DOCSLIB.ORG

Final Copy 2018 09 25 Gaunt

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Final Copy 2018 09 25 Gaunt This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School. September 2017 Word Count: ~52,000 Abstract Associative recognition memory enables judgements of whether configurations of stimuli have been previously encountered and these memories require de novo protein synthesis in the CA1 subregion of the hippocampus for their consolidation. To investigate associative recognition memory in the present study, the paired viewing procedure (Zhu et al, 1996) was used to present novel and familiar arrangements of images using a within-subjects design. A previous report of increased Fos expression in the novel compared to the familiar condition in CA1 following paired viewing of arrangements was replicated. As there is increased sensitivity to subtle changes in gene expression in the translatome compared to the transcriptome, translating ribosome affinity purification (TRAP; Heiman et al, 2008) was used to extract messenger RNAs engaged with the ribosome by tagging the ribosomal protein L10a with EGFP. In this thesis, viral vectors expressing the EGFP- L10a transgene were developed to target CA1 pyramidal neurons. Combining TRAP and paired viewing, a study profiling the translatome of rat CA1 neurons over time following paired viewing was conducted, aiming to further understanding of the genes and regulatory networks involved in associative recognition memory. As gene expression is also induced in response to behavioural conditions not requiring learning, a no-image control condition was included with matched timepoints. TRAP-generated RNA samples were sequenced and submitted to a range of bioinformatic analyses to identify genes that were differentially expressed between novel and familiar conditions and over time. There was strong evidence of enriched protein-protein interactions between differentially expressed genes (DEGs) and potential regulators of the DEG network were identified. This first translatome profiling study of associative recognition memory sheds light on the dynamics of gene expression during learning and identifies promising candidate genes and molecular functions of interest for follow-up studies. i ii Acknowledgements I would firstly like to thank my supervisors, James Uney, Clea Warburton, and Lucia Marucci, for all their advice and support during my PhD. I would particularly like to thank Helen Scott for her patient guidance in the lab and her assistance with TRAP experiments. I would also like to thank collaborators Steven Sheardown for his advice in setting up the TRAP protocol, Younbok Lee and Doyoung Lee for producing the AAV, and Mark Rogers and Tom Batstone for advice on bioinformatics. I would also like to thank the members of the Bashir-Warburton and Uney-Wong labs, as well as the other present and former students on the Neural Dynamics course, for their friendship and support over the past four years. I am also grateful to the Neural Dynamics programme directors and the Wellcome Trust for giving me this opportunity. I am also grateful to the staff of the Bristol Animal Services Unit for all of the work they do that enabled these experiments and would particularly like to thank Gareth Gough and Jo Roe for going above and beyond. I would also like to thank Simon Lishman of the IT department and Tom Richardson of the Electronics workshop for all their help updating the behavioural equipment. Finally, I would like to thank my friends and family for their endless love and support on this journey. iii iv Author’s declaration I declare that the work in this dissertation was carried out in accordance with the requirements of the University's Regulations and Code of Practice for Research Degree Programmes and that it has not been submitted for any other academic award. Except where indicated by specific reference in the text, the work is the candidate's own work. Work done in collaboration with, or with the assistance of, others, is indicated as such. Any views expressed in the dissertation are those of the author. SIGNED: ............................................................. DATE:.......................... v vi Table of Contents Chapter 1 Introduction .................................................................................................1 1.1 Memory and the brain .....................................................................................1 1.1.1 Types of memory and memory processes.................................................1 1.1.2 Neural pathways for memory and regional functions ...............................2 1.1.3 Recognition memory ................................................................................6 1.2 Genes and cellular processes in the control of synaptic plasticity and memory formation .................................................................................................................. 13 1.2.1 Types of plasticity................................................................................... 14 1.2.2 Regulation of gene expression for plasticity ........................................... 16 1.2.3 Differential gene expression and plasticity ............................................. 19 1.3 Profiling genome-wide gene expression ......................................................... 23 1.3.1 Identifying mRNA transcripts .................................................................. 23 1.3.2 Translatome profiling ............................................................................. 25 1.4 Modification of gene expression in-vivo ......................................................... 30 1.4.1 Transgenic organisms ............................................................................. 30 1.4.2 Viruses ................................................................................................... 31 1.4.3 Summary................................................................................................ 35 1.5 Present work ................................................................................................. 37 Chapter 2 Development of a viral method for Translating Ribosome Affinity Purification 39 2.1 Introduction................................................................................................... 39 2.1.1 Transduction of neurons by viral vectors ................................................ 39 2.1.2 Present work .......................................................................................... 43 2.2 Methods ........................................................................................................ 45 2.2.1 Virus production .................................................................................... 45 2.2.2 Primary culture and transduction by lentivirus ....................................... 47 2.2.3 Viral injections ....................................................................................... 48 2.2.4 Translating Ribosome Affinity Purification (TRAP) ................................... 49 2.3 Results ........................................................................................................... 51 2.3.1 Preparation of AAV and Lentiviruses for TRAP ........................................ 51 2.3.2 Expression of lentiviruses in primary hippocampal culture ..................... 54 2.3.3 Optimisation of viral expression in-vivo .................................................. 59 vii 2.3.4 TRAP with virally transduced cells .......................................................... 64 2.4 Discussion...................................................................................................... 67 2.4.1 Virus development ................................................................................. 67 2.4.2 Lentivirus expression in-vitro ................................................................. 67 2.4.3 Optimisation
Load more

Recommended publications
  • Supplementary Figure 1
    Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown siRNA Sequence nucleotides Source GCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3 knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat. # L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our laboratory using the siDESIGN center from the Dharmacon website (www.dharmacon.com) by inputting the Genbank accession number NM_000598 (IGFBP-3). Supplementary Table 2 Transcripts Activated by NKX3.1 in PC-3 Cells PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up- or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as IGFBP-3.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery
    Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Duygu Ucar Graduate Program in Computer Science and Engineering The Ohio State University 2009 Dissertation Committee: Srinivasan Parthasarathy, Advisor Yusu Wang Umit Catalyurek c Copyright by Duygu Ucar 2009 ABSTRACT Many biological datasets can be effectively modeled as interaction networks where nodes represent biological entities of interest such as proteins, genes, or complexes and edges mimic associations among them. The study of these biological network structures can provide insight into many biological questions including the functional characterization of genes and gene products, the characterization of DNA-protein bindings, and the under- standing of regulatory mechanisms. Therefore, the task of constructing biological interac- tion networks from raw data sets and exploiting information from these networks is critical, but is also fraught with challenges. First, the network structure is not always known in a priori; the structure should be inferred from raw and heterogeneous biological data sources. Second, biological networks are noisy (containing unreliable interactions) and incomplete (missing real interactions) which makes the task of extracting useful information difficult. Third, typically these networks have non-trivial topological properties (e.g., uneven degree distribution, small world) that limit the effectiveness of traditional knowledge discovery al- gorithms. Fourth, these networks are usually dynamic and investigation of their dynamics is essential to understand the underlying biological system. In this thesis, we address these issues by presenting a set of computational techniques that we developed to construct and analyze three specific types of biological interaction networks: protein-protein interaction networks, gene co-expression networks, and regulatory networks.
    [Show full text]
  • Multifaceted Deregulation of Gene Expression and Protein Synthesis with Age
    Multifaceted deregulation of gene expression and protein synthesis with age Aleksandra S. Anisimovaa,b,c,1, Mark B. Meersona,c, Maxim V. Gerashchenkob, Ivan V. Kulakovskiya,d,e,f,2, Sergey E. Dmitrieva,c,d,2, and Vadim N. Gladyshevb,2 aBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow 119234, Russia; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; cFaculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow 119234, Russia; dEngelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia; eVavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia; and fInstitute of Protein Research, Russian Academy of Sciences, Pushchino 142290, Russia Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved May 27, 2020 (received for review January 30, 2020) Protein synthesis represents a major metabolic activity of the cell. RNA polymerase I, eIF2Be, and eEF2, decrease with age in rat However, how it is affected by aging and how this in turn impacts tissues (10). Increased promoter methylation in ribosomal RNA cell function remains largely unexplored. To address this question, genes and decreased ribosomal RNA concentration during aging herein we characterized age-related changes in both the transcrip- were also reported (11). In addition, down-regulation of trans- tome and translatome of mouse tissues over the entire life span. lation with age was confirmed in vivo in the sheep (12) as well as We showed that the transcriptome changes govern those in the in replicatively aged yeast (13).
    [Show full text]
  • Structure and Expression Analyses of SVA Elements in Relation to Functional Genes
    pISSN 1598-866X eISSN 2234-0742 Genomics Inform 2013;11(3):142-148 G&I Genomics & Informatics http://dx.doi.org/10.5808/GI.2013.11.3.142 ORIGINAL ARTICLE Structure and Expression Analyses of SVA Elements in Relation to Functional Genes Yun-Jeong Kwon, Yuri Choi, Jungwoo Eo, Yu-Na Noh, Jeong-An Gim, Yi-Deun Jung, Ja-Rang Lee, Heui-Soo Kim* Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Korea SINE-VNTR-Alu (SVA) elements are present in hominoid primates and are divided into 6 subfamilies (SVA-A to SVA-F) and active in the human population. Using a bioinformatic tool, 22 SVA element-associated genes are identified in the human genome. In an analysis of genomic structure, SVA elements are detected in the 5′ untranslated region (UTR) of HGSNAT (SVA-B), MRGPRX3 (SVA-D), HYAL1 (SVA-F), TCHH (SVA-F), and ATXN2L (SVA-F) genes, while some elements are observed in the 3′UTR of SPICE1 (SVA-B), TDRKH (SVA-C), GOSR1 (SVA-D), BBS5 (SVA-D), NEK5 (SVA-D), ABHD2 (SVA-F), C1QTNF7 (SVA-F), ORC6L (SVA-F), TMEM69 (SVA-F), and CCDC137 (SVA-F) genes. They could contribute to exon extension or supplying poly A signals. LEPR (SVA-C), ALOX5 (SVA-D), PDS5B (SVA-D), and ABCA10 (SVA-F) genes also showed alternative transcripts by SVA exonization events. Dominant expression of HYAL1_SVA appeared in lung tissues, while HYAL1_noSVA showed ubiquitous expression in various human tissues. Expression of both transcripts (TDRKH_SVA and TDRKH_noSVA) of the TDRKH gene appeared to be ubiquitous.
    [Show full text]
  • Genome-Wide Association Study Identifies 44 Independent Genomic Loci for Self-Reported Adult Hearing Difficulty in the UK Biobank Cohort
    bioRxiv preprint doi: https://doi.org/10.1101/549071; this version posted February 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genome-wide association study identifies 44 independent genomic loci for self-reported adult hearing difficulty in the UK Biobank cohort Helena RR. Wells1,2, Maxim B. Freidin1, Fatin N. Zainul Abidin2, Antony Payton3, Piers Dawes4, Kevin J. Munro4,5, Cynthia C. Morton4,5,6, David R. Moore4,7, #*Sally J Dawson2, #*Frances MK. Williams1 1Department of Twin Research and Genetic Epidemiology, School of Life Course Sciences, King's College London 2UCL Ear Institute, University College London 3Division of Informatics, Imaging & Data Sciences, The University of Manchester 4Manchester Centre for Audiology and Deafness, The University of Manchester 5Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Science Centre 6Departments of Obstetrics and Gynecology and of Pathology, Brigham and Women’s Hospital, Harvard Medical School 7Cincinnati Children's Hospital Medical Centre, Department of Otolaryngology, University of Cincinnati College of Medicine #Joint senior authors *Corresponding authors 1 bioRxiv preprint doi: https://doi.org/10.1101/549071; this version posted February 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Age-related hearing impairment (ARHI) is the most common sensory impairment in the aging population; a third of individuals are affected by disabling hearing loss by the age of 651.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,476,099 B2 Spinella Et Al
    US009476.099B2 (12) United States Patent (10) Patent No.: US 9,476,099 B2 Spinella et al. (45) Date of Patent: Oct. 25, 2016 (54) METHOD FOR DETERMINING FOREIGN PATENT DOCUMENTS SENSTIVITY TO DECTABINE WO WO 2012/031008 A2 3, 2012 TREATMENT WO WO 2012, 11885.6 A1 9, 2012 (71) Applicant: TRUSTEES OF DARTMOUTH COLLEGE, Hanover, NH (US) OTHER PUBLICATIONS (72) Inventors: Michael Spinella, Hanover, NH (US); Tsai et al Cancer Cell. Mar. 20, 2012. 21(3):43.0-446 and Supple Maroun J. Beyrouthy, Lebanon, NH mental pages 1-18. (US) Agilent Technologies. DNA Oligo Microarray Gene Lists and Annotations, available via url: <chem.agilent.com/cag?bSp? gene (73) Assignee: Trustees of Dartmouth College, lists.asp printed on Mar. 1, 2016.* Hanover, NH (US) Abele et al. “The EORTC Early Clinical Trials Cooperative Group Experience with 5-Aza-2'-deoxycytidine (NSC 127716) in Patients (*) Notice: Subject to any disclaimer, the term of this with Colo-rectal, Head and Neck, Renal Carcinomas and Malignant patent is extended or adjusted under 35 Melanomas' European Journal of Cancer and Clinical Oncology U.S.C. 154(b) by 0 days. 1987 23(12): 1921-1924. Adewumi et al. “Characterization of Human Embryonic Stem Cell (21) Appl. No.: 14/416,142 Lines by the International StemCell Initiative” Nature Biotechnol ogy 2007 vol. 25(7):803-816. (22) PCT Filed: Jul. 31, 2013 Al-Hajj et al. "Prospective Identification of Tumorigenic Breast Cancer Cells' Proceedings of the National Academy of Sciences (86). PCT No.: PCT/US2013/052899 2003 100(7):3983-3988 with correction.
    [Show full text]
  • Identification of the Long, Edited Dsrnaome of LPS-Stimulated Immune Cells
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Identification of the long, edited dsRNAome of LPS-stimulated immune cells Matthew G. Blango and Brenda L. Bass* Department of Biochemistry, University of Utah, Salt Lake City, Utah 84112, USA * Correspondence: [email protected] Phone: 801-581-4884 Running title: dsRNAome of mammalian immune cells Keywords: dsRNA, RNA binding protein, ADAR, Inosine, RNA editing, LPS 1 Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Endogenous double-stranded RNA (dsRNA) must be intricately regulated in mammals to prevent aberrant activation of host inflammatory pathways by cytosolic dsRNA binding proteins. Here we define the long, endogenous dsRNA repertoire in mammalian macrophages and monocytes during the inflammatory response to bacterial lipopolysaccharide. Hyperediting by adenosine deaminases that act on RNA (ADAR) enzymes was quantified over time using RNA-seq data from activated mouse macrophages to identify 342 Editing Enriched Regions (EERs), indicative of highly structured dsRNA. Analysis of publicly available datasets for samples of human peripheral blood monocytes resulted in discovery of 3,438 EERs in the human transcriptome. Human EERs had predicted secondary structures that were significantly more stable than those of mouse EERs and were located primarily in introns, whereas nearly all mouse EERs were in 3’UTRs. Seventy-four mouse EER-associated genes contained an EER in the orthologous human gene, although nucleotide sequence and position were only rarely conserved. Among these conserved EER-associated genes were several TNFα-signaling genes, including Sppl2a and Tnfrsf1b, important for processing and recognition of TNFα, respectively.
    [Show full text]
  • Dissertation
    Dissertation submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences Presented by Dipl. Biochemist Birgit Rogell born in Speyer (Germany) nd Oral-examination: 2 November 2016 Exploring the biology of RNPs: specific capture of RNPs using antisense locked nucleic acids Referees: 1. Dr. Anne Ephrussi 2. Prof. Dr. Ralf Bartenschlager Abstract Abstract RNA-binding proteins (RBPs) are central players in cell biology and respond to a multitude of cellular cues and environmental stimuli. Identification of RBPs associated with specific transcripts in a cell is a challenging task; and the available strategies to purify specific transcripts and their bound proteome face numerous limitations. Thus, methods to determine the composition of proteins on a given RNA are required to further understand the regulation and biological function of any given RNA. Therefore, the focus of my PhD project was to develop a highly specific and selective method, “specific Ribonucleoprotein (RNP) capture”, to isolate a specific RNA species together with its bound proteome. Following irradiation with ultraviolet (UV) light that creates a covalent bond between RNA and protein, RNAs are captured using short LNA (locked nucleic acid)/DNA mixmer antisense probes coupled to a solid support.The proteins covalently linked to the isolated RNA are then identified by quantitative mass spectrometry. First, I successfully established the method for this application in vitro. Mass spectrometry data revealed that the protein Sister of Sex lethal (Ssx) has similar binding preferences to a mRNA derived from male-specific lethal (msl)2 mRNA as its paralog Sxl in Drosophila melanogaster embryo extracts.
    [Show full text]
  • Expression of Distinct Maternal and Somatic 5.8S, 18S, and 28S Rrna Types During Zebrafish Development
    Downloaded from rnajournal.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press REPORT Expression of distinct maternal and somatic 5.8S, 18S, and 28S rRNA types during zebrafish development MAURO D. LOCATI,1,3 JOHANNA F.B. PAGANO,1,3 GENEVIÈVE GIRARD,1 WIM A. ENSINK,1 MARINA VAN OLST,1 SELINA VAN LEEUWEN,1 ULRIKE NEHRDICH,2 HERMAN P. SPAINK,2 HAN RAUWERDA,1 MARTIJS J. JONKER,1 ROB J. DEKKER,1 and TIMO M. BREIT1 1RNA Biology and Applied Bioinformatics Research Group, Swammerdam Institute for Life Sciences, Faculty of Science, University of Amsterdam, Amsterdam 1090 GE, the Netherlands 2Department of Molecular Cell Biology, Institute of Biology, Leiden University, Gorlaeus Laboratories–Cell Observatorium, Leiden 2333 CE, the Netherlands ABSTRACT There is mounting evidence that the ribosome is not a static translation machinery, but a cell-specific, adaptive system. Ribosomal variations have mostly been studied at the protein level, even though the essential transcriptional functions are primarily performed by rRNAs. At the RNA level, oocyte-specific 5S rRNAs are long known for Xenopus. Recently, we described for zebrafish a similar system in which the sole maternal-type 5S rRNA present in eggs is replaced completely during embryonic development by a somatic-type. Here, we report the discovery of an analogous system for the 45S rDNA elements: 5.8S, 18S, and 28S. The maternal-type 5.8S, 18S, and 28S rRNA sequences differ substantially from those of the somatic-type, plus the maternal-type rRNAs are also replaced by the somatic-type rRNAs during embryogenesis. We discuss the structural and functional implications of the observed sequence differences with respect to the translational functions of the 5.8S, 18S, and 28S rRNA elements.
    [Show full text]
  • Meta-Type Analysis of Dopaminergic Effects on Gene Expression in the Neuroendocrine Brain of Female Goldfish
    ORIGINAL RESEARCH ARTICLE published: 02 November 2012 doi: 10.3389/fendo.2012.00130 Meta-type analysis of dopaminergic effects on gene expression in the neuroendocrine brain of female goldfish JasonT. Popesku 1*†, Christopher J. Martyniuk 2 and Vance L.Trudeau 1* 1 Centre for Advanced Research in Environmental Genomics, Department of Biology, University of Ottawa, Ottawa, ON, Canada 2 Canadian Rivers Institute and Department of Biology, University of New Brunswick, Saint John, NB, Canada Edited by: Dopamine (DA) is a major neurotransmitter important for neuroendocrine control and recent Wei Ge, The Chinese University of studies have described genomic signaling pathways activated and inhibited by DA agonists Hong Kong, China and antagonists in the goldfish brain. Here we perform a meta-type analysis using microar- Reviewed by: José A. Muñoz-Cueto, University of ray datasets from experiments conducted with female goldfish to characterize the gene Cadiz, Spain expression responses that underlie dopaminergic signaling. Sexually mature, pre-spawning Anderson O. Wong, The University of [gonadosomatic index (GSI) D 4.5 ± 1.3%] or sexually regressing (GSI D 3 ± 0.4%) female Hong Kong, Hong Kong goldfish (15–40 g) injected intraperitoneally with either SKF 38393, LY 171555, SCH 23390, *Correspondence: sulpiride, or a combination of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and a-methyl-p- Jason T. Popesku, Centre for Advanced Research in Environmental tyrosine. Microarray meta-type analysis identified 268 genes in the telencephalon and hypo- Genomics, Department of Biology, thalamus as having reciprocal (i.e., opposite between agonism and antagonism/depletion) University of Ottawa, Ottawa, ON, fold change responses, suggesting that these transcripts are likely targets for DA-mediated Canada K1N 6N5.
    [Show full text]
  • Identification of the Long, Edited Dsrnaome of LPS-Stimulated Immune Cells
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Identification of the long, edited dsRNAome of LPS-stimulated immune cells Matthew G. Blango and Brenda L. Bass Department of Biochemistry, University of Utah, Salt Lake City, Utah 84112, USA Endogenous double-stranded RNA (dsRNA) must be intricately regulated in mammals to prevent aberrant activation of host inflammatory pathways by cytosolic dsRNA binding proteins. Here, we define the long, endogenous dsRNA reper- toire in mammalian macrophages and monocytes during the inflammatory response to bacterial lipopolysaccharide. Hyperediting by adenosine deaminases that act on RNA (ADAR) enzymes was quantified over time using RNA-seq data from activated mouse macrophages to identify 342 Editing Enriched Regions (EERs), indicative of highly structured dsRNA. Analysis of publicly available data sets for samples of human peripheral blood monocytes resulted in discovery of 3438 EERs in the human transcriptome. Human EERs had predicted secondary structures that were significantly more stable than those of mouse EERs and were located primarily in introns, whereas nearly all mouse EERs were in 3′ UTRs. Seventy-four mouse EER-associated genes contained an EER in the orthologous human gene, although nucleotide sequence and position were only rarely conserved. Among these conserved EER-associated genes were several TNF alpha-signaling genes, including Sppl2a and Tnfrsf1b, important for processing and recognition of TNF alpha, respectively. Using publicly available data and experimental validation, we found that a significant proportion of EERs accumulated in the nucleus, a strategy that may prevent aberrant activation of proinflammatory cascades in the cytoplasm.
    [Show full text]