mouse tissues over the entire life span. lation with age was confirmed in vivo in the sheep (12) as well as We showed that the transcriptome changes govern those in the in replicatively aged yeast (13).
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • Elucidating Biological Roles of Novel Murine Genes in Hearing Impairment in Africa
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 19 September 2019 doi:10.20944/preprints201909.0222.v1 Review Elucidating Biological Roles of Novel Murine Genes in Hearing Impairment in Africa Oluwafemi Gabriel Oluwole,1* Abdoulaye Yal 1,2, Edmond Wonkam1, Noluthando Manyisa1, Jack Morrice1, Gaston K. Mazanda1 and Ambroise Wonkam1* 1Division of Human Genetics, Department of Pathology, Faculty of Health Sciences, University of Cape Town, Observatory, Cape Town, South Africa. 2Department of Neurology, Point G Teaching Hospital, University of Sciences, Techniques and Technology, Bamako, Mali. *Correspondence to: [email protected]; [email protected] Abstract: The prevalence of congenital hearing impairment (HI) is highest in Africa. Estimates evaluated genetic causes to account for 31% of HI cases in Africa, but the identification of associated causative genes mutations have been challenging. In this study, we reviewed the potential roles, in humans, of 38 novel genes identified in a murine study. We gathered information from various genomic annotation databases and performed functional enrichment analysis using online resources i.e. genemania and g.proflier. Results revealed that 27/38 genes are express mostly in the brain, suggesting additional cognitive roles. Indeed, HERC1- R3250X had been associated with intellectual disability in a Moroccan family. A homozygous 216-bp deletion in KLC2 was found in two siblings of Egyptian descent with spastic paraplegia. Up to 27/38 murine genes have link to at least a disease, and the commonest mode of inheritance is autosomal recessive (n=8). Network analysis indicates that 20 other genes have intermediate and biological links to the novel genes, suggesting their possible roles in HI.
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]