DOCSLIB.ORG

Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Constructing and Analyzing Biological Interaction Networks for Knowledge Discovery Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Duygu Ucar Graduate Program in Computer Science and Engineering The Ohio State University 2009 Dissertation Committee: Srinivasan Parthasarathy, Advisor Yusu Wang Umit Catalyurek c Copyright by Duygu Ucar 2009 ABSTRACT Many biological datasets can be effectively modeled as interaction networks where nodes represent biological entities of interest such as proteins, genes, or complexes and edges mimic associations among them. The study of these biological network structures can provide insight into many biological questions including the functional characterization of genes and gene products, the characterization of DNA-protein bindings, and the under- standing of regulatory mechanisms. Therefore, the task of constructing biological interac- tion networks from raw data sets and exploiting information from these networks is critical, but is also fraught with challenges. First, the network structure is not always known in a priori; the structure should be inferred from raw and heterogeneous biological data sources. Second, biological networks are noisy (containing unreliable interactions) and incomplete (missing real interactions) which makes the task of extracting useful information difficult. Third, typically these networks have non-trivial topological properties (e.g., uneven degree distribution, small world) that limit the effectiveness of traditional knowledge discovery al- gorithms. Fourth, these networks are usually dynamic and investigation of their dynamics is essential to understand the underlying biological system. In this thesis, we address these issues by presenting a set of computational techniques that we developed to construct and analyze three specific types of biological interaction networks: protein-protein interaction networks, gene co-expression networks, and regulatory networks. iii Dedicated to my mother, who gave me the courage for the journey to the PhD. I wish she were here to see the end of the journey. iv Acknowledgments I would like to first thank my advisor Dr. Srinivasan Parthasarathy for his invaluable support and guidance throughout my years at OSU. Starting from my first months at OSU, he supported me greatly and provided a stimulating environment for my academic studies. I am grateful for his openness for new ideas and fields including Bioinformatics. I would also like to thank Dr. Yusu Wang, Dr. Ramana Davuluri, and Dr. Umit Catalyurek for serving on my candidacy and defense committees and for providing me with invaluable insights and suggestions. I would also like to thank my collaborators Dr. Hakan Ferhatosmanoglu and Dr. Fatih Altiparmak for their assistance in my work with the gene external similarity. I would also like to thank and acknowledge my collaborators outside the OSU. First, I would like to thank Dr. Christopher Workman for supporting my study at the Technical University of Denmark and for providing a very motivating and friendly environment for me in Denmark. I would like to further thank Dr. Workman and to Dr. Andreas Beyer for all their domain expertise and guidance in my work with regulatory networks. I also would like to thank Dr. Rui-Ru Ji, for hosting me at the Bristol-Myers Squibb as a research intern and for her efforts in our work and in arranging my accommodation and transportation in New Jersey. I would like to acknowledge the National Science Foundation and Department of En- ergy for supporting this work in part through the following grants: NSF CAREER Grant v IIS-0347662, NSF SGER Grant IIS-0742999, NSF RI CNS-0403342, and DOE DE-FG02- 04ER25611. Any opinions, findings, and conclusions expressed in this dissertation are those of the author, her advisor, and collaborators, and do not necessarily reflect the views of the National Science Foundation or the Department of Energy. I would like to thank my friends and colleagues at the Data Mining Research Lab (DMRL) at OSU. I heartily thank my friend Sitaram Asur for long hours we spent dis- cussing ideas, writing papers, and sharing our passion for food and travel. I also want to thank Shirish Tatikonda for always being so positive and genuine. I want to thank Hui Yang for being very supportive during my first years at OSU. She has been a great mentor and a very caring friend to me. I also want to thank other friends at the DMRL for sharing so many things: Amol Ghoting, Greg Buehrer, Matthew Otey and Matthew Goyder, Sameep Mehta, Venu Satuluri, Xintian Yang, and Ye Wang. It was a great pleasure to be a member of this motivating and friendly group. I am more thankful than I can express to my family. Their patience and constant support through my studies kept me going. Special thanks are owed to my dear brother Utku Ucar for sharing my apartment, my ideas, and my life in Columbus during the last year of my PhD. It was a great pleasure to have him here as a friend and as a caring and loving family member. My PhD studies will not come to an end without the constant support of my friends. I am grateful to my dear friend Zulal Fazlioglu Akin for being such a good listener and a supporter. I thank her for her advice and enlightening thoughts in many difficult situations. I also want to thank Yigit and Zulal Akin for sharing so many dinners, conversations, and laughs with me over the years at Crane's. It will always be remembered as a place filled with joy and friendship. I would like to thank Sahika Vatan Korkmaz for always vi listening to me and cheering me up. I also want to thank Gokhan Korkmaz for his friendship and for graduating a year ahead of Sahika. The days we spent with Sahika in 2007 were among the best in my life. I also would like to thank my dear friend Hasibe Otter for her sisterly support and for taking such good care of me, during her years at Columbus. Hasibe, Thomas, Artun, and Timon always made me feel at home and welcomed me to the joyful Otter family. I would also like to thank my friends Arif and Hulya Cetintas for their friendship and for many hours we spent together in Columbus. And I would like to thank my friends in Turkey whom I see in person only once in a while for being there with love, support, and encouragement. And last of all, I want to pay my special thanks to my friend and partner Emre Sencer for his continuous support during my studies and for his joyful existence in my life. I am more thankful than I can say to share my life with such a loving and caring person and to have my share of his colorful stories, his appetite for ethnic-food, his history lessons, and his passion for travel. I had the privilege to learn a lot from him in a very broad range of topics, though none of those are relevant enough to be included into this dissertation. vii VITA July 27, 1980 . Born – Corum, Turkey May 2003 . B.S. Computer Engineering, Bilkent University, Turkey September 2007 . .M.Sc Computer Science & Engineering, The Ohio State University 2003 - 2009 . Graduate Teaching/Research Associate, The Ohio State University June 2007 - Sept 2007 . Research Intern, Bristol-Myers Squibb January 2008 - June 2008 . Guest Researcher, Technical University of Denmark PUBLICATIONS Research Publications Duygu Ucar, Fatih Altiparmak, Hakan Ferhatosmanoglu, and Srinivasan Parthasarathy. Mutual Information Based Extrinsic Similarity for Microarray Analysis. International Conference on Bioinformatics and Computational Biology, BiCOB 2009. Duygu Ucar, Andreas Beyer, Christopher T. Workman, Srinivasan Parthasarathy. Predict- ing functionality of protein-DNA interactions by integrating diverse evidence. Bioinfor- matics Volume 25:12, pages 137-144, 2009 viii Duygu Ucar, Andreas Beyer, Christopher T. Workman, Srinivasan Parthasarathy. Predict- ing functionality of protein-DNA interactions by integrating diverse evidence. In the Pro- ceedings of the 17th Annual International Conference on Intelligent Systems for Molecular Biology, ISMB, 2009. Duygu Ucar, Isaac Neuhaus, Petra Ross-MacDonald, Charles Tilford, Srinivasan Parthasarathy, Nathan Siemers, and Rui-Ru Ji. Construction of a Reference Gene Association Network from Multiple Profiling Data: Application to Data Analysis. Bioinformatics Volume 23:20, pages 2716-2724, August 2007 Sitaram Asur, Duygu Ucar, Srinivasan Parthasarathy. An Ensemble Framework for Clus- tering Protein-Protein Interaction Networks. Bioinformatics Volume 23:13, pages 29-40, July 2007. Sitaram Asur, Duygu Ucar, Srinivasan Parthasarathy. An Ensemble Framework for Clus- tering Protein-Protein Interaction Networks. In the Proceedings of the 15th Annual Inter- national Conference on Intelligent Systems for Molecular Biology, ISMB, 2007. Hui Yang, Srinivasan Parthasarathy, Duygu Ucar. A spatio-temporal mining approach to- wards summarizing and analyzing protein folding trajectories. Algorithms for Molecular Biology, Volume 2:3, April 2007 Duygu Ucar, Fatih Altiparmak, Hakan Ferhatosmanoglu, and Srinivasan Parthasarathy. Investigating the use of Extrinsic Similarity Measures for Microarray Analysis In the BioKDD workshop held at the 13th ACM International Conference on Knowledge Dis- covery and Data Mining, SIGKDD, 2007 Sitaram Asur, Srinivasan Parthasarathy, and Duygu Ucar. An Event-based Framework for Characterizing the Evolutionary Behavior of Interaction Graphs. The 13th International Conference on Knowledge Discovery and Data Mining, SIGKDD, 2007 Duygu Ucar, Sitaram Asur, Umit Catalyurek, and Srinivasan Parthasarathy. Functional Modularity in Protein-Protein Interactions Graphs Using Hub-induced Subgraphs. The 17th European Conference on Principles and Practice of Knowledge Discovery in Databases, PKDD, 2006 Sitaram Asur, Srinivasan Parthasarathy, and Duygu Ucar. An Ensemble Approach for Clus- tering Scale-Free Graph. The LinkKDD workshop held at the 12th ACM International Conference on Knowledge Discovery and Data Mining SIGKDD, 2006 ix Hui Yang, Srinivasan Parthasarathy, and Duygu Ucar. Protein Folding Trajectories Anal- ysis: Summarization, Folding Events Detection and Common Partial Folding Pathway Identification.
Load more

Recommended publications
  • Final Copy 2018 09 25 Gaunt
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School.
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • (TEX) Genes: a Review Focused on Spermatogenesis and Male Fertility
    Bellil et al. Basic and Clinical Andrology (2021) 31:9 https://doi.org/10.1186/s12610-021-00127-7 REVIEW ARTICLE Open Access Human testis-expressed (TEX) genes: a review focused on spermatogenesis and male fertility Hela Bellil1, Farah Ghieh2,3, Emeline Hermel2,3, Béatrice Mandon-Pepin2,3 and François Vialard1,2,3* Abstract Spermatogenesis is a complex process regulated by a multitude of genes. The identification and characterization of male-germ-cell-specific genes is crucial to understanding the mechanisms through which the cells develop. The term “TEX gene” was coined by Wang et al. (Nat Genet. 2001; 27: 422–6) after they used cDNA suppression subtractive hybridization (SSH) to identify new transcripts that were present only in purified mouse spermatogonia. TEX (Testis expressed) orthologues have been found in other vertebrates (mammals, birds, and reptiles), invertebrates, and yeasts. To date, 69 TEX genes have been described in different species and different tissues. To evaluate the expression of each TEX/tex gene, we compiled data from 7 different RNA-Seq mRNA databases in humans, and 4 in the mouse according to the expression atlas database. Various studies have highlighted a role for many of these genes in spermatogenesis. Here, we review current knowledge on the TEX genes and their roles in spermatogenesis and fertilization in humans and, comparatively, in other species (notably the mouse). As expected, TEX genes appear to have a major role in reproduction in general and in spermatogenesis in humans but also in all mammals such as the mouse. Most of them are expressed specifically or predominantly in the testis.
    [Show full text]
  • Ecological and Evolutionary Effects of Interspecific Competition in Tits
    Wilson Bull., 101(2), 1989, pp. 198-216 ECOLOGICAL AND EVOLUTIONARY EFFECTS OF INTERSPECIFIC COMPETITION IN TITS ANDRE A. DHONDT' AmTRAcT.-In this review the evidence for the existence of interspecific competition between members of the genus Purus is organized according to the time scale involved. Competition on an ecological time scale is amenable to experimental manipulation, whereas the effects of competition on an evolutionary time scale are not, Therefore the existence of competition has to be inferred mainly from comparisons between populations. Numerical effects of interspecific competition in coexisting populations on population parameters have been shown in several studies of Great and Blue tits (Parus major and P. caerulm) during the breeding season and during winter, and they have been suggested for the Black-capped Chickadee (P. atricapillus)and the Tufted Titmouse (P. bicolor).It is argued that the doubly asymmetric two-way interspecific competition between Great and Blue tits would have a stabilizing effect promoting their coexistence. Functional effects on niche use have been experimentally shown by removal or cage experiments between Willow (P. montanus)and Marsh (P. pahstris) tits, between Willow and Crested tits (P. cristatus)and Coal Tits (P. ater) and Goldcrests (Regulus reguh), and between Coal and Willow tits. Non-manipulative studies suggestthe existence of interspecific competition leading to rapid niche shifts between Crested and Willow tits and between Great and Willow tits. Evolutionary responses that can be explained as adaptations to variations in the importance of interspecific competition are numerous. An experiment failed to show that Blue Tit populations, subjected to different levels of interspecific competition by Great Tits, underwent divergent micro-evolutionary changes for body size.
    [Show full text]
  • Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79
    www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Supplementary Figure 1
    Supplementary Table 1 siRNA Oligonucleotide Sequences not Used for IGFBP-3 Knockdown siRNA Sequence nucleotides Source GCUACAAAGUUGACUACGA 686-704 ON-TARGET Plus SMART pool sequences GAAAUGCUAGUGAGUCGGA 536-554 ON-TARGET Plus SMART pool sequences GCACAGAUACCCAGAACUU 713-731 ON-TARGET Plus SMART pool sequences GAAUAUGGUCCCUGCCGUA 757-775 ON-TARGET Plus SMART pool sequences UAUCGAGAAUAGGAAAACC 1427-1445 siDESIGN center GCAGCCUCUCCCAGGCUACA 940-958 siDESIGN center GCAUAAGCUCUUUAAAGGCA 1895-1913 siDESIGN center UGCCUGGAUUCCACAGCUU 44-62 siDESIGN center AAGCAGCGTGCCCCGGUUG 106-124 siDESIGN center AAAGGCAAAGCUUUAUUUU 1908-1926 siDESIGN center Oligonucleotide sequences used for siRNA oligonucleotides tested to induce IGFBP-3 knockdown. Sequences 1-4 were from ON-TARGET Plus SMART pool sequences (Cat. # L-004777-00-0005, Dharmacon, Lafayette, CO). Sequences 5-10 were generated in our laboratory using the siDESIGN center from the Dharmacon website (www.dharmacon.com) by inputting the Genbank accession number NM_000598 (IGFBP-3). Supplementary Table 2 Transcripts Activated by NKX3.1 in PC-3 Cells PC-3 cells were stably transfected with the pcDNA3.1 empty vector or NKX3.1 expression vector and mRNA from two clones of each cell type was isolated for microarray analysis on the Affymetrix U-133 expression array. Analyses of results from each pair of clones of the same genotype that did not match up were discarded to ensure clonal variation was not a factor. 984 genes were found to be up- or down-regulated more that 1.4 fold in the NKX3.1 expressing PC-3 cells, in comparison to the PC-3 control cells. The 6th and 9th most activated probe sets were for human growth hormone-dependent insulin-like growth factor-binding protein, now known as IGFBP-3.
    [Show full text]
  • Symbiotic Relationship in Which One Organism Benefits and the Other Is Unaffected
    Ecology Quiz Review – ANSWERS! 1. Commensalism – symbiotic relationship in which one organism benefits and the other is unaffected. Mutualism – symbiotic relationship in which both organisms benefit. Parasitism – symbiotic relationship in which one organism benefits and the other is harmed or killed. Predation – a biological interaction where a predator feeds on a prey. 2A. Commensalism B. Mutualism C. Parasitism D. Predation 3. Autotrophic organisms produce their own food by way of photosynthesis. They are also at the base of a food chain or trophic pyramid. 4. Answer will vary – You will need two plants, two herbivores, and two carnivores 5. Decreases. Only 10% of the energy available at one level is passed to the next level. 6. If 10,000 units of energy are available to the grass at the bottom of the food chain, only 1000 units of energy will be available to the primary consumer, and only 100 units will be available to the secondary consumer. 7. Population is the number of a specific species living in an area. 8. B – All members of the Turdis migratorius species. 9. The number of secondary consumers would increase. 10. The energy decreases as you move up the pyramid which is indicated by the pyramid becoming smaller near the top. 11. Second highest-level consumer would increase. 12. Primary consumer would decrease due to higher numbers of secondary consumer. 13. The number of organisms would decrease due to the lack of food for primary consumers. Other consumers would decrease as the numbers of their food source declined. 14. Number of highest-level consumers would decrease due to lack of food.
    [Show full text]
  • Making Ribosomes: Biochemical and Structural Studies of Early Ribosome Biogenesis in Yeast Malik Chaker-Margot
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 Making Ribosomes: Biochemical and Structural Studies of Early Ribosome Biogenesis in Yeast Malik Chaker-Margot Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Chaker-Margot, Malik, "Making Ribosomes: Biochemical and Structural Studies of Early Ribosome Biogenesis in Yeast" (2018). Student Theses and Dissertations. 472. https://digitalcommons.rockefeller.edu/student_theses_and_dissertations/472 This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. MAKING RIBOSOMES: BIOCHEMICAL AND STRUCTURAL STUDIES OF EARLY RIBOSOME BIOGENESIS IN YEAST A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Malik Chaker-Margot June 2018 © Copyright by Malik Chaker-Margot 2018 MAKING RIBOSOMES: BIOCHEMICAL AND STRUCTURAL STUDIES OF EARLY RIBOSOME BIOGENESIS IN YEAST Malik Chaker-Margot, Ph.D. The Rockefeller University 2018 The ribosome is a complex macromolecule responsible for the synthesis of all proteins in the cell. In yeast, it is made of four ribosomal RNAs and 79 proteins, asymmetrically divided in a small and large subunit. In a growing yeast cell, more than 2000 ribosomes are assembled every minute. The ribosome is assembled through a highly complex process involving more than 200 trans-acting factors. Ribosome assembly begins in the nucleolus where RNA polymerase I transcribes a long polycistronic RNA, the 35S pre- ribosomal RNA which contains the sequences for three of the four ribosomal RNAs, as well as spacer sequences which are transcribed and removed during assembly.
    [Show full text]
  • Pathogenic Variants in the DEAH-Box RNA Helicase DHX37 Are a Frequent Cause of 46,XY Gonadal Dysgenesis and 46,XY Testicular Regression Syndrome
    ARTICLE © American College of Medical Genetics and Genomics Pathogenic variants in the DEAH-box RNA helicase DHX37 are a frequent cause of 46,XY gonadal dysgenesis and 46,XY testicular regression syndrome Ken McElreavey, PhD 1, Anne Jorgensen, PhD 2, Caroline Eozenou, PhD1, Tiphanie Merel, MSc1, Joelle Bignon-Topalovic, BSc1, Daisylyn Senna Tan, BSc3, Denis Houzelstein, PhD 1, Federica Buonocore, PhD 4, Nick Warr, PhD 5, Raissa G. G. Kay, PhD5, Matthieu Peycelon, MD, PhD 6,7,8, Jean-Pierre Siffroi, MD, PhD6, Inas Mazen, MD9, John C. Achermann, MD, PhD 4, Yuliya Shcherbak, MD10, Juliane Leger, MD, PhD11, Agnes Sallai, MD 12, Jean-Claude Carel, MD, PhD 11, Laetitia Martinerie, MD, PhD11, Romain Le Ru, MD13, Gerard S. Conway, MD, PhD14, Brigitte Mignot, MD15, Lionel Van Maldergem, MD, PhD 16, Rita Bertalan, MD, PhD17, Evgenia Globa, MD, PhD 18, Raja Brauner, MD, PhD19, Ralf Jauch, PhD 3, Serge Nef, PhD 20, Andy Greenfield, PhD5 and Anu Bashamboo, PhD1 Purpose: XY individuals with disorders/differences of sex devel- specifically associated with gonadal dysgenesis and TRS. opment (DSD) are characterized by reduced androgenization Consistent with a role in early testis development, DHX37 is caused, in some children, by gonadal dysgenesis or testis regression expressed specifically in somatic cells of the developing human during fetal development. The genetic etiology for most patients and mouse testis. with 46,XY gonadal dysgenesis and for all patients with testicular Conclusion: DHX37 pathogenic variants are a new cause of an regression syndrome (TRS) is unknown. autosomal dominant form of 46,XY DSD, including gonadal Methods: We performed exome and/or Sanger sequencing in 145 dysgenesis and TRS, showing that these conditions are part of a individuals with 46,XY DSD of unknown etiology including clinical spectrum.
    [Show full text]
  • A Regional Study
    POPULATION STRUCTURE AND INTERREGIONAL INTERACTION IN PRE- HISPANIC MESOAMERICA: A BIODISTANCE STUDY DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of the Ohio State University By B. Scott Aubry, B.A., M.A. ***** The Ohio State University 2009 Dissertation Committee: Approved by Professor Clark Spencer Larsen, Adviser Professor Paul Sciulli _________________________________ Adviser Professor Sam Stout Graduate Program in Anthropology Professor Robert DePhilip Copyright Bryan Scott Aubry 2009 ABSTRACT This study addresses long standing issues regarding the nature of interregional interaction between central Mexico and the Maya area through the analysis of dental variation. In total 25 sites were included in this study, from Teotihuacan and Tula, to Tikal and Chichen Itza. Many other sites were included in this study to obtain a more comprehensive picture of the biological relationships between these regions and to better estimate genetic heterozygosity for each sub-region. The scope of the present study results in a more comprehensive understanding of population interaction both within and between the sub-regions of Mesoamerica, and it allows for the assessment of differential interaction between sites on a regional scale. Both metric and non-metric data were recorded. Non-metric traits were scored according to the ASU system, and dental metrics include the mesiodistal and buccolingual dimensions at the CEJ following a modification of Hillson et al. (2005). Biodistance estimates were calculated for non-metric traits using Mean Measure of Divergence. R-matrix analysis, which provides an estimate of average genetic heterozygosity, was applied to the metric data. R-matrix analysis was performed for each of the sub-regions separately in order to detect specific sites that deviate from expected levels of genetic heterozygosity in each area.
    [Show full text]
  • Multifaceted Deregulation of Gene Expression and Protein Synthesis with Age
    Multifaceted deregulation of gene expression and protein synthesis with age Aleksandra S. Anisimovaa,b,c,1, Mark B. Meersona,c, Maxim V. Gerashchenkob, Ivan V. Kulakovskiya,d,e,f,2, Sergey E. Dmitrieva,c,d,2, and Vadim N. Gladyshevb,2 aBelozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow 119234, Russia; bDivision of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; cFaculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow 119234, Russia; dEngelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119991, Russia; eVavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia; and fInstitute of Protein Research, Russian Academy of Sciences, Pushchino 142290, Russia Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved May 27, 2020 (received for review January 30, 2020) Protein synthesis represents a major metabolic activity of the cell. RNA polymerase I, eIF2Be, and eEF2, decrease with age in rat However, how it is affected by aging and how this in turn impacts tissues (10). Increased promoter methylation in ribosomal RNA cell function remains largely unexplored. To address this question, genes and decreased ribosomal RNA concentration during aging herein we characterized age-related changes in both the transcrip- were also reported (11). In addition, down-regulation of trans- tome and translatome of mouse tissues over the entire life span. lation with age was confirmed in vivo in the sheep (12) as well as We showed that the transcriptome changes govern those in the in replicatively aged yeast (13).
    [Show full text]