Metabolic Engineering of Clostridium tyrobutyricum for Enhanced n-Butanol

Production and Sugar Utilization

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

By

Le Yu, B.S.

Graduate Program in The Ohio State Biochemistry Program

The Ohio State University

2015

Dissertation Committee:

Professor Shang-Tian Yang, Advisor

Professor Jeffrey Chalmers

Professor Andre Palmer

Professor Hua Wang

Copyright by

Le Yu

2015

Abstract

With diminished availability of fossil fuels and volatility of petroleum prices, concerns over the reliability in fossil-based energy supply and stability of society and economy are on the rise. The development of bio-based energy resources is becoming more and more important, as the demand for renewable and green energy sources is rapidly expanding. n-Butanol, a four-carbon alcohol, has been widely considered as a superior substitute for current gasoline additive ethanol and a prospective alternative for traditional transportation fuel. Therefore in recent years, increasing attentions have been paid to butanol production from biological approach, and extensive studies have been carried out to better transform biobutanol technology into viable large-scale industrial application.

Clostridium tyrobutyricum ATCC 25755 is characterized as a native acidogen, which only produces acetate and butyrate as its main metabolites. Compared to other solventogenic Clostridium, simpler metabolic pathways and less complex regulatory mechanism that C. tyrobutyricum processes make it easier to manipulate and control.

With advances in metabolic engineering techniques of Clostridium, establishment of a butanol producing pathway in C. tyrobutyricum was achieved previously. However, less than 10 g/L of butanol was produced in batch fermentation with a large amount of acid accumulated, indicating that further genetic manipulation is required to improve butanol

ii production and reduce by-product accumulation.

In order to solve the problem of low butanol production brought by acid accumulation, the effect of CoA transferase (encoded by ctfAB) on butanol production was investigated in this study. The CoA transferase from solventogenic clostridia can catalyze the following reaction: acetate/butyrate + acetoacetyl-CoA → acetyl/butyryl-CoA + acetoacetate, and can thus decrease acetate and butyrate levels and increase butanol production. The plasmid pMTL007 was used to co-express adhE2

(aldehyde /alcohol dehydrogenase) and ctfAB from C. acetobutylicum ATCC 824. In addition, the sol operon containing ctfAB, adc (acetoacetate decarboxylase), and ald

(aldehyde dehydrogenase) was also cloned from C. beijerinckii NCIMB 8052 and expressed in C. tyrobutyricum (Δack, adhE2). Compared to the control C. tyrobutyricum

(Δack, adhE2), all mutants with ctfAB overexpression produced more butanol, with butanol yield increased to 0.22-0.26 g/g (vs. 0.10-0.13 g/g) and productivity to 0.35 g/L·h

(vs. 0.13 g/L·h). Meanwhile, acetate and butyrate decreased 54% and 75%, respectively.

The expression of ctfAB also resulted in acetone production from acetoacetate through a non-enzymatic decarboxylation. An exclusive Pta-Buk reverse pathway for butyrate re-uptake by C. tyrobutyricum was also proposed in this study.

Another problem of C. tyrobutyricum is that the native strain cannot catabolize maltose and soluble starch as its substrates. Therefore in this study, C. tyrobutyricum was further optimized by introducing two extracellular α-glucosidases encoded by agluI and agluII from C. acetobutylicum ATCC 824. The mutants showed active hydrolytic capability of maltose and soluble starch. Significant increase in butanol production by using these two substrates was also observed. Compared to the parental strain C. iii tyrobutyricum (Δack, adhE2) grown on glucose, mutants expressing agluI can direct more butanol production (17.2 vs. 9.5 g/L) with a higher butanol yield (0.20 vs. 0.10 g/g) and productivity (0.29 vs. 0.16 g/L·h). In comparison with C. acetobutylicum ATCC 824, the mutant produced more butanol from maltose (17.2 vs. 11.2 g/L) and soluble starch

(16.2 vs. 8.8 g/L) in batch fermentations. The mutant strain was also stable without antibiotics, reaching a high butanol productivity of 0.40 g/L·h.

Similar to other Clostridium, glucose-mediated carbon catabolite repression (CCR) impedes efficient utilization of xylose in C. tyrobutyricum when the preferred sugar source glucose is present, which would lead to inefficient utilization of xylose in lignocellulosic biomass and low butanol production. To eliminate the bottleneck, three rate-limiting enzymes in xylose catabolism encoded by xylT, xylA, and xylB were overexpressed in C. tyrobutyricum (Δack, adhE2). The resulted mutant realized efficient co-utilization of glucose and xylose with a similar consumption rate. Moreover, compared to the control, the mutant produced more butanol (12.0 vs. 3.2 g/L) with higher butanol yield (0.12 vs. 0.07 g/g) and productivity (0.17 vs. 0.07 g/L·h) from the co-utilization of glucose and xylose. The fermentation with different glucose-to-xylose ratios demonstrated that efficient and simultaneous glucose and xylose utilization could be achieved even at low xylose levels. Efficient and complete co-utilization of glucose and xylose within soybean hull hydrolysate by the mutant further confirmed its exceptional capability of using cheap and abundant lignocellulosic biomass as feedstock.

In summary, two major problems in butanol-producing C. tyrobutyricum including acid accumulation and poor sugar utilization have been addressed. Through genetic engineering, the mutants developed in this study have realized enhanced butanol iv production with more robust sugar utilization capability. With the ability to produce high levels of butanol from low-cost soluble starch and lignocellulose, the engineered C. tyrobutyricum strains developed in this study should have good potential for application in industrial biobutanol production.

v

Dedication

Dedicated to my parents and grandparents

vi

Acknowledgements

First of all, I would like to express my sincere gratitude to my advisor, Dr.

Shang-Tian Yang, for his enormous support and guidance during my 5-year graduate study. His in-depth insight and comprehension of this project has been a true blessing, and his inspiring suggestions and continuous encouragements have been a great motivation to me whenever I encountered difficulties. I am also very grateful to have the opportunity to study in Dr. Yang’s lab. The knowledge and techniques I learned will be a priceless treasure for my future career.

I also want to give my special thanks to Dr. Jeffrey Chalmers, Dr. Andre Palmer, and

Dr. Hua Wang as my committee members. Their kind and valuable suggestions also contributed a lot to the completion of this project.

I want to express my particular thanks to my colleague Dr. Jingbo Zhao, who taught me every basic operation in metabolic engineering, genetic modifications, and anaerobic culture when I first came to this group. His concentration and devotion to this field also set a great example to me. I also want to thank my colleague Dr. Mengmeng Xu for the collaboration and assistance to my work. Great appreciation is given to all my previous and current colleagues in Dr. Yang’s lab, including Dr. Mingrui Yu, Dr. Xiaoguang Liu,

Dr. Baohua Zhang, Dr. Zhongqiang Wang, Dr. Yinming Du, Dr. Yipin Zhou, Dr.

Chih-Chin Chen, Dr. Jie Dong, Dr. Fangfang Liu, Dr. Xiaorui Yang, Dr. Wenyan Jiang and Dr. Meng Lin. Their instruction and assistance are indispensable to my progress in vii both professional expertise and teamwork ability.

Financial supports from the Ohio Department of Development Third Frontier

Advanced Energy Program and National Science Foundation STTR Program are deeply appreciated.

Finally, I would like to thank my parents, Mr. Junping Yu and Mrs. Xiaoyu Liu, and my grandparents Mr. Dezhong Yu and Mrs. Yueying You for giving me their great support and love in the pursuit of my dream.

viii

Vita

June 2006 ……………………………………………………Tianjin No.1 Senior High

2006-2010……………………………………………………B.S. Biological Sciences,

Nankai University

2010 to present……………………………………………Graduate Research Associate,

The Ohio State University

Publications

Yu L, Zhao JB, Xu M, Dong J, Varghese S, Yu MR, Tang IC, Yang ST (2015) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production: Effects of CoA transferase. Appl Microbiol Biotechnol. DOI: 10.1007/s00253-015-6566-5.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST. (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production. Appl. Microbiol. Biotechnol. 99:1011-22.

Yu L, Xu M, Tang IC, Yang ST (2015) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production through co-utilization of glucose and xylose. Biotechnol Bioeng. Accepted.

Fields of Study

Major Field: Biochemistry

Specialty: Biochemical Engineering

ix

Table of Contents

Abstract ...... ii

Dedication ...... vi

Acknowledgements ...... vii

Vita ...... ix

Table of Contents ...... x

List of Figures ...... xvi

List of Tables ...... xix

Chapter 1: Introduction ...... 1

1.1 Project goal and specific tasks ...... 4

1.2 Significance and major impacts ...... 7

1.3 References ...... 8

Chapter 2: Literature review ...... 12

2.1 Current trend in biofuel and biobutanol ...... 12

2.2 Butanol production through ABE fermentation ...... 15

2.2.1 The physiology of solventogenic Clostridium ...... 15

2.2.2 Techniques for genetic manipulation in Clostridium ...... 17

2.2.3 Problems in butanol production by solvent-producing Clostridium ...... 19

2.3 Clostridium tyrobutyricum and butanol production ...... 22

x

2.3.1 Clostridium tyrobutyricum and acid production ...... 22

2.3.2 Butanol production by Clostridium tyrobutyricum ...... 23

2.4 Acid assimilation in Clostridium ...... 25

2.5 Sugar transport and catabolism in Clostridium ...... 28

2.5.1 Sugar transport systems in Clostridium acetobutylicum ...... 28

2.5.2 Sugar catabolism in Clostridium acetobutylicum ...... 30

2.5.3 Regulation of sugar catabolism in Clostridium acetobutylicum ...... 32

2.6 References ...... 36

Chapter 3: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production:

Effects of CoA transferase ...... 62

Abstract ...... 62

3.1 Introduction ...... 63

3.2 Materials and methods ...... 65

3.2.1 Bacterial strains, plasmids, and culture media ...... 65

3.2.2 Plasmids construction ...... 65

3.3.3 Transformation and mutant confirmation ...... 67

3.3.4 Enzyme activity assay ...... 67

3.3.5 Fermentation kinetics ...... 68

3.3.6 Analytical methods...... 69

3.3.7 Statistical analysis ...... 69

3.4 Results ...... 69

3.4.1 Enzyme activity ...... 69

3.4.2 Fermentation Kinetics ...... 70 xi

3.4.3 Effects of ctfAB ...... 73

3.4.4 Effects of pH ...... 75

3.4.5 Effects of different ctfAB and ald genes ...... 75

3.4.6 Acid re-assimilation ...... 76

3.5 Discussion ...... 77

3.6 Acknowledgements ...... 81

3.7 References ...... 82

Chapter 4: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production from maltose and soluble starch by overexpressing α-glucosidases ...... 98

Abstract ...... 98

4.1 Introduction ...... 99

4.2 Materials and methods ...... 101

4.2.1 Bacterial strains, plasmids, and culture media ...... 101

4.2.2 Plasmids construction ...... 101

4.2.3 Transformation ...... 102

4.2.4 Enzyme activity assay ...... 103

4.2.5 Fermentation kinetics ...... 104

4.2.6 Analytical methods...... 104

4.2.7 Segregational stability ...... 105

4.2.8 Statistical analysis ...... 105

4.3 Results ...... 105

4.3.1 α-Glucosidase activity...... 105

4.3.2 Effects of pH ...... 107 xii

4.3.3 Fermentation kinetics using maltose as substrate ...... 109

4.3.4 Fermentation kinetics using soluble starch as substrate ...... 110

4.3.5 Fermentation kinetics without antibiotics ...... 112

4.3.6 Segregational stability ...... 113

4.4 Discussion ...... 114

4.5 Acknowledgements ...... 117

4.6 References ...... 117

Chapter 5: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production through co-utilization of glucose and xylose ...... 129

Abstract ...... 129

5.1 Introduction ...... 130

5.2 Materials and methods ...... 132

5.2.1 Bacterial strains, plasmids, and culture media ...... 132

5.2.2 Plasmids construction ...... 133

5.2.3 Transformation ...... 133

5.2.4 Hydrolysis of soybean hull and detoxification ...... 134

5.2.5 Fermentation kinetics ...... 135

5.2.6 Analytical methods...... 135

5.2.7 Statistical analysis ...... 136

5.3 Results ...... 136

5.3.1 Comparison of Ct(Δack)-pTBA and Ct(Δack)-pM2 in xylose utilization ...... 136

5.3.2 Improved co-utilization of glucose and xylose by Ct(Δack)-pTBA ...... 137

5.3.3 Xylose utilization by Ct(Δack)-pTBA in media with varying glucose-to-xylose xiii

ratios ...... 138

5.3.4 Fermentation of glucose and xylose in soybean hull hydrolysate ...... 139

5.4 Discussion ...... 140

5.5 Acknowledgements ...... 144

5.6 References ...... 144

Chapter 6: Conclusions and Recommendations ...... 156

6.1 Conclusions ...... 156

6.2 Recommendations ...... 158

6.3 References ...... 163

Bibliography ...... 167

Appendix A: Gas chromatography (GC) and high performance liquid chromatography

(HPLC) diagrams ...... 186

A.1 GC standard diagram ...... 186

A.2 GC sample diagram of C. tyrobutyricum expressing adhE2 and co-expressing adhE2 and ctfAB ...... 187

A.3 GC sample diagram of C. tyrobutyricum expressing agluI or agluII using maltose and soluble starch ...... 188

A.4 GC sample diagram of C. tyrobutyricum with pTBA ...... 189

A.5 HPLC standard diagram ...... 190

A.6 HPLC sample diagram of C. tyrobutyricum expressing adhE2 and co-expressing adhE2 and ctfAB ...... 191

A.7 HPLC sample diagram of C. tyrobutyricum expressing agluI or agluII using maltose as substrate...... 192 xiv

A.8 HPLC sample diagram of C. tyrobutyricum expressing agluI or agluII using soluble starch as substrate ...... 193

A.9 HPLC sample diagram of C. tyrobutyricum with pTBA co-utilizing glucose and xylose

...... 194

A.10 HPLC sample diagram of C. tyrobutyricum with pTBA in soybean hull hydrolysate195

Appendix B: Supplementary materials in the study of effects of CoA transferase ...... 196

B.1 Gene adhE2 sequence of C. acetobutylicum with C. tyrobutyricum thl promoter .... 196

B.2 Gene ctfAB sequence of C. acetobutylicum ...... 197

B.3 sol operon of C. beijerinckii ...... 198

Appendix C: Supplemental materials in the generation of Ct pGluI and Ct pGluII ...... 202

C.1 Recombinant plasmids pGluI and pGluII for the expression of agluI and agluII, respectively, and adhE2, under the control of thiolase promoter (Thl) ...... 202

C.2 Gene agluI sequence of C. acetobutylicum ...... 202

C.3 Gene agluII sequence of C. acetobutylicum ...... 203

C.4 Alignment of Aglu I and Aglu II amino acid sequences ...... 206

Appendix D: Supplemental materials in the generation of Ct pTBA mutants ...... 208

D.1 Recombinant plasmid pTBA for the co-expression of xylT, xylB, xylA and adhE2 under the control of thiolase promoter (Thl) ...... 208

D.2 Gene xylT, xylB and xylA sequences in pTBA ...... 208

xv

List of Figures

Figure 1.1 Overview of research objective and tasks ...... 11

Figure 2.1 Annual consumption of biofuels mandated by the Renewable Fuel Standard. 54

Figure 2.2 Metabolic pathways in C. acetobutylicum and C. tyrobutyricum ...... 55

Figure 2.3 A schematic of Clostridium model plasmids ...... 56

Figure 2.4 The procedure of targeting and splicing of the group II intron in ClosTron and

Targetron systems...... 57

Figure 2.5 A schematic procedure of isolation of Clostridium double-crossover allelic

exchange mutants by using lactose-inducible counterselection markers ...... 58

Figure 2.6 Mechanisms of CoA-transferases of families I ...... 59

Figure 2.7 The transport of sugars into cells through phosphotransferase system (PTS) .. 60

Figure 2.8 Global regulatory mechanism of carbon catabolite repression (CCR) on gene

expression...... 61

Figure 3.1 Metabolic pathways in C. tyrobutyricum ...... 92

Figure 3.2 Plasmid maps of pMAD72, pMAT, pSOL and pSV6...... 93

Figure 3.3 Fermentation kinetics of C. tyrobutyricum Ct(Δack)-pMAD72,

Ct(Δack)-pMAT, Ct(Δack)-pSOL, Ct(Δack)-pSV6 at pH 6.0 ...... 94

Figure 3.4 Comparison of butyrate, acetate and butanol production and cell growth (OD)

among strains carrying plasmids pMAD72, pMAT, pSOL and pSV6 in batch

xvi

fermentations at pH 6.0 and 5.0 ...... 95

Figure 3.5 Comparison of butyrate, acetate, acetone, ethanol and butanol production and

specific growth rate for strains carrying plasmids pMAD72, pMAT, pSOL and pSV6

in batch fermentations at pH 6.0 and 5.0...... 96

Figure 3.6 Fermentation kinetics of C. tyrobutyricum Ct(Δack)-pMAT and

Ct(Δack)-pMAD72 at pH 6.0 with acetate or butyrate addition in the medium...... 97

Figure 4.1 Effects of pH on cell growth (OD), maltose consumption, and butyrate, acetate,

ethanol and butanol production in batch fermentations by C. tyrobutyricum

Ct(Δack)-pGluI with pH controlled at 5.0, 5.5, and 5.8 ...... 125

Figure 4.2 Kinetics of batch fermentations of maltose by C. tyrobutyricum Ct(Δack)-pGluI

and Ct(Δack)-pGluII and C. acetobutylicum ATCC 824...... 126

Figure 4.3 Kinetics of batch fermentations of soluble starch by C. tyrobutyricum

Ct(Δack)-pGluI and Ct(Δack)-pGluII and C. acetobutylicum ATCC 824...... 127

Figure 4.4 Batch fermentation kinetics of C. tyrobutyricum Ct(Δack)-pGluI at pH 5.8 with

maltose as carbon source in the absence of thiamphenicol...... 128

Figure 5.1 Kinetics of C. tyrobutyricum Ct(Δack)-pM2and Ct(Δack)-pTBA in batch

fermentations with xylose as substrate at pH 6.0...... 152

Figure 5.2 Kinetics of C. tyrobutyricum Ct(Δack)-pM2 and Ct(Δack)-pTBA in batch

fermentations with glucose and xylose mixture as substrates at pH 6.0...... 153

Figure 5.3 Comparison of xylose and glucose consumptions and butanol production by

Ct(Δack)-pTBA under different initial xylose-to-glucose ratios...... 154

Figure 5.4 Kinetics of C. tyrobutyricum Ct(Δack)-pM2, Ct(Δack)-pTBA and

Ct(Δack)-pTBA with 500 M MV, in batch fermentations with soybean hull xvii

hydrolysate as substrate...... 155

Figure A.1 GC standard diagram for analysis of acetone, ethanol, butanol, acetate, and

butyrate using isobutanol and isobutyrate as inner standard ...... 186

Figure A.2 GC diagrams for analysis of samples in fermentation of C. tyrobutyricum

expressing adhE2 and co-expressing adhE2 and ctfAB ...... 187

Figure A.3 GC diagrams for analysis of samples in fermentation of C. tyrobutyricum

expressing agluI or agluII using maltose and soluble starch ...... 188

Figure A.4 GC diagrams for analysis of samples in fermentation of glucose and xylose by

C. tyrobutyricum with pTBA ...... 189

Figure A.5 HPLC standard diagram for analysis of glucose, xylose, ethanol, butanol,

acetate, and butyrate...... 190

Figure A.6 HPLC diagrams for sample analysis of C. tyrobutyricum expressing adhE2

and co-expressing adhE2 and ctfAB ...... 191

Figure A.7 HPLC diagrams for sample analysis of C. tyrobutyricum expressing agluI or

agluII using maltose as substrate ...... 192

Figure A.8 HPLC diagrams for sample analysis of C. tyrobutyricum expressing agluI or

agluII using soluble starch as substrate ...... 193

Figure A.9 GC diagrams for analysis of samples in fermentation of glucose and xylose in

CGM by C. tyrobutyricum with pTBA ...... 194

Figure A.10 GC diagrams for analysis of samples in fermentation of glucose and xylose in

soybean hull hydrolysate by C. tyrobutyricum with pTBA ...... 195

Figure B.1 Fermentation kinetics of C. tyrobutyricum Ct(Δack)-pMAD72,

Ct(Δack)-pMAT, Ct(Δack)-pSOL, and Ct(Δack)-pSV6 at pH 5.0 ...... 201 xviii

List of Tables

Table 2.1 Comparison of genetic manipulation techniques in Clostridium ...... 51

Table 2.2 Fermentation performances of metabolically engineered of C. acetobutylicum 52

Table 2.3 Sugar utilization in fermentation of lignocellulosic hydrolysates ...... 53

Table 3.1 Bacterial strains and plasmids used in this study ...... 90

Table 3.2 CoA transferase activities in C. acetobutylicum ATCC 824, C. beijerinckii

NCIMB 8052, and C. tyrobutyricum Ct(Δack), Ct(Δack)-pMAD72, Ct(Δack)-pMAT,

Ct(Δack)-pSOL, and Ct(Δack)-pSV6...... 91

Table 4.1 Bacterial strains and plasmids used in this study ...... 122

Table 4.2 α-Glucosidase activities in cell extract, associated with cells, and in supernatant

at different pHs...... 123

Table 4.3 α-Glucosidase activities of C. tyrobutyricum Ct(Δack)-pGluI and C.

acetobutylicum ATCC 824 pregrown on glucose, maltose, and glucose and maltose

mixture...... 123

Table 4.4 Fermentation kinetics of C. tyrobutyricum and C. acetobutylicum grown on

maltose and starch ...... 124

Table 5.1 Bacterial strains and plasmids...... 149

Table 5.2 Kinetics of co-fermentation of glucose and xylose in CGM and SHH by

Ct(Δack)-pM2 and Ct(Δack)-pTBA...... 150

xix

Table 5.3 Fermentation kinetics of Ct(Δack)-pTBA grown on glucose-xylose mixtures at

different ratios in serum bottles...... 151

Table B.1 Summary of fermentation kinetics of various C. tyrobutyricum mutants ...... 200

xx

Chapter 1: Introduction

n-Butanol is a four-carbon alcohol used in a variety of industries, such as cosmetics, textile and pharmaceuticals (Ladisch, 1991). Besides, as one of the most important and promising biofuels, n-butanol shares many physical similarities to the traditional gasoline and is also superior to the current gasoline additive ethanol, including higher energy density, lower vapor pressure and less corrosivity (Xue et al., 2013). The application of biobutanol as an alternative transportation fuel can greatly eliminate many environmental issues brought by current petroleum-based industry. Considering these advantages, butanol has been widely recognized as a prospective substitute for gasoline (Dürre, 2007).

The current mainstream method for butanol production is based on a chemical process via Oxo synthesis, which is still incapable of avoiding the reliance on fossil fuels (Atsumi et al., 2008). Biobutanol production through large-scale acetone-butanol-ethanol (ABE) fermentation can be traced back to more than one hundred years ago and was once among the largest in fermentation industry (Jones and Woods, 1986). Although the industry of

ABE fermentation declined rapidly after the World War II due to economic reasons, interest in applying ABE fermentation for biobutanol production is rising again in recent years (Dürre, 2007; Kumar and Gayen, 2011).

Two main solvent-producing microorganisms Clostridium acetobutylicum and

Clostridium beijerinckii are well-known for ABE production and they are characterized by a biphasic metabolism including acidogenesis and solventogenesis (Lee et al., 2008). 1

During ABE fermentation, the main metabolites acetate and butyrate produced in the acidogenesis are reassimilated for subsequent ethanol and butanol production in the solventogenesis (Lee et al., 2008). The entire process that controls the metabolic pathways relies on the expression of different sets of genes which are responsible for the biosynthesis of acids and alcohols, respectively (Andersch et al., 1983; Hartmanis and

Gatenbeck, 1984; Branduardi et al., 2013). Two essential operons (sol and adc operons) are activated and are in charge of solvent production during solventogenesis. The sol operon is consist of an adhE gene encoding an aldehyde/alcohol dehydrogenase that catalyzes the conversion from acetyl-CoA and butyryl-CoA to ethanol and butanol, and ctfAB genes encoding a CoA transferase that is capable of converting acetate and butyrate into acetyl-CoA and butyryl-CoA and producing acetoacetate at the same time (Fischer et al., 1993). The acetoacetate obtained in the CoA-transfer reaction can be further decarboxylated to acetone by an acetoacetate decarboxylase encoded by the adc operon

(Gerischer et al., 1992). Although over these years, the two Clostridium species have been extensively studied in order to improve their fermentation performance (Lee et al.,

2008; Branduardi et al., 2013), the detailed metabolic pathways as well as the regulatory mechanism still remain unclear (Zheng et al., 2009).

This study focuses on another Clostridium species: C. tyrobutyricum ATCC 25755.

Compared to C. acetobutylicum and C. beijerinckii, C. tyrobutyricum shares a very similar metabolic pathway in terms of acid synthesis, but it lacks several essential enzymes catalyzing the biosynthesis of ABE (acetone, butanol and ethanol), including a

CoA transferase, an aldehyde/alcohol dehydrogenase and an acetoacetate decarboxylase.

As a result, C. tyrobutyricum is characterized as an acidogenic strain which can only 2 produce butyrate and acetate as its main metabolites from hexose or pentose (Zhu and

Yang, 2003; Liu et al., 2005). Compared to solvent-producing Clostridium, C. tyrobutyricum does not contain complex metabolic regulations that control the transition from acidogenesis to solventogenesis, therefore it is a much simpler strain and is easy to manipulate in fermentation (Yu et al., 2012). The common techniques in genetic engineering of Clostridium are also applicable in C. tyrobutyricum and many mutants constructed by heterologous overexpression or integrational mutagenesis have been developed (Zhu et al., 2004; Liu et al., 2005; Zhang et al., 2012; Yu et al., 2011&2012).

Besides this, C. tyrobutyricum also has a robust C4 congestion pathway with high butyrate tolerance and production (Liu et al., 2005), which is an advantage for biobutanol production. In terms of butanol tolerance, C. tyrobutyricum is also superior in comparison with C. acetobutylicum and C. beijerinckii (Yu et al., 2012). In consideration of all these respects, C. tyrobutyricum is a more desirable strain for future large-scale biobutanol production.

According to a previous study, the ack gene in the pathway towards acetate production was knocked out by integrational mutagenesis (Liu et al., 2006). Although the disruption of ack failed to eliminate acetate synthesis completely, the mutant strain

CT(Δack) can tolerate a much higher concentration of butyrate and produce more butyrate (41.65 g/L vs. 19.98 g/L for the wild type) in the fermentation, suggesting that the disruption of ack enabled a favorable carbon flux toward C4 congestion pathway (Liu et al., 2006). In another study, the adhE2 gene which encodes a bifunctional aldehyde/alcohol dehydrogenase (Fontaine et al., 2002) was overexpressed in the C. tyrobutyricum mutant strain CT(Δack), which successfully induced the production of 3 butanol to a level of ~8-10 g/L in a batch fermentation (Yu et al., 2011&2012). Aside from butanol and ethanol, a large amount of butyrate and acetate (>20 g/L) was also accumulated in the fermentation, which indicated that the robustness of acid-producing pathway still overwhelmed the heterologous butanol-producing pathway. This resulted in a low butanol yield at ~0.1 g/g (Yu et al., 2011&2012). Although the problem of acid accumulation could be relieved previously by the implementation of an artificial electron carrier methyl viologen in the fermentation (Du et al., 2014), the application of the methyl viologen in large-scale fermentation is questionable due to its high economic cost and toxicity to the environment.

Another problem of C. tyrobutyricum is that it is only capable of catabolizing a limited number of sugars as its substrates, mainly including a few hexoses and pentoses such as glucose, xylose, fructose, mannitol and lactate (Dwidar et al., 2012). In this respect, C. acetobutylicum and C. beijerinckii are better in utilizing a wide range of sugars including monosaccharides, disaccharides and even some oligo-/poly-saccharides

(Lu, 2011). This drawback makes C. tyrobutyricum at a disadvantage in using cheap biomass-based feedstocks which usually contain a diversity of sugars. With development and maturity of techniques in metabolic engineering of Clostridium, solving these problems in C. tyrobutyricum has become feasible. Construction of a high-titer and high-yield butanol-producing C. tyrobutyricum with a more robust sugar catabolic network will make it more prospective to be applied in industrial applications.

1.1 Project goal and specific tasks

The purpose of this study was metabolic engineering of C. tyrobutyricum for 4 improved butanol production and sugar utilization. This included the relief of acid accumulation during butanol production by C. tyrobutyricum through genetic modification. Higher butanol titer and yield were expected after depressed acid production. Another goal was to improve the utilization of sugars by C. tyrobutyricum.

This included the introduction of necessary enzymes from C. acetobutylicum for the consumption of maltose and soluble starch by C. tyrobutyricum. It also included metabolic engineering of C. tyrobutyricum for efficient co-utilization of glucose and xylose. The elimination of the bottleneck of carbon catabolic repression in xylose catabolism in the presence of glucose would facilitate the utilization of lignocellulosic biomass containing glucose and xylose. Figure 1.1 gives an overview of research objective and specific tasks. The detailed tasks in this study are described below.

Task 1: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production: Effects of CoA transferase

C. tyrobutyricum has been successfully engineered to realize the production of butanol by the overexpression of an alcohol/aldehyde dehydrogenase encoded by adhE2

(Yu et al., 2011 & 2012). However, the mutant still produced a significant amount of acetate and butyrate, resulting in a relatively low butanol titer and yield. To solve this problem, a CoA transferase pathway was introduced to reutilize butyrate and acetate accumulated during butanol production. In order to find the optimal fermentation result, two plasmids that overexpressing adhE2 and ctfAB from C. acetobutylicum, and a sol operon from C. beijerinckii, respectively were transformed into C. tyrobutyricum.

Besides that, another plasmid pSV6 expressing adhE2 and a truncated sol operon were 5 also transformed into C. tyrobutyricum. The detailed fermentation kinetics of the mutants constructed is shown and discussed in Chapter 3.

Task 2: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production from maltose and soluble starch by overexpressing α-glucosidases.

C. tyrobutyricum is unable to utilize maltose and soluble starch as substrates.

However, they are two major forms of sugars present in potatoes and various cereals, which were once the main feedstock in ABE fermentation one hundred years ago and are still the most common substrates in current industrial biobutanol production in China. In order to realize the utilization of maltose and soluble starch by C. tyrobutyricum, two extracellular α-glucosidases from C. acetobutylicum ATCC 824 were transferred into C. tyrobutyricum. Fermentations with different pHs were carried out to find out the optimal pH for maltose and soluble starch hydrolysis. Comparison among C. tyrobutyricum only expressing adhE2, C. acetobutylicum ATCC 824 and two C. tyrobutyricum mutants expressing the two α-glucosidases, respectively was carried out. The detailed fermentation kinetics is exhibited and discussed in Chapter 4.

Task 3: Metabolic engineering of Clostridium tyrobutyricum for n-butanol production through co-utilization of glucose and xylose

Carbon catabolic repression (CCR) impedes the consumption of xylose in the presence of glucose. No xylose can be catabolized after glucose is used up, leading to an early termination of fermentation and low butanol production (Hu et al., 2011; Jin et al.,

2014). The rate-limiting enzymes in xylose catabolism, including a xylose symporter, a 6 xylose isomerase and a xylulokinase, were identified in C. acetobutylicum ATCC 824

(Xiao et al., 2011). In order to relieve the restriction in glucose and xylose co-utilization, these three enzymes were overexpressed in C. tyrobutyricum. The performance of glucose and xylose co-utilization by the mutant was investigated under different glucose-to-xylose ratios. The hydrolysate from soybean hull rich in glucose and xylose was also used to further demonstrate the ability of this mutant in glucose and xylose co-utilization in biomass-based feedstocks. The detailed results are discussed in Chapter

5.

1.2 Significance and major impacts

This study focused on metabolic engineering of C. tyrobutyricum for enhanced butanol production and sugar utilization. Acid accumulation in C. tyrobutyricum has become a major barrier in achieving high-titer and high-yield butanol production in C. tyrobutyricum. As a result, it would be ideal if the acids produced in C. tyrobutyricum could be reused for butanol production. The transfer of the CoA transferase into C. tyrobutyricum not only realized the reutilization of acids but also transformed the native acidogenic C. tyrobutyricum into an ABE producer. Meanwhile, improved butanol production is achieved after CoA transferase expression with much less acid accumulation. In addition, utilization of maltose and starch as substrates is an essential capability for butanol production, since these two substrates are currently the main feedstocks for ABE fermentation in industry. High butanol production in fermentation of maltose and starch is an invaluable feature for industrial application. The realization of maltose and soluble starch utilization in C. tyrobutyricum makes it more prospective to be 7 applied in large-scale butanol production. Lastly, many previous studies have reported inefficient xylose utilization in fermentation of lignocellulosic biomass, which is caused by the glucose-mediated catabolite repression present in multiple Clostridium spp. The setback in utilization of lignocellulose as feedstock would be economically unfavorable and lead to low butanol production in fermentation. Therefore, a breakthrough in efficient glucose and xylose co-utilization is especially important for future application of lignocellulosic biomass, the use of which would turn large-scale biobutanol production into an economically feasible process.

1.3 References

Andersch W, Bahl H, Gottschalk (1983) Level of enzymes involved in acetate, butyrate, acetone and butanol formation by Clostridium acetobutylicum. Appl Microbiol Biotechnol. 18:327–332.

Atsumi S. Hanai T, Liao JC (2008) Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature. 17: 327-332

Branduardi P, De Ferra F, Longo V, Porro D (2013) Microbial n-butanol production from Clostridia to non-Clostridial hosts. Eng Life Sci. 14: 16-26

Du YM, Jiang WY, Yu MR, Tang IC, Yang ST (2014) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol. Bioeng. 9999: 1–12

Dürre P (2007) Biobutanol: An attractive biofuel. J Biotechnol. 2: 1525-1534.

Dwidar M, Park JY, Mitchell RJ, Sang BI (2012) The future of butyric acid in industry. Scientific World Journal. 2012: 471417.

Fischer RJ, Helms J, Dürre P (1993) Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol. 175: 6959-69

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular 8 characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

Gerischer U, Dürre P (1990) Cloning, sequencing, and molecular analysis of the acetoacetate decarboxylase gene region from Clostridium acetobutylicum. J Bacteriol. 172: 6907-18

Hartmanis MGN, Gatenbeck S. (1984) Intermediary metabolism in Clostridium acetobutylicum: Levels of enzymes involved in the formation of acetate and butyrate. Appl Microbiol Biotechnol 47:1277–1283

Hu S, Zheng H, Gu Y, Zhao J, Zhang W, Yang Y, Wang S, Zhao G, Yang S, Jiang W. (2011) Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. BMC Genomics. 12: 93.

Jin L, Zhang H, Chen L, Yang C, Yang S, Jiang W, Gu Y (2014) Combined overexpression of genes involved in pentose phosphate pathway enables enhanced D-xylose utilization by Clostridium acetobutylicum. J Biotechnol. 173:7-9.

Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev 50: 484-524.

Kumar, M. and K. Gayen (2011). Developments in biobutanol production: New insights. Appl. Ener. 88: 1999-2012.

Ladisch MR (1991) Fermentation-derived butanol and scenarios for its uses in energy-related applications. Enzyme and microbial technology. 50: 484-524.

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: 209-228.

Liu X, Zhu Y, Yang ST (2005) Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC 25755 and mutants. Enz Microb Technol 38: 521-528.

Liu X, Zhu Y, Yang ST (2006) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog. 22:1265-75.

Lu CC. (2011) Butanol production from lignocellulosic feedstocks by acetone-butanol-ethanol fermentation with integrated product recovery. Dissertation, The Ohio State University.

9

Xiao H, Gu Y, Ning Y, Yang Y, Mitchell WJ, Jiang W, Yang S (2011) Confirmation and elimination of xylose metabolism bottlenecks in glucose phosphoenolpyruvate-dependent phosphotransferase system-deficient Clostridium acetobutylicum for simultaneous utilization of glucose, xylose, and arabinose. Appl Environ Microbiol. 77: 7886–7895.

Xue C, Zhao X-Q, Liu CG, Chen L-J, Bai F-W (2013) Prospective and development of butanol as an advanced biofuel. Biotechnol Adv. 31:1575-1584.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng. 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol.93: 881-9.

Zhang YL, Yu MR, Yang ST. (2012) Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol. Prog. 28: 52–59.

Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ. (2009) Problems with the microbial production of butanol. J Ind Microbiol Biotechnol. 36:1127-38.

Zhu Y, Yang ST. (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr 19:365-372.

Zhu Y, Liu X, Yang ST. (2004) Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng 90: 154-166.

10

Figure 1.1 Overview of research objective and tasks

11

Chapter 2: Literature review

2.1 Current trend in biofuel and biobutanol

With the rapid development of society and economy, increasing demand for oil supplies and concerns about environmental pollutions have become an imminent issue for our life. The demand for sustainable and green energy sources has rapidly expanded over the past decade (Demirbas, 2009; Green, 2011) and the annual worldwide investment in renewable energy has climbed up to more than $200 billon since 2010 (McCrone et al.,

2014). Biofuels, as one of the most promising renewable energies applicable in a variety of industries, have drawn special attentions. It is widely accepted that biofuels carry several outstanding advantages over the traditional fossil industry. Firstly, biofuel is a much cleaner and safer alternative which can preserve environmental quality and greatly reduce green gas emissions. Biofuels also provide renewability and sustainability in contrast to fossil-based resources. The utilization of cheap feedstocks from biomass-based materials in biofuel production has become a heated study field in recent years (Stöcker, 2008; Kumar et al., 2009). Last but not in the least, biofuels can also decrease nations’ reliance on foreign import and therefore greatly strengthen domestic energy security. Governments could be able to be more independent to meet their domestic demands and adopt their own energy policy, should market-based biofuel production be built (Dürre, 2007; Agarwal, 2007). The U.S. government enacted the 12

Energy Independence and Security Act (EISA) in 2007 to advocate the development of alternative energies. The Renewable Fuel Standard (Figure 2.1) provided in the EISA mandates the annual consumption of biofuels to reach 36 billion gallons by 2022, which consists of 35 billion gallons of biofuels and 1 billion gallons of biomass-based diesel production. Although reaching the goal would be a long and difficult task due to economic and social reasons, considerable progress has been made in biofuel technology.

Biofuel, as a prospective alternative energy in the future, has not only become an attainable idea, but also been recognized as an indispensable development and investment direction by both developed and developing countries. With the continuous improvement of the production and biorefinery technology, biofuels, together with other types of renewable energies, will have the potential to replace the traditional energy sources and become a mainstream energy supply in our future life.

Currently, a large portion of biofuel market is taken by bioethanol and biodiesel industries (Brunschwiga et al., 2012). Some other types of biofuels, such as biobutanol, have also been found to be valuable as well as applicable for large-scale manufacture. n-Butanol is a four-carbon alcohol. Its similarity to gasoline in a few crucial physical properties makes it widely recognized as a promising substitute for current transportation fuel (Ezeji et al., 2007a; Lee et al., 2008). It also carries many advantages, compared to the current gasoline additive ethanol, including higher energy density, lower vapor pressure and less corrosivity (Xue et al., 2013). In the current market, more than 5 million tons of butanol is produced per year mainly by petrochemical synthesis via Oxo process

(Atsumi et al., 2008), which accounts for ~$6 billion market. Although the butanol production through bacterial fermentation has boomed but declined later during the 19th 13 and 20th century, renewed attentions towards biobutanol production have been raised over the last decade (Dürre, 2007; Ni et al., 2009; Mariano et al., 2013; Branduardi et al.,

2013). However, limited by relatively low butanol production as well as high production investment and cost, the current price of biobutanol is still higher than that of bioethanol, making market-based biobutanol industry difficult to advance. As increasing attentions have been paid, extensive studies on both the upstream and downstream process in biobutanol production have been carried out by the collaboration of many companies and research groups. In 2006, the companies BP and DuPont announced a joint collaboration to develop advanced biofuels technologies. In 2009, they formed Butamax Advanced

Biofuels LLC to develop and deliver biobutanol technology for large-scale butanol production. Another company Gevo Inc founded the first commercial-scale biobutanol plant in 2012 and its production scale is still rapidly expanding over the last two years.

Also in 2012, a demonstration plant was developed in Brazil under the cooperation of

Cobalt Techonology and Rhodia Inc. to apply sugarcane bagasse as the feedstock in butanol production. The company Green Biologics is also committed to the development of biobutanol with branches and collaborations in many countries including the United

States, the United Kingdom, India and China. As advances in the technology of ABE fermentation, large-scale biobutanol production would become more feasible in both technological and economic levels. Considering those advantages of butanol over ethanol, butanol is superior as the additive to gasoline and is even prospective to be developed to a desirable alternative to transportation fuels.

14

2.2 Butanol production through ABE fermentation

The first large-scale acetone-butanol-ethanol (ABE) fermentation using Clostridium can be traced back to more than one hundred years ago (Jones and Woods 1986). After the World War II, the industry of ABE fermentation shrank rapidly due to diminished market demands, increased production costs and limited availability of crops as feedstocks (Dürre, 2007; Kumar and Gayen, 2011). However, the interests in ABE fermentation have risen again over the last 10 years and many studies have been carried out attempting to illustrate the mechanism behind ABE fermentation (Dürre, 2007;

Lutke-Eversloh and Bahl, 2011; Branduardi et al., 2013).

2.2.1 The physiology of solventogenic Clostridium

ABE fermentation using solventogenic clostridia such as Clostridium acetobutylicum and Clostridium beijerinickii has been extensively studied over the last few years (Branduardi et al., 2013). C. acetobutylicum and C. beijerinickii share a similar metabolic pathway of solvent synthesis and a similar biphasic metabolism feature.

Acidogenesis and solventogenesis are the two phases that occur subsequently during fermentation. Different sets of genes and their corresponding pathways would be initiated in the two phases (Dürre et al., 1987; Lee et al., 2008). In acidogenesis, acetate and butyrate are the main metabolites both converted from acetyl-CoA, the oxidative product of pyruvate. Acetate is synthesized directly from the acetyl-CoA by a phosphotransacetylase (Pta) and an acetate kinase (Ack). Acetyl-CoA can also enter a C4 congestion pathway to form butyryl-CoA. Similar reactions are followed to catalyze butyryl-CoA into butyrate by a phosphotransbutyrylase (Ptb) and a butyrate kinase (Buk) 15

(Andersch et al., 1983; Hartmanis and Gatenbeck, 1984). The process of acids synthesis is accompanied by ATP accumulation which is used to support cell growth and metabolism. The accumulation of acids lowers the culture pH to a certain level and triggers the initiation of solventogenic phase. During solventogenesis, several essential genes responsible for ABE production including adhE and ctfAB genes are activated. An aldehyde/alcohol dehydrogenase encoded by the adhE gene directs the butanol and ethanol synthetic pathways (Fischer et al., 1993). A CoA transferase encoded by the ctfAB genes is responsible for transferring a CoA moiety from acetoacetyl-CoA to butyrate and acetate, forming acetoacetate, butyryl-CoA and acetyl-CoA (Wiesenborn et al. 1989a).

Acetoacetate, the precursor of acetone, will be further decarboxylated by an acetoacetate decarboxylase (Gerischer et al., 1992). The pathways shown in Figure 2.2 summarize the physiology of solvent-producing Clostridium. For the transition from acidogenesis to solventogenesis during fermentation, several critical regulators, such as Spo0A and SolR, have been identified to be essential in the initiation and regulation of solventogenesis.

Previous studies that inactivated Spo0A and SolR regulators caused depressed and enhanced solvent production, respectively, suggesting that Spo0A and SolR were acted as an activator and a repressor, respectively in the solvent-producing process (Harris et al.,

2001; Alaska et al., 2004). However, the detailed regulatory mechanism about how these regulators trigger the initiation of the transition and activate the expression of solvent-producing enzymes remains unclear (Nair et al., 1999; Ravagnani et al., 2000;

Thormann et al., 2002; Alsaker et al., 2004).

16

2.2.2 Techniques for genetic manipulation in Clostridium

In order to better understand the metabolism of ABE fermentation, strategies of targeted genetic manipulation in Clostridium, including gene overexpression, gene knockins and knockouts, have been developed (Table 2.1) (Lütke-Eversloh, 2014). For heterologous gene overexpression, several shuttle vectors between Clostridium and E. coli have been constructed, such as pMTL80000 series. The pMTL80000 series contain different combinations of Gram-positive replicons and selective markers, and all the necessary components for plasmid transformation by conjugation (Figure 2.3) (Heap et al., 2009). The expression profiles of native Clostridium promoters such as thl, ptb and adc promoters have also been demonstrated to be able to induce constitutive gene expression (Feustel et al., 2004). The construction of methylation plasmid pAN1 and pAN2 can protect the heterologous plasmids from the restriction modification system within the cells, providing additional efficiency to the transformation process as well as stability to the expression system (Mermelstein and Papoutsakis, 1993a&b). Over these years, gene expression using methylated pMTL80000 vectors has been widely used and become a highly efficient technique in the metabolic engineering of Clostridium.

Gene knockins & knockouts based on homologous recombination have also been widely used by designing an integration cassette with homologous regions in a non-replicative plasmid (Green and Bennett, 1996; Nair et al., 1999; Harris et al., 2002;

Heap et al., 2012). Gene expression through integration of an expression cassette together with an appropriate selective marker into chromosomes can avoid the loss of heterologous plasmids and prevent the addition of antibiotics in fermentation

(Lütke-Eversloh, 2014). Single crossovers and double crossovers are the two main 17 strategies used in homologous recombination in Clostridium (Cartman et al., 2012;

Kennedy et al., 2005; Zhang et al., 2012). However, low integration rate is a persistent problem of this method. Since the method depends on the transformation and the integration of a non-replicative plasmid into chromosome, the low efficiency of transformation and low occurrence rate of recombination require extra efforts in the construction of mutants (Al-Hinai et al., 2012). The knock-in cassettes are also restricted to the size which can be up to 6.5 kb (Heap et al., 2012). Limited availability in the choice of antibiotics is another problem which makes multiple knockins and knockouts difficult to realize (Heap et al., 2009). A possible solution is using an antibiotic recovery system of Flp-Frt recombination designed into the integration cassette (Heap et al.,

2010).

The development of the ClosTron mutagenesis system provides an additional approach for the disruption of a target gene in Clostridium spp. The ClosTron system utilizes a segment of mobile group II intron RNA which can specifically target a specific

DNA site on the chromosome and process reverse splicing, therefore realizing the disruption of the target gene (Figure 2.4). In the ClosTron system, all the components are constructed in shuttle vector pMTL007 which includes an Ll.LtrB intron from

Lactococcus lactis and an IEP gene ltrA which can facilitate the targeting of intron RNA to the specific DNA site (Heap et al., 2007&2009). This method provides an efficient and stable way for targeted gene knock-out. Compared to homologous integration, this method is easy to manipulate, less labor-intensive and is also reliable, and it has already been applied in a variety of Clostridium spp. (Emerson et al., 2009; Twine et al., 2009;

Xu et al., 2015). The TargeTron technique based on the same principle has also been used 18 to construct gene knock-out mutants in Clostridium (Zhong et al., 2003). Previous studies showed that it can also be customized for target gene knock-ins (Rawsthorne et al., 2006), but no such example has been reported in Clostridium. Multiple knockouts can be obtained in both methods by using Flp-Frt recombination to reuse antibiotic markers

(Heap et al., 2009).

A novel system for efficient selection of double-crossovers mutants by using a counterselection marker was established recently for fast and accurate isolation of target gene disruption in Clostridium spp. (Al-Hinai et al., 2012). This method uses a toxin encoded by mazF as the counterselection marker (Zhang et al., 2006) under the control of a lactose-inducible promoter (Hartman et al., 2011). The knock-out cassette designed for double-crossovers is cloned into a replicative Clostridium plasmid and remains stable in the cells, therefore significantly increased the probability of homologous recombination.

The toxin only functions after the addition of lactose which induces its expression. The isolation process is to screen for mutants that have lost the plasmid which expressing the toxin gene mazF as well as successful allelic exchange mutants carrying an appropriate antibiotic marker inserted into the target site (Figure 2.5). Successful gene knock-ins were achieved by using this method and the knock-in cassette can be as large as 6.2 kb.

Flp-Frt recombination can be also applied in the design for the removal of antibiotic markers so that multiple knock-outs and knock-ins could be obtained.

2.2.3 Problems in butanol production by solvent-producing Clostridium

With the development of genetic manipulation techniques for Clostridium, metabolic engineering of Clostridium has become more efficient. Studies using one or a 19 combination of these techniques mentioned above have been applied in clostridia to explore its metabolism and also the regulation behind it. However, two main problems in

ABE fermentation including butanol tolerance and by-products accumulation are still unsolved and will impede high-titer and high-yield butanol production (Lee et al., 2008;

Zheng et al., 2009).

Butanol tolerance is one of the most critical problems in ABE fermentation. Among other solvents, butanol is especially toxic to the cells. As high as 50% inhibition in cell growth was observed when 1.1% (v/v) butanol was applied and no sign of growth was observed at 1.5% (v/v) butanol in C. acetobutylicum (Jones and Woods, 1986; Baer et al.,

1987). According to a previous study, high level of butanol would increase the fluidity of cell membrane and therefore destabilize the membrane structure and inactivate membrane-associated functions (Lee et al., 2008). According to previous studies, the change in the physiology of the cell membrane was accompanied by an increase in the expression level of heat shock proteins (HSP) (Nicolaou et al., 2010; Janssen et al., 2012).

Overexpressing a HSP-encoding gene groESL increased butanol tolerance and solvent production by 40% (Tomas et al., 2003&2004). Increased expression level of a cyclopropane fatty acid synthase gene cfa could also improve butanol tolerance (Zhao et al. 2003). Besides this, a previous study developed a mutant strain JB200 based on C. acetobutylicum through adaption and random mutagenesis with increased butanol tolerance and titer to ~20 g/L. Comparative genomic analysis with the parental strain revealed a truncated mutation in the histidine kinase-encoding gene cac3319. The disruption of this gene using the ClosTron system in the wild type resulted in a mutant with comparable butanol production to that of JB200, indicating that the histidine kinase 20 may be another critical factor in both butanol tolerance and production (Xu et al., 2015).

Process optimization is another way to solve butanol tolerance issue in ABE fermentation.

In situ solvent recovery techniques such as gas stripping and adsorption have been applied to fermentation process, which have been demonstrated to be able to effectively alleviate the challenge of butanol tolerance and realize high-titer butanol production

(Qureshi and Blaschek, 2001b; Ezeji et al., 2005a; Wiehn et al., 2014).

Another problem in ABE fermentation is that the production of byproducts such as acetate, butyrate and acetone would divert carbon flux from butanol biosynthesis, therefore compromising butanol production (Zheng et al., 2009). Table 2.2 summarizes previous studies that used metabolic engineering to reestablish the metabolic pathways in

Clostridium in order to improve butanol production. Generally, disruption of acetate and butyrate producing pathways would exert a favorable impact on butanol production due to decreased acid accumulation (Green et al., 1996; Cooksley et al., 2012; Jang et al.,

2012). A previous study which combined a double knockout of pta and buk genes responsible for acids conversion, and an overexpression of a mutated adhE gene for butanol synthesis in C. acetobutylicum realized a significant increase in butanol titer and yield to 18.9 g/L and 0.29 g/g glucose (Jang et al., 2012). However, disruption of acetone synthetic pathway through the knockout or knockdown of ctfAB or adc gene by either the

ClosTron or RNA interference technique, failed to reduce acetone level significantly; instead it elevated acid accumulation and decreased butanol production even if the pathway of acid synthesis was also disrupted in the mutant (Tummala et al., 2003; Sillers et al., 2009; Cooksley et al., 2012), while overexpression of ctfAB and adc gene could induce more solvent production, which indicated the importance of the 21 acetone-producing pathway in acid reassimilation and butanol production. Also, disruption of sol operon repressor gene solR had a favorable impact on butanol production, probably caused by attenuated repression on sol operon expression.

2.3 Clostridium tyrobutyricum and butanol production

2.3.1 Clostridium tyrobutyricum and acid production

Similar to most of ABE-producing Clostridium, C. tyrobutyricum ATCC 25755 is rod-shaped and sporogenic Clostridium. It is strictly anaerobic and characterized as an acidogen which only produces acetate and butyrate as its main metabolites (Wu and Yang,

2003). It shares similar metabolic pathways to solvent-producing Clostridium, but lack a few vital genes responsible for solvent productions including ctfAB and adc for acid reuptake and acetone production and adhE for butanol and ethanol synthesis (Figure 2.2).

Because it can produce high level of butyrate, C. tyrobutyricum has been widely considered for butyrate production in industrial application (Zhu and Yang, 2003; Liu et al., 2005; Dwidar et al., 2012).

Studies have been conducted previously to investigate the effects of ack, pta and ptb knock-outs on acids production in C. tyrobutyricum. After disruption of ptb gene, declined activities of both Ptb and its downstream enzyme Buk were detected. However, the decrease in their activities failed to contribute to a decline in butyrate level, implying that multiple copies of ptb genes or some other unknown butyrate synthetic pathways may exist. Also, the disruption of ptb led to an increase in acetate and hydrogen production (Zhang et al., 2012). Disruption of ack gene responsible for acetate conversion was also realized previously by homologous integration. The fermentation of 22 the mutant strain showed a drastic increase in butyrate level from 20.0 g/L to 41.7 g/L.

More than 30% of the maximum growth rate was retained at a level of 15 g/L butyrate, compared to less than 10% in the wild type, suggesting an increase in butyrate tolerance after ack knockout. Enhanced butyrate production after the ack knockout indicated a strengthened C4 congestion pathway toward C4 product synthesis (Liu et al., 2006). The knockout of pta gene in C. tyrobutyricum exhibited a similar trend, which increased butyrate level by 15% and decreased acetate level by 14%. The butyrate productivity was also improved by 100% (Zhu et al., 2004). In summary, the disruption of ack or pta gene improved the production of butyrate, but did not eliminate acetate synthesis. This may be because that multiple copies of acetate synthetic enzymes may be present in C. tyrobutyricum. Apparently, C. tyrobutyricum with disrupted ack gene is superior to the pta-disrupted mutant in terms of butyrate production, indicating that the acetate kinase encoded by ack may be a rate-limiting step in acetate conversion.

2.3.2 Butanol production by Clostridium tyrobutyricum

Increased butyrate level after the disruption of ack suggests a strong metabolic flux towards C4 metabolites such as butyrate and butyryl-CoA, which makes this mutant a promising candidate for butanol production (Liu et al., 2006). Butanol production by C. tyrobutyricum was achieved previously by the overexpression of a bifunctional aldehyde and alcohol dehydrogenase encoded by an adhE2 gene cloned from C. acetobutylicum

ATCC 824. Different vectors including pMTL8000 series (Yu et al., 2011) and pMTL007

(Yu et al., 2012) were used to direct stable and efficient butanol production. The overexpression of adhE2 can induce butanol titer to a level of 8-10 g/L, with its yield at 23

0.10 g/g glucose. In addition to butanol production, acids accumulation can also reach

~20 g/L. Increased butanol titer (~18 g/L) was realized previously by using a more reducing sugar mannitol, suggesting that high NADH level would benefit butanol production (Yu et al., 2012). In order to decrease acids accumulation and increase NADH level for solvent synthesis, the artificial electron carrier methyl viologen (MV) was applied to the fermentation in a previous study (Du et al., 2014). Methyl viologen can increase the level of NADH by directing the electron flow towards NADH conversion other than hydrogen generation. Butanol level after the addition of MV was elevated to

14.5 g/L with a significant decline in both H2 and acids production (Du et al., 2014).

Although C. acetobutylicum and C. beijerinckii have been well-studied and considered as the most prospective strains for biobutanol production, there are still a lot of concerns and disadvantages for these two strains. As described above, most solventogenic clostridia contain two metabolic phases named as acidogenesis and solventogenesis. The metabolic shift between them depends on a complex and highly regulated network, which involves a series of unclear regulatiors and activators to trigger the initiation of solventogenesis, including sporulation, pH, redox potential and metabolite levels (Girbal et al., 1995; Dürre et al., 2002; Thormann et al., 2002; Alsaker et al., 2004;Rydzak et al., 2011;). For solvent production, two essential operons (sol and adc) are involved in this process (Gerischer and Dürre, 1990; Petersen and Bennett, 1990;

Fischer et al., 1993). Although a few regulators like spo0A and solR have been identified to be essential for the regulation of these operons, detailed mechanism still remains unknown (Nair et al., 1999; Ravagnani et al., 2000; Thormann et al., 2002; Alsaker et al.,

2004). In addition, acid crash remains to be another critical concern when fast 24 accumulation of acetate and butyrate occurs without the control of pH, which may lead to repressed solvent production (Maddox et al., 2000; Wang et al., 2011). Therefore, the complexity of solventogenic clostridia would bring a lot of uncertainty and instability to the fermentation performance. On the contrary, C. tyrobutyricum is characterized as a native acetogen with much simpler metabolic cycle and pathway. High butyrate production after the disruption of ack indicated a favorable carbon flux towards C4 metabolism (Liu et al., 2006). The expression of adhE2 gene enabled this strain to constitutively produce butanol through the life cycled, and avoid complex metabolic regulation and transition (Yu et al., 2011 & 2012). As for butanol tolerance, C. tyrobutyricum is also more resistant under the stress of butanol. According to the previous study, the inhibition of cell growth was less than 20% and 50% at 1.0% and 1.5% (v/v) butanol, respectively, whereas cell growth was inhibited by ~20% and ~85% in C. beijerinckii and ~50% and ~100% in C. acetobutylicum (Yu et al., 2012). Based on these respects, C. tyrobutyricum is a more promising candidate in butanol production than the other two solvent-producing Clostridium spp.

2.4 Acid assimilation in Clostridium

Although butanol production was realized previously in C. tyrobutyricum, the mutant is still subject to low butanol titer and yield with a large amount of acids accumulated. The production of excessive acids also lowers the pH rapidly, which requires frequent pH adjustment during fermentation. Butanol production will be improved if reduced acid production or reuptake of acids could be achieved in C. tyrobutyricum (Yu et al., 2011&2012; Du et al., 2014). 25

Much less acids are accumulated in C. acetobutylicum and C. beijerinckii, since the pathway for the reassimilation of butyrate and acetate is present in their metabolic pathways. Over these years, topics concerning the detailed mechanism of acetate and butyrate reassimilation in solvent-producing Clostridium have been extensively studied.

One widely-accepted opinion is that acid reassimilation is mediated by the expression of the CoA transferase during the metabolic shift from acidogenesis to solventogenesis

(Wiesenborn et al., 1989a). In C. acetobutylicum, the ctfAB genes encoding the

CoA-transferase are located in the same operon (sol operon) with adhE gene, indicating that during solventogenesis, they are co-expressed to direct solvent production (Lee et al.,

2008). The CoA transferase found in solventogenic Clostridium belongs to family I of

CoA transferases which catalyzes substrates including 3-oxoacids (EC 2.8.3.5, EC

2.8.3.6), short-chain fatty acids (EC 2.8.3.8, EC 2.8.3.9) and glutaconate (EC 2.8.3.12).

The reversible reaction proceeds via a ping-pong mechanism with a glutamate residue as the active site (Figure 2.6) (Charrier et al., 2006). The enzyme in bacteria is a heterodimer consists of two subunits (A and B) of about 25 kd each and will undergo a conformational change during the reaction. The main function of the CoA transferase in ABE metabolism is to re-uptake the acids (mainly butyrate and acetate) synthesized during acidogenesis by the transfer of a CoA moiety from acetoacetyl-CoA, leading to the production of butyryl-CoA and acetyl-CoA which can be further converted to butanol and ethanol synthesis. The CoA transferase will remove the toxicity brought by acetate and butyrate in the early stage of fermentation and use them as substrates for following butanol synthesis. In vitro study showed that the relative rate of acetate conversion by the CoA transferase was higher than that of butyrate when equal molar ratio of butyrate and 26 acetate were present in the reaction, however in vivo, CoA transferase had a much higher activity towards butyrate than acetate (Wiesenborn et al., 1989a). This is probably due to that differences in the intracellular concentrations of butyrate and acetate might have facilitated the CoA transferase activity for butyrate, and the levels of CoASH, acetyl-CoA and butyryl-CoA within cells inhibited the transferase activity towards acetate more than butyrate (Wiesenborn et al., 1989a). Besides butyrate and acetate, the CoA-transferase also showed broad substrate specificity with respect to multiple carboxylic acids such as propionate. Many previous studies have knocked out or knocked down the ctfAB genes, showing a significant increase in acid production and a decline in butanol level, suggesting the significance of the CoA transferase pathway in acid re-uptake and solvent production (Sillers et al., 2008; Lee et al., 2009; Jang et al., 2012).

A lot of previous studies have also suggested the existence of a CoA transferase-independent butyrate reuptake pathway catalyzing the reverse reaction from butyrate to butyrl-CoA through a Buk and Ptb channel. It means the Buk and Ptb are in charge of not only butyrate synthesis but also butyrate re-uptake. Many evidences have implied the presence of this reverse reaction by using a ctfAB-disrupted mutant. The fermentation results of the mutant showed a rise in acetate level throughout the fermentation, whereas butyrate concentration exhibited an increase in the exponential phase and a subsequent decrease in the following stationary phase (Jiang et al., 2009;

Lehmann et al., 2012; Jang et al., 2012). Another interesting study was done by the overexpression of ptb and buk genes in C. acetobutylicum. Instead of a rise in butyrate level, a significant decline in its level was observed, signifying the reverse reaction was probably closely connected to Buk and Ptb channel (Walter et al., 1994). The presence of 27 this mechanism was also reasoned by using a mathematical model that simulated the metabolic switch in ABE-producing network (Millat et al., 2014). Another study that used purified Ptb from C. acetobutylicum to test its activity in catalyzing the reverse reaction.

The result showed a lifted activity of the reverse reaction from butyryl phosphate to butyryl-CoA, as the pH decrease below 6.0, further suggesting that the Ptb in the butyrate-producing pathway can also catalyze a reversible reaction (Wiesenborn et al.,

1989b).

2.5 Sugar transport and catabolism in Clostridium

One of the advantages of C. acetobutylicum and C. beijerinckii is that they are capable of catabolizing a wide range of carbohydrates such as glucose, xylose, fructose, galactose, glycerol, sucrose, lactose, cellobiose, maltose, and starch as their substrates

(Lu, 2011). Compared to them, C. tyrobutyricum is limited in the metabolism of carbohydrates only including a few monosaccharides such as glucose, xylose, fructose, and mannose (Dwidar et al., 2012). Efficient utilization of different carbohydrates is a critical standard for the selection of a qualified strain for industrial fermentation, because when using different types of feedstocks like crops-based materials or industrial wastes, multiple types of sugars may be contained. Especially in large-scale fermentation, incapable of or inefficient utilization of sugars may lead to underproduction and a large economic loss (Qureshi and Blaschek, 2000&2001a).

2.5.1 Sugar transport systems in Clostridium acetobutylicum

Three different transportation systems are present in C. acetobutylicum. One is the 28 most well-known phosphotransferase system (PTS) which is mainly responsible for the import of monosaccharides and disaccharides (Mitchell et al., 1991; Tangney et al.,

2001&2007; Yu et al., 2007). PTS is comprised of two cytosolic components (Enzyme I and HPr) and a membrane substrate-specific enzyme complex II (EII). The transport of sugars is initiated by the specific binding of the EII complex with a sugar molecule. A cascade of phosphorylation reactions will proceed with the successive transfer of a phosphate from PEP, EI, HPr, and EII to the final sugar molecule to form a phosphorylated sugar (Figure 2.7). Therefore after the transport, the imported sugar will be in a phosphorylated form (Mitchell and Tangney, 2005; Deutscher et al., 2006; Bizzini et al., 2010). Another transport system is called ATP-binding cassette (ABC) transporter system. In C. acetobutylicum, ABC transporters are mainly in charge of the transport of pentose and sucrose (Nölling et al., 2001). The fundamental structure of an ABC transporter is comprised of 4 core domains, including 2 transmembrane domains (TMDs) and 2 nucleotide-binding domains (NBD) (Higgins, 1995; Linton and Higgins, 1998).

The TMDs, each contains six transmembrane α-helices, form a channel through which sugar molecules are transported. The NBDs are located in the cytoplasmic side of membrane and can direct ATP hydrolysis once sugar molecules bind to the TMDs and trigger a conformational change. Other than these domains, some periplasmic binding proteins are also important in facilitating the specific binding of the target molecules and the delivery to the TMDs (Higgins, 2001). The third type of sugar transport system is known as facilitated diffusion. Unlike the other two transport systems which are ATP dependent, facilitated diffusion is driven by electrochemical gradients across the cell membrane (Friedman, 2008). Several symporters for glucose, xylose, arabinose and 29 galactose transport have been identified in C. acetobutylicum and most of these facilitators belong to the major facilitator superfamily (MFS) (Nölling et al., 2001).

2.5.2 Sugar catabolism in Clostridium acetobutylicum

In C. acetobutylicum, two main glycolytic pathways are present. One is the

Embden-Meyerhof-Parnas (EMP) pathway for hexose catabolism; the other is through the Pentose Phosphate Pathway (PPP) for pentose metabolism (Gheshlaghi et al., 2009;

Liu et al., 2012; Jin et al., 2014). Glucose is the simplest and most preferred sugar for C. acetobutylicum (Yu et al., 2007). Two copies of glucose PTS transporters encoded by

CAC0570, CAC1353 and CAC1354 were identified on the chromosome (Servinsky et al.,

2010). Once imported by PTS and becomes glucose-6-P, it will enter the glycolytic pathway directly. Maltose, which is consist of two glucose units linked by an α-1,4 glycosidic bond, can be catabolized through two divergent systems. One is through a PTS system (malP, CAC0532) for the import of maltose molecules and a maltose-6-P glucosidase (malH, CAC0533) for the hydrolysis of maltose-6-P into glucose and glucose-6-P (Tangney et al., 2001; Thompson et al., 2004). The other system is based on two extracellular α-glucosidases (CAC2252, CAC2891) which can process the breakdown of a maltose molecule into two glucose units outside the cells (Bendtsen et al.,

2004). Starch, a polysaccharide consists of a large number of glucose units, was used as the substrate for ABE fermentation since a long time ago and is still the main feedstock for biobutanol production currently in China (Ezeji et al., 2005b&2007a). Most of the reactions which involved the hydrolysis of starch occur in the extracellular matrix

(Servinsky et al., 2010). Two copies of α-amylases (CA_P0168, CA_P0098) which can 30 process random cleavage at the α-1,4 glycosidic bond were identified in the megaplasimd pSol of C. acetobutylicum (Paquet et al., 1991). Glucoamylase (CAC2810) and

α-glucosidase (CAC2252, CAC2891) can cleave off one glucose unit at a time from the non-reducing end of maltose or maltodextrin (Sonic et al., 1992). De-branching enzymes like pullulanase are also important in starch hydrolysis which can catalyze the hydrolysis of α-1,6 glycosidic linkage in starch to produce a linear chain of oligosaccharides

(Eksteen et al., 2003). Increased expression of other glucose and maltose metabolic systems is also observed during starch hydrolysis when smaller hydrolytic products such as glucose and maltose start to accumulate (Servinsky et al., 2010).

Fructose is a ketonic monosaccharide, which is abundant in corn syrups (Tappy and

Lê, 2010). The import of fructose also relies on the PTS system encoded by CAC0233 and CAC0234. Once imported, the fructose-1-P will be phosphorylated into fructose-1,6-Bis-P by a phosphofructokinase (CAC0232) and then be broke down into glyceraldehyde and dihydroxyacetone by an aldolase (Barrière et al., 2005; Servinsky et al., 2010). As intermediates in the glycolytic pathways, the glyceraldehyde and dihydroxyacetone can be further catabolized. The disaccharide sucrose is formed by the linkage of a fructose and a glucose. Similar to fructose, the metabolism of sucrose uses a

PTS system encoded by scrA (CAC0423) to transport and convert sucrose into sucrose-6-P. A sucrose-6-P hydrolase (scrB, CAC0425) hydrolyzes the sucrose-6-P into a glucose-6-phosphate and a fructose which will be further phosphorylated by a fructokinase (scrK, CAC0424) to become fructose-1-P (Tangney and Mitchel, 2000).

Xylose is a pentose which is abundant in multiple lignocellulosic hydrolysates. In order to explore the metabolism of xylose and to improve the efficiency of xylose 31 utilization, many studies have been carried out in solventogenic Clostridium (Ounine et al., 1985; Kanouni et al., 1998; Jeffries, 1983; Aristidou and Penttila, 2000; Xiao et al.,

2011; Gu et al., 2009; Hu et al., 2011; Jin et al., 2014). Transcriptional analysis of C. acetobutylicum ATCC 824 was conducted previously and two operons (CAC1344-1349 and CAC2610-2612) were identified to be involved in xylose transport and metabolism.

The first operon encodes a xylose symporter, a xylulose kinase, a transaldolase, a transketolase, an aldose-1-epimerase and a putative xylose isomerase, whereas the second one includes a xylulose kinase, a hypothetical protein and an L-fucose isomerase

(putative xylose isomerase) (Grimmler et al., 2010). A previous study has predicted multiple putative catabolite responsive element (CRE) sequences and XylR regulator binding sites within these two operons, indicating the transcription of the xylose catabolic genes was subject to catabolic regulations (Rodionov et al. 2001). Once xylose is imported, a series of reactions are followed, including xylose isomerization and xylulose phosphorylation by the xylose isomerase and the xylulose kinase, respectively. The intermediate xylulose-5-P will be further processed in the PPP which involved a series of reactions catalyzed by enzymes including transaldolase, transketolase and aldose-1-epimerase (Servinsky et al., 2010).

2.5.3 Regulation of sugar catabolism in Clostridium acetobutylicum

Most of gene expressions in bacteria are regulated at transcriptional level (Rutberg,

1997). The transcriptional regulation of sugar transport and metabolism in C. acetobutylicum has been extensively studied previously (Gutierrez and Maddox, 1996;

Tangney and Mitchel, 2000; Nölling et al., 2001; Tangney et al., 2001; Thompson et al., 32

2004; Servinsky et al., 2010). Similar to the well-studied bacterium Bacillus subtilis

(Lorca et al., 2005; Lulko et al., 2007), a central transcriptional regulation system called carbon catabolite repression (CCR) plays an essential role in the global regulation of sugar metabolism in C. acetobutylicum. Basically, when glucose or another preferred substrate is present, cells will consume these favorite substrate at first, and in the meanwhile the expression of other sugar catabolic systems will be repressed through

CCR (Titgemeyer and Hillen, 2002; Görke and Stülke, 2008). The central regulator in

CCR is named as catabolite control protein CcpA. The regulation is realized through the specific binding of CcpA to a catabolite responsive element (CRE) usually located in the leader region of an operon (Deutscher, 2008; Görke and Stülke, 2008). A couple of mediators have been identified which can initiate the activity of CcpA, including the histidine phosphoprotein (HPr) in the PTS, the bifunctional HPr kinase (HPrK) and the glycolytic intermediate fructose-1,6-bisphosphate (Deutscher et al., 1995). In Bacillus subtilis, the binding of the dimeric CcpA to a specific CRE is mainly regulated by the

HPr. When phosphorylated at Ser46 site, HPr will trigger the binding of the CcpA to a

CRE sequence, therefore regulating the expression of the target gene (Jones et al., 1997).

The phosphorylation of the HPr at Ser46 site is mediated by the HPrK which is further regulated by the glycolytic intermediate fructose-1,6-bisphosphate (Jault et al., 2000;

Nessler et al., 2003). Figure 2.8 exhibited the global regulatory mechanism of CCR on gene expression (Deutscher, 2006). The CcpA (CAC3037) and many putative CREs have been identified within the sugar metabolic operons of C. acetobutylicum, such as the galactose PTS operons (CAC2958, CAC2957 and CAC2956) and the galactose symporter (CAC2835) for galactose imports, the xylulose kinase (CAC1344) and two 33 xylose isomerases (CAC1342 and CAC1346) for xylose metabolism, indicating that CCR is actively involved in multiple sugar catabolic regulations (Gutierrez and Maddox, 1996;

Brückner and Titgemeyer, 2002; Tangney et al., 2003; Ren, et al., 2010).

Glucose and xylose co-utilization has been a persistent issue in ABE fermentation using lignocellulosic biomass as feedstocks. During fermentation in common clostridia growth medium, no or little amount of xylose is consumed in the presence of glucose, whereas in lignocellulosic hydrolysates, the performance on xylose catabolism is inconsistent. Table 2.3 summarizes previous studies that utilized different lignocellulosic hydrolysates in ABE fermentation. As shown in the table, the efficiency in xylose utilization varied in different lignocellulosic biomass, indicating that the stability in xylose utilization may be affected by different compositions within lignocellulosic biomass. Putative catabolite responsive element (CRE) sequences were identified in the xylose-related operons in C. acetobutylicum, suggesting that xylose catabolism is under the control of CCR system (Rodionov et al., 2001). According to a previous study, xylose could only be consumed when xylose-pregrown C. tyrobutyricum was used in fed-batch fermentation of lignocellulosic biomass (Du, 2013), providing additional evidence that xylose utilization is subject to catabolic repression. As mentioned above, many studied has been conducted to eliminate the bottleneck in glucose and xylose co-utilization.

Disruption of the catabolite control protein A (CcpA) in C. acetobutylicum improved xylose metabolism and butanol titer to ~12 g/L. However, the disruption of CcpA also caused an unexpected change in other metabolic activities, such as impaired expression of CoA transferase and glycolytic genes, suggesting that the lack of regulation mediated by CcpA may interrupt other essential cellular metabolism (Ren et al., 2010). The most 34 successful study that overcame the repression in C. acetobutylicum involved overexpression of three genes (xylT, xylA, and xylB) encoding a xylose proton-symporter, a xylose isomerase and a xylulokinase, which realized complete and efficient co-utilization of glucose and xylose in fermentation (Xiao et al., 2011). The constitutive expression of these three rate-limiting steps in xylose catabolism could largely bypass the repression induced by CCR.

In addition to CCR, regulation through the transcriptional termination and antitermination system has also been found in C. acetobutylicum (Tangney and Mitchell

2000; Servinsky et al., 2010). In the termination and antitermination system, gene transcription will be repressed when an inherent rho-independent transcription terminator is formed in the upstream leader region of an operon and thus impedes the binding and movement of RNA polymerases. An antiterminator is functioned as a transcriptional activator. Once induced by an environmental signal, it will be able to bind to the terminator sequence, therefore preventing the formation of the termination structure during DNA transcription (Yanofsky, 2000; Lathe et al., 2002; Rutberg, 1997). Four families of antiterminators have been found in Clostridium spp., including SacPA, SacB,

Bgl, and Lic (Rutberg, 1997; Shimizu et al., 2002; Bao et al., 2011). Examples of such regulation of carbohydrate catabolism in C. acetobutylicum were identified in previous studies, including a BglG-type transcriptional antiterminator (CAC1406) which can initiate the utilization of cellobiose through the activated expression of a

β-glucosidase-specific PTS component (CAC1407) and a P-β-glucosidase (CAC1408), and a similar BglG-type transcriptional antiterminator (scrT, CAC0422) which can regulate the expression of scrA, scrK and scrB genes for sucrose metabolism (Tangney 35 and Mitchell, 2000; Servinsky et al., 2010).

In addition to these two types of regulation, many other regulators which belong to the families of DeoR, LacI, TetR, MarR and LysR were also identified within the genome of Clostridium spp. They functioned as either an activator or a repressor in gene expression and their expressions and activities may be subject to the regulation of the global regulator CCR as well (Marvaud et al., 1998; Nölling et al., 2001; Yu et al., 2007;

Servinsky et al., 2010; Yokoyama et al., 2011; Liang et al., 2013). Therefore, the whole regulation in sugar catabolism constitutes a complex and highly organized regulatory network (Titgemeyer and Hillen, 2002; Görke and Stülke, 2008). However, although the purpose of the regulation is to save energy and make sure that the simplest type of sugar could be used first, the strictly regulated sugar catabolism may unfortunately exert an unfavorable effect on sugar consumption in fermentation. Low efficiency in sugar utilization in the presence of multiple types of substrates is still a major obstacle in many kinds of fermentation. With more detailed information on the regulation of sugar metabolism to be unveiled, the designing of a mutant strain to efficiently utilize specific types of carbohydrates according to the different substrates used in fermentation will become feasible.

2.6 References

Agarwal AK (2007) Biofuels (alcohols and biodiesel) applications as fuels for internal combustion engines. Progress in Energy and Combustion Science 33: 233–271.

Al-Hinai MA, Fast AG, Papoutsakis ET (2012) Novel system for efficient isolation of Clostridium double-crossover allelic exchange mutants enabling markerless chromosomal gene deletions and DNA integration. Appl Environ Microbiol. 78: 8112-21.

36

Alsaker KV, Spitzer TR, Papoutsakis ET (2004) Transcriptional analysis of spo0A overexpression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J Bacteriol. 186:1959-1971.

Andersch W, Bahl H, Gottschalk G (1983) Level of enzymes involved in acetate, butyrate, acetone and butanol formation by Clostridium acetobutylicum. Appl Microbiol Biotechnol 18:327-332.

Aristidou A and Penttila M (2000) Metabolic engineering applications to renewable resource utilization. Curr Opin Biotechnol.11:187-198.

Atsumi S, Hanai T, Liao JC (2008) Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature. 451: 86-89.

Baer SH, Blaschek HP, Smith TL (1987) Effect of butanol challenge and temperature on lipid-composition and membrane fluidity of butanol-tolerant Clostridium acetobutylicum. Appl Environ Microbiol. 53: 2854-2861.

Bao G, Wang R, Zhu Y, Dong H, Mao S, Zhang Y, Chen Z, Li Y, Ma Y (2011) Complete genome sequence of Clostridium acetobutylicum DSM 1731, a solvent-producing strain with multireplicon genome architecture. J Bacteriol. 193: 5007-8.

Barrière C, Veiga-da-Cunha M, Pons N, Guédon E, van Hijum SA, Kok J, Kuipers OP, Ehrlich DS, Renault P (2005) Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J Bacteriol. 187: 3752-61.

Bizzini A, Entenza JM, Michielin O, Arnold I, Erni B, Moreillon P (2010) A single mutation in enzyme I of the sugar phosphotransferase system confers penicillin tolerance to Streptococcus gordonii. Antimicrob Agents Chemother. 54: 259-66.

Branduardi P, De Ferra F, Longo V, Porro D (2013) Microbial n-butanol production from Clostridia to non-Clostridial hosts. Eng Life Sci 14: 16-26.

Brückner R, Titgemeyer F (2002) Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol Lett. 209: 141-148.

Brunschwiga C, Moussavoua W, Blin J (2012) Use of bioethanol for biodiesel production. Progress in Energy and Combustion Science. 38: 281-301.

Cartman ST, Kelly ML, Heeg D, Heap JT, Minton NP (2012) Precise manipulation of the Clostridium difficile chromosome reveals a lack of association between the tcdC genotype and toxin production. Appl. Environ. Microbiol. 78:4683-4690.

37

Charrier C, Duncan GJ, Reid MD, Rucklidge GJ, Henderson D, Young P, Russell VJ, Aminov RI, Flint HJ, Louis P (2006) A novel class of CoA-transferase involved in short-chain fatty acid metabolism in butyrate-producing human colonic bacteria. Microbiology. 152:179-85.

Cooksley CM, Zhang Y, Wang H, Redl S, Winzer K, Minton NP (2012) Targeted mutagenesis of the Clostridium acetobutylicum Acetone Butanol-Ethanol fermentation pathway. Metab Eng. 14: 630-641.

Demirbas A (2009) Political, economic and environmental impacts of biofuels: A review. Appl Energy. 86: s108-s117.

Deutscher J, Küster E, Bergstedt U, Charrier V, Hillen W (1995) Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Mol Microbiol. 15:1049-53.

Deutscher J, Francke C and Postma PW (2006) How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 70: 939-1031.

Deutscher J (2008) The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol. 11: 87-93.

Du YM (2013) High-yield and high-titer n-butanol production from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD Dissertation, The Ohio State University

Du YM, Jiang WY, Yu MR, Tang IC, Yang ST (2014) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol Bioeng. 9999: 1-12.

Dürre P, Kuhn A, Gottwald M, Gottschalk G (1987) Enzymatic investigations on butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl Microbiol Biotechnol. 26:268-272.

Dürre P, Böhringer M, Nakotte S, Schaffer S, Thormann K, Zickner B (2002) Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol Microbiol Biotechnol. 4: 295-300.

Dürre P (2007) Biobutanol: An attractive biofuel. J Biotechnol. 2: 1525-1534.

Dwidar M, Park JY, Mitchell RJ, Sang BI (2012) The future of butyric acid in industry. Scientific World Journal. 2012: 471417.

38

Eksteen JM, Van Rensburg P, Cordero Otero RR, Pretorius IS (2003) Starch fermentation by recombinant Saccharomyces cerevisiae strains expressing the alpha-amylase and glucoamylase genes from Lipomyces kononenkoae and Saccharomycopsis fibuligera. Biotechnol Bioeng. 84: 639-46.

Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF (2009) A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein. Mol. Microbiol. 74: 541-556.

Ezeji TC, Karcher PM, Qureshi N, Blaschek HP (2005a) Improving performance of a gas stripping-based recovery system to remove butanol from Clostridium beijerinckii fermentation. Bioprocess Biosyst Eng. 27:207-14

Ezeji TC, Qureshi N, Blaschek HP (2005b) Continuous butanol fermentation and feedstarch retrogradation: butanol fermentation sustainability using Clostridium beijerinckii BA101. J Biotechnol. 115:179-187.

Ezeji TC, Qureshi N, Blaschek HP (2007a) Bioproduction of butanol from biomass: from genes to bioreactors. Curr Opin Biotechnol. 18: 220-227.

Ezeji TC, Qureshi N, Blaschek HP (2007b) Production of acetone–butanol–ethanol (ABE) in a continuous flow bioreactor using degermed corn and Clostridium beijerinckii. Process Biochemistry. 42: 34–39.

Feustel L, Nakotte S, Dürre P (2004) Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol. 70:798-803.

Fischer RJ, Helms J, Dürre P (1993) Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol. 175: 6959-69.

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

Friedman MH (2008) Principles and models of biological transport, second edition. Springer. ISBN 978-0387-79239-2.

Gerischer U, Dürre P (1990) Cloning, sequencing, and molecular analysis of the acetoacetate decarboxylase gene region from Clostridium acetobutylicum. J Bacteriol. 172: 6907-18.

Gheshlaghi R, Scharer JM, Moo-Young M, Chou CP (2009) Metabolic pathways of 39 clostridia for producing butanol. Biotechnol Adv. 27:764-81.

Girbal L, Croux C, Vasconcelos I, Soucaille P (1995) Regulation of metabolic shifts in Clostridium acetobutylicum ATCC 824. FEMS Microbiology Reviews. 17: 287-298.

Green EM, Bennett GN (1996) Inactivation of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. Appl Biochem Biotechnol. 57–58:213–221.

Green EM (2011) Fermentative production of butanol–the industrial perspective. Curr Opin Biotechnol. 22: 337–343.

Grimmler C, Held C, Liebl W, Ehrenreich A (2010) Transcriptional analysis of catabolite repression in Clostridium acetobutylicum growing on mixtures of D-glucose and D-xylose. J Biotechnol. 150: 315-23.

Görke B, Stülke J. (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol. 6:613-24.

Gu Y, Li J, Zhang L, Chen J, Niu L, Yang Y, Yang S, Jiang W (2009) Improvement of xylose utilization in Clostridium acetobutylicum via expression of the talA gene encoding transaldolase from Escherichia coli. J Biotechnol. 143:284-7.

Guo T, He AY, Du TF, Zhu DW, Liang DF, Jiang M, Wei P, Ouyang PK (2013) Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: 379-85.

Gutierrez NA and Maddox IS (1996) Galactose transport in Clostridium acetobutylicum. Lett Appl Microbiol. 23: 97-100.

Harris LM, Blank L, Desai RP, Welker NE, Papoutsakis ET (2001) Fermentation characterization and flux analysis of recombinant strains of Clostridium acetobutylicum with an inactivated solR gene. J Ind Microbiol Biotechnol. 27:322-328.

Harris LM, Welker NE, Papoutsakis ET (2002) Northern, morphological, and fermentation analysis of spo0A inactivation and overexpression in Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 3586-3597.

Hartman AH, Liu H, Melville SB (2011) Construction and characterization of alactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Appl Environ Microbiol. 77:471-478.

Hartmanis MGN, Gatenbeck S (1984) Intermediary metabolism in Clostridium acetobutylicum: Levels of enzymes involved in the formation of acetate and butyrate. Appl Microbiol Biotechnol. 47:1277-1283.

40

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The ClosTron: A universal gene knock-out system for the genus Clostridium. J. Microbiol. Meth. 70:452-464.

Heap JT, Pennington OJ, Cartman ST, Minton NP (2009) A modular system for Clostridium shuttle plasmids. J Microbiol Meth. 78: 79-85.

Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP (2010) The ClosTron: Mutagenesis in Clostridium refined and streamlined. J Microbiol Meth. 80:49-55.

Heap JT, Ehsaan M, Cooksley CM, Ng YK, Cartman ST, Winzer K, Minton NP (2012) Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic Acids Res. 40:e59.

Heider J (2001) A new family of CoA-transferases. FEBS Lett. 509(3):345-9.

Higgins CF (1995) The ABC of channel regulation. Cell. 82: 693-696.

Higgins CF (2001) ABC transporters: physiology, structure and mechanism-an overview. Res Microbiol. 152: 205-210

Hu S, Zheng H, Gu Y, Zhao J, Zhang W, Yang Y, Wang S, Zhao G, Yang S, Jiang W (2011) Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. BMC Genomics. 12: 93.

Jault JM, Fieulaine S, Nessler S, Gonzalo P, Di Pietro A, Deutscher J, Galinier A (2000) The HPr kinase from Bacillus subtilis is a homo-oligomeric enzyme which exhibits strong positive cooperativity for nucleotide and fructose 1,6-bisphosphate binding. J Biol Chem. 275:1773-80.

Jeffries TW (1983) Utilization of xylose by bacteria, yeasts and fungi. Adv Biochem Eng. Biotechnol. 27:1-32.

Jiang Y, Xu C, Dong F, Yang Y, Jiang W, Yang S (2009) Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Metab Eng. 11: 284-291.

Jin L, Zhang H, Chen L, Yang C, Yang S, Jiang W, Gu Y (2014) Combined overexpression of genes involved in pentose phosphate pathway enables enhanced D-xylose utilization by Clostridium acetobutylicum. J Biotechnol. 173:7-9.

Jang YS, Lee JY, Lee J, Park JH, Im JA, Eom MH, Lee J, Lee SH, Song H, Cho JH, Seung do Y, Lee SY (2012) Enhanced butanol production obtained by reinforcing the 41 direct butanol-forming route in Clostridium acetobutylicum. MBio. 3: e00314-12

Janssen H, Grimmler C, Ehrenreich A, Bahl H, Fischer RJ (2012) A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum-solvent stress caused by a transient n-butanol pulse. J Biotechnol. 161:354-365

Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev. 50: 484-524.

Jones BE, Dossonnet V, Küster E, Hillen W, Deutscher J, Klevit RE (1997) Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr. J Biol Chem. 272: 26530-5.

Kanouni AE, Zerdani I, Zaafa S, Znassni M, Loutfi M, Boudouma M (1998) The improvement of glucose/xylose fermentation by Clostridium acetobutylicum using calcium carbonate. World J. Microbiol. Biotechnol. 14:431-435

Kennedy CL, Krejany EO, Young LF, O'Connor JR, Awad MM, Boyd RL, Emmins JJ, Lyras D, Rood JI (2005) The alpha-toxin of Clostridium septicum is essential for virulence. Mol Microbiol. 57:1357-1366.

Kumar P, Barrett DM, Delwiche MJ, Stroeve P (2009) Methods for pretreatment of lignocellulosic biomass for efficient hydrolysis and biofuel production. Ind Eng Chem Res. 48: 3713-3729.

Kumar M, Gayen K (2011) Developments in biobutanol production: New insights Appl Ener. 88: 1999-2012.

Lathe WC, Suyama M, Bork P (2002) Identification of attenuation and antitermination regulation in prokaryotes. Genome Biology. 3: preprint0003.1

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: 209-228.

Lee JY, Jang YS, Lee J, Papoutsakis ET, Lee SY (2009) Metabolic engineering of Clostridium acetobutylicum M5 for highly selective butanol production. J Biotechnol. 4: 1432-1440.

Lehmann D, Radomski N, Lütke-Eversloh T (2012) New insights into the butyric acid metabolism of Clostridium acetobutylicum. Appl Microbiol Biotechnol. 96: 1325-39.

Liang WD, Bi YT, Wang HY, Dong S, Li KS, Li JS (2013) Gene expression profiling of Clostridium botulinum under heat shock stress. Biomed Res Int. 2013:760904.

Linton KJ, Higgins CF (1998) The Escherichia coli ATP-binding cassette (ABC) proteins. 42

Mol Microbiol. 28: 5-13

Liu X, Zhu Y, Yang ST (2005) Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC 25755 and mutants. Enz Microb Technol .38: 521-528.

Liu X, Zhu Y, Yang ST (2006) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog. 22:1265-75.

Liu L, Zhang L, Tang W, Gu Y, Hua Q, Yang S, Jiang W, Yang C (2012) Phosphoketolase pathway for xylose catabolism in Clostridium acetobutylicum revealed by 13C metabolic flux analysis. J Bacteriol. 194: 5413-22.

Liu Z, Ying Y, Li F, Ma C, Xu P (2010) Butanol production by Clostridium beijerinckii ATCC 55025 from wheat bran. J Ind Microbiol Biotechnol 37: 495-501.

Lorca GL, Chung YJ, Barabote RD, Weyler W, Schilling CH, Saier MH Jr (2005) Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. J Bacteriol. 187:7826-39.

Lu CC (2011) Butanol Production from lignocellulosic feedstocks by Acetone-Butanol-Ethanol fermentation with integrated product recovery. PhD Dissertation, The Ohio State University

Lulko AT, Buist G, Kok J, Kuipers OP (2007) Transcriptome analysis of temporal regulation of carbon metabolism by CcpA in Bacillus subtilis reveals additional target genes. J Mol Microbiol Biotechnol. 12:82-95.

Lutke-Eversloh T, Bahl H (2011) Metabolic engineering of Clostridium acetobutylicum: Recent advances to improve butanol production. Curr Opin Biotechnol. 22: 634-647.

Lutke-Eversloh T (2014) Application of new metabolic engineering tools for Clostridium acetobutylicum. Appl Microbiol Biotechnol. 98:5823-5837.

Maddox IS, Steiner E, Hirsch S, Wessner S, Gutierrez NA, Gapes JR, Schuster KC (2000) The cause of “acid crash” and “acidogenic fermentations” during the batch acetone-butanol-ethanol (ABE-) fermentation process. J Mol Microbiol Biotechnol. 2: 95-100.

Mariano AP, Dias MO, Junqueira TL, Cunha MP, Bonomi A, Filho RM (2013) Butanol production in a first-generation Brazilian sugarcane biorefinery: technical aspects and economics of greenfield projects. Bioresour Technol. 135:316-323.

Marvaud JC, Eisel U, Binz T, Niemann H, Popoff MR. (1998) TetR is a positive regulator of the tetanus toxin gene in Clostridium tetani and is homologous to botR. Infect Immun. 43

66: 5698-702.

McCrone A, Usher E, Sonntag-O’brien V, Moslener U, Gruning C (2014) Global trends in renewable energy investment 2014. www.ren21.net/gsr.

Mermelstein LD, Papoutsakis ET, Petersen DJ, Bennett GN (1993a) Metabolic engineering of Clostridium acetobutylicum ATCC 824 for increased solvent production by enhancement of acetone formation enzyme-activities using a synthetic acetone operon. Biotechnol Bioeng. 42:1053-1060.

Mermelstein LD, Papoutsakis ET (1993b) In vivo methylation in Escherichia coli by the Bacillus subtilis phage Φ3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 59:1077-1081.

Millat T, Voigt C, Janssen H, Cooksley CM, Winzer K, Minton NP, Bahl H, Fischer RJ, Wolkenhauer O (2014) Coenzyme A-transferase-independent butyrate re-assimilation in Clostridium acetobutylicum-evidence from a mathematical model. Appl Microbiol Biotechnol. Epub ahead of print.

Mitchell WJ, Shaw JE and Andrews L (1991) Properties of the glucose phosphotransferase system of Clostridium acetobutylicum NCIB 8052. Appl Environ Microbiol. 57: 2534–2539.

Mitchell WJ, Tangney M. (2005). Carbohydrate uptake by the phosphotransferase system and other mechanisms. In Handbook on Clostridia, pp. 155-176. Edited by P. Durre. Boca Raton, FL: CRC Press.

Nair RV, Green EM, Watson DE, Bennett GN, Papoutsakis ET (1999) Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol. 181:319-330.

Nessler S, Fieulaine S, Poncet S, Galinier A, Deutscher J, Janin J (2003) HPr kinase/phosphorylase, the sensor enzyme of catabolite repression in Gram-positive bacteria: structural aspects of the enzyme and the complex with its protein substrate. J Bacteriol. 185: 4003-4010

Ni Y, Sun Z (2009) Recent progress on industrial fermentative production of acetone-butanol-ethanol by Clostridium acetobutylicum in China. Appl Microbiol Biotechnol. 83:415-23.

Nicolaou SA, Gaida SM, Papoutsakis ET (2010) A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: from biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng. 12:307-331.

44

Nölling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR (2001) Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: 4823-4838.

Ounine K, Petitdemange H, Raval G, Gay R (1985) Regulation and butanol inhibition of D-xylose and D-glucose uptake in Clostridium acetobutylicum. Appl Environ Microbiol. 49:874-878.

Paquet V, Croux C, Goma G, Soucaille P (1991) Purification and characterization of the extracellular alpha-amylase from Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 57: 212-218.

Parekh SR, Parekh RS, Wayman M (1988) Ethanol and butanol production by fermentation of enzymatically saccharified SO2-prehydrolysed lignocellulosics. Enzyme and Microbial Technology. 10: 660–668

Petersen DJ, Bennett GN (1990) Purification of acetoacetate decarboxylase from Clostridium acetobutylicum ATCC 824 and cloning of the acetoacetate decarboxylase gene in Escherichia coli. Appl Environ Microbiol. 56: 3491-3498.

Qureshi N, Blaschek HP (2000) Economics of butanol fermentation using hyper-butanol producing Clostridium beijerinckii BA101. Food and Bioproducts Processing. 78:139-144

Qureshi N, Blaschek HP (2001a) ABE production from corn: a recent economic evaluation. J Ind Microbiol Biotechnol. 27:292-297

Qureshi N, Blaschek HP (2001b) Recovery of butanol from fermentation broth by gas stripping. Renewable Energy. 22: 557-564.

Qureshi N, Saha BC, Cotta MA (2007) Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioprocess Biosyst Eng. 30: 419-27.

Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP (2008a) Butanol production by Clostridium beijerinckii. Part I: use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: 5915-5922.

Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Cotta MA (2008b) Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: Part I—Batch fermentation. Biomass and Bioenergy. 32: 168–175

Qureshi N, Saha BC, Cotta MA (2008c) Butanol production from wheat straw by 45 simultaneous saccharification and fermentation using Clostridium beijerinckii: Part II—Fed-batch fermentation. Biomass and Bioenergy. 32: 176–183

Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA (2010a) Production of butanol (a biofuel) from agricultural residues: Part I – Use of barley straw hydrolysate. Biomass Bioenergy 34: 559-565.

Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cotta MA (2010b) Production of butanol (a biofuel) from agricultural residues: Part II - Use of corn stover and switchgrass hydrolysates. Biomass Bioenerg 34: 566-571.

Ravagnani A, Jennert KC, Steiner E, Grünberg R, Jefferies JR, Wilkinson SR, Young DI, Tidswell EC, Brown DP, Youngman P, Morris JG, Young M (2000) Spo0A directly controls the switch from acid to solvent production in solvent-forming clostridia. Mol Microbiol. 37:1172-85.

Rawsthorne H, Turner KN, Mills DA (2006) Multicopy integration of heterologous genes, using the lactococcal group II intron targeted to bacterial insertion sequences. Appl. Environ. Microbiol. 72: 6088-6093.

Ren C, Gu Y, Hu S, Wu Y, Wang P, Yang Y, Yang C, Yang S, Jiang W (2010) Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum. Metab Eng. 12: 446-54.

Rodionov DA, Mironov AA, Gelfand MS (2001) Transcriptional regulation of pentose utilisation systems in the Bacillus/Clostridium group of bacteria. FEMS Microbiol Lett. 205: 305-314.

Rutberg B (1997) Antitermination of transcription of catabolic operons. Mol Microbiol. 23:413-21

Rydzak T, Levin DB, Cicek N, Sparling R (2011) End-product induced metabolic shifts in Clostridium thermocellum ATCC 27405. Appl Microbiol Biotechnol. 92:199-209.

Servinsky MD, Kiel JT, Dupuy NF, Sund CJ (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiology. 156:3478-91.

Shimizu T, Ohtani K, Hirakawa H, Ohshima K, Yamashita A, Shiba T, Ogasawara N, Hattori M, Kuhara S, Hayashi H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. PNAS. 99:996-1001.

Siller R, Chow A, Tracy B, Papoutsakis ET (2008) Metabolic engineering of the non-sporulating, non-solventogenic Clostridium acetobutylicumstrain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and 46 the importance of the electron balance. Metab Eng. 10: 321-332.

Sillers R, Al-Hinai MA, Papoutsakis ET (2009) Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol Bioeng. 102: 38-49.

Soni BK, Kapp C, Goma G, Soucaille P (1992) Solvent production from starch: effect of pH on α-amylase and glucoamylase localization and synthesis in synthetic medium. Appl Microbiol Biotechnol. 37: 539-534

Stöcker M (2008) Biofuels and biomass-to-liquid fuels in the biorefinery: catalytic conversion of lignocellulosic biomass using porous materials. Angewandte Chemie International Edition. 47: 9200-11.

Tappy L, Lê KA (2010) Metabolic effects of fructose and the worldwide increase in obesity. Physiol Rev. 90:23-46.

Tangney M, Mitchell WJ (2000) Analysis of a catabolic operon for sucrose transport and metabolism in Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol. 2:71-80

Tangney M, Winters GT, Mitchell WJ (2001) Characterization of a maltose transport system in Clostridium acetobutylicum ATCC 824. J Ind Microbiol Biotechnol. 27: 298-306.

Tangney M, Galinier A, Deutscher J, Mitchell WJ (2003) Analysis of the elements of catabolite repression in Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol. 6: 6-11.

Tangney M, Mitchell WJ (2007). Characterisation of a glucose phosphotransferase system in Clostridium acetobutylicum ATCC 824. Appl Microbiol Biotechnol. 74: 398-405.

Thompson J, Hess S, Pikis A. (2004) Genes malh and pagl of Clostridium acetobutylicum ATCC 824 encode NAD+ - and Mn2+ - dependent phospho-a-glucosidase(s). J Biol Chem. 279: 1553-1561.

Thormann K, Feustel L, Lorenz K, Nakotte S, Dürre P (2002) Control of butanol formation in Clostridium acetobutylicum by transcriptional activation. J Bacteriol. 184: 1966-1973

Titgemeyer F, Hillen W (2002) Global control of sugar metabolism: a gram-positive solution. Antonie Van Leeuwenhoek. 82:59-71.

47

Tomas CA, Welker NE, Papoutsakis ET (2003) Overexpression of groESL in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl Environ Microbiol. 69:4951-4965.

Tomas CA, Beamish J, Papoutsakis ET (2004) Transcriptional analysis of butanol stress and tolerance in Clostridium acetobutylicum. J Bacteriol 186:2006–2018

Tummala SB, Junne SG, Papoutsakis ET (2003) Antisense RNA downregulation of coenzyme A transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol. 185: 3644-3653.

Twine SM, Reid CW, Aubry A, McMullin DR, Fulton KM, Austin J, Logan SM (2009) Motility and flagellar glycosylation in Clostridium difficile. J Bacteriol. 191:7050-62

Walter KA, Mermelstein LD, Papoutsakis ET (1994) Studies of recombinant Clostridium acetobutylicum with increased dosages of butyrate formation genes. Ann NY Acad Sci. 721:69-72

Wang L, Chen H (2011) Increased fermentability of enzymatically hydrolyzed steam-exploded corn stover for butanol production by removal of fermentation inhibitors. Process Biochem 46: 604-607

Wang S, Zhang Y, Dong H, Mao S, Zhu Y, Wang R, Luan G, Li Y (2011) Formic acid triggers the "Acid Crash" of acetone-butanol-ethanol fermentation by Clostridium acetobutylicum. Appl Environ Microbiol. 77:1674-80.

Wiehn M, Staggs K, Wang Y, Nielsen DR (2014) In situ butanol recovery from Clostridium acetobutylicum fermentations by expanded bed adsorption. Biotech Progress. 30: 68-78

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989a) Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl Environ Microbiol. 55: 323-329.

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989b) Phosphotransbutyrylase from Clostridium acetobutylicum ATCC 824 and its role in acidogenesis. Appl Environ Microbiol. 55:317-322

Woods DR (1995) The genetic engineering of microbial solvent production. Trends Biotechnol. 13:259-264.

Wu ZT, Yang ST (2003) Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotech Bioeng. 82: 93-102. 48

Xiao H, Gu Y, Ning Y, Yang Y, Mitchell WJ, Jiang W, Yang S (2011) Confirmation and elimination of xylose metabolism bottlenecks in glucose phosphoenolpyruvate-dependent phosphotransferase system-deficient Clostridium acetobutylicum for simultaneous utilization of glucose, xylose, and arabinose. Appl Environ Microbiol. 77: 7886-7895.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production. Appl Microbiol Biotechnol. 99:1011-22.

Xue C, Zhao XQ, Liu CG, Chen LJ, Bai FW (2013) Prospective and development of butanol as an advanced biofuel. Biotechnol Adv. 31:1575-1584.

Yanofsky C (2000) Transcription attenuation: once viewed as a novel regulatory strategy. J Bacteriol. 182:1-8

Yokoyama S, Oshima K, Nomura I, Hattori M, Suzuki T (2011) Complete genomic sequence of the O-desmethylangolensin-producing bacterium Clostridium rRNA cluster XIVa strain SY8519, isolated from adult human intestine. J Bacteriol. 193: 5568-9.

Yang S (2013) “Optimizing pentose utilization in clostridia for improved solvents production from lignocellulosic hydrolysates” in “Metabolic Engineering IX”, Eds, ECI Symposium Series, Volume P18. http://dc.engconfintl.org/metabolic_ix/7

Yu Y, Tangney M, Aass HC, Mitchell WJ (2007) Analysis of the mechanism and regulation of lactose transport and metabolism in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 73: 1842-1850.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng. 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol. 93: 881-9.

Zhang XZ, Yan X, Cui ZL, Hong Q, Li SP (2006) mazF, a novel counterselectable marker for unmarked chromosomal manipulation in Bacillus subtilis. Nucleic Acids Res. 34:e71.

Zhang YL, Yu MR, Yang ST (2012) Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol Prog. 28: 52-59.

Zhao Y, Hindorff LA, Chuang A, Monroe-Augustus M, Lyristis M, Harrison ML, Rudolph FB, Bennett GN (2003) Expression of a cloned cyclopropane fatty acid synthase 49 gene reduces solvent formation in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 69:2831-2841

Zhao J, Lu C, Chen CC, Yang ST (2013) Biological production of butanol and higher alcohols, in Yang ST, El-Enshasy HA, Thongchul N. (eds.) Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Ch. 13, pp. 235-261.

Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ (2009) Problems with the microbial production of butanol. J Ind Microbiol Biotechnol. 36:1127-38.

Zhong J, Karberg M, Lambowitz AM (2003) Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic Acids Res. 31:1656-1664

Zhu Y, Yang ST (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr. 19:365-372.

Zhu Y, Liu X, Yang ST (2004) Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng. 90: 154-166.

50

Table 2.1 Comparison of genetic manipulation techniques in Clostridium

Techniques Advantages Disadvantages Model plasmids available with multiple Could be a metabolic burden; unstable selections for promoters, replicons and without antibiotics. Heterologous plasmids markers; easy to transform by conjugation and electroporation; relatively stable with antibiotics addition; high copy numbers. Target gene expression Incorporated into chromosome; stable Low allelic exchange efficiency; low copy Gene knock-in via expression without antibiotics; antiselection number; limited knock-in size double cross-overs marker available for efficient screening. Incorporated into chromosome; stable Only realized in other bacteria; limited intron The ClosTron system expression without antibiotics; intron marker targeting sites; low copy number; limited available for efficient screening knocks-in size. Relatively easy to construct and manipulate; Not very stable; could be lost through Single cross-over relatively higher integrational probability homologous recombination

5

1 than double cross-over

Antiselection marker available for efficient Relatively lower integrational probability; Double cross-over screening; very stable relatively labor-intensive and Target gene disruption time-consuming Commercialized tool; high specificity and limited intron targeting sites; divergent The ClosTron system efficiency; stable deletion mutant; phenotypes with different targeting sites Easy to realize using heterologous plasmids; Overexpression may cause toxicity; Antisense RNA easy to construct, transform and manipulate Relatively low specificity; can only knock down target gene expression. Table 2.2 Fermentation performances of metabolically engineered of C. acetobutylicum strains. +: increased; -: decreased; o: no change

5

2

(Modified from Zhao et al., 2013 and Lutke-Eversloh, 2014)

Table 2.3 Sugar utilization in fermentation of lignocellulosic hydrolysates

Initial sugars ABE yield Strains Feedstocks Sugar utilization References (g/L) (g/g) C. beijerinckii 55025 Wheat bran 45 0.21 Insufficient use of xylose and arabinose Liu et al., 2010

C. acetobutylicum 824 Corn stover 45 0.27 Insufficient use of xylose and arabinose Wang and Chen, 2011

C. beijerinckii P260 Barley straw 60 0.44 Full use Qureshi et al., 2010a

C. beijerinckii P260 Corn stover 60 0.44 Full use Qureshi et al., 2010b

C. beijerinckii IB4 Corn fiber 30 0.31 Insufficient use of xylose and arabinose Guo et al., 2013

C. beijerinckii P260 Wheat straw 25.4 0.37 Full use Qureshi et al., 2007 C. beijerinckii BA101 5 Corn fiber 25 0.35 Full use Qureshi et al., 2008a

3

C. beijerinckii P260 Wheat straw 28.4 0.42 Full use Qureshi et al., 2008b C. acetobutylicum P262 Corn stover 81 0.27 74% of total sugars was consumed Parekh et al., 1988 87% of total sugars was consumed with C. beijerinckii P260 Wheat straw 52 0.35 Qureshi et al., 2008c xylose and glucose left C. tyrobutyricum Cotton stalk 55 0.36 Limited xylose utilization Du, 2013 C. tyrobutyricum Soybean hull 60 0.38 Limited xylose utilization Du, 2013 C. tyrobutyricum Corn fiber 55 0.33 Limited xylose utilization Du, 2013 (Modified from Yang, 2013)

(http://dels.nas.edu/banr)

Figure 2.1 Annual consumption of biofuels between 2008 and 2022 mandated by the Renewable Fuel Standard. Different types of biofuels are showed in red, white, blue and yellow.

54

Figure 2.2 Metabolic pathways in C. acetobutylicum and C. tyrobutyricum. The dotted lines show the pathways with missing genes in C. tyrobutyricum in comparison to other solvent producing Clostridium species. The boxes show the ABE products produced after introducing ald or adhE2 and ctfAB genes. (ack: acetate kinase, adc: acetoacetate decarboxylase, adh: alcohol dehydrogenase, adhE2: aldehyde/alcohol dehydrogenase, ald: aldehyde dehydrogenase, bdh: butanol dehydrogenase, ctfAB: CoA-transferase, pta: phosphotransacetylase)

55

(Heap et al., 2009)

Figure 2.3 A schematic of Clostridium model plasmids showing the restriction cleavage sites and components of Gram-negative and Gram-positive replicons and antibiotic markers

56

(http://www.targetrons.com.)

Figure 2.4 The procedure of targeting and splicing of the group II intron in ClosTron and Targetron systems.

57

(Al-Hinai et al., 2013)

Figure 2.5 A schematic procedure of isolation of Clostridium double-crossover allelic exchange mutants by using lactose-inducible counterselection markers

58

(Heider, 2001)

Figure 2.6 Mechanisms of CoA-transferases of families I

59

(Bizzini et al., 2010)

Figure 2.7 The transport of sugars into cells through phosphotransferase system (PTS)

60

(Deutscher et al., 2006)

Figure 2.8 Global regulatory mechanism of carbon catabolite repression (CCR) on gene expression.

61

Chapter 3: Metabolic engineering of Clostridium tyrobutyricum for n-butanol

production: Effects of CoA transferase

Abstract

The overexpression of CoA transferase (ctfAB), which catalyzes the reaction: acetate/butyrate + acetoacetyl-CoA → acetyl/butyryl-CoA + acetoacetate, was studied for its effects on acid re-assimilation and butanol biosynthesis in C. tyrobutyricum (Δack, adhE2). The plasmid pMTL007 was used to co-express adhE2 and ctfAB from C. acetobutylicum ATCC 824. In addition, the sol operon containing ctfAB, adc (acetoacetate decarboxylase), and ald (aldehyde dehydrogenase) was also cloned from C. beijerinckii

NCIMB 8052 and expressed in C. tyrobutyricum (Δack, adhE2). Mutants expressing these genes were evaluated for their ability to produce butanol from glucose in batch fermentations at pH 5.0 and 6.0. Compared to C. tyrobutyricum (Δack, adhE2) without expressing ctfAB, all mutants with ctfAB overexpression produced more butanol, with butanol yield increased to 0.220.26 g/g (vs. 0.100.13 g/g) and productivity to 0.35 g/L·h (vs. 0.13 g/L·h) because of the reduced acetate and butyrate production. The expression of ctfAB also resulted in acetone production from acetoacetate through a non-enzymatic decarboxylation.

62 3.1 Introduction

With increasing concerns about environmental pollution and the diminishing oil supplies, increased attentions and efforts have focused on the development of next-generation or advanced biofuels (Demirbas, 2009; Green, 2011; Jiang et al., 2014).

Biobutanol, which shares many similar fuel properties with gasoline and has a 30% higher energy density than ethanol, is one of the most promising advanced biofuels with good prospect as a gasoline substitute (Dürre, 2007; Xue et al., 2013). n-Butanol can be produced from biorenewable feedstocks in acetone-butanol-ethanol (ABE) fermentation, which was once the second largest industrial fermentation that can be traced back more than one hundred years ago (Jones and Woods, 1986). However, ABE fermentation processes are limited by low butanol yield, productivity and titer, and generally cannot compete with petroleum-based n-butanol that currently dominates in the market (Zhao et al., 2013). Metabolic engineering of solventogenic clostridia, mainly Clostridium acetobutylicum and Clostridium beijerinckii, have thus been intensively studied and used to manipulate the host strains to better understand their physiology and to develop robust strains for industrial application (Branduardi et al., 2014; Jang et al., 2012; Lee et al.,

2008; Lütke-Eversloh, 2014; Papoutsakis, 2008; Wang et al., 2014).

However, the progress to date has been limited because the biphasic nature of the

ABE fermentation and the complex metabolic and regulatory pathways involved are difficult to manipulate and control (Zheng et al., 2009; Lehmann et al., 2012b). To overcome these problems, we have focused on the engineering of Clostridium tyrobutyricum, an acidogen which naturally can only produce butyrate and acetate (Liu et al., 2005), but not solvents, because of lacking some key enzymes (genes), including CoA

63 transferase (ctfAB), acetoacetate decarboxylase (adc) and aldehyde dehydrogenase (ald), in the pathways leading to ABE production (see Figure 3.1). In our recent study, we overexpressed a bifunctional aldehyde/alcohol dehydrogenase gene (adhE2) from C. acetobutylicum in C. tyrobutyricum, and turned the mutant into an n-butanol producer

(Yu et al., 2011). Compared to native solventogenic clostridia, the engineered C. tyrobutyricum has a much simpler butanol biosynthesis pathway and potentially can produce more butanol from glucose at a higher yield (>0.3 g/g). However, because large amounts of butyrate and acetate were also produced by this mutant in fermentation, the actual butanol yield was low, only ~0.1 g/g glucose consumed (Yu et al., 2011). Since

CoA transferase (ctfAB) is usually overexpressed in solventogenic clostridia during the solventogenic phase to convert acetate and butyrate to acetyl-CoA and butyryl-CoA, respectively, it is desirable to also express ctfAB, together with adhE2, in C. tyrobutyricum to further increase butanol production.

In the present study, adhE2 and ctfAB were co-expressed in C. tyrobutyricum strain

Ct(Δack) with acetate kinase (ack) knockout, which could tolerate and produce butyrate at concentrations higher than 40 g/L (Liu et al., 2008). The ctfAB genes from C. acetobutylicum were expressed together with adhE2 in plasmid pMTL007 (Heap et al.,

2007), and the effects of overexpressing ctfAB on fermentation kinetics were studied in stirred-tank bioreactors at pH 6.0 and 5.0. In addition, co-expressing ctfAB, ald, and adc genes obtained from the sol operon of C. beijerinckii in Ct(Δack) was also studied. The results showed that ctfAB expression not only significantly increased butanol and reduced acids production, but also induced acetone production even in the absence of adc gene.

This study demonstrated the beneficial effects of ctfAB on acids reassimilation and

64 butanol biosynthesis in the non-native solventogenic C. tyrobutyricum with potential industrial application for n-butanol production. This study also provided new insights on the role of ctfAB in controlling acid re-assimilation and its effects on solventogenesis.

3.2 Materials and methods

3.2.1 Bacterial strains, plasmids, and culture media

Table 3.1 shows the bacterial strains and recombinant plasmids developed and used in this study. C. tyrobutyricum Ct(Δack), a mutant strain of ATCC 25755 with ack knockout (Liu et al., 2008) was used as the host for all recombinant plasmids constructed in this work. The Clostridium cultures were grown in Clostridial Growth Medium (CGM) with glucose as the carbon source at 37 °C under anaerobic conditions. The CGM contained (g/L): 4 Tryptone, 2 yeast extract, 1.0 K2HPO4∙3H2O, 0.5 KH2PO4, 2

(NH4)2SO4, 0.1 MgSO4∙7H2O, and trace minerals (Zhu and Yang, 2003). E. coli strains used in the cloning were cultivated at 37 °C aerobically in liquid Luria-Bertani (LB) medium with agitation at 250 rpm and on LB agar plates. These media were sterilized by autoclaving at 121 oC for 30 min., and after cooling, supplemented with appropriate antibiotics: 25 μg/ml chloramphenicol, 45 μg/ml thiamphenicol or 250 μg/ml cycloserine.

3.2.2 Plasmids construction

Plasmid pMTL007 was the basic vector from which the other constructs were derived. The DNA sequences for adhE2 (CA_P0035) and ctfAB (CA_P0163 and

CA_P0164) genes were extracted and PCR-amplified from C. acetobutylicum ATCC 824 genomic DNA. The whole sol operon containing ald (Cbei_3832), ctfAB (Cbei_3833 and

65 Cbei_3834) and adc (Cbei_3835) genes in pSOL, and the truncated sol operon containing only ald and ctfAB genes in pSV6 were derived from C. beijerinckii NCIMB 8052

(ATCC 51743) genomic DNA. The thiolase (thl) promoter used to drive the constitutive expression of the genes mentioned above was from C. tyrobutyricum ATCC 25755 (Yu et al., 2012). The primers used in PCR amplification of these genes are listed in Table 1.

The plasmid pMAD72 for the overexpression of adhE2 under the control of thl promoter has been described in details elsewhere (Yu et al., 2011). The plasmid pMAT was constructed from pMAD72 by inserting ctfAB after adhE2 at the SacII site using the

Clontech infusion cloning kit. The plasmid pSOL was constructed by inserting the

PCR-amplified sol operon from C. beijerinckii NCIMB 8052 together with thl promoter into pMTL007 between XhoI and SacII sites by infusion. The plasmid pSV6 contained hygromycin B resistance gene and the truncated sol operon (ald and ctfAB genes) and adhE2 under fac and thl promoters, respectively. The artificial promoter fac, which was constructed by combining the operator of the E. coli lacZ operon and the promoter of C. pasteurianum ferredoxin gene (Fox et al., 1996), was derived from the model Clostridium shuttle vector to direct the constitutive expression of heterologous genes in Clostridium

(Heap et al., 2007). The hygromycin B resistance gene was cut from pGEMT-hygB vector with NcoI and ligated into pMAD72, and the PCR-amplified ald and ctfAB genes from C. beijerinckii genome were ligated into the plasmid with HindIII to generate plasmid pSV6. Figure 3.2 shows the schematic maps of these plasmids. These plasmids were amplified and stored in E. coli DH5α and transformed into C. tyrobutyricum

Ct(Δack) via the donor cell, E. coli CA434, by conjugation described below.

66 3.3.3 Transformation and mutant confirmation

All plasmids were transformed into Ct(Δack) by conjugation as previously described with some modifications (Yu et al., 2011). The plasmids were first transformed into E. coli CA434 using the heat shock method. Then, the transformants were cultivated in LB medium containing 25 μg/ml chloramphenicol at 37 °C overnight to reach OD600 of

1.52.0. The collected transformants were washed once using 1 ml sterile phosphate-buffered saline (PBS) and collected by centrifugation at 4,000×g for 2 min.

The transformed donor cells were then mixed with 200 μl of C. tyrobutyricum cells precultured at 37 °C overnight, and the mixture was pipetted onto CGM agar plates in an anaerobic chamber and incubated at 37 °C for 824 h. Then, cells were recovered and re-suspended in 1 ml of PBS and spread onto CGM plates containing 45 μg/ml thiamphenicol and 250 μg/ml cycloserine for 23 days to select for positive transformants, which were confirmed by PCR cloning and plasmid extraction. The transformants carrying the plasmids pMAD72, pMAT, pSOL, and pSV6 are designated as mutant strains Ct(Δack)-pMAD72, Ct(Δack)-pMAT, Ct(Δack)-pSOL and Ct(Δack)-pSV6, respectively, and were obtained and stored at -80 °C.

3.3.4 Enzyme activity assay

The activity of ctfAB in cells was assayed under anaerobic conditions following the method previously described (Chen and Blaschek, 1999). Each crude cell extract from 50 ml of cells present in an overnight culture was prepared in a buffer containing 50 mM

3-(N-morpholino) propanesulfonic acid (MOPS) (pH 7.0), 500 mM (NH4)2SO4, and 20%

(v/v) glycerol. The cell debris was removed by centrifugation at 13,000 rpm for 10 min at

67 4 °C. The assay mixture (1 ml) containing 110 mM Tris-HCl (pH 7.5), 5.5% (v/v) glycerol, 20 mM MgCl2, 0.1 mM acetoacetyl-CoA, crude cell extract (20 to 100 g), and

0.32 M potassium acetate (or butyrate) was purged with nitrogen to eliminate O2. The assay mixture without potassium acetate (or butyrate) was used as blank for negative control. The activity of CoA transferase was measured by monitoring the disappearance of acetoacetyl-CoA at 310 nm in a UV/Vis spectrophotometer (UV-1601, Shimadzu). One unit of enzyme activity is defined as the disappearance of 1 mol of acetoacetyl-CoA per min. Protein concentration was measured by the Bradford dye-binding assay (Bio-Rad

Laboratories, Hercules, CA) with bovine serum albumin as standard. The specific enzyme activity is reported as U/mg protein.

3.3.5 Fermentation kinetics

Batch fermentation kinetics were studied in a stirred-tank bioreactor containing 600 ml of CGM medium with glucose as the carbon source and 45 μg/ml thiamphenicol to prevent culture degeneration or plasmid loss. The bioreactor was sparged with nitrogen for ~30 min. to reach anaerobic condition, and then inoculated with an overnight culture at a volume ratio of 5%. Unless otherwise noted, the bioreactor was maintained at 37 oC with the pH controlled at 5.0 or 6.0 by adding 40% ammonium hydroxide. Samples were collected twice a day at regular intervals for analyses of cell density and concentrations of glucose, acetone, butanol, ethanol, acetate and butyrate. Each fermentation condition was repeated at least once and representative data with averages and standard deviations are reported.

68 3.3.6 Analytical methods

Cell growth was monitored by measuring the optical density at 600 nm (OD600) with a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). YSI 2700 Select

Biochemistry Analyzer (Yellow Springs, OH) was used to assay the concentration of glucose in samples. Acetone, butanol, ethanol, acetate and butyrate were analyzed with a gas chromatograph (GC, Shimadzu GC-2014) equipped with a flame ionization detector and a 30 m fused silica column (0.25 m film thickness and 0.25 mm ID, Stabilwax-DA).

The carrier gas was nitrogen at 1.47 ml/min (linear velocity: 35 cm/s). Samples were diluted 20 times with an internal standard buffer solution containing 0.5 g/L isobutanol,

0.1 g/L isobutyric acid and 1% phosphoric acid (for acidification), and injected (1 μL each) using an auto injector (AOC-20i Shimadzu). The column temperature was held at

80 oC for 3 min, raised to 150 oC at a rate of 30 oC/min, and held at 150 oC for 3.7 min.

Both the injector and detector were set at 250 oC.

3.3.7 Statistical analysis

All batch fermentations were at least duplicated for each condition studied, and the means with standard errors for kinetic parameters such as product yields and productivities are reported. Student’s t-test analysis with JMP software was performed to determine the significant difference (p < 0.05).

3.4 Results

3.4.1 Enzyme activity

To confirm the expression of ctfAB in the mutants, the CoA transferase activity was

69 assayed with the parental strain Ct(Δack) as the negative control and C. acetobutylicum and C. beijerinckii as positive controls, and the results are shown in Table 3.2. As expected, the strains Ct(Δack) and Ct(Δack)-pMAD72 showed no or negligible CoA transferase activity while Ct(Δack)-pMAT, Ct(Δack)-pSOL and Ct(Δack)-pSV6 all showed a high specific CoA transferase activity (0.11 to 0.26 U/mg protein) comparable to the positive controls, confirming the expression of ctfAB genes in these mutants. With

CoA-transferase, these mutants can catalyze the transfer of CoA moiety from acetoacetyl-CoA to either butyrate or acetate, thus allowing the conversion of butyrate and acetate to butanol and ethanol, respectively.

3.4.2 Fermentation Kinetics

Figure 3.3 shows the fermentation kinetics for Ct(Δack)-pMAD72, Ct(Δack)-pMAT,

Ct(Δack)-pSOL and Ct(Δack)-pSV6 at pH 6.0. All these mutants were able to produce butanol and ethanol because of the overexpression of adhE2 or ald gene. The former encodes a bifunctional aldehyde/alcohol dehydrogenase, which catalyzes the reaction from butyryl-CoA to butanol and acetyl-CoA to ethanol. It is noted that the genome of C. tyrobutyricum contains adh (alcohol dehydrogenase) and bdh (butanol dehydrogenase) genes (unpublished data). Therefore, overexpressing ald (aldehyde dehydrogenase) alone would be sufficient for C. tyrobutyricum to produce butanol and ethanol, as evidenced in the case with the mutant Ct(Δack)-pSOL (Fig. 3.3C).

For the mutant Ct(Δack)-pMAD72 overexpressing only adhE2, butanol production reached ~10 g/L, with large amounts of butyrate (~13.7 g/L) and acetate (~6.7 g/L) also produced (Fig. 3.3A). In contrast, for the mutants also expressing ctfAB, more butanol

70 (12.3 to 13.4 g/L) and much less acids (3.14.5 g/L butyric acid; 1.62.6 g/L acetic acid) were produced (Fig. 3.3B-D). Clearly, with ctfAB genes, which are responsible for transferring the CoA moiety from acetoacetyl-CoA to butyrate and acetate, butyrate and acetate produced by the cells can be re-assimilated back into butyryl-CoA and acetyl-CoA and reenter the main metabolic pathway (Wiesenborn et al. 1989a), leading to the production of butanol and ethanol, respectively. Therefore, much less acids accumulation and more butanol production were observed with Ct(Δack)-pMAT, Ct(Δack)-pSOL and

Ct(Δack)-pSV6. Compared to Ct(Δack)-pMAD72, the production of acetate and butyrate decreased 61%76% and 67%77%, respectively, while butanol production increased

20.6%31.4%. While acetate production was significantly reduced, ethanol production did not increase but instead decreased in mutants overexpressing ctfAB. This could be due to that adhE2 overexpression shifted the metabolic flux from C2 (acetate) toward C4

(butyrate) biosynthesis (Yu et al. 2011), which is further discussed later in this paper.

It should be noted that Ct(ack)-pMAD72 consumed ~100 g/L of glucose during the fermentation, while only 6070 g/L of glucose was consumed by the mutants with CoA transferase expression. The earlier and accelerated butanol production by these mutants led to an early threshold of butanol toxicity (Bowles and Ellefson, 1985), which inhibited cell metabolism and resulted in incomplete glucose consumption. Nevertheless, the butanol titer produced by the mutants was higher than that by Ct(ack)-pMAD72 even though less glucose was consumed because of increased butanol yield.

Interestingly, the mutants overexpressing ctfAB also produced a significant amount of acetone (6.5–7.4 g/L) even in the absence of adc (acetoacetate decarboxylase). In solventogenic clostridia, acetone is produced from acetoacetyl-CoA in two steps 71 catalyzed by CoA transferase (ctfAB) and acetoacetate decarboxylase (adc), respectively

(Petersen and Bennett, 1990). As expected, Ct(Δack)-pSOL overexpressing ctfAB and adc was able to produce 7.4 g/L acetone. However, Ct(Δack)-pMAT and Ct(Δack)-pSV6, which did not have the adc gene, also showed a comparable acetone production (6.57.0 g/L), suggesting a non-enzymatic decarboxylation of acetoacetate. This finding is consistent with a previous study by Han et al (2011), who knocked out the adc gene in C. beijerinckii NCIMB 8052 and observed no obvious decrease in acetone production by the knock-out mutant. Similarly, the down-regulation of adc with antisense RNA resulted in

86% decrease in the decarboxylase activity but only a 17% reduction in acetone production (Tummala et al. 2003). Clearly, adc is not required for acetone production in

C. tyrobutyricum although its presence appeared to give a slightly higher acetone production compared to the strains without the gene.

The fermentation kinetics for Ct(Δack)-pMAD72, Ct(Δack)-pMAT, Ct(Δack)-pSOL and Ct(Δack)-pSV6 were also studied at pH 5.0 (see Appendix B). In general, similar kinetics was observed at both pHs 5.0 and 6.0, although butanol production was lower at pH 5.0. Figures 3.4 and 3.5 illustrate the effects of ctfAB overexpression and pH on C. tyrobutyricum growth and fermentation kinetics, including specific growth rate, product titers, and butanol yield and productivity (see Appendix B). Compared to

Ct(Δack)-pMAD72, the mutants overexpressing ctfAB had a much higher butanol yield

(0.190.22 vs. 0.10 g/g glucose at pH 6.0; 0.180.26 vs. 0.14 g/g glucose at pH 5.0) and productivity (0.310.35 vs. 0.13 g/L·h at pH 6.0; 0.230.24 vs. 0.13 g/L·h at pH 5.0).

These mutants had a comparable specific growth rate, but a much lower final cell density compared to Ct(Δack)-pMAD72. The effects of ctfAB overexpression and pH on C.

72 tyrobutyricum growth and fermentation kinetics are further discussed below.

3.4.3 Effects of ctfAB

CoA transferase encoded by ctfAB plays an important role in the re-assimilation and conversion of acetate and butyrate, produced in the acidogenesis phase, to solvents

(acetone, butanol, and ethanol) in the solventogenic phase in solventogenic Clostridium.

The overexpression of ctfAB in C. tyrobutyricum Ct(Δack) thus had pronounced effects on cell growth, acids production, and butanol production. Without ctfAB, the strain

Ct(Δack)-pMAD72 produced much more butyrate (Fig. 3.4A, B) and acetate (Fig. 3.4C,

D), and less butanol (Fig. 3.4E, F), compared to the mutants overexpressing

CoA-transferase. Ct(Δack)-pMAD72 also grew slower initially with a longer lag phase of

~30 h, but reached a higher final cell density (Fig. 3.4G, H). On the other hand, the overexpression of CoA transferase caused an earlier production of butanol, which was toxic to cells and thus resulted in lower cell density and earlier termination of the fermentation with less glucose consumption and total metabolites (solvents and acids) produced (Fig. 3.5A, B). Nevertheless, overexpressing ctfAB resulted in over 100% increase in butanol yield (Fig. 3.5C, D) and productivity (Fig. 3.5E), but negligible effect on the specific growth rate (Fig. 3.5F).

Clearly, ctfAB expression improved butanol production by re-assimilating and converting butyrate and acetate to their corresponding alcohols, resulting in 21%31% higher butanol titer and over 100% increase in butanol yield (from 0.10 to 0.22 g/g glucose) and productivity (from 0.13 to 0.35 g/L·h) at pH 6.0. The mutants with CoA transferase expression also had a much shorter lag phase, although a similar specific

73 growth rate, indicating that CoA transferase expression allowed cells to grow sooner by limiting the accumulation of butyrate, which is an inhibitor to cell growth (Zhu and Yang,

2003). However, the accelerated production of butanol by these mutants led to an early threshold of butanol toxicity (Bowles and Ellefson, 1985), lower cell density reached in the stationary phase, and earlier termination of the fermentation with less glucose consumption.

Although ctfAB had pronounced effects on decreasing butyrate and acetate production and increasing butanol production, it showed negligible effect on ethanol production (Figure 3.5A, B). This can be attributed to the fact that C. tyrobutyricum, as a native high butyrate-tolerant and producing strain, has a high metabolic flux from acetyl-CoA to butyryl-CoA, which favors butanol production over ethanol production.

Therefore, the expression of CoA transferase in C. tyrobutyricum increased its butanol production but had little effect on ethanol production.

It is noted that the reduction in butyrate production was much more than the reduction in acetate production in the presence of ctfAB. For example, on average, butyrate production decreased 73% and 85%, while acetate production decreased 67% and 59% at pH 6.0 and pH 5.0, respectively (see Appendix B). Apparently, much more butyrate has been converted by CoA transferase than acetate, although the in vitro enzyme activity assay showed a similar rate for CoA transfer to butyrate or acetate (see

Table 3.2). This finding is consistent with a previous study showing that in vivo CoA transferase had a much higher activity towards butyrate than acetate (Wiesenborn et al.,

1989a).

74 3.4.4 Effects of pH

In general, more butanol was produced at a higher rate at pH 6.0 than at pH 5.0 because the optimal pH for aldehyde/alcohol dehydrogenase (adhE2) is around 6.5

(Fontaine et al., 2002). In addition, at pH 5.0, most acids would be present in the undissociated form, which is toxic to cells (Maddox et al., 2000). On the other hand, the

CoA transferase did not seem to be much affected by the pH between 5.0 and 6.0, as their effects on decreasing acids production and increasing butanol yield and productivity were similar at both pHs. The lack of effect on increasing butanol titer at pH 5.0 by the mutants

Ct(Δack)-pMAT and Ct(Δack)-pSOL as compared to Ct(Δack)-pMAD72 could be attributed to the low aldehyde/alcohol dehydrogenase activities at the acidic pH. This problem was alleviated by co-expressing ald and adhE2 in Ct(Δack)-pSV6, which produced significantly more butanol (11 g/L vs. <9 g/L) compared to the other mutants.

For all mutants expressing ctfAB, more acetone was also produced at pH 6.0 than at pH 5.0 (see Appendix B), because of higher cell activity at pH 6.0. Moreover, the butanol/acetone ratio was lower at pH 6.0 (1.71.9 g/g) than at pH 5.0 (2.1.6 g/g), suggesting that pH 6.0 was more favorable for acetone production, probably because CoA transferase activity was higher at pH 6.0 than at 5.0 (Wiesenborn et al., 1989a).

3.4.5 Effects of different ctfAB and ald genes

No significant difference in the fermentation kinetics were found for Ct(Δack)-pMAT and Ct(Δack)-pSOL. The former expressed adhE2 and ctfAB from C. acetobutylicum

ATCC 824, while the latter expressed ald, ctfAB and adc from C. beijerinckii. Different from C. acetobutylicum, C. beijerinckii does not bear any mega-plasmid and ald, ctfAB

75 and adc are located on its chromosome. Also, the ald gene in C. beijerinckii, unlike adhE gene from C. acetobutylicum, only has aldehyde dehydrogenase activity. Nevertheless, butanol and acids production levels in both mutant strains were similar, suggesting that the native bdh and adh genes in C. tyrobutyricum genome are functional. In addition, both strains produced acetone at a similar level, indicating that the adc gene encoding an acetoacetate decarboxylase is not required for acetone production from acetoacetate, as also found for C. beijerinckii by Han et al (2011). Overexpressing both adhE2 and ald in

Ct(Δack)-pSV6 gave the best butanol production among the mutants studied, probably because of the increased aldehyde dehydrogenase activity. The effect was more pronounced at pH 5.0, at which the activities of aldehyde/alcohol dehydrogenase might be limited because the optimal pH for the enzyme activity is around neutral (Fontaine et al. 2002).

3.4.6 Acid re-assimilation

To further illustrate the effects of CoA-transferase on acid re-assimilation, batch fermentations of Ct(Δack)-pMAD72 and Ct(Δack)-pMAT were studied at pH 6.0 in media initially also containing ~20 mM acetate or butyrate. As expected, for the strain

Ct(Δack)-pMAT expressing ctfAB, both acetate and butyrate were kept at a relatively low level (less than 35 g/L) compared to the control strain Ct(Δack)-pMAD72 without ctfAB, which produced large amounts of acetate and butyrate (Figure 3.6). In fact, a notable decrease in the acetate level after peaking at ~24 h was observed for Ct(Δack)-pMAT

(Fig. 3.6A, B), but not for Ct(Δack)-pMAD72 (Fig. 3.6C, D). These results clearly demonstrated that ctfAB played an important role in acid re-assimilation. It is noted that

76 without ctfAB, there was a long lag phase of ~24 h, especially when ~20 mM butyrate was added in the medium. Interestingly, the butyrate concentration decreased from 2.4 g/L to 0.4 g/L during the lag phase (Fig. 3.6D). The apparent butyrate uptake by

Ct(Δack)-pMAD72 suggested the existence of a reverse reaction from butyrate to butyryl-CoA, possibly catalyzed by phosphotransbutyrylase (Ptb) and butyrate kinase

(Buk), which has also been proposed for C. acetobutylicum (Jiang et al., 2009; Lehmann et al., 2012a; Jang et al., 2012; Millat et al., 2014). Nevertheless, this butyrate uptake pathway seemed to work only in the lag phase, not during the exponential growth phase, and required energy (ATP). Once the butyrate level was reduced to a non-inhibiting level, normal cell growth started and butyrate (and acetate) was produced, which generated more ATP to support fast cell growth. No acetate uptake by Ct(Δack)-pMAD72 was observed (Fig. 3.6C), again confirming that acetate re-assimilation required the CoA transferase (ctfAB).

3.5 Discussion

The sol operon containing adhE (aldehyde/alcohol dehydrogenase) or ald (aldehyde dehydrogenase), and ctfA and ctfB (encoding two protein subunits for the

CoA-transferase) is responsible for the production of ABE in solventogenic clostridia

(Cornillot et al., 1997; Nair et al., 1999; Nair and Papoutsakis, 1994). The ability to re-assimilate acetate and butyrate is critical to the biphasic ABE fermentation. Failure to do so by solventogenic clostridia can cause acid crash, a phenomenon often observed in industrial ABE fermentation (Wang et al., 2011; Maddox et al., 2000). As evidenced in this study and many other studies, the CoA transferase encoded by ctfAB is responsible

77 for transferring CoA from acetoacetyl-CoA to butyrate and acetate, forming acetoacetate, butyryl-CoA and acetyl-CoA, which are then converted to ABE in the reactions catalyzed by the enzymes encoded by adc and adhE, respectively (Lee et al., 2008). Also, acetone production is usually coupled with the re-assimilation of acids, as mutants with disrupted acetone-producing pathway also showed a significantly increased acids production

(Sillers et al., 2008; Lee et al., 2008; 2009; Jang et al., 2012). It is thus generally believed that the re-assimilation of acids in C. acetobutylicum is controlled by the expression of ctfAB during the metabolic shift from acidogenesis to solventogenesis (Lehmann et al.,

2012b).

However, studies with ctfAB-disrupted mutants also suggested the existence of a

CoA-transferase-independent butyrate uptake pathway involving Ptb and Buk, which normally catalyze the reactions from butyryl-CoA to butyryl phosphate and then to butyrate, respectively (Jiang et al., 2009; Lehmann et al., 2012a; Jang et al., 2012).

Butyrate uptake through the reverse Ptb-Buk pathway was demonstrated with a mutant overexpressing ptb and buk (Walter et al., 1994), as well as by using a mathematical model simulating the metabolic pathways in ABE-producing network (Millat et al., 2014).

In addition, purified Ptb from C. acetobutylicum ATCC 824 also showed an increased catalytic activity for the reverse reaction of butyryl phosphate to butyryl-CoA as the pH decreased below 6.0 (Wiesenborn et al., 1989b). For the first time, our study also showed the possible existence of the reverse Ptb-Buk pathway for butyrate uptake by a native butyrate-producing C. tyrobutyricum, although ptb and buk genes have not been found or annotated in the recently published draft genome of C. tyrobutyricum ATCC 25755 (Bassi et al., 2013; Jiang et al., 2013), probably because of the incomplete annotation (only

78 ~50%). The existence of Ptb and Buk in C. tyrobutyricum was partially proved by testing their enzyme activities in a previous study (Zhang et al., 2012); however, further verification would be necessary.

All previous studies on ctfAB and acid re-assimilation were conducted with type strains of solventogenic clostridia, such as C. acetobutylicum ATCC 824 and C. beijerinckii NCIMB 8052, which have complex biphasic physiology involving highly-regulated metabolic and transcriptional networks (Alsaker et al., 2010; Dürre et al.,

2002; Girbal et al., 1995; Janssen et al., 2012; Rydzak et al., 2011; Thormann et al., 2002;

Schwarz et al., 2012; Wang et al., 2013). Several genes located on two operons (sol and adc) are involved in the biphasic ABE fermentation (Fischer et al., 1993; Gerischer and

Dürre, 1990; Petersen and Bennett, 1990), and they are tightly regulated by several transcription factors, including spo0A and solR (Alsaker et al., 2004; Thormann et al.,

2002; Nair et al., 1999; Ravagnani et al., 2000; Steiner et al., 2011; Tomas et al., 2004).

However, the regulatory mechanism is highly complicated, involving many additional genes and transcription factors controlling not only acidogenesis, solventogenesis, but also sporulation and clostridia life cycle, and remains unclear (Nicolaou et al., 2010; Xu et al., 2015). In contrast, C. tyrobutyricum, as a native ctfAB and adc deficient strain without the complex biphasic physiology, provides a novel (simpler) system to study acid re-assimilation by ctfAB and its effects on cell growth and solvents production. This cannot be easily done with C. acetobutylicum as its ctfAB-disruption would also influence the expression of adhE located within the same cistronic operon, compromising alcohol production by the mutant (Tummala et al., 2003; Sillers et al., 2009).

The metabolically engineered C. tyrobutyricum can also be used as a novel host for

79 n-butanol production with several advantages over conventional solventogenic clostridia

(Ma et al., 2015). Its high tolerance to butyrate, as well as butanol, and strong carbon flux towards C4 products would favor the production of n-butanol, instead of ethanol, when adhE2 is overexpressed (Yu et al., 2011). Butanol is the desirable product as it has superior biofuel properties compared to ethanol. While overexpressing adhE in C. acetobutylicum ATCC 824 increased both ethanol and butanol production, increasing the flux from acetyl-CoA to acetoacetyl-CoA by also overexpressing thl (encoding thiolase) decreased C2 metabolites (acetate and ethanol) and increased acetone and butyrate production (Sillers et al., 2009). Clearly, an enhanced intracellular butyryl-CoA pool could improve butanol production and selectivity. On the other hand, a butyrate-negative mutant strain of C. acetobutylicum ATCC 824 showed elevated ethanol titer with depressed butanol production (Lehmann et al., 2012b). Constitutively expressing adhE2 in C. tyrobutyricum also enables the mutant strain to continuously produce n-butanol throughout the fermentation without subjecting to life cycle regulation and acid crash as often encountered by C. acetobutylicum. Further expression of CoA transferase in C. tyrobutyricum not only increased its butanol production, with more than 100% increase in butanol yield and productivity, but also facilitated the production of acetone. A previous study also showed that overexpressing adc and ctfAB in C. acetobutylicum led to earlier induction of acetone formation, with enhanced acetone (95%), butanol (37%), and ethanol (90%) production (Mermelstein et al., 1993).

Although overexpressing ctfAB increased butanol yield and productivity by more than 100%, the final butanol titer in the fermentation only increased 20% to 30%. This is because butanol production is also limited by butanol toxicity and the availability of

80 NADH (see Fig. 1). Butanol toxicity can be alleviated by removing butanol in situ during fermentation (Xue et al. 2012; Xue et al. 2014), increasing butanol tolerance via adaptation (Yang and Zhao, 2013) and metabolic engineering (Lütke-Eversloh and Bahl,

2011; Tomas et al., 2003), whereas NADH availability can be increased by inhibiting hydrogen production (Datta and Zeikus, 1985), redox engineering (Ventura et al., 2013;

Wang et al., 2012) and using artificial electron carriers such as methyl viologen (Du et al.,

2015) and more reduced substrates such as mannitol (Yu et al., 2012). With further metabolic and process engineering, it is possible to produce butanol at a higher titer of

~20 g/L using C. tyrobutyricum Ct(Δack) overexpressing ctfAB and adhE2.

In conclusion, overexpressing ctfAB facilitated the re-assimilation of butyrate and significantly increased butanol production from glucose by C. tyrobutyricum Ct(Δack) overexpressing adhE2, resulting in over 100% increase in butanol yield and productivity.

Co-expressing ctfAB with adhE2 also led to the production of acetone to a high level of

~50% of that for butanol, turning the native acidogenic C. tyrobutyricum into an ABE producer with high yields. Further improvement in butanol production can be achieved by engineering the cells for higher butanol tolerance and increasing the NADH level available for butanol biosynthesis during the fermentation. This study demonstrated the essential role of CoA-transferase in acetate and butyrate reassimilation and also suggested possible existence of an exclusive Pta-Buk reverse pathway for butyrate uptake by C. tyrobutyricum.

3.6 Acknowledgements

This work was supported in part by the National Science Foundation STTR program

81 (IIP-1026648). We are grateful to Prof. N. P. Minton, University of Nottingham, UK for providing the donor E. coli CA434 and plasmid pMTL007 used in this study.

3.7 References

Alsaker KV., Spitzer TR, Papoutsakis ET (2004). Transcriptional analysis of spo0A overexpression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J Bacteriol. 186:1959-1971.

Alsaker KV, Paredes C, Papoutsakis ET (2010). Metabolite stress and tolerance in the production of biofuels and chemicals: gene-expression-based systems analysis of butanol, butyrate, and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol Bioeng 105:1131–1147.

Bassi D, Fontana C, Gazzola S, Pietta E, Puglisi E, Cappa F, Cocconcelli PS (2013). Draft Genome Sequence of Clostridium tyrobutyricum Strain UC7086, Isolated from grana padano cheese with late-blowing defect. Genome Announc. 1: e00614-13.

Bowles LK, Ellefson WL (1985) Effects of butanol on Clostridium acetobutylicum. Appl Environ Microbiol 50: 1165-1170.

Branduardi P, De Ferra F, Longo V, Porro D (2014) Microbial n-butanol production from clostridia to non-clostridial hosts. Eng Life Sci 14: 16-26

Chen C-K, Blaschek HP (1999) Effect of acetate on molecular and physiological aspects of Clostridium beijerinckii NCIMB 8052 solvent production and strain degeneration. Appl Environ Microbiol 65: 499-505.

Cornillot E, Nair RV, Papoutsakis ET, Soucaille P (1997) The genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain. J Bacteriol. 179:5442-7.

Du Y, Jiang W, Yu M, Tang IC, Yang ST (2015) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution and fermentation kinetics, Biotechnol Bioeng, DOI:10.1002/bit.25489.

82 Dürre P, Böhringer M, Nakotte S, Schaffer S, Thormann K, Zickner B (2002) Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol Microbiol Biotechnol. 4: 295-300.

Dürre P (2007) Biobutanol: An attractive biofuel. Biotechnol J. 2: 1525-1534.

Demirbas A (2009) Political, economic and environmental impacts of biofuels: A review. Appl Energy. 86: s108-s117.

Datta R, Zeikus JG (1985) Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol. 48:764-770.

Fischer RJ, Helms J, Dürre P (1993) Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol. 175: 6959-69

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

Fox ME, Lemmon MJ, Mauchline ML, Davis TO, Giaccia AJ, Minton NP, Brown JM (1996) Anaerobic bacteria as a delivery system for cancer gene therapy: in vitro activation of 5-fluorocytosine by genetically engineered clostridia. Gene Ther. 3: 173-178.

Gerischer U, Dürre P (1990) Cloning, sequencing, and molecular analysis of the acetoacetate decarboxylase gene region from Clostridium acetobutylicum. J Bacteriol. 172: 6907-18

Girbal L, Croux C, Vasconcelos I, Soucaille P (1995) Regulation of metabolic shifts in Clostridium acetobutylicum ATCC 824. FEMS Microbiol Rev. 17: 287-298

Green EM (2011) Fermentative production of butanol–the industrial perspective. Curr Opin Biotechnol. 22: 337-343.

Han B, Gopalan V, Ezeji C (2011) Acetone production in solventogenic Clostridium species. Appl Microbiol Biotechnol. 91: 565-576.

83 Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The Clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: 452-464.

Jang YS, Lee JY, Lee J, Park JH, Im JA, Eom MH, Lee J, Lee SH, Song H, Cho JH, Seung DY, Lee SY (2012) Enhanced butanol production obtained by reinforcing the direct butanol-forming route in Clostridium acetobutylicum. MBio. 3: e00314-12

Janssen H, Grimmler C, Ehrenreich A, Bahl H, Fischer RJ (2012) A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum - Solvent stress caused by a transient n-butanol pulse. J Biotechnol 161:354–365.

Jiang Y, Xu C, Dong F, Yang Y, Jiang W, Yang S (2009) Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Metab Eng 11: 284–291

Jiang W, Zhao J, Wang Z, Yang ST (2014) Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations. Bioresour Technol 163:172-179.

Jiang L, Zhu L, Xu X, Li Y, Li S, Huang H (2013) Genome Sequence of Clostridium tyrobutyricum ATCC 25755, a Butyric Acid-Overproducing Strain. Genome Announc. 30:1(3). pii: e00308-13

Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev 50: 484-524.

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by Clostridia. Biotechnol Bioeng. 101: 209-228.

Lee JY, Jang YS, Lee J, Papoutsakis ET, Lee SY (2009) Metabolic engineering of Clostridium acetobutylicum M5 for highly selective butanol production. Biotechnol J. 4: 1432-1440

Lehmann D, Hönicke D, Ehrenreich A, Schmidt M, Weuster-Botz D, Bahl H, Lütke-Eversloh T (2012a) Modifying the product pattern of Clostridium acetobutylicum: physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol Biotechnol. 94:743-754.

Lehmann D, Radomski N, Lütke-Eversloh T (2012b) New insights into the butyric acid metabolism of Clostridium acetobutylicum. Appl Microbiol Biotechnol 96: 1325-1339.

84

Liu X, Zhu Y, Yang ST (2005) Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC 25755 and mutants. Enz Microb Technol 38: 521-528.

Liu X, Zhu Y, Yang ST (2008) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog 22: 1265-1275.

Lütke-Eversloh T, Bahl H (2011) Metabolic engineering of Clostridium acetobutylicum: Recent advances to improve butanol production. Curr Opin Biotechnol 22: 634-647.

Lütke-Eversloh T (2014) Application of new metabolic engineering tools for Clostridium acetobutylicum. Appl Microbiol Biotechnol 98:5823-5837

Ma C, Kojima K, Xu N, Mobley J, Zhou L, Yang ST, Liu X (2015) Comparative proteomics analysis of high n-butanol producing metabolically engineered Clostridium tyrobutyricum, J Biotechnol 193: 108–119.

Maddox IS, Steiner E, Hirsch S, Wessner S, Gutierrez NA, Gapes JR, Schuster KC (2000) The cause of “acid crash” and “acidogenic fermentations” during the batch acetone-butanol-ethanol (ABE-) fermentation process. J Mol Microbiol Biotechnol 2: 95-100.

Mermelstein LD, Papoutsakis ET, Petersen DJ, Bennett, GN (1993) Metabolic engineering of Clostridium acetobutylicum ATCC 824 for increased solvent production by enhancement of acetone formation enzyme activities using a synthetic acetone operon. Biotechnol Bioeng. 42:1053-1060.

Millat T, Voig, C, Janssen H, Cooksley CM, Winzer K, Minton NP, Bah H, Fischer RJ, Wolkenhauer O (2014) Coenzyme A-transferase-independent butyrate re-assimilation in Clostridium acetobutylicum-evidence from a mathematical model. Appl Microbiol Biotechnol 98: 9059-9072

Nair RV, Green EM, Watson DE, Bennett GN, Papoutsakis ET (1999) Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol 181:319–330.

Nair RV, Papoutsakis ET (1994) Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production. J Bacteriol. 176:5843-6.

85 Nicolaou SA, Gaida SM, Papoutsakis ET (2010) A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: from biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng 12:307–331.

Papoutsakis ET (2008) Engineering solventogenic clostridia. Curr Opin Biotechnol 19: 420–429.

Petersen DJ, Bennett GN (1990) Purification of acetoacetate decarboxylase from Clostridium acetobutylicum ATCC 824 and cloning of the acetoacetate decarboxylase gene in Escherichia coli. Appl Environ Microbiol 56: 3491-3498.

Ravagnani A, Jennert KC, Steiner E, Grünberg R, Jefferies JR, Wilkinson SR, Young DI, Tidswell EC, Brown DP, Youngman P, Morris JG, Young M (2000) Spo0A directly controls the switch from acid to solvent production in solvent-forming clostridia. Mol Microbiol. 37:1172-85.

Rydzak T, Levin DB, Cicek N, Sparling R (2011) End-product induced metabolic shifts in Clostridium thermocellum ATCC 27405. Appl Microbiol Biotechnol. 92:199-209.

Schwarz KM, Kuit W, Grimmler C, Ehrenreich, A, Kengen, SWM (2012) A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum - Cellular behavior in adaptation to n-butanol. J Biotechnol 161:366–377.

Siller R, Chow A, Tracy B, Papoutsakis ET (2008) Metabolic engineering of the non-sporulating, non-solventogenic Clostridium acetobutylicum strain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng 10: 321–332

Sillers R, Al-Hinai MA, Papoutsakis ET (2009) Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol Bioeng 102: 38-49.

Steiner E, Dago AE, Young DI, Heap JT, Minton NP, Hoch JA, Young M (2011) Multiple orphan histidine kinases interact directly with Spo0A to control the initiation of endospore formation in Clostridium acetobutylicum. Mol Microbiol 80:641-654.

Thormann K, Feustel L, Lorenz K, Nakotte S, Dürre P (2002) Control of butanol formation in Clostridium acetobutylicum by transcriptional activation. J. Bacteriol. 184: 1966-1973

86 Tomas CA, Welker NE, Papoutsakis ET (2003) Overexpression of groESL in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl Environ Microbiol 69: 4951-4965.

Tomas CA, Beamish J, Papoutsakis ET (2004) Transcriptional analysis of butanol stress and tolerance in Clostridium acetobutylicum. J Bacteriol 186:2006-2018.

Tummala SB, Junne SG, Papoutsakis ET (2003) Antisense RNA downregulation of coenzyme A transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol 185: 3644-3653.

Ventura S, Hu H, Jahng D (2013) Enhanced butanol production in Clostridium acetobutylicum ATCC 824 by double overexpression of 6-phosphofructokinase and pyruvate kinase genes. Appl Microbiol Biotechnol 97: 7505-7516.

Walter KA, Mermelstein LD, Papoutsakis ET (1994) Studies of recombinant Clostridium acetobutylicum with increased dosages of butyrate formation genes. Ann NY Acad Sci 721:69–72.

Wang Q, Venkataramanan KP, Huang H, Papoutsakis ET, Wu CH (2013) Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress. BMC Syst Biol 7:120.

Wang J, Yang X, Chen CC, Yang ST (2014) Engineering clostridia for butanol production from biorenewable resources: from cells to process integration, Curr Opin Chem Eng 6:43-54.

Wang S, Zhang Y, Dong H, Mao S, Zhu Y, Wang R, Luan G, Li Y (2011) Formic acid triggers the "Acid Crash" of acetone-butanol-ethanol fermentation by Clostridium acetobutylicum. Appl Environ Microbiol. 77:1674-80.

Wang S, Zhu Y, Zhang Y, Li Y (2012) Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93: 1021-1030.

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989a) Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl Environ Microbiol 55: 323-329.

87 Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989b) Phosphotransbutyrylase from Clostridium acetobutylicum ATCC 824 and its role in acidogenesis. Appl Environ Microbiol 55:317-322

Williams DR, Young DI, Young M (1990) Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. Microbiology 136: 819-826.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production, Appl Microbiol Biotechnol 99:1011-1022.

Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC (2012) High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: 2746-2756.

Xue C, Zhao XQ, Liu CG, Chen LJ, Bai FW (2013) Prospective and development of butanol as an advanced biofuel. Biotechnol Adv 31:1575-1584.

Xue C, Zhao J, Sun JX, Jie CL, Bai FW, Yang ST (2014) Integrated butanol recovery for an advanced biofuel: current state and prospects. Appl Microbiol Biotechnol 98: 3463-3474.

Yang ST, Zhao JB (2013) Adaptive engineering of Clostridium for increased butanol production. US Patent 8450093.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: 881-889.

Zhang Y, Yu M, Yang ST (2012) Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol Prog 28:52-9.

Zhao J, Lu C, Chen CC, Yang ST (2013) Biological production of butanol and higher alcohols. In: Yang ST, El-Enshasy HA, Thongchul N, editors. Bioprocessing technologies in biorefinery for sustainable production of fuels, chemicals, and polymers. New York: John Wiley & Sons. pp 235-261.

88 Zheng Y, Li L, Xian M, Ma Y, Yang J, Xu X, He D (2009) Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: 1127-1138.

Zhu Y, Yang ST (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Prog 19: 365-372.

89 Table 3.1 Bacterial strains and plasmids used in this study Strain/Plasmid Relevant Characteristics Reference/ Source Strains E. coli DH5α Host cells for plasmids amplification Invitrogen

E. coli CA434 Donor cells in conjugation transformation Williams et al. 1990

Ct(Δack) C. tyrobutyricum ATCC 25755 with ack knockout Liu et al., 2008

Ct(Δack)-pMAD72 adhE2 overexpression in Ct(Δack) Yu et al.,2011

Ct(Δack)-pMAT adhE2 and ctfAB overexpression in Ct(Δack) This study Ct(Δack)-pSOL Sol operon overexpression in Ct(Δack) This study Ct(Δack)-pSV6 ald, ctfAB, and adhE2 overexpression in Ct(Δack) This study Plasmids pMTL007 ColE1 ori; Cmr; pCB102 ori Heap et al., 2007 pMAD72 From pMTL007; P-thl adhE2 Yu et al., 2011 pMAT From pMTL007; P-thl adhE2 ctfAB This study pSOL From pMTL007; P-thl sol operon (ald ctfAB adc) This study pSV6 From pMTL007; P-fac ald ctfAB Hygr; P-thl adhE2 This study Primers Sequence (5’-3’) TTTGCTTCATTATCC ctfAB-for AAGGAGGGATTAAAATGAACTCTAAAATAATT ctfAB-rev GTAATTACAAATCCC GTATTTCTTTCTAAACAGCCATGGGT CCATGGAGATCTCGA SOL-for ATTGATAAAAATAATAATAGTGGGTATAATTAAG GTAATTACAAATCCC SOL-rev AATCATATATAACTTCAGCTCTAGGCAATA SV6-for GACACACTAATACCTACAAGCTTAAAGATTTA SV6-rev AGTAAGCTTAGTCATTTGTTACATCAATTAC

90 Table 3.2 CoA transferase activities in C. acetobutylicum ATCC 824, C. beijerinckii NCIMB 8052, and C. tyrobutyricum Ct(Δack), Ct(Δack)-pMAD72, Ct(Δack)-pMAT, Ct(Δack)-pSOL, and Ct(Δack)-pSV6. Specific enzyme activity (U/mg protein) Strain Acetate as substrate Butyrate as substrate Ct(Δack) 0.00 ± 0.00 0.00 ± 0.00 Cac ATCC 824 0.31 ± 0.05 NA Cbei NCIMB 8052 0.17 ± 0.04 NA Ct(Δack)-pMAD72 0.000 ± 0.001 0.007±0.001 Ct(Δack)-pMAT 0.22 ± 0.02 0.26±0.02 Ct(Δack)-pSOL 0.11 ± 0.04 NA Ct(Δack)-pSV6 0.18 ± 0.03 NA Data shown are mean ± s.d. (n = 3). NA: Not available

91

Figure 3.1 Metabolic pathways in C. tyrobutyricum. The dotted lines show the pathways with missing genes in C. tyrobutyricum in comparison to other solvent producing Clostridium species. The boxes show the ABE products produced after introducing ald or adhE2 and ctfAB genes. The reversible reactions between butyryl-CoA and butyrate catalyzed by ptb and buk are hypothetical as these two genes have not been identified or annotated in the published draft genomic sequences of C. tyrobutyricum (ack: acetate kinase, adc: acetoacetate decarboxylase, adh: alcohol dehydrogenase, adhE2: aldehyde/alcohol dehydrogenase, ald: aldehyde dehydrogenase, bdh: butanol dehydrogenase, buk: butyrate kinase, ctfAB: CoA-transferase, pta: phosphotransacetylase, ptb: phosphotransbutyrylase)

92

Figure 3.2 Plasmid maps of pMAD72, pMAT, pSOL and pSV6. The grey arrows show the promoters and genes. (adc: acetoacetate decarboxylase, adhE2: aldehyde/alcohol dehydrogenase, ald: aldehyde dehydrogenase, ctfAB: CoA-transferase, CatP: chloramphenicol resistance gene, ColE1: Gram-negative replicon, fac: artificial Clostridium promoter, oriT: origin of transfer, pCB102: Gram-positive replicon, thl: thiolase promoter, traJ: TraJ protein for conjugation)

93

Figure 3.3 Fermentation kinetics of C. tyrobutyricum at pH 6.0 with various strains. A. Ct(Δack)-pMAD72, B. Ct(Δack)-pMAT, C. Ct(Δack)-pSOL, and D. Ct(Δack)-pSV6.

94

Figure 3.4 Comparison of butyrate, acetate and butanol production and cell growth (OD) among strains carrying different plasmids pMAD72, pMAT, pSOL and pSV6 in batch fermentations at pH 6.0 (A, C, E, G) and 5.0 (B, D, F, H)

95

Figure 3.5 Comparison of butyrate, acetate, acetone, ethanol and butanol production and specific growth rate for strains carrying different plasmids pMAD72, pMAT, pSOL and pSV6 in batch fermentations at pH 6.0 and 5.0.

96

Figure 3.6 Fermentation kinetics of C. tyrobutyricum Ct(Δack)-pMAT and Ct(Δack)-pMAD72 at pH 6.0 with acetate or butyrate addition in the medium.

97

Chapter 4: Metabolic engineering of Clostridium tyrobutyricum for n-butanol

production from maltose and soluble starch by overexpressing α-glucosidases

Abstract

Clostridium tyrobutyricum does not have the enzymes needed for using maltose or starch.

Two extracellular α-glucosidases encoded by agluI and agluII from C. acetobutylicum

ATCC 824 catalyzing the hydrolysis of α-1,4-glycosidic bonds in maltose and starch from the non-reducing end were cloned and expressed in C. tyrobutyricum (Δack, adhE2), and their effects on n-butanol production from maltose and soluble starch in batch fermentations were studied. Compared to the parental strain grown on glucose, mutants expressing agluI showed robust activity in breaking down maltose and produced more butanol (17.2 vs. 9.5 g/L) with a higher butanol yield (0.20 vs. 0.10 g/g) and productivity

(0.29 vs. 0.16 g/L·h). The mutant was also able to use soluble starch as substrate, although at a slower rate compared to maltose. Compared to C. acetobutylicum ATCC

824, the mutant produced more butanol from maltose (17.2 vs. 11.2 g/L) and soluble starch (16.2 vs. 8.8 g/L) in batch fermentations. The mutant was stable in batch fermentation without adding antibiotics, achieving a high butanol productivity of 0.40 g/L·h. This mutant strain thus can be used in industrial production of n-butanol from maltose and soluble starch. 98

4.1 Introduction

n-Butanol is a promising gasoline substitute that can be produced by solventogenic

Clostridium such as C. acetobutylicum and C. beijerinckii in acetone-butanol-ethanol

(ABE) fermentation (Wang et al., 2014; Xue et al., 2013; Zhao et al., 2013). Because of the high crude oil prices and concerns of the depletion of fossil energy, many countries including U.S., China, and Brazil have planned or started to apply ABE fermentation for n-butanol production (Ni et al., 2009; Mariano et al., 2013; Qureshi and Blaschek, 2001).

However, conventional ABE fermentation is limited by low productivity and butanol yield because of strong butanol cytotoxicity and the coproduction of acetone (Lee et al.,

2008; Lütke-Eversloh, 2014; Nicolaou et al., 2010; Papoutsakis 2008; Zheng et al., 2009).

In addition, the feedstock usually accounts for more than 50% of the product cost in ABE fermentation (Green, 2011; Gu et al., 2011). Starchy materials from corn, cassavas and potatoes are cheaper than glucose, and have thus been widely used in ABE fermentation with C. acetobutylicum and C. beijerinckii, which have amylases and can directly use starch and its hydrolytic products including maltose, maltotriose and maltodextrin as substrates. However, glucose, as the end product in starch hydrolysis hinders the amylolytic activity through catabolite repression (Annous and Blaschek, 1990; 1991;

Chojecki and Blaschek, 1986). Also, pH variation caused by the metabolic shift in the biphasic fermentation (acidogenesis and solventogenesis) by solventogenic clostridia can negatively affect the activity and stability of starch hydrolyzing enzymes, especially glucoamylase and the rate-limiting α-amylase (Paquet et al., 1991; Soni et al., 1992;

Madihah et al., 2001), causing process difficulties. 99

Recently, we have engineered Clostridium tyrobutyricum, an acidogen producing butyrate as the main product with a high titer and yield (Liu et al., 2005), for n-butanol production by overexpressing adhE2 encoding a bifunctional aldehyde/alcohol dehydrogenase (Yu et al., 2011; 2012). The engineered C. tyrobutyricum was able to produce n-butanol as the main product (without acetone) from glucose with a high titer and yield when additional NADH was available (Du et al., 2014). However, C. tyrobutyricum can only use a very restricted range of carbon sources, including a few monosaccharides (glucose, xylose, and fructose), mannitol, and lactate (Dwidar et al.,

2012). It is unable to use disaccharides, such as maltose, and polysaccharides, such as starch, because of lacking some important transport and catabolic systems.

In this study, two α-glucosidase genes (CAC2252, CAC2891) were cloned from C. acetobutylicum ATCC 824 (Cac 824) and separately expressed in C. tyrobutyricum together with adhE2 in a clostridia shuttle vector (Heap et al., 2009; Yu et al., 2012). The mutants were evaluated for their abilities to use maltose and soluble starch as substrates in batch fermentations at different pHs between 5.0 and 6.0, which affected the activity of

α-glucosidase and butanol biosynthesis. The results showed that the mutant expressing agluI and adhE2 had superior capability of utilizing maltose and starch, and produced more butanol as compared to Cac 824. This is the first study realizing the direct utilization of maltose and starch in C. tyrobutyricum, which should have advantages for industrial production of biobutanol from low-cost feedstocks such as food wastes or processing byproducts rich in maltose or starch. Although C. thermocellum cellulases have been expressed as mini-cellulosomes on C. acetobutylicum (Kovács et al., 2013), this study is the first one successfully transferring α-glucosidase, an extracellular enzyme, 100 between two different Clostridium species, indicating a similar recognition and export system functioning in C. acetobutylicum and C. tyrobutyricum.

4.2 Materials and methods

4.2.1 Bacterial strains, plasmids, and culture media

Table 4.1 summarizes the bacterial strains and plasmids used in this study. All recombinant plasmids constructed in this work were transformed into the mutant strain of

C. tyrobutyricum ATCC 25755 with ack knockout developed in a previous study (Liu et al., 2008). Clostridial Growth Medium (CGM) was used to culture C. tyrobutyricum at

37 °C under anaerobic conditions. The CGM contained (g/L): 4 Tryptone, 2 yeast extract,

1.0 K2HPO4∙3H2O, 0.5 KH2PO4, 2 (NH4)2SO4, 0.1 MgSO4∙7H2O, and trace minerals (Zhu and Yang, 2003). Carbon sources including glucose, maltose, and soluble starch (dextrose equivalent (DE) value of 25, Cargill, Eddyville, IA) were added as needed. E. coli strains used in the cloning were cultivated at 37 °C aerobically in liquid Luria-Bertani (LB) medium and on LB agar plates. After autoclaving at 121 oC for 30 min, media were supplemented with 25 μg/ml chloramphenicol, 45 μg/ml thiamphenicol, or 250 μg/ml cycloserine as needed.

4.2.2 Plasmids construction

All plasmids were constructed from pMTL82151-adhE2 (Yu et al., 2012). The agluI

(CAC2891) and agluII (CAC2252) were extracted and amplified from C. acetobutylicum

ATCC 824 genomic DNA by PCR with the primers shown in Table 4.1. The original ribosome binding sites were replaced with the consensus sequence “AGGAGG” to 101 optimize their expression. The thiolase (thl) promoter from C. tyrobutyricum was used to drive gene expression. The plasmids pGluI and pGluII were constructed from pMTL82151-adhE2 by inserting agluI and agluII, respectively, after adhE2 at the SacII site (see Appendix C) using In-fusion HD cloning kit from Clontech (Mountain View,

CA).

4.2.3 Transformation

The plasmids were transformed into the host cells by conjugation (Yu et al., 2012).

The donor cells, E. coli CA434, used to carry the plasmids to be transformed were cultivated in LB medium containing 25 μg/ml chloramphenicol at 37 °C overnight to reach OD600 of 1.5-2.0. After transformation by electroporation, E. coli cells were collected by centrifugation at 4,000×g for 2 min and washed once using 1 ml sterile phosphate-buffered saline (PBS). The donor cells were then mixed with 200 μl C. tyrobutyricum cells precultured at 37 °C overnight, and the mixture was pipetted onto

CGM agar plates in an anaerobic chamber and incubated at 37 °C for 8-12 h. Then, cells were recovered and re-suspended in 1 ml of PBS and spread onto CGM plates containing

45 μg/ml thiamphenicol and 250 μg/ml cycloserine for 2-3 days to select for positive transformants. A relatively high transformation efficiency of (3.32 ± 1.3)×10−6 colony/donor cell was achieved using the plasmid pMTL82151 (Yu et al., 2012). Positive transformants were first identified by colony PCR and then confirmed by restriction enzyme digestion of the plasmids extracted from the transformants. Two mutant strains each containing one of the two recombinant plasmids were obtained and stored at -80 °C.

102

4.2.4 Enzyme activity assay

The activity of α-glucosidase was assayed under anaerobic conditions using the p-nitrophenyl α-D-glucoside (PNPG) method (Albasheri and Mitchell, 1995; McMahon et al., 1999). To test the presence of intracellular, cell-bound, and secretory α-glucosidase, cell crude extract, whole cells and cell culture supernatant were assayed separately. All mutants were cultured overnight to reach a similar optical cell density. For the preparation of cell crude extract, cells in 50 ml of overnight culture broth were collected by centrifugation and washed twice in a potassium phosphate buffer (50 mM, pH 5.5).

After centrifugation, the cell pellet was resuspended in the same buffer. Cells were then disrupted by using Mini-beadbeater-16 (Biospec, Bartlesville, OK) and the cell debris was removed by centrifugation at 13,000 rpm for 10 min at 4 °C. For whole cell preparation, 2 ml cells were harvested by centrifugation at 4000 rpm for 5 min and the cell pellet was then washed and suspended in 400 ul potassium phosphate buffer. The supernatant was prepared by filtration to remove all the remaining cells. The assay mixture (1 ml) containing 5 mM PNPG, 50 mM potassium phosphate (at pH 5.5 or as indicated otherwise) and an appropriate amount of crude cell extract, whole cell, or supernatant was incubated at 37 °C for 1 h. The reaction was stopped by adding 1 ml 0.5

M sodium carbonate solution. The assay mixture without cell extract was used as the blank. The activity of α-glucosidase was measured by monitoring the release of PNP in the mixture at 400 nm with a UV/Vis spectrophotometer (UV-1601, Shimadzu). The protein concentration was measured by the Bradford dye-binding assay (Bio-Rad

Laboratories, Hercules, CA.) with bovine serum albumin as standard. The specific enzyme activity is reported as the amount of released PNP per min per ml of the cell 103 culture broth with OD normalized to 1.

4.2.5 Fermentation kinetics

Batch fermentation was studied in a 1-L stirred-tank bioreactor containing 600 ml of

CGM with glucose, maltose or soluble starch as the substrate and 45 μg/ml thiamphenicol, with pH controlled at the desired level (5.0, 5.5, or 5.8) by adding 40% ammonium hydroxide, unless otherwise noted. The bioreactor was inoculated with an overnight culture at a volume ratio of 5%, and liquid samples were collected twice a day at regular intervals to monitor cell density, sugar consumption, and products formation. Each fermentation condition was repeated at least once.

4.2.6 Analytical methods

Cell growth was monitored by measuring the optical density at 600 nm (OD600) with a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Glucose, maltose, and soluble starch in samples were measured using a high performance liquid chromatograph

(HPLC) equipped with an organic acid analysis column (HPX-87H, Bio-Rad) and a refractive index detector (Shimadzu RID-10A) at 45 °C (Yu et al., 2011). A series of various concentrations of starch solutions were used as standards for calibration. Acetone, butanol, ethanol, acetate and butyrate were analyzed with a gas chromatograph (GC,

Shimadzu GC-2014) equipped with a flame ionization detector and a 30-m fused silica column (0.25 m film thickness and 0.25 mm ID, Stabilwax-DA). Detailed description of the GC method has been given elsewhere (Jiang et al., 2014).

104

4.2.7 Segregational stability

Segregational stability of the plasmid pGluI was evaluated in a series of subcultures in CGM containing glucose or maltose without antibiotics following the method previously described (Yu et al., 2012). Briefly, a single colony of the mutant was picked and cultured in 1 ml CGM medium with 20 g/L glucose and 30 μg/ml thiamphenicol for

24 h at 37 °C . Cells were collected and washed with PBS, and then subcultured in antibiotic-free CGM containing 20 g/L glucose or maltose at 1% inoculum every 24 h for

96 h. At 96 h, cells were diluted by 104 times with PBS and plated on CGM agar plates

(containing 20 g/L glucose) with or without antibiotics at 37 °C for 5 days to determine colony-forming unites (CFU). The segregational stability P can be calculated from the following equation: R = Pn or P = n√R, where R is the fraction of cells carrying the plasmid and n is the number of generations in 96 h, which was ~28 based on the observed specific growth rate of ~0.20 h-1 (generation time = 3.465 h).

4.2.8 Statistical analysis

Unless otherwise noted, batch fermentation for each condition was studied in duplicate, and the means with standard errors for product yields and productivities are reported. Student’s t-test analysis was performed using JMP software with the significance level α = 0.05.

4.3 Results

4.3.1 α-Glucosidase activity

The mutants expressing Aglu I or Aglu II were examined for their α-glucosidase 105 activities. As shown in Table 4.2, high enzyme activity was found with the whole cell, while only negligible or trivial activity was detected in the supernatant and cell crude extract. On the other hand, no enzyme activity was found with Ct(Δack)-pM2 as the negative control. The results suggested that both Aglu I and Aglu II were exported and associated with cell membrane, instead of being kept intracellularly or secreted into the medium. The trivial activity detected in the supernatant was probably caused by cell lysis.

Also, the mutant Ct(Δack)-pGluI had about 60% higher enzyme activity compared to

Ct(Δack)-pGluII. It was found that the Aglu activity was sensitive to the pH, decreasing from 48.0 nmol PNP/ml/min at pH 5.0 to 7.4 nmol PNP/ml/min at pH 6.5 for the assay with Ct(Δack)-pGluI. To study if the Aglu expression was affected by the substrate used in the culture, the enzyme activity was also investigated with glucose, maltose and glucose/maltose (1:1, total 20 g/L) pregrown cultures of Ct(Δack)-pGluI and Cac 824

(Table 3). As expected, regardless of the substrate used in culturing the cells, comparable

Aglu activities were detected for Ct(Δack)-pGluI, confirming the constitutive expression of aglu in the mutant. In contrast, for Cac 824, the Aglu activity was significantly lower for cells grown on glucose and glucose/maltose, suggesting that the expression of aglu was both induced by maltose and repressed by glucose in Cac 824. The glucose-mediated catabolite repression on the expression of α-amylase was also observed previously in Cac

824 (Annous and Blaschek, 1990). It should be noted that Cac 824 also showed significant intracellular -glucosidase activity that might be attributed to another

-glucosidase (CAC1085) present in its genome.

Aglu I and Aglu II, encoded by agluI (CAC2891) and agluII (CAC2252), respectively,

106 on the chromosome of Cac 824, were both annotated as α-glucosidase with conserved family 31 of glycosyl hydrolases domain located at 55-775 and 27-779 amino acids, respectively (see Appendix C). Alignment of these two proteins shows a high level of similarity with 75% identities. SignalP analysis of the sequences gave a signal peptide score of 0.839 for Aglu I and 0.449 for Aglu II, suggesting the presence of signal peptides in these proteins for their exporting or secretion (Bendtsen et al., 2004; Servinsky et al.,

2010). Variations in the protein sequence, especially the signal peptides, might have caused differences in export efficiency, and thus influenced the enzyme activity, as observed in this study with the two mutants expressing Aglu I and Aglu II, respectively.

4.3.2 Effects of pH

The optimal pH for C. tyrobutyricum grown on glucose is ~6.3 (Liu et al., 2005; Yu et al., 2011; 2012), whereas the optimal pH range for Aglu activity is expected to be between 4.5 and 5.5, the pH usually used for growing C. acetobutylicum ATCC 824

(Huang et al., 1986). To find the optimal pH for butanol production from maltose by the mutants Ct(Δack)-pGluI and Ct(Δack)-pGluI, the effects of pH on their growth, maltose consumption, and acids and alcohols production in batch fermentation of maltose were evaluated with pH controlled at 5.0, 5.5, 5.8 and 6.0, respectively. As can be seen in

Figure 4.1, increasing the pH from 5.0 to 5.8 decreased cell growth and maltose consumption slightly (Fig. 4.1A, B). At pH 5.0 and 5.5, all maltose, ~120 g/L, was consumed or hydrolyzed in ~70 h, whereas ~7 g/L of maltose remained at the end of the fermentation at pH 5.8. Meanwhile, a large amount of glucose was accumulated (up to

~30 g/L) in the fermentation at pH 5.0, 5.5 and 5.8, indicating that Aglu I was actively 107 breaking down maltose into glucose at a faster rate than glucose uptake by cells in the fermentation. Maltose hydrolysis (consumption) slowed down significantly after cells had entered the stationary phase at ~35 h. The final (maximum) cell density was lower at pH

5.8 than at pH 5.0 and 5.5. Also, compared to the lower pHs, much less acids (acetate and butyrate) but more alcohols (butanol and ethanol) were produced at pH 5.8. The final butanol concentration reached ~6.5 g/L at pH 5.0, ~12.0 g/L at pH 5.5, and ~17.2 g/L at pH 5.8, with corresponding butanol yields of 0.20 g/g at pH 5.8 and ~0.10 g/g at pH 5.0 and 5.5 (see Table 4.4). The higher butanol yield at pH 5.8 can be attributed to the lower acids production. At pH 5.0 and 5.5, 15.7-18.2 g/L of butyrate and 4.8-5.7 g/L of acetate were produced, while acids production decreased to ~8.3 g/L butyrate and ~3.3 g/L acetate at pH 5.8. The butanol productivity was also much higher at pH 5.8, 0.29 g/L·h vs.

0.19 g/L·h at pH 5.5 and 0.11 g/L·h at pH 5.0. Clearly, pH 5.8 was more favorable for alcohol production, probably because it was closer to the optimal pH of ~6.0 for the bifunctional aldehyde/alcohol dehydrogenase, which catalyzes the biosynthesis of butanol and ethanol from butyryl-CoA and acetyl-CoA, respectively (Fontaine et al.,

2002).

However, Ct(Δack)-pGluI was unable to consume maltose to support its growth at pH

6.0. As shown in Table 2, Aglu activity was compromised at pH above 6.0. Since Aglu was exported to the cell membrane, its activity and stability would be sensitive to the medium pH. Similar phenomena have also been reported for other extracellular amylolytic enzymes found in C. acetobutylicum, which also suffered from low activity and poor stability under inappropriate pH conditions (Paquet et al., 1991; Soni et al.,

1992; Madihah et al., 2001). The optimal pH for Ct(Δack)-pGluI to produce butanol from 108 maltose was thus determined to be 5.8, compromising between butanol biosynthesis and

Aglu I activity. Similar pH effects were also observed with Ct(Δack)-pGluII (data not shown), which also had the best butanol production when the pH was controlled at 5.8.

4.3.3 Fermentation kinetics using maltose as substrate

Figure 4.2 shows batch fermentation kinetics of maltose at pH 5.8 by Ct(Δack)-pGluI,

Ct(Δack)-pGluII, and Cac 824. As expected, all strains were capable of growing on maltose to produce butanol, butyrate, acetate and ethanol. For Cac 824, acetone was also produced as a main product. However, the fermentation with Ct(Δack)-pGluI was faster than Ct(Δack)-pGluII and Cac 824, indicating a more robust α-glucosidase encoded by agluI in the hydrolysis of maltose, which was consistent with the higher enzyme activity for Ct(Δack)-pGluI. Ct(Δack)-pGluI also produced more butanol (17.2 g/L) than

Ct(Δack)-pGluII (11.2 g/L) and Cac 824 (11.2 g/L) did, giving a higher butanol productivity of 0.29 g/L·h (vs. 0.17 g/L·h for Ct(Δack)-pGluII and 0.10 g/L·h for Cac

824) (see Table 4.3). The butanol yield from maltose by Ct(Δack)-pGluI was 0.20 g/g, which was comparable to that by Cac 824 and ~82% higher than that of Ct(Δack)-pGluII

(0.11 g/g). Ct(Δack)-pGluI also produced significantly more butyrate (8.3 g/L vs. 5.6 g/L for Ct(Δack)-pGluII and 2.5 g/L for Cac 824), while similar levels of ethanol and acetate were produced by all three strains. The lower butyrate production (accumulation) by Cac

824 was attributed to its CoA-transferases, which reassimilated butyrate and acetate, leading to the production of acetone to ~8.8 g/L. Overall, Ct(Δack)-pGluI has good maltose catabolism and butanol synthesis capabilities, and would be a better choice for industrial butanol production from maltose. 109

It should be noted that growth on maltose by Ct(Δack)-pGluI was much slower at

0.14 h-1 compared to the control strain Ct(Δack)-pM2 (0.24 h-1) on glucose (see Table

4.4). The slower growth could be attributed to the additional metabolic burden in expressing Aglu I for maltose hydrolysis. The total duration of the maltose fermentation was thus longer (~70 h vs. ~35 h for Ct(Δack)-pM2). However, more butanol was produced from maltose fermentation compared to glucose by Ct(Δack)-pM2, which produced ~9.5 g/L of butanol, at a much lower yield of 0.10 g/g (vs. 0.20 g/g by

Ct(Δack)-pGluI). This was because faster cell growth led to higher butyrate production

(accumulation) and thus limited butanol biosynthesis, which competed for the same substrate, butyryl-CoA with the native butyrate biosynthesis pathway (Yu et al., 2011).

Therefore, it would be desirable to produce butanol from maltose, instead of glucose, not only for the lower substrate cost but also for the higher product yield.

4.3.4 Fermentation kinetics using soluble starch as substrate

Figure 4.3 shows batch fermentation kinetics at pH 5.8 with soluble starch as the substrate. The soluble starch used in this study had a dextrose equivalent (DE) value of

25, or 4-5 degree of polymerization. Because of the longer α-1,4-glycosidic polymer chain, the hydrolysis and fermentation of soluble starch were slower than with maltose.

Unlike in maltose fermentation, the glucose released from starch hydrolysis was maintained at a relatively low level of <5 g/L, with some maltose, maltotriose and maltodextrin also present at a lower amount, for all three strains studied, indicating that starch hydrolysis could be limiting the fermentation. Similar to the results with maltose,

Ct(Δack)-pGluI performed better with faster starch consumption and higher butanol 110 production than Ct(Δack)-pGluII, again confirming that Aglu I was more robust than

Aglu II in breaking down the α-1,4-glycosidic bonds in starch. Ct(Δack)-pGluI produced

~16.2 g/L butanol from ~97 g/L starch in ~80 h, while Ct(Δack)-pGluII produced ~13.6 g/L butanol from ~90 g/L starch in ~105 h. In contrast, Cac 824 produced ~8.9 g/L butanol and ~6.0 g/L acetone from ~71 g/L starch in ~80 h. Clearly, Ct(Δack)-pGluI gave higher butanol yield (0.17 g/g vs. ~0.14 g/g for Ct(Δack)-pGluII and Cac 824) and productivity (0.20 g/L·h vs. 0.13 g/L·h for Ct(Δack)-pGluII and 0.10 g/L·h for Cac 824), and would be the better choice for industrial butanol production from starch. All fermentation kinetics data for these strains are summarized in Table 4.3 for direct comparison.

It is noted that only 89.5%, 80.9%, and 71.2% of soluble starch in the medium was hydrolyzed and consumed in the fermentation by Ct(Δack)-pGluI, Ct(Δack)-pGluII, and

Cac 824, respectively. This is because complete (efficient) starch hydrolysis usually require multiple amylases, including α-amylase for starch liquefaction, α-amylase and glucoamylase or α-glucosidase for saccharification, and de-branching enzyme such as pullulanase to break down α-1,6-glycosidic linkage. The lack of pullulanase would not allow the complete utilization of soluble starch, which has a high percentage (>5%) of maltodextrin with α-1,6-glycosidic bonds. Interestingly, Cac 824, a native starch-consuming strain, showed inferior ability in hydrolyzing and using starch in the fermentation at a rate of 1.01 g/h, which was much slower than that for Ct(Δack)-pGluI

(1.52 g/h). Clearly, constitutively overexpressing agluI in Ct(Δack)-pGluI gave a more robust starch hydrolysis ability than the highly regulated starch hydrolysis mechanism used in Cac 824 involving multiple genes for a phosphotransferase system (PTS) for 111 maltose transport, two α-amylases, a glucoamylase, a pullulanase, and two α-glucosidases, which may have to be induced with maltose, instead of starch itself (Servinsky et al.,

2010), and may be repressed by glucose accumulated in the medium. In addition, the redundancy in expressing multiple enzymes and transport systems in Cac 824 could overload the cells with excessive ATP consumption and result in lower cell growth and metabolic activity.

4.3.5 Fermentation kinetics without antibiotics

In the aforementioned fermentation kinetics studies, thiamphenicol was added in the fermentation medium to ensure cells maintain the plasmids and express the heterologous genes. However, the addition of an antibiotic as the selection pressure is undesirable as it would not only add cost but also impose additional metabolic burdens on cells in the fermentation. Since C. tyrobutyricum is a native maltose auxotroph, incapable of hydrolyzing or uptaking maltose, only the cells with cell-associated Aglu activity can survive in the medium with maltose as the sole carbon source. Therefore, theoretically maltose (and soluble starch) can be used as the selection pressure for the recombinant C. tyrobutyricum carrying the heterologous aglu (and adhE2) genes, allowing for stress-free cell-associated Aglu expression and fermentation to produce butanol in the absence of thiamphenicol. To prove this hypothesis, the fermentation without antibiotics addition was conducted with Ct(Δack)-pGluI and maltose as the carbon source, and the results are shown in Figure 4.4. As expected, cells appeared to be more robust in the fermentation without antibiotics, growing at a faster rate of 0.24 h-1 (vs. 0.14 h-1 with antibiotics) with almost no lag phase (vs. ~12 h with antibiotics) and reaching a higher cell density of OD 112

28 (vs. <24). Consequently, the fermentation was faster, consuming ~100 g/L of maltose and producing ~17.3 g/L of butanol in <45 h (vs. ~70 h with antibiotics). The amount of butanol produced in the absence of antibiotics was comparable to that with antibiotics, but at a much higher productivity of 0.40 g/L·h (vs. 0.29 g/L·h with antibiotics). It should be noted that the maltose hydrolysis (consumption) rate in the fermentation was comparable to that with antibiotics, indicating similar agluI expression level and Aglu I activity under both conditions (with or without antibiotics). However, the amount of glucose present in the fermentation medium was significantly lower at <10 g/L and there was no sharp accumulation of glucose, as observed in the fermentation with antibiotics

(see Fig. 4.2A), which imposed additional metabolic burden and impeded cell growth and glucose consumption. Although butanol productivity was higher in the absence of antibiotics, butanol yield was slightly lower at 0.17 g/g (vs. 0.20 g/g) due to the higher cell growth and butyrate production (13.1 g/L vs. 8.3 g/L). Butanol yield was usually higher when less butyrate was produced since both butyrate and butanol competed for the same precursor, butyryl-CoA and a faster butyrate biosynthesis would result in lower butanol production (Yu et al., 2011).

4.3.6 Segregational stability

The segregational stability of pGluI in C. tyrobutyricum was investigated to confirm the plasmid stability in Ct(Δack)-pGluI in fermentation without applying the antibiotic selection pressure. In general, the plasmid pGluI was highly stable in C. tyrobutyricum even grown on glucose without a selection pressure (P = 99.5% ± 0.1%), comparable to that found for pMTL82151 in a previous study (Yu et al., 2012). An even higher stability 113 of 99.8% ± 0.1% was observed when cells were grown on maltose, confirming that maltose could also function as a selection pressure in the absence of the antibiotic. It is thus convincible that the expression of Aglu would be stable even when the hydrolytic product of maltose, glucose, was accumulated in the fermentation medium.

4.4 Discussion

ABE fermentation of corn (starch) with C. acetobutylicum has long been used in industrial production of n-butanol and acetone (Jones and Woods, 1986). Starch and maltose are composed of glucose and they share the same sugar metabolism in Cac 824.

Based on the available genome data, Cac 824 has a putative maltose PTS (MalP), a maltose-6’-P glucosidase (MalH), two α-amylases, one glucoamylase, one pullulanase and two α-glucosidases (Aglu I, Aglu II) (Tangney et al., 2001; Servinsky et al., 2010).

Starch is first hydrolyzed extracellularly to maltose and glucose. There are two glucose

PTS transporters, one is constitutively expressed and another is induced by glucose

(Servinsky et al., 2010). There are also two systems for maltose metabolism. One involves MalP, which phosphorylates and transports maltose into cell, and MalH, which hydrolyzes maltose-6-P to glucose and glucose-6-P (Thompson et al., 2004). The second system involves two putative α-glucosidase genes, agluI (CAC2252) and agluII

(CAC2891), regulated by maltose regulator MalR (Novichkov et al., 2010). Both of these two systems are induced by maltose and starch, and repressed in the presence of glucose through catabolite repression, which could limit starch and maltose utilization by Cac 824 in the fermentation as observed in this study.

In the present study, we introduced the α-glucosidase genes (agluI, agluII) from Cac 114

824 into C. tyrobutyricum and enabled the latter to use maltose and soluble starch for butanol production at a higher rate than Cac 824. Aglu I and Aglu II, consisting of 1157 and 1217 amino acids, respectively, have been annotated based on their genomic sequences but have not been well characterized (Servinsky et al., 2010). This study not only demonstrated the high activity of these two enzymes for starch and maltose hydrolysis, but also, for the first time, confirmed that these two enzymes are indeed translocated outside the cell as predicted by the presence of secretion (signal) peptide sequences on their N-terminal (Bendtsen et al., 2004). The improved fermentation can be attributed to the fact that α-glucosidase is constitutively expressed in C. tyrobutyricum without subjecting to gene regulation or glucose repression. The engineered mutant strain

CT(Δack)-pGluI is also genetically stable and can thus be used for industrial production of n-butanol from low-cost starch and maltose, which is a preferred substrate (than glucose) because of more balanced growth resulting in higher butanol (and lower butyrate) production. Soluble starch is produced after treating starch with α-amylase, and is easier to use in fermentation than starch and cheaper than glucose. Maltose is abundant in most germinating grains, which has been widely used in the brewing industry (Boulton and

Quain, 2008). The abundance and the economics of germinating grains could provide an economic feedstock for direct maltose fermentation in future industrial production of biobutanol.

Since only cells with Aglu activity can survive in a medium containing maltose or soluble starch as the sole carbon source, aglu can be used as a marker for selecting the transformants coexpressing a target gene with aglu. This could provide an antibiotic-free cloning vector for future strain construction. Antibiotic resistance genes are usually used 115 for selection in cloning. However, the limitation in the available selective antibiotics has been an obstacle for cloning, especially for Clostridium (Al-Hinai et al., 2012; Heap et al.,

2009). Using antibiotics during culture growth and fermentation to maintain the recombinant plasmids would increase costs, impose additional stress on cell growth and metabolism, which could negatively impact the fermentation performance, and raise concerns on the release or exposure of antibiotics to the environment, especially in large-scale industrial fermentation. Furthermore, many bacteria could mutate spontaneously to become antibiotic resistant without carrying the antibiotic resistance gene in the recombinant plasmid, rendering the antibiotic selection ineffective. Although stable mutants can be developed by gene knock-in or integrated into chromosome, without requiring the cell to carry the plasmids, the available techniques are limited by the relatively low efficiency in transformation, gene integration, and gene expression

(Al-Hinai et al., 2012; Heap et al., 2007; Xu et al., 2015). Using the algu plasmid and a maltose auxotroph such as C. tyrobutyricum can provide a novel expression system with self-selection ability for stable clone maintenance and large-scale fermentation without antibiotics addition, as demonstrated in this study. It is thus desirable to further exploit the ability of using maltose for selectively culturing the transformant carrying the plasmid containing aglu gene as a useful tool for genetically engineering C. tyrobutyricum and other maltose auxotrophs incapable of hydrolyzing or uptaking maltose.

In conclusion, two α-glucosidases from C. acetobutylicum ATCC 824 were cloned and expressed in C. tyrobutyricum for butanol production from maltose and soluble starch.

The mutant expressing agluI and adhE2 showed multiple advantages in fermentation compared to C. tyrobutyricum expressing only adhE2 (using glucose) and C. 116 acetobutylicum ATCC 824 using maltose and soluble starch as substrate, including higher butanol titer, yield and productivity. The mutant strain is stable without antibiotics, and is thus a desirable candidate for use in future large-scale fermentation for n-butanol production from low-cost maltose and soluble starch.

4.5 Acknowledgements

This work was supported in part by the National Science Foundation STTR program

(IIP-1026648).

4.6 References

Al-Hinai MA, Fast AG, Papoutsakis ET (2012) Novel system for efficient isolation of Clostridium double-crossover allelic exchange mutants enabling markerless chromosomal gene deletions and DNA integration. Appl Environ Microbiol. 78:8112-21.

Albasheri KA and Mitchell WJ (1995) Identification of two α-glucosidase activities in Clostridium acetobutylicum NCIB 8052. J Appl Microbial. 78: 149-156

Annous BA, Blaschek HP (1990) Regulation and localization of amylolytic enzymes in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 56: 2559-2661

Annous BA, Blaschek HP (1991) Isolation and characterization of Clostridium acetobutylicum mutants with enhanced amylolytic activity. Appl Environ Microbiol. 57:2544-8

Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795.

Boulton C and Quain D (2006) Brewing yeast and fermentation. Wiley-Blackwell, New York, NY.

Chojecki A and Blaschek HP (1986) Effect of carbohydrate source on α-amylase and glucoamylase formation by Clostridium acetobutylicum SA-1. J. Industrial Microbiol. 1: 63-67

Diderichsen B and Christiansen L. (1988) Cloning of a maltogenic α-amylase from 117

Bacillus stearothermophilus. FEMS Microbiol. Lett. 56:53-60.

Du Y, Jiang W, Yu M, Tang IC, Yang ST (2015) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution and fermentation kinetics, Biotechnol Bioeng, DOI:10.1002/bit.25489.

Dwidar M, Park JY, Mitchell RJ, Sang BI (2012) The future of butyric acid in industry. Scientific World J. 2012: 471417.

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

Green EM (2011) Fermentative production of butanol–the industrial perspective. Curr Opin Biotechnol 22:337–343.

Gu Y, Jiang Y, Wu H, Liu X, Li Z, Li J, Xiao H, Shen Z, Dong H, Yang Y, Li Y, Jiang W, Yang S (2011) Economical challenges to microbial producers of butanol: Feedstock, butanol ratio and titer. Biotechnol J 6:1348-1357.

Heap JT, Pennington OJ, Cartman ST, Minton NP. (2009) A modular system for Clostridium shuttle plasmids. J Microbiol Methods. 78:79-85.

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The Clostron: A universal gene knock-out system for the genus Clostridium. J Microbiol Methods 70: 452-464.

Huang L, Forsberg CW, Gibbins LN (1986) Influence of external pH and fermentation products on Clostridium acetobutylicum intracellular pH and cellular distribution of fermentation products. Appl Environ Microbiol. 51: 1230–1234.

Jiang W, Zhao J, Wang Z, Yang ST (2014) Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations. Bioresour Technol 163:172-179.

Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev 50:484-524.

Kovács K, Willson BJ, Schwarz K, Heap JT, Jackson A, Bolam DN, Winzer K, Minton NP (2013) Secretion and assembly of functional mini-cellulosomes from synthetic chromosomal operons in Clostridium acetobutylicum ATCC 824. Biotechnol Biofuels 6: 117. 118

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: 209-228.

Liu X, Zhu Y, Yang ST (2005) Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC 25755 and mutants. Enz Microb Technol 38: 521-528.

Liu X, Zhu Y, Yang ST (2008) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog 22: 1265-1275.

Lütke-Eversloh T (2014) Application of new metabolic engineering tools for Clostridium acetobutylicum. Appl Microbiol Biotechnol 98:5823-5837.

Madihah MS, Ariff AB, Khalil MS, Suraini AA, Karim MI (2001) Anaerobic fermentation of gelatinized sago starch-derived sugars to acetone-1-butanol-ethanol solvent by Clostridium acetobutylicum. Folia Microbiol (Praha) 46:197-204.

Mariano AP, Dias MO, Junqueira TL, Cunha MP, Bonomi A, Filho RM (2013) Butanol production in a first-generation Brazilian sugarcane biorefinery: technical aspects and economics of greenfield projects. Bioresour Technol. 135:316-323.

McMahon H, Zoecklein BW, Fugelsang K, Jasinski Y (1999) Quantification of glycosidase activities in selected yeasts and lactic acid bacteria. J Ind Microbiol Biotechnol. 23: 198-203

Ni Y and Sun Z (2009) Recent progress on industrial fermentative production of acetone-butanol-ethanol by Clostridium acetobutylicum in China. Appl Microbiol Biotechnol. 83:415-23.

Nicolaou SA, Gaida SM, Papoutsakis ET (2010) A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: from biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng 12:307–331.

Novichkov PS, Laikova ON, Novichkova ES, Gelfand MS, Arkin AP, Dubchak I, Rodionov DA (2010) RegPrecise: a database of curated genomic inferences of transcriptional regulatory interactions in prokaryotes. Nucleic Acids Res 38:D111-D118.

Papoutsakis ET (2008) Engineering solventogenic clostridia. Curr Opin Biotechnol 19: 420-429.

Paquet V, Croux C, Goma G, Soucaille P (1991) Purification and characterization of the extracellular α-amylase from Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 57: 212–218.

119

Qureshi N and Blaschek HP (2001) ABE production from corn: a recent economic evaluation. J Ind Microbiol Biotechnol. 27:292-297.

Servinsky MD, Kiel JT, Dupuy NF, Sund CJ (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiology. 156:3478-91.

Soni BK, Kapp C, Goma G, Soucaille P (1992) Solvent production from starch: effect of pH on α-amylase and glucoamylase localization and synthesis in synthetic medium. Appl Microbiol Biotechnol. 37: 539-534

Tangney M, Winters GT, Mitchell WJ (2001) Characterization of a maltose transport system in Clostridium acetobutylicum ATCC 824. J Ind Microbiol Biotechnol 27:298-306.

Thompson J, Hess S, Pikis A (2004) Genes malh and pagl of Clostridium acetobutylicum ATCC 824 encode NAD+- and Mn2+-dependent phospho- -glucosidase(s). J Biol Chem 279:1553–1561.

Wang J, Yang X, Chen CC, Yang ST (2014) Engineering clostridia for butanol production from biorenewable resources: from cells to process integration, Curr Opin Chem Eng 6:43–54.

Williams DR, Young DI, Young M (1990) Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. Microbiology 136: 819-826.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production, Appl Microbiol Biotechnol 99:1011–1022.

Xue C, Zhao X-Q, Liu CG, Chen L-J, Bai F-W (2013) Prospective and development of butanol as an advanced biofuel. Biotechnol Adv 31:1575-1584.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol.93:881-9.

Zhao J, Lu C, Chen CC, Yang ST (2013) Biological production of butanol and higher alcohols, in Yang ST, El-Enshasy HA, Thongchul N. (eds.) Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Ch. 13, pp. 235-261. 120

Zheng Y, Li L, Xian M, Ma Y, Yang J, Xu X, He D (2009) Problems with the microbial production of butanol. J Ind Microbiol Biotechnol 36: 1127-1138.

Zhu Y, Yang ST (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Prog 19: 365-372.

121

Table 4.1 Bacterial strains and plasmids used in this study Strain/Plasmid Characteristics Reference / Source Strains E. coli DH5α Host cells for plasmids amplification Invitrogen E. coli CA434 Donor cells in conjugation transformation Williams et al., 1990 Cac 824 C. acetobutylicum ATCC 824 ATCC Ct(Δack) C. tyrobutyricum ATCC 25755 with ack knockout Liu et al., 2008 Ct(Δack)-pM2 adhE2 overexpression in Ct(Δack) Yu et al., 2012 Ct(Δack)-pGluI adhE2 and agluI overexpression in Ct(Δack) This study Ct(Δack)-pGluII adhE2 and agluII overexpression in Ct(Δack) This study Plasmids pMTL82151 ColE1 ori; Cmr; pBP1 ori, TraJ Heap et al., 2009 pM2 pMTL82151; P-thl adhE2 Yu et al., 2012 pGluI pMTL82151; P-thl adhE2 agluI This study pGluII pMTL82151; P-thl adhE2 agluII This study Primers Sequence (5’-3’) TTTGCTTCATTATCC AGGAGG AgluI-for GTAAAATATAATGTATAATAGTTCAAAAACACG AgluI-rev GAAACAGCTATGACC TAAATAATTCTATAAAACCACAAGAAATC TTTGCTTCATTATCC AGGAGG AgluII-for ACTACCACATAGGTTTGAGAAGTTTA AgluII-rev GAAACAGCTATGACC ATTAACATATTTTGGGTGTATGTTTGA

122

Table 4.2 α-Glucosidase activities in cell extract (intracellularly), associated with cells (exported to cell membrane), and in supernatant (secreted extracellularly) at different pHs. Cell extract Whole cell Supernatant Strains pH (nmol PNP/ml/min) (nmol PNP/ml/min) (nmol PNP/ml/min) 5.0 NA 48.0 ± 1.1 NA 5.5 0.023 ± 0.003 32.7 ± 2.1 0.22 ± 0.01 Ct(Δack)-pGluI 6.0 NA 14.1± 0.9 NA 6.5 NA 7.4 ± 1.0 NA Ct(Δack)-pGluII 5.5 0.013 ± 0.007 20.5 ± 2.0 0.10 ± 0.04 Ct(Δack)-pM2 5.5 0.0010 ± 0.0003 0.06 ± 0.02 0.002 ± 0.001 Data shown are mean ± s.d. (n = 3). NA: data not available.

Table 4.3 α-Glucosidase activities of C. tyrobutyricum Ct(Δack)-pGluI and C. acetobutylicum ATCC 824 pregrown on glucose, maltose, and glucose/maltose mixture at pH 5.5. Preculture Cell extract Whole cell Supernatant Strains carbon source (nmol PNP/ml/min) (nmol PNP/ml/min) (nmol PNP/ml/min) Glucose 0.023 ± 0.003 32.7 ± 2.1 0.22 ± 0.01 Glucose/ Ct(Δack)-pGluI NA 28.9 ± 0.9 NA Maltose Maltose NA 34.8 ± 0.5 NA

Glucose 0.017 ± 0.001 3.2 ± 0.4 ND Glucose/ Cac ATCC 824 2.3 ± 0.3 14.4 ± 1.3 0.003 ± 0.000 Maltose Maltose 6.1 ± 0.5 29.3 ± 1.1 0.28 ± 0.09 Data shown are mean ± s.d. (n = 3). NA: data not available. ND: activity not detected.

123

Table 4.4 Fermentation kinetics of C. tyrobutyricum and C. acetobutylicum grown on maltose and starch Specific Butanol Butyrate Acetate Ethanol Acetone Strain Sugar pH Growth -1 Titer Yield Productivity (g/L) (g/L) (g/L) (g/L) rate (h ) (g/L) (g/g) (g/L·h) Ct(Δack)-pM2 Glucose 6.0 0.20±0.02 9.5±0.4 0.10±0.01 0.16±0.01 22.5±0.8 9.0±0.4 2.1±0.4 - Cac 824 Maltose 5.0 0.08±0.00 11.2±0.5 0.20±0.02 0.10±0.02 2.5±0.3 3.0±0.3 1.7±0.7 8.8±0.5 Starch 5.0 0.10±0.01 8.8±0.2 0.14±0.02 0.10±0.03 2.1±0.6 2.6±0.7 2.2±0.9 6.0±1.1 Ct(Δack)-pGluII Maltose 5.8 0.08±0.01 11.2±0.3 0.11±0.01 0.17±0.01 5.6±0.3 2.7±0.2 2.0±0.2 - Starch 5.8 0.04±0.01 13.4±0.5 0.14±0.01 0.13±0.01 11.7±1.0 7.5±0.8 2.6±0.6 - Ct(Δack)-pGluI Maltose 5.8 0.12±0.03 17.2±0.2 0.20±0.02 0.29±0.01 8.3±0.9 3.3±0.8 2.5±0.7 -

12

4 5.5 0.11±0.01 12.0±0.3 0.11±0.01 0.19±0.01 18.2±1.0 4.8±0.1 1.7±0.5 -

5.0 0.15±0.01 6.5±0.3 0.07±0.01 0.11±0.01 15.7±0.9 5.7±1.0 1.3±0.3 - Starch 5.8 0.06±0.01 16.2±0.2 0.17±0.02 0.20±0.01 9.5±1.2 4.5±0.3 2.7±0.2 - Ct(Δack)-pGluI Maltose 5.8 0.19±0.01 17.3±0.3 0.17±0.01 0.40±0.01 13.1±0.1 3.0±0.3 2.6±0.8 - no antibiotics Data shown are mean ± s.d. (n = 2).

Figure 4.1 Effects of pH on cell growth (OD), maltose consumption, and butyrate, acetate, ethanol and butanol production in batch fermentations by C. tyrobutyricum Ct(Δack)-pGluI with pH controlled at 5.0 (circle), 5.5 (square), and 5.8 (triangle). The fermentation kinetics was studied with the medium containing 30 μg/ml thiamphenicol.

125

Figure 4.2 Kinetics of batch fermentations of maltose by C. tyrobutyricum Ct(Δack)-pGluI (A) and Ct(Δack)-pGluII (B) at pH 5.8 and C. acetobutylicum ATCC 824 (C) at pH 5.0. For Ct(Δack)-pGluI and Ct(Δack)-pGluII, the fermentation was studied with the medium containing 30 μg/ml thiamphenicol. 126

Figure 4.3 Kinetics of batch fermentations of soluble starch by C. tyrobutyricum Ct(Δack)-pGluI (A) and Ct(Δack)-pGluII (B) at pH 5.8 and C. acetobutylicum ATCC 824 (C) at pH 5.0. For Ct(Δack)-pGluI and Ct(Δack)-pGluII, the fermentation was studied with the medium containing 30 μg/ml thiamphenicol.

127

Figure 4.4 Batch fermentation kinetics of C. tyrobutyricum Ct(Δack)-pGluI at pH 5.8 with maltose as carbon source in the absence of thiamphenicol.

128

Chapter 5: Metabolic engineering of Clostridium tyrobutyricum for n-butanol

production through co-utilization of glucose and xylose

Abstract

The glucose-mediated carbon catabolite repression (CCR) in C. tyrobutyricum impedes efficient utilization of xylose present in lignocellulosic biomass hydrolysates. In order to relieve the CCR and enhance xylose utilization, three genes (xylT, xylA, and xylB) encoding a xylose proton-symporter, a xylose isomerase and a xylulokinase, respectively, from C. acetobutylicum ATCC 824 were co-overexpressed with aldehyde/alcohol dehydrogenase (adhE2) in C. tyrobutyricum (Δack,). Compared to the strain

Ct(Δack)-pM2 expressing only adhE2, the mutant Ct(Δack)-pTBA had a higher xylose uptake rate and was able to simultaneously consume glucose and xylose at comparable rates for butanol production. Ct(Δack)-pTBA produced more butanol (12.0 vs. 3.2 g/L) with a higher butanol yield (0.12 vs. 0.07 g/g) and productivity (0.17 vs. 0.07 g/L·h) from both glucose and xylose, while Ct(Δack)-pM2 consumed little xylose in the fermentation.

The results confirmed that the CCR in C. tyrobutyricum could be overcome through overexpressing xylT, xylA, and xylB. The mutant was also able to co-utilize glucose and xylose present in soybean hull hydrolysate (SHH) for butanol production, achieving a high butanol titer of 15.7 g/L, butanol yield of 0.24 g/g and productivity of 0.29 g/L·h.

This study demonstrated the potential application of Ct(Δack)-pTBA for industrial 129 biobutanol production from lignocellulosic biomass.

5.1 Introduction

Biological production of n-butanol, an important industrial solvent and potentially an advanced biofuel, from lignocellulosic biomass in acetone-butanol-ethanol (ABE) fermentation by solvent-producing Clostridium acetobutylicum and Clostridium beijerinckii has drawn increasing attentions in recent years (Green, 2011; Jang et al., 2012;

Wang et al., 2014). However, conventional ABE fermentation with the biphasic metabolic shift from acidogenesis to solventogenesis is difficult to control and is prone to “acid crash” due to the complex metabolic regulation in solventogenic Clostridium (Zhao et al.,

2013; Xu et al., 2015). Recently, we have engineered Clostridium tyrobutyricum, an acidogen natively producing acetate and butyrate as two major fermentation products from glucose and xylose (Liu et al., 2006), to produce n-butanol by overexpressing adhE2 encoding a bifunctional aldehyde/alcohol dehydrogenase (Yu et al., 2011). The engineered strain C. tyrobutyricum (Δack, adhE2) produced butanol, along with butyrate and acetate, throughout the fermentation. Besides being stable without subjecting to biphasic metabolic shift, higher butanol tolerance and lack of acetone-synthetic pathway in C. tyrobutyricum are also beneficial to butanol biosynthesis and downstream purification (Yu et al., 2012). Furthermore, butanol became the main fermentation product by C. tyrobutyricum (Δack, adhE2) in the presence of methyl viologen (MV), an artificial electron carrier, which increased NADH availability and resulted in a high butanol titer and yield (Du et al., 2015).

Lignocellulosic biomass is the most abundant renewable resource, and its utilization as the fermentation substrate is a key to economically viable biobutanol 130 production (Kumar et al., 2013). However, a major problem of fermenting lignocellulosic biomass hydrolysates by most of clostridia, including C. acetobutylicum, C. beijerinckii and C. tyrobutyricum, is the inefficient co-utilization of glucose and xylose, the two major sugars present in lignocellulose. Although these clostridia can use xylose as the sole carbon source, negligible or limited amount of xylose was consumed in the presence of glucose, leading to incomplete substrate utilization and low solvent production

(Ounine et al., 1985; Xiao et al., 2012). The inhibited xylose metabolism is caused by the glucose-mediated carbon catabolite repression (CCR), a common phenomenon observed in many microbes (Aristidou and Penttila, 2000; Görke and Stülke, 2008; Yao and

Shimizu, 2013). Various efforts have been made to overcome the CCR in C. acetobutylicum (Gu et al., 2009; Hu et al., 2011; Jin et al., 2014; Ren et al., 2010; Xiao et al., 2011). It has been suggested that the inherent rate-limiting steps of xylose utilization in Clostridium occur in the metabolic pathway prior to the pentose phosphate pathway

(PPP) due to lack of an efficient xylose transport system as well as strong effects of glucose repression on these metabolic reactions (Grimmler et al., 2010; Gu et al., 2010;

Xiao et al., 2011; 2012).

In this work, we studied the feasibility of engineering C. tyrobutyricum to simultaneously and efficiently use a mixture of glucose and xylose for n-butanol production. Although the draft genome of C. tyrobutyricum ATCC 25755 contains genes encoding a sugar:proton symporter with a high amino acid identity with the xylose symporter (xylT) from C. acetobutylicum ATCC 824, and putative xylose isomerase and xylulokinase, these genes have not been experimentally verified and may also be subjected to glucose CCR. We thus speculated that the bottleneck in xylose utilization, 131 such as xylose transport, isomerization, and xylulose phosphorylation, as indicated in previous studies of solventogenic Clostridium (Gu et al., 2010; Xiao et al., 2011; 2012), also exists in C. tyrobutyricum. According to the genomic annotations of C. tyrobutyricum ATCC 25755, the C. tyrobutyricum genome contains no xylose transporter, and one copy of putative xylose isomerase and xylulokinase, both of which have not yet been experimentally verified. Therefore, to facilitate xylose transport and metabolism in

C. tyrobutyricum, three genes, encoding a xylose proton-symporter (xylT, CAC1345), a xylose isomerase (xylA, CAC2610), and a xylulokinase (xylB, CAC2612), respectively, from C. acetobutylicum ATCC 824 were constitutively co-expressed with adhE2 in C. tyrobutyricum (Δack). Co-utilization of glucose and xylose with significantly reduced residual xylose was achieved in the mutant Ct(Δack)-pTBA, resulting in greatly enhanced butanol production. The co-fermentation of glucose and xylose showed comparable cell growth and butanol production with all xylose efficiently consumed at all glucose-to-xylose ratios studied, confirming that the CCR bottleneck in the fermentation of glucose-xylose mixture by C. tyrobutyricum could be effectively alleviated by enhancing the xylose metabolic pathway. Finally, efficient utilization of glucose and xylose present in soybean hull hydrolysate (SHH) by the mutant was demonstrated.

5.2 Materials and methods

5.2.1 Bacterial strains, plasmids, and culture media

The bacterial strains and recombinant plasmids used in this study are listed in Table

5.1. C. tyrobutyricum ATCC 25755 with ack knockout (Liu et al., 2006) and all mutant strains derived from it were cultured in Clostridial Growth Medium (CGM) containing 4 132 g/L Tryptone, 2 g/L yeast extract, 1 g/L K2HPO4∙3H2O, 0.5 g/L KH2PO4, 2 g/L

(NH4)2SO4, 0.1 g/L MgSO4∙7H2O, trace minerals (Zhu and Yang, 2003), and glucose or xylose as carbon source, unless otherwise noted, at 37 °C under anaerobic conditions. E. coli strains used in this study were grown aerobically at 37 °C in Luria-Bertani (LB) medium or on LB agar plates. All media were autoclaved at 121 oC for 30 min, and supplemented with appropriate antibiotics (25 μg/ml chloramphenicol, 45 μg/ml thiamphenicol, or 250 μg/ml cycloserine) after autoclaving.

5.2.2 Plasmids construction

The plasmid pTBA (see Appendix D) was constructed from pMTL82151-adhE2

(pM2) (Yu et al., 2011) by sequentially inserting xylT (CAC1345), xylB (CAC2612), and xylA (CAC2610), which were amplified from C. acetobutylicum ATCC 824 genomic

DNA by PCR using the primers shown in Table 5.1, after adhE2 at the SacII cutting site using the Clontech infusion cloning kit (Clontech Laboratories, Inc., Mountain View, CA).

The constitutive co-expressions of the four genes were driven by the native thiolase (thl) promoter from C. tyrobutyricum (Yu et al., 2011), and the original ribosome binding site of each gene was replaced with the consensus sequence “AGGAGG” to optimize the expression.

5.2.3 Transformation

The plasmid pTBA was transformed into C. tyrobutyricum (Δack) by conjugation

(Yu et al. 2012). E. coli CA434 carrying the plasmids to be transformed were cultivated in LB medium containing 25 μg/ml chloramphenicol at 37°C overnight to reach OD600 of 133

1.52.0. The donor cells were collected by centrifugation at 4,000×g for 2 min, washed once using 1 ml sterile phosphate-buffered saline (PBS), mixed with 200 μl of C. tyrobutyricum cells precultured at 37 °C overnight, and the mixture was pipetted onto

CGM agar plates. After incubating in an anaerobic chamber at 37 °C for 812 h, cells were collected and re-suspended in 1 ml of PBS and spread onto CGM plates containing

45 μg/ml thiamphenicol and 250 μg/ml cycloserine. The plates were incubated for 23 days to obtain colonies, and positive transformants, which were confirmed by colony

PCR screening and plasmid extraction, were selected and stored at -80 °C.

5.2.4 Hydrolysis of soybean hull and detoxification

Soybean hull, obtained from Minnesota Soybean Processors, was hydrolyzed to release glucose and xylose by dilute acid pretreatment and enzymatic hydrolysis according to a previously optimized method (Dong et al., 2014). Briefly, 100 g soybean hull particles were suspended in 1 L of 0.04 N HCl solution, followed by autoclaving at

121 °C, 15 psig for 30 min. The solution was then adjusted to pH 5.0 using sodium hydroxide and treated with 3.0 g Cellic CTec2 (containing cellulases, β-glucosidases, and hemicullulase; Novozymes North America, Inc., Franklinton, NC) for 72 h at 50 °C. After removing the undissolved solids by centrifugation at 7000 rpm for 15 min, the hydrolysate was concentrated three times by vacuum rotary evaporation at 60 °C. The concentrated hydrolysate was then adjusted to pH 2.0 with HCl and detoxified with 2%

(w/w) activated carbons at 80 °C in a water bath for 60 min. After removing activated carbons by centrifugation, the soybean hull hydrolysate (SHH), containing ~45 g/L

134 glucose and ~20 g/L xylose, was adjusted to pH 6.5 with sodium hydroxide and stored at

4 °C. Before use in batch fermentation kinetics studies, SHH was supplemented with additional xylose to bring the glucose/xylose ratio to ~1.0 and the total sugar concentration to ~90 g/L in the fermentation medium so that butanol production would not be limited by the availability of sugar.

5.2.5 Fermentation kinetics

Batch fermentation kinetics was studied in serum bottles containing 50 ml CGM and

1-L stirred-tank bioreactor containing 600 ml of CGM or SHH. The bioreactor was autoclaved at 121 oC for 30 min and then sparged with nitrogen for ~30 min to reach anaerobiosis, while the serum bottles were sparged with nitrogen first before autoclaving.

An overnight culture was used to inoculate the reactor at a volume ratio of 5%.

Thiamphenicol (45 μg/ml) was also added at the time of inoculation to ensure plasmid stability during the fermentation. The pH in the bioreactor was controlled at 6.0 with 40% ammonium hydroxide and samples were collected twice a day at regular intervals. For fermentation in serum bottles, samples (~1 ml each) were taken daily, with pH adjusted manually to 6.36.5 by adding 10% sodium hydroxide drop by drop with a syringe and gas released to avoid pressure build-up. All fermentations were repeated at least once and representative data with averages and standard errors are reported.

5.2.6 Analytical methods

Cell growth was monitored by measuring the optical density at 600 nm (OD600) with a spectrophotometer (UV-16-1, Shimadzu, Columbia, MD). Glucose and xylose were 135 analyzed using a high performance liquid chromatograph (HPLC) equipped with an organic acid analysis column (Bio-Rad HPX-87H) and a refractive index detector

(Shimadzu RID-10A) at 45 °C (Yu et al., 2011). Acetone, butanol, ethanol, acetate and butyrate were determined with a gas chromatograph (GC, Shimadzu GC-2014) equipped with a flame ionization detector and a 30 m fused silica column (0.25 m film thickness and 0.25 mm ID, Stabilwax-DA) following the method described elsewhere (Jiang et al.,

2014).

5.2.7 Statistical analysis

Unless otherwise noted, batch fermentation for each condition was repeated once, and product concentrations, yields and productivities are reported as average with standard errors. Student’s t-test analysis was performed using JMP software with the significance level α = 0.05.

5.3 Results

5.3.1 Comparison of Ct(Δack)-pTBA and Ct(Δack)-pM2 in xylose utilization

Xylose metabolism in C. tyrobutyricum Ct(Δack)-pTBA overexpressing the three genes, xylT, xylB and xylA, responsible for xylose metabolism in C. acetobutylicum

ATCC 824 was first evaluated and compared with Ct(Δack)-pM2 in batch fermentations using xylose as the sole carbon source. As shown in Figure 5.1, Ct(Δack)-pTBA had a longer lag phase (~24 h vs. ~10 h for the control), probably the result of the extra metabolic burden in overexpressing xylTBA, but a higher xylose consumption rate (2.6 g/L·h vs. 1.7 g/L·h) in the exponential phase, apparently because of the overexpression of 136 xylTBA. However, both strains had similar specific growth rate and butanol production, with butanol titer, yield and productivity reaching 8.6 g/L, 0.09 g/g and 0.14 g/L·h, respectively.

5.3.2 Improved co-utilization of glucose and xylose by Ct(Δack)-pTBA

To evaluate the performance of xylose catabolism in the presence of glucose, batch fermentations of glucose and xylose mixture at pH 6.0 were carried out for

Ct(Δack)-pTBA and Ct(Δack)-pM2, and the results are shown in Figure 5.2 and Table

5.2. As expected, glucose and xylose were co-utilized by the mutant in the log phase, at comparable rates of 1.03 g/L·h for glucose and 1.05 g/L·h for xylose. In contrast, the control strain could uptake glucose at a higher rate (1.85 g/L·h) but with negligible xylose consumption even after the depletion of glucose. Clearly, the control strain was subjected to catabolic repression in xylose metabolism. It should be noted that the mutant showed a slight delay in using xylose, compared to its utilization of glucose, which might be caused by the extra metabolic burden from the xylTBA overexpression as mentioned before. The delayed utilization of xylose was a common phenomenon also observed in other studies (Gu et al., 2009; Ren et al., 2010; Xiao et al., 2011), suggesting that the initial steps in xylose catabolism (such as xylose transport) might be crucial in glucose-mediated CCR. Overall, xylose utilization by the mutant was greatly improved with a total consumption of 87.3% of xylose, whereas only limited amount of xylose

(10.6%) was consumed by the control, which occurred after glucose was nearly depleted.

Finally, butanol and ethanol production by the mutant increased to 12.0 g/L and 3.6 g/L, an improvement of 275% and 164%, respectively. Meanwhile, a higher butanol yield and 137 productivity (0.12 g/g vs. 0.07 g/g, and 0.17 g/L·h vs. 0.07 g/L·h, respectively) were also obtained.

5.3.3 Xylose utilization by Ct(Δack)-pTBA in media with varying glucose-to-xylose ratios

In order to demonstrate the capability of Ct(Δack)-pTBA in glucose and xylose co-catabolism at different xylose concentrations, fermentations with different glucose-to-xylose ratios (3:1, 2:1, 1:1 and 1:2) were studied in serum bottles, and the results are shown in Figure 5.3 and Table 5.3. In general, co-utilization of glucose and xylose was observed at all tested ratios, all of which also gave similar specific growth rates and butanol and acid production. However, as the ratio of xylose increased, xylose uptake rate also increased from 0.14 g/L·h to 0.45 g/L·h, suggesting that the xylose consumption rate was closely related to the level of xylose. This phenomenon was also observed in previous studies with solventogenic Clostridium (Ren et al., 2010; Xin et al.,

2014). Since xylose uptake by the xylose-proton symporter is a facilitated diffusion process driven by an electrochemical gradient (Cook et al., 2006), xylose transport rate would depend on not only the expression level of the xylose symporter, but also the extracellular xylose concentration. On the contrary, the glucose uptake rate exhibited only a slight decrease as the ratio of glucose decreased, suggesting that ATP-dependent glucose transport systems might exist in C. tyrobutyricum, which could transport glucose without being affected by its extracellular level. Nevertheless, the data confirmed that the ability of active co-catabolism of glucose and xylose can be obtained even at a low extracellular xylose level, which has also been reported for two other Clostridium strains 138

(Ren et al., 2010; Xin et al., 2014).

5.3.4 Fermentation of glucose and xylose in soybean hull hydrolysate

Figure 5.4 shows batch fermentation kinetics with SSH as substrate by

Ct(Δack)-pTBA and Ct(Δack)- pM2, and the fermentation performances are also summarized in Table 5.2. Similar to the fermentations with CGM, co-utilization of glucose and xylose, at the uptake rate of 1.20 g/L·h and 1.21 g/L·h, respectively, in SHH was observed for the mutant during the exponential phase, and 92.7% of xylose in the medium was consumed, whereas only 17.8% of xylose was consumed by the control.

Consequently, the mutant produced much more butanol compared to the control since both sugars were used in the fermentation. Finally, 8.1 g/L of butanol was produced with the butanol yield of 0.10 g/g by the mutant. Meanwhile, more acids (~29 g/L) were also produced by the mutant, compared to ~16 g/L by the control.

To decrease acids production and direct more metabolic flux towards butanol biosynthesis, 500 M methyl viologen (MV) was added at the beginning of the fermentation. With MV, butanol production increased to 15.7 g/L, while butyrate and acetate production decreased greatly to 5.8 g/L and 2.0 g/L, respectively. The decline in acids production also contributed to improved butanol yield (0.24 g/g) and productivity

(0.29 g/L·h). MV, as an artificial electron carrier, directed the electron towards NADH synthesis, instead of hydrogen production, and thus favored butanol biosynthesis, which required NADH (Du et al., 2015). However, the addition of MV showed a negative effect on cell growth and xylose utilization, causing incomplete xylose consumption (65.2%) and decreased xylose uptake rate (0.76 g/L·h), probably because the expression and 139 activities of XylABT were compromised by the reduced ATP as a result of less acids production. A previous study with glucose or xylose as the sole carbon source also showed that MV inhibited cell growth, decreased sugar uptake, and caused incomplete sugar consumption in the fermentation by Ct(Δack)-pM2 (Du, 2013). Compared to glucose, the negative effect of MV on xylose utilization was more severe because less

ATP is generated in xylose metabolism.The higher butanol concentration might have also negatively affected xylose transport. Nevertheless, the production of 15.7 g/L butanol from SHH by the mutant was much higher than those previously obtained with C. acetobutylicum (7.6 g/L) and C. beijerinckii (10.0 g/L) (Dong et al., 2014).

It should be noted that similar performances of the glucose-xylose co-fermentation were obtained with CGM and SHH. One major obstacle in using lignocellulosic biomass in ABE fermentation is the presence of inhibitors generated from the pretreatment of lignocellulosic biomass, which would impair cell activity and solvent production (Baral and Shah, 2014). However, the SHH hydrolysate inhibitors did not seem to have much of an effect on C. tyrobutyricum. The efficient utilization of soybean hull hydrolysate as substrate by C. tyrobutyricum further demonstrated its potential application for biobutanol production from lignocellulosic biomass.

5.4 Discussion

In recent years, extensive studies have focused on ABE fermentation for butanol production from lignocellulosic biomass, including barley straw, corn stover, corn fiber, soybean hull, cassava bagasse, wheat bran, wheat straw, and wood pulp (Guo et al., 2013;

Liu et al., 2010; Lu et al., 2012; 2013; Qureshi et al., 2008; 2010a; 2010b; Wang and 140

Chen, 2011). Almost all of the previous studies have indicated the difficulty or slowness in the utilization of xylose present in lignocellulosic biomass hydrolysates, suggesting that the CCR for xylose catabolism is widely present in the ABE fermentation of lignocellulose. How to overcome the glucose-induced catabolic repression causing inefficient utilization of xylose and other sugars present in the biomass is a major challenge in using lignocellulose for biobutanol production. Although numerous attempts have been made in C. acetobutylicum and C. beijerinckii to improve the strains’ ability in xylose catabolism, results to date are still far from ideal, especially with respect to simultaneous utilization of glucose and xylose.

CCR occurs when a preferred sugar (glucose in this study) is present in the medium, which negatively affects the metabolism of other sugars (xylose) through the repression mainly at the transcriptional level. Many efforts have been made to relieve the catabolite repression and to realize co-utilization of glucose and xylose in solventogenic

Clostridium. According to a previous study, disruption of the catabolite control protein A

(CcpA), which is the global transcriptional regulator in CCR (Lorca et al., 2005; Moreno et al., 2004), in C. acetobutylicum improved xylose metabolism and butanol titer to ~12 g/L. However, the disruption of CcpA also caused an unexpected change in other metabolic activities, such as impaired expression of CoA transferase and glycolytic genes, which were undesirable (Ren et al., 2010). Although inserting a mutated ccpAV302N into the chromosome of CcpA-disrupted C. acetobutylicum mutant improved glucose and xylose co-utilization, it led to much slower glucose consumption and solvents production

(Wu et al., 2015). The disruption of xylR showed improved utilization of xylose; however, the effects of xylR knock-out on butanol production were different: the final butanol titer 141 was not improved in the C. acetobutylicum mutant, whereas significant improvement to

11.4 g/L was achieved in the C. beijerinckii mutant (Hu et al., 2011; Xiao et al., 2012). It is speculated that the transcriptional repressor XylR in xylose catabolism may also exist in C. tyrobutyricum; however, with incomplete genomic sequence and annotations, such regulators have not yet been identified or characterized. It is also well known that the glucose phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS) plays an important role in the induction of CCR (Tangney and Mitchell, 2007). However, the disruption of the gene (glcG) encoding an enzyme II in the glucose PTS in C. acetobutylicum did not significantly improve the situation of incomplete xylose consumption and a large amount of residual xylose still remained unused in the fermentation, suggesting that the subdued glucose PTS might not be sufficient to completely eliminate the CCR in C. acetobutylicum (Xiao et al., 2011).

In order to identify the rate-limiting steps in xylose catabolism, the effect of overexpressing genes involved in the pentose phosphate pathway (PPP) has also been investigated (Jin et al., 2014; Gu et al., 2009). However, the improvement in xylose utilization was limited and no evidence on glucose and xylose co-utilization was provided.

This indicated that the PPP might not be a major barrier in xylose catabolism. For xylose transport and metabolism before the PPP, two operons (CAC1344-1349 and

CAC2610-2612) were identified in C. acetobutylicum, including one xylose symporter

(CAC1345), one xylose isomerase (CAC1346), one L-fucose isomerase (CAC2610, putative xylose isomerase, xylA), and two xylulokinases (xylB, CAC1344 and 2612)

(Grimmler et al., 2010). Putative catabolite responsive element (CRE) sequences and xylose regulator (XylR) binding sites were identified in these two operons (Rodionov et 142 al., 2001) and the transcriptional analysis indicated that multiple genes within the operons were subjected to catabolic repression, except for xylA (CAC2610) and xylB (CAC2612), which have been proven to be indispensible in xylose catabolism by comparative genomics analysis (Grimmler et al., 2010; Gu et al., 2010). The importance of these two enzymes in xylose catabolism was also confirmed in a novel Clostridium strain BOH3 with much higher xylose isomerase and xylulokinase activities, which might contribute to its exceptional capability of co-utilizing glucose and xylose, as compared to other solventogenic Clostridium (Xin et al., 2014).

Previous studies have identified the putative rate-limiting steps in xylose catabolism in C. acetobutylicum, including the transport and isomerization of xylose, and the phosphorylation of xylulose into xylulose-5-phosphate (Xiao et al., 2011; 2012). These steps were catabolite repressed mainly at the transcriptional level, and were also inherently inefficient (Grimmler et al., 2010; Xiao et al., 2011). Separate overexpression of each one of the rate-limiting enzymes, including CAC1345, CAC2610, and CAC2612, all led to enhanced catabolism of xylose in glucose and xylose co-fermentation, and the combined overexpression of these three genes gave the optimal xylose utilization.

However, in the study most of xylose was consumed only after glucose had been depleted, compromising the fermentation efficiency.

To overcome the bottleneck of the CCR in C. tyrobutyricum, CAC1345, CAC2612, and CAC2610 (xylTBA) were co-expressed under the constitutive promoter thl in this study. As shown in the fermentation results, the heterologous expression of these genes facilitated efficient and complete co-utilization of glucose and xylose, at comparable rates, without the disruption of the glucose PTS or other regulators such as CcpA and XylR. 143

This study thus provides evidence that an improved xylose transport, isomerization, and phosphorylation process could accelerate xylose uptake and co-utilization with glucose without the negative effect of CCR in C. tyrobutyricum.

In conclusion, Three genes, xylT, xylA, and xylB, catalyzing the transport of xylose and the first two metabolic steps before the pentose phosphate pathway from C. acetobutylicum were co-overexpressed in C. tyrobutyricum, resulting in alleviated catabolite repression, efficient simultaneous consumption of glucose and xylose, and significantly enhanced butanol production, confirming the essential roles of xylT, xylA, and xylB in xylose metabolism. The fermentation kinetics with different glucose-to-xylose ratios demonstrated that efficient xylose consumption could be achieved even at low xylose levels. The fermentation of soybean hull hydrolysate by the mutant further confirmed its capability of utilizing cheap and abundant lignocellulosic biomass as feedstock. The results from this study provide valuable information in better understanding xylose metabolic pathways and glucose-mediated catabolite repression of

C. tyrobutyricum, and the multiple advantages of the mutant demonstrate its potential for large-scale and cost-effective industrial biobutanol production.

5.5 Acknowledgements

This work was supported in part by the National Science Foundation STTR program

(IIP-1026648).

5.6 References

Aristidou A, Penttila M (2000) Metabolic engineering applications to renewable resource 144 utilization. Curr Opin Biotechnol 11: 187-198.

Baral NR, Shah A (2014) Microbial inhibitors: formation and effects on acetone-butanol-ethanol fermentation of lignocellulosic biomass. Appl Microbiol Biotechnol 98: 9151-72.

Cook GM, Janssen PH, Morgan HW (2006) Simultaneous uptake and utilization of glucose and xylose by Clostridium thermohydrosulfuricum. FEMS Microbiol Letters. 109: 55-61.

Dong J (2014) Butanol production from lignocellulosic biomass and agriculture residues by Acetone-Butanol-Ethanol fermentation. Ph.D. Dissertation, The Ohio State University, Columbus, Ohio

Dong J, Du YM, Zhou YP, Yang ST (2014) Butanol production from soybean hull and soy molasses by Acetone-Butanol-Ethanol fermentation. Soy-Based Chemicals and Materials, Chapter 2, pp 25–41. 2014 American Chemical Society.

Du Y (2013) High-yield and high-titer n-butanol production from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum, Ph.D. Dissertation, The Ohio State University, Columbus, Ohio.

Du YM, Jiang WY, Yu MR, Tang IC, Yang ST (2015) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol. Bioeng. 112: 705–715.

Görke B, Stülke J (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol 6: 613-24.

Green EM (2011) Fermentative production of butanol–the industrial perspective. Curr Opin Biotechnol 22: 337–343

Grimmler C, Held C, Liebl W, Ehrenreich A (2010) Transcriptional analysis of catabolite repression in Clostridium acetobutylicum growing on mixtures of D-glucose and D-xylose. J Biotechnol 150:315-23.

Gu Y, Ding Y, Ren C, Sun Z, Rodionov DA, Zhang W, Yang S, Yang C, Jiang W. (2010) Reconstruction of xylose utilization pathway and regulons in Firmicutes. BMC Genomics 11: 255.

Gu Y, Li J, Zhang L, Chen J, Niu L, Yang Y, Yang S, Jiang W (2009) Improvement of xylose utilization in Clostridium acetobutylicum via expression of the talA gene encoding transaldolase from Escherichia coli. J Biotechnol. 143: 284-287.

145

Guo T, He AY, Du TF, Zhu DW, Liang DF, Jiang M, Wei P, Ouyang PK (2013) Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: 379-85.

Hu S, Zheng H, Gu Y, Zhao J, Zhang W, Yang Y, Wang S, Zhao G, Yang S, Jiang W. (2011). Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. BMC Genomics 12: 93.

Jang YS, Malaviya A, Cho C, Lee J, Lee SY (2012) Butanol production from renewable biomass by clostridia. Bioresour Technol 123: 653-663.

Jiang W, Zhao J, Wang Z, Yang ST (2014) Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations. Bioresour Technol 163: 172-179.

Jin L, Zhang H, Chen L, Yang C, Yang S, Jiang W, Gu Y (2014) Combined overexpression of genes involved in pentose phosphate pathway enables enhanced D-xylose utilization by Clostridium acetobutylicum. J Biotechnol 173: 7-9.

Kumar M, Goyal Y, Sarkar A, Gayen K (2013) Comparative economic assessment of ABE fermentation based on cellulosic and non-cellulosic feedstocks. Appl Energy 93: 193–204.

Liu X, Zhu Y, Yang ST (2006) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog 22: 1265-1275.

Liu Z, Ying Y, Li F, Ma C, Xu P (2010) Butanol production by Clostridium beijerinckii ATCC 55025 from wheat bran. J Ind Microbiol Biotechnol 37: 495-501.

Lorca GL, Chung YJ, Barabote RD, Weyler W, Schilling CH, Saier MH Jr (2005) Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. J Bacteriol 187: 7826-39.

Lu C, Zhao J, Yang ST, Wei D (2012) Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: 380-7.

Lu C, Dong J, Yang ST (2013) Butanol production from wood pulping hydrolysate in an integrated fermentation-gas stripping process. Bioresour Technol 143: 467-75.

Moreno MS, Schneider BL, Maile RR, Weyler W, Saier MH Jr (2004) Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation

146 revealed by whole-genome analyses. Mol Microbiol 39: 1366-81.

Ounine K, Petitdemange H, Raval G, Gay R (1985) Regulation and butanol inhibition of D-xylose and D-glucose uptake in Clostridium acetobutylicum. Appl Environ Microbiol 49: 874-878.

Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP (2008) Butanol production by Clostridium beijerinckii. Part I: use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: 5915-5922.

Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA (2010a) Production of butanol (a biofuel) from agricultural residues: Part I – Use of barley straw hydrolysate. Biomass Bioenergy 34: 559-565.

Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cotta MA (2010b) Production of butanol (a biofuel) from agricultural residues: Part II - Use of corn stover and switchgrass hydrolysates. Biomass Bioenerg 34: 566-571.

Ren C, Gu Y, Hu S, Wu Y, Wang P, Yang Y, Yang C, Yang S, Jiang W (2010) Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum. Metab Eng 12: 446-54.

Rodionov DA, Mironov AA, Gelfand MS (2001) Transcriptional regulation of pentose utilisation systems in the Bacillus/Clostridium group of bacteria. FEMS Microbiol Lett 205: 305-314.

Tangney M, Mitchell WJ (2007) Characterization of a glucose phosphotransferase system in Clostridium acetobutylicum ATCC 824. Appl Microbiol Biotechnol 74: 398–405.

Wang L, Chen HZ (2011) Increased fermentability of enzymatically hydrolyzed steam-exploded corn stover for butanol production by removal of fermentation inhibitors. Process Biochem 46: 604-607

Wang J, Yang X, Chen CC, Yang ST (2014) Engineering clostridia for butanol production from biorenewable resources: from cells to process integration, Curr Opin Chem Eng 6: 43–54.

Wu Y, Yang Y, Ren C, Yang C, Yang S, Gu Y, Jiang W (2015) Molecular modulation of pleiotropic regulator CcpA for glucose and xylose coutilization by solvent-producing Clostridium acetobutylicum. Metab Eng 28: 169-179.

Xiao H, Gu Y, Ning Y, Yang Y, Mitchell WJ, Jiang W, Yang S (2011) Confirmation and elimination of xylose metabolism bottlenecks in glucose phosphoenolpyruvate-dependent phosphotransferase system-deficient Clostridium acetobutylicum for simultaneous

147 utilization of glucose, xylose, and arabinose. Appl. Environ. Microbiol 77: 7886–7895.

Xiao H, Li Z, Jiang Y, Yang Y, Jiang W, Gu Y, Yang S (2012) Metabolic engineering of D-xylose pathway in Clostridium beijerinckii to optimize solvent production from xylose mother liquid. Metab Eng 14: 569-78.

Xin F, Wu YR, He J (2014) Simultaneous fermentation of glucose and xylose to butanol by Clostridium sp. strain BOH3. Appl Environ Microbiol 80: 4771-8.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production, Appl Microbiol Biotechnol 99: 1011–1022.

Yao R, Shimizu K (2013) Recent progress in metabolic engineering for the production of biofuels and biochemicals from renewable sources with particular emphasis on catabolite regulation and its modulation, Process Biochem 48: 1409-1417.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: 881-9.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol 93: 881-9.

Zhao J, Lu C, Chen CC, Yang ST (2013) Biological production of butanol and higher alcohols, in Yang ST, El-Enshasy HA, Thongchul N. (eds.) Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Ch. 13, pp. 235-261.

Zhu Y, Yang ST (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Prog 19: 365-372.

148

Table 5.1 Bacterial strains and plasmids. Strain/Plasmid Relevant Characteristics Reference / Source Strains E. coli DH5α Host cells for plasmids amplification Invitrogen E. coli CA434 Donor cells for conjugation transformation Williams et al., 1990 Ct(Δack) C. tyrobutyricum ATCC 25755 with ack knockout Liu et al., 2006 Ct(Δack)-pM2 adhE2 overexpression in Ct(Δack) Yu et al., 2011 Ct(Δack)-pTBA adhE2 and xylTBA overexpression in Ct(Δack) This study Plasmids pMTL82151 ColE1 ori; Cmr; pBP1 ori, TraJ Heap et al., 2009 pM2 From pMTL82151; P-thl adhE2 Yu et al., 2011 pTBA From pMTL82151; P-thl adhE2 xylTBA This study Primers Sequence (5’-3’) XylT-for TTTGCTTCATTATCC CAGATTGAGGAGGAATATAAAATGAATAA GAAACAGCTATGACC GAGCTC XylT-rev AACTACTCATTTAATCCTCTAACTTTTCCA TTAAATGAGTAGTTG XylB-for AGGAGGTTTGATTATGAGGTATTTATTAGGTATAGAC AAACAGCTATGACC GAGCTC XylB-rev GCGCTCCTACTTTTAACTATTTATATATCT XylA-for AAAAGTAGGAGCGCG AGGAGGAATTAAAATGAATAATACACCAA

149

Table 5.2 Kinetics of co-fermentation of glucose and xylose in CGM and SHH by Ct(Δack)-pM2 and Ct(Δack)-pTBA. Glucose Xylose Sp. Xylose Butanol uptake uptake Butyrate Acetate Strains Medium growth consumption rate rate Titer Yield Productivity (g/L) (g/L) rate (h-1) (%) (g/L·h) (g/L·h) (g/L) (g/g) (g/L·h) CGM 0.22±0.01 1.85±0.10 0 10.6±0.6 3.2±0.2 0.07±0.01 0.07±0.01 10.4±0.4 7.0±0.3 Ct(Δack)-pM2 SHH 0.21±0.01 1.43±0.03 0 17.8±1.0 3.5±0.1 0.06±0.01 0.10±0.01 10.3±0.5 5.8±0.8 CGM 0.21±0.00 1.03±0.07 1.05±0.08 87.3± 1.0 12.0±0.2 0.12±0.00 0.17±0.01 8.0±0.4 5.1±0.2 Ct(Δack)-pTBA SHH 0.20±0.01 1.20±0.11 1.21±0.08 92.7±0.8 8.1±0.1 0.10±0.01 0.15±0.01 20.1±0.6 8.7±0.5 SHH+MV 0.16±0.01 1.29±0.12 0.75±0.07 65.2±1.3 15.7±0.4 0.24±0.02 0.29±0.01 5.8±0.3 2.0±0.5 CGM: Clostridial growth medium containing 45 g/L glucose and 60 g/L xylose.

1

50 SHH: soybean hull hydrolysate containing 45 g/L glucose and 45 g/L xylose.

Data shown are mean ± s.d. (n = 2).

Table 5.3 Fermentation kinetics of Ct(Δack)-pTBA grown on glucose-xylose mixtures at different ratios in serum bottles. Glucose Glucose Xylose Butanol Sp. growth Butanol Butyrate Acetate to xylose uptake rate uptake rate productivity rate (h-1) (g/L) (g/L) (g/L) ratio (g/L·h) (g/L·h) (g/L·h)

3:1 0.13±0.02 0.53±0.03 0.14±0.01 0.05±0.01 8.5±0.8 8.1±1.1 5.4±0.4

2:1 0.14±0.02 0.53±0.02 0.19±0.02 0.05±0.00 8.5±0.6 7.9±0.6 5.5±0.6

1:1 0.13±0.03 0.50±0.04 0.30±0.01 0.05±0.01 8.2±0.6 8.5±0.5 5.2±0.6

1:2 0.13±0.03 0.45±0.02 0.45±0.02 0.05±0.01 8.1±0.7 8.9±0.4 5.5±0.8 Total initial sugar concentration: 60 g/L.

Data shown are mean ± s.d. (n = 2).

151

Figure 5.1 Kinetics of C. tyrobutyricum Ct(Δack)-pM2 (A) and Ct(Δack)-pTBA (B) in batch fermentations with xylose as substrate in bioreactors at pH 6.0.

152

Figure 5.2 Kinetics of C. tyrobutyricum Ct(Δack)-pM2 (A) and Ct(Δack)-pTBA (B) in batch fermentations with glucose (~50 g/L) and xylose (~60 g/L) mixture as substrates in bioreactors at pH 6.0.

153

Figure 5.3 Comparison of xylose (square) and glucose (circle) consumptions and butanol production (diamond) by Ct(Δack)-pTBA under different initial xylose-to-glucose ratios (as indicated) in serum bottles with pH adjusted to 6.3-6.5 daily..

154

Figure 5.4 Kinetics of C. tyrobutyricum Ct(Δack)-pM2 (A), Ct(Δack)-pTBA (B) and Ct(Δack)-pTBA with 500 M MV (C), in batch fermentations with soybean hull hydrolysate as substrate in bioreactors at pH 6.0. 155

Chapter 6: Conclusions and Recommendations

6.1 Conclusions

In this study, enhanced butanol production was realized through genetic engineering of C. tyrobutyricum to alter the metabolic flux towards high level of butanol biosynthesis and to optimize the strain for improved sugar utilization. One of the critical problems involved in C. tyrobutyricum expressing adhE2 is the accumulation of acetate and butyrate at ~5.7 g/L and ~13.7 g/L, respectively, which greatly compromised the butanol production. The importance of butanol yield was demonstrated in a previous economic assessment which reported that an increase in butanol yield by 19% could lower the butanol price by 14.7% (Qureshi and Blaschek, 2001a). The CoA transferase from C. acetobutylicum ATCC 824 was well studied previously, showing an effective capability in acid reassimilation (Fischer et al., 1993). In this study, the introduction of the CoA transferase in C. tyrobutyricum expressing adhE2 has successfully brought down the level of acetate and butyrate more than 54% and 75%, respectively, and contributed to increases in butanol yield and productivity by ~100% and ~170%, respectively. The introduction of CoA transferase inevitably induced acetone production at the same time, making C. tyrobutyricum an ABE producer. An exclusive Ptb-Buk reverse pathway for butyrate re-uptake was also demonstrated through the addition of butyrate at the beginning of fermentation with Ct(Δack)-pMAD72, which suggested that butyrate 156 re-uptake might not be only dependent on the CoA transferase pathway. Although butanol yield and productivity were raised with CoA transferase expression, butanol titer was not significantly improved, which might be caused by a few reasons, including low levels of adhE2 expression NADH availability and butanol tolerance.

Another important problem concerning the limitation of sugar utilization by C. tyrobutyricum was also addressed in this study. The successful transfer of maltose and soluble starch hydrolytic capability from C. acetobutylicum to C. tyrobutyricum set an example for other related studies that involve the introduction of other sugar catabolic systems into C. tyrobutyricum. After the expression of an α-glucosidase from C. acetobutylicum, active hydrolysis of maltose and soluble starch was observed. Besides, fermentation of maltose and soluble starch by C. tyrobutyricum expressing agluI showed significantly increased butanol titer, yield and productivity, compared to C. tyrobutyricum expressing adhE2 alone using glucose and C. acetobutylicum ATCC 824 using maltose and soluble starch. This was the first study that enabled C. tyrobutyricum to utilize maltose and soluble starch as substrates in fermentation, signifying that C. tyrobutyricum could be applied in large-scale biobutanol production using cheap feedstocks containing maltose or soluble starch. The final butanol titer by using maltose or soluble starch can reach 16.2-17.2 g/L, which is the highest butanol level ever reported in Clostridium using these two substrates in batch fermentation.

Carbon catabolite repression (CCR) is another obstruction in sugar catabolism, which is present in multiple Clostridium spp. (Titgemeyer and Hillen, 2002; Görke and

Stülke, 2008). No or little xylose was consumed by C. tyrobutyricum when glucose was present in the medium, suggesting that the CCR also exists in C. tyrobutyricum. One way 157 to eliminate the repression is to disrupt the central regulator catabolite control protein

CcpA, which has been proven to be effective in C. acetobutylicum (Ren et al, 2010).

Another strategy to realize efficient co-utilization of glucose and xylose is to constitutively express the rate-limiting xylose catabolic pathway, which was used in this study. After expressing three essential genes, xylT, xylA, and xylB, which were responsible for xylose transport, isomerization, and xylulose phosphorylation, respectively, efficient glucose and xylose co-utilization was achieved. The overexpression also led to an increase in butanol titer by ~293%, since both glucose and xylose were actively consumed during the fermentation. An increase in xylose uptake rate was also observed with an increase in xylose to glucose ratio, which was probably because that the xylose transport mediated by the xylose symporter was driven by an electrochemical gradient across the cell membrane. The mutant has also been proven to be effective in using soybean hull hydrolysate containing a mixture of glucose and xylose, suggesting that this mutant was a potential candidate to be applied in industrial fermentation using lignocellulose as feedstock.

6.2 Recommendations

In this study, two critical problems including acid accumulation and sugar utilization in C. tyrobutyricum have been addressed. However, there are other issues still limiting butanol production in C. tyrobutyricum. In the first study, after expressing a CoA transferase, in spite of a significant increase in butanol yield and productivity, the increase in butanol titer was limited. This indicated that the expression of CoA transferase was unable to elevate butanol titer significantly. Although acid accumulation has been 158 relieved after expressing the CoA transferase, many other factors may still impact butanol titer in fermentation, such as the expression level of adhE2, NADH/NAD+ ratio and butanol tolerance. In this study, the biosynthesis of butanol was induced by a bifunctional aldehyde/alcohol dehydrogenase (AAD) encoded by an adhE2 under the control of a native thiolase promoter (thl) (Yu et al., 2011 & 2012). In batch fermentations of Ct pMAD72 and Ct pM2 both expressing the adhE2 alone, large amounts of butyrate (13.7 g/L and 22.5 g/L, respectively) were accumulated, whereas only 10.2 g/L and 9.5 g/L of butanol was produced, respectively, indicating that the butyrate-producing pathway still played a dominating role in the fermentation. In the second study, the use of maltose and soluble starch as substrates slowed down cell specific growth rate by ~50%, but it elevated butanol production and reduced butyrate accumulation. A possible explanation is that the decline in cell growth rate suppressed the activity of the butyrate-producing pathway, and in the meantime allowed a higher level of the aldehyde/alcohol dehydrogenase to be expressed and more time to catalyze the butanol conversion from butyryl-CoA. It also implied that the expression induced by the adhE2 under thl promoter might not be strong enough to compete with the butyrate-producing pathway.

To find the optimal promoter for adhE2 expression, expression profiles of other

Clostridium promoters including ptb and adc promoters which were proven to be effective in the induction of constitutive expression in Clostridium (Tummala et al., 1999;

Feustel et al., 2004) should be evaluated. The adhE2 gene expressed in C. tyrobutyricum was cloned from C. acetobutylicum ATCC 824 (Yu et al, 2011 & 2012). Since these two strains may have different DNA codon preferences, additional modifications by codon optimization may be needed for the optimal translation efficiency. Moreover, according to 159 a previous study, a mutation in AAD (D385G) could increase its affinity for NADPH or

NADH and can thus improve butanol production (Jang et al., 2012). Similar strategy could be applied in C. tyrobutyricum to reinforce the reaction towards butanol production.

To further improve the butanol production by C. tyrobutyricum, the combination of ack and ptb double knockouts together with the adhE2 and ctfAB overexpression may be another promising direction. A previous study combining the overexpression of a mutated

AAD and ack and ptb double knockouts in C. acetobutylicum realized increased butanol titer and yield to 18.9 g/L and 0.31 g/g glucose, respectively, which were 160% and 245% higher than the wild type (Jang et al., 2012). Besides this, the existence of heterologous plasmids within the cells may become a metabolic burden. Cells carrying heterologous plasmids may be subject to low cell activity, slow cell growth and weak production level

(Seo and Bailey, 1985; Cheah et al., 1987). The supplementation of antibiotics in the fermentation is also economically unfavorable. Therefore, the construction of an adhE2 knock-in mutant could avoid the loss of heterologous plasmids and further stabilize the butanol synthetic pathway.

For sugar catabolism, the introduction of two extracellular α-glucosidases from C. acetobutylicum has realized the utilization of maltose and soluble starch by C. tyrobutyricum. Similar strategy could be also used for transferring other sugar catabolic systems into C. tyrobutyricum. The catabolism of sucrose, galactose, lactose and glycerol may be good targets for further metabolic engineering. The sucrose transport and metabolism system has been identified previously in C. acetobutylicum, which included three genes (scrA/K/B) in one operon encoding a PTS IIBCA domain, a fructokinase and a sucrose-6-P hydrolase (Tangney and Mitchel, 2000). The metabolism of galactose was 160 also characterized before, including a galactokinase (galK), a UDP-galactose epimerase

(galE) and a galactose-1-P-uridylyltransferase (galT). Lactose is composed of a galactose and a glucose linked by a β-1-4 glycosidic bond and the hydrolysis of lactose could be achieved based on the galactose catabolic system with the expression of an additional

6-P-β-galactosidase (lacG) (Servinsky et al., 2010). The relevant enzymes for glycerol catabolism have been identified and annotated in the genome of C. tyrobutyricum; however the cells are unable to consume glycerol as its substrate. This is probably caused by excess of NADH when using glycerol. The introduction of a NADH-consuming

1,3-propanediol pathway has been demonstrated to be effective on the relief of excessive

NADH (González-Pajuelo et al., 2006), and may be able to realize glycerol consumption and also 1,3-propanediol production in C. tyrobutyricum.

Limitations of NADH level and butanol tolerance are two other critical bottlenecks which would impede butanol production by C. tyrobutyricum. Since C4 congestion pathway requires the expense of NADH, high NADH/NAD+ will benefit carbon flux towards butyryl-CoA synthesis. Increased NADH level can also improve the activity of

NADH-dependent aldehyde and alcohol dehydrogenase, which could improve alcohol production in Clostridium (Fontaine et al., 2002). Previously, more butanol was produced after an increase in NADH level through the utilization of artificial electron carriers, such as methyl viologen (MV), and more reducing sugar, such as mannitol (Du et al., 2015).

However, the application of MV or reducing sugar mannitol in large-scale fermentation is simply infeasible due to economic and environmental reasons. Therefore, a more direct way to increase NADH availability is to disrupt the hydrogen-producing pathway and inhibit the production of H2. However, a previous study trying to knockout the 161 hydrogen-producing gene hydA in C. acetobutylicum failed to obtain a viable mutant

(Cooksley et al., 2012). The only successful hydA-disrupted mutant obtained in C. acetobutylicum was constructed under the basis of quadruple knockouts of pta, buk, ctfB and adhE genes, which resulted in increased butyrate to acetate ratio but decreased alcohol synthesis due to the inactivated adhE gene (Jang et al., 2014). However, the disruption of the hydA gene has not been tried before in C. tyrobutyricum. The wild type

C. tyrobutyricum originally does not contain adhE and ctfAB genes, making it possible for subsequent hydA knockout.

As for solvent tolerance, several essential factors involved in the stress response to solvent toxicity have been identified in C. acetobutylicum, including sporulation, molecular pumps, fatty acid synthesis, chaperones and several transcription regulators

(Tomas et al., 2004; Lee et al., 2008; Borden and Papoutsakis, 2007). Since high concentration of solvents could increase the membrane fluidity by altering the composition of lipids and disrupting the structure of phospholipid bilayer, the activity of membrane-attached functions would be severely affected (Bowles and Ellefson, 1985).

To preserve membrane integrity and stabilize its activity, previous studies which overexpressed a cyclopropane fatty acid synthase gene cfa and a heat shock protein groESL obtained increased solvent tolerance and production (Zhao et al., 2003; Tomas et al., 2003). Also in a previous study, 16 genes including 4 transcriptional regulators were identified to be closely connected to solvent tolerance by genomic library screening.

Overexpressing one of the identified transcriptional regulators (CAC1869) has shown to be particularly effective which increased butanol tolerance by 81% (Borden and

Papoutsakis, 2007). Although relatively higher butanol tolerance was demonstrated in C. 162 tyrobutyricum, compared to C. acetobutylicum (Yu et al., 2012), butanol tolerance could still be a major barrier on butanol production. In this study, the expression of CoA transferase led to early and accelerated butanol synthesis, which resulted in a limited increase in butanol titer and a significant decrease in maximum cell optical density, providing evidence that butanol tolerance may still be a bottleneck in C. tyrobutyricum.

In order to solve this problem, transcriptional analysis could illustrate and specifically identify transcriptional changes of an individual gene under butanol stress in C. tyrobutyricum, which will provide additional clues for further genetic manipulation of C. tyrobutyricum to improve solvent tolerance.

Another way to obtain a high butanol-tolerant mutant is through evolutionary engineering. C. beijerinckii BA101 and C. acetobutylicum JB200 were two examples of high butanol-tolerant strains developed by adaptation and random mutagenesis (Qureshi and Blaschek, 2001b; Xu et al., 2015). Process integrating butanol recovery with fermentation has been applied to alleviate the butanol stress. Several recovery techniques were reported for efficient butanol recovery from fermentation broth, including adsorption, liquid-liquid extraction, pervaporation and gas stripping (Groot et al., 1990;

Qureshi and Blaschek, 1999; Thompson et al., 2011; Xue et al., 2013). The application of these techniques in fermentation of butanol-producing C. tyrobutyricum could to large extent relieve the stress from butanol accumulation and lead to more efficient butanol production.

6.3 References

Borden JR, Papoutsakis ET (2007) Dynamics of genomic-library enrichment and 163 identification of solvent tolerance genes for Clostridium acetobutylicum. Appl Environ Microbiol. 73:3061–3068

Bowles LK, Ellefson WL (1985) Effects of butanol on Clostridium acetobutylicum. Appl Environ Microbiol. 50:1165–1170.

Cheah UE, Weigand WA, Stark BC (1987) Effects of recombinant plasmid size on cellular processes in Escherichia coli. Plasmid. 18: 127–134.

Cooksley CM, Zhang Y, Wang H, Redl S, Winzer K, Minton NP (2012) Targeted mutagenesis of the Clostridium acetobutylicum Acetone-Butanol-Ethanol fermentation pathway. Metab Eng 14: 630–641

Du YM, Jiang WY, Yu MR, Tang IC, Yang ST (2015) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol. Bioeng. 9999: 1–12

Feustel L, Nakotte S, Dürre P (2004) Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol 70:798–803

Fischer RJ, Helms J, Dürre P (1993) Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol. 175: 6959-69

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

González-Pajuelo M, Meynial-Salles I, Mendes F, Soucaille P, Vasconcelos I (2006) Microbial conversion of glycerol to 1,3-propanediol: physiological comparison of a natural producer, Clostridium butyricum VPI 3266, and an engineered strain, Clostridium acetobutylicum DG1(pSPD5). Appl Environ Microbiol. 72: 96-101.

Görke B, Stülke J. (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol. 6:613-24.

Groot WJ, Soedjak HS, Donck PB, van der Lans RGJM, Luyben KChAM, Timmer JMK (1990) Butanol recovery from fermentations by liquid-liquid extraction and membrane solvent extraction. Bioprocess Engineering. 5: 203-216.

Jang YS, Lee JY, Lee J, Park JH, Im JA, Eom MH, Lee J, Lee SH, Song H, Cho JH, Seung do Y, Lee SY (2012) Enhanced butanol production obtained by reinforcing the 164 direct butanol-forming route in Clostridium acetobutylicum. MBio 3: e00314-12

Jang YS, Im JA, Choi SY, Lee JI, Lee SY (2014) Metabolic engineering of Clostridium acetobutylicum for butyric acid production with high butyric acid selectivity. Metab Eng. doi:10.1016/j.ymben.2014.03.004i

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by clostridia. Biotechnol Bioeng 101: 209-228.

Qureshi N, Blaschek HP (1999) Production of acetone butanol ethanol (ABE) by a hyper-producing mutant strain of Clostridium beijerinckii BA101 and recovery by pervaporation. Biotechnol Prog. 15:594-602.

Qureshi N, Blaschek HP (2001a) ABE production from corn: A recent economic evaluation. J Ind Microbiol Biotechnol. 27: 292–297

Qureshi N, Blaschek HP (2001b) Recent advances in ABE fermentation: Hyper-butanol producing Clostridium beijerinckii BA101. J Ind Microbiol Biotech 27:287–291.

Ren C, Gu Y, Hu S, Wu Y, Wang P, Yang Y, Yang C, Yang S, Jiang W (2010) Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum. Metab Eng. 12: 446-54.

Seo JH, Bailey JE (1985) Effects of recombinant plasmid content on growth properties and cloned gene product formation in Escherichia coli. Biotech Bioeng. 27: 1668-1674.

Servinsky MD, Kiel JT, Dupuy NF, Sund CJ (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiology. 156:3478-91.

Tangney M, Mitchell WJ. (2000). Analysis of a catabolic operon for sucrose transport and metabolism in Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol 2:71–80

Thompson AB, Cope SJ, Swift TD, Notestein JM (2011) Adsorption of n-butanol from dilute aqueous solution with grafted calixarenes. Langmuir. 27:11990-8.

Titgemeyer F, Hillen W. (2002) Global control of sugar metabolism: a gram-positive solution. Antonie Van Leeuwenhoek. 82:59-71.

Tomas CA, Welker NE, Papoutsakis ET (2003) Overexpression of groESL in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell’s transcriptional program. Appl Environ Microbiol 69:4951–4965.

165

Tomas CA, Beamish J, Papoutsakis ET (2004) Transcriptional analysis of butanol stress and tolerance in Clostridium acetobutylicum. J Bacteriol. 186:2006–2018.

Tummala SB, Welker NE, Papoutsakis ET (1999) Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 65:3793–3799

Williams DR, Young DI, Young M (1990) Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. Microbiology 136: 819-826.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production. Appl Microbiol Biotechnol. 99:1011–1022

Xue C, Zhao J, Liu F, Lu C, Yang ST, Bai FW (2013) Two-stage in situ gas stripping for enhanced butanol fermentation and energy-saving product recovery. Bioresour Technol. 135: 396-402.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol.93:881-9.

Zhao Y, Hindorff LA, Chuang A, Monroe-Augustus M, Lyristis M, Harrison ML, Rudolph FB, Bennett GN (2003) Expression of a cloned cyclopropane fatty acid synthase gene reduces solvent formation in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 69:2831–2841

166

Bibliography

Agarwal AK (2007) Biofuels (alcohols and biodiesel) applications as fuels for internal combustion engines. Progress in Energy and Combustion Science 33: 233–271.

Albasheri KA and Mitchell WJ (1995) Identification of two α-glucosidase activities in Clostridium acetobutylicum NCIB 8052. J Appl Microbial. 78: 149-156

Al-Hinai MA, Fast AG, Papoutsakis ET (2012) Novel system for efficient isolation of Clostridium double-crossover allelic exchange mutants enabling markerless chromosomal gene deletions and DNA integration. Appl Environ Microbiol. 78: 8112-21.

Alsaker KV, Spitzer TR, Papoutsakis ET (2004) Transcriptional analysis of spo0A overexpression in Clostridium acetobutylicum and its effect on the cell's response to butanol stress. J Bacteriol. 186:1959-1971.

Alsaker KV, Paredes C, Papoutsakis ET (2010). Metabolite stress and tolerance in the production of biofuels and chemicals: gene-expression-based systems analysis of butanol, butyrate, and acetate stresses in the anaerobe Clostridium acetobutylicum. Biotechnol Bioeng 105:1131–1147.

Andersch W, Bahl H, Gottschalk G (1983) Level of enzymes involved in acetate, butyrate, acetone and butanol formation by Clostridium acetobutylicum. Appl Microbiol Biotechnol 18:327-332.

Annous BA, Blaschek HP (1990) Regulation and localization of amylolytic enzymes in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 56: 2559-2661

Annous BA, Blaschek HP (1991) Isolation and characterization of Clostridium acetobutylicum mutants with enhanced amylolytic activity. Appl Environ Microbiol. 57:2544-8

Aristidou A and Penttila M (2000) Metabolic engineering applications to renewable resource utilization. Curr Opin Biotechnol.11:187-198.

Atsumi S, Hanai T, Liao JC (2008) Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature. 451: 86-89.

167

Baer SH, Blaschek HP, Smith TL (1987) Effect of butanol challenge and temperature on lipid-composition and membrane fluidity of butanol-tolerant Clostridium acetobutylicum. Appl Environ Microbiol. 53: 2854-2861.

Bao G, Wang R, Zhu Y, Dong H, Mao S, Zhang Y, Chen Z, Li Y, Ma Y (2011) Complete genome sequence of Clostridium acetobutylicum DSM 1731, a solvent-producing strain with multireplicon genome architecture. J Bacteriol. 193: 5007-8.

Baral NR, Shah A (2014) Microbial inhibitors: formation and effects on acetone-butanol-ethanol fermentation of lignocellulosic biomass. Appl Microbiol Biotechnol 98: 9151-72.

Barrière C, Veiga-da-Cunha M, Pons N, Guédon E, van Hijum SA, Kok J, Kuipers OP, Ehrlich DS, Renault P (2005) Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J Bacteriol. 187: 3752-61. Bassi D, Fontana C, Gazzola S, Pietta E, Puglisi E, Cappa F, Cocconcelli PS (2013). Draft Genome Sequence of Clostridium tyrobutyricum Strain UC7086, Isolated from grana padano cheese with late-blowing defect. Genome Announc. 1: e00614-13.

Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795.

Bizzini A, Entenza JM, Michielin O, Arnold I, Erni B, Moreillon P (2010) A single mutation in enzyme I of the sugar phosphotransferase system confers penicillin tolerance to Streptococcus gordonii. Antimicrob Agents Chemother. 54: 259-66.

Borden JR, Papoutsakis ET (2007) Dynamics of genomic-library enrichment and identification of solvent tolerance genes for Clostridium acetobutylicum. Appl Environ Microbiol. 73:3061–3068

Boulton C and Quain D (2006) Brewing yeast and fermentation. Wiley-Blackwell, New York, NY.

Bowles LK, Ellefson WL (1985) Effects of butanol on Clostridium acetobutylicum. Appl Environ Microbiol 50: 1165-1170.

Branduardi P, De Ferra F, Longo V, Porro D (2013) Microbial n-butanol production from Clostridia to non-Clostridial hosts. Eng Life Sci 14: 16-26.

Brückner R, Titgemeyer F (2002) Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol Lett. 209: 141-148.

168

Brunschwiga C, Moussavoua W, Blin J (2012) Use of bioethanol for biodiesel production. Progress in Energy and Combustion Science. 38: 281-301.

Cartman ST, Kelly ML, Heeg D, Heap JT, Minton NP (2012) Precise manipulation of the Clostridium difficile chromosome reveals a lack of association between the tcdC genotype and toxin production. Appl. Environ. Microbiol. 78:4683-4690.

Charrier C, Duncan GJ, Reid MD, Rucklidge GJ, Henderson D, Young P, Russell VJ, Aminov RI, Flint HJ, Louis P (2006) A novel class of CoA-transferase involved in short-chain fatty acid metabolism in butyrate-producing human colonic bacteria. Microbiology. 152:179-85.

Cheah UE, Weigand WA, Stark BC (1987) Effects of recombinant plasmid size on cellular processes in Escherichia coli. Plasmid. 18: 127–134.

Chen C-K, Blaschek HP (1999) Effect of acetate on molecular and physiological aspects of Clostridium beijerinckii NCIMB 8052 solvent production and strain degeneration. Appl Environ Microbiol 65: 499-505.

Chojecki A and Blaschek HP (1986) Effect of carbohydrate source on α-amylase and glucoamylase formation by Clostridium acetobutylicum SA-1. J. Industrial Microbiol. 1: 63-67

Cook GM, Janssen PH, Morgan HW (2006) Simultaneous uptake and utilization of glucose and xylose by Clostridium thermohydrosulfuricum. FEMS Microbiol Letters. 109: 55-61.

Cooksley CM, Zhang Y, Wang H, Redl S, Winzer K, Minton NP (2012) Targeted mutagenesis of the Clostridium acetobutylicum Acetone Butanol-Ethanol fermentation pathway. Metab Eng. 14: 630-641.

Cornillot E, Nair RV, Papoutsakis ET, Soucaille P (1997) The genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain. J Bacteriol. 179:5442-7.

Datta R, Zeikus JG (1985) Modulation of acetone butanol ethanol fermentation: utilization of carbon monoxide to inhibit hydrogen production and to enhance butanol yields. Appl Environ Microbiol. 48:764-770.

Demirbas A (2009) Political, economic and environmental impacts of biofuels: A review. Appl Energy. 86: s108-s117.

Deutscher J, Küster E, Bergstedt U, Charrier V, Hillen W (1995) Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite 169 repression in gram-positive bacteria. Mol Microbiol. 15:1049-53.

Deutscher J, Francke C and Postma PW (2006) How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 70: 939-1031.

Deutscher J (2008) The mechanisms of carbon catabolite repression in bacteria. Curr Opin Microbiol. 11: 87-93.

Diderichsen B and Christiansen L. (1988) Cloning of a maltogenic α-amylase from Bacillus stearothermophilus. FEMS Microbiol. Lett. 56:53-60.

Dong J (2014) Butanol production from lignocellulosic biomass and agriculture residues by Acetone-Butanol-Ethanol fermentation. Ph.D. Dissertation, The Ohio State University, Columbus, Ohio

Dong J, Du YM, Zhou YP, Yang ST (2014) Butanol production from soybean hull and soy molasses by Acetone-Butanol-Ethanol fermentation. Soy-Based Chemicals and Materials, Chapter 2, pp 25–41. 2014 American Chemical Society.

Du YM (2013) High-yield and high-titer n-butanol production from lignocellulosic feedstocks by metabolically engineered Clostridium tyrobutyricum. PhD Dissertation, The Ohio State University

Du YM, Jiang WY, Yu MR, Tang IC, Yang ST (2015) Metabolic process engineering of Clostridium tyrobutyricum Δack-adhE2 for enhanced n-butanol production from glucose: Effects of methyl viologen on NADH availability, flux distribution, and fermentation kinetics. Biotechnol Bioeng. 9999: 1-12.

Dürre P, Kuhn A, Gottwald M, Gottschalk G (1987) Enzymatic investigations on butanol dehydrogenase and butyraldehyde dehydrogenase in extracts of Clostridium acetobutylicum. Appl Microbiol Biotechnol. 26:268-272.

Dürre P, Böhringer M, Nakotte S, Schaffer S, Thormann K, Zickner B (2002) Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol Microbiol Biotechnol. 4: 295-300.

Dürre P (2007) Biobutanol: An attractive biofuel. J Biotechnol. 2: 1525-1534.

Dwidar M, Park JY, Mitchell RJ, Sang BI (2012) The future of butyric acid in industry. Scientific World Journal. 2012: 471417.

Eksteen JM, Van Rensburg P, Cordero Otero RR, Pretorius IS (2003) Starch fermentation by recombinant Saccharomyces cerevisiae strains expressing the alpha-amylase and glucoamylase genes from Lipomyces kononenkoae and Saccharomycopsis fibuligera. 170

Biotechnol Bioeng. 84: 639-46.

Emerson JE, Reynolds CB, Fagan RP, Shaw HA, Goulding D, Fairweather NF (2009) A novel genetic switch controls phase variable expression of CwpV, a Clostridium difficile cell wall protein. Mol. Microbiol. 74: 541-556.

Ezeji TC, Karcher PM, Qureshi N, Blaschek HP (2005) Improving performance of a gas stripping-based recovery system to remove butanol from Clostridium beijerinckii fermentation. Bioprocess Biosyst Eng. 27:207-14

Ezeji TC, Qureshi N, Blaschek HP (2005) Continuous butanol fermentation and feedstarch retrogradation: butanol fermentation sustainability using Clostridium beijerinckii BA101. J Biotechnol. 115:179-187.

Ezeji TC, Qureshi N, Blaschek HP (2007) Bioproduction of butanol from biomass: from genes to bioreactors. Curr Opin Biotechnol. 18: 220-227.

Ezeji TC, Qureshi N, Blaschek HP (2007) Production of acetone–butanol–ethanol (ABE) in a continuous flow bioreactor using degermed corn and Clostridium beijerinckii. Process Biochemistry. 42: 34–39.

Feustel L, Nakotte S, Dürre P (2004) Characterization and development of two reporter gene systems for Clostridium acetobutylicum. Appl Environ Microbiol. 70:798-803.

Fischer RJ, Helms J, Dürre P (1993) Cloning, sequencing, and molecular analysis of the sol operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J Bacteriol. 175: 6959-69.

Fontaine L, Meynial-Salles I, Girbal L, Yang X, Croux C, Soucaille P (2002) Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 821-830.

Fox ME, Lemmon MJ, Mauchline ML, Davis TO, Giaccia AJ, Minton NP, Brown JM (1996) Anaerobic bacteria as a delivery system for cancer gene therapy: in vitro activation of 5-fluorocytosine by genetically engineered clostridia. Gene Ther. 3: 173-178.

Friedman MH (2008) Principles and models of biological transport, second edition. Springer. ISBN 978-0387-79239-2.

Gerischer U, Dürre P (1990) Cloning, sequencing, and molecular analysis of the acetoacetate decarboxylase gene region from Clostridium acetobutylicum. J Bacteriol. 172: 6907-18. 171

Gheshlaghi R, Scharer JM, Moo-Young M, Chou CP (2009) Metabolic pathways of clostridia for producing butanol. Biotechnol Adv. 27:764-81.

Girbal L, Croux C, Vasconcelos I, Soucaille P (1995) Regulation of metabolic shifts in Clostridium acetobutylicum ATCC 824. FEMS Microbiology Reviews. 17: 287-298.

González-Pajuelo M, Meynial-Salles I, Mendes F, Soucaille P, Vasconcelos I (2006) Microbial conversion of glycerol to 1,3-propanediol: physiological comparison of a natural producer, Clostridium butyricum VPI 3266, and an engineered strain, Clostridium acetobutylicum DG1(pSPD5). Appl Environ Microbiol. 72: 96-101.

Green EM, Bennett GN (1996) Inactivation of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. Appl Biochem Biotechnol. 57–58:213–221.

Green EM (2011) Fermentative production of butanol–the industrial perspective. Curr Opin Biotechnol. 22: 337–343.

Grimmler C, Held C, Liebl W, Ehrenreich A (2010) Transcriptional analysis of catabolite repression in Clostridium acetobutylicum growing on mixtures of D-glucose and D-xylose. J Biotechnol. 150: 315-23.

Groot WJ, Soedjak HS, Donck PB, van der Lans RGJM, Luyben KChAM, Timmer JMK (1990) Butanol recovery from fermentations by liquid-liquid extraction and membrane solvent extraction. Bioprocess Engineering. 5: 203-216.

Görke B, Stülke J. (2008) Carbon catabolite repression in bacteria: many ways to make the most out of nutrients. Nat Rev Microbiol. 6:613-24.

Gu Y, Li J, Zhang L, Chen J, Niu L, Yang Y, Yang S, Jiang W (2009) Improvement of xylose utilization in Clostridium acetobutylicum via expression of the talA gene encoding transaldolase from Escherichia coli. J Biotechnol. 143:284-7.

Gu Y, Jiang Y, Wu H, Liu X, Li Z, Li J, Xiao H, Shen Z, Dong H, Yang Y, Li Y, Jiang W, Yang S (2011) Economical challenges to microbial producers of butanol: Feedstock, butanol ratio and titer. Biotechnol J 6:1348-1357.

Gu Y, Ding Y, Ren C, Sun Z, Rodionov DA, Zhang W, Yang S, Yang C, Jiang W. (2010) Reconstruction of xylose utilization pathway and regulons in Firmicutes. BMC Genomics 11: 255.

Guo T, He AY, Du TF, Zhu DW, Liang DF, Jiang M, Wei P, Ouyang PK (2013) Butanol production from hemicellulosic hydrolysate of corn fiber by a Clostridium beijerinckii mutant with high inhibitor-tolerance. Bioresour Technol 135: 379-85.

172

Gutierrez NA and Maddox IS (1996) Galactose transport in Clostridium acetobutylicum. Lett Appl Microbiol. 23: 97-100.

Han B, Gopalan V, Ezeji C (2011) Acetone production in solventogenic Clostridium species. Appl Microbiol Biotechnol. 91: 565-576.

Harris LM, Blank L, Desai RP, Welker NE, Papoutsakis ET (2001) Fermentation characterization and flux analysis of recombinant strains of Clostridium acetobutylicum with an inactivated solR gene. J Ind Microbiol Biotechnol. 27:322-328.

Harris LM, Welker NE, Papoutsakis ET (2002) Northern, morphological, and fermentation analysis of spo0A inactivation and overexpression in Clostridium acetobutylicum ATCC 824. J Bacteriol. 184: 3586-3597.

Hartman AH, Liu H, Melville SB (2011) Construction and characterization of alactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Appl Environ Microbiol. 77:471-478.

Hartmanis MGN, Gatenbeck S (1984) Intermediary metabolism in Clostridium acetobutylicum: Levels of enzymes involved in the formation of acetate and butyrate. Appl Microbiol Biotechnol. 47:1277-1283.

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The ClosTron: A universal gene knock-out system for the genus Clostridium. J. Microbiol. Meth. 70:452-464.

Heap JT, Pennington OJ, Cartman ST, Minton NP (2009) A modular system for Clostridium shuttle plasmids. J Microbiol Meth. 78: 79-85.

Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC, Minton NP (2010) The ClosTron: Mutagenesis in Clostridium refined and streamlined. J Microbiol Meth. 80:49-55.

Heap JT, Ehsaan M, Cooksley CM, Ng YK, Cartman ST, Winzer K, Minton NP (2012) Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic Acids Res. 40:e59.

Heider J (2001) A new family of CoA-transferases. FEBS Lett. 509(3):345-9.

Higgins CF (1995) The ABC of channel regulation. Cell. 82: 693-696.

Higgins CF (2001) ABC transporters: physiology, structure and mechanism-an overview. Res Microbiol. 152: 205-210

173

Hu S, Zheng H, Gu Y, Zhao J, Zhang W, Yang Y, Wang S, Zhao G, Yang S, Jiang W (2011) Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. BMC Genomics. 12: 93.

Huang L, Forsberg CW, Gibbins LN (1986) Influence of external pH and fermentation products on Clostridium acetobutylicum intracellular pH and cellular distribution of fermentation products. Appl Environ Microbiol. 51: 1230–1234.

Jang YS, Malaviya A, Cho C, Lee J, Lee SY (2012) Butanol production from renewable biomass by clostridia. Bioresour Technol 123: 653-663.

Jang YS, Im JA, Choi SY, Lee JI, Lee SY (2014) Metabolic engineering of Clostridium acetobutylicum for butyric acid production with high butyric acid selectivity. Metab Eng. doi:10.1016/j.ymben.2014.03.004i

Jault JM, Fieulaine S, Nessler S, Gonzalo P, Di Pietro A, Deutscher J, Galinier A (2000) The HPr kinase from Bacillus subtilis is a homo-oligomeric enzyme which exhibits strong positive cooperativity for nucleotide and fructose 1,6-bisphosphate binding. J Biol Chem. 275:1773-80.

Jeffries TW (1983) Utilization of xylose by bacteria, yeasts and fungi. Adv Biochem Eng. Biotechnol. 27:1-32.

Jiang Y, Xu C, Dong F, Yang Y, Jiang W, Yang S (2009) Disruption of the acetoacetate decarboxylase gene in solvent-producing Clostridium acetobutylicum increases the butanol ratio. Metab Eng. 11: 284-291.

Jiang L, Zhu L, Xu X, Li Y, Li S, Huang H (2013) Genome Sequence of Clostridium tyrobutyricum ATCC 25755, a Butyric Acid-Overproducing Strain. Genome Announc. 30:1(3). pii: e00308-13

Jiang W, Zhao J, Wang Z, Yang ST (2014) Stable high-titer n-butanol production from sucrose and sugarcane juice by Clostridium acetobutylicum JB200 in repeated batch fermentations. Bioresour Technol 163:172-179.

Jin L, Zhang H, Chen L, Yang C, Yang S, Jiang W, Gu Y (2014) Combined overexpression of genes involved in pentose phosphate pathway enables enhanced D-xylose utilization by Clostridium acetobutylicum. J Biotechnol. 173:7-9.

Jang YS, Lee JY, Lee J, Park JH, Im JA, Eom MH, Lee J, Lee SH, Song H, Cho JH, Seung do Y, Lee SY (2012) Enhanced butanol production obtained by reinforcing the direct butanol-forming route in Clostridium acetobutylicum. MBio. 3: e00314-12

Janssen H, Grimmler C, Ehrenreich A, Bahl H, Fischer RJ (2012) A transcriptional study 174 of acidogenic chemostat cells of Clostridium acetobutylicum-solvent stress caused by a transient n-butanol pulse. J Biotechnol. 161:354-365

Jones DT, Woods DR (1986) Acetone-butanol fermentation revisited. Microbiol Rev. 50: 484-524.

Jones BE, Dossonnet V, Küster E, Hillen W, Deutscher J, Klevit RE (1997) Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr. J Biol Chem. 272: 26530-5.

Kanouni AE, Zerdani I, Zaafa S, Znassni M, Loutfi M, Boudouma M (1998) The improvement of glucose/xylose fermentation by Clostridium acetobutylicum using calcium carbonate. World J. Microbiol. Biotechnol. 14:431-435

Kennedy CL, Krejany EO, Young LF, O'Connor JR, Awad MM, Boyd RL, Emmins JJ, Lyras D, Rood JI (2005) The alpha-toxin of Clostridium septicum is essential for virulence. Mol Microbiol. 57:1357-1366.

Kovács K, Willson BJ, Schwarz K, Heap JT, Jackson A, Bolam DN, Winzer K, Minton NP (2013) Secretion and assembly of functional mini-cellulosomes from synthetic chromosomal operons in Clostridium acetobutylicum ATCC 824. Biotechnol Biofuels 6: 117.

Kumar P, Barrett DM, Delwiche MJ, Stroeve P (2009) Methods for pretreatment of lignocellulosic biomass for efficient hydrolysis and biofuel production. Ind Eng Chem Res. 48: 3713-3729.

Kumar M, Gayen K (2011) Developments in biobutanol production: New insights Appl Ener. 88: 1999-2012.

Kumar M, Goyal Y, Sarkar A, Gayen K (2013) Comparative economic assessment of ABE fermentation based on cellulosic and non-cellulosic feedstocks. Appl Energy 93: 193–204.

Lathe WC, Suyama M, Bork P (2002) Identification of attenuation and antitermination regulation in prokaryotes. Genome Biology. 3: preprint0003.1

Lee SY, Park JH, Jang SH, Nielsen LK, Kim J, Jung KS (2008) Fermentative butanol production by Clostridia. Biotechnol Bioeng 101: 209-228.

Lee JY, Jang YS, Lee J, Papoutsakis ET, Lee SY (2009) Metabolic engineering of Clostridium acetobutylicum M5 for highly selective butanol production. J Biotechnol. 4: 1432-1440.

Lehmann D, Radomski N, Lütke-Eversloh T (2012) New insights into the butyric acid 175 metabolism of Clostridium acetobutylicum. Appl Microbiol Biotechnol. 96: 1325-39.

Lehmann D, Hönicke D, Ehrenreich A, Schmidt M, Weuster-Botz D, Bahl H, Lütke-Eversloh T (2012) Modifying the product pattern of Clostridium acetobutylicum: physiological effects of disrupting the acetate and acetone formation pathways. Appl Microbiol Biotechnol. 94:743-754

Liang WD, Bi YT, Wang HY, Dong S, Li KS, Li JS (2013) Gene expression profiling of Clostridium botulinum under heat shock stress. Biomed Res Int. 2013:760904.

Linton KJ, Higgins CF (1998) The Escherichia coli ATP-binding cassette (ABC) proteins. Mol Microbiol. 28: 5-13

Liu X, Zhu Y, Yang ST (2005) Butyric acid and hydrogen production by Clostridium tyrobutyricum ATCC 25755 and mutants. Enz Microb Technol .38: 521-528.

Liu X, Zhu Y, Yang ST (2006) Construction and characterization of ack deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid and hydrogen production. Biotechnol Prog. 22:1265-75.

Liu L, Zhang L, Tang W, Gu Y, Hua Q, Yang S, Jiang W, Yang C (2012) Phosphoketolase pathway for xylose catabolism in Clostridium acetobutylicum revealed by 13C metabolic flux analysis. J Bacteriol. 194: 5413-22.

Liu Z, Ying Y, Li F, Ma C, Xu P (2010) Butanol production by Clostridium beijerinckii ATCC 55025 from wheat bran. J Ind Microbiol Biotechnol 37: 495-501.

Lorca GL, Chung YJ, Barabote RD, Weyler W, Schilling CH, Saier MH Jr (2005) Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. J Bacteriol. 187:7826-39.

Lu CC (2011) Butanol Production from lignocellulosic feedstocks by Acetone-Butanol-Ethanol fermentation with integrated product recovery. PhD Dissertation, The Ohio State University

Lu C, Zhao J, Yang ST, Wei D (2012) Fed-batch fermentation for n-butanol production from cassava bagasse hydrolysate in a fibrous bed bioreactor with continuous gas stripping. Bioresour Technol 104: 380-7.

Lulko AT, Buist G, Kok J, Kuipers OP (2007) Transcriptome analysis of temporal regulation of carbon metabolism by CcpA in Bacillus subtilis reveals additional target genes. J Mol Microbiol Biotechnol. 12:82-95.

Lutke-Eversloh T, Bahl H (2011) Metabolic engineering of Clostridium acetobutylicum: Recent advances to improve butanol production. Curr Opin Biotechnol. 22: 634-647. 176

Lutke-Eversloh T (2014) Application of new metabolic engineering tools for Clostridium acetobutylicum. Appl Microbiol Biotechnol. 98:5823-5837.

Ma C, Kojima K, Xu N, Mobley J, Zhou L, Yang ST, Liu X (2015) Comparative proteomics analysis of high n-butanol producing metabolically engineered Clostridium tyrobutyricum, J Biotechnol 193: 108–119.

McMahon H, Zoecklein BW, Fugelsang K, Jasinski Y (1999) Quantification of glycosidase activities in selected yeasts and lactic acid bacteria. J Ind Microbiol Biotechnol. 23: 198-203

Maddox IS, Steiner E, Hirsch S, Wessner S, Gutierrez NA, Gapes JR, Schuster KC (2000) The cause of “acid crash” and “acidogenic fermentations” during the batch acetone-butanol-ethanol (ABE-) fermentation process. J Mol Microbiol Biotechnol. 2: 95-100.

Madihah MS, Ariff AB, Khalil MS, Suraini AA, Karim MI (2001) Anaerobic fermentation of gelatinized sago starch-derived sugars to acetone-1-butanol-ethanol solvent by Clostridium acetobutylicum. Folia Microbiol (Praha) 46:197-204.

Mariano AP, Dias MO, Junqueira TL, Cunha MP, Bonomi A, Filho RM (2013) Butanol production in a first-generation Brazilian sugarcane biorefinery: technical aspects and economics of greenfield projects. Bioresour Technol. 135:316-323.

Marvaud JC, Eisel U, Binz T, Niemann H, Popoff MR. (1998) TetR is a positive regulator of the tetanus toxin gene in Clostridium tetani and is homologous to botR. Infect Immun. 66: 5698-702.

McCrone A, Usher E, Sonntag-O’brien V, Moslener U, Gruning C (2014) Global trends in renewable energy investment 2014. www.ren21.net/gsr.

Mermelstein LD, Papoutsakis ET, Petersen DJ, Bennett GN (1993) Metabolic engineering of Clostridium acetobutylicum ATCC 824 for increased solvent production by enhancement of acetone formation enzyme-activities using a synthetic acetone operon. Biotechnol Bioeng. 42:1053-1060.

Mermelstein LD, Papoutsakis ET (1993) In vivo methylation in Escherichia coli by the Bacillus subtilis phage Φ3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 59:1077-1081.

Millat T, Voigt C, Janssen H, Cooksley CM, Winzer K, Minton NP, Bahl H, Fischer RJ, Wolkenhauer O (2014) Coenzyme A-transferase-independent butyrate re-assimilation in

177

Clostridium acetobutylicum-evidence from a mathematical model. Appl Microbiol Biotechnol. Epub ahead of print.

Mitchell WJ, Shaw JE and Andrews L (1991) Properties of the glucose phosphotransferase system of Clostridium acetobutylicum NCIB 8052. Appl Environ Microbiol. 57: 2534–2539.

Mitchell WJ, Tangney M. (2005). Carbohydrate uptake by the phosphotransferase system and other mechanisms. In Handbook on Clostridia, pp. 155-176. Edited by P. Durre. Boca Raton, FL: CRC Press.

Moreno MS, Schneider BL, Maile RR, Weyler W, Saier MH Jr (2004) Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation revealed by whole-genome analyses. Mol Microbiol 39: 1366-81.

Nair RV, Green EM, Watson DE, Bennett GN, Papoutsakis ET (1999) Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol. 181:319-330.

Nair RV, Papoutsakis ET (1994) Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production. J Bacteriol. 176:5843-6.

Nessler S, Fieulaine S, Poncet S, Galinier A, Deutscher J, Janin J (2003) HPr kinase/phosphorylase, the sensor enzyme of catabolite repression in Gram-positive bacteria: structural aspects of the enzyme and the complex with its protein substrate. J Bacteriol. 185: 4003-4010

Ni Y, Sun Z (2009) Recent progress on industrial fermentative production of acetone-butanol-ethanol by Clostridium acetobutylicum in China. Appl Microbiol Biotechnol. 83:415-23.

Nicolaou SA, Gaida SM, Papoutsakis ET (2010) A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: from biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng. 12:307-331.

Nölling J, Breton G, Omelchenko MV, Makarova KS, Zeng Q, Gibson R, Lee HM, Dubois J, Qiu D, Hitti J, Wolf YI, Tatusov RL, Sabathe F, Doucette-Stamm L, Soucaille P, Daly MJ, Bennett GN, Koonin EV, Smith DR (2001) Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum. J Bacteriol 183: 4823-4838.

Novichkov PS, Laikova ON, Novichkova ES, Gelfand MS, Arkin AP, Dubchak I, Rodionov DA (2010) RegPrecise: a database of curated genomic inferences of transcriptional regulatory interactions in prokaryotes. Nucleic Acids Res 38:D111-D118.

178

Ounine K, Petitdemange H, Raval G, Gay R (1985) Regulation and butanol inhibition of D-xylose and D-glucose uptake in Clostridium acetobutylicum. Appl Environ Microbiol. 49:874-878.

Papoutsakis ET (2008) Engineering solventogenic clostridia. Curr Opin Biotechnol 19: 420–429.

Paquet V, Croux C, Goma G, Soucaille P (1991) Purification and characterization of the extracellular alpha-amylase from Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 57: 212-218.

Parekh SR, Parekh RS, Wayman M (1988) Ethanol and butanol production by fermentation of enzymatically saccharified SO2-prehydrolysed lignocellulosics. Enzyme and Microbial Technology. 10: 660–668

Petersen DJ, Bennett GN (1990) Purification of acetoacetate decarboxylase from Clostridium acetobutylicum ATCC 824 and cloning of the acetoacetate decarboxylase gene in Escherichia coli. Appl Environ Microbiol. 56: 3491-3498.

Qureshi N, Blaschek HP (2000) Economics of butanol fermentation using hyper-butanol producing Clostridium beijerinckii BA101. Food and Bioproducts Processing. 78:139-144

Qureshi N, Blaschek HP (2001) ABE production from corn: a recent economic evaluation. J Ind Microbiol Biotechnol. 27:292-297

Qureshi N, Blaschek HP (2001) Recovery of butanol from fermentation broth by gas stripping. Renewable Energy. 22: 557-564.

Qureshi N, Saha BC, Cotta MA (2007) Butanol production from wheat straw hydrolysate using Clostridium beijerinckii. Bioprocess Biosyst Eng. 30: 419-27.

Qureshi N, Ezeji TC, Ebener J, Dien BS, Cotta MA, Blaschek HP (2008) Butanol production by Clostridium beijerinckii. Part I: use of acid and enzyme hydrolyzed corn fiber. Bioresour Technol 99: 5915-5922.

Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Cotta MA (2008) Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: Part I—Batch fermentation. Biomass and Bioenergy. 32: 168–175

Qureshi N, Saha BC, Cotta MA (2008) Butanol production from wheat straw by simultaneous saccharification and fermentation using Clostridium beijerinckii: Part

179

II—Fed-batch fermentation. Biomass and Bioenergy. 32: 176–183

Qureshi N, Saha BC, Dien B, Hector RE, Cotta MA (2010) Production of butanol (a biofuel) from agricultural residues: Part I – Use of barley straw hydrolysate. Biomass Bioenergy 34: 559-565.

Qureshi N, Saha BC, Hector RE, Dien B, Hughes S, Liu S, Iten L, Bowman MJ, Sarath G, Cotta MA (2010) Production of butanol (a biofuel) from agricultural residues: Part II - Use of corn stover and switchgrass hydrolysates. Biomass Bioenerg 34: 566-571.

Ravagnani A, Jennert KC, Steiner E, Grünberg R, Jefferies JR, Wilkinson SR, Young DI, Tidswell EC, Brown DP, Youngman P, Morris JG, Young M (2000) Spo0A directly controls the switch from acid to solvent production in solvent-forming clostridia. Mol Microbiol. 37:1172-85.

Rawsthorne H, Turner KN, Mills DA (2006) Multicopy integration of heterologous genes, using the lactococcal group II intron targeted to bacterial insertion sequences. Appl. Environ. Microbiol. 72: 6088-6093.

Ren C, Gu Y, Hu S, Wu Y, Wang P, Yang Y, Yang C, Yang S, Jiang W (2010) Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum. Metab Eng. 12: 446-54.

Rodionov DA, Mironov AA, Gelfand MS (2001) Transcriptional regulation of pentose utilisation systems in the Bacillus/Clostridium group of bacteria. FEMS Microbiol Lett. 205: 305-314.

Rutberg B (1997) Antitermination of transcription of catabolic operons. Mol Microbiol. 23:413-21

Rydzak T, Levin DB, Cicek N, Sparling R (2011) End-product induced metabolic shifts in Clostridium thermocellum ATCC 27405. Appl Microbiol Biotechnol. 92:199-209.

Schwarz KM, Kuit W, Grimmler C, Ehrenreich, A, Kengen, SWM (2012) A transcriptional study of acidogenic chemostat cells of Clostridium acetobutylicum - Cellular behavior in adaptation to n-butanol. J Biotechnol 161:366–377.

Servinsky MD, Kiel JT, Dupuy NF, Sund CJ (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. Microbiology. 156:3478-91.

Seo JH, Bailey JE (1985) Effects of recombinant plasmid content on growth properties and cloned gene product formation in Escherichia coli. Biotech Bioeng. 27: 1668-1674.

180

Shimizu T, Ohtani K, Hirakawa H, Ohshima K, Yamashita A, Shiba T, Ogasawara N, Hattori M, Kuhara S, Hayashi H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. PNAS. 99:996-1001.

Siller R, Chow A, Tracy B, Papoutsakis ET (2008) Metabolic engineering of the non-sporulating, non-solventogenic Clostridium acetobutylicumstrain M5 to produce butanol without acetone demonstrate the robustness of the acid-formation pathways and the importance of the electron balance. Metab Eng. 10: 321-332.

Sillers R, Al-Hinai MA, Papoutsakis ET (2009) Aldehyde-alcohol dehydrogenase and/or thiolase overexpression coupled with CoA transferase downregulation lead to higher alcohol titers and selectivity in Clostridium acetobutylicum fermentations. Biotechnol Bioeng. 102: 38-49.

Soni BK, Kapp C, Goma G, Soucaille P (1992) Solvent production from starch: effect of pH on α-amylase and glucoamylase localization and synthesis in synthetic medium. Appl Microbiol Biotechnol. 37: 539-534

Steiner E, Dago AE, Young DI, Heap JT, Minton NP, Hoch JA, Young M (2011) Multiple orphan histidine kinases interact directly with Spo0A to control the initiation of endospore formation in Clostridium acetobutylicum. Mol Microbiol 80:641-654.

Stöcker M (2008) Biofuels and biomass-to-liquid fuels in the biorefinery: catalytic conversion of lignocellulosic biomass using porous materials. Angewandte Chemie International Edition. 47: 9200-11.

Tappy L, Lê KA (2010) Metabolic effects of fructose and the worldwide increase in obesity. Physiol Rev. 90:23-46.

Tangney M, Mitchell WJ (2000) Analysis of a catabolic operon for sucrose transport and metabolism in Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol. 2:71-80

Tangney M, Winters GT, Mitchell WJ (2001) Characterization of a maltose transport system in Clostridium acetobutylicum ATCC 824. J Ind Microbiol Biotechnol. 27: 298-306.

Tangney M, Galinier A, Deutscher J, Mitchell WJ (2003) Analysis of the elements of catabolite repression in Clostridium acetobutylicum ATCC 824. J Mol Microbiol Biotechnol. 6: 6-11.

Tangney M, Mitchell WJ (2007). Characterisation of a glucose phosphotransferase system in Clostridium acetobutylicum ATCC 824. Appl Microbiol Biotechnol. 74: 398-405.

181

Thompson J, Hess S, Pikis A. (2004) Genes malh and pagl of Clostridium acetobutylicum ATCC 824 encode NAD+ - and Mn2+ - dependent phospho-a-glucosidase(s). J Biol Chem. 279: 1553-1561.

Thompson AB, Cope SJ, Swift TD, Notestein JM (2011) Adsorption of n-butanol from dilute aqueous solution with grafted calixarenes. Langmuir. 27:11990-8.

Thormann K, Feustel L, Lorenz K, Nakotte S, Dürre P (2002) Control of butanol formation in Clostridium acetobutylicum by transcriptional activation. J Bacteriol. 184: 1966-1973

Titgemeyer F, Hillen W (2002) Global control of sugar metabolism: a gram-positive solution. Antonie Van Leeuwenhoek. 82:59-71.

Tomas CA, Welker NE, Papoutsakis ET (2003) Overexpression of groESL in Clostridium acetobutylicum results in increased solvent production and tolerance, prolonged metabolism, and changes in the cell's transcriptional program. Appl Environ Microbiol. 69:4951-4965.

Tomas CA, Beamish J, Papoutsakis ET (2004) Transcriptional analysis of butanol stress and tolerance in Clostridium acetobutylicum. J Bacteriol 186:2006–2018

Tummala SB, Junne SG, Papoutsakis ET (2003) Antisense RNA downregulation of coenzyme A transferase combined with alcohol-aldehyde dehydrogenase overexpression leads to predominantly alcohologenic Clostridium acetobutylicum fermentations. J Bacteriol. 185: 3644-3653.

Tummala SB, Welker NE, Papoutsakis ET (1999) Development and characterization of a gene expression reporter system for Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 65:3793–3799

Twine SM, Reid CW, Aubry A, McMullin DR, Fulton KM, Austin J, Logan SM (2009) Motility and flagellar glycosylation in Clostridium difficile. J Bacteriol. 191:7050-62

Ventura S, Hu H, Jahng D (2013) Enhanced butanol production in Clostridium acetobutylicum ATCC 824 by double overexpression of 6-phosphofructokinase and pyruvate kinase genes. Appl Microbiol Biotechnol 97: 7505-7516.

Walter KA, Mermelstein LD, Papoutsakis ET (1994) Studies of recombinant Clostridium acetobutylicum with increased dosages of butyrate formation genes. Ann NY Acad Sci. 721:69-72

Wang L, Chen H (2011) Increased fermentability of enzymatically hydrolyzed steam-exploded corn stover for butanol production by removal of fermentation inhibitors. 182

Process Biochem 46: 604-607

Wang S, Zhang Y, Dong H, Mao S, Zhu Y, Wang R, Luan G, Li Y (2011) Formic acid triggers the "Acid Crash" of acetone-butanol-ethanol fermentation by Clostridium acetobutylicum. Appl Environ Microbiol. 77:1674-80.

Wang S, Zhu Y, Zhang Y, Li Y (2012) Controlling the oxidoreduction potential of the culture of Clostridium acetobutylicum leads to an earlier initiation of solventogenesis, thus increasing solvent productivity. Appl Microbiol Biotechnol 93: 1021-1030.

Wang Q, Venkataramanan KP, Huang H, Papoutsakis ET, Wu CH (2013) Transcription factors and genetic circuits orchestrating the complex, multilayered response of Clostridium acetobutylicum to butanol and butyrate stress. BMC Syst Biol 7:120.

Wang J, Yang X, Chen CC, Yang ST (2014) Engineering clostridia for butanol production from biorenewable resources: from cells to process integration, Curr Opin Chem Eng 6:43-54.

Wiehn M, Staggs K, Wang Y, Nielsen DR (2014) In situ butanol recovery from Clostridium acetobutylicum fermentations by expanded bed adsorption. Biotech Progress. 30: 68-78

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989) Coenzyme A transferase from Clostridium acetobutylicum ATCC 824 and its role in the uptake of acids. Appl Environ Microbiol. 55: 323-329.

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1989) Phosphotransbutyrylase from Clostridium acetobutylicum ATCC 824 and its role in acidogenesis. Appl Environ Microbiol. 55:317-322

Williams DR, Young DI, Young M (1990) Conjugative plasmid transfer from Escherichia coli to Clostridium acetobutylicum. Microbiology 136: 819-826.

Woods DR (1995) The genetic engineering of microbial solvent production. Trends Biotechnol. 13:259-264.

Wu ZT, Yang ST (2003) Extractive fermentation for butyric acid production from glucose by Clostridium tyrobutyricum. Biotech Bioeng. 82: 93-102.

Wu Y, Yang Y, Ren C, Yang C, Yang S, Gu Y, Jiang W (2015) Molecular modulation of pleiotropic regulator CcpA for glucose and xylose coutilization by solvent-producing Clostridium acetobutylicum. Metab Eng 28: 169-179.

Xiao H, Gu Y, Ning Y, Yang Y, Mitchell WJ, Jiang W, Yang S (2011) Confirmation and 183 elimination of xylose metabolism bottlenecks in glucose phosphoenolpyruvate-dependent phosphotransferase system-deficient Clostridium acetobutylicum for simultaneous utilization of glucose, xylose, and arabinose. Appl Environ Microbiol. 77: 7886-7895.

Xiao H, Li Z, Jiang Y, Yang Y, Jiang W, Gu Y, Yang S (2012) Metabolic engineering of D-xylose pathway in Clostridium beijerinckii to optimize solvent production from xylose mother liquid. Metab Eng 14: 569-78.

Xin F, Wu YR, He J (2014) Simultaneous fermentation of glucose and xylose to butanol by Clostridium sp. strain BOH3. Appl Environ Microbiol 80: 4771-8.

Xu M, Zhao J, Yu L, Tang IC, Xue C, Yang ST (2015) Engineering Clostridium acetobutylicum with a histidine kinase knockout for enhanced n-butanol tolerance and production. Appl Microbiol Biotechnol. 99:1011-22.

Xue C, Zhao J, Lu C, Yang ST, Bai F, Tang IC (2012) High-titer n-butanol production by Clostridium acetobutylicum JB200 in fed-batch fermentation with intermittent gas stripping. Biotechnol Bioeng 109: 2746-2756.

Xue C, Zhao XQ, Liu CG, Chen LJ, Bai FW (2013) Prospective and development of butanol as an advanced biofuel. Biotechnol Adv. 31:1575-1584.

Xue C, Zhao J, Sun JX, Jie CL, Bai FW, Yang ST (2014) Integrated butanol recovery for an advanced biofuel: current state and prospects. Appl Microbiol Biotechnol 98: 3463-3474.

Yanofsky C (2000) Transcription attenuation: once viewed as a novel regulatory strategy. J Bacteriol. 182:1-8

Yao R, Shimizu K (2013) Recent progress in metabolic engineering for the production of biofuels and biochemicals from renewable sources with particular emphasis on catabolite regulation and its modulation, Process Biochem 48: 1409-1417.

Yokoyama S, Oshima K, Nomura I, Hattori M, Suzuki T (2011) Complete genomic sequence of the O-desmethylangolensin-producing bacterium Clostridium rRNA cluster XIVa strain SY8519, isolated from adult human intestine. J Bacteriol. 193: 5568-9.

Yang S (2013) “Optimizing pentose utilization in clostridia for improved solvents production from lignocellulosic hydrolysates” in “Metabolic Engineering IX”, Eds, ECI Symposium Series, Volume P18. http://dc.engconfintl.org/metabolic_ix/7

Yang ST, Zhao JB (2013) Adaptive engineering of Clostridium for increased butanol production. US Patent 8450093.

184

Yu Y, Tangney M, Aass HC, Mitchell WJ (2007) Analysis of the mechanism and regulation of lactose transport and metabolism in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 73: 1842-1850.

Yu M, Zhang Y, Tang IC, Yang ST (2011) Metabolic engineering of Clostridium tyrobutyricum for n-butanol production. Metab Eng. 13: 373-382.

Yu M, Du Y, Jiang W, Chang WL, Yang ST, Tang IC (2012) Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl Microbiol Biotechnol. 93: 881-9.

Zhang XZ, Yan X, Cui ZL, Hong Q, Li SP (2006) mazF, a novel counterselectable marker for unmarked chromosomal manipulation in Bacillus subtilis. Nucleic Acids Res. 34:e71.

Zhang YL, Yu MR, Yang ST (2012) Effects of ptb knockout on butyric acid fermentation by Clostridium tyrobutyricum. Biotechnol Prog. 28: 52-59.

Zhao Y, Hindorff LA, Chuang A, Monroe-Augustus M, Lyristis M, Harrison ML, Rudolph FB, Bennett GN (2003) Expression of a cloned cyclopropane fatty acid synthase gene reduces solvent formation in Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol. 69:2831-2841

Zhao J, Lu C, Chen CC, Yang ST (2013) Biological production of butanol and higher alcohols, in Yang ST, El-Enshasy HA, Thongchul N. (eds.) Bioprocessing Technologies in Biorefinery for Sustainable Production of Fuels, Chemicals, and Polymers, Wiley, Ch. 13, pp. 235-261.

Zheng YN, Li LZ, Xian M, Ma YJ, Yang JM, Xu X, He DZ (2009) Problems with the microbial production of butanol. J Ind Microbiol Biotechnol. 36:1127-38.

Zhong J, Karberg M, Lambowitz AM (2003) Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic Acids Res. 31:1656-1664

Zhu Y, Yang ST (2003) Adaptation of Clostridium tyrobutyricum for enhanced tolerance to butyric acid in a fibrous-bed bioreactor. Biotechnol Progr. 19:365-372.

Zhu Y, Liu X, Yang ST (2004) Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotech Bioeng. 90: 154-166.

185

Appendix A: Gas chromatography (GC) and high performance liquid

chromatography (HPLC) diagrams

A.1 GC standard diagram

Figure A.1 GC standard diagram for analysis of acetone, ethanol, butanol, acetate, and butyrate using isobutanol and isobutyrate as inner standard (10.0 g/L for each chemical, samples were diluted by 20-fold)

186

A.2 GC sample diagram of C. tyrobutyricum expressing adhE2 and co-expressing

adhE2 and ctfAB

A

B

Figure A.2 GC diagrams for analysis of samples in fermentation of C. tyrobutyricum expressing adhE2 (A) and co-expressing adhE2 and ctfAB (B). Samples were taken at the same time and diluted by 20-fold.

187

A.3 GC sample diagram of C. tyrobutyricum expressing agluI or agluII using maltose

and soluble starch

A

B

Figure A.3 GC diagrams for analysis of samples in fermentation of C. tyrobutyricum expressing agluI or agluII using maltose (A) and soluble starch (B). Samples were taken at the same time and diluted by 20-fold.

188

A.4 GC sample diagram of C. tyrobutyricum with pTBA

Figure A.4 GC diagrams for analysis of samples in fermentation of glucose and xylose by C. tyrobutyricum with pTBA. Samples were taken at the same time and diluted by 20-fold.

189

A.5 HPLC standard diagram

20 RI det RI det 20 Retention Time Name 18 Name Retention Time 18 Height Height 16 16

14 6457 14

6599

4699

12 4819 12

Acetate

10 Butyrate 10

ethanol

Butanol

8 8

16.608 23.942

6 6

21.733

36.933 uRIU uRIU 4 4

2 2

0 0

-2 -2

18063

-4 17073 -4

-6 10.467 -6

11.175

-8 -8

Glucose xylose -10 -10 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes Figure A.5 HPLC standard diagram for analysis of glucose, xylose, ethanol, butanol, acetate, and butyrate (2.0 g/L for each chemical).

190

A.6 HPLC sample diagram of C. tyrobutyricum expressing adhE2 and co-expressing

adhE2 and ctfAB

10 RI det 10 A Retention Time 9 Name 9 8 Height 8

7 7

6 1858 6

1156

947

5 5

164

4 Acetate 4

Butyrate Butanol

3 3

286

46

ethanol

15.175

2 2

21.933 36.500

1 1

8.358

uRIU uRIU

21.083 6.275 0 0

-1 -1

-2 -2

-3 -3 8226

-4 -4

-5 -5

-6 Glucose -6

-7 -7 9.083 -8 -8 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes

10 RI det 10 Retention Time 9 Name 9 B 8 Height 8

7 7 1828

6 6

5 5

317

97

4 Butanol 4

3 305 3

418

Butyrate

49

ethanol

36.492

2 2

1 1

8.367

13.000

21.950

uRIU uRIU

21.083 6.267 0 0

-1 -1

-2 -2

-3 -3 7349

-4 -4

-5 -5

-6 Glucose -6

-7 -7 9.083 -8 -8 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes Figure A.6 HPLC diagrams for sample analysis of C. tyrobutyricum expressing adhE2 (A) and co-expressing adhE2 and ctfAB (B)

191

A.7 HPLC sample diagram of C. tyrobutyricum expressing agluI or agluII using

maltose as substrate.

18 18 A RI det Retention Time Name 16 Height 16

14 14

12 12

10 10 uRIU uRIU 8 8

6 6

264

4 4

15736

260

Glucose

2 2

Maltose

14.392 8.233

0 0 12.525

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes

10 RI det 10 B Retention Time Name 9 Height 9

8 8

7 7

6 6

5 5

uRIU uRIU

4 4 543

3 3

968

632

970

754

2 Glucose 2

353

9.850 10.858 33.233

1 11.900 1

14.408

8.233

0 0

-1 -1 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes Figure A.7 HPLC diagrams for sample analysis of C. tyrobutyricum expressing agluI or agluII using maltose as substrate (A, initial sample; B, last sample)

192

A.8 HPLC sample diagram of C. tyrobutyricum expressing agluI or agluII using

soluble starch as substrate

37.5 RI det 37.5 A Retention Time 35.0 Name 35.0 Height 32.5 32.5

30.0 30.0

27.5 27.5

25.0 25.0

22.5 22.5

20.0 20.0

17.5 17.5

uRIU uRIU

15.0 15.0

12.5 12.5

8763

18335

10.0 10.0

7.5 16241 7.5

2103

8.017

Glucose

5.0 5.0

2.5 8.850 2.5

Starch

10.458

0.0 0.0

-2.5 7.067 -2.5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Minutes

RI det Retention Time B 14 14 Name

Height

11139 11249

12 12

10 8.817 10

7.983

8957

8901

8 8

7.500 7.492

6 6

3597

uRIU uRIU

4 4

Starch 483

437

2 2

7.192

23.975 16.633

0 9739 0

-2 -2

Glucose

-4 -4 10.467

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Minutes Figure A.8 HPLC diagrams for sample analysis of C. tyrobutyricum expressing agluI or agluII using soluble starch as substrate (A, initial sample; B, last sample)

193

A.9 HPLC sample diagram of C. tyrobutyricum with pTBA co-utilizing glucose and

xylose

20 RI det 20 A Retention Time Name 18 Height 18

16 16

14 14

12 12

10 10

uRIU uRIU

8 8

6 1 6

4 17015 4

16179

117

0

143

acid Acetic

2 2

xylose

Glucose

7.858

18.283

16.008

16.033

0 0

9.342 10.008

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes

10 RI det 10 Retention Time B Name 9 Height 9

8 8

7 7

6 6

5 5

uRIU uRIU

1534

4 1466 4

1169

1155

357

3 Xylose 3

Butyrate

Butanol

Acetate

2 301 2

10.000

21.717

ethanol

116

35.200

15.167

1 1

20.642

10.600

7.842

0 0

-1 -1 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes Figure A.9 GC diagrams for analysis of samples in fermentation of glucose and xylose in CGM by C. tyrobutyricum with pTBA (A, initial sample; B, last sample).

194

A.10 HPLC sample diagram of C. tyrobutyricum with pTBA in soybean hull

hydrolysate

20 20 A RI det Retention Time Name 18 Height 18

16 16

14 14

12 12

10 10

uRIU uRIU

8 8

700

255

6 6 1402

4 4

950

740

709

678

665

17367

acid Acetic

acid Butyric

19309

2 6.892 2

8.917

7.317

9.242 16.617

8.200

9.708

23.967

Glucose xylose

0 0

10.475 11.175 -2 -2 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes

10 RI det 10 B Retention Time Name 9 Height 9

8 8

7 7

3304

6 6

3769

5 5

1670

acid Butyric

uRIU uRIU

4 11.167 4

23.950

740

728

Acetic acid Acetic

3 1539 3

530

160

985

987

552

710

Butanol

351 326

2 16.608 2

Glucose

6.900

xylose

2

Ethanol

8.908

7.367

9.217 37.000

1 8.183 1

10.500

9.708

18.133

12.200

21.733 16.033 0 0

-1 -1 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Minutes Figure A.10 GC diagrams for analysis of samples in fermentation of glucose and xylose in soybean hull hydrolysate by C. tyrobutyricum with pTBA (A, initial sample; B, last sample).

195

Appendix B: Supplementary materials in the study of effects of CoA transferase

B.1 Gene adhE2 sequence of C. acetobutylicum with C. tyrobutyricum thl promoter

CTGAATATTCAGCGAAAATAGTATATTATATAATTATAAATTGATGAATAGCTAGA GTGGTCAGACCTCCTAGCTATTGTTTTAGAAAACTTTGTGTTTTTTTTAACAAA AATATTGATAAATTTTTAATTATCTAGTATAATGAAGTTGTTGGTAAAAAGGTTT GTAATCAATTTAAATTTGGATCCATAAATATTTAGGAGGAATAGTCATGAAAGTT ACAAATCAAAAAGAACTAAAACAAAAGCTAAATGAATTGAGAGAAGCGCAAA AGAAGTTTGCAACCTATACTCAAGAGCAAGTTGATAAAATTTTTAAACAATGT GCCATAGCCGCAGCTAAAGAAAGAATAAACTTAGCTAAATTAGCAGTAGAAGA AACAGGAATAGGTCTTGTAGAAGATAAAATTATAAAAAATCATTTTGCAGCAG AATATATATACAATAAATATAAAAATGAAAAAACTTGTGGCATAATAGACCATGA CGATTCTTTAGGCATAACAAAGGTTGCTGAACCAATTGGAATTGTTGCAGCCAT AGTTCCTACTACTAATCCAACTTCCACAGCAATTTTCAAATCATTAATTTCTTTA AAAACAAGAAACGCAATATTCTTTTCACCACATCCACGTGCAAAAAAATCTAC AATTGCTGCAGCAAAATTAATTTTAGATGCAGCTGTTAAAGCAGGAGCACCTA AAAATATAATAGGCTGGATAGATGAGCCATCAATAGAACTTTCTCAAGATTTGA TGAGTGAAGCTGATATAATATTAGCAACAGGAGGTCCTTCAATGGTTAAAGCG GCCTATTCATCTGGAAAACCTGCAATTGGTGTTGGAGCAGGAAATACACCAGC AATAATAGATGAGAGTGCAGATATAGATATGGCAGTAAGCTCCATAATTTTATCA AAGACTTATGACAATGGAGTAATATGCGCTTCTGAACAATCAATATTAGTTATG AATTCAATATACGAAAAAGTTAAAGAGGAATTTGTAAAACGAGGATCATATATA CTCAATCAAAATGAAATAGCTAAAATAAAAGAAACTATGTTTAAAAATGGAGC TATTAATGCTGACATAGTTGGAAAATCTGCTTATATAATTGCTAAAATGGCAGGA ATTGAAGTTCCTCAAACTACAAAGATACTTATAGGCGAAGTACAATCTGTTGAA AAAAGCGAGCTGTTCTCACATGAAAAACTATCACCAGTACTTGCAATGTATAA AGTTAAGGATTTTGATGAAGCTCTAAAAAAGGCACAAAGGCTAATAGAATTAG GTGGAAGTGGACACACGTCATCTTTATATATAGATTCACAAAACAATAAGGATA AAGTTAAAGAATTTGGATTAGCAATGAAAACTTCAAGGACATTTATTAACATGC CTTCTTCACAGGGAGCAAGCGGAGATTTATACAATTTTGCGATAGCACCATCAT TTACTCTTGGATGCGGCACTTGGGGAGGAAACTCTGTATCGCAAAATGTAGAG CCTAAACATTTATTAAATATTAAAAGTGTTGCTGAAAGAAGGGAAAATATGCTT TGGTTTAAAGTGCCACAAAAAATATATTTTAAATATGGATGTCTTAGATTTGCAT TAAAAGAATTAAAAGATATGAATAAGAAAAGAGCCTTTATAGTAACAGATAAA GATCTTTTTAAACTTGGATATGTTAATAAAATAACAAAGGTACTAGATGAGATA GATATTAAATACAGTATATTTACAGATATTAAATCTGATCCAACTATTGATTCAGT 196

AAAAAAAGGTGCTAAAGAAATGCTTAACTTTGAACCTGATACTATAATCTCTAT TGGTGGTGGATCGCCAATGGATGCAGCAAAGGTTATGCACTTGTTATATGAATA TCCAGAAGCAGAAATTGAAAATCTAGCTATAAACTTTATGGATATAAGAAAGA GAATATGCAATTTCCCTAAATTAGGTACAAAGGCGATTTCAGTAGCTATTCCTAC AACTGCTGGTACCGGTTCAGAGGCAACACCTTTTGCAGTTATAACTAATGATG AAACAGGAATGAAATACCCTTTAACTTCTTATGAATTGACCCCAAACATGGCAA TAATAGATACTGAATTAATGTTAAATATGCCTAGAAAATTAACAGCAGCAACTG GAATAGATGCATTAGTTCATGCTATAGAAGCATATGTTTCGGTTATGGCTACGGA TTATACTGATGAATTAGCCTTAAGAGCAATAAAAATGATATTTAAATATTTGCCT AGAGCCTATAAAAATGGGACTAACGACATTGAAGCAAGAGAAAAAATGGCAC ATGCCTCTAATATTGCGGGGATGGCATTTGCAAATGCTTTCTTAGGTGTATGCCA TTCAATGGCTCATAAACTTGGGGCAATGCATCACGTTCCACATGGAATTGCTTG TGCTGTATTAATAGAAGAAGTTATTAAATATAACGCTACAGACTGTCCAACAAA GCAAACAGCATTCCCTCAATATAAATCTCCTAATGCTAAGAGAAAATATGCTGA AATTGCAGAGTATTTGAATTTAAAGGGTACTAGCGATACCGAAAAGGTAACAG CCTTAATAGAAGCTATTTCAAAGTTAAAGATAGATTTGAGTATTCCACAAAATAT AAGTGCCGCTGGAATAAATAAAAAAGATTTTTATAATACGCTAGATAAAATGTC AGAGCTTGCTTTTGATGACCAATGTACAACAGCTAATCCTAGGTATCCACTTAT AAGTGAACTTAAGGATATCTATATAAAATCATTTTAA

B.2 Gene ctfAB sequence of C. acetobutylicum

ATGAACTCTAAAATAATTAGATTTGAAAATTTAAGGTCATTCTTTAAAGATGGG ATGACAATTATGATTGGAGGTTTTTTAAACTGTGGCACTCCAACCAAATTAATT GATTTTTTAGTTAATTTAAATATAAAGAATTTAACGATTATAAGTAATGATACATG TTATCCTAATACAGGTATTGGTAAGTTAATATCAAATAATCAAGTAAAAAAGCTT ATTGCTTCATATATAGGCAGCAACCCAGATACTGGCAAAAAACTTTTTAATAAT GAACTTGAAGTAGAGCTCTCTCCCCAAGGAACTCTAGTGGAAAGAATACGTG CAGGCGGATCTGGCTTAGGTGGTGTACTAACTAAAACAGGTTTAGGAACTTTG ATTGAAAAAGGAAAGAAAAAAATATCTATAAATGGAACGGAATATTTGTTAGA GCTACCTCTTACAGCCGATGTAGCATTAATTAAAGGTAGTATTGTAGATGAGGC CGGAAACACCTTCTATAAAGGTACTACTAAAAACTTTAATCCCTATATGGCAAT GGCAGCTAAAACCGTAATAGTTGAAGCTGAAAATTTAGTTAGCTGTGAAAAAC TAGAAAAGGAAAAAGCAATGACCCCCGGAGTTCTTATAAATTATATAGTAAAG GAGCCTGCATAAAATGATTAATGATAAAAACCTAGCGAAAGAAATAATAGCCA AAAGAGTTGCAAGAGAATTAAAAAATGGTCAACTTGTAAACTTAGGTGTAGGT CTTCCTACCATGGTTGCAGATTATATACCAAAAAATTTCAAAATTACTTTCCAAT CAGAAAACGGAATAGTTGGAATGGGCGCTAGTCCTAAAATAAATGAGGCAGAT AAAGATGTAGTAAATGCAGGAGGAGACTATACAACAGTACTTCCTGACGGCAC ATTTTTCGATAGCTCAGTTTCGTTTTCACTAATCCGTGGTGGTCACGTAGATGTT ACTGTTTTAGGGGCTCTCCAGGTAGATGAAAAGGGTAATATAGCCAATTGGATT GTTCCTGGAAAAATGCTCTCTGGTATGGGTGGAGCTATGGATTTAGTAAATGGA 197

GCTAAGAAAGTAATAATTGCAATGAGACATACAAATAAAGGTCAACCTAAAAT TTTAAAAAAATGTACACTTCCCCTCACGGCAAAGTCTCAAGCAAATCTAATTGT AACAGAACTTGGAGTAATTGAGGTTATTAATGATGGTTTACTTCTCACTGAAAT TAATAAAAACACAACCATTGATGAAATAAGGTCTTTAACTGCTGCAGATTTACT CATATCCAATGAACTTAGACCCATGGCTGTTTAG

B.3 sol operon of C. beijerinckii adhE, ctfAB and adc genes are shown in grey, blue and green, respectively

ATGAATAAAGACACACTAATACCTACAACTAAAGATTTAAAAGTAAAAACAAA TGGTGAAAACATTAATTTAAAGAACTACAAGGATAATTCTTCATGTTTCGGAGT ATTCGAAAATGTTGAAAATGCTATAAGCAGCGCTGTACACGCACAAAAGATATT ATCCCTTCATTATACAAAAGAGCAAAGAGAAAAAATCATAACTGAGATAAGAA AGGCCGCATTACAAAATAAAGAGGTCTTGGCTACAATGATTCTAGAAGAAACA CATATGGGAAGATATGAGGATAAAATATTAAAACATGAATTGGTAGCTAAATATA CTCCTGGTACAGAAGATTTAACTACTACTGCTTGGTCAGGTGATAATGGTCTTA CAGTTGTAGAAATGTCTCCATATGGTGTTATAGGTGCAATAACTCCTTCTACGA ATCCAACTGAAACTGTAATATGTAATAGCATAGGCATGATAGCTGCTGGAAATG CTGTAGTATTTAACGGACACCCATGCGCTAAAAAATGTGTTGCCTTTGCTGTTG AAATGATAAATAAGGCAATTATTTCATGTGGCGGTCCTGAAAATCTAGTAACAA CTATAAAAAATCCAACTATGGAGTCTCTAGATGCAATTATTAAGCATCCTTCAAT AAAACTTCTTTGCGGAACTGGGGGTCCAGGAATGGTAAAAACCCTCTTAAATT CTGGTAAGAAAGCTATAGGTGCTGGTGCTGGAAATCCACCAGTTATTGTAGAT GATACTGCTGATATAGAAAAGGCTGGTAGGAGCATCATTGAAGGCTGTTCTTTT GATAATAATTTACCTTGTATTGCAGAAAAAGAAGTATTTGTTTTTGAGAATGTT GCAGATGATTTAATATCTAACATGCTAAAAAATAATGCTGTAATTATAAATGAAG ATCAAGTATCAAAATTAATAGATTTAGTATTACAAAAAAATAATGAAACTCAAG AATACTTTATAAACAAAAAATGGGTAGGAAAAGATGCAAAATTATTCTTAGATG AAATAGATGTTGAGTCTCCTTCAAATGTTAAATGCATAATCTGCGAAGTAAATG CAAATCATCCATTTGTTATGACAGAACTCATGATGCCAATATTGCCAATTGTAAG AGTTAAAGATATAGATGAAGCTATTAAATATGCAAAGATAGCAGAACAAAATAG AAAACATAGTGCCTATATTTATTCTAAAAATATAGACAACCTAAATAGATTTGAA AGAGAAATAGATACTACTATTTTTGTAAAGAATGCTAAATCTTTTGCTGGTGTT GGTTATGAAGCAGAAGGATTTACAACTTTCACTATTGCTGGATCTACTGGTGAG GGAATAACCTCTGCAAGGAATTTTACAAGACAAAGAAGATGTGTACTTGCCGG CTAATTTCTTGCTAAATTTATACATTTATTCACATAACTTTAATATGCAATATTCCC ACAAAATATTAAAAACTATTTAGAAGGGAGATATTAAAATGAATAAATTAGTAA AATTAACAGATTTAAAGCGCATTTTCAAAGATGGCATGACAATTATGGTTGGGG GTTTTTTAGATTGTGGAACTCCTGAAAATATTATAGATATGCTAGTTGATTTAAA TATAAAAAATCTGACTATTATAAGCAATGATACAGCTTTTCCTAATAAAGGAATA GGAAAACTTATTGTAAATGGTCAAGTTTCTAAAGTAATTGCTTCACATATTGGA 198

ACTAATCCTGAAACTGGAAAAAAAATGAGCTCTGGAGAACTTAAAGTTGAGC TTTCCCCACAAGGAACACTGATTGAAAGAATTCGTGCAGCTGGATCTGGACTC GGAGGTGTATTAACTCCAACTGGACTTGGAACTATCGTTGAAGAAGGTAAGAA AAAAGTTACTATCGATGGCAAAGAATATCTATTAGAACTTCCTTTATCTGCTGAT GTTTCATTAATAAAAGGTAGCATTGTAGATGAATTTGGAAATACCTTCTATAGGG CTGCTACTAAAAATTTCAATCCATATATGGCAATGGCTGCAAAAACAGTTATAG TTGAAGCAGAAAATTTAGTTAAATGTGAAGATTTAAAAAGAGATGCCATAATG ACTCCTGGCGTATTAGTAGATTATATCGTTAAGGAGGCGGCTTAATTGATTGTAG ATAAAGTTTTAGCAAAAGAGATAATTGCCAAAAGAGTTGCAAAAGAACTAAA AAAAGACCAACTCGTAAACCTTGGAATAGGACTTCCAACTTTAGTAGCAAATT ATGTACCAAAAGAAATGAACATTACTTTTGAATCAGAAAATGGCATGGTTGGTA TGGCACAAATGGCATCATCAGGTGAAAATGACCCAGATATAATAAATGCTGGC GGGGAATATGTAACATTATTACCTCAAGGTTCATTTTTTGATAGTTCAATGTCTT TCGCACTAATACGAGGAGGACATGTTGATGTTGCTGTTCTTGGTGCTCTAGAA GTTGATGAAAAAGGTAATTTAGCTAACTGGATTGTTCCAAATAAAATTGTCCCA GGTATGGGTGGCGCTATGGATTTAGCAATAGGCGCAAAAAAAATAATAGTGGC AATGCAACATACAGGAAAAAGTAAACCTAAAATCGTTAAAAAATGTACTCTCC CACTTACTGCTAAGGCTCAAGTGGATTTAATTGTCACAGAACTTTGTGTAATTG ATGTAACAAATGACGGCTTACTTTTAAAAGAAATTCATAAAGATACAACTATTG ATGAAATTAAATTTTTAACAGATGCAGATTTAATTATTCCAGATAACTTAAAGAT TATGGATATATGAATCATTCTATTTTAAATATATAACTTTAAAAATCTTATGTATTA AAAACTAAGAAAAGAGGTTGATTGTTTTATGTTAGAAAGTGAAGTATCTAAAC AAATTACAACTCCACTTGCTGCTCCAGCGTTTCCTAGAGGACCATATAGGTTTC ACAATAGAGAATATCTAAACATTATTTATCGAACTGATTTAGATGCTCTTCGAAA AATAGTACCAGAGCCACTTGAATTAGATAGAGCATATGTTAGATTTGAAATGAT GGCTATGCCTGATACAACCGGACTAGGCTCATATACAGAATGTGGTCAAGCTAT TCCAGTAAAATATAATGGTGTTAAGGGTGACTACTTGCATATGATGTATCTAGAT AATGAACCTGCTATTGCTGTTGGAAGAGAAAGTAGCGCTTATCCAAAAAAGCT TGGCTATCCAAAGCTATTTGTTGATTCAGATACTTTAGTTGGGACACTTAAATAT GGTACATTACCAGTAGCTACTGCAACAATGGGATATAAGCACGAGCCTCTAGAT CTTAAAGAAGCCTATGCTCAAATTGCAAGACCCAATTTTATGCTAAAAATCATT CAAGGTTACGATGGTAAGCCAAGAATTTGTGAACTAATATGTGCAGAAAATAC TGATATAACTATTCACGGTGCTTGGACTGGAAGTGCACGTCTACAATTATTTAG CCATGCACTAGCTCCTCTTGCTGATTTACCTGTATTAGAGATTGTATCAGCATCT CATATCCTCACAGATTTAACTCTTGGAACACCTAAGGTTGTACATGATTATCTTT CAGTAAAATAA

199

Table B.1 Summary of fermentation kinetics of various C. tyrobutyricum mutants

Specific Highest Strain Butanol Acetone Ethanol Acetate Butyrate growth OD rate

Titer (g/L) Yield (g/g) Productivity (g/L·h) Titer (g/L) Titer (g/L) Titer (g/L) Titer (g/L) (h-1)

pH 6.0 pMAD72 10.2±0.3 0.10±0.01 0.13±0.03 0 0.90±0.20 5.7±1.4 13.7±1.9 28.0 0.16±0.01

pMAT 12.3±0.6 0.22±0.01 0.31±0.01 6.5±0.6 0.90±0.14 2.6±0.3 3.4±0.4 12.4 0.16±0.02

pSOL 12.6±0.2 0.19±0.01 0.34±0.01 7.4±0.6 0.50±0.04 2.5±0.3 4.5±0.4 10.4 0.18±0.02

200 pSV6 13.4±0.4 0.21±0.01 0.35±0.01 7.0±0.6 0.60±0.11 1.6±0.1 3.1±0.7 11.5 0.16±0.01

pH 5.0 pMAD72 8.9±0.1 0.14±0.03 0.13±0.04 0 0.70±0.25 3.9±0.3 11.0±1.8 21.7 0.16±0.01

pMAT 8.4±0.1 0.22±0.05 0.23±0.03 4.0±0.3 0.90±0.37 1.5±0.1 1.5±0.0 13.3 0.18±0.01

pSOL 8.7±0.1 0.18±0.01 0.24±0.03 3.9±0.2 0.90±0.35 1.4±0.1 1.7±0.1 16.7 0.19±0.01

pSV6 11.0±0.3 0.24±0.02 0.24±0.01 4.3±0.6 0.90±0.42 1.9±0.1 1.8±0.1 14.2 0.18±0.02 Data shown are mean ± s.d. (n = 2).

Figure B.1 Fermentation kinetics of C. tyrobutyricum at pH 5.0 with various strains. A. Ct(Δack)-pMAD72, B. Ct(Δack)-pMAT, C. Ct(Δack)-pSOL, and D. Ct(Δack)-pSV6.

201

Appendix C: Supplemental materials in the generation of Ct pGluI and Ct pGluII

C.1 Recombinant plasmids pGluI and pGluII for the expression of agluI and agluII, respectively, and adhE2, under the control of thiolase promoter (Thl)

C.2 Gene agluI sequence of C. acetobutylicum

ATGAGCATATTATACAATGATCATAACAGAAGATTTCACTTATCAACAAAAAAA ACCAGCTACATTATAGAGATATCAGAAGATGGATATCTGACACATCTACACTGG GGACGCAAAATAAGAAATTTTGGGAGTTCACAGCTATTAGAACTAAGAGAAA GATGTTCATTCTCTGCAAATCCAGATGCAAGTAAACCTATACTTTCATTAGATAC ATTACCTCAAGAATATCCTAGCTACGGGAACACAGATTTACGAAATCCTGCTTT TATAGTCCAATTAGAAAACGGTTCCACTATAACAGATCTTAAATACGTATCACAT GAGATCTTAAAAGGAAAACCGACACTTGCAGGATTACCATCAACATATGTTGA ATGCGTAGATGAAGCAGAGACTTTAGAGATAACTATGGAAGATTCTTTAATAGG GCTAAAAGTCATTTTAACTTATACAGTTTTTGAAGATCATAATGTTATAACAAGA AGTGCAAGGTTTGCAAATGAAGGAAATGAAAAGCTGAAAATTCTTCGTGCTTT 202

GAGTATAAGTGTAGATTTTAATAGAAATGATTATAAGTTTCTGCATTTAGCAGGC TCATGGGCTAGAGAACGTCATGTTGAGATAGATAGTTTGAGCACAGGCAGAAA ATCTATAGACAGTAGAAGAGGTGCAAGTAGCCATCAACATAATCCTTTTATAGC CCTATTATCTTCGGAAGCAAATGAAGATAATGGAGAGGTATATGGATTTAGCTT AATTTATAGTGGAAATTTTTTAGCAGAAGCTGAAATTGATCAGTATCAAACTAC AAGAGTATCTATGGGAATAAACCCATTTGATTTCACTTGGTTATTAGAAAAAGG TGAAGTTTTTCAAACCCCTGAGGTTGTGATGGTTTATTCAAATGAGGGAATAG GTGATATGTCTAGAACCTATCATAAACTTTATAGAACCAGATTATGTAGAGGTG AATATAGAGATAAAACAAGACCAGTGCTTGTAAACAATTGGGAAGCAACATAC TTTAATTTTAATGCAGAAAAAATTGAGGATATCGCGAAAGTTGGAAGAGAATT AGGTATAGAATTATTTGTGCTAGATGATGGTTGGTTTGGTAAAAGAGATAGTGA TAATTGTTCTCTTGGAGATTGGGTTGTTGATAAAAATAAACTTCCTGCAGGTCT AGATGATTTAGCAAAACGTGTTAATAATCTTGGATTAAAGTTTGGATTATGGTTT GAGCCAGAAATGATATCGCCAAATAGCGACTTATATAGAAAACATCCGGATTGG TGTATTCATGTACCAAATAGAAATCGATCTCAAGCAAGAAAGCAGTTGATATTA GATTTATCTAGAGAAGACGTATGCCAATATATAATAAAGGCTATAAGTGATGTTT TAAAAAGTGCGCCTATAGCTTATGTTAAATGGGATATGAACAGGAACATGACTG AAGTTGGGTCAGCATTATTAAACGCTGAAAGACAAAGAGAAACAGCGCATAG ATATATGCTAGGACTATATAGAGTGTTAGAAGCTATAACTTCGGCTTTCCCACAT GTATTATTCGAAAGCTGTTCAGGTGGTGGTGGAAGGTTTGACCCAGGAATGTT ATATTACATGCCACAGACATGGACTAGTGACGATTCTGATGCTATCGAAAGACT TAAGATTCAATATGGAACAAGTATTGTGTACCCAACCAGTACTATGGGAGCACA TGTATCAGCAGTTCCAAACCATCAGGTTGAGAGAGTAACATCTTTAAAGACAA GGGCAGATGTAGCGATGTCTGGAAACTTTGGATATGAGCTAGATCTTACAAAG TTTACAGAAGAAGAGAAGAAGGAAGTAGCAAAGCAAATAGAACAATATAAAA GCATAAGAGAATTAATTCAATTTGGAGATATGTATCGAATATTAAGCCCTTTTGA AGGAAATGATACAGCTTGGATGTATGTATCAGAAGATAAAAATGAAGCTTTTAT AGTATATGTTCAAACTTTAGCTATACCAAATCCGCCTATGAAAAGGTTAAGATT AAAAGGACTAGATCCAAATAAAGAATACCTTTTAGAGGAACAGCTAAATACAA TAATCGGAGGAGACGAATTAATGTACTTAGGCTTGAATATACCAGAGATTAGAG GAGACTTTAAGAGTATAACCTGGAAACTTAAAAGTGTAGGTTTATAG

C.3 Gene agluII sequence of C. acetobutylicum

ATGTATAGTGGTAAGAAAAAAGTTTGGAAAAAGACCCTATATTATTTTGTTGCA GCAGCGTTAACATTAAATACTGTGCCTGAAATTATAAGACCTGTGAGTGCAAA AGCAGCGCCTAATATGAAAACGATATCTAAAATTAAAACAGTCAAAGAAAATG CTAGAGTATCAAATTTATCTGCAAAATTAAATGGTGATACTCTACAAATTGTAAA CGGTTTAGATGAGACGGATATTAAAATATGTGAACCTCAAGTTTTAAAAGTTGA TTATAAACCATCGGGTCAATCTAGTTCTGATACTTTGGTAGTTGATCCAAATAAA ATTTGGAATACTGGAAATATAATATCTAGTGATTTAAATTCAGATCCAATGGTAA TTACAACTCAAAAAATGACAATTAAAATAAGTAAGTCTGATTTAACAATGAGT 203

GTATATGATTCTACTGGTAAACAAATAGTTAAGCAGCAATCTATTGCTAGTAAA AGCGTAAGTTTTACTCATAATTCAGGAGATAGATTTTATGGAATAAACGGATATA ATTTCAAAGAAGATTCAAATAAAGGAATGCTTAGAAATGGTACAGAATCTGTTT ATGCTGGATATCAAGGACACTGCGGTTCACCATTTGTATGGAGTAATGATGGTT ATGGATTACTTGTGGATTCAGATGGAGGAAGTTTTACAATTGGAGATACATCAC TTCAATATAGTGGTATTTCCAAAACAGATACAGACTATTATTTAATGCTTGGAAG TCCTAAGGAAGTTATTTCTGAGGAATCAGATGTATCAGGTAAAGCACCAATGTT TCCTAAATGGGCAACCGGTTTTACAAACACTCAATGGGGTTGGAATAATTCACT ATCCGGAACAGGAAATGATGAAGATAAACTTAAAAGTGTGCTAAATACCTATC GTTCTAAGCAAATACCTATTGATAACTTCTGTCTTGATTTTGAATGGAAAAAAT GGGGGCAAGATAACTATGGTGAATTTAAATGGAATACAGATAACTTTCCTGATG CCCAAAATGGTCAGTTAAAGGCTTATATGGATTCTAAAGGACTTAAGATGACA GGTATAATGAAACCAAGAATTCTTGCAGATTCAGAGCAGGCTAGATATGTAACA TCAAAAGGCTGGTGGCTTCCAGGAGACAGTGCAGCTTCGGATTACTGCTCTGG TAAAATGATGGAAAACGTTAATTTTGCAATTTCAGATGTTAGAAAATGGTGGTG GAATAACATTCAAGATGCTTTTGATAAAGGTATTGTAGGTTTTTGGAATGATGA ATGTGATGAAAATGTTAATTTTGGAAACTTTGGCAATATGAATATGGAAAGAGC TATATATGATGGACAAAGGGCTTATAAAAATCAAAGAGTGTGGTCACTTAATAG AAACTACTATGCTGGAGCACAAAGATATTGTTATGGAATGTGGTCTGGTGATAT ATCTACTGGTTTTGATAGTATGGCAAATCAACGTGAAAGAATGCTTTCAGCAGT TAATTTAGGAGAAGCTAAATGGGGAATGGATACAGGTGGCTTCAATGATGGAG ATCCGACACCTGAAAATTATGCAAGATGGATGGAATTCAGTGCATTTACACCTA TATTTAGAGTTCATGGACAAGATAATAGGGTGCGTTATCCATGGGCATTTGGTT CAACTGCAGAGGCCGCTGCAAAGAAAGCTATGCAGTTAAGATACACTTTAATA CCATATATATATTCATATGATAGAAGTGCATCACAATCTGGATTAGGACTTGTAA GATCACTTATGATGGAATACCCTAATGATTCTAATGCAGCAAATGATAAGGAAG CTTGGATGTTTGGAGATTATATGCTTGTATCACCTGTAGTAAATCAAGGTCAAA CTTCAAAAAGTATATACTTGCCAGAGGGAAATTGGATAGACTATACAACAGGA AGAGAATATACAGGTGGACAAACTATAAACTATGCTGTAGATTCAACTAATTGG AGTGATATACCTCTATTTATAAAGAGCGGAGCAATTATTCCTACACAAGATTTTG AAAACTATGTAGGTGAAAAGAAAATAACTGACGTTTATGTAGATGCTTTTCCA AGTGATAAAGCTACAACCTTTGACTACTATGATGATGATGGAACTAGTTATGATT ATGAAAATGGCTCTTATTTTGATCAAAAGATGACCCTTCAAACTTCTACTGATT CAAAATCTGTACAATTTAACATAGATAAAAATACGGGAAGCTATACTCCTGATT TAAAAGACTATATAGTTAAAATGCATGTAAAGGGTAATGGAGCTGTTACTGCTA ACGGACAGGCATTAACGCAATATTCAAGCTATGATGCATTAAAGAGTGCTTCA GGAGAAGGATATGCATCAGGAACTGACACCTATGGAAATGTTGTATATATAAAG GTTTCATCAGGAGATGCAAAAAATATAAATGTATCTTGTAATCCTTTACCTGTAA CAATTACAGCAGCTGCAAATCCTAAAGGAGGAACTTATTATGGACCTCAAACA GTGTCACTTACAGCTTCAAAATCAGATGCAACAATATACTATACACTAGATGGT ACAACACCAACTGTTAATAGTACAAAATATATAGCACCAATTACACTTAACCCA AGTTCAAGTAAGCAACAGCTTAATTTTTTAGCTGTAGATGCTTCTGGTAATCAA TCTCAAATTTATACAGAAGTATATAATGTGCTTAAAGTAGGAGATGGAATAAAG GTTCACTTTAAAGATCCAAATGGTTGGTCAGCACCTAATATATATTACTATGACC CTGCAGGAAAGTTAACAGGACCAGGTTGGCCAGGAGTAAAAATGAATAGTGA 204

TGGTAATGGATGGTATTCATATACTATTCAGAACTGGACGAGTGCAAAGGTACT ATTTGATGACGGAACTAATCAAATCCCAGGTGTAAATCAGCCAGGAATTGATGT TACAGGGGAAGAGTGGTATGAGAATGGTAAATTGTATCAAGCTAATCCAGATAT CAGTGCAAGTGCTAGTGTTAAAGGTGGAACCTATAAGAATGCACAGACGGTAA CTCTTACAGCATCAAATTCAGATGCAACAATATACTATACCTTAGATGGCACAA CACCAACTGTTAATAGCGCAAAATATACAGCACCAATCACAATAAATTCAACTA CTACACTTAAATTTATTGCAGTAGGATCACAAGGAAATCAATCTGATGTATATAC AGAGGTATATAATATAAATACAGTTGGAAACATCATAACAGTACACTTCAAAAA TCCAAGCGGTTGGGGAGCACCATATGTATACTACTATACTAGTTCTGGACAAAC AGGACCAGGTTGGCCAGGAGTAAAAATGAATAGTGATGGCAATGGATGGTACT CATATACTATTAATGGGTTAAGTAGTGCAAAAGTACTATTTAATGATAAAATCAA CCAAACCCCAGGAAGGAATCAACCAGGTTACGATGTTACAGGAGAAGAATGG TATGAAAATGGTACATGGTATAAAAGTAATCCTGATGTAGAATCAATAGCTAAA GCAGCTTTAAAGATTAATTCTAAAACTGTTAATTATAATGTTAATTCATTATGCG ATGCTGCTACAATAAATTTACTTCCTCCTTGCCTTAGATAA

205

C.4 Alignment of Aglu I (upper line) and Aglu II (lower line) amino acid sequences

Red highlight indicates the predicted signal peptides; yellow highlight indicates the conserved region of -glucosidases.

1 - 90 MYNSSKTRIW KRTLYCLVAA AVVVSAMPQA LN-INVKADT NKVVNKNSKS SSQK----KF HAKLNGNTLK IKKGKDETII RICEPQVFKV MY-SGKKKVW KKTLYYFVAA ALTLNTVPEI IRPVSAKAAP NMKTISKIKT VKENARVSNL SAKLNGDTLQ IVNGLDETDI KICEPQVLKV 91-180 DYKPNGKSSK DTLVVDPNKK WSTGNIVSSD IKSDPMVITT KKMVLKINKE DLSILVYDLQ GKLLLKQDST ASKTASFTHN SGDRFYGING DYKPSGQSSS DTLVVDPNKI WNTGNIISSD LNSDPMVITT QKMTIKISKS DLTMSVYDST GKQIVKQQSI ASKSVSFTHN SGDRFYGING 181-270 YNFQEDSSKG MLRNGTESVY AGYQGHCGSP FVWSNDGYGL LVDSDGGSFT IGDTSLKYDG ISKTDTDYYV MVGNPKEILS EESDVSGKAP YNFKEDSNKG MLRNGTESVY AGYQGHCGSP FVWSNDGYGL LVDSDGGSFT IGDTSLQYSG ISKTDTDYYL MLGSPKEVIS EESDVSGKAP

206 271-360 MFPKWANGFT NTQWGWDNSL SGTGNDEAKL KSVINTYRSK QLPIDNFCLD FDWKKWGQDN YGEFKWNTDN FPDSQNGQLK AYMDSKGLKM MFPKWATGFT NTQWGWNNSL SGTGNDEDKL KSVLNTYRSK QIPIDNFCLD FEWKKWGQDN YGEFKWNTDN FPDAQNGQLK AYMDSKGLKM

361-450 TGIMKPRILA DSKQGRYVTS KGWWLPGDSE ASDYCSGKMM ENVNFALPQV RKWWWNNIQG AFDKGIVGFW NDECDENVNF GNFGNMNMER TGIMKPRILA DSEQARYVTS KGWWLPGDSA ASDYCSGKMM ENVNFAISDV RKWWWNNIQD AFDKGIVGFW NDECDENVNF GNFGNMNMER 451-540 AIYDGQRRHK NQRVWSLNRN YYAGAQRYSY GMWSGDISTG FDSMANQRER MLSAVNLGEA KWGMDTGGFN GGDPTPENYA RWMEFSAFTP AIYDGQRAYK NQRVWSLNRN YYAGAQRYCY GMWSGDISTG FDSMANQRER MLSAVNLGEA KWGMDTGGFN DGDPTPENYA RWMEFSAFTP 541-630 IFRVHGQDNK VRYPWAFGST AEATAKKAMQ LRYTLIPYIY SYDRSASQSG LGLVRSLMME YPNDSNAAND KEAWMFGDYM LVSPVVQEGQ IFRVHGQDNR VRYPWAFGST AEAAAKKAMQ LRYTLIPYIY SYDRSASQSG LGLVRSLMME YPNDSNAAND KEAWMFGDYM LVSPVVNQGQ 631-720 TSKSIYLPEG NWIDYTTGRE YTGGQTINYA VDSTNWSDIP LFIKSGAIIP TQDFENYVGE KKITDVYVDA FPGNEASSFD YYDDDGTSYN TSKSIYLPEG NWIDYTTGRE YTGGQTINYA VDSTNWSDIP LFIKSGAIIP TQDFENYVGE KKITDVYVDA FPSDKATTFD YYDDDGTSYD 721-810 YENGSYFDQK MTLERAKDLK SVQFNISPKT GYYKSDLKNY IVKMHVKSSG DVTVGGRRIT RYASYDELKN AQGEGYVVGT DTYGSVVYIK YENGSYFDQK MTLQTSTDSK SVQFNIDKNT GSYTPDLKDY IVKMHVKGNG AVTANGQALT QYSSYDALKS ASGEGYASGT DTYGNVVYIK 811-900 VSAGHDKNIN VPCNQ—VQL TAYADVKGGT YTSPQKVSLK ASDPNAAIYY TLDGTAPTVN STKYTGPITI DSSKT---LK FIVRDANGNE VSSGDAKNIN VSCNPLPVTI TAAANPKGGT YYGPQTVSLT ASKSDATIYY TLDGTTPTVN STKYIAPITL NPSSSKQQLN FLAVDASGNQ 901-990 SDVFTEQYTT Y-----IKVH YKNPTNWSEP SVYYDNTAGG VKGPDWPGVK MNNDGNGWYS YIIKDTTAAK ATFNDETNK- ----SSVIDV SQIYTEVYNV LKVGDGIKVH FKDPNGWSAP NIYYYDPAGK LTGPGWPGVK MNSDGNGWYS YTIQNWTSAK VLFDDGTNQI PGVNQPGIDV 991-1080 TGEEWYENGT LYQYNPDITV SPSLKGGSYA GSQTLTLTSS DAKATIYYTI DGTVPTVNST KYTGPITIDS SKTIEFMAVD GSGDKSQVYT TGEEWYENGK LYQANPDISA SASVKGGTYK NAQTVTLTAS NSDATIYYTL DGTTPTVNSA KYTAPITINS TTTLKFIAVG SQGNQSDVYT 1081-1170 EKYN-----T YMKVHFKNIS TWAAPNIYFY DATGGVTGPE WPGAKMKDDG NGWYSYTIDN CTSAKVLFND GVNQIPGHNE PGFDVSGEEW EVYNINTVGN IITVHFKNPS GWGAPYVYYY TSSGQ-TGPG WPGVKMNSDG NGWYSYTING LSSAKVLFND KINQTPGRNQ PGYDVTGEEW 1171-1220 YKDGNWYKSN PN------YENGTWYKSN PDVESIAKAA LKINSKTVNY NVNSLCDAAT INLLPPCLR

207

Appendix D: Supplemental materials in the generation of Ct pTBA mutants

D.1 Recombinant plasmid pTBA for the co-expression of xylT, xylB, xylA and adhE2 under the control of thiolase promoter (Thl)

D.2 Gene xylT, xylB and xylA sequences in pTBA xylT, xylB and xylA are shown in grey, blue and green, respectively

ATGAATAAAAAAATATCTCCAGCACTAATTTATTTCTTTGGAGCCTT CGGTGGATTTATGTTTGGATATGATATTGGAATAATTAATGGTGCTT TACCTGGAATTAATGCAACTTGGCACGTAAGTTCTTGGTTAGAAGGA TTTATCACTTCTGGATTGTTTGTTGGAGCTATGATAGGAGCCTCATT AATGGCTTCACTAGCAGATAGGTTTGGTCGTCGTAGAATGATTATGT GGAGTGCAATTGTGTTTGCACTTGGTGCATTAGGTTCTGCCGTTTCT

208

ACTAGTACTAATCTTTTAATCGGTGCTCGTGTTATTTTAGGAGTAGC TGTAGGTGGAGCTTCTGCTTTAGTTCCAATGTATATGGGAGAAATTA GCCCTGCTGAAACACGTGGAAAACTATCTGGTTTAAATCAATTAATG ATAACTGTTGGAATGCTTTTCTCATATGGTGTAAATTTTGCGTTTGCT GGTGCATTTGAAGGATGGCGTTGGATGCTTGGAGGAGCTATGGTAC CTGCAATGGTACTATTAATTGGAACATTTATACTTCCAGAGTCACCA AGATTTTTAGCTAGAATAGGAAAGACAGAATTAGCAAAACAAGTAC TTCAGACTTTACGTTCAAAGGAAGAGGCAGAAACTGAATATCAAGA GATTATTAATTCAAAACATACTGAAACAGGTTCTTTTGGAGATTTAT TTGCAAAACAGGCTTTGCCAGCTGTAATTGCAGGCTGTGGGTTAACA CTTCTTCAACAAATTCAAGGTGCAAACACTATTTTCTACTATTCATC ACAAATTTTATCCAATGTTTTTGGATCAGCAAATGGTGGAACTATTA GTACTGTTGGAATTGGTGTGGTTCTAGTATTAGCAACTATTGTAACT TTATTGGTTGTAGACAAATTCAAACGTCGTACATTATTTATGACTGG TTCTATTGGAATGGGCGCATCTCTATTATTAGTTGGATTAATTTATCC ATACTCTGAAGCTAAACATGCGTGGGCAACTTGGTTAGTATTCTTCT TCATATGTTTATACGTTGTTTTCTATGCATACTCTTGGGCAGCTACTA CATGGATTGTTGTTGGAGAATTATTCCCAAGTAATGTTAGAGGACTT GCAACAGGTATTGCATCAGCAGTAAACTGGTTTGGTAACATTTTAGT TGCTTTATTCTTCCCAGTATTACTTGAAACTGTAGGTTTATCTGTAAT CTTCTTCGGTTTTGCTGCAATTTGTATCATAGGATTTTTATTTGCAAA ATATGTTCTTTATGAAACAAAAGGAAAATCTTTAGAAGAAATTGAG ACATATTTGTACAATCGTTCTATTGGAAAAGTTAGAGGATTAAATGA GTAGTTGAGGAGGTTTGATTATGAGGTATTTATTAGGTATAGACGTT GGAACATCAGGAACCAAGACAGCTTTGTTTGATGAATGTGGAAATA CAATAAAAACTTCAACGCATGAGTATGAGTTATTTCAACCACAGGTT GGATGGGCAGAACAAAATCCTGAAAATTGGTGGACAGCTTGTGTTA AAGGTATAAGAGAAGTAATTGAAAAAAGTAAAATTGATCCTTTAGA TATTAAAGGAATTGGTATAAGTGGACAAATGCATGGACTTGTTTTGA TTGACAAAGAGTACAAAGTAATTAGAAACTCCATAATTTGGTGTGA TCAGAGAACAGAAAAGGAATGTACTCAGATTACAGATACCATAGGA AAAGAAAAATTAATTAGGATAACAGGCAATCCTGCATTAACGGGTT TCACCCTTTCAAAACTATTATGGGTTAGGAATAATGAACCAGACAAT TATAAGAGAATATATAAGGTTCTTCTTCCTAAGGATTATATAAGATT TAAACTTACTGGAGTTTTTGCTGCCGAAGTTTCAGATGCTAGTGGTA CTCAGATGTTAGATATAAATACTAGAAATTGGAGTGAAGAACTTTT AGATGACTTAAGAATAGATAAGAACATATTACCTGATGTATATGAA TCAGTTGTTGTTAGTGGATGCGTTATAGAAAAAGCTTCAAAAGAGA CTAAGTTAGCAGTTAACACTCCCGTTGTAGGTGGGGCAGGAGATCA AGCAGCTGGAGCTATAGGGAATGGAATCGTTAGAGAAGGTTTAATA 209

TCAACAGTGATAGGAACTTCTGGAGTAGTATTTGCGGCTACAGATA CGCCTAGATTTGATAGTAAGGGAAGAGTTCATACTCTTTGTCATGCA GTGCCTAATAAGTGGCATATAATGGGAGTTACTCAGGGAGCAGGCT TATCATTAAATTGGTTTAAAAGGACATTTTGTGCAAAAGAAATTTTA GAAAGTAAAGAGGCTGGAATTAATATTTATGATTTATTGACCGAAA AAGCATCACAATCAAAGCCTGGTTCTAATGGGATAATTTATTTGCCA TACCTTATGGGTGAAAGAACACCGCACATAGATCCAAATGTAAAAG GAGCTTTTTTAGGTATATCACTTATAAATAACCACAATGATTTTGTG CGTAGTATATTAGAAGGAGTAGGCTTTAGTTTAAAGAATTGTCTCGA TATTATTGAGAATATGAAGGTTAATATTGAGGAAATACGAGTAAGT GGTGGAGGTGCAGAAAGCAGCATATGGAGACAAATATTGTCAGATA TATTTAACTATGAGCTTACAACAGTAAAGGCATCAGAAGGACCAGC ACTTGGCGTAGCAATACTTGCAGGAGTTGGTGCAGGAATATATAAT TCCGTGGAAGAGGCTTGTGACAAAATAGTAAAAGGAAACGAAAAG GTTATGCCAAATGCAAATTTAATAGAAGTATATTCAAAGGTATATG AGGTATATAATTCAGCTTATCCTAAAATAAAAGATATATAAATAGTT AAAAGTAGGAGCGCGAGGAGGAATTAAAATGAATAATACACCAAA ATTAAAATTAGGAATTGTTGCAGTAAGTAGAGACTGCTTTCCAATGG AATTATCAGAGAATAGAAGAAAGGCAGTAGTAGATGCTTACAATGG AGAAATCTTCGAGTGCTTAACAACTGTTGAAAATGAAAAAGATATG AGAAAAGCTTTAAAAGAAGTGAAAAGTGCAGGTGTAAATGCACTAG TAGTATATTTAGGTAACTTTGGACCAGAAACTCCAGAAACTTTAATT GCTAAAGAATTTGATGGACCAGTTATGTTTGCAGCCGCAGCAGAAG AGAGAGGAGACAATCTAGTTAATGGACGTGGAGATGCTTATTGTGG AATGCTAAATGCAAGCTATAATTTAGCACTTAGAAACATAAATGCTT ATATTCCTGAATATCCAGTGGGAACAGCTTCAGATGTTGCAAATATG ATTAATGAATTTGTACCGGTTGCTACTGCATTAATTGGATTAAAGAA TTTAAAGATTATTTCTTTTGGGCCAAGACCTCAGGATTTCCTAGCTT GCAATGCTCCTATTAAGCAGTTATATAATTTAGGTGTTGAAATAGAG GAAAATTCGGAGCTTGATTTGTTTGCCTCATTTAATGAACATGAAAA CGATTCTAGAATTCCAGATGTAGTAAAAGACATGGAGGAAGAGTTA GGTGAGGGCAATAAAATGCCTGGTATTTTGCCAAAGCTTGCTCAAT ATGAACTTACATTACTAGATTGGGCAGAGGAGCATAAAGGATCAAG AGAATATGTTGTGTTTGCAAATAAATGCTGGCCAGCGTTTCAAACAC AATTTGGATGTGTGCCTTGCTATGTAAACAGTAGACTAACGGCTAGA GGAATTCCAGTATCTTGTGAGGTTGACATTTATGGAGCTTTAAGTGA ATACATTGGAACATGTGTAAGTCAAGATGTTGTAACCTTACTTGATA TTAATAACACAGTACCAAAAGATATGTATGAATCAGAAATTAAAAG CAAATTTAACTATACGTTAAAGGATACCTTCATGGGTTTTCACTGTG GAAACACAGCAGCATGTAAATTAACAAGCGGAACTATGAAAAATCA 210

AATGATTATGGCAAGAGCTCTTGAGCCAAATCAAGAGCCTAATATA ACTAGAGGAACGTTAGAGGGAGATATTGTACCAGGAGAAATCACTT TCTTCCGTCTACAAAGTAATGCAGATAGTGAGTTAACAGCCTATGTA GCAGAAGGAGAGGTTTTACCTGTTAAGACACGCTCTTTTGGATCTAT TGGAGTATTTGCAATTCCTCAAATGGGGAGATTTTACCGCCATGTAC TAATTGAAAATAGATTCCCACACCATGGTGCAGTTGCATTTGGACAT TTTGGTAAAGCAATTTATAATTTGTTTAGATATTTGGGAGTTAAAGA GGTAGGTTTTAATAGGCCAAAGGAAATGCTATATAAAACAGAAAAT CCTTTTGAGTAA

211