INVESTIGATION

The Histone Acetyltransferase GcnE (GCN5) Plays a Central Role in the Regulation of Aspergillus Asexual Development

David Cánovas,*,†,1,2 Ana T. Marcos,*,1 Agnieszka Gacek,†,1 María S. Ramos,* Gabriel Gutiérrez,* Yazmid Reyes-Domínguez,†,3 and Joseph Strauss†,‡ *Departmento de Genética, Facultad de Biología, Universidad de Sevilla, 41012, Spain, †Fungal Genetics and Genomics Unit, Department of Applied Genetics and Cell Biology, University of Natural Resources and Life Sciences, Vienna A-3430, Austria, and ‡Department of Health and Environment, Bioresources, Austrian Institute of Technology, Tulln/Donau A-3430, Austria

ABSTRACT Acetylation of histones is a key regulatory mechanism of gene expression in eukaryotes. GcnE is an acetyltransferase of Aspergillus nidulans involved in the acetylation of histone H3 at lysine 9 and lysine 14. Previous works have demonstrated that deletion of gcnE results in defects in primary and secondary metabolism. Here we unveil the role of GcnE in development and show that a ΔgcnE mutant strain has minor growth defects but is impaired in normal conidiophore development. No signs of conidiation were found after 3 days of incubation, and immature and aberrant conidiophores were found after 1 week of incubation. Centroid linkage clustering and principal component (PC) analysis of transcriptomic data suggest that GcnE occupies a central position in Aspergillus developmental regulation and that it is essential for inducing conidiation genes. GcnE function was found to be required for the acetylation of histone H3K9/K14 at the promoter of the master regulator of conidiation, brlA, as well as at the promoters of the upstream developmental regulators of conidiation flbA, flbB, flbC, and flbD (fluffy genes). However, analysis of the gene expression of brlA and the fluffy genes revealed that the lack of conidiation originated in a complete absence of brlA expression in the ΔgcnE strain. Ectopic induction of brlA from a heterologous alcA promoter did not remediate the conidiation defects in the ΔgcnE strain, suggesting that additional GcnE-mediated mechanisms must operate. Therefore, we conclude that GcnE is the only nonessential histone modifier with a strong role in fungal development found so far.

HROMATIN rearrangements are associated with the lation, and ubiquitination at different positions of the his- Ctranscriptional regulation of gene expression in eukar- tone proteins. In particular, acetylation of lysine 9 or lysine yotes. For example, facultative heterochromatin can be as- 14 in histone H3 has been associated with activation of sociated with the transcriptionally active or silent states of transcription. Acetylation of histones plays two roles in the developmentally regulated loci (Grewal and Jia 2007). This regulation of transcription: it alters the physical properties is achieved in part through histone post translational mod- of the histone–DNA interaction, and it also provides a frame ifications (PTM), which play a very important role in the for the binding of bromodomain proteins that remodel the control of these active or silent chromatin states. Histone chromatin and regulate gene expression (Spedale et al. modifications include acetylation, methylation, phosphory- 2012). These modifications regulate the nucleosome posi- tioning at the gene promoters and the recruitment of the Copyright © 2014 by the Genetics Society of America regulatory proteins. One of these modifiers, the SAGA com- doi: 10.1534/genetics.114.165688 plex, is responsible for the acetylation of several lysine Manuscript received May 1, 2014; accepted for publication June 4, 2014; published Early Online June 6, 2014. residues in the N-terminal region of histones, particularly Supporting information is available online at http://www.genetics.org/lookup/suppl/ histone H3 lysine 9 (H3K9) and histone H3 lysine 14 doi:10.1534/genetics.114.165688/-/DC1. 1These authors contributed equally to this work. (H3K14) (Kuo et al. 1996). The SAGA complex is a multi- 2Corresponding author: Departamento de Genética, Facultad de Biología, Universidad meric protein association with several subunits including de Sevilla, Reina Mercedes 6, 41012 Sevilla, Spain. E-mail: [email protected] 3Present address: Research Centre for Agriculture and Forestry Laimburg, Laimburg Ada2p, Ada3p, Spt3p, and Tra1p (Grant et al. 1997; Spedale 6, Auer/Ora, BZ, 39040, Italy. et al. 2012), where Gcn5p is the subunit with the histone

Genetics, Vol. 197, 1175–1189 August 2014 1175 acetyltransferase (HAT) catalytic activity (Grant et al. 1997). Dominguez 2011). For example, it has been demonstrated The SAGA complex is implicated in several functions related that acetylation of histone H3 is required for the synthesis of to transcription, such as transcription initiation and elonga- secondary metabolites in A. nidulans (Reyes-Dominguez tion, histone ubiquitination, and interactions of TATA-binding et al. 2010; Nützmann et al. 2011; Bok et al. 2013; Nützmann proteins. In addition, SAGA has also been implicated in et al. 2013). Reduction of heterochromatin marks leads to messenger RNA (mRNA) export in yeasts and Drosophila higher secondary metabolite production in Aspergillus and (Rodriguez-Navarro et al. 2004; Kurshakova et al. 2007). Fusarium species (Reyes-Dominguez et al. 2010, 2012), and In Saccharomyces cerevisiae, the SAGA complex is involved in it has also been found that it de-represses silent clusters, the transcriptional regulation of 12% of the yeast genome. leading to the production of novel metabolites (Bok et al. Approximately, a third of that 12% of the yeast genome is 2009). In addition, adverse metabolic and morphologic downregulated and two-thirds are upregulated in DGCN5 effects are also observed in histone modifier mutants, for cells (Lee et al. 2000), implying a direct or indirect negative example, deletion of the histone H3K9 methyltransferase role of Gcn5p. Interestingly, a high proportion of genes regu- clrD in Aspergillus fumigatus resulted in reduced radial lated by SAGA are upregulated during the responses to envi- growth and also delayed transcriptional activation of brlA ronmental stresses (such as heat, oxidation, and starvation) and conidiation (Palmer et al. 2008). (Huisinga and Pugh 2004). The SAGA complex is also present Asexual reproduction, also called conidiation, results in in metazoans, where it has diverged and evolved into four the formation of mitotic propagules (conidia), which are the different complexes (two SAGA and two ATAC complexes), infectious particles for pathogenic filamentous fungi. Con- while lower eukaryotes, such as yeasts and other fungi, con- idiation is the most common and proliferative reproductive tain one single SAGA complex. It was hypothesized that this mode in filamentous fungi. For this reason, conidiation has evolution into a diverse set of complexes is involved in cellu- been extensively studied in A. nidulans for several decades lar specialization during development and homeostasis in (for recent reviews see Etxebeste et al. 2010; Park and Yu metazoans (Spedale et al. 2012). The SAGA and ATAC com- 2012; Krijgsheld et al. 2013). Conidiation is controlled by plexes participate in the regulation of genes in response to a central regulatory pathway (Figure 1), encompassing intracellular and extracellular signals: protein kinase C sig- three transcriptional activators: BrlA, AbaA, and WetA (see naling, response to osmotic stress, UV-induced DNA damage, reviews by Adams et al. 1998; Yu et al. 2006). The first arsenite-induced signaling, endoplasmic reticulum stress, and component in this regulatory cascade, BrlA, is essential to nuclear receptor signaling (Spedale et al. 2012). Likewise, drive conidiation (Adams et al. 1988). brlA expression is plants also have multiple HATs. In Arabidopsis,AtGCN5is silent during vegetative growth, and its expression during involved in many developmental processes (Servet et al. conidiation is controlled by a number of genes, including the 2010). fluffy genes. Deletion of any of the fluffy genes gives a typical Although elegant experimental approaches using Neuros- fluffy phenotype with cotton-like colonies, lack of normal pora crassa as a model system have significantly contributed conidia, and reduced levels of brlA expression (Adams to general concepts of DNA methylation, genome defense, et al. 1998; Yu et al. 2006). There are six fluffy genes: fluG and heterochromatin formation (Tamaru and Selker 2001; and flbA–E. fluG encodes a protein similar to bacterial Freitag et al. 2002, 2004; Honda et al. 2010; Rountree and glutamine synthetases (Lee and Adams 1994), and the Selker 2010), studies on transcriptionally related chromatin FluG protein is responsible for the synthesis of the extracel- rearrangements and histone modifications are still scarce in lular factor dehydroaustinol that, in conjunction with the filamentous fungi, a broad group of ecologically, industrially, orsellinic acid derivative diorcinol, induces conidiation and clinically important organisms. In N. crassa, the tran- (Rodriguez-Urra et al. 2012). FluG works upstream of the scriptional activation of the light-inducible gene al-3 flbA-E genes (Yu et al. 2006). Flb genes operate in three requires the acetylation of histone H3K14 by a homolog of parallel routes in A. nidulans to regulate the expression of Gcn5p, NGF-1 (Grimaldi et al. 2006), and in Aspergillus brlA upon induction of conidiation. FlbA is a repressor of the nidulans the SAGA/ADA complex is involved in the acetyla- G-protein signaling, which participates in a protein kinase A- tion of H3K9/K14 at the prnD-prnB bidirectional promoter dependent pathway to promote filamentous growth and to during inducing conditions, but increased levels of H3K9ac/ inhibit conidiation (Yu et al. 1996). FlbE interacts with FlbB K14ac are not required for transcription (Reyes-Dominguez at the fungal tip and is required for proper activation of FlbB et al. 2008). Georgakopoulos et al. (2013) reported the de- (Garzia et al. 2009). FlbB is a bZip transcription factor that lineation of the A. nidulans SAGA complex with a combined activates the transcription of flbD, a cMyb-type regulator. proteomics and bioinformatics approach revealing a high Then, both FlbB and FlbD jointly activate the transcription conservation with the yeast SAGA complex except for the of brlA (Garzia et al. 2010). FlbC is a putative C2H2 Zn finger deubiquitination–H2B–Ub complex. Only recently, the rele- protein that constitutes a third route for the regulation of vance of chromatin-based silencing of secondary metabolite brlA expression (Kwon et al. 2010). These fluffy genes are gene clusters was recognized in several Aspergillus and Fusa- expressed in vegetative mycelium and are able to respond to rium species (Shwab et al. 2007; Bok et al. 2009; Lee et al. intracellular stimuli to induce a coordinated activation of the 2009; Reyes-Dominguez et al. 2010; Strauss and Reyes- master regulator brlA (Etxebeste et al. 2010).

1176 D. Cánovas et al. removed by centrifugation, and RNA samples were further purified using the NucleoSpin RNA II Kit (Macherey-Nagel). The primers employed for real-time RT-PCR are detailed in Table S2. Real-time RT-PCR experiments were performed in triplicates (technical replicates) in a LightCycler 480 II (Roche) by using the One Step SYBR PrimeScript RT-PCR Kit (Takara Bio Inc.). The fluorescent signal obtained for each gene was normalized to the corresponding fluorescent signal obtained with the b-tubulin gene benA to correct for sampling errors. Expression data are the average of at least three independent biological replicates.

Microarray experiment fi Figure 1 Simpli ed model of the genetic regulation of conidiation. Only Strains were grown in complete liquid medium for 18 hr at some of the regulators studied in this work are shown for clarity. FluG is 37°, and then conidiation was induced by transferring the responsible for the synthesis of an extracellular factor that induces the rest of the fluffy genes in the three parallel routes. FlbE (not shown) interacts and vegetative cultures to complete solid media. Strains were activates FlbB. FlbB and FlbD are transcription factors that jointly bind to the further grown for 10 hr at 37°. Samples were immediately promoter of brlA, activating its transcription. FlbC is another transcription frozen in liquid nitrogen upon harvesting and stored at –80° factor activating the expression of brlA. FlbA is a regulator of G-protein until processing. RNA was isolated from strains grown in activity that positively regulates the transcription of brlA. Activation of brlA liquid or solid media as previously reported (Schinko et al. is necessary and sufficient to induce conidiation. Ovals indicate the promoter regions, and in front of brlA correspond to the two sites analyzed by ChIP. 2010). RNA samples were quality controlled with the Agi- lent 2100 Bioanalyzer using the RNA 6000 Nano Kit. Previous work noted that deletion of the SAGA subunits For each array, 1 mg of total RNA was labeled with Message- gcnE or adaB in A. nidulans resulted in strongly reduced AmpTMII-Biotin Enhanced RNA Kit (Ambion) according to conidiation, while not affecting the activation (but repress- the manufacturer’s instructions. Hybridizations were done ibility) of the proline utilization genes prnD-prnB,which automatically for 16 hr at 45° using the GeniomRT Analyzer. are transcribed divergently from a bidirectional promoter The array underwent a stringent wash. Following the label- (Reyes-Dominguez et al. 2008). Interestingly, Georgakopoulos ing procedure, a microfluidic-based primer extension assay et al. (2012) also found a lack of acetate repressibility in was performed. This assay utilized the bound mRNAs as aSAGA-defectivemutant.Here,weclarifytheroleofGcnE a primer for an enzymatic elongation with labeled nucleo- in the control of fungal development. tides. The elongation was done with Klenow Fragment and biotinylated nucleotides at 37° for 15 min. Finally, the array Materials and Methods was washed automatically and detection was achieved with streptavidin–phycoerythrin using a Cy3 filter set in a GeniomRT Strains, media, and culture conditions Analyzer. Three independent biological replicates were The A. nidulans strainsusedinthisstudyarelistedin obtained for each sample. Supporting Information, File S1, and Table S1. Strains were Analysis of microarray data grown in complete or minimal media containing the appro- priate supplements (Cove 1966). Glucose was used as the The experimental dataset is deposited in the Gene Expres- carbon source and ammonium nitrate was used as the nitro- sion Omnibus database (accession no. GSE48426). For the gen source. In the brlA-overexpressing experiments, threonine four conditions, further data analysis was performed in the and fructose were used as carbon sources to overexpress the Bioconductor R (http://www.bioconductor.org/). Raw in- brlA gene, and glucose was used to repress the brlA gene tensity values were imported into R for statistical analysis under the control of the promoter of the alcA gene. Ammo- using the Limma package (Smyth 2005). First, we carried nium tartrate was used as nitrogen source. Strains were out a global background subtraction; i.e., for each array, the obtained following standard procedures (Pontecorvo et al. global background was computed and subtracted from 1953). Trichostatin A, butyric acid, and valproic acid were the measured intensity. To account for variations between purchased from Sigma and used as histone deacetylase the hybridized arrays, variance stabilizing normalization (VSN) (HDAC) inhibitors at a concentration of 5 mM. was used. The normalized data were thereby transformed to a so-called generalized log scale. Thus, the fold quotients were RNA isolation and real-time RT-PCR also calculated on a log scale (qmedian). To provide estimates Isolation of RNA and quantification of mRNA were performed of the fold quotients, we utilized the exponential function. This as previously described (Ruger-Herreros et al. 2011). Briefly, was roughly equivalent to using the natural logarithm instead mycelia (100–200 mg) were disrupted in 1 ml of TRI reagent of log2 (log-qmedian). (Sigma) with 1.5 g of zirconium beads by using a cell homo- For the detection of differentially regulated genes between geneizer (FastPrep-24, MP Biomedicals). Cell debris was vegetative growth and conidiation in the wild-type or the

GcnE is Essential for Fungal Conidiation 1177 mutant strain, the Empirical Bayes test statistics (Smyth 2005) reduced conidiation. Here, we followed the developmental was used. The raw P-values were adjusted for multiple testing process in complete medium in a time-course experiment. As tocontrolthefalsediscoveryratebyusingtheBenjamini– shown in Figure 2A, conidiophore heads were already evi- Hochberg (BH) method (Benjamini and Hochberg 1995) with dent after 10 hr of induction in a wild-type strain. After acutoffofadjustedP-value of ,0.05. Under this criterion, all 72 hr of induction, conidiophores were completely mature selected genes showed a minimum log-qmedian ,20.7 or with heads displaying the regular cylindric morphology. .0.7 (where a log-qmedian of 0.7 was roughly equivalent to However, the ΔgcnE mutant strain did not show any evi- atwofoldchange). dence of conidiophore formation even after 72 hr of induc- To study the effect of the different factors (mutant, wild tion. Complementation of the ΔgcnE deletion restored the type, vegetative growth, and conidiation) on gene expression, conidiation defects (Figure S1). we performed the ANOVA test of the normalized intensities The phenotype of the deletion strain was compared to using the Babelomics 4 suite (Medina et al. 2010). Differen- a set of strains harboring deletions in genes of the central tially expressed genes were selected using a cutoff of adjusted regulatory pathway (brlA, abaA,orwetA) to search for the P-values (BH method) of 0.05. The normalized intensities of step at which conidiation was blocked. As shown in Figure the genes selected by the ANOVA test were used for PC anal- 2B, the brlA mutant produced the stalk cells and then con- ysis and clustering of the 12 samples (under four different tinued growing rather than developing the conidiophore conditions with 3 replicate samples each). The PC analysis vesicles, metulae, phialides, and conidia, which gave it a bris- was performed with PAST (Hammer et al. 2001). Cluster anal- tly appearance under the stereo microscope. Mutations in ysis was performed by centroid linkage clustering of the eu- abaA and wetA interfered in later stages of the conidiophore clidean distances in Eisen’smodified Cluster 3.0 (de Hoon et al. development, and white structures corresponding to the 2004). Gene Ontology (GO) analysis was performed with the vesicles, metulae, and phialides could be observed under GO Term Finder tool at the Aspergillus Genome Database site the stereo microscope. The phenotypic differences between (http://www.aspergillusgenome.org)(Arnaudet al. 2010). abaA and wetA mutants with regards to the formation of conidia could not be observed at this magnification. Never- Chromatin immunoprecipitation theless, the phenotype of ΔgcnE did not resemble ΔabaA or Chromatin immunoprecipitation (ChIP) assays were carried ΔwetA strains, suggesting that developmental defects prob- out as previously described (Reyes-Dominguez et al. 2008) ably originate in genes upstream of abaA. Indeed, the ΔgcnE with primers listed in Table S2. DNA was immunoprecipi- mutant looked more like a ΔbrlA strain. When the ΔgcnE tated with antibodies recognizing acetylated K9 and K14 of strain was allowed to grow for 1 week, some conidiophores histone H3 (Millipore ab 06-599) or the C terminus of his- could be observed (Figure 2C). The colony showed a very tone H3 (Abcam ab1791). For each sample, the absolute low density of conidiphores as compared to a wild-type amount of the specific DNA fragment in the immunopreci- strain. In addition, higher SEM magnifications revealed that pitated sample was divided by the amount of this fragment the conidiophores were not completely developed, harbor- in the sample before precipitation (normalizing to input ing rows of four conidia at most, even after 1 week of DNA). The values shown are the averages of at least three growth. Most remarkably, these conidiophores displayed ab- biological repetitions. Standard errors are indicated. errant morphologies, for example, a conidium arising from Scanning electron microscopy a hyphal tip, rama growing out of stalk cells, or sterimagta cells budding off what could be stalk or hyphal cells Strains were grown on complete solid medium for 7 days at (Figure 2D). 37°. Samples were prepared for electron microscopy as pre- We reasoned that the conidiation defects could be due to viously reported (Canovas et al. 2011) with some modifica- the growth reduction previously reported (Reyes-Dominguez tions. Briefly, excised cubes of agar containing fungal mats et al. 2008). To test this, we quantified the linear growth were fixed with 2.5% glutaraldehyde in cacodylate buffer rate of both the wild-type and an isogenic ΔgcnE mutant ° for 2 hr at 4 and then treated with 1% OsO4 in cacodylate strain on complete and minimal solid media (Figure 3A). buffer for 2 hr at 4°. Samples were slowly dehydrated by Consistent with the previous report, the wild-type strain first using increasing concentrations of ethanol from 10 to grew faster than the ΔgcnE strain on both complete 70% and then using increasing concentrations of acetone and minimal media. However, the growth reduction ob- from 70 to 100%. Samples were dried in a Balzers CPD served in the mutant strain was not strong enough to ex- 030 Critical Point Dryer and gold-coated. Samples were ex- plain the conidiation defects. When both the wild-type and amined with a JEOL 6460LV Scanning Electron Microscope. the ΔgcnE strains were point-inoculated on plates and allowed to grow until they reached the same colony size Results (diameter), the wild type showed strong conidia develope- ment whereas the mutant strain did not show any signs of ΔgcnE strain does not undergo asexual development conidiation (Figure 3B). This suggests that the growth re- Reyes-Dominguez et al. (2008) noted that deletion of the duction in the mutant strain is not responsible for the con- SAGA/ADA components gcnE or adaB resulted in strongly idiation defects.

1178 D. Cánovas et al. Figure 2 The ΔgcnE mutant is impaired in conidiation. (A) Wild type (WT) and ΔgcnE strains were grown vegetatively for 18 hr, and then conidiation was induced in complete medium. Progression of the developmental program was followed under the stereo microscope at the indicated time points. Conidiophore heads were evident after 10 hr of induction in the wild-type strain. Yellow conidia were evident 24 hr after induction. No such structures were seen in the ΔgcnE strain even after 72 hr of induction. (B) Comparision of the conidiation phenotype of wild-type and ΔgcnE strain with the phenotypes of the mutants in the central regulatory pathway (ΔbrlA, ΔabaA,orΔwetA) after 4 days of growth. The brlA mutant produced the stalk cells and then continued growing rather than developing the conidiophore vesicles, metulae, phialides, and conidia. Mutations in abaA and wetA interfered in later stages of conidiophore development and were capable of producing white structures corresponding to the vesicles, metulae, and phialides. The ΔgcnE strain resembles a ΔbrlA phenotype. (C) SEM images of the wild-type and ΔgcnE strains grown for 1 week. A very low density of immature conidiophores can be observed in the ΔgcnE strain, compared to the complete development of the wild-type conidiophores. Bar, 50 mm. (D) Details of SEM images comparing the wild-type conidiophores with the aberrant ΔgcnE conidiophore morphologies (indicated by arrows). Arrows indicate details of aberrant conidiophores. The double-line arrow points to a severe example where sterigmata cells seem to bud off from a hyphal or stalk cell. A higher magnification of this example is shown as a separate image at the top right. Bar, 10 mm, except for the top right image where the bar corresponds to 5 mm.

Transcriptome analysis of conidiation Of these 1225 differentially regulated genes, 600 were downregulated and 625 were upregulated (Figure S2; Table The fact that the gcnE-deletion mutant phenotype was most S3 and Table S4 list the Top 25 up- and downregulated similar to the ΔbrlA mutant suggested that conidiation is genes). This suggests that after 10 hr of induction a major blocked at an early stage of development, and no or very fi few conidiophore heads are produced. Thus, the mutant reprogramming of the gene expression pro le occurred in cells are most likely defective in the expression of the up- the conidiating cultures. Some of the upregulated genes are stream developmental regulators or genes in the central relevant for the regulation of conidiation (see Table 1 for fl fl regulatory pathway. As chromatin modifyers impact on the a list of genes), for example, the uffy gene bC, and the expression of a large set of genes, we globally compared central regulatory cascade of transcriptional activators (brlA, gene expression in the wild type and in the ΔgcnE during abaA, and wetA) involved in the temporal and spatial regu- vegetative growth and development. In a first approach, the lation of the conidiation genes (Mirabito et al. 1989). Other transcriptomes of wild-type cells grown vegetatively in genes involved in conidiation were also found to be upregu- liquid medium (time 0, non-induced) and at 10 hr after lated, such as vosA, medA, ivoB, yA, rodA, and dewA. Gene induction of conidiation on solid medium (time 10 hr, ontology (GO) term analysis of the significant genes upre- inducing conditions) were compared using two colors ex- gulated during conidiation revealed that some terms were pression microarray. At this time, genes in the central regu- enriched (see Figure S3), e.g., carbohydrate metabolism, in latory pathway are already activated. The analysis of the which 60 genes of the 584 upregulated genes having GO data by Empirical Bayes Test statistics revealed that 1225 descriptions were induced, including polysaccharide (25), genes were differentially regulated (i.e., 13.6% of the total pectin (7), alcohol (31), xylan (6), and pentose (9) metab- number of genes in the chip) between these two conditions. olism genes. Another GO term was found to be involved in

GcnE is Essential for Fungal Conidiation 1179 conditions were compared (Figure S2). This corresponds to only 26% of the number of genes (319 in the ΔgcnE strain vs. 1225 in the wild type) differentially regulated in the wild- type strain. Therefore, deletion of gcnE appeared to affect the expression of a large number of genes regulated during development. Of these differentially expressed genes, 181 genes were upregulated and 138 genes were downregulated in the ΔgcnE mutant (Figure S2; Table S5 and Table S6 list the Top 25 up- and downregulated genes). In agreement with the phenotype of the mutant, some regulators of con- idiation were not upregulated during conidiation in the ΔgcnE strain, for example, brlA, abaA, wetA, vosA, and medA (Table 1). In addition, genes required for the synthesis of secondary metabolites (such as laeA or the sterigmatocystin gene cluster) were not upregulated either. Several GO groups mainly related to primary metabolism showed a higher expression level during vegetative growth in the mutant, but only one GO group, namely xylan metabo- lism, was more strongly expressed in the gcnE mutant under Figure 3 Differences in growth rate do not explain the conidiation conidiation conditions (Figure S4). Therefore, wild-type and Δ Δ defects in gcnE. (A) Growth of wild-type and gcnE strains was followed ΔgcnE strains shared most of the GO terms of genes upregu- on complete and minimal solid media over a period of 5 days. The linear growth rate of the mutant was only slightly lower in comparison with the lated during vegetative growth but not during conidiation, wild type on both media. The growth rate is shown as the increment in suggesting that deletion of gcnE affected mainly the regula- the colony diameter on solid media per day. Error bars show the standard tion of genes during development. Of the 625 genes upregu- error of at least three independent experiments performed in duplicates. lated during development in the wild type, 41 were also Δ (B) Wild type and gcnE strains were point-inoculated on complete media upregulated in the ΔgcnE, which suggests that these genes plates and allowed to grow at 37 °C. Plates were photographed after the colonies reached the same size. are gcnE-independent. Seventy-four genes appeared to be gcnE-independent in the downregulated genes (Figure S2).

Transcriptome analysis reveals that GcnE is involved in secondary metabolism and toxin synthesis corresponding to the regulation of conidiation and secondary 20 genes of the 584 upregulated genes having GO descrip- metabolism genes tions (e.g., 8 genes of the sterigmatocystin biosynthesis clus- Δ ter and the regulator aflR). Another GO group that was The transcriptome data of the wild-type and gcnE cells was enriched is related to cell-wall biogenesis (18 of 584), which further analyzed by ANOVA to allow the comparision of all includes conidiation genes involved in the synthesis of the four conditions at the same time, i.e., wild-type vegetative, Δ Δ spores layers (dewA, rodA, wetA). sdeA and sdeB, which are wild-type conidiation, gcnE vegetative, and gcnE conidia- required for development in A. nidulans (Wilson et al. tion. Using this type of analysis, 1162 genes were found to 2004), belong to another enriched GO. be differentially expressed in at least one of the conditions. GO term analysis of the significant genes downregulated This corresponds to 10.9% of the total number of predicted during conidiation (i.e., vegetative genes) identified small A. nidulans genes. The expression pattern of these 1162 molecule metabolism (89 genes of the 579 downregulated differentially expressed genes was grouped by using cen- genes having GO descriptions), which included metabolism troid linkage clustering of the euclidean distances. The Δ of ketone (52), carboxilic acids (51), and cellular nitrogen resulting dendrogram shows that the gcnE strain grown (39) and biosynthesis of heterocycle (cofactor and coenzyme) under conidiation conditions clustered together with vege- (25) and nucleotides (17) (see Figure S3). This suggests that tative cultures of both the wild-type and the mutant genes involved in primary metabolism were expressed more strain (Figure 4A). We further analyzed the differentially strongly during vegetative growth, while genes related to expressed gene set by PC analysis to assess the contribution development or secondary metabolite production were of the genetic background or the growth mode to the gene expressed at a higher level during the conidiation program. expression pattern. PC analysis assigns coordinates (compo- nents) to the variation in gene expression, representing the Transcriptome analysis of gcnE-dependent and largest, second largest, third largest, and so on variance in independent control of gene expression the corresponding axis. As shown in Figure 4B, the major during development variation between vegetative growth and conidiation in the In contrast to the 1225 genes differentially regulated in the wild-type strain was depicted in the first PC (the x-axis), wild-type strain, only 319 genes were differentially regu- while the second PC (the y-axis) showed small differences lated in the ΔgcnE strain when vegetative and conidiation between these two conditions in comparison (50 and 11

1180 D. Cánovas et al. Table 1 Differentially regulated genes involved in development (sexual or asexual) and secondary metabolism in A. nidulans

WT vegetative ΔgcnE vegetative vs. vs. conidiation conidiation Gene Gene Log Log Description of name code qmediana qmedian qmedian qmedian gene function dewA AN8006 160.8 5.1 ——Hydrophobin, protein of the conidium wall responsible for hydrophobicity of conidium surface yA AN6635 28.2 3.3 ——Conidial laccase (p-diphenol oxidase) involved in dark-green pigment production of conidium wall pclA AN0453 11.6 2.4 5.4 1.7 G1/S cyclin: mutants produce abnormal conidiophores with extra layers of phialides. ivoB AN0231 11.1 2.4 3.7 1.3 Conidiophore-specific phenol oxidase wetA AN1937 11.0 2.4 ——Regulatory protein involved in conidial development aflR AN7820 10.0 2.3 ——Transcriptional activator of the sterigmatocystin biosynthesis gene cluster abaA AN0422 8.9 2.2 ——TEA/ATTS domain transcriptional activator involved in regulation of conidiation; required for phialide differentiation. brlA AN0973 5.9 1.8 ——C2H2 zinc-finger transcription factor, master regulator of conidiophore development rodA AN8803 5.5 1.7 ——Hydrophobin medA AN6230 5.3 1.7 ——Protein involved in regulation of conidiophore development; required for normal temporal expression of brlA. hogA AN1017 4.2 1.4 ——MAPK involved in osmotic stress response; required for sexual development and conidiation. flbC AN2421 3.7 1.3 ——C2H2 zinc-finger transcription factor; involved in regulation of conidiophore development. vosA AN1959 3.6 1.3 ——Nuclear protein involved in spore formation and trehalose accumulation imeB AN6243 0.4 20.9 ——Serine/threonine protein kinase involved in light-mediated regulation of sexual development and sterigmatocystin production nsdC AN4263 0.3 21.2 ——C2H2 zinc-finger transcription factor; required for sexual development. laeA AN0807 0.2 21.9 ——Methyltransferase-domain protein: velvet complex component composed of VelB, VeA and LaeA; coordinates asexual development in response to light; regulates secondary metabolism; and is required for Hülle cell formation pipA AN2513 0.1 21.9 ——Serine/threonine protein kinase involved in hyphal growth and asexual development sskA AN7697 ——0.2 21.6 Response regulator, part of a two- component signal transducer involved in the HOG-signaling pathway that regulates osmotic stress response; null spores are heat labile and lose viability at 4° rosA AN5170 ——13.6 2.6 Zn(II)2Cys6 transcription factor; negative regulator of sexual development —, not differentially regulated under those conditions in that strain. a qmedian values .1 (or positive log qmedian values) indicate that the gene is expressed during conidiation, while qmedian values ,1 (or negative log qmedian values) indicate that the gene is expressed during vegetative growth. An absence of value indicates that gene is not differentially expressed in that strain.

GcnE is Essential for Fungal Conidiation 1181 of the vegetative wild-type strain was similar to the ΔgcnE strain under both vegetative and conidiation conditions in the x-axis/first PC (4 and 13 units, respectively; Figure 4B). In other words, the gcnE mutant under conidiation conditions was more similar to the wild-type strain growing vegetatively than conidiating (the gene expression profile of the gcnE mutant was similar to the vegetatively growing wild type regardless of the growth mode of the mutant). The results of this statistical analysis enforces the view that GcnE plays a more important role in regulation of develop- ment and seems to be less involved in the regulation of transcription under the conditions of vegetative growth used in this set of experiments. Among the top 20 genes differ- entially expressed during conidiation in the wild-type strain (positive side of the first PC), 9 genes are known to have a role in conidiation or secondary metabolism (Table S7). The negative side of the first PC includes genes involved in oxidoreduction or other metabolic activities, such as hydro- lases and peptidases (Table S8). Using this approach, we thus identified a group of genes that were specifically expressed in the wild-type strain during conidiation but were not expressed in the gcnE mutant under any condition. Two interesting genes appearing in this list were nkuA and nkuB. Knockout strains of nkuA have become widely used in Aspergillus and Neurospora laboratories after the discovery that deletion of the KU80 or KU70 homologs results in a high rate of homologous integration but does not affect development (Ninomiya et al. 2004; da Silva Ferreira et al. 2006; Krappmann et al. 2006; Nayak et al. 2006). How- ever, both genes were found to be upregulated during conidia- Figure 4 Global expression analysis of wild-type and ΔgcnE strains grow- tion, and their induction seems to be GcnE-independent ing under vegetative or conidiation conditions. Both strains were grown (upregulated also in the ΔgcnE mutant). A more complete vegetatively for 18 hr, and then conidiation was induced for 10 hr. The global expression of genes under the four conditions (wild-type vegeta- analysis of the GO terms of genes found to be differentially tive, WT-VEG; wild type-conidiation, WT-CON; ΔgcnE vegetative, GCN- regulated by ANOVA is shown in Figure S5, Figure S6, Table VEG; ΔgcnE conidiation, GCN-CON) was compared by using microarray S7, Table S8, Table S9,andTable S10. hibridization. A total of 1162 differentially expressed genes were identi- fied by ANOVA. (A) A dendogram was obtained by centroid linkage brlA is a major target of GcnE clustering using euclidean distances of the 1162 differentially regulated genes in the 12 samples (four conditions with three biological replicates Analysis of the transcriptomes revealed that conidiation each). The ΔgcnE strain grown under conidiation conditions was more genes and their regulators were induced in the wild-type similar to vegetative growth than to the conidiating wild type. (B) PC strain after 10 hr of induction, but most of these genes analysis of the genes differentially regulated under at least one of the remained unchanged in the ΔgcnE strain (Table 1). As fi four different conditions. The x-axis shows the rst PC with a variation of expected, we found brlA as an induced gene in the wild 49% due to the growth mode (vegetative vs. conidiation). The y-axis shows the second PC with a variation of 26% due to the genetic back- type, but this central regulator was not upregulated in the ground (wild type vs ΔgcnE). The results obtained by clustering (A) and PC ΔgcnE strain. To get further details and to confirm transcrip- (B) analysis are in agreement. tome data, we studied the expression of brlA by RT-qPCR in the wild-type and the gcnE mutant strain grown under the units, respectively). On the other hand, differences between same conditions as employed for the microarray experiment the wild-type strain and the ΔgcnE mutant appeared mainly and, in addition, in cultures harvested 72 hr after induction in the second PC (y-axis) and not in the x-axis, when the of conidiation (Figure 5A). In the wild-type strain, brlA ex- strains were grown vegetatively (4 units in the x-axis vs. pression was high at both time points whereas the ΔgcnE 16 units in the y-axis). This difference between the wild type strain did not show any accumulation of brlA mRNA after and mutant strains in the y-axis strongly increased when 10 hr. Interestingly, brlA mRNA can be detected in this strain conidation was induced (31 units). PC analysis assigned at 72 hr post-induction (still 30-fold lower than in the 49% of the variation to the mode of growth (vegetative vs. wild-type strain), which is in agreement with microarray conidiation) and 26% to the genetic variation (wild type vs. data and with the DgcnE phenotype, in which some conidia ΔgcnE). These results mean that the gene expression profile are produced upon prolongued incubation on solid media.

1182 D. Cánovas et al. fragments encompassing nucleosome +1 are captured by the proximal PCR primers. On the contrary, in the ΔgcnE strain the acetylation levels at the promoter of brlA were lower than in the wild-type strain and did not increase over the basal levels of the wild-type strain growing vegetatively. This was consistent with the lack of brlA expression and, consequently, with the absence of conidiophore formation in the mutant. Analysis of the total amount of histone H3 at the brlA promoter by ChIP revealed that the total amount of histone H3 decreased in the wild type after induction of conidiation and reached a minimum at 72 hr (Figure S7). In contrast to the wild-type strain, the total levels of histone H3 did not decrease, but even increased in the ΔgcnE strain upon induction of conidiation, consistent with an inactive promoter (Figure S7). Inhibitors of histone deacetylation do not recover conidiation in DgcnE Surprisingly, although the histone H3K9 and H3K14 acety- lation levels were below the wild-type basal levels in the ΔgcnE strain, there was a slight increase in acetylation after the induction of conidiation. We reasoned that alternative histone H3 acetyltransferases may be operating at these Figure 5 brlA is not expressed and acetylation of histone H3K9/K14 at  the brlA promoter is reduced in the ΔgcnE strain. (A) Both wild-type and genes under induction conditions as 40 putative acetyltrans- ΔgcnE strains were grown vegetatively for 18 hr, and then conidiation ferases are present in the genome of A. nidulans (Nützmann was induced for 10 or 72 hr. RNA was isolated and gene expression was et al. 2011). To test this possibility, we employed HDAC quantified by RT-qPCR. Data are shown normalized to the tubulin gene inhibitors to block deacetylation. This presumably would (benA) as an internal standard. (B) ChIP was carried out by immunopre- lead to increased acetylation levels of histone H3 and may cipitation of cross-linked DNA with an antibody recognizing acetylated Δ histone H3K9ac and H3K14ac, followed by qPCR analysis of the promoter recover conidiation in the gcnE mutant. Trichostatin A was regions. brlA showed an increase in the immunoprecipitated DNA in both already shown to be an effective HDAC inhibitor in A. nidu- distal (brlAp1) and proximal (brlAp3) regions of the promoter in the wild lans in previous studies (Shwab et al. 2007). Addition of type. In the ΔgcnE strain, acetylation levels were grossly reduced and trichostatin A or a cocktail of inhibitors (trichostatin A + fi conidiation-speci c increases were not observed. Values were normalized butyric acid + valproate) did not result in restoration of con- to input DNA (before immunoprecipitation) and are shown as the mean with standard errors of the mean of at least three biologically indepen- idiation, not even partially (Figure S8). Therefore, the most dent experiments. plausible explanation is that the histone H3 acetylation levels in the ΔgcnE strain corresponded to background levels To find out whether the effect of gcnE deletion on brlA is and that a functional SAGA complex is necessary for brlA direct or indirect, we determined the acetylation pattern of expression. histone H3K9 and H3K14 at the brlA promoter by ChIP. Because the promoter of brlA covers .2 kb from the ATG Expression of the upstream regulatory genes Δ of brlAa (Garzia et al. 2010; Kwon et al. 2010), we controlling conidiation in the gcnE strain is deregulated employed two different primer pairs. Primers brlAp1 were located at a distal position from the ATG of brlAa (–2303 to There are three parallel routes for the activation of coni- 22483 bp), spanning the FlbB-binding site, while primers diation, consisting of FlbA, FlbB/D, and FlbC (Adams et al. brlAp3 were located at a proximal position to the ATG (260 1998; Etxebeste et al. 2010). The transcriptome studies to 2245 bps). The acetylation levels of H3K9 and H3K14 revealed a slight upregulation of flbC, one of the upstream increased after induction of conidiation in both regions of factors for conidiation genes, and that this pattern was af- the promoter in the wild-type strain (Figure 5B). The levels fected by the gcnE deletion (Table 1). To get further details of acetylation were higher at 10 than at 72 hr after induction and to confirm transcriptome data, we tested the expression of conidiation. The overall acetylation pattern was similar in of flbC and four of the other upstream regulators in the wild- both regions of the promoter although the levels were type and gcnE mutant strain grown under the conditions higher in the proximal region to the ATG than in the distal described above in Figure 5. As shown in Figure 6, none region. This can be explained by the fact that highly acety- of these genes were upregulated in the wild-type strain after lated nucleosomes +1 in the open reading frames are not 10 hr of induction (the conditions used for the microarray evicted during transcriptional activation (in contrast to experiment). However, after a longer period of induction promoter nucleosomes) (Workman 2006), and the DNA (72 hr), four of these genes (flbA, flbB, flbC,andflbD) showed

GcnE is Essential for Fungal Conidiation 1183 expression. This is also consistent with the fact that expres- sion of the fluffy genes was already detected in vegetative mycelia and that their transcriptional upregulation is not the critical regulatory point for their function in the transcrip- tional activation of brlA. Consistent with the moderate transcriptional activation of flbA, flbB, flbC, and flbD genes, their promoters showed higher levels of H3 acetylation during induction of conidia- tion (data not shown). This increase was associated with a decrease in the amount of total histone H3 present at these promoters probably due to partial eviction of nucleosomes from these regions. This difference was not observed in the mutant strain that showed very low H3 occupancy at all fluffy gene promoters before and after conidial induction (data not shown).

Are there additional targets mediating the GcnE effects on development? During the analysis of the microarray data, we observed that the orcinol/orsellinic acid cluster was not expressed in the ΔgcnE strain. This is in agreement with a previous report by Nützmann et al. (2011). Diorcinol is a derivative of orsellinic acid and functions together with dehydroaustinol, one of the signals required for the induction of conidiation (Rodriguez- Urra et al. 2012). One possibility is that the absence of the expression of this cluster contributes to the conidiation defects. However, addition of different concentrations of orcinol ranging from 50 mg to 50 mg did not recover the conidiation defects of the ΔgcnE strain (Figure 7A). Further- more, the deletion of the polyketide synthase orsA, respon- sible for the biosynthesis of orsellinic acid (Schroeckh et al. 2009), a precurssor of diorcinol, did not show any conidia- tion defects (data not shown). Figure 6 Expression of the fluffy genes during conidiation is deregulated Therefore, this result further implied that the conidiation Δ Δ in the gcnE strain. Both wild-type and gcnE strains were grown vege- defects of the ΔgcnE strain could be directly related to SAGA tatively for 18 hr, and then conidiation was induced for 10 or 72 hr. RNA was isolated and gene expression was quantified by RT-qPCR. Data are function at the brlA promoter. We tested this by expressing shown normalized to the tubulin gene (benA) as an internal standard. the brlA gene under the control of the heterologous induc- Values are the mean and standard error of the mean of at least three ible promoter of the alcA gene at an ectopic location (Adams independent experiments. et al. 1988). ΔgcnE alcA(p)::brlA strains were constructed by crossing. The parentals and two strains from the progeny higher steady-state mRNA levels compared to vegetative my- were grown in liquid medium for 24 hr and then transferred celia or after 10 hr of induction in the wild-type strain. When to inducing (threonine) or repressing (glucose) liquid me- mRNA levels of these five genes were compared between dium and grown for another 24 hr. Inspection of the fungal both strains in vegetative mycelia, flbA showed a threefold pellets by light microscopy (Figure 7B) revealed that the higher expression in the ΔgcnE strain than in the wild type, wild-type strain harboring the alcA(p)::brlA construct pro- whereas the other genes were basically identical. There was duced primitive conidiophores and conidia under inducing no significant difference between wild type and ΔgcnE in conditions as previously reported (Adams et al. 1988). How- expression of the upstream regulators at time point 10 hr of ever, none of the ΔgcnE alcA(p)::brlA strains produced any of induction with the exception of flbC,butinterestingly,at these primitive conidiophores or conidia. The experiment 72 hr, flbA expression is reduced whereas flbB expression is was repeated twice with two independent strains from the around twofold higher in the gcnE mutant compared to the progeny. Next, we transferred the strains grown for 24 hr in wild-type strain. In the case of fluG, there was a big variation glucose liquid media (repressing conditions) to solid media from sample to sample at the 72-hr time point, so no conclu- containing threonine (inducing) or glucose (repressing) sion could be drawn from these results. These slight differ- conditions. The ΔgcnE alcA(p)::brlA could not conidiate even ences in mRNA levels suggest that the lack of conidiation in under these conditions (Figure 7C). However, it is interest- ΔgcnE probably did not originate from defects in fluffy gene ing that growth restriction upon induction of alcA(p)::brlA

1184 D. Cánovas et al. Figure 7 GcnE has additional as-yet-unidentified targets medi- ating the developmental effects. (A) Wild-type and ΔgcnE strains were pregrown for 24 hr before addition of different concentra- tions of orcinol (50 mgto50 mg) on top of the colony. Plates were incubated for 3 additional days and photographed. The highest concentration of orcinol had some slightly negative effects on colony development in both strains. (B) Strains indicated at the left were pregrown for 24 hr in liquid media under repressing conditions (glucose) and then transferred to fresh liquid me- dium containing inducing threo- nine or repressing glucose, and incubation was continued for an additional 24 hr. Fungal pellets were photographed under the light microscope. The parental strains harbored either a construct overexpressing brlA from the alcA promoter (OE::brlA) or the gcnE deletion (ΔgcnE). Two indepen- dent strains of the cross progeny (DKA234, DKA235) were used in this experiment. Black arrows in- dicate conidiophore-like structures, black arrowheads point to individ- ual conidia produced in liquid cul- tures, and white dotted arrows point to vegetative hyphal tips. (C) Strains were pregrown as in B for 24 hr under repressing condin- tions but then transferred to solid medium containing threonine or glucose, and incubation was con- tinued for 1 day. Fungal colonies were photographed under a stereo microscope at the same magnifica- tion. The OEbrlA strain (brlA+; alcA (p)::brlA) conidiated on glucose plates due to brlA expression from its native promoter. Two independent strains of the progeny were also used in this experiment. (D) Strains pregrown for 24 hr under repressing condintions (as in B) were transferred to solid medium containing threonine or glucose, and incubation was continued. Plates were photographed after 3 days of growth. Growth inhibition could be observed in the strains overexpressing brlA in both the wild-type and ΔgcnE background only under brlA-inducing conditions (threonine). on threonine was observed in both the wild-type and the we and others have established that histone acetylation ΔgcnE strains overexpressing brlA (Figure 7D). This effect plays only a minor role in the regulation of some selected was already observed by Adams et al. (1988) and may be primary metabolic systems (Reyes-Dominguez et al. 2008; suggestive of a BrlA role in halting vegetative growth, per- Georgakopoulos et al. 2012) but significantly regulates sec- haps through crosstalk with the FlbA/G-protein-signaling ondary metabolism (Shwab et al. 2007; Nützmann et al. pathway regulating vegetative growth. 2011, 2013; Bok et al. 2013). Data presented here enlarge our picture of GcnE function to a genome-wide scale, and from these experiments it is becoming clear that GcnE is Discussion a minor regulator of primary metabolism but an essential The data obtained during this work revealed that GcnE is component in driving A. nidulans developmental processes. the only nonessential histone modifier found so far with an In the diverse set of reversible histone modifications, acety- essential function in fungal development. In previous work, lation and methylation have been the most extensively

GcnE is Essential for Fungal Conidiation 1185 studied ones in filamentous fungi (Gacek and Strauss 2012). clusters in A. nidulans. Some of the secondary metabolites It has been shown that the histone H3K9 methyltransferase can be considered as “weapons” utilized only under stressing ClrD and the heterochromatin-protein 1 (HepA) are regula- conditions in nature as a defense mechanism. For example, tors of secondary metabolite gene clusters (Reyes-Dominguez it was found that GcnE played a major role during the in- et al. 2010; Gacek and Strauss 2012). Deletion of the his- duction of biosynthetic gene clusters of sterigmatocystin, tone H3K9 methyltransferase clrD or the histone H3K4 terrequinone, and penicillin (Nützmann et al. 2011). An in- methyltransferase cclA in A. nidulans has no growth or teresting case is polyketide orsellinic acid, which is produced conidiation phenotype (Bok et al. 2009; Reyes-Dominguez by A. nidulans in response to the interaction with a strepto- et al. 2010). However, a decrease in radial growth and mycete species in a GcnE-dependent manner (Nützmann delayed conidiation due to later brlA expression is observed et al. 2011). Synthesis of orsellinic acid derivatives in the equivalent A. fumigatus clrD deletion mutant (Palmer F9775A and -B, which is induced in a ΔveA strain, is lost et al. 2008). The histone deacetylase RpdA is essential for in the double-mutant ΔgcnE ΔveA (Bok et al. 2013). Thus, growth in A. nidulans, and, consequently, a direct and un- the reported role of GcnE in the regulation of secondary equivocal effect on development has not been tested yet metabolism is consistent with our microarray expression (Tribus et al. 2010). The histone H4K12 acetyltransferase analysis. Orsellinic acid is also the precursor of diorcinol, which EsaA is also essential for growth and cooperates with the makes an adduct with the bioactive compound dehydroausti- general secondary metabolite regulator LaeA to mediate his- nol, produced by FluG, to induce conidiation (Rodriguez-Urra tone H4 acetylation and transcriptional activation of selected et al. 2012). Although the absence of GcnE activity could lead secondary metabolite clusters (Soukup et al. 2012), but due to a lack of this conidiation inducer adduct, addition of to its essential nature the involvement in conidiation remains external orcinol did not restore conidiation. In support of elusive. Similarly, deletion of the histone deacetylase hdaA this, the deletion of the polyketide synthase orsA responsible was reported to have effects on secondary metabolism but for the biosynthesis of orsellinic acid (Schroeckh et al. 2009) not on development (Shwab et al. 2007; Bok et al. 2009). did not show any conidiation defects either. Therefore, a sce- Therefore, other histone modifiers either have shown a minor nario in which brlA expression is not turned on in the gcnE role during development or are essential for growth, while mutant after induction due to the lack of the inducer adduct GcnE is required for conidiation but not essential for growth. seems unlikely. Instead, GcnE appears to be responsible for The SAGA complex is also involved in the regulation of de- histone H3K9/K14 acetylation at the brlA promoter, which velopment in higher eukaryotes, such as plants (Servet et al. in turn is a prerequisite for brlA expression. Consequently, 2010), and metazoans (Spedale et al. 2012). In Arabidopsis, deletion of gcnE blunts brlA expression under inducing con- AtGCN5 plays an essential role in the development of root ditions. However, this is only a part of the whole picture and shoot and flower meristems, leaf-cell differentiation, and because forced expression of brlA from the inducible alcA responses to light. AtGCN5 also appears to regulate the ex- promoter could not restore conidiation in a ΔgcnE back- pression of a large number of genes, likely mediated by direct ground. As expression of upstream regulators of the fluffy or indirect interactions with DNA-binding transcription fac- family of genes (flbA, flbB, flbC, flbD, and fluG) was also not tors (Servet et al. 2010). In metazoans, it was suggested that significantly affected by gcnE deletion and the phenotype Gcn5 may be required to maintain pluripotent states and is does not conform to the mutants of the central regulatory important for the differentiation of rat mesenchymal stem pathway abaA-wetA either, we have to assume that other cells into cardiomyocytes. Indeed, loss of Gcn5 resulted in regulators of conidiation may be “hidden” targets of this a hard-pack chromatin structure at the cardiomyocyte-specific SAGA complex component. One such target may be the genes GATA4 and NKx2.5 and elevated levels of apoptosis velvet complex members veA, velB,orvelC (Bayram et al. during embrionic development (Lin et al. 2007; Li et al. 2008b) or the light receptors fphA, lreA/B,orcryA (Bayram 2010). It is intriguing that, while metazoans have evolved et al. 2008a; Purschwitz et al. 2008). However, we did not four HAT complexes acetylating histone H3 specialized in observe any significant change in expression of these regu- different cellular processes (Spedale et al. 2012), A. nidulans lators and photoreceptors comparing the wild type and the has only one. gcnE mutant, and these genes are not even responsive to The SAGA complex plays a general role in transcriptional induction of conidiation in the wild type. Thus it is unlikely activation in yeasts. TAFII145 and Gcn5 are apparently func- that some of these known genes involved in developmental tionally redudant in yeast (Lee et al. 2000), although there regulation are targets of the SAGA complex. At the moment is some specialization of the SAGA complex in stress-related it remains elusive which of the differentially regulated genes genes (Huisinga and Pugh 2004). Although the SAGA com- (apart form brlA) may be responsible for the strong conidia- plex is very similar in A. nidulans to the yeast counterpart, tion-deficient phenotype of the gcnE deletion strain. In the role of GcnE seems to be significantly different from the addition, the SAGA complex participates in more cellular role of its orthologs in yeasts. Thus, according to genome- functions as it is necessary not only for the activation of gene wide expression analysis and the observation of mutant phe- expression but also for transcriptional elongation, splicing, notypes, it appears that the main role of GcnE is to regulate nuclear mRNA export, and as a general platform for the development and some specific secondary metabolism gene recruitment of regulatory factors (Millar and Grunstein

1186 D. Cánovas et al. 2006; Baker and Grant 2007; Gunderson and Johnson 2009; components of the SAGA/ADA complex showed a phenotype Gunderson et al. 2011). Therefore, the conidiation defects in of increased Rad52 foci and sister-chromatid recombination the ΔgcnE strain could be mediated through a combination (Munoz-Galvan et al. 2013). Whether GcnE and the SAGA of several targets and diverse molecular activities, which complex play similar roles in filamentous fungi is not known deserve further investigation. yet, but the importance of GcnE in conidiospore production In this study, we compared vegetative cells grown in may justify speculations of a similar role in these organisms. liquid cultures immediately before and after 10 hr of shift to In conclusion, GcnE plays an essential role in asexual conidiation conditions and found 1225 genes differentially development and is required for the expression of the master regulated, of which 625 were upregulated. Garzia et al. regulator of conidiation brlA and some yet-unidentified con- (2013) analyzed the conidiation-specific transcriptome after idiation-specific genes. It is, to the best of our knowledge, so 5 hr of induction and found 2222 genes differentially regu- far the only nonessential histone modifier with such a role. lated (corresponding to 20.3% of the genes present in the One of the questions to be followed up is to identify the other genome), of which only 187 were upregulated. These num- GcnE-dependent mechanisms required for initiation of devel- bers are much higher than the 533 genes found to be dif- opment and to elucidate the factors that recruit the SAGA ferentially regulated in response to light in A. nidulans complex to the promoter of brlA. (Ruger-Herreros et al. 2011). It suggests that induction of asexual development actually results in a major cellular reprogramming over time. For example, master regulators Acknowledgments of carbon (creA) and nitrogen (areA) metabolism did not We thank Jae-Hyuk Yu, Nancy Keller, Axel Brakhage, and the appear to be differentially regulated at 10 hr after the in- Fungal Genetics Stock Center for sharing strains and Juan Luis duction of conidiation in our analysis, but they were down- Ribas and Cristina Vaquero (Servicio de Microscopía, Centro de regulated after 5 hr. The comparison of both transcriptomic Investigación Tecnología e Innovación, Universidad de Sevilla) experiments at different time points suggests that in a first for help with SEM. D.C. thanks the University of Sevilla for stage there is a major downregulation of genes expressed in supporting his stay at BOKU–University of Natural Resources the vegetative phase to produce a growth arrest. In a next and Life Sciences, Vienna. Work was funded by grant SFB-F37- stage, many genes are upregulated to accommodate all 3 from the Austrian Science Fund (Fonds zur Förderung der morphogenetic requirements for asexual reproduction. Ten wissenschaftlichen Forschung) and grant LS12-009 (EpiMed) hours after the transition from vegetative growth to conidia- of the NÖ-Forschung und Bildung Fund (to J.S.). tion, the number of upregulated genes approximates to the prediction of 1200 unique mRNAs postulated by Timberlake (1980). However, Martinelli and Clutterbuck (1971) esti- Literature Cited mated that only between 45 and 150 genes are specifically Adams, T. H., M. T. Boylan, and W. E. Timberlake, 1988 brlA is required for conidiation. This difference could be explained fi fi necessary and suf cient to direct conidiophore development in with genes that are not speci cally required for conidiation, Aspergillus nidulans. Cell 54: 353–362. but rather play additional roles or simply indirectly respond Adams, T. H., J. K. Wieser, and J. H. Yu, 1998 Asexual sporulation to the changing environmental conditions (exposure to ox- in Aspergillus nidulans. Microbiol. Mol. Biol. Rev. 62: 35–54. ygen, light, solid interphase, different nutrient signaling, Arnaud, M. B., M. C. Chibucos, M. C. Costanzo, J. Crabtree, D. O. etc.). For example, the osmotic stress MAPK hogA is still Inglis et al., 2010 The Aspergillus Genome Database, a curated comparative genomics resource for gene, protein and sequence upregulated after 10 hr (as it is after 5 hr) of induction of information for the Aspergillus research community. Nucleic conidiation, but some of its targets or downstream regula- Acids Res. 38: D420–D427. tors are not (atfA, srrA, tcsA). None of the chromatin regu- Baker, S. P., and P. A. Grant, 2007 The SAGA continues: expand- lators known in A. nidulans appear to be regulated at the ing the cellular role of a transcriptional co-activator complex. – transcriptional level upon induction of conidiation (gcnE, Oncogene 26: 5329 5340. Bayram, O., C. Biesemann, S. Krappmann, P. Galland, and G. H. adaB, clrD, hepA, cclA, rpdA, dmtA, and laeA), and they do Braus, 2008a More than a repair enzyme: Aspergillus nidulans not require GcnE for their constitutive expression (they are photolyase-like CryA is a regulator of sexual development. Mol. not affected by the ΔgcnE deletion). Notably, one of the most Biol. Cell 19: 3254–3262. heavily affected GO categories found in the list of genes Bayram, O., S. Krappmann, M. Ni, J. W. Bok, K. Helmstaedt et al., upregulated in the ΔgcnE mutant during conidiation was 2008b VelB/VeA/LaeA complex coordinates light signal with fungal development and secondary metabolism. Science 320: related to responses to stress and, in particular, to DNA 1504–1506. damage (nkuA, nkuB, uvsC, and other putative genes). It Benjamini, Y., and Y. Hochberg, 1995 Controlling the false dis- can be argued that GcnE is required for genome stability covery rate: a practical and powerful approach to multiple test- maintenance and/or DNA repair during conidiation, and, ing. J. R. Stat. Soc. B 57: 289–300. consequently, the absence of GcnE may generate DNA dam- Bok, J. W., Y. M. Chiang, E. Szewczyk, Y. Reyes-Dominguez, A. D. Davidson et al., 2009 Chromatin-level regulation of biosyn- age stress. The function of the spores is not only dispersion thetic gene clusters. Nat. Chem. Biol. 5: 462–464. in the environment but also protection of the genome (Park Bok, J. W., A. A. Soukup, E. Chadwick, Y. M. Chiang, C. C. Wang and Yu 2012). Indeed, isolation of yeast mutants affected in et al., 2013 VeA and MvlA repression of the cryptic orsellinic

GcnE is Essential for Fungal Conidiation 1187 acid gene cluster in Aspergillus nidulans involves histone 3 acet- Honda, S., Z. A. Lewis, M. Huarte, L. Y. Cho, L. L. David et al., ylation. Mol. Microbiol. 89: 963–974. 2010 The DMM complex prevents spreading of DNA methyl- Canovas, D., K. J. Boyce, and A. Andrianopoulos, 2011 The fungal ation from transposons to nearby genes in Neurospora crassa. type II myosin in Penicillium marneffei, MyoB, is essential for Genes Dev. 24: 443–454. chitin deposition at nascent septation sites but not actin locali- Huisinga, K. L., and B. F. Pugh, 2004 A genome-wide housekeep- zation. Eukaryot. Cell 10: 302–312. ing role for TFIID and a highly regulated stress-related role for Cove, D. J., 1966 The induction and repression of nitrate reduc- SAGA in Saccharomyces cerevisiae. Mol. Cell 13: 573–585. tase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta Krappmann, S., C. Sasse, and G. H. Braus, 2006 Gene targeting in 113: 51–56. Aspergillus fumigatus by homologous recombination is facili- da Silva Ferreira, M. E., M. R. Kress, M. Savoldi, M. H. Goldman, A. tated in a nonhomologous end- joining-deficient genetic back- Hartl et al., 2006 The akuB(KU80) mutant deficient for non- ground. Eukaryot. Cell 5: 212–215. homologous end joining is a powerful tool for analyzing patho- Krijgsheld,P.,R.Bleichrodt,G.J.vanVeluw,F.Wang,W.H. genicity in Aspergillus fumigatus. Eukaryot. Cell 5: 207–211. Muller et al., 2013 Development in Aspergillus. Stud. Mycol. de Hoon, M. J., S. Imoto, J. Nolan, and S. Miyano, 2004 Open 74: 1–29. source clustering software. Bioinformatics 20: 1453–1454. Kuo, M. H., J. E. Brownell, R. E. Sobel, T. A. Ranalli, R. G. Cook Etxebeste, O., A. Garzia, E. A. Espeso, and U. Ugalde, et al., 1996 Transcription-linked acetylation by Gcn5p of his- 2010 Aspergillus nidulans asexual development: making the tones H3 and H4 at specific lysines. Nature 383: 269–272. most of cellular modules. Trends Microbiol. 18: 569–576. Kurshakova, M. M., A. N. Krasnov, D. V. Kopytova, Y. V. Shidlovskii, Freitag, M., R. L. Williams, G. O. Kothe, and E. U. Selker, 2002 A J. V. Nikolenko et al., 2007 SAGA and a novel Drosophila ex- cytosine methyltransferase homologue is essential for repeat- port complex anchor efficient transcription and mRNA export to induced point mutation in Neurospora crassa. Proc. Natl. Acad. NPC. EMBO J. 26: 4956–4965. Sci. USA 99: 8802–8807. Kwon, N. J., A. Garzia, E. A. Espeso, U. Ugalde, and J. H. Yu, Freitag, M., P. C. Hickey, T. K. Khlafallah, N. D. Read, and E. U. 2010 FlbC is a putative nuclear C(2)H(2) transcription factor Selker, 2004 HP1 is essential for DNA methylation in Neuros- regulating development in Aspergillus nidulans. Mol. Microbiol. pora. Mol. Cell 13: 427–434. 77: 1203–1219. Gacek, A., and J. Strauss, 2012 The chromatin code of fungal Lee, B. N., and T. H. Adams, 1994 The Aspergillus nidulans fluG secondary metabolite gene clusters. Appl. Microbiol. Biotechnol. gene is required for production of an extracellular developmen- 95: 1389–1404. tal signal and is related to prokaryotic glutamine synthetase I. Garzia, A., O. Etxebeste, E. Herrero-Garcia, R. Fischer, E. A. Espeso Genes Dev. 8: 641–651. et al., 2009 Aspergillus nidulans FlbE is an upstream develop- Lee, I., J. H. Oh, E. K. Shwab, T. R. Dagenais, D. Andes et al., mental activator of conidiation functionally associated with the 2009 HdaA, a class 2 histone deacetylase of Aspergillus fumi- putative transcription factor FlbB. Mol. Microbiol. 71: 172–184. gatus, affects germination and secondary metabolite produc- Garzia, A., O. Etxebeste, E. Herrero-Garcia, U. Ugalde, and E. A. tion. Fungal Genet. Biol. 46: 782–790. Espeso, 2010 The concerted action of bZip and cMyb tran- Lee, T. I., H. C. Causton, F. C. Holstege, W. C. Shen, N. Hannett scription factors FlbB and FlbD induces brlA expression and et al., 2000 Redundant roles for the TFIID and SAGA com- asexual development in Aspergillus nidulans. Mol. Microbiol. plexes in global transcription. Nature 405: 701–704. 75: 1314–1324. Li, L., J. Zhu, J. Tian, X. Liu, and C. Feng, 2010 A role for Gcn5 in Garzia, A., O. Etxebeste, J. Rodriguez-Romero, R. Fischer, E. A. cardiomyocyte differentiation of rat mesenchymal stem cells. Espeso et al., 2013 Transcriptional changes in the transition Mol. Cell. Biochem. 345: 309–316. from vegetative cells to asexual development in the model fun- Lin, W., G. Srajer, Y. A. Evrard, H. M. Phan, Y. Furuta et al., gus Aspergillus nidulans. Eukaryot. Cell 12: 311–321. 2007 Developmental potential of Gcn5(2/2) embryonic stem Georgakopoulos, P., R. A. Lockington, and J. M. Kelly, 2012 SAGA cells in vivo and in vitro. Dev. Dyn. 236: 1547–1557. complex components and acetate repression in Aspergillus nidu- Martinelli, S. D., and A. J. Clutterbuck, 1971 A quantitative sur- lans. G3 2: 1357–1367. vey of conidiation mutants in Aspergillus nidulans. J. Gen. Micro- Georgakopoulos, P., R. A. Lockington, and J. M. Kelly, 2013 The biol. 69: 261–268. Spt-Ada-Gcn5 Acetyltransferase (SAGA) complex in Aspergillus Medina, I., J. Carbonell, L. Pulido, S. C. Madeira, S. Goetz et al., nidulans. PLoS ONE 8: e65221. 2010 Babelomics: an integrative platform for the analysis of Grant,P.A.,L.Duggan,J.Cote,S.M.Roberts,J.E.Brownellet al., transcriptomics, proteomics and genomic data with advanced 1997 Yeast Gcn5 functions in two multisubunit complexes to functional profiling. Nucleic Acids Res. 38: W210–W213. acetylate nucleosomal histones: characterization of an Ada complex Millar, C. B., and M. Grunstein, 2006 Genome-wide patterns of and the SAGA (Spt/Ada) complex. Genes Dev. 11: 1640–1650. histone modifications in yeast. Nat. Rev. Mol. Cell Biol. 7: 657– Grewal, S. I., and S. Jia, 2007 Heterochromatin revisited. Nat. 666. Rev. Genet. 8: 35–46. Mirabito, P. M., T. H. Adams, and W. E. Timberlake, Grimaldi, B., P. Coiro, P. Filetici, E. Berge, J. R. Dobosy et al., 1989 Interactions of three sequentially expressed genes con- 2006 The Neurospora crassa White Collar-1 dependent blue trol temporal and spatial specificity in Aspergillus development. light response requires acetylation of histone H3 lysine 14 by Cell 57: 859–868. NGF-1. Mol. Biol. Cell 17: 4576–4583. Munoz-Galvan, S., S. Jimeno, R. Rothstein, and A. Aguilera, Gunderson, F. Q., and T. L. Johnson, 2009 Acetylation by the 2013 Histone H3K56 acetylation, Rad52, and non-DNA repair transcriptional coactivator Gcn5 plays a novel role in co- factors control double-strand break repair choice with the sister transcriptional spliceosome assembly. PLoS Genet. 5: e1000682. chromatid. PLoS Genet. 9: e1003237. Gunderson,F.Q.,E.C.Merkhofer,andT.L.Johnson,2011 Dynamic Nayak, T., E. Szewczyk, C. E. Oakley, A. Osmani, L. Ukil et al., histone acetylation is critical for cotranscriptional spliceosome as- 2006 A versatile and efficient gene targeting system for Asper- sembly and spliceosomal rearrangements. Proc. Natl. Acad. Sci. gillus nidulans. Genetics 172: 1557–1566. USA 108: 2004–2009. Ninomiya, Y., K. Suzuki, C. Ishii, and H. Inoue, 2004 Highly effi- Hammer, Ø., D. Harper, and P. D. Ryan, 2001 PAST: Paleontolog- cient gene replacements in Neurospora strains deficient for non- ical Statistics Software Package for Education and Data Analy- homologous end-joining. Proc. Natl. Acad. Sci. USA 101: sis. Palaeontologia Electronica 4: 1–9. 12248–12253.

1188 D. Cánovas et al. Nützmann, H. W., Y. Reyes-Dominguez, K. Scherlach, V. Schroeckh, nidulans reveals connections to nitric oxide metabolism. Mol. Mi- F. Horn et al., 2011 Bacteria-induced natural product forma- crobiol. 78: 720–738. tion in the fungus Aspergillus nidulans requires Saga/Ada-medi- Schroeckh, V., K. Scherlach, H. W. Nutzmann, E. Shelest, W. ated histone acetylation. Proc. Natl. Acad. Sci. USA 108: Schmidt-Heck et al., 2009 Intimate bacterial-fungal interac- 14282–14287. tion triggers biosynthesis of archetypal polyketides in Aspergillus Nützmann, H. W., J. Fischer, K. Scherlach, C. Hertweck, and A. A. nidulans. Proc. Natl. Acad. Sci. USA 106: 14558–14563. Brakhage, 2013 Distinct amino acids of histone H3 control Servet, C., N. Conde e Silva, and D. X. Zhou, 2010 Histone ace- secondary metabolism in Aspergillus nidulans. Appl. Environ. tyltransferase AtGCN5/HAG1 is a versatile regulator of devel- Microbiol. 79: 6102–6109. opmental and inducible gene expression in Arabidopsis. Mol. Palmer, J. M., R. M. Perrin, T. R. Dagenais, and N. P. Keller, Plant 3: 670–677. 2008 H3K9 methylation regulates growth and development Shwab, E. K., J. W. Bok, M. Tribus, J. Galehr, S. Graessle et al., in Aspergillus fumigatus. Eukaryot. Cell 7: 2052–2060. 2007 Histone deacetylase activity regulates chemical diversity Park,H.S.,andJ.H.Yu,2012 Geneticcontrolofasexualspor- in Aspergillus. Eukaryot. Cell 6: 1656–1664. ulation in filamentous fungi. Curr. Opin. Microbiol. 15: 669– Smyth, G. K., 2005 Limma: linear models for microarray data, pp. 677. 397–420 in Computational Biology Solutions Using R and Biocon- Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. Macdonald, and ductor, edited by V. C. R. Gentleman, S. Dudoit, R. Irizarry, and A. W. Bufton, 1953 The genetics of Aspergillus nidulans. Adv. W. Huber. Springer, New York. Genet. 5: 141–238. Soukup, A. A., Y. M. Chiang, J. W. Bok, Y. Reyes-Dominguez, B. R. Purschwitz, J., S. Muller, C. Kastner, M. Schoser, H. Haas et al., Oakley et al., 2012 Overexpression of the Aspergillus nidulans 2008 Functional and physical interaction of blue- and red-light histone 4 acetyltransferase EsaA increases activation of second- sensors in Aspergillus nidulans. Curr. Biol. 18: 255–259. ary metabolite production. Mol. Microbiol. 86: 314–330. Reyes-Dominguez, Y., F. Narendja, H. Berger, A. Gallmetzer, R. Spedale, G., H. T. Timmers, and W. W. Pijnappel, 2012 ATAC- Fernandez-Martin et al., 2008 Nucleosome positioning and king the complexity of SAGA during evolution. Genes Dev. 26: histone H3 acetylation are independent processes in the Asper- 527–541. gillus nidulans prnD-prnB bidirectional promoter. Eukaryot. Cell Strauss, J., and Y. Reyes-Dominguez, 2011 Regulation of second- 7: 656–663. ary metabolism by chromatin structure and epigenetic codes. Reyes-Dominguez, Y., J. W. Bok, H. Berger, E. K. Shwab, A. Basheer Fungal Genet. Biol. 48: 62–69. et al., 2010 Heterochromatic marks are associated with the Tamaru, H., and E. U. Selker, 2001 A histone H3 methyltransfer- repression of secondary metabolism clusters in Aspergillus nidu- ase controls DNA methylation in Neurospora crassa. Nature 414: lans. Mol. Microbiol. 76: 1376–1386. 277–283. Reyes-Dominguez, Y., S. Boedi, M. Sulyok, G. Wiesenberger, N. Timberlake, W. E., 1980 Developmental gene regulation in Asper- Stoppacher et al., 2012 Heterochromatin influences the sec- gillus nidulans. Dev. Biol. 78: 497–510. ondary metabolite profile in the plant pathogen Fusarium gra- Tribus, M., I. Bauer, J. Galehr, G. Rieser, P. Trojer et al., 2010 A minearum. Fungal Genet. Biol. 49: 39–47. novel motif in fungal class 1 histone deacetylases is essential for Rodriguez-Navarro,S.,T.Fischer,M.J.Luo,O.Antunez,S.Brettsch- growth and development of Aspergillus. Mol. Biol. Cell 21: 345– neider et al., 2004 Sus1, a functional component of the SAGA 353. histone acetylase complex and the nuclear pore-associated mRNA Wilson, R. A., P. K. Chang, A. Dobrzyn, J. M. Ntambi, R. Zarnowski export machinery. Cell 116: 75–86. et al., 2004 Two Delta9-stearic acid desaturases are required Rodriguez-Urra, A. B., C. Jimenez, M. I. Nieto, J. Rodriguez, H. for Aspergillus nidulans growth and development. Fungal Genet. Hayashi et al., 2012 Signaling the induction of sporulation Biol. 41: 501–509. involves the interaction of two secondary metabolites in Asper- Workman, J. L., 2006 Nucleosome displacement in transcription. gillus nidulans. ACS Chem. Biol. 7: 599–606. Genes Dev. 20: 2009–2017. Rountree, M. R., and E. U. Selker, 2010 DNA methylation and the Yu, J. H., J. Wieser, and T. H. Adams, 1996 The Aspergillus FlbA formation of heterochromatin in Neurospora crassa. Heredity RGS domain protein antagonizes G protein signaling to block (Edinb) 105: 38–44. proliferation and allow development. EMBO J. 15: 5184–5190. Ruger-Herreros, C., J. Rodriguez-Romero, R. Fernandez-Barranco, Yu, J. H., J. H. Mah, and J. A. Seo, 2006 Growth and develop- M. Olmedo, R. Fischer et al., 2011 Regulation of conidiation mental control in the model and pathogenic aspergilli. Eukar- by light in Aspergillus nidulans. Genetics 188: 809–822. yot. Cell 5: 1577–1584. Schinko, T., H. Berger, W. Lee, A. Gallmetzer, K. Pirker et al., 2010 Transcriptome analysis of nitrate assimilation in Aspergillus Communicating editor: A. P. Mitchell

GcnE is Essential for Fungal Conidiation 1189 GENETICS

Supporting Information http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.114.165688/-/DC1

The Histone Acetyltransferase GcnE (GCN5) Plays a Central Role in the Regulation of Aspergillus Asexual Development

David Cánovas, Ana T. Marcos, Agnieszka Gacek, María S. Ramos, Gabriel Gutiérrez, Yazmid Reyes-Domínguez, and Joseph Strauss

Copyright © 2014 by the Genetics Society of America DOI: 10.1534/genetics.114.165688

Table S1 A. nidulans strains used in this study

Strain Relevant genotype Source

biA1; veA1

biA1; yA2; veA1 (REYES-DOMINGUEZ et al. 2008)

biA1; ∆gcnE::pyrG; veA1 (REYES-DOMINGUEZ et al. 2008) TU85 biA1 pabaA1; argB2; pyroA4 ;∆brlA::argB veA+ Nancy Keller

TNJ37.2 pyrG89 ∆abaA::AfpyrG; pyroA4; veA+ (KWON et al. 2010) TMY1 ∆wetA::AfpyrG; pyrG89 pyroA4 veA+ Jae-Hyuk Yu

A1153gcnE-3xflag yA1; pabaA1; gcnE::gcnEp-gcnE-3x-flag-pabaA; pyroA4; (NÜTZMANN et al. 2011) ∆nkuA::bar FGSC A1078 yA2; pabaA1; biA1; methG1; alcA(p)::brlA; veA1 FGSC DKA106 argB2; ∆gcnE::pyrG; veA1 This study DKA234 ∆gcnE::pyrG; alcA(p)::brlA; veA1 This study DKA235 ∆gcnE::pyrG; alcA(p)::brlA; veA1 This study

2 SI D. Cánovas et al.

Table S2 Primers used in this study

Primer name Sequence brlA-F TACCGCGACGGGTTTCAG brlA-R GAGGTCTGTCGTCGGAGCAT fluG-F CTCGAAGAAATCGCCGAAAC fluG-R CTCGGCATGGAATTGTTGAA flbA-F CTGGCTGATGGACTGTTCGA flbA-R CAAAAAGTTCCGCGATCAGAA flbB-F CGCTTACGGCGCATACTTACA flbB-R TCGGGCTCATTCCTGATGA flbC-F GAGAAGCGTCATTCGCTTGTG flbC-R CGGAGGTTAGAGACAACGGAAA benA-F CCAGTGTGGTAACCAGGTTGGT benA-R GGCGTCGAGGCCATGTT brlAp1-2483 GAGATGTGCAGCCGGGTACT brlAp1-2303 TTCCCACTGCCTGTCATTCC brlAp3-245 CAGTCTTTTACTGCTGTCGAGATTAGC brlAp3-60 CAGAGCACCGTTCAGTTTACGT flbAp-227 AGGTTTCATTTCCCTACCTATCCA flbAp-30 AGGCTAGGGCAGACTAAGTAAAATGAG flbBp-244 TGCGTATACCCATCATTTCCAA flbBp-60 GCGTGAAGCGAGGAAAGG flbCp-208 CCTCTACTCTCGACCAGCTTCCT flbCp-26 CTGGAAGATCGTGTTGATGTTCTC fluGp-220 CGATCGTCGCTGGTCCTACT fluGp-40 AAAATAAACCCCCCCAGAAAAC

D. Cánovas et al. 3 SI

Table S3 Top 25 genes induced during conidiation in the wild type strain log NAMES qmedian Description AN0602 4.57 Ortholog of A. niger CBS 513.88: An15g02350, A. oryzae RIB40: AO090023000525, A. niger ATCC 1015: 48700-mRNA, A. versicolor: Aspve1_0146150 and A. sydowii: Aspsy1_0055411 AN1837 5.36 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor AN1837 4.95 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor AN4641 4.48 Hypothetical protein AN5650 4.72 Ortholog(s) have Golgi apparatus, cell division site, cell tip, endoplasmic reticulum localization AN7804 4.87 Putative FAD-containing monooxygenase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster; expression upregulated after exposure to farnesol AN7806 4.79 Putative versicolorin reductase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN7809 5.15 Ortholog of A. versicolor : Aspve1_0126175 and A. terreus NIH2624 : ATET_01291 AN7813 5.35 Hypothetical protein AN7821 4.99 Putative norsolorinic acid reductase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN7824 4.73 Putative sterigmatocystin biosynthesis P450 monooxygenase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN8006 5.99 Hydrophobin, protein of the conidium wall responsible for hydrophobicity of conidium surface; recombinant DewA spontaneously assembles at air:water interfaces and forms functional amyloids AN8375 6.04 Hypothetical protein AN8379 4.81 Predicted oxidoreductase; required for austinol and dehydroaustinol biosynthesis AN8384 4.99 Protein of unknown function; required for austinol and dehydroaustinol biosynthesis; aus secondary metabolism gene cluster member AN8803 4.99 Hydrophobin; protein involved in conidium development; required for the formation of outer hydrophobic layer (rodlet layer) of the conidium wall; transcriptionally regulated by BrlA; predicted glycosylphosphatidylinositol (GPI)-anchor AN9247 5.14 Protein required for normal levels of austinol and dehydroaustinol production AN9253 4.59 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis AN7825 4.47 Putative polyketide synthase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN8439 4.45 Protein of unknown function; transcript is induced by nitrate; predicted NirA binding site AN0499 4.43 Has domain(s) with predicted chitin binding activity, role in chitin metabolic process and extracellular region localization AN9248 4.42 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis AN1818 4.41 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans AN9246 4.39 Predicted dioxygenase; required for austinol and dehydroaustinol biosynthesis AN3722 4.38 Has domain(s) with predicted role in transmembrane transport and integral to membrane localization

4 SI D. Cánovas et al.

Table S4 Top 25 genes induced during vegetative growth in the wild type strain

log NAMES qmedian Description AN1826 -4.98 Has domain(s) with predicted hydrolase activity AN1825 -4.51 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation AN9295 -4.38 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN5943 -4.30 Ortholog of A. nidulans FGSC A4 : AN8548, AN8661, AN4642, A. fumigatus Af293 : Afu3g00850, Afu4g08850 and A. niger CBS 513.88 : An02g13470, An11g00090, An03g01430, An12g09260 AN6754 -4.03 Predicted glycosylphosphatidylinositol (GPI)-anchored protein AN2623 -3.77 Isopenicillin-N N-acyltransferase; null produces reduced levels of penicillin; partially redundant with aatB AN5945 -3.74 Ortholog of A. fumigatus Af293 : Afu6g14630, N. fischeri NRRL 181 : NFIA_060670 and A. terreus NIH2624 : ATET_10017 AN7233 -3.72 Putative epoxide hydrolase; expression reduced after exposure to farnesol AN1541 -3.70 Has domain(s) with predicted oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor activity and role in oxidation-reduction process AN2571 -3.69 Hypothetical protein AN5228 -3.65 Putative NADH:flavin oxidoreductase/NADH oxidase; intracellular, menadione stress-induced protein AN2622 -3.61 Isopenicillin-N synthase with a role in penicillin biosynthesis; expression is negatively regulated by glucose and acidic pH AN9001 -3.57 Hypothetical protein AN6095 -3.57 Has domain(s) with predicted role in transmembrane transport and integral to membrane localization AN6075 -3.51 Has domain(s) with predicted ammonia-lyase activity, role in L-phenylalanine catabolic process, biosynthetic process and cytoplasm localization AN1304 -3.49 Hypothetical protein AN9108 -3.48 Has domain(s) with predicted heme binding activity AN3866 -3.48 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism AN0620 -3.45 Ortholog of A. versicolor : Aspve1_0023747 and Aspergillus sydowii : Aspsy1_0086329 AN6424 -3.43 Has domain(s) with predicted oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors activity AN4845 -3.37 Hypothetical protein AN5444 -3.30 Putative tryptophan synthase with a predicted role in aromatic amino acid biosynthesis AN3030 -3.21 Alcohol dehydrogenase, class V; upregulated in A. oryzae and A. nidulans under hypoxic growth conditions AN8972 -3.18 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN6249 -3.17 Putative calcineurin binding protein, calcipressin

D. Cánovas et al. 5 SI

Table S5 Top 25 genes induced during conidiation in the ∆gcnE strain.

log NAMES qmedian Description AN0482 3.13 Putative ubiquitin-conjugating enzyme; transcript repressed by nitrate AN0546 3.12 Hypothetical protein AN1604 3.84 Putative alpha-1,3-glucanase; predicted glycosyl phosphatidylinositol (GPI)-anchor AN1818 4.10 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans AN3613 3.29 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans; transcription is controlled by the carbon catabolite repression system AN3860 2.94 Putative beta-1,4-endoglucanase AN5037 3.10 Has domain(s) with predicted electron carrier activity, flavin adenine dinucleotide binding, oxidoreductase activity, acting on CH-OH group of donors activity and role in oxidation- reduction process AN5267 2.94 Protein with ferulic acid esterase activity, involved in degradation of xylans AN5290 3.09 Predicted glycosylphosphatidylinositol (GPI)-anchored protein AN5408 4.25 Has domain(s) with predicted RNA binding, ribonuclease III activity and role in RNA processing AN5942 3.29 Ortholog of A. versicolor : Aspve1_0148858 and Aspergillus sydowii : Aspsy1_0029071 AN6401 3.94 Putative hydrophobin AN6718 3.06 Has domain(s) with predicted ATP binding, nucleoside-triphosphatase activity AN7549 3.33 Transcript induced in response to calcium dichloride in a CrzA-dependent manner AN7580 3.71 Ortholog of A. fumigatus Af293 : Afu2g15110, A. niger CBS 513.88 : An15g02960, A. oryzae RIB40 : AO090012000329, A. versicolor : Aspve1_0030832 and Aspergillus sydowii : Aspsy1_0046014 AN8154 3.06 Hypothetical protein AN8479 3.16 Has domain(s) with predicted RNA binding, RNA-directed DNA polymerase activity and role in RNA-dependent DNA replication AN8611 3.79 Has domain(s) with predicted catalytic activity and role in nucleoside metabolic process AN9380 3.78 Putative chitin deacetylase; catalyzes the conversion of chitin to chitosan by the deacetylation of N-acetyl-D-glucosamine residues AN7594 2.89 DUF636 domain-containing protein; intracellular, menadione stress-induced protein; protein levels decrease in response to farnesol AN0635 2.89 Ortholog(s) have intracellular localization AN2029 2.85 Putative F-box protein AN1813 2.83 Ortholog of A. niger CBS 513.88 : An06g00160, A. oryzae RIB40 : AO090038000504, AO090138000042, AO090103000093, A. niger ATCC 1015 : 37735-mRNA and A. versicolor : Aspve1_0125259 AN6530 2.79 Ortholog(s) have 1-acylglycerol-3-phosphate O-acyltransferase activity, 1- acylglycerophosphocholine O-acyltransferase activity, role in glycerophospholipid biosynthetic process and endoplasmic reticulum, ribosome localization AN8483 2.75 Ortholog of A. niger CBS 513.88 : An13g02730, Aspergillus brasiliensis : Aspbr1_0180212, N. fischeri NRRL 181 : NFIA_001870, Aspergillus flavus NRRL 3357 : AFL2T_10566 and A. clavatus NRRL 1 : ACLA_063590

6 SI D. Cánovas et al.

Table S6 Top 25 genes induced during vegetative growth in the ∆gcnE strain.

log NAMES qmedian Description AN1726 -5.09 Putative 3-methyl-2-oxobutanoate dehydrogenase AN1825 -5.27 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation AN1826 -5.47 Has domain(s) with predicted hydrolase activity AN1895 -4.54 Maleyl-acetoacetate isomerase, enzyme involved in phenylalanine catabolism AN1896 -3.96 Fumarylacetoacetate hydrolase, catalyzes the last step in the phenylalanine catabolic pathway; intracellular; protein abundance decreased by menadione stress; mutation in human ortholog causes type I hereditary tyrosinaemia AN1897 -5.64 Homogentisate 1,2-dioxygenase, enzyme in phenylalanine catabolism; required for growth on phenylalanine or phenylacetate as the sole carbon source; mutation in human ortholog results in alkaptonuria AN1899 -5.54 Putative 4-hydroxyphenylpyruvate dioxygenase with a predicted role in aromatic amino acid biosynthesis; expression induced by phenylalanine and repressed by glucose; mutants unable to use phenylalanine as a sole carbon source AN3555 -3.74 Small heat-shock protein; Hsp30p ortholog/paralog; expression upregulated after exposure to farnesol; palA-dependent expression independent of pH AN3639 -4.80 Putative dihydrolipoamide transacylase; alpha keto acid dehydrogenase E2 subunit AN3866 -4.07 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism AN4688 -4.12 Putative acyl-coA dehydrogenase AN7324 -4.09 Has domain(s) with predicted oxidoreductase activity and role in oxidation-reduction process AN8559 -4.08 Putative branched chain alpha-keto acid dehydrogenase E1, beta subunit AN9007 -5.81 Putative cytochrome P450; predicted secondary metabolism gene cluster member AN9108 -5.01 Has domain(s) with predicted heme binding activity AN1858 -3.69 Putative tryptophan 2,3-dioxygenase with a predicted role in aromatic amino acid biosynthesis AN2623 -3.50 Isopenicillin-N N-acyltransferase; null produces reduced levels of penicillin; partially redundant with aatB AN5957 -3.36 Putative branched chain amino acid aminotransferase with a predicted role in valine, leucine, and isoleucine metabolism AN8559 -3.23 Putative branched chain alpha-keto acid dehydrogenase E1, beta subunit AN4690 -3.22 Alpha subunit of 3-methylcrotonyl-CoA carboxylase, involved in leucine degradation AN6940 -3.22 Has domain(s) with predicted metal ion transmembrane transporter activity, role in metal ion transport, transmembrane transport and membrane localization AN6476 -3.17 Hypothetical protein AN2571 -3.11 Hypothetical protein AN6476 -3.11 Hypothetical protein AN1898 -3.11 Ortholog(s) have role in melanin biosynthetic process from tyrosine, tyrosine catabolic process and cytoplasm localization

D. Cánovas et al. 7 SI

File S1

GO term analysis of the genes found by ANOVA to be differentially regulated.

A gene ontology (GO) analysis of the genes that define each component revealed that the genes located in the positive values of

1st PC are mainly involved in oxidation-reduction processes, secondary metabolism and polysaccharide metabolism, which includes cell wall biogenesis (Table S6 and Figure S1), while genes located in the negative values of 1st PC are principally involved in general primary metabolism, in particular metabolism of carboxilic and organic acids, ketones, small molecules, amino acids and coenzymes, and oxidation-reduction processes (Table S7 and Figure S1). The positive values of the 2nd PC are characterized by genes involved in secondary and primary metabolism (in particular, metabolism of carbohydrates, cellular nitrogen, carboxilic acids, ketones, small molecules, amino acids and coenzymes, and oxidation-reduction processes) (Table S8 and Figure S2). The genes that group at the negative values of the 2nd PC are involved in the metabolism of xylan and glucan carbohydrates, and cell wall polysaccharide metabolism (Table S9 and Figure S2). Interestingly, there was a major contribution of unknown genes (aproximately

50%) in this category (negative values of the second PC). The expression of most of the genes in the GO categories of response to stress, cellular response to stress, DNA metabolic process, response to DNA damage stimulus and DNA repair was higher in the gcnE mutant grown under conidiation conditions (Figure S2). Two strange cases are ppoA and phiA. ppoA is responsible for the synthesis of an oxylipin that regulates the balance between conidiation and sexual development (TSITSIGIANNIS et al. 2004). The expression of ppoA is also higher in the gcnE mutant growing under conidiation conditions. phiA, a gene required for phialide formation (MELIN et al. 2003), was up-regulated in the gcnE mutant even growing vegetatively.

8 SI D. Cánovas et al.

Table S7 Top 20 genes in the first PC (positive values)

Gene code PC value X- Gene description axis AN5650 0.11 Has domain(s) with predicted role in transmembrane transport and integral to membrane localization AN9247 0.1027 Protein required for normal levels of austinol and dehydroaustinol production AN7809 0.09632 Ortholog of A. terreus NIH2624 : ATEG_01291 AN8384 0.09609 Protein of unknown function; required for austinol and dehydroaustinol biosynthesis AN9253 0.09568 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis AN8006 0.0955 Hydrophobin, protein of the conidium wall responsible for hydrophobicity of conidium surface; recombinant DewA spontaneously assembles at air:water interfaces and forms functional amyloids AN1837 0.09346 Putative hydrophobin; predicted glycosyl phosphatidylinositol (GPI)-anchor AN7806 0.09198 Putative versicolorin reductase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN4641 0.08857 Hypothetical protein AN8375 0.08841 Hypothetical protein AN9246 0.08729 Predicted dioxygenase; required for austinol and dehydroaustinol biosynthesis AN9258 0.08666 Hypothetical protein AN0499 0.08614 Has domain(s) with predicted chitin binding activity, role in chitin metabolic process and extracellular region localization AN2665 0.08514 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN8908 0.08013 Ortholog of A. fumigatus Af293 : Afu8g00630, A. niger CBS 513.88 : An07g00510, A. oryzae RIB40 : AO090009000111, A. flavus NRRL 3357 : AFL2G_10541 and A. niger ATCC 1015 : 180382-mRNA AN8979 0.07799 Alcohol dehydrogenase with a role in two-carbon compound metabolism; expression is negatively regulated by glucose; transcript upregulated by exposure to ethanol AN7810 0.07611 Putative aflatoxin biosynthesis protein with a role in aflatoxin/sterigmatocystin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN9248 0.07526 Putative cytochrome P450; required for austinol and dehydroaustinol biosynthesis AN7821 0.07496 Putative norsolorinic acid reductase with a predicted role in sterigmatocystin/aflatoxin biosynthesis; member of the sterigmatocystin biosynthesis gene cluster AN8624 0.07415 Hypothetical protein

D. Cánovas et al. 9 SI

Table S8 Top 20 genes in the first PC (negative values)

Gene code PC value X- Gene description axis AN0824 0.0513 Putative mitochondrial acyl-coA dehydrogenase involved in short-chain fatty acid beta- oxidation; required for growth on short-chain fatty acids AN5944 0.0514 Ortholog of A. nidulans FGSC A4 : AN10908, A. niger CBS 513.88 : An06g00460, An16g08070, An11g00100, An07g04470, A. oryzae RIB40 : AO090038000122 and A. flavus NRRL 3357 : AFL2G_08946, AFL2G_10172 AN6095 0.05162 Has domain(s) with predicted role in transmembrane transport and integral to membrane localization AN9295 0.05317 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN8963 0.05358 Hypothetical protein AN1899 0.05361 Putative 4-hydroxyphenylpyruvate dioxygenase with a predicted role in aromatic amino acid biosynthesis; expression induced by phenylalanine and repressed by glucose; mutants unable to use phenylalanine as a sole carbon source AN3639 0.0542 Putative dihydrolipoamide transacylase; alpha keto acid dehydrogenase E2 subunit AN0620 0.05424 Hypothetical protein AN7324 0.05544 Has domain(s) with predicted oxidoreductase activity and role in oxidation-reduction process AN6438 0.05656 Ortholog(s) have exopeptidase activity AN9007 0.05743 Putative cytochrome P450 AN6249 0.05796 Putative calcineurin binding protein, calcipressin AN6754 0.05936 Predicted glycosylphosphatidylinositol (GPI)-anchored protein AN3866 0.06007 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism AN7233 0.06644 Putative epoxide hydrolase; expression reduced after exposure to farnesol AN6424 0.06821 Has domain(s) with predicted oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors activity AN2572 0.07122 Putative dipeptidyl-peptidase; transcript upregulated by nitrate limitation AN1826 0.07172 Has domain(s) with predicted hydrolase activity AN9108 0.08742 Has domain(s) with predicted heme binding activity AN1825 0.08933 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation

10 SI D. Cánovas et al.

Table S9 Top 20 genes in the second PC (positive values)

Gene code PC value X- Gene description axis AN3675 0.1177 Transcription factor of the Gcn4p c-Jun-like transcriptional activator family; involved in cross- pathway control of amino acid biosynthesis in response to amino acid starvation; role in sexual development; contains two 5' uORFs AN1825 0.1007 Putative sulfide:quinone oxidoreductase; transcript repressed by nitrogen limitation AN2571 0.09414 Hypothetical protein AN3992 0.09197 Ortholog of A. nidulans FGSC A4 : AN8424, AN7089, A. fumigatus Af293 : Afu7g05085, A. oryzae RIB40 : AO090005000321, A. flavus NRRL 3357 : AFL2G_00322, AFL2G_06467 and N. fischeri NRRL 181 : NFIA_026200 AN7793 0.0898 Hypothetical protein AN1304 0.0861 Hypothetical protein AN1826 0.08586 Has domain(s) with predicted hydrolase activity AN2319 0.08414 Ortholog of A. niger CBS 513.88 : An14g04210, A. oryzae RIB40 : AO090010000485, A. flavus NRRL 3357 : AFL2G_11647, A. niger ATCC 1015 : 49373-mRNA and A. terreus NIH2624 : ATEG_07606 AN9184 0.08085 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN8148 0.07651 Hypothetical protein AN3396 0.07358 Putative non-ribosomal peptide synthase (NRPS); transcript repressed by nitrogen limitation AN6940 0.07249 Has domain(s) with predicted metal ion transmembrane transporter activity, role in metal ion transport, transmembrane transport and membrane localization AN3866 0.07062 Putative dehydratase with a predicted role in glycine, serine, and threonine metabolism AN3555 0.06999 Small heat-shock protein; Hsp30p ortholog/paralog; expression upregulated after exposure to farnesol; palA-dependent expression independent of pH AN2585 0.06933 Has domain(s) with predicted substrate-specific transmembrane transporter activity, role in transmembrane transport and integral to membrane localization AN9304 0.06752 Glutathione S-transferase; upregulated in A. oryzae and A. nidulans under hypoxic growth conditions AN6104 0.0673 Ortholog of A. fumigatus Af293 : Afu2g09510, A. niger CBS 513.88 : An16g06890, A. oryzae RIB40 : AO090011000722, A. flavus NRRL 3357 : AFL2G_05453 and A. niger ATCC 1015 : 205026-mRNA AN6753 0.06548 Putative NADH-dependent flavin oxidoreductase; menadione stress-induced protein AN7792 0.06529 Putative lysophosphoplipase A; predicted glycosylphosphatidylinositol (GPI)-anchored protein AN1726 0.06515 Putative 3-methyl-2-oxobutanoate dehydrogenase

D. Cánovas et al. 11 SI

Table S10 Top 20 genes in the second PC (negative values)

Gene code PC value X- Gene description axis AN1818 0.06743 Protein with endo-1,4-beta-xylanase activity, involved in degradation of xylans AN3877 0.06905 Ortholog of A. fumigatus Af293 : Afu8g01510, A. niger CBS 513.88 : An09g00650, A. oryzae RIB40 : AO090020000665, A. flavus NRRL 3357 : AFL2G_10687 and A. niger ATCC 1015 : 203168-mRNA AN2029 0.06913 Putative F-box protein AN5509 0.06925 Putative F-box protein AN5408 0.06956 Has domain(s) with predicted RNA binding, ribonuclease III activity and role in RNA processing AN7087 0.07038 Ortholog of A. fumigatus Af293 : Afu8g07170, A. oryzae RIB40 : AO090005000253, A. flavus NRRL 3357 : AFL2G_00260, N. fischeri NRRL 181 : NFIA_099960 and A. clavatus NRRL 1 : ACLA_060210 AN7580 0.0705 Ortholog of A. fumigatus Af293 : Afu2g15110, A. niger CBS 513.88 : An15g02960, A. oryzae RIB40 : AO090012000329, A. flavus NRRL 3357 : AFL2G_03238 and N. fischeri NRRL 181 : NFIA_090370 AN1604 0.07053 Putative alpha-1,3-glucanase; predicted glycosyl phosphatidylinositol (GPI)-anchor AN7908 0.07226 Protein with alpha-arabinofuranosidase activity, involved in degradation of pectin; member of the F9775 secondary metabolite gene cluster AN7876 0.07244 Putative branched chain amino acid aminotransferase with a predicted role in branched chain amino acid biosynthesis AN3520 0.07264 Ortholog of A. niger CBS 513.88 : An04g10140 and A. niger ATCC 1015 : 55208-mRNA AN6936 0.07337 Putative 2-hydroxychromene-2-carboxylate isomerase AN6273 0.07357 Ortholog(s) have intracellular localization AN6151 0.07382 Has domain(s) with predicted catalytic activity and role in metabolic process AN8154 0.0748 Hypothetical protein AN0482 0.07696 Putative ubiquitin-conjugating enzyme; transcript repressed by nitrate AN3882 0.08028 Has domain(s) with predicted cysteine-type endopeptidase activity and role in proteolysis AN9273 0.08553 Ortholog of A. oryzae RIB40 : AO090005000176, A. flavus NRRL 3357 : AFL2G_00195 and A. terreus NIH2624 : ATEG_04373 AN8479 0.08646 Has domain(s) with predicted RNA binding, RNA-directed DNA polymerase activity and role in RNA-dependent DNA replication AN5290 0.0919 Predicted glycosylphosphatidylinositol (GPI)-anchored protein

12 SI D. Cánovas et al.

Figure S1 Genetic complementation of the gcnE deletion. Strains were grown in minimal medium containing the appropriate nutritional requirements and photographed under the stereo microscope after 4 days of growth.

D. Cánovas et al. 13 SI

Figure S2 Comparision of the up- and down-regulated genes in the wild type and ∆gcnE strains. The Venn-diagram depicts the number of genes down-regulated (differentially expressed during vegetative growth) or up-regulated (differentially expressed during conidiation) in the wild type and ∆gcnE strains. The size of the circle is propotional to the number of differentially regulated genes. The number of genes differentially regulated is 3.8-fold lower in the ∆gcnE than in the wild type strain. Specifically there are 3.3- and 4.5-fold lower number of differentially expressed genes during vegetative growth and conidiation, respectively, showing a tendency of gcnE to regulate conidiation genes. Genes up- or down-regulated in both strains are shown in the overlapping region of the circles and the total number of differentially regulated genes in each condition is shown in brackets.

14 SI D. Cánovas et al.

Figure S3 Analysis of GO terms of biological processes of the genes differentially up-regulated (conidiation) or down-regulated (vegetative) in the wild type strain. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

D. Cánovas et al. 15 SI

Figure S4 Analysis of GO terms of biological processes of the genes differentially up-regulated (conidiation) or down-regulated (vegetative) in the ∆gcnE strain. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

16 SI D. Cánovas et al.

Figure S5 Analysis of GO terms of biological processes of the genes in the X-axis of the PC analysis. Genes with PC values over 0.5 (positive values) or under -0.5 (negative values) were selected for further analysis by GO terms because these are the genes that provide a higher statistical weight for defining the characteristics of the axis. The upper diagram depicts the GO terms of biological processes that are enriched in the list of differentially regulated genes located in the positive values of the X-axis. The lower diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the negative values of the X- axis. One gene can appear in more than one category. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

D. Cánovas et al. 17 SI

Figure S6 Analysis of GO terms of biological processes of the genes in the Y-axis of the PC analysis. Genes with PC values over 0.5 (positive values) or under -0.5 (negative values) were selected for further analysis by GO terms because these are the genes that provide a higher statistical weight for defining the characteristics of the axis. The upper diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the positive values of the Y-axis. The lower diagram depicts the GO terms that are enriched in the list of differentially regulated genes located in the negative values of the Y-axis. Please note that one gene can appear in more than one category. Data is shown as percentage of genes in the actual category with respect to the total number of genes used for the GO term analysis.

18 SI D. Cánovas et al.

Figure S7 Total amount of histone H3 at the promoter of brlA. Wild type and ∆gcnE strains were grown vegetatively for 18h and then conidiation was induced for 10 or 72 h. ChIP was carried out by immunoprecipitation of crosslinked DNA with an antibody against the C-terminus of histone H3, followed by qPCR analysis of the promoter regions. Consistent with a loss of nucleosomes during gene activation brlA showed a decrease in the immunoprecipitated DNA in both distal (brlAp1) and proximal (brlAp3) regions of the promoter in the wild type after induction of conidiation (con 10h, con 72h). The ∆gcnE mutant showed lower amounts than the wild type strain during vegetative growth but had comparable amounts after induction of conidiation. These low amounts also provide an explanation of the very low H3K9ac/K14ac levels found in the ∆gcnE strain at vegetative conditions (compare with Figure 5B), however, when the values shown in Figure 5B are normalized to the H3 C-terminal values there are still significantly lower acetylation levels found in the gcnE mutant. Values are the mean and standard error of the mean of at least 3 independent experiments.

D. Cánovas et al. 19 SI

Figure S8 Inhibitors of histone deacetylases do not rescue the aconidial gcnE deletion phenotype. Wild type and ∆gcnE strains were inoculated on complete medium plates containing trichostatin A, or a cocktail of inhibitors (trichostatin A, butyrate and valproate) at 5µM. Plates were grown at 37°C for 4 days and then photographed.

20 SI D. Cánovas et al.