(12) United States Patent (10) Patent No.: US 8,617.534 B2 Sussman Et Al

USOO8617534B2

(12) United States Patent (10) Patent No.: US 8,617.534 B2 Sussman et al. (45) Date of Patent: Dec. 31, 2013

(54) COMPOSITIONS AND METHOD FOR Bachmann, “The serine/threonine kinase Pim-1'. The International MANIPULATING PM-1 ACTIVITY IN Journal of Biochemistry & Cell Biology 37 (2005) 726-730. CIRCULATORY SYSTEM CELLS Bhattacharya, "Pim-1 associates with protein complexes necessary for mitosis”. Chromosoma (2002) 111:80-95. (75) Inventors: Mark A. Sussman, San Diego, CA Camper-Kirby, “Myocardial Akt Activation and Gender: Increased (US); John A. Muraski, San Clemente, Nuclear Activity in Females Versus Males'. Circulation Research CA (US) (2001), 88: 1020-1027. Fransioli, “Evolution of the c-kit-Positive Cell Respons to Pathologi (73) Assignee: San Diego State University (SDSU) cal Challenge in the Myocardium', StemCells (2008) 26:1315-1324. Foundation, San Diego, CA (US) Gude, "Akt Promotes Increased Cardiomyocyte Cycling and Expan sion of the Cardiac Progenitor Cell Population'. Circulation Research (2006) 99:381-388. (*) Notice: Subject to any disclaimer, the term of this Hammerman, "Pim and Akt oncogenes are independent regulators of patent is extended or adjusted under 35 hematopoietic cell growth and survival', (2005) 105:4477-4483. U.S.C. 154(b) by 419 days. Katakami, “Role of Pim-1 in Smooth Muscle Cell Proliferation'. The Journal of Biological Chemistry, vol. 279, No. 52, Issue of Dec. 24. (21) Appl. No.: 12/742,871 pp. 54742-54749, 2004. Kato, 'Atrial natriuretic peptide promotes cardiomyocyte Survival by (22) PCT Filed: Nov. 14, 2008 cGMP-dependent nuclear accumulation of Zyxin and Akt'. The Jour nal of Clinical Investigation, vol. 115, No. 10, Oct. 2005, pp. 2716 (86). PCT No.: PCT/US2O08/083693 2730. Lily, “The PIM-1 serine kinase prolongs survival and inhibits S371 (c)(1), apoptosis-related mitochondrial dysfunction in part through a bcl-2- (2), (4) Date: Jul. 21, 2010 dependent pathway”. Oncogene (1999) 18, 4022-4031. Macdonald, “Pim kinases phosphorylate multiple sites on Bad and (87) PCT Pub. No.: WO2009/065080 promote 14-3-3 binding and dissociation from Bcl-XL, BMC Cell Biology (2006) 7:1, pp. 1-14. PCT Pub. Date: May 22, 2009 Mikkers, "Mice Deficient for All PIM Kineses Display Reduced Body Size and Impaired Responses to Hematopoietic Growth Fac (65) Prior Publication Data tors’, Mol. Cell Biol. 2004, 24(13):6104–61 15. US 2010/0316701 A1 Dec. 16, 2010 Muraski, "Pim-1 regulates cardiomyocyte survival downstream of Akt, Nature Medicine, vol. 13, No. 12, Oct. 2007, pp. 1467-1475. Plank. “Calcium dynamics in the failing heart: restoration by Related U.S. Application Data B-adrenergic receptor blockade'. Am. J. Physiol. Heart Circ. Physiol. (60) Provisional application No. 61/091,698, filed on Aug. 285: H305-H315, 2003. 25, 2008, provisional application No. 60/988,753, Roh, "Overexpression of the Oncogenic Kinase Pim-1 Leads to filed on Nov. 16, 2007. Genomic Instability”, Cancer Res. (2003) 63:8079-8084. Rota, "Nuclear Targeting of Akt Enhances Ventricular Function and Myxocyte Contractility”, Circ. Res. (2005) 97:1332-1341. (51) Int. Cl. Shiraishi. "Nuclear Targeting of Akt Enhances Kinase Activity and A6 IK 4.8/00 (2006.01) Survival of Cardiomyocytes”, Circ. Res. (2004) 94:884-891. CI2N 15/63 (2006.01) Solarogu, "Anti-Apoptotic Effect of Granulocyte-Colony Stimulat A61 K3 L/70 (2006.01) ing Factor After Focal Cerebral Ischemia in the Rat'. Neuroscience (52) U.S. Cl. 143 (2006) 965-974. USPC ...... 424/93.21: 435/455; 435/320.1 Sussman, “Myocardial Aging and Senescence: Where Have the Stem (58) Field of Classification Search Cells Gone?”, Annu. Rev. Physiol. (2004) 66:29-48. USPC ...... 424/93.21: 435/455,320.1 Sussman, “Myofibril Degeneration Caused by Tropomodulin Overexpression Leads to Dilated Cardiomyopathy in Juvenile Mice'. See application file for complete search history. J. Clin. Invest., vol. 101, No. 1 Jan. 1998, 51-61. (56) References Cited (Continued) U.S. PATENT DOCUMENTS Primary Examiner — Quang Nguyen (74) Attorney, Agent, or Firm — Gregory P. Einhorn; 2002/0076395 A1* 6/2002 Crystal et al...... 424.93.2 2004/0258669 A1* 12/2004 Dzau et al...... 424.93.21 Gavrilovich, Dodd & Lindsey LLP 2007/003 1899 A1* 2/2007 Kobayashi etal 435/723 2008/0267921 A1* 10, 2008 Marban et al...... 424,93.7 (57) ABSTRACT 2012/O1286.31 A1 5/2012 Sussman The invention provides compositions (e.g., pharmaceutical OTHER PUBLICATIONS compositions) comprising nucleic acids encoding the serine/ Muraski et al. Pim-1 regulates cardiomyocyte Survival downstream threonine kinase PIM-1, and methods for making and using of Akt. Abstract #1523 in Circulation 114 (18, Suppl. S): p. 11-294. them; including methods for inducing cellular proliferation, Oct. 31 2006. and protecting cardiac cells from hypoxia and cellular apop Cottage, C et al. Pim-1 stimulates cardiac progenitor cell prolifera tosis. The invention provides compositions (e.g., pharmaceu tion and asymmetric division. Circulation 118(18, Suppl. 2): p. S321, tical compositions) comprising nucleic acids encoding PIM Abstract No. 1414, 2008).* 1, and methods for enhancing the regenerative potential of Aho et al., “Pim-1 kinase promotes inactivation of the pro-apoptotic stem cells in the heart. Bad protein by phosphorylating it on the Ser112 gatekeeper site'. FEBS Letter 571 (2004) 43-49. 8 Claims, 21 Drawing Sheets US 8,617.534 B2 Page 2

(56) References Cited Fischer et al., “Enhancement of Myocardial Regeneration Through Genetic Engineering of Cardiac Progenitor Cells Expressing Pim-1 OTHER PUBLICATIONS Kinase'. Circulation 2009, 120:2077-2087. Gnecchi et al., “Paracrine action accounts for marked protection of Tsujita, “Evaluation of Left Ventricular Function in Cardiomyopathic ischemic heart by Akt-modified mesenchymal stern cells'. Nature Mice by Tissue Doppler and Color M-Mode Doppler Medicine, vol. 11, No. 4, Apr. 2005, pp. 367-368. Echocardiography”, Echocardiography, A.Jml. of CV Ultrasound & Gnecchi et al., “Evidence Supporting paracrine hypothesis for Akt Allied Tech., vol. 22, No. 3, 2005, pp. 245-253. Tsujita, "Nuclear targeting of Akt antagonizes aspects of modified mesenchymal stem cell-mediated cardiac protection and cardiomyocyte hypertrophy, PNAS, Aug. 8, 2006, vol. 103, No. 32. functional improvement'. The FASEB Journal, vol. 20, Apr. 2006, 11946-11951. pp. 661-669. Wang, “Pim-1: A serine/threonine kinase with a role in cell survival, Mangi et al., “Mesenchymal stem cells modified with Akt prevent proliferation, differentiation and tumorigenesis”. J. Vet. Sci. (2001), remodeling and restore performance of infarcted hearts'. Nature 2(3), 167-179. Medicine, vol. 9, No. 9, Sep. 2003, pp. 1195-1201. Welch, “Cardiac-Specific IGF-1 Expression Attenuates Dilated Mirotsou et al., “Secreted frizzled related protein 2 (Sfrp2) is the key Cardiomyopathy in Tropomodulin-Overexpressing Transgenic Akt-mesenchymal stem cell-released paracrine factor mediating Mice". Circ. Res. (2002)90:641-648. Yan, “The PIM-2 Kinase Phosphorylates BAD on Serine 112 and myocardial survival and repair', PNAS, Jan. 30, 2007, vol. 104, No. Reverses BAD-induced Cell Death'. The Journal of Biological 5, pp. 1643-1648. Chemistry, vol. 278, No. 46, Issue of Nov. 14, pp. 45358-45367, Mohsin et al., “Human Cardiac Progenitor Cells Engineered with 2003. Pim-I Kinase Enhance Myocardial Repair'. Journal of the American Fox et al., “The serine/threonine kinase Pim-2 is a transcriptionally College of Cardiology, vol. 60, No. 14, 2012, pp. 1278-1287. regulated apoptotic inhibitor.” Genes Dev. 2003 17:1841-1854. Noiseux et al., “Mesenchymal Stemn Cells Overexpressing Akt Dra Fischer, et al., “Cardiac Progenitor Cell Commitment is Inhibited by matically Repair Infarcted Myocardium and Improve Cardiac Func Nuclear Akt Expression.” Circulation Research, 2011; 108:960-970. tion Despite Infrequent Cellular Fusion or Differentiation'. Molecu Sussman, et al., “Pathogenesis of dilated cardiomyopathy: molecular, lar Therapy, vol. 14, No. 6, Dec. 2006. pp. 840-850. structural, and population analyses in tropomodulin-overexpressing transgenic mice”, Am J Pathol. Dec 1999; 155(6):2101-13. * cited by examiner U.S. Patent Dec. 31, 2013 Sheet 1 of 21 US 8,617.534 B2

Figure 1 U.S. Patent Dec. 31, 2013 Sheet 2 of 21 US 8,617.534 B2

z9.InÃ¡H

U.S. Patent Dec. 31, 2013 Sheet 4 of 21 US 8,617.534 B2

?6eJOSX33M U.S. Patent Dec. 31, 2013 Sheet 5 of 21 US 8,617.534 B2

S9.InÃ¡H U.S. Patent Dec. 31, 2013 Sheet 6 of 21 US 8,617.534 B2

U.S. Patent Dec. 31, 2013 Sheet 7 of 21 US 8,617.534 B2

U.S. Patent Dec. 31, 2013 Sheet 8 of 21 US 8,617.534 B2

Akt Pim-1

GAPDH is tos. Figure 8 (A)

SarCOmeric Pr- actin Nuclei overlay

NTG

AKT

Figure 8 (B) U.S. Patent Dec. 31, 2013 Sheet 9 of 21 US 8,617.534 B2

A phalloidin Pin overlay

Non-infected

Figure 9 U.S. Patent Dec. 31, 2013 Sheet 10 of 21 US 8,617.534 B2

8 - s & A - CD

i 21 U.S. Patent Dec. 31, 2013 Sheet 11 of 21 US 8,617.534 B2

6LQM-uuld

U.S. Patent

CVS U.S. Patent Dec. 31, 2013 Sheet 13 of 21 US 8,617.534 B2

Untreated

200

Figure 13 U.S. Patent Dec. 31, 2013 Sheet 14 of 21 US 8,617.534 B2

AWOd b PWDd 0.14 0.15 Pim-wit Sh 0.13 t " 0.4 wn-Pim-wit Sham Pi-wt TAC 0.3 a-NG Sham reserNTGAC e are Pim-WAC 9. 0.12 iNTGTAC to 0.11 O, 1 3 0,1 0.09 O,09 0.08 0.08 0.07 0.07 2 3 4 5 is 7 8 9 10 1 12 13 14 2 3 4 5 6 8 9 O 1 12 13 4 weeks post-op d weeks post-op

0,45 re--Pin-wtsham EDD 0.34 ESD --MTG sham kick El Pin-wit TAC 3 aimwTac ck 0. 4. NTGAC -e-N6 TAC 0.26 0.35 0,O 282 0. 3

0.25 2 3 4 5 6 8 9 0 1 12 13 14 1 2 3 4 5 6 8 9 10 1 2 3 4. weeks post-op weeks post-op FS --PiwiShan EF ar-Pin-wi Sham HNT Sham snNT Sham 90 --Pir-wt TAC

--Pin-wt TAC NGTAC GTAC as 530 : 40 75 3 5 70

3 O 65

2 5 6O 1 2 3 4 5 6 7 8 9 O 1 2 3 4 2 3 4 5 6 7 8 9 O 2 3 4. weeks post-op weeks post-Op Figure 14 U.S. Patent US 8,617.534 B2

SI9.InÃ¡Ã

U.S. Patent US 8,617.534 B2

sego ecleA : U.S. Patent Dec. 31, 2013 Sheet 18 of 21 US 8,617.534 B2

0 1 2 3 4 6 8 0 12 0 2 4 6 8 10 12

Time (weeks)

dpdbd

O 2 4 6 8 10 12 Time (weeks) PBS CGW CGW-Pim-wit Sham E 2 LVEDP F 8000 dPidT 6000 4000 E S 2000 E 0 2000 4000 (pdb rig *ge -6000 r PBS CGW CGW-Pim-wit Sham

-ms- sham werew PBS sp4.01, p<.05, compared to PBS -- CGW ## pC.01, gp4,05, compared to CGW m-m CGW-PMW (pp4.0, p<05, compared to Sham Figure 18 U.S. Patent Dec. 31, 2013 Sheet 19 of 21 US 8,617.534 B2

i i

O. O. O O O O O N. co V f CN Se O pe3Jeju IeM eel AT% U.S. Patent Dec. 31, 2013 Sheet 20 of 21 US 8,617.534 B2

10 ..a ------

O 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 Time (weeks)

100

40 O ------i. ------20

0 2 4 6 8 10 12 14 16 18 20 22 24, 26 28 30 32 Time (weeks) Figure 20 U.S. Patent Dec. 31, 2013 Sheet 21 of 21 US 8,617.534 B2

i US 8,617,534 B2 1. 2 COMPOSITIONS AND METHOD FOR highly expressed in the liver and spleen during fetal hemato MANIPULATING PIM-1 ACTIVITY IN poiesis and primarily in B-lymphoid and myeloid cell lines. CIRCULATORY SYSTEM CELLS PIM-1 exists in two isoforms with molecular weights of 34 and 44 kDa. The 34 kDa isoform is cytosolic and nuclear CROSS-REFERENCE TO RELATED localized, while the 44 kDa isoform was recently found to be APPLICATIONS membrane bound. PIM-1 may be a relatively promiscuous kinase based upon minimal target Substrate recognition This United States utility patent application is the S371 sequence requirements and capacity for autophosphoryla national phase of PCT international patent application no. tion. Two additional family members, PIM-2 and PIM-3, may 10 exhibit functional redundancy with PIM-1. PCT/US2008/083693, having an international filing date of Induction of PIM-1 expression is mediated by cytokines Nov. 14, 2008, which claims benefit of priority to U.S. Pro and growth factors including LIF, GM-CSF, EGF, and most visional Patent Application Ser. No. 61/091,698, filed Aug. interleukins, consistent with a role for PIM-1 in proliferation 25, 2008; and U.S. Ser. No. 60/988,753, filed Nov. 16, 2007. and survival of hematopoeitic cells. PIM-1 mediates prolif The aforementioned applications are expressly incorporated 15 erative actions through phosphorylation of multiple target herein by reference in their entirety and for all purposes. Substrates, resulting in cell cycle transition, as well as protec tive effects via phosphorylation of multiple targets. Induction FEDERAL FUNDING of PIM-1 expression has been linked to AKT (a serine/threo This invention was produced in part using funds from the nine kinase) in hematopoeitic cells. Federal government under one or more of the following SUMMARY grants 5R01HL067245, 1R01HL091102, 1P01HL085577, and 1 PO1AGO23071, all from the National Institutes of The invention provides compositions, such as pharmaceu Health. Accordingly, the Federal government has certain tical compositions, comprising nucleic acids encoding a rights in this invention. 25 serine/threonine kinase PIM, and methods for making and using them; including methods for inducing cardiac or vas REFERENCE TO SEQUENCE LISTING cular cellular proliferation, and protecting cardiac or vascular SUBMITTED VIA EFS-WEB cells from hypoxia and cellular apoptosis. In one aspect, the compositions and methods of the invention are used to The entire content of the following electronic submission 30 express PIM-1 (e.g., by upregulating PIM kinase expression of the sequence listing via the USPTO EFS-WEB server, as and/or activity) to protect cardiomyocytes from hypertrophy authorized and set forth in MPEP S 1730 II.B.2(a)(C), is incorporated herein by reference in its entirety for all pur and inhibit myocardial apoptosis induced by infarction, poses. The sequence listing is identified on the electronically reducing infarct size. In another embodiment, the composi filed text file as follows: tions and methods of the invention are used to express PIM to 35 induce cardiac or vascular cellular dedifferentiation and re expression of stem cell markers; and in one aspect, to over express PIM to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart after a FileName Date of Creation Size (bytes) myocardial infarction (post-MI). 475442002940Seqlist.txt Nov. 10, 2008 10,066 bytes 40 One aspect of the disclosure relates to a method, compris ing identifying a patient in need of enhanced PIM activity in a vascular system tissue, and enhancing levels of PIM in TECHNICAL FIELD vascular system tissue of the patient to alter a functional characteristic of cells in that tissue. In one embodiment, the This invention generally relates to cell and molecular biol 45 patient has experienced cardiac injury and the enhanced PIM ogy, treatment or prevention of cardiac disease or injury, and levels facilitate cardiac regeneration to repair that injury. The regenerative medicine. Disclosed are compositions (e.g., enhancing step may advantageously comprise enhancing pharmaceutical compositions) comprising nucleic acids endogenous production of PIM in the vascular system tissue. encoding the serine/threonine kinase PIM-1 (and related PIM Alternatively, it may comprise administering to the patient an enzymes), and medical uses and methods relating to alter 50 exogenous PIM. The exogenous PIM may comprise PIM-1, ation of PIM availability or availability in cardiac or vascular for example, or another material sharing that same function, system cells or tissues; including inducing or enhancing dif and may comprise a PIM enzyme in association with a cel ferentiation, implantation, Survival, and function of stem lular delivery moiety, such as a translocation domain that is cells, progenitor cells, or adult cells in a cardiac or vascular attached to the PIM enzyme. In yet another embodiment, the tissue or environment. Also disclosed are compositions com 55 enhancing step comprises administering cells to the patient prising nucleic acids encoding PIM, and methods for enhanc that produce enhanced levels of PIM. As examples, the ing the regenerative potential of stem cells and progenitor administered cells may be stem cells or vascular system pro cells in a vascular or cardiac environment. genitor cells. Advantageously, the administered cells com prise a PIM-encoding polynucleotide operatively linked to a BACKGROUND 60 non-PIM promoter. In one embodiment, the enhancing step comprises admin Intracellular molecular signaling networks communicate istering cells to vascular tissue of the patient, and expressing via kinases that phosphorylate target Substrates to regulate enhanced levels of PIM from the administered cells. critical aspects of growth and survival. PIM-1, a proto-onco A different embodiment comprises PIM-delivering or genic serine/threonine kinase, was originally discovered as 65 enhancing material for treatment of vascular system disease the proviral integration site for Moloney murine Leukemia or injury. This material can be, for example, a PIM enzyme virus. PIM-1 is up-regulated in prostate cancer. The gene is linked to a cellular delivery agent, or a cell for introduction US 8,617,534 B2 3 4 into a human or animal, wherein the cell has been altered to Also contemplated are liposomes comprising a pharma permit enhanced production of PIM. In some cases, the cell is ceutical compound of the invention; and/or nanoparticles a progenitor cell or a stem cell, and the alteration comprises a comprising a pharmaceutical compound of the invention. PIM-encoding polynucleotide under control of a non-PIM Still other embodiments include uses of a pharmaceutical promoter. Advantageously, the promoter may be a cardiac compound of the invention, a liposome of the invention, or a specific promoter, an inducible promoter, an endogenous pro nanoparticle of the invention, for the manufacture of a medi moter, an exogenous promoter, or a constituitive promoter. cament for: Alternatively, the PIM-enhancer may be an inducer of endog (a) the amelioration, treatment or prevention of cellular enous PIM expression. apoptosis and/or damage inacardiac or vascular cell, tissue or Yet another embodiment is use of a PIM-delivering or 10 enhancing material in the preparation of a medicament for organ Subsequent to cellular, tissue and/or organ hypoxia, treating vascular system disease or injury. hypoxaemia or anoxia, or Subsequent to pressure-overload Still another embodiment is a composition, comprising a induced hypertrophy or heart failure, by increasing PIM-1 vascular system cell or a cell that is differentiatable into a kinase activity in the cardiac or vascular cell, tissue or organ; vascular system cell, where the cell comprises a PIM-encod 15 (b) the use of (a), wherein the hypoxia, hypoxaemia or ing polynucleotide sequence operably linked to a non-PIM anoxia is caused by an infarction, trauma, Surgery, reimplan promoter. The cell may be, for example, a stem cell or cardiac tation, transplantation or a toxin; progenitor cell. Various types of stem cells that are contem (c) inducing cellular dedifferentiation and/or re-expression plated include mesenchymal stem cells, cardiac stem cells, of a stem cell marker in a cardiac or vascular cell, tissue or adipose-derived stem cells, embryonic stem cells, and Organ; hematopoietic stem cells. Advantageously, the promoter is an (d) enhancing the retention of engrafted or transplanted inducible promoter or a cardiac-specific promoter. cells, tissues or organs by overexpressing or expressing Yet another embodiment is a method for treating cardiac PIM-1 in the cells, tissues or organs; disease or injury, comprising enhancing levels of PIM within (e) increasing the expression ofbcl-2, bcl-XL and/orphos diseased or injured cardiac tissue. The cardiac disease or 25 phorylation of Bad protein in a cardiac or vascular cell, tissue injury may include ischemic injury, hypoxic injury, myocar or organ; dial infarction, traumatic cardiac injury, cardiac hypertrophy, (f) the amelioration, treatment or prevention of ischemia overpressure injury, congestive heart failure, apoptosis-in reperfusion injury in a cardiac or vascular cell, tissue or ducing injury or disease, bacterial infection, viral infection, Organ; and conditions that create an enhanced risk of any of the 30 (g) the use of any of (a) to (f), wherein the cardiac or foregoing. vascular cell, tissue or organ is or is contained in: a heart cell Another embodiment provides pharmaceutical composi (a myocyte), a heart tissue or a heart or other organ; tion formulated for administration to heart muscle compris (h) overexpressing or expressing PIM-1 in a stem cell or a ing: pluripotent cell to enhance the regenerative potential and/or (i)(a) a PIM-1 encoding nucleic acid; 35 induce proliferation of the stem cell or pluripotent cell; (b) a PIM-1 encoding nucleic acid inserted in an expression (i) overexpressing or expressing PIM-1 in a heart cell (a construct or expression vehicle, or a naked PIM-1 encoding myocyte) or heart tissue to increase Bcl-XL expression in the nucleic acid operably linked to a promoter; heart cell (myocyte) or heart tissue to induce cardioprotective (c) the pharmaceutical composition of (b), wherein the anti-apoptotic signaling and/or to increase myocardial Sur expression construct or expression vehicle comprises or con 40 Vival signaling: sists of a vector, a plasmid, a recombinant virus oran artificial (j) the use of any of (a) to (i), wherein the cell is a stem cell, chromosome; an adult stem cell, a hematopoietic stem cell, an adipose (d) the pharmaceutical composition of (c), wherein the derived stem cell, a mesenchymal stem cell, a c-kit' stem cell. expression construct or expression vehicle comprises or con a human stem cell, an autologous or allogeneic stem cell, an sists of a recombinant adeno-associated viral vector, an aden 45 embryonic cell, a tissue-specific resident stem cell, an allo ovirus vector, a retroviral vector; or a lentiviral vector; geneic or autologous cell, a progenitor cell, a placental and/or (e) the pharmaceutical composition of (d), wherein the cord blood cell, a Sca-1+ cell, or a CD34+ cell; or expression construct or expression vehicle comprises or con (k) the use of any of (a) to (), wherein the use is for the sists of an immunodeficiency virus derived vector; amelioration, treatment or prevention of cellular apoptosis (f) the pharmaceutical composition of (e), wherein the 50 and/or damage in a cardiac or vascular cell, tissue or organ immunodeficiency virus derived vector comprises or consists Subsequent to cellular, tissue and/or organ hypoxia, of a human immunodeficiency virus (HIV) derived vector; or hypoxaemia or anoxia, or Subsequent to pressure-overload (g) the pharmaceutical composition of (f), wherein the induced hypertrophy or heart failure; or because of a hyper human immunodeficiency virus (HIV) derived vector com trophic myocardium, an aged myocardium, a failing myocar prises or consists of a human immunodeficiency virus-1 55 dium, an ischemic myocardium, a remodeled myocardium, a (HIV-1) derived vector; myocardium damaged by inflammation, infection, chronic (h) the pharmaceutical composition of any of (a) to (g), stress, disease, diabetes or alcoholism; and/or oxidative dam wherein the PIM-1 encoding nucleic acid is operably linked age. to a promoter; Also included are methods for inducing, upregulating or (i) the pharmaceutical composition of (h), wherein the 60 inserting a PIM-1 nucleic acid or a PIM-1 kinase activity in a promoter is a constitutive or an inducible promoter, or cardiac or vascular cell, tissue or organ, comprising: () the pharmaceutical composition of (i), wherein the pro (a)(i) providing a PIM-1 encoding nucleic acid; and insert moter is constitutively or inducibly active in a heart cell (a ing the PIM-1 encoding nucleic acid into the cardiac or vas myocyte); and, cular cell, tissue or organ; (ii) providing a cell expressing (ii) a pharmaceutically acceptable excipient. 65 and/or secreting a PIM-1 kinase; (iii) administering PIM-1 wherein the pharmaceutical composition formulated for kinase or a PIM-1 expressing nucleic acid to the cardiac or administration to heart muscle. vascular cell, tissue or organ; or, (iv) providing a compound US 8,617,534 B2 5 6 that induces or upregulates PIM-1 nucleic acid or a PIM-1 (s) the method of (r), wherein the individual has congestive kinase activity in a cardiac or vascular cell, tissue or organ; heart failure, or has had a myocardial infarction, or heart (b) the method of (a), wherein the PIM-1 encoding nucleic muscle damage: acid comprises or consists of a PIM-1 encoding message (a (t) the method of any of (a) to (s), wherein the cardiac or PIM-1 encoding mRNA), or a PIM-1 gene; vascular cell, tissue or organ is or is contained in: a heart cell (c) the method of (a) or (b), wherein the PIM-1 encoding (a myocyte), a heart tissue or a heart or other organ; nucleic acid comprises or consists of a human PIM-1 encod (u) the method of (a), wherein the compound that induces ing nucleic acid, or a human PIM-1 encoding message or upregulates PIM-1 nucleic acid or a PIM-1 kinase activity (mRNA), or a human PIM-1 gene, or a human PIM-1 gene in a cardiac or vascular cell, tissue or organ comprises: an locus; 10 (d) the method of any of (a) to (c), wherein the cell is a interleukin, a cytokine and/or a paracrine factor involved in human cell, a stem cell, an adult stem cell, a hematopoietic Survival and/or proliferative signaling; an up-regulator of stem cell, an adipose-derived stem cell, a mesenchymal stem AKT serine/threonine kinase; insulin-like growth factor-1 cell, a c-kit' stem cell, a human stem cell, an autologous or (IGF-1); insulin; leukemia inhibitory factor (LIF); granulo allogeneic stem cell, an embryonic cell, a tissue-specific resi 15 cyte-macrophage colony-stimulating factor (GM-CSF); or dent stem cell, an allogeneic or autologous cell, a progenitor epidermal growth factor (EGF); cell, a placental and/or cord blood cell, a Sca-1+ cell, or a (v) the method of any of (a) to (u), wherein the wherein CD34+ cell; PIM-1 activity in the cardiac or vascular cell, tissue or organ (e) the method of any of (a) to (d), wherein the PIM-1 is increased by administering an exogenous PIM-1 kinase to encoding nucleic acid is inserted into a cardiac or vascular the population of cells; cell, tissue or organ ex vivo or in Vivo: (w) the method of (v), wherein PIM-1 activity is increased (f) the method of any of (a) to (e), wherein a PIM-1 encod by contacting a population of cells with a transfected cell that ing nucleic acid is inserted in an expression construct or expresses an exogenous PIM-1 gene; expression vehicle; (x) the method of (v), wherein the population of cells (g) the method of any of (f), wherein the expression con 25 comprises stem cells; or struct or expression vehicle comprises or consists of a vector, (y) the method of any of (a) to (y), wherein the PIM-1 a plasmid, a recombinant virus or an artificial chromosome; kinase activity is increased and/or upregulated in the cardiac (h) the method of any of (g), wherein the expression con or vascular cell, tissue or organ by administering a pharma structor expression vehicle comprises or consists of a recom ceutical compound of the invention, a liposome of the inven binant adeno-associated viral vector; an adenovirus vector, a 30 tion, or a nanoparticle of the invention, or any combination retroviral vector; or a lentiviral vector; (i) the method of any of (h), wherein the expression con thereof. struct or expression vehicle comprises or consists of an Still other aspects include methods for treating, preventing immunodeficiency virus derived vector; or ameliorating a disease or condition comprising adminis (j) the method of any of (i), wherein the immunodeficiency 35 tering to an individual in need thereof a pharmaceutical com virus derived vector comprises or consists of a human immu pound of the invention, a liposome of the invention, or a nodeficiency virus (HIV) derived vector; nanoparticle of the invention, or any combination thereof, (k) the method of any of (), wherein the human immuno wherein the treatment, prevention and/or amelioration of the deficiency virus (HIV) derived vector comprises or consists disease or condition comprises: of a human immunodeficiency virus-1 (HIV-1) derived vec 40 (a) the amelioration, treatment or prevention of cellular tor; apoptosis and/or damage inacardiac or vascular cell, tissue or (1) the method of any of (a) to (k), wherein the PIM-1 organ Subsequent to cellular, tissue and/or organ hypoxia, encoding nucleic acid is inserted into a cell that does not hypoxaemia or anoxia, or Subsequent to pressure-overload express wild type (normal) levels of PIM-1 protein; induced hypertrophy or heart failure; or because of a hyper (m) the method of (1), wherein the PIM-1 encoding nucleic 45 trophic myocardium, an aged myocardium, a failing myocar acid is inserted into a cell that does not express wild type dium, an ischemic myocardium, a remodeled myocardium, a (normal) levels of PIM-1 protein-encoding message myocardium damaged by inflammation, infection, chronic (mRNA): stress, disease, diabetes or alcoholism; and/or oxidative dam (n) the method of (m), wherein the PIM-1 encoding nucleic age, by increasing or upregulating PIM-1 kinase activity in acid is inserted into a cell that does not comprise a wild type 50 the cardiac or vascular cell, tissue or organ; (normal) PIM-1 gene or genomic PIM-1 encoding nucleic (b) the method of (a), wherein the cellular apoptosis and/or acid; damage, or the hypoxia, hypoxaemia or anoxia, is caused by (o) the method of any of (a) to (n), wherein the PIM-1 an infarction, trauma, Surgery, reimplantation, transplanta encoding nucleic acid is inserted into a cardiac or vascular tion or a toxin, or by inflammation, infection, chronic stress, cell, tissue or organ ex vivo and the cardiac or vascular cell, 55 diabetes or alcoholism; and/or oxidative damage: tissue or organis implanted into an individual in need thereof. (c) inducing cellular dedifferentiation and/or re-expression (p) the method of any of (a) to (o), wherein the PIM-1 of a stem cell marker in a cardiac or vascular cell, tissue or encoding nucleic acid is inserted into a heart cell, cardiac or Organ; vascular tissue or cardiac or vascular organ or a myocyte cell (d) enhancing the retention of engrafted or transplanted ex vivo and the cell is implanted into a cardiac or vascular cell, 60 cells, tissues or organs by overexpressing or expressing tissue or organ or a myocardium (a heart) in need thereof; PIM-1 in the cells, tissues or organs; (q) the method of any of (a) to (n), wherein the PIM-1 (e) increasing the expression ofbcl-2, bcl-XL and/orphos encoding nucleic acid is in vivo inserted into a cardiac or phorylation of Bad protein in a cardiac or vascular cell, tissue vascular cell, tissue or organ in an individual in need thereof; or organ; (r) the method of (q), wherein the PIM-1 encoding nucleic 65 (f) the amelioration, treatment or prevention of ischemia acid is inserted into a cardiac or vascular cell, tissue or organ reperfusion injury in a cardiac or vascular cell, tissue or or a heart cell or a myocyte cell or a heart in vivo; Organ; US 8,617,534 B2 7 8 (g) the method of any of (a) to (f), wherein the cardiac or nuclei that correspond to the overlay colors of green, red, and vascular cell, tissue or organ is or is contained in: a heart cell blue respectively, as described in detail in Example 2, below. (a myocyte), a heart tissue or a heart or other organ; FIG. 9 illustrates that nuclear accumulation of Akt induces (h) overexpressing or expressing PIM-1 in a stem cell or a Pim-1 expression: FIG. 9(A) illustrates a confocal micros pluripotent cell to enhance the regenerative potential and/or copy of cultured cardiomyocytes infected with adenoviruses induce proliferation of the stem cell or pluripotent cell; or expressing nuclear-targeted B-galactosidase (B-gal), Akt (i) overexpressing or expressing PIM-1 in a heart cell (a wild-type (Akt wt), or nuclear targeted Akt (Akt-nuc) myocyte) or heart tissue to increase Bcl-XL expression in the detected with myc-tag antibody (Tag); FIG. 9(B) illustrates heart cell (myocyte) or heart tissue to induce cardioprotective an immunoblot blot showing increased Pim-1 expression in anti-apoptotic signaling and/or to increase myocardial Sur 10 cardiomyocyte cells infected with adenovirus encoding Vival signaling. nuclear-targeted Akt (Akt-nuc), as described in detail in (j) the method of any of (a) to (i), wherein the cell is a stem Example 2, below. cell, an adult stem cell, a hematopoietic stem cell, an adipose FIG. 10 illustrates an immunoblot blot showing expression derived stem cell, a mesenchymal stem cell, a c-kit' stem cell, of dominant negative Pim-1 prompts Akt accumulation in a human stem cell, an autologous or allogeneic stem cell, an 15 cardiomyocytes; immunoblot shows infection of neonatal rat embryonic cell, a tissue-specific resident stem cell, an allo cardiomyocytes with adenoviruses expressing Pim-1 in either geneic or autologous cell, a progenitor cell, a placental and/or wildtype (wt) or dominant-negative (DN) forms, as described cord blood cell, a Sca-1+ cell, or a CD34+ cell. in detail in Example 2, below. The details of one or more embodiments of the invention FIG. 11 illustrates data characterizing founder lines and are set forth in the accompanying drawings and the descrip protein expression in Pim-1 transgenic mice: FIG. 11 left tion below. Other features, objects, and advantages of the panel illustrates a PCR of genomic DNA samples from Pim-1 invention will be apparent from the description and drawings, transgenic mice, and FIG. 11 right panel illustrates an immu and from the claims. noblot of cardiac lysates, as described in detail in Example 2, All publications, patents, patent applications, GenBank below. sequences and ATCC deposits, cited herein are hereby 25 FIG. 12 graphically illustrates data showing that inactiva expressly incorporated by reference for all purposes. tion of Pim-1 in the myocardium increases apoptosis and fibrosis: FIG. 12a and FIG. 12b graphically illustrate DESCRIPTION OF DRAWINGS echocardiographic measurement of posterior (12a) and ante rior (12b) wall dimension (PWD and AWD respectively) in FIG. 1 illustrates immunoblots demonstrating that cardio 30 NTG and Pim-DN animals at two week intervals: FIG. 12c protective stimuli induces Pim-1 expression, as described in graphically illustrates heart weight to body weight ratios in detail in Example 2, below. NTG and Pim-DN animals at 10 and 22 weeks of age: FIG. FIG. 2 illustrates confocal micrographs showing that car 12d graphically illustrates histogram data representing counts diomyopathic stimuli induce Pim-1 expression in Surviving of TUNEL positive myocytes per mm in 17-22 week old myocardium: a widefield view is shown in the micrographs of 35 NTG and Pim-DN transgenics, as described in detail in the upper row, with selected regions is shown in higher mag Example 3, below. nification to reveal cellular detail is shown in the micrographs FIG. 13 shows individual cell surface area measurements of the lower row, as described in detail in Example 2, below. from uninfected control, EGFP, and Pim-wt infected neonatal FIG.3 graphically illustrates data showing that Pim-1 pre rat cardiomyocyte cultures treated and untreated with endot serves hemodynamic function in ischemia-reperfusion 40 helin-1, as described in detail in Example 3, below. injury, as described in detail in Example 2, below. FIG. 14 graphically illustrates data showing Pim-wt trans FIG. 4 illustrates immunoblots demonstrating Pim-1 genic animals are resistant to pressure overload induced expression is highest in postnatal hearts and decreases with hypertrophy: FIGS. 14a to 14fillustrate line graphs represent age, as described in detail in Example 2, below. ing weekly echo-cardiographic assessment of NTG and Pim FIG. 5 illustrates immunoblots demonstrating Pim-1 45 wt sham and TAC banded hearts for anterior wall dimension expression in cardiomyocytes from recombinant adenoviral (AWD 14d, 14a), posterior wall dimension (PWD 14d. 14b), vectors, as described in detail in Example 2, below. end diastolic dimension (EDD, 14c), end-systolic dimension FIGS. 6 and 7 show how Pim-1 inhibits apoptosis in car (ESD, 14d), percent fractional shortening (FS, 14e), and ejec diomyocytes: FIG. 6 graphically Summarizes that non-in tion fraction (EF, 14f), as described in detail in Example 3, fected cells (NI) or GFP-expressing cells show comparable 50 below. TUNEL labeling following doxorubicin treatment, whereas FIG. 15 graphically illustrates data showing that Pim-1 Pimwit expressing cells show significant reductions of enhances cardiac function: FIG. 15a, FIG. 15b and FIG. 1C TUNEL positive nuclei (p<0.05); and show in vivo hemodynamic assessment of NTG and Pim-wt FIG. 7 illustrates a micrograph demonstrating that cells hearts 4 and 10 weeks after sham or TAC operation, as expressing the DN construct show enhanced TUNEL label 55 described in detail in Example 3, below. ing; while FIG. 6 shows quantitative results, the FIG. 7 panels FIG. 16 graphically illustrates data demonstrating that illustrate representative fields of infected cardiomyocytes Pim-1 protects against infarction injury: FIG. 16a graphically showing GFP fluorescence (green) overlay with actin fila illustrates a histogram representing infarct size 7 days post ments revealed by phalloidin (red) in GFP only, GFP-Pim-wt MI as a percent of left-ventricular free wall in Pim-KO hearts: and GFP-Pim-DN samples, as described in detail in Example 60 FIG. 16b graphically illustrates data showing the number of 2, below. TUNEL positive myocytes per mm 7 days post-MI in Pim FIGS. 8A and 8B illustrate that nuclear accumulation of KO hearts: FIG. 16c graphically illustrates in vivo hemody Akt induces expression of Pim-1 kinase in the myocardium: namic measurements of NTG and Pim-KO mice 5 days fol Immunoblot (FIG.8A) and confocal microscopy (FIG.8B) of lowing MI; FIG. 16e graphically illustrates immunoblot sections from 6 month old normal (NTG) and transgenic mice 65 quantitation of Survival protein levels 7 days post-infarction expressing cardiac-specific nuclear-targeted Akt, a separated in Pim-KO and NTG control hearts: FIG. 16f graphically grayscale images in scans correspond to pim-1, actin, and illustrates infarct size measurements 10 days post-infarction; US 8,617,534 B2 10 FIG. 16g graphically illustrates the number of TUNEL-la activity into tissues or cells, introduction of polynucleotide beled CM/m2 in LV 10 days after MI, as described in detail in encoding a PIM material into existing cells of a human or Example 3, below. animal, removing cells from a Subject and altering those cells FIG.17 illustrates data showing increased proliferative rate to express enhanced levels of PIM, then reintroducing the of Pim-1 engineered CSCs: FIG.17A illustrates a cell growth cells into the Subject, introducing exogenous cells into the assessment using trypan blue assay of control, CGW, and Subject that have been engineered to produce enhanced levels CGW-Pim-wt transduced CPCs; FIG.17B illustrates an MTT of PIM, including stem cells or progenitor cells that include a assay on control, CGW, CGW-Pim-wt transduced CPCs; PIM-encoding polynucleotide under the control of a non-PIM FIG. 17C illustrates the proliferation rate of Pim-1 expressing promoter, including an inducible promoter, a constituitive CPC's treated with or without 10 uM of Quercetagentin, a 10 promoter, or a cardiac-specific promoter. specific Pim-1 activity inhibitor, as described in detail in The term “PIM is used herein to refer to a serine or Example 4, below. threonine kinase, including the various PIM enzymes, e.g., FIG. 18 graphically illustrates data showing that intra PIM-1, PIM-2, and PIM-3, further including any isoforms myocardial injection of Pim-1 expressing CPCs improves thereof. For example, the serine/threonine kinase PIM-1 is cardiac function: FIGS. 18A-C graphically illustrate electro 15 known to exist in two isoforms, and references to PIM and cardiographic assessment of AWD (FIG. 18A), EF (FIG. PIM-1 herein are intended to encompass both isoforms, 18B), and FS (FIG. 18C), in sham (), PBS injected (O), unless otherwise specified. In addition, although certain cells, CGW (A), and CGW-Pim-WT(0) cardiac progenitor cells; constructs, polynucleotides, techniques, uses, and methods FIG. 18D-F graphically illustrates in vivo hemodynamic are described in connection with one particular PIM, such as measurements of left ventricular developed pressure (LVDP) PIM-1, such descriptions are exemplary, and should be taken (FIG. 18D), left ventricular end diastolic pressure (LVEDP) as also including the other PIM enzymes having similar activ (FIG. 18E), and dP/dT maximum and minimum (FIG. 18F) ity. were used to assess cardiac function 12 weeks post-intramyo The term “PIM activity” and “PIM kinase activity” refer to cardial injection of PBS, eGFP, and Pim-1 expressing CPCs, the enzymatic or physiological activity of the PIM enzymes, as described in detail in Example 4, below. 25 e.g., the activity of a PIM-1, and encompasses use of other FIG. 19 graphically illustrates data showing that CGW materials having similar activity. The discoveries set forth Pim-wit CPCs form myocytes and vasculature in infarcted herein relate to altering characteristics of living cells by heart tissue reducing infarction area; and shows a quantitation enhancing a particular kinase activity in the cells. Of course, of infarction area 12 weeks post CPC injection, as described as is well known, enzyme variants exist or can be readily in detail in Example 4, below. 30 constructed, having conservative amino acid Substitutions, FIG. 20 graphically illustrates that long term cardiac func cross-linking, cross-species domain Substitutions, trunca tional recovery is afforded by CGW-Pim-wit expressing CPCs tions, and the like, while preserving a physiologically-effec 32 weeks after intra-myocardial injection: FIG. 20A-C illus tive level of enzymatic activity (in this case, kinase activity for trates electrocardiographic assessment of FS (FIG. 20A), EF the PIM-1 target). The present discoveries are not focused (FIG.20B), and AWD (FIG.20C), in sham (), PBS injected 35 only on a particular kinase, but include the discovery of an (O), CGW (A), and CGW-Pim-WT (0) cardiac progenitor entirely new role for PIM kinase activity in vascular system cells 32 weeks post CPC transplantation, as described in cells and tissues. Thus, the results discussed herein flow from detail in Example 4, below. alteration of PIM kinase activity, regardless of the exact FIG. 21 illustrates an exemplary lentiviral constructs of the modality by which that is achieved. invention, as described in detail in Example 4, below. 40 The term “vascular system” is used herein to refer to the Like reference symbols in the various drawings indicate blood vessels and the heart, and all the tissues and cells of like elements. which they are comprised, including cardiac smooth muscle, cardiomyocytes, cardiomyoblasts, vascular wall, endothe DETAILED DESCRIPTION lium, vascular Smooth muscle, vascular connective tissue, 45 and other known cells and tissues of the vascular system. The present disclosure includes the discovery of new roles The term “stem cell' is used broadly to include totipotent, for PIM-1, its isoforms, and other PIM enzymes having pluripotent, and multipotent cells that can differentiate into equivalent or overlapping targets and Substrates. Specifically, vascular system cells, including cardiac cells. “Progenitor these enzymes have a role in cardiac and other circulatory cells' overlaps somewhat with multipotent stem cells, and system protection, Survival, repair, regeneration, and recov 50 includes cells that are at least partially differentiated but that ery, and in the implantation, differentiation, function, and are multipotent or unipotent, in that they have the ability to survival of stem cells, progenitor cells, or differentiated cells differentiate into at least one type of vascular system cells. introduced into circulatory system tissues. These discoveries The terms “treat' and “treatment” are used broadly, to form the basis for new cardiac therapies, including repair of include both prophylactic and therapeutic treatments. Simi damaged heart tissue and implantation, expansion, and Sur 55 larly, when referring to disease or injury of circulatory system vival of implanted stem cells or progenitor cells that differ tissues, those terms are used broadly to include fully devel entiate into functional heart tissue. Prior to this invention, oped disease or injury, as well as incipient or threatened enhancement of PIM activity was not known to have any disease or injury. Thus, a patient at risk of or beginning to prophylactic or therapeutic utility in heart tissue, heart cells, develop a particular condition, is considered to have that or in other circulatory system cells or tissues. 60 condition “treated when methods as disclosed herein are We show that circulatory system disease or injury can be used to reduce the risk of development or progression of that attenuated, halted, prevented, or reversed, and that damaged condition, as well as when an already-developed condition is circulatory system tissue can be replaced, repaired, or regen reversed, inhibited, cured, or ameliorated, and when the rate erated, by enhancement of PIM activity in that tissue. Ways in of development of a condition is halted or slowed. which PIM activity can be enhanced are described in more 65 Those being treated are referred to variously as patients, detail below, but include upregulation of endogenous PIM individuals, Subjects, humans, or animals. Treatments identi production, direct introduction of materials having PIM fied as useful for one category are also useful for other cat US 8,617,534 B2 11 12 egories, and selection of a particular term (other than First, there are individuals with readily-diagnosable exist “human') is not intended to be limiting, but rather just a use ing conditions, including known disease or injury to cardiac of an alternative expression. or other circulatory tissue that is treatable with the composi The disclosure includes compositions, such as pharmaceu tions, methods, or techniques contemplated herein. In those tical compositions, comprising nucleic acids encoding a PIM cases, diagnosis or identification of the disease or injury serine/threonine kinase, such as PIM-1, and methods for would constitute diagnosis, selection, or identification of an making and using them; including methods for inducing car individual in need of the specified treatment. diac or vascular cellular proliferation, and protecting cardiac Second, there are individuals in need of treatment that is or vascular cells from hypoxia and cellular apoptosis. In one more prophylactic, for example, treatment that takes advan aspect, the compositions and methods of the invention are 10 tage of the powerful cardioprotective properties exerted by used to express PIM-1 to protect cardiomyocytes from hyper PIM. In some cases, identification can take place by recog trophy and inhibit myocardial apoptosis induced by infarc nizing an inchoate disease or injury that would otherwise tion, reducing infarct size. In another embodiment, the com progress, for example, injury or other factors that have or will positions and methods of the invention are used to express initiate apoptosis, or conditions or factors that enhance the PIM-1 to induce cardiac or vascular cellular dedifferentiation 15 risk of developing a particular condition. Identification and and re-expression of stem cell markers; and in one aspect, to treatment of those individuals may be desirable to prevent overexpress PIM-1 to enhance the regenerative potential of development of a disease or injury or to slow its development. stem cells, including stem cell ability to engraft in the heart In between these two alternatives are individuals with after a myocardial infarction (post-MI). In another embodi existing disease or injury, which disease or injury is likely to ment, the compositions and methods of the invention are used progress. Identification and treatment of those individuals is to express PIM-1 to increase Bcl-XL expression to induce also contemplated. cardioprotective anti-apoptotic signaling, thus increasing One significant condition lending itself to treatment myocardial Survival signaling. through enhancement of PIM activity in cardiac tissue is Also disclosed are compositions, such as pharmaceutical myocardial infarction or other ischemic injury. Prophylactic compositions, comprising nucleic acids encoding the serine/ 25 treatment is desirable, when high risk of ischemic injury can threonine kinase PIM-1 and methods for preventing or inhib be identified. However, in many cases, the patient will be iting cell or tissue damage, e.g., cardiomyocyte cell death or treated after the injury has occurred. Treatment should be inhibitinganischemic or reperfusion related injury; including commenced as soon as is practicable after the injury. preventing or inhibiting the irreversible cellular and tissue Similarly, PIM-activity enhancement can be used to treat a damage and cell death caused by ischemia, e.g., ischemia 30 number of other conditions and to create desired physiologi Subsequent to reperfusion (which can exacerbates ischemic cal effects, by treating a subject to enhance PIM activity in damage by activating inflammatory response and oxidative vascular, cardiac, or other circulatory system cells or tissues. stress). These include prevention, reduction, or reversal of cardiac The disclosure further provides compositions, such as hypertrophy, including but not limited to maladaptive hyper pharmaceutical compositions, comprising nucleic acids 35 trophic remodeling; promoting cardiac cell Survival and encoding a serine/threonine kinase PIM and methods for inhibiting apoptosis of those cells; enhancing cardiac con regulating cardiac or vascular cellular proliferation and Sur tractility; improving cardiac ejection fraction; enhancing vas vival. cular growth and repair, and promoting differentiation of Using human and murine myocardial samples, we have stem cells and progenitor cells toward cardiac or vascular demonstrated that both human and murine myocardial cells 40 tissue. show elevated PIM-1 expression in failing hearts; where the In another aspect, the methods contemplated herein elevated PIM-1 has predominantly a nuclear localization. We include, but are not limited to, inhibition of cardiac apoptosis: have also shown that acute cardiomyopathic challenge also inhibition of cardiac fibrosis; inhibition of cardiac remodel induces PIM-1 expression with nuclear and perinuclear dis ing; inhibition of cardiac hypertrophy; preservation or tribution in mouse myocardium. 45 reduced loss of ejection fraction in damaged hearts; enhanced Expression of PIM-1 in postnatal mouse myocardium preservation of contractile function; decrease in cardiac decreases with aging, and cardioprotective stimuli associated necrosis; reduction in lesion size following ischemic injury; with AKT activation and nuclear-targeted AKT in particular and increasing cardiac cellularity and decreasing myocyte increase PIM-1 expression. We disclose that cardiomyocyte volume. All of these methods can be practiced prophylacti apoptosis is inhibited by PIM-1 via increased expression of 50 cally (to prevent or reduce a particular condition that would bcl-2, bcl-XL, and phosphorylation of Bad'. Ischemia rep otherwise be likely to occur) and therapeutically (to treat a erfusion injury is enhanced in PIM-1 knockout mice. Since condition that is already in existence, including treatment to loss of PIM-1 expression or activity leads to increased AKT slow progression of a condition). expression without associated cardioprotective effects, From another perspective, conditions that may lead to PIM-1 represents a critical and novel facet of survival signal 55 treatment by enhancement of PIM activity include (but are ing downstream of AKT in the myocardium. not limited to) congenital heart conditions; ischemic injury of Treatments and Medical Uses any kind to heart tissue; damage from infarction; cardiac Detailed strategies for enhancing PIM activity within cir reperfusion injury; traumatic cardiac injury; congestive heart culatory tissues are provided below. Regardless of the method failure injury; and injury relating to cardiac infection with a by which PIM activity is increased, we have discovered that 60 pathogen, including viral, bacterial, and parasitic pathogens. enhancement of PIM activity has multiple beneficial effects In addition to identifying an individual having a condition for in cardiac and other circulatory system tissues. which PIM treatment is desirable, methods of treating the Initially, the care provider may wish to perform a patient individual can include a step of increasing the level of PIM selection step. This may include, for example, assessing activity in a target tissue, such as vascular tissue or cardiac whether a patient is in need of one or more of the various 65 tissue. This step can be practiced in the various ways dis treatments, or identifying a patient in need of such treatment. closed herein. By way of example, and not limitation, those Two significant categories of need warrant some discussion. include administering factors or drugs to the patient, systemi US 8,617,534 B2 13 14 cally or locally, that upregulate endogenous PIM expression; Also disclosed are human DNA sequences of PIM-2 (SEQ administering PIM protein, preferably in combination with a ID NO:4) and PIM-3 (SEQ ID NO:5). delivery modality, such as a linked transduction domain, a In alternative embodiments, nucleic acids of this invention liposome, an antibody, or the like; administering PIM-encod are operatively linked to a transcriptional regulatory ing polynucleotide to the patient, including naked DNA sequence, e.g., a promoter and/or an enhancer, e.g., cardiac administration, administration of the polynucleotide in a viral specific, promoters to drive (e.g., regulate) expression of Pim vector, liposome, or other delivery modality; electroporation 1. Promoters and enhancers used to practice this invention can of cells of a subject to deliver DNA; and administering an be of any type and/or origin, an in one embodiment promoters autologous cell to the Subject (e.g., into the heart) that has specific to the species receiving the Pim-1 construct are used; been altered to enhance PIM expression, including cardi 10 e.g., humans can receive human promoters, mice receive omyocytes, cardiac progenitor cells, cardiac stem cells, mes murine promoters, etc. In other embodiments, promoters enchymal stem cells, hematopoietic stem cells, adipose-de from heterologous species can be used; e.g., mammals or rived stem cells, and the like. Vertebrates receiving promoters that originate from other When administering cells to a human patient, for example, mammals or vertebrates, or viral or synthetic promoters to treat a cardiac condition, the number of cells can be any 15 active in the appropriate specie and/or cell type also can be amount effective to enhance cardiac function or structure or used. These promoters can comprise, for example, a C-myo treat a target condition. Exemplary, non-limiting amounts sin heavy chain promoter, a cardiac troponin-T promoter, a include 10 to 10' cells, more typically 10° to 10 cells. MLC-2v promoter; and any other promoter that drives Exemplary, non-limiting amounts of PIM protein admin expression in cardiac tissue but does not drive significant istered to an adult human heart can be, for example, from expression in other tissues. In one embodiment, promoters about 10 g to about 10' g, calculated as the pure PIM and enhancers active in primordial cells or stem cells, e.g., protein. Exemplary, non-limiting amounts of DNA include myocardial stem cells, can be operatively linked to drive about 0.05 to 500 ug/kg, or 0.5 to 50 ug/kg body weight, and expression of Pim-1. in the case of viral particles, formulated at a titer of about at Nucleic Acid Delivery Gene Therapy Vehicles least 10', 10'', 10", 10", 10", 10', or 107 physical par 25 In one aspect, this disclosure provides constructs or expres ticles per milliliter. In one aspect, the PIM-1 encoding nucleic sion vehicles, e.g., expression cassettes, vectors, viruses (e.g., acid is administered in about 10, 20, 30, 40, 50, 60, 70, 80,90, lentiviral expression vectors, e.g., see SEQID NO:4), and the 100, 110, 120, 130, 140 or 150 or more microliter (ul) injec like, comprising a PIM-encoding sequence, e.g., a PIM-1 tions. Doses and dosage regimens can be determined by con encoding message or a PIM-1a gene, for use as ex vivo or in ventional range-finding techniques known to those of ordi 30 vitro gene therapy vehicles, or for expression of PIM-1 in nary skill in the art. For example, in alternative embodiments, heart tissue, a cardiac or vascular cell, tissue or organ to about 10°, 107, 10, 10, 10°, 10, 10°, 10, 10, 10, practice the methods of this invention, and for research, drug 10" or 10'7 viral (e.g., lentiviral) particles are delivered to the discovery or transplantation. individual (e.g., a human patient) in one or multiple doses. In one aspect, an expression vehicle used to practice the In other embodiments, an intracardiac single administra 35 invention can comprise a promoter operably linked to a tion (e.g., a single dose) comprises from about 0.1 ul to 1.0 ul, nucleic acid encoding a PIM protein (or functional subse 10 ul or to about 100 ul of a pharmaceutical composition of quence thereof). For example, the invention provides expres the invention. Alternatively, dosage ranges from about 0.5 ng sion cassettes comprising nucleic acid encoding a PIM-1 or 1.0 ng to about 10 ug, 100 ug to 1000 g of PIM-1 express protein operably linked to a transcriptional regulatory ele ing nucleic acid is administered (either the amount in an 40 ment, e.g., a promoter. expression construct, or as in one embodiment, naked DNA is In one aspect, an expression vehicle used to practice the injected). invention is designed to deliver a PIM-1 encoding sequence, PIM Sequences e.g., a PIM-1 gene or any functional portion thereof to a Some embodiments include nucleic acid constructs com cardiac tissue or cell of an individual. Expression vehicles, prising a PIM-encoding sequence, e.g., a PIM-1 expressing 45 e.g., vectors, used to practice the invention can be non-viral or message or a PIM-1 gene. In one aspect, PIM-expressing viral vectors or combinations thereof. The invention can use nucleic acids used to practice this invention include PIM-1 any viral vector or viral delivery system known in the art, e.g., genomic sequences, or fragments thereof, including coding adenoviral vectors, adeno-associated viral (AAV) vectors, or non-coding sequences, e.g., including introns, 5' or 3' non herpes viral vectors (e.g., herpes simplex virus (HSV)-based coding sequences, and the like. Also encompassed are PIM 50 vectors), retroviral vectors, lentiviral vectors and baculoviral encoding mRNA sequences. VectOrS. In one aspect, the PIM-1 expressing, or PIM-1 inducing or In one aspect of the invention, an expression vehicle, e.g., upregulating, composition is a nucleic acid, including a vec a vector or a virus, is capable of accommodating a full-length tor, recombinant virus, and the like; and a recombinant PIM-1 PIM-1 gene or a message, e.g., a cDNA. In one aspect, the is expressed in a cell in vitro, ex vivo and/or in vivo. 55 invention provides a retroviral, e.g., a lentiviral, vector In one aspect, a PIM-1 expressing nucleic acid encodes a capable of delivering the nucleotide sequence encoding full human PIM-1, such as Genbank accession no. AAA36447 length human PIM-1 in vitro, ex vivo and/or in vivo. An (see also, e.g., Domen (1987) Oncogene Res. 1 (1): 103-112), exemplary lentiviral expression vector backbone (no "pay SEQID NO:1. load' included, e.g., no PIM-1 sequence included) that can be In another aspect, a PIM-1 expressing nucleic acid encodes 60 used to practice this invention is set forth in SEQID NO:4. a human PIM-1 kinase 44 kDa isoform, see e.g., Genbank In one embodiment, a lentiviral vector used to practice this accession no. AAY87461 (see also, e.g., Xie (2006) Onco invention is a “minimal lentiviral production system lacking gene 25(1), 70-78), SEQID NO:2. one or more viral accessory (or auxiliary) gene. Exemplary In a further aspect, a PIM-1 expressing nucleic acid com lentiviral vectors for use in the invention can have enhanced prises a human PIM-1 kinase message (mRNA), see e.g., 65 safety profiles in that they are replication defective and self Genbank accession no. NM 002648 (see also, e.g., Zhang inactivating (SIN) lentiviral vectors. Lentiviral vectors and (2007) Mol. Cancer. Res. 5 (9), 909-922), SEQID NO:3. production systems that can be used to practice this invention US 8,617,534 B2 15 16 include e.g., those described in U.S. Pat. Nos. 6,277.633; large number of rare codons and by changing these to corre 6,312,682; 6,312,683; 6,521,457; 6,669,936; 6,924,123; spond to commonly used mammalian codons, increased 7,056,699; and 7,198,784; any combination of these are expression of the packaging components in mammalian pro exemplary vectors that can be employed in the practice of the ducer cells can be achieved. Codon usage tables are known in invention. In an alternative embodiment, non-integrating len the art for mammalian cells, as well as for a variety of other tiviral vectors can be employed in the practice of the inven organisms. Codon optimization has a number of other advan tion. For example, non-integrating lentiviral vectors and pro tages. By virtue of alterations in their sequences, the nucle duction systems that can be employed in the practice of the otide sequences encoding the packaging components of the invention include those described in U.S. Pat. No. 6,808,923. viral particles required for assembly of viral particles in the The expression vehicle can be designed from any vehicle 10 producer cells/packaging cells have RNA instability known in the art, e.g., a recombinant adeno-associated viral sequences (INS) eliminated from them. At the same time, the vector as described, e.g., in U.S. Pat. App. Pub. No. amino acid sequence coding sequence for the packaging com 20020194630, Manning, et al.; or a lentiviral gene therapy ponents is retained so that the viral components encoded by vector, e.g., as described by e.g., Dull, et al. (1998) J. Virol. the sequences remain the same, or at least Sufficiently similar 72:8463-8471; or a viral vector particle, e.g., a modified 15 that the function of the packaging components is not compro retrovirus having a modified proviral RNA genome, as mised. Codon optimization also overcomes the Rev/RRE described, e.g., in U.S. Pat. App. Pub. No. 20030003582; or requirement for export, rendering optimized sequences Rev an adeno-associated viral vector as described e.g., in U.S. Pat. independent. Codon optimization also reduces homologous No. 6,943,153, describing recombinant adeno-associated recombination between different constructs within the vector viral vectors for use in the eye; or a retroviral or a lentiviral system (for example between the regions of overlap in the vector as described in U.S. Pat. Nos. 7,198.950; 7,160,727: gag-pol and env open reading frames). The overall effect of 7,122,181 (describing using a retrovirus to inhibit intraocular codon optimization is therefore a notable increase in viral neovascularization in an individual having an age-related titer and improved safety. The strategy for codon optimized macular degeneration); or U.S. Pat. No. 6,555,107. gag-pol sequences can be used in relation to any retrovirus. Any viral vector can be used to practice this invention, and 25 Vectors, recombinant viruses, and other expression sys the concept of using viral vectors for gene therapy is well tems used to practice this invention can comprise any nucleic known; see e.g., Verma and Somia (1997) Nature 389:239 acid which can infect, transfect, transiently or permanently 242; and Coffin et al (“Retroviruses' 1997 Cold Spring Har transduce a cell. In one aspect, a vector used to practice this bour Laboratory Press Eds: J M Coffin, S M Hughes, H E invention can be a naked nucleic acid, or a nucleic acid Varmus pp 758-763) having a detailed list of retroviruses. 30 complexed with protein or lipid. In one aspect, a vector used Any lentiviruses belonging to the retrovirus family can be to practice this invention comprises viral or bacterial nucleic used for infecting both dividing and non-dividing cells with a acids and/or proteins, and/or membranes (e.g., a cell mem PIM-1-encoding nucleic acid, see e.g., Lewis et al (1992) brane, a viral lipid envelope, etc.). In one aspect, expression EMBO J. 3053-3058. systems used to practice this invention comprise replicons Viruses from lentivirus groups from “primate” and/or 35 (e.g., RNA replicons, bacteriophages) to which fragments of “non-primate' can be used; e.g., any primate lentivirus can be DNA may be attached and become replicated. In one aspect, used, including the human immunodeficiency virus (HIV). expression systems used to practice this invention include, the causative agent of human acquired immunodeficiency but are not limited to RNA, autonomous self-replicating cir syndrome (AIDS), and the simian immunodeficiency virus cular or linear DNA or RNA (e.g., plasmids, viruses, and the (SIV); or a non-primate lentiviral group member, e.g., includ 40 like, see, e.g., U.S. Pat. No. 5.217.879), and include both the ing “slow viruses' such as a visna/maedi virus (VMV), as expression and non-expression plasmids. well as the related caprine arthritis-encephalitis virus In one aspect, a recombinant microorganism or cell culture (CAEV), equine infectious anemia virus (EIAV) and/or a used to practice this invention can comprise 'expression vec feline immunodeficiency virus (FIV) or a bovine immunode tor” including both (or either) extra-chromosomal circular ficiency virus (BIV). 45 and/or linear nucleic acid (DNA or RNA) that has been incor In alternative embodiments, lentiviral vectors used to prac porated into the host chromosome(s). In one aspect, where a tice this invention are pseudotyped lentiviral vectors. In one vector is being maintained by a host cell, the vector may either aspect, pseudotyping used to practice this invention incorpo be stably replicated by the cells during mitosis as an autono rates in at least a part of, or Substituting a part of, or replacing mous structure, or is incorporated within the host’s genome. all of an env gene of a viral genome with a heterologous env 50 In one aspect, an expression system used to practice this gene, for example an env gene from another virus. In alter invention can comprise any plasmid, which are commercially native embodiments, the lentiviral vector of the invention is available, publicly available on an unrestricted basis, or can pseudotyped with VSV-G. In an alternative embodiment, the be constructed from available plasmids in accord with pub lentiviral vector of the invention is pseudotyped with Rabies lished procedures. Plasmids that can be used to practice this G. 55 invention are well known in the art. Lentiviral vectors used to practice this invention may be In alternative aspects, a vector used to make or practice the codon optimized for enhanced safety purposes. Different invention can be chosen from any number of suitable vectors cells differ in their usage of particular codons. This codon bias known to those skilled in the art, including cosmids, YACs corresponds to a bias in the relative abundance of particular (Yeast Artificial Chromosomes), megaYACS, BACs (Bacte tRNAs in the cell type. By altering the codons in the sequence 60 rial Artificial Chromosomes), PACs (P1 Artificial Chromo so that they are tailored to match with the relative abundance some), MACs (Mammalian Artificial Chromosomes), a of corresponding tPNAS, it is possible to increase expression. whole chromosome, or a small whole genome. The vector By the same token, it is possible to decrease expression by also can be in the form of a plasmid, a viral particle, or a deliberately choosing codons for which the corresponding phage. Other vectors include chromosomal, non-chromo tRNAs are known to be rare in the particular cell type. Thus, 65 somal and synthetic DNA sequences, derivatives of SV40; an additional degree of translational control is available. bacterial plasmids, phage DNA, baculovirus, yeast plasmids, Many viruses, including HIV and other lentiviruses, use a vectors derived from combinations of plasmids and phage US 8,617,534 B2 17 18 DNA, viral DNA such as vaccinia, adenovirus, fowl pox Sweetening, flavoring and perfuming agents, preservatives virus, and pseudorabies. A variety of cloning and expression and antioxidants can also be present in the compositions. vectors for use with prokaryotic and eukaryotic hosts are Formulations of the PIM-expressing, or inducing or described by, e.g., Sambrook. Bacterial vectors which can be upregulating, compositions of the invention include those used include commercially available plasmids comprising Suitable for systemic administration, direct local vascular or genetic elements of known cloning vectors. cardiac administration, or alternatively oral/nasal, topical, Pharmaceutical Compositions parenteral, rectal, and/or intravaginal administration. The for The invention provides compositions, including pharma mulations may conveniently be presented in unit dosage form ceutical compositions, and methods for expressing PIM, e.g., and may be prepared by any methods well known in the art of 10 pharmacy. The amount of active ingredient which can be for expressing PIM-1 or another functionally-equivalent combined with a carrier material to produce a single dosage kinase to protect cardiomyocytes from hypertrophy and to form will vary depending upon the host being treated, the inhibit myocardial apoptosis induced by infarction, and to particular mode of administration. The amount of active reduce infarct size. (Functional equivalence is considered to ingredient which can be combined with a carrier material to exist based on ability to act on the same Substrate and produce 15 produce a single dosage form will generally be that amount of the same product, and does not require identical kinetics.) In the compound which produces a therapeutic effect. another embodiment, the pharmaceutical compositions of the Pharmaceutical formulations of this invention may com invention are used to express PIM-1 to induce cardiac or prise one or more diluents, emulsifiers, preservatives, buffers, vascular cellular dedifferentiation and re-expression of stem excipients, etc. and may be provided in Such forms as liquids, cell markers; and in one aspect, to overexpress PIM-1 to powders, emulsions, lyophilized powders, sprays, creams, enhance the regenerative potential of stem cells, including lotions, controlled release formulations, tablets, pills, gels, on stem cell ability to engraft in the heart after a myocardial patches, in implants, etc. infarction (post-MI). Pharmaceutical formulations for oral administration can be In one aspect, the PIM-1 expressing, or PIM-1 inducing or formulated using pharmaceutically acceptable carriers well upregulating, composition is a nucleic acid, including a vec 25 known in the art in appropriate and Suitable dosages. Such tor, recombinant virus, and the like; and a recombinant PIM-1 carriers enable the pharmaceuticals to be formulated in unit is expressed in a cell in vitro, ex vivo and/or in vivo. dosage forms as tablets, pills, powder, dragees, capsules, In alternative embodiments, in practicing use of the phar liquids, lozenges, gels, syrups, slurries, Suspensions, etc., maceutical compositions and methods of this invention, com Suitable for ingestion by the patient. Pharmaceutical prepa pounds that induce or upregulate PIM nucleic acid or a PIM 30 rations for oral use can be formulated as a Solid excipient, kinase activity in the heart or a cardiac or vascular cell, tissue optionally grinding a resulting mixture, and processing the or organ are administered. For example, compounds that can mixture of granules, after adding suitable additional com be administered in practicing use of the pharmaceutical com pounds, if desired, to obtain tablets or dragee cores. Suitable positions and methods of this invention can comprise: an solid excipients are carbohydrate or protein fillers include, interleukin, a cytokine and/or a paracrine factor involved in 35 e.g., Sugars, including lactose, Sucrose, mannitol, or Sorbitol; Survival and/or proliferative signaling; an up-regulator of starch from corn, wheat, rice, potato, or other plants; cellulose AKT serine/threonine kinase; insulin-like growth factor-1 Such as methyl cellulose, hydroxypropylmethyl-cellulose, or (IGF-1); insulin; leukemia inhibitory factor (LIF); granulo Sodium carboxy-methylcellulose; and gums including arabic cyte-macrophage colony-stimulating factor (GM-CSF); or and tragacanth; and proteins, e.g., gelatin and collagen. Dis epidermal growth factor (EGF). Okadaic acid and SV40 40 integrating or Solubilizing agents may be added. Such as the small T antigen inhibit or block negative regulation of PIM-1 cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a by protein phosphatase 2A, and can thus be used to increase salt thereof. Such as sodium alginate. PIM-1 levels. See Maj. et al., Oncogene 26(35):5145-53 Dragee cores are provided with Suitable coatings such as (2007). concentrated Sugar Solutions, which may also contain gum In alternative embodiments, the PIM-expressing, or PIM 45 arabic, talc, polyvinylpyrrolidone, carbopolgel, polyethylene inducing or upregulating, compositions of the invention are glycol, and/or titanium dioxide, lacquer Solutions, and Suit formulated with a pharmaceutically acceptable carrier. In able organic solvents or solvent mixtures. Dyestuffs or pig alternative embodiments, the pharmaceutical compositions ments may be added to the tablets or dragee coatings for of the invention can be administered parenterally, topically, product identification or to characterize the quantity of active orally or by local administration, such as by aerosol or trans 50 compound (i.e., dosage). Pharmaceutical preparations of the dermally. The pharmaceutical compositions can be formu invention can also be used orally using, e.g., push-fit capsules lated in any way and can be administered in a variety of unit made of gelatin, as well as soft, sealed capsules made of dosage forms depending upon the condition or disease and gelatin and a coating Such as glycerol or Sorbitol. Push-fit the degree of illness, the general medical condition of each capsules can contain active agents mixed with a filler or patient, the resulting preferred method of administration and 55 binders such as lactose or starches, lubricants such as talc or the like. Details on techniques for formulation and adminis magnesium Stearate, and, optionally, stabilizers. In soft cap tration are well described in the scientific and patent litera Sules, the active agents can be dissolved or Suspended in ture, see, e.g., the latest edition of Remington’s Pharmaceu Suitable liquids, such as fatty oils, liquid paraffin, or liquid tical Sciences, Maack Publishing Co., Easton Pa. polyethylene glycol with or without stabilizers. (“Remington's'). 60 Aqueous Suspensions can contain an active agent (e.g., a Therapeutic agents of the invention can be administered chimeric polypeptide or peptidomimetic of the invention) in alone or as a component of a pharmaceutical formulation admixture with excipients suitable for the manufacture of (composition). The compounds may be formulated for aqueous Suspensions. Such excipients include a Suspending administration in any convenient way for use in human or agent, Such as sodium carboxymethylcellulose, methylcellu Veterinary medicine. Wetting agents, emulsifiers and lubri 65 lose, hydroxypropylmethylcellulose, sodium alginate, poly cants, such as Sodium lauryl Sulfate and magnesium Stearate, vinylpyrrolidone, gum tragacanth and gum acacia, and dis as well as coloring agents, release agents, coating agents, persing or wetting agents such as a naturally occurring US 8,617,534 B2 19 20 phosphatide (e.g., lecithin), a condensation product of an microspheres for oral administration, see, e.g., Eyles (1997) alkylene oxide with a fatty acid (e.g., polyoxyethylene Stear J. Pharm. Pharmacol. 49:669-674. ate), a condensation product of ethylene oxide with a long In practicing this invention, the pharmaceutical com chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), pounds can be parenterally administered, such as by intrave a condensation product of ethylene oxide with a partial ester 5 nous (IV) administration or administration into a body cavity derived from a fatty acid and a hexitol (e.g., polyoxyethylene or lumen of the heart. Use of catheters that temporarily block Sorbitol mono-oleate), or a condensation product of ethylene flow of blood from the heart while incubating the stem cells or oxide with a partial ester derived from fatty acid and a hexitol a viral construct in heart tissue can be used, as well as recir anhydride (e.g., polyoxyethylene Sorbitan mono-oleate). The culation systems of well-known type that isolate the circula aqueous Suspension can also contain one or more preserva 10 tion in all or a part of the heart to increase the dwell time of an tives such as ethyl or n-propyl p-hydroxybenzoate, one or introduced agent (e.g., stem cell, construct, naked DNA, PIM more coloring agents, one or more flavoring agents and one or protein, viral or other vector) in the heart. These formulations more Sweetening agents, such as Sucrose, aspartame or sac can comprise a solution of active agent dissolved in a phar charin. Formulations can be adjusted for osmolarity. maceutically acceptable carrier. Acceptable vehicles and sol Oil-based pharmaceuticals can be used to deliver PIM-1 15 vents that can be employed are water and Ringer's solution, expressing, or PIM-1 inducing or upregulating, compositions an isotonic sodium chloride. In addition, sterile fixed oils can of the invention. Oil-based suspensions can be formulated by be employed as a solvent or Suspending medium. For this Suspending an active agent in a vegetable oil. Such as arachis purpose any bland fixed oil can be employed including Syn oil, olive oil, sesame oil or coconut oil, or in a mineral oil Such thetic mono- or diglycerides. In addition, fatty acids Such as as liquid paraffin; or a mixture of these. See e.g., U.S. Pat. No. oleic acid can likewise be used in the preparation of 5,716,928 describing using essential oils or essential oil com injectables. These solutions are sterile and generally free of ponents for increasing bioavailability and reducing inter- and undesirable matter. These formulations may be sterilized by intra-individual variability of orally administered hydropho conventional, well known sterilization techniques. The for bic pharmaceutical compounds (see also U.S. Pat. No. 5,858, mulations may contain pharmaceutically acceptable auxil 401). The oil suspensions can contain a thickening agent, 25 iary Substances as required to approximate physiological con Such as beeswax, hard paraffin or cetyl alcohol. Sweetening ditions such as pH adjusting and buffering agents, toxicity agents can be added to provide a palatable oral preparation, adjusting agents, e.g., sodium acetate, Sodium chloride, Such as glycerol, Sorbitol or Sucrose. These formulations can potassium chloride, calcium chloride, sodium lactate and the be preserved by the addition of an antioxidant Such as ascor like. The concentration of active agent in these formulations bic acid. As an example of an injectable oil vehicle, see Minto 30 can vary widely, and will be selected primarily based on fluid (1997).J. Pharmacol. Exp. Ther. 281:93-102. The pharmaceu Volumes, viscosities, body weight, and the like, in accordance tical formulations of the invention can also be in the form of with the particular mode of administration selected and the oil-in-water emulsions. The oily phase can be a vegetable oil patient’s needs. For IV administration, the formulation can be or a mineral oil, described above, or a mixture of these. a sterile injectable preparation, such as a sterile injectable Suitable emulsifying agents include naturally-occurring 35 aqueous or oleaginous Suspension. This suspension can be gums, such as gum acacia and gum tragacanth, naturally formulated using those Suitable dispersing or wetting agents occurring phosphatides, such as soybean lecithin, esters or and Suspending agents. The sterile injectable preparation can partial esters derived from fatty acids and hexitol anhydrides, also be a suspension in a nontoxic parenterally-acceptable Such as Sorbitan mono-oleate, and condensation products of diluent or solvent, such as a solution of 1,3-butanediol. The these partial esters with ethylene oxide. Such as polyoxyeth 40 administration can be by bolus or continuous infusion (e.g., ylene Sorbitan mono-oleate. The emulsion can also contain substantially uninterrupted introduction into a blood vessel Sweetening agents and flavoring agents, as in the formulation for a specified period of time). of syrups and elixirs. Such formulations can also contain a The pharmaceutical compounds and formulations of the demulcent, a preservative, or a coloring agent. invention can be lyophilized. The invention provides a stable In practicing this invention, the pharmaceutical com 45 lyophilized formulation comprising a composition of the pounds can also be administered by in intranasal, intraocular invention, which can be made by lyophilizing a solution and intravaginal routes including Suppositories, insufflation, comprising a pharmaceutical of the invention and a bulking powders and aerosol formulations (for examples of steroid agent, e.g., mannitol, trehalose, raffinose, and Sucrose or mix inhalants, see Rohatagi (1995) J. Clin. Pharmacol. 35:1187 tures thereof. A process for preparing a stable lyophilized 1193: Tiwa (1995) Ann. Allergy Asthma Immunol. 75:107 50 formulation can include lyophilizing a solution about 2.5 111). Suppositories formulations can be prepared by mixing mg/mL protein, about 15 mg/mL Sucrose, about 19 mg/mL the drug with a suitable non-irritating excipient which is solid NaCl, and a sodium citrate buffer having a pH greater than 5.5 at ordinary temperatures but liquid at body temperatures and but less than 6.5. See, e.g., U.S. patent app. no. 2004.0028670. will therefore melt in the body to release the drug. Such The compositions and formulations of the invention can be materials are cocoa butter and polyethylene glycols. 55 delivered by the use of liposomes (see also discussion, In practicing this invention, the pharmaceutical com below). By using liposomes, particularly where the liposome pounds can be delivered by transdermally, by a topical route, Surface carries ligands specific for target cells, or are other formulated as applicator Sticks, Solutions, Suspensions, emul wise preferentially directed to a specific organ, one can focus sions, gels, creams, ointments, pastes, jellies, paints, pow the delivery of the active agent into target cells of the heart or ders, and aerosols. 60 other part of the circulatory system in vivo. See, e.g., U.S. Pat. In practicing this invention, the pharmaceutical com Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. pounds can also be delivered as microspheres for slow release Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Bio in the body. For example, microspheres can be administered technol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. via intradermal injection of drug which slowly release sub 46:1576-1587. cutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 65 The formulations of the invention can be administered for 7:623-645; as biodegradable and injectable gel formulations, prophylactic and/or therapeutic treatments. In therapeutic see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as applications, compositions are administered to a subject US 8,617,534 B2 21 22 already Suffering from a condition, infection or disease in an logic molecules, such as polypeptide, including cardiac or amount sufficient to cure, alleviate or partially arrest the vascular or stem cell Surface polypeptides, including heart clinical manifestations of the condition, infection or disease cell (e.g., myocyte) cell Surface polypeptides. In alternative and its complications (a “therapeutically effective amount”). embodiments, the invention provides nanoparticles and lipo For example, in alternative embodiments, pharmaceutical 5 Somal membranes targeting diseased and/or injured heart compositions of the invention are administered in an amount cells, or stem cells, such as any pluripotent cell. sufficient to treat, prevent and/or ameliorate the deleterious In alternative embodiments, the invention provides nano effects on the heart of a myocardial infarction (post-MI); to particles and liposomal membranes comprising (in addition protect cardiomyocytes from hypertrophy and to inhibit myo to comprising compounds of this invention) molecules, e.g., cardial apoptosis induced by infarction, and to reduce infarct 10 size. In another embodiment, the pharmaceutical composi peptides or antibodies, that selectively target diseased and/or tions of the invention are used to express PIM-1 to induce injured heart cells, or stem cells. In alternative embodiments, cellular dedifferentiation and re-expression of stem cell the invention provides nanoparticles and liposomal mem markers; and in one aspect, to overexpress PIM-1 to enhance branes using interleukin receptors and/or other receptors to the regenerative potential of stem cells, including stem cell 15 target receptors on cells, e.g., diseased and/or injured heart ability to engraft in the heart post-MI. cells, or stem cells. See, e.g., U.S. patent application publi The amount of pharmaceutical composition adequate to cation no. 200602399.68. accomplish this is defined as a “therapeutically effective Thus, in one aspect, the compositions of the invention are dose.” The dosage schedule and amounts effective for this specifically targeted to stem cells or heart cells, such as myo use, i.e., the “dosing regimen.” will depend upon a variety of 20 cytes. factors, including the stage of the disease or condition, the The invention also provides nanocells to allow the sequen severity of the disease or condition, the general state of the tial delivery of two different therapeutic agents with different patient’s health, the patient's physical status, age and the like. modes of action or different pharmacokinetics, at least one of In calculating the dosage regimen for a patient, the mode of which comprises a composition of this invention. A nanocell administration also is taken into consideration. 25 is formed by encapsulating a nanocore with a first agent inside The dosage regimen also takes into consideration pharma a lipid Vesicle containing a second agent; see, e.g., Sengupta, cokinetics parameters well known in the art, i.e., the active et al., U.S. Pat. Pub. No. 20050266067. The agent in the outer agents’ rate of absorption, bioavailability, metabolism, clear lipid compartment is released first and may exert its effect ance, and the like (see, e.g., Hidalgo-Aragones (1996) J. before the agent in the nanocore is released. The nanocell Steroid Biochem. Mol. Biol. 58:611-617: Groning (1996) 30 delivery system may be formulated in any pharmaceutical Pharmazie 51:337-341; Fotherby (1996) Contraception composition for delivery to patients suffering from any dis 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; ease or condition as described herein, e.g., such as congestive Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. heart failure or heart attack (myocardial infarction). For J. Clin. Pharmacol. 24:103-108; the latest Remington's, example, in treating myocardial infarction, an antibody and/ supra). The state of the art allows the clinician to determine 35 orangiogenic agent can be contained in the outer lipid vesicle the dosage regimen for each individual patient, active agent of the nanocell, and a composition of this invention is loaded and disease or condition treated. Guidelines provided for into the nanocore. This arrangement allows the antibody and/ similar compositions used as pharmaceuticals can be used as orangiogenic agent to be released first and delivered to the guidance to determine the dosage regiment, i.e., dose sched injured tissue. ule and dosage levels, administered practicing the methods of 40 The invention also provides multilayered liposomes com the invention are correct and appropriate. prising compounds of this invention, e.g., for transdermal Single or multiple administrations of formulations can be absorption, e.g., as described in Park, et al., U.S. Pat. Pub. No. given depending on the dosage and frequency as required and 20070082042. The multilayered liposomes can be prepared tolerated by the patient. The formulations should provide a using a mixture of oil-phase components comprising Sufficient quantity of active agent to effectively treat, prevent 45 squalane, sterols, ceramides, neutral lipids or oils, fatty acids orameliorate a conditions, diseases or symptoms as described and lecithins, to about 200 to 5000 nm in particle size, to herein. Methods for preparing parenterally or non-parenter entrap a composition of this invention. ally administrable formulations are known or apparent to A multilayered liposome of the invention may further those skilled in the art and are described in more detail in such include an antiseptic, an antioxidant, a stabilizer, a thickener, publications as Remington's. 50 and the like to improve stability. Synthetic and natural anti The methods of the invention can further comprise co septics can be used, e.g., in an amount of 0.01% to 20%. administration with other drugs or pharmaceuticals, e.g., Antioxidants can be used, e.g., BHT, erySorbate, tocopherol, compositions for treating heart attacks, congestive heart fail astaxanthin, vegetable flavonoid, and derivatives thereof, or a ure and related symptoms or conditions. For example, the plant-derived antioxidizing Substance. A stabilizer can be methods and/or compositions and formulations of the inven- 55 used to stabilize liposome structure, e.g., polyols and Sugars. tion can be co-formulated with and/or co-administered with Exemplary polyols include butylene glycol, polyethylene antibiotics (e.g., antibacterial or bacteriostatic peptides or glycol, propylene glycol, dipropylene glycol and ethyl carbi proteins), particularly those effective against gram negative tol; examples of Sugars are trehalose. Sucrose, mannitol, Sor bacteria, fluids, cytokines, immunoregulatory agents, anti bitol and chitosan, or a monosaccharide or an oligosaccha inflammatory agents, complement activating agents, such as 60 ride, or a high molecular weight starch. A thickener can be peptides or proteins comprising collagen-like domains or used for improving the dispersion stability of constructed fibrinogen-like domains (e.g., a ficolin), carbohydrate-bind liposomes in water, e.g., a natural thickener oran acrylamide, ing domains, and the like and combinations thereof. or a synthetic polymeric thickener. Exemplary thickeners Nanoparticles and Liposomes include natural polymers, such as acacia gum, Xanthan gum, The invention also provides nanoparticles and liposomal 65 gellangum, locust bean gum and starch, cellulose derivatives, membranes comprising the PIM-1-expressing compounds of Such as hydroxyethylcellulose, hydroxypropyl cellulose and this invention which target specific molecules, including bio carboxymethyl cellulose, synthetic polymers, such as poly US 8,617,534 B2 23 24 acrylic acid, poly-acrylamide or polyvinylpyrollidone and In one embodiment vectors used to practice this invention, polyvinylalcohol, and copolymers thereof or cross-linked e.g., to generate a PIM-expressing cell, are bicistronic. In one materials. embodiment, a MND (or, myeloproliferative sarcoma virus Liposomes can be made using any method, e.g., as LTR-negative control region deleted) promoter is used to described in Park, et al., U.S. Pat. Pub. No. 20070042031, drive Pim-1 expression. In one embodiment, a reporter is also including method of producing a liposome by encapsulating used, e.g., an enhanced green florescent protein (eGFP) a therapeutic product comprising providing an aqueous solu reporter, which can be driven off a viral internal ribosomal tion in a first reservoir, providing an organic lipid solution in entry site (VIRES). In alternative embodiments, all constructs a second reservoir, wherein one of the aqueous Solution and are third generation self-inactivating (SIN) lentiviral vectors 10 and incorporate several elements to ensure long-term expres the organic lipid solution includes atherapeutic product; mix sion of the transgene. For example, a MND promoter allows ing the aqueous solution with said organic lipid solution in a for high expression of the transgene, while the LTR allows for first mixing region to produce a liposome solution, wherein long-term expression after repeated passage. In alternative the organic lipid solution mixes with said aqueous Solution so as to Substantially instantaneously produce a liposome encap embodiments, the vectors also include (IFN)-B-scaffold 15 attachment region (SAR) element; SAR elements have been Sulating the therapeutic product; and immediately thereafter shown to be important in keeping the vector transcriptionally mixing the liposome solution with a buffer solution to pro active by inhibiting methylation and protecting the transgene duce a diluted liposome solution. from being silenced. The invention also provides nanoparticles comprising In alternative embodiments, as a secondary course of compounds of this invention to deliver a composition of the therapy, PIM-1 expressing nucleic acid delivery vehicles, invention as a drug-containing nanoparticles (e.g., a second e.g., expression constructs, such as vectors or recombinant ary nanoparticle), as described, e.g., in U.S. Pat. Pub. No. viruses, can be used to enhance proliferation during culture of 20070077286. In one embodiment, the invention provides adult stem cells extracted from the patient’s damaged heart or nanoparticles comprising a fat-soluble drug of this invention other organ. In alternative embodiments, blood, fat, or mar or a fat-solubilized water-soluble drug to act with a bivalentor 25 row-derived stem cells can also be used. PIM-1 expression trivalent metal salt. can be activated through addition of the drug to culture media. Gene Therapy Delivery Methods After a number of days in culture, the expression of PIM-1 The PIM-1 expressing nucleic acid compositions of the can be then turned off through removal of the drug; and, in one invention can be delivered for ex vivo or in vivo gene therapy aspect, the increased number of cells produced in culture are to deliver a PIM-1 encoding nucleic acid. In one aspect, 30 reintroduced into the damaged area contributing to an PIM-1 expressing nucleic acid compositions of the invention, enhanced repair process. including non-reproducing viral constructs expressing high The invention can incorporate use of any non-viral delivery levels of the human PIM-1 protein, are delivered ex vivo or for or non-viral vector systems are known in the art, e.g., includ in vivo gene therapy. ing lipid mediated transfection, liposomes, immunolipo The PIM-1 expressing nucleic acid compositions of the 35 Somes, lipofectin, cationic facial amphiphiles (CFAS) and invention can be delivered to and expressed in a variety of combinations thereof. cardiac or vascular cells to induce cellular proliferation, and/ In one aspect, expression vehicles, e.g., vectors or recom or to protect cardiac or vascular cells from hypoxia and cel binant viruses, used to practice the invention are injected lular apoptosis. PIM-1 so expressed (by practicing the com directly into the heart muscle. In one aspect, the PIM-1 encod position and methods of this invention) can protect 40 ing nucleic acid is administered to the individual by direct cardiomyocytes from hypertrophy and inhibit cell death injection. Thus, in one embodiment, the invention provides induced by myocardial infarction (e.g. heart attack), reducing sterile injectable formulations comprising expression the amount of muscle affected. In addition, PIM-1 overex vehicles, e.g., vectors or recombinant viruses, used to practice pression (by practicing the composition and methods of this the invention. invention) in cardiac or vascular cells, e.g., in heart cells, 45 In alternative embodiments, it may be appropriate to results in cellular reversion; the cardiac or vascular cells administer multiple applications and employ multiple routes, become stem cell like; complete with re-expression of stem e.g., directly into the heart muscle and intravenously, to cell markers (such as cardiac stem cell markers). ensure Sufficient exposure of target cells (e.g., myocytes or In one aspect, overexpression of PIM-1 (by practicing the stem cells) to the expression construct. Multiple applications compositions and methods of this invention) enhances the 50 of the expression construct may also be required to achieve regenerative potential of stem cells and their ability to repair the desired effect. a damaged or injured organ (e.g., an injured heart after a heart One particular embodiment of the invention is the ex vivo attack). In one aspect, the invention provides compositions modification of stem cells of any origin or any pluripotent cell and methods for overexpressing PIM-1 using a controlled to enhance PIM-1 expression, followed by administration of system using cultured stem cells prior to reintroduction in the 55 the stem cells to a human or other mammalian host, or to any adult human to enhance their ability to repair the organ fol vertebrate. The stem cells may be directly or locally admin lowing injury. istered, for example, into cardiac tissue in the same manner as The invention provides use of PIM-1 for a clinical therapy in existing stem cell therapy for cardiac injury or insuffi for repair of a number of tissues damaged by low oxygen or ciency. Alternatively, systemic administration is also contem other means through use of a conditional control element that 60 plated. The stem cells may be autologous stem cells or het allows control of PIM-1 expression. For example, PIM-1 erologous stem cells. They may be derived from embryonic expressing nucleic acid delivery vehicles, e.g., expression Sources or from infant or adult organisms. The enhancement constructs, such as vectors or recombinant viruses, can be of PIM-1 expression may for example be the result of upregu injected directly into the organ (e.g., a heart) to protect it from lation of the expression of existing chromosomal PIM-1- immediate injury. Expression of the protein can be then acti 65 encoding sequence in the stem cells, or may be the result of vated through an oral prescription drug (formulations for insertion of an exogenous polynucleotide operably encoding which are discussed above). PIM-1. As discussed in other contexts herein, a PIM-1-en US 8,617,534 B2 25 26 coding insert in Such stem cells may advantageously be under the heart, directly into both coronary and/or peripheral arter inducible expression control. In addition, the use of a "suicide ies, e.g., using a lipid-mediated gene transfer. sequence' of known type In these aspects, including direct intracoronary injection, In alternative embodiments, one or more "suicide or directly into both coronary and/or peripheral arteries, can sequences' are also administered, either separately or in con be at an amount sufficient for the PIM-1 expressing nucleic junction with a nucleic acid construct of this invention, e.g., acids (e.g., vector, transgene) to be expressed to a degree incorporated within the same nucleic acid construct (Such as which allows for sufficiently effective; e.g., the amount of the a vector, recombinant virus, and the like. See, e.g., Marktel S. PIM-1 expressing nucleic acid (e.g., vector, transgene) et al., Immunologic potential of donor lymphocytes express injected can be in the range of between about 10 to 10", or ing a Suicide gene for early immune reconstitution after 10 between about 10" to 10", viral particles. The injection can hematopoietic T-cell-depleted stem cell transplantation. be made deeply (such as 1 cm within the arterial lumen) into Blood 101:1290-1298 (2003). Suicide sequences used to the lumen of the coronary arteries, and can be made in both practice this invention can be of known type, e.g., sequences coronary arteries, as the growth of collateral blood vessels is to induce apoptosis or otherwise cause cell death, e.g., in one highly variable within individual patients. By injecting the aspect, to induce apoptosis or otherwise cause cell death upon 15 material directly into the lumen of the coronary artery by administration of an exogenous trigger compound or expo coronary catheters, it is possible to target the PIM-1 express Sure to another type of trigger, including but not limited to ing nucleic acid (e.g., vector, transgene) rather effectively, light or other electromagnetic radiation exposure. and to minimize loss of the recombinant vectors to the proxi In one aspect, a PIM-1 encoding nucleic acid-comprising mal aorta during injection. Any variety of coronary catheter, expression constructor vehicle of the invention is formulated or Stack perfusion catheters, and the like can be used. See, at an effective amount of ranging from about 0.05 to 500 e.g., U.S. Patent App. Pub. No. 20040132190. ug/kg, or 0.5 to 50 ug/kg body weight, and can be adminis In one aspect, the invention combines a therapeutic PIM-1 tered in a single dose or in divided doses. However, it should nucleic acid with a genetic 'sensor that recognizes and be understood that the amount of a PIM-1 encoding nucleic responds to the oxygen deprivation that follows the reduced acid of the invention, or other the active ingredient (e.g., a 25 blood flow, or ischemia, from coronary artery disease and PIM-1 inducing or upregulating agent) actually administered heart attack. As soon as the oxygen declines, the sensor turns ought to be determined in light of various relevant factors on the therapeutic gene, thereby protecting the heart. In addi including the condition to be treated, the age and weight of the tion to its potential for patients with heart disease, the aspect individual patient, and the severity of the patient’s symptom; of this invention is useful for any condition in which circula and, therefore, the above dose should not be intended to limit 30 tory system tissues are susceptible to loss of blood Supply, the scope of the invention in any way. including stroke, shock, trauma and sepsis. In one aspect, a PIM-1 encoding nucleic acid-comprising Direct PIM Delivery expression constructor vehicle of the invention is formulated In addition to cellular and nucleic acid approaches, PIM at a titer of about at least 10", 10'', 10°, 10", 10", 10", proteins can also be delivered directly to the affected cardiac 10", or 10'7 physical particles per milliliter. In one aspect, 35 or other circulatory tissues. Because PIM acts intracellularly, the PIM-1 encoding nucleic acid is administered in about 10, it is preferred to utilize a delivery strategy to facilitate intra 20, 30, 40, 50, 60, 70, 80,90, 100, 110, 120, 130, 140 or 150 cellular delivery of PIM. or more microliter (ul) injections. Doses and dosage regimens One technique that can be used is to provide the PIM in a can be determined by conventional range-finding techniques vehicle that in taken up by or that fuses with a target cell. known to those of ordinary skill in the art. For example, in 40 Thus, for example, PIM can be encapsulated within a lipo alternative embodiments, about 10, 107, 10, 10, 10", 10', some or other vesicle, as described in more detail above in 10, 10", 10", 10", 10' or 107 viral (e.g., lentiviral) connection with polynucleotide delivery to cells. particles are delivered to the individual (e.g., a human patient) Alternatively, the PIM may be linked to a transduction in one or multiple doses. domain, such as TAT protein. In some embodiments, PIM In other embodiments, an intracardiac single administra 45 enzyme can be operably linked to a transduction moiety. Such tion (e.g., a single dose) comprises from about 0.1 ul to 1.0 ul, as a synthetic or non-synthetic peptide transduction domain 10 ul or to about 100 ul of a pharmaceutical composition of (PTD), Cell penetrating peptide (CPP), a cationic polymer, an the invention. Alternatively, dosage ranges from about 0.5 ng antibody, a cholesterol or cholesterol derivative, a Vitamin E or 1.0 ng to about 10 ug, 100 ug to 1000 g of PIM-1 express compound, a tocol, a tocotrienol, a tocopherol, glucose, ing nucleic acid is administered (either the amount in an 50 receptor ligand or the like, to further facilitate the uptake of expression construct, or as in one embodiment, naked DNA is the PIM by cells. injected). Any necessary variations in dosages and routes of A number of protein transduction domains/peptides are administration can be determined by the ordinarily skilled known in the art and facilitate uptake of heterologous mol artisan using routine techniques known in the art. ecules linked to the transduction domains (e.g., cargo mol In one embodiment, a PIM-1 expressing nucleic acid is 55 ecules). Such peptide transduction domains (PTDs) facili delivered in vivo directly to a heart using a viral stock in the tate uptake through a process referred to as macropinocytosis. form of an injectable preparation containing pharmaceuti Macropinocytosis is a nonselective form of endocytosis that cally acceptable carrier such as saline. The final titer of the all cells perform. vector in the injectable preparation can be in the range of Exemplary peptide transduction domains (PTD’s) are between about 10 to 10'', or between about 10' to 10', 60 derived from the Drosophila homeoprotein antennapedia viral particles; these ranges can be effective for gene transfer. transcription protein (AntFID) (Joliot et al., New Biol. In one aspect, PIM-1 expressing nucleic acids (e.g., vector, 3:1121-34, 1991; Joliot et al., Proc. Natl. Acad. Sci. USA, transgene) constructs are delivered to the myocardium by 88:1864-8, 1991; LeRoux et al., Proc. Natl. Acad. Sci. USA, direct intracoronary injection, e.g., using a standard percuta 90:9120-4, 1993), the herpes simplex virus structural protein neous catheter based methods under fluoroscopic guidance. 65 VP22 (Elliott and O'Hare, Cell 88:223-33, 1997), the HIV-1 Alternatively, PIM-1 expressing nucleic acids (e.g., vector, transcriptional activator TAT protein (Green and Loewen transgene) constructs are delivered to organs and tissues, e.g., stein, Cell 55:1179-1188, 1988: Frankel and Pabo, Cell US 8,617,534 B2 27 28 55:1189-1193, 1988), and more recently the cationic N-ter fold in the failing human myocardium when compared to minal domain of prion proteins. Preferably, the peptide trans normal controls. A similar pattern is seen in tropomodulin duction domain increases uptake of the biomolecule to which overexpressing transgenic (TOT) mice, a DCM model. it is fused in a receptor independent fashion, is capable of Though PIM-1 is expressed at low levels in the 6 month old transducing a wide range of cell types, and exhibits minimal 5 wildtype (NTG) mouse, expression in the TOT mouse is or no toxicity (Nagahara et al., Nat. Med. 4: 1449-52, 1998). increased 5.9-fold and was mostly nuclear. Peptide transduction domains have been shown to facilitate PIM-1 Expressed in the Mouse Myocardium is Developmen uptake of DNA (Abu-Amer, Supra), antisense oligonucle tally Regulated. otides (Astriab-Fisher et al., Pharm. Res, 19:744-54, 2002), Immunoblot analysis of myocardial lysates from mice at small molecules (Polyakov et al., Bioconjug. Chem. 11:762 10 various time points after birth demonstrates decreasing 71, 2000) and even inorganic 40 nanometer iron particles PIM-1 expression with age. Neonatal heart samples exhibit (Dodd et al., J. Immunol. Methods 256:89-105, 2001; 6.3-fold more PIM-1 than 30 week old mice. Postnatal Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002: expression levels decline, but remain significantly elevated, Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et until 8 weeks of age when they became comparable to 30 al., Bioconjug., Chem. 10:186-91, 1999). 15 week old hearts. Confocal microscopy of mouse hearts at Fusion proteins with such trans-cellular delivery proteins various developmental time points show PIM-1 expression is can be readily constructed using known molecular biology predominantly nuclear in neonates, becomes increasingly techniques. cytosolic in early adulthood, and is virtually absent in the 30 In addition, any of the polynucleotides encoding PIM mol week old adult. This is corroborated by immunoblotting of ecules can be linked to the foregoing domains to facilitate subcellular fractionated myocardium for PIM-1. PIM-1 transduction of those polynucleotides into target cells, in vivo expression is 10.5-fold and 5.2-fold more nuclear and 5.0 and or in vitro. 4.6-fold less cytosolic in neonatal hearts and 8 week old Kits and Libraries hearts respectively when compared to 30 week old mouse The invention provides kits comprising compositions of myocardium. this invention and methods of the invention, including PIM 25 PIM-1 Exhibits Cardioprotective Effects. In Vivo. expressing, or PIM-inducing or upregulating compositions Using an art-accepted animal model, these data demon and/or nucleic acids of the invention, including vectors, strate that expression of PIM-1 in vivo has a cardioprotective recombinant viruses and the like, transfecting agents, trans effect. PIM-1 localization and expression were examined in ducing agents, cardiac or vascular cells and/or cell lines, hearts from 3-month old normal mice processed four days instructions (regarding the methods of the invention), or any 30 after sham or cardio-myopathic injury resulting from infarc combination thereof. As such, kits, cells, vectors and the like tion (MI) or pressure overload (TAC). Four days following are provided herein. TAC banding to induce pressure-overload hypertrophy, a The invention will be further described with reference to marked peri-nuclear increase in PIM-1 immunoreactivity is the following examples; however, it is to be understood that observed in cardiomyocytes Surrounding major vessels. the invention is not limited to Such examples. 35 Similarly, peri-nuclear PIM-1 immunoreactivity is increased in border Zone cardiomyocytes, but is unaffected in healthy EXAMPLE1 regions of remote myocardium. PIM-1 positive border Zone cardiomyocytes are negative for "terminal deoxynucleotidyl Demonstrating the Therapeutic Efficacy of transferase-mediated duTP-biotin nick end labeling Upregulating PIM-1 40 (TUNEL) labeling and exhibit increased Bcl-XL expression indicative of cardioprotective anti-apoptotic signaling, dem This example demonstrates that the compositions of the onstrating a role for PIM-1 in myocardial Survival signaling, invention comprising nucleic acids encoding the serine/ also demonstrating the compositions and methods of the threonine kinase PIM-1, and the methods of this invention, invention can be effective in myocardial Survival signaling by are effective for inducing cellular proliferation, and protect 45 expressing and/or upregulating PIM-1 kinase expression and/ ing cells from hypoxia and cellular apoptosis; and to express or activity. PIM-1 kinase to protect cardiomyocytes from hypertrophy A protective role for PIM-1 was confirmed using hearts of and/or inhibit myocardial apoptosis induced by infarction, mice deficient for PIM-1 by genetic deletion subjected to ex reducing infarct size; and to express PIM-1 to induce cellular Vivo ischemia/reperfusion injury together with age and sex dedifferentiation and re-expression of stem cell markers; and 50 matched controls. Hearts of PIM-1 knockout mice exhibited to overexpress PIM-1 to enhance the regenerative potential of statistically significant decreases in functional recovery fol stem cells, including stem cell ability to engraft in the heart lowing 45 minutes of reperfusion, as measured by left-ven after a myocardial infarction (post-MI). These data demon tricular developed pressure. TUNEL staining of paraffin strate that in using compositions and methods described embedded sections from hearts subjected to ex vivo ischemia herein, PIM-1 functions as a defense againstapoptotic stimuli 55 reveals a 2.4-fold increase in the number of TUNEL positive induced during ischemic/reperfusion injury resulting from cardiomyocytes in the PIM-1 knockout mice versus wildtype myocardial infarction, pressure-overload induced hypertro controls. phy, and heart failure. PIM-1 induces anti-apoptotic protein expression and pro Results tects cardiomyocytes in vitro. GFP-tagged cDNAs for wild PIM-1 is Expressed in the Human Myocardium and Upregu 60 type 34 kDa PIM-1 (PIM-wt) or a kinase dead (K67M) lated in Failure. mutant (PIM-DN) as previously described' were used to Immunohistochemistry of normal and failing human heart generate recombinant adenoviruses used for infection of neo samples indicates that PIM-1 expression is distributed natal rat cardiomyocyte cultures. Immunoblotting of lysates throughout the cytoplasm in normal adult human myocar from cultures expressing GFP-PIM-wt or GFP-PIM-DN dium. In contrast, in failing human heart samples, PIM-1 65 accumulate 64 kDa GFP-PIM-1 fusion proteins recognized becomes mostly nuclear. Immunoblotting of human heart by either GFP or PIM-1 antibodies. Cardiomyocytes overex lysates demonstrates that PIM-1 expression increases 2.65 pressing GFP-PIM-wt exhibit a statistically significant US 8,617,534 B2 29 30 decrease in TUNEL labeling compared to EGFP infected cardioprotective effect (a myocardium protective effect), e.g., controls. In comparison, GFP-PIM-DN overexpression after a myocardial infarction. Molecular regulation of cardio induced a 30.8% increase in apoptotic cardiomyocytes protection endures as a highly significant research avenue for (p<0.05). Cultured cardiomyocytes were protected from therapeutic interventional strategies in the treatment of myo apoptotic challenge with doxorubicin or deoxyglucose by 5 cardial injury and heart failure. With this invention's discov GFP-PIM-wt overexpression (*p<0.01 for both groups), ery of a central role for PIM-1 in cardioprotection, as dem whereas GFP-PIM-DN overexpression exacerbated apop onstrated by the data presented herein, a new facet of totic effects (**p<0.01, and *p<0.05 respectively). Consis signaling has been uncovered with profound implications for tent with these results, GFP-PIM-DN induced a 3.6-fold regulation of cardiomyocyte Survival and AKT-mediated increase in caspase3 cleavage and an 80% increase in cleaved 10 effects. Taken together, data presented here provide the first poly (ADP-ribose) polymerase (PARP). In comparison, GFP evidence of PIM-1 expression and protective effects in the PIM-wt produced significant increases in bcl-XL and bcl-2 myocardium and demonstrate a reciprocal feedback mecha expression (2.2-fold and 25.4-fold, respectively) when com nism between PIM-1 and AKT. The codependent interrela pared to control (p<0.01). GFP-PIM-wt also increased phos tionship between AKT and PIM-1 previously documented in phorylation of Bad at the serine 112 residue (S112) by 16.7- 15 the hematopoeitic system indicates both molecules work in fold versus uninfected control while levels of total Bad COncert. remained unchanged (p<0.01). PIM-1 Functions as a Defense Against Apoptotic Stimuli PIM-1 is Induced by Cardioprotective Stimuli. Induced During Ischemia/Reperfusion Injury These data demonstrate that the compositions and methods PIM-1 has not previously been studied in the myocardial of the invention can be used to increase the expression of 20 context studies. In non-cardiac cells is has been demonstrated PIM-1 to provide a cardioprotective effect, e.g., after a myo that PIM-1 as a critical regulator of proliferation and cell cardial infarction. Treatment of neonatal rat cardiomyocyte survival signaling, e.g., as reviewed in ref (see below). Using cultures with cardioprotective agents including Leukemia the compositions and methods of this invention, PIM-1 func Inhibitory Factor (LIF), Insulin-like Growth Factor (IGF-1), tions as a defense against apoptotic stimuli induced during dexamethasone, and PMA, for 2 hours prior to assay induced 25 ischemia/reperfusion injury resulting from myocardial inf PIM-1 immunoreactivity compared to control cells as visu arction, pressure-overload induced hypertrophy, and heart alized by confocal microscopy. PIM-1 immunoreactivity was failure. Although PIM-1 level is developmentally down-regu not induced by phenylephrine, endothelin-1, forskolin, or lated, expression reappears in cardiomyocytes following car estradiol (FIG. 4A). LIF, IGF, PMA, and dexamethasone diac injury by pressure-overload induced by TAC banding induced PIM-1 expression by 2.8, 2.7, 2.3, and 2.0-fold 30 and myocardial infarction. PIM-1 is one of several protonco respectively (p<0.05, *p<0.01). The adenylate cyclase genes participating in the “immediate early response’ gene activator, forskolin, reduced PIM-1 expression by 45% versus profile expressed following cardiac injury' including c-fos, control cultures (**p<0.01). c-myc', Raf and Ras. PIM-1 has been shown to cooperate IGF-1 Induction of Pim-1 Expression is Akt-Dependent. with c-myc in activation of c-Myb dependent cellular prolif PIM-1 expression in response to IGF-1 treatment is signifi- 35 eration in other tissues'' suggesting synergistic effects cantly reduced in the presence of the PI3 kinase inhibitor between oncogenes may help preserve the myocardium in wortmannin or inactivated AKT (AKT-DN) by 4.0-fold and reaction to injury. 9.1-fold respectively (**p<0.001). A role for nuclear accu PIM-1 Potentiates Intracellular Anti-Apoptotic Signaling mulation of AKT resulting following IGF stimulation'' was In addition to its proliferative effects, these data also dem confirmed, as overexpression of nuclear-targeted AKT' 40 onstrate that PIM-1 potentiates intracellular anti-apoptotic increased PIM-1 expression in cultured cardiomyocytes by signaling. Consistent with findings in non-cardiac 2.1-fold compared to uninfected controls (p<0.05). In con cells,'''' adenoviral overexpression of PIM-1 protects trast, overexpression of wildtype AKT (AKT-wt) decreased neonatal rat cardiomyocytes from doxorubicinand deoxyglu expression of PIM-1 1.4-fold versus uninfected control cose induced apoptosis through induction of bcl-2 and Bcl (p<0.05). Confocal micrographs of cultured cardiomyo- 45 XL expression as well as phosphorylation of Bad (FIG. 3). It cytes demonstrate that expression of nuclear-targeted AKT is also possible that PIM-1 serves as the downstream effector induces increased nuclear localization of PIM-1 (FIG. 5C). of AKT induced p53 inhibition, since induction of mdm2 Consistent with in vitro results, immunohistochemistry of expression, phosphorylation, and p53 degradation is medi hearts from six-month-old cardiac-specific nuclear-targeted ated by PIM-17 and AKT protects against doxorubicin AKT transgenics exhibit increased PIM-1 immunoreactivity 50 induced apoptosis through a p53-dependent mechanism". and nuclear localization compared to controls and a represen Furthermore, inactivation of PIM-1 induced apoptotic signal tative immunoblot corroborates increased PIM-1 expression. ing in the cardiomyocyte context, exacerbating doxorubicin PIM-1 and AKT Exhibit Feedback Relationships. induced apoptosis. PIM-1 inactivation may also increase apo AKT expression and phosphorylation (S7) increase in ptotic activity through increasing generation of reactive-oxy response to overexpression of GFP-PIM-DN in cultured car- 55 gen species and mitochondrial pore permeability, as has been diomyocytes (FIG. 6A). Comparable findings of increased found in other cellular contexts'. phospho-AKT' were observed with confocal microscopy Several well known cardioprotective factors including LIF, of immunolabeled myocardial sections from 2-month old the PKC activator PMA, the glucocorticoid dexamethasone, PIM-KO mice. Increased phospho-AKT7 and total AKT in and IGF-1 significantly increased PIM-1 expression (FIG. 4), immunoblots of whole heart lysates from PIM-KO mice cor- 60 consistent with published reports showing induction of related with the immunostaining, demonstrating that regula PIM-1 by PMA treatment of T cells' as well as gp130 recep tion of Akt expression and activity depends, in part, upon tor ligands including IL-6 and LIF’s ' ' '. These PIM-1 levels. ligands and their cognate receptor are increased in the failing Discussion heart'''''' as well as during development and hypertrophy Using an art-accepted animal model, these data demon- 65 of the myocardium. With regard to other inductive stimuli, strate that the compositions and methods of the invention can PMA-mediated PKC activation is cardioprotective,” cor be used to increase the expression of PIM-1 to provide a relative findings show PIM-1 is rapidly induced by PMA US 8,617,534 B2 31 32 treatment in T cells.' IGF-1 mediates myocardial survival inhibitor and 50 ul of phosphatase inhibitor) was made at the signaling''' and stem cell proliferation" although we were bottom of an ultracentrifuge tube followed by a 2.4M unable to find prior published demonstration of PIM-1 induc STEAKMTM (2.4M sucrose, 25 mM KCL, 5% MgCl, 1 mM tion by IGF. Results indicate that IGF-1 induced PIM-1 DTT, 0.5 mM PMSF, 500 ul of protease inhibitor and 50 ul of expression is AKT dependent and that nuclear-targeted AKT phosphatase inhibitor). The homogenate layer was added. expression induces significant increases in PIM-1 expression The 3 layers were centrifuged at 112,000xg for 1 hour at 4°C. in vitro and in vivo. Conversely, inactivation or ablation of White interface between 2.7 and 2.4M STEAKMTM was col PIM-1 expression induced AKT expression and activation, lected for nuclear fraction. 5 volumes of 0.57 STEAKMTM but increased AKT activation is unable to enhance recovery or was added and the pellets were centrifuged at 2000xg for 20 reduce apoptosis following ischemia/reperfusion injury in 10 minutes at 4°C. The pellet was re-suspended in sample buffer PIM-1 null animals. containing phosphatase inhibitors and protease inhibitors. These results indicate that PIM-1 is an important mediator Immunoblotting. Infected cardiomyocytes were harvested of cardioprotection downstream from comparatively well 24 hours after infection in SDS denaturing sample buffer, documented AKT signaling in the myocardium responsible Sonicated and boiled for 10 minutes, and quantitated using the for cardioprotection. Following growth factor or cytokine 15 Bradford assay. Mouse whole heart lysates were generated receptor activation, AKT is phosphorylated resulting in a from flash frozen hearts pulverized in a mortar and pestle then conformational change which releases AKT from the mem resuspended in SDS denaturing sample buffer, Sonicated, brane allowing it to transit through the cytosol and eventually boiled for 10 minutes and quantitated using Bradford assay. to the nucleus where it affects transcription of target genes' Approximately 50 ug of each sample was loaded on a 4-15% and exerts cardioprotective activity." Recent research dem gradient Bis-Acrylamide Tris Glycine gel and transferred to onstrates similar substrate specificity shared by PIM-1 and PVDF. Blots were blocked in 3% BSA for 1 hour, and probed AKT, and that the widely employed PI3K inhibitor with primary antibodies (PIM-1 (Cell Signaling Technology), LY294.002TM binds to and inhibits PIM-1 activity'. There c-jun (Cell Signaling Technology), HISTONE3TM (Cell Sig fore, previous studies involving the use of LY294.002TM naling Technology), GFP (Molecular Probes), bcl-2 (Santa require reinterpretation in the context of AKT-dependent 25 Cruz), bcl-XL (Cell Signaling Technology), PHOSPHO PIM-1 signaling in the myocardium. BADS112TM (Biosource) AKT (Cell Signaling Technology), Cardioprotective effects together with heightened expres GAPDH (Research Diagnostics Inc.), PHOSPHO sion in both postnatal/juvenile myocardium and pathologi AKTS473TM (Cell Signaling Technology), total PARP (Bio cally challenged hearts implicate PIM-1 in promotion of phe source), cleaved PARP (Biosource), and cleaved caspase3 notypic characteristics typically associated with a youthful 30 (Cell Signaling Technologies)) diluted in blocking Solution myocardium. Indeed, the cytokine expression profile of neo overnight at 4° C. Blots were washed in TBS-0.5% Tween natal myocardium share marked similarities with that exhib three times and probed with fluorescent or alkaline phos ited by AKT-nuc transgenic hearts. It appears that many of the phatase conjugated secondary antibodies diluted 1:5000 in beneficial effects previously ascribed to Akt-nuc''' (see blocking solution for 1 hour at room temperature followed by references below) may depend, at least in part, upon induction 35 three washes in TBS-0.5% Tween. Blots were scanned using of PIM-1 expression. a TYPHOON 9410 IMAGERTM (GE Healthcare) and quan Methods titated using IMAGEQUANT 5.2TM software (GE Health Neonatal Rat Cardiomyocyte Cultures infections and treat care). All quantitation is based on standardization to loading ments. Neonatal rat cardiomyocyte cultures were prepared as controls. described previously'. Cells to be subjected to treatments 40 Adenoviral constructs. AKT-nuc and AKT wildtype aden were placed in media with 2% serum overnight and then oviruses were prepared as described previously, see refer treated with the appropriate agent and harvested or fixed after ence'. PIM-wt and PIM-DN adenoviruses were prepared by the pre-described timepoint. Cardiomyocytes were infected subcloning of the Nhel/SmaI fragments from pBGFP-N1 with adenovirus for two hours, washed in PBS and then re-fed PIM-1 and pEGFP-N1PIM-DNTM plasmids described previ M199 with 2% FBS and 50 ug/ml pen/strep, and 100 uM 45 ouslyl', into the pDC315ioTM (Microbix) adenoviral shuttle glutamine. vector. Sequence verified shuttle vectors were cotrans Nuclear and cytosolic extraction. Hearts were washed in fected with the genomic pBHGloxAE1.3Cre into 293iqTM PBS, transferred to 2ml of 0.57MSTEAKM (0.57 Msucrose, cells (Microbix) to generate the adenovirus. Purified plaques 25 mM KCL, 5% MgCl, 1 mM DTT, 0.5 mM PMSF,500 ul were isolated and expanded for use in experiments. protease inhibitor and 50 ul phosphatase inhibitor), homog 50 Immunohistochemistry. Hearts were fixed and embedded enized in ice using polytron and centrifuged for 10 minutes at and cardiomyocytes fixed and permeabilized as described 1000xg. previously. Staining of cultured neonatal rat cardiomyo Pellets were resuspended in 1.5 mL of 0.57MSTEAKMTM, cytes was performed with antibodies described above diluted homogenized in tight fitting pestle and centrifuged at 1000xg 1:25 in PBS containing 10% horse serum overnight at 4°C. for 10 minutes at 4°C. Supernatant was collected for cytoso 55 Slides were washed in PBS and probed with fluorescent con lic fraction. jugated secondary antibodies (1:100) for one hour at room Pellets were re-suspended in 750 ul of 0.57MSTEAKMTM temperature, and Texas Red phalloidin (1:50 Molecular with 0.5% TRITON-XTM and centrifuged at 1000xg for 10 Probes) to identify actin filaments. Slides were washed three minutes at 4° C. Supernatant was collected for membrane times in PBS, and stained for 30 minutes with TOPRO-3TM fraction. 60 (1:5000 Molecular Probes) to identify nuclei, washed once Pellets were re-suspended in 300 ul of 2.3M STEAKMTM and cover-slipped using VECTRASHIELDTM (Vectra Labs). (2.3M Sucrose, 25 mMKCL, 5% MgCl, 1 mMDTT, 0.5 mM Paraffin embedded samples were cut at 4 um and deparaf PMSF, 500 ul of protease inhibitor and 50 ul of phosphatase finized through a standard series of Xylene and graded Etha inhibitor). 2 volumes of 0.57M STEAKMTM was added and nol steps to water. Antigen retrieval was performed in 10 mM the pellets were gently mixed. 65 Citrate pH6.0. PIM-1 and phospho-AKT signals were ampli A layer of 2.7M STEAKMTM (2.7M sucrose, 25 mM KCL, fied using the TYRAMIDE AMPLIFICATION KITTM (Per 5% MgCl, 1 mM DTT, 0.5 mM PMSF, 500 ul of protease kin Elmer) with primary concentrations of 1:500 for both US 8,617,534 B2 33 34 antibodies, and secondaries 1:3000. Slides were washed fol 9. Krishnan, N., Pan, H., Buckley, D. J. & Buckley, A. Pro lowing the amplification process, and stained with TOPRO-3 lactin-regulated PIM-1 transcription: identification of (Molecular Probes) to identify nuclei, washed and cover critical promoter elements and Akt signaling. Endocrine slipped with VECTRASHIELDTM (Vectra Labs). Confocal 20, 123-30 (2003). imaging of stained slides was performed on a Leica LCS 5 10. Bhattacharya, N. et al. PIM-1 associates with protein confocal microscope. For comparison purposes, all slides complexes necessary for mitosis. Chromosoma 111, 80-95 were treated identically and scanned using the same settings (2002). in each experiment. 11. Camper-Kirby, D. et al. Myocardial Akt activation and Doxorubicin and deoxyglucose induction of apoptosis. gender: increased nuclear activity in females Versus males. Cardiomyocytes were infected with GFP, PIM-wt, and PIM 10 Circ Res 88, 1020-7 (2001). DN viruses as described earlier. Twenty-four hours after 12. Shiraishi, I. et al. Nuclear targeting of Akt enhances infection, cells were treated with 1 uMDoxorubicin or 1 mM kinase activity and Survival of cardiomyocytes. Circ Res deoxyglucose for 16 hours then labeled for TUNEL using the 94, 884-91 (2004). 1N. SITU CELL DEATH DETECTION KITTM, TMR red 15 13. Sugden, P. H. & Clerk, A. Cellular mechanisms of cardiac (Roche Applied Science) per manufacturer instructions. hypertrophy. J Mol Med 76, 725-46 (1998). Number of infected TUNEL positive cells was counted for 14. Izumo, S., Nadal-Ginard, B. & Mandavi, V. Protoonco each treatment on a Nikon DIAPHOT 420TM fluorescent gene Induction and Reprogramming of Cardiac Gene Scope. Expression Produced by Pressure Overload. PNAS 85, Myocardial infarction and trans-aortic constriction. Mice 339-343 (1988). were placed under anesthesia, and the chest wall Surgically 15. Katakami, N. et al. Role of PIM-1 in smooth muscle cell opened. To induce an acute ischemic event, the left anterior proliferation. J Biol Chem 279, 54742-9 (2004). descending artery (LAD) was located and ligated using 8-0 16. Hoefnagel, J. J. et al. Distinct types of primary cutaneous nylon Suture. To induce pressure overload, the aorta was large B-cell lymphoma identified by gene expression pro banded with 8-0 prolene using a 27 gauge needle as a guide. 25 filing. Blood (2004). Sham animals were treated identically except the LAD or 17. Ionov, Y. et al. PIM-1 protein kinase is nuclear in Burkitt's aorta were not ligated. Animal hearts were harvested as lymphoma: nuclear localization is necessary for its bio described above and embedded into paraffin. logic effects. Anticancer Res 23, 167-78 (2003). Ex Vivo Ischemia/Reperfusion. Ex vivo ischemia/reperfu 18. Lilly, M., Sandholm, J., Cooper, J. J., Koskinen, P. J. & sion was performed as described previously. Sections from 30 Kraft, A. The PIM-1 serine kinase prolongs survival and four hearts from each experimental group were cut and ana inhibits apoptosis-related mitochondrial dysfunction in lyzed for cell death using TUNEL labeling (1NSITUCELL part through a bcl-2-dependent pathway. Oncogene 18, DEATH DETECTION KITTM, TMR red (Roche AppliedSci 4022-31 (1999). ence)) according to the kit directions. 19. Macdonald, A. et al. PIM kinases phosphorylate multiple Statistical Analysis. Statistical analysis was performed 35 sites on Bad and promote 14-3-3 binding and dissociation using student T test, and analysis of variance (ANOVA) as from Bcl-XL. BMC Cell Biol 7, 1 (2006). appropriate. P values less than 0.05 were considered signifi 20. Fujiwara, Y. et al. Inhibition of the PI3 kinase/Akt path Cant. way enhances doxorubicin-induced apoptotic cell death in tumor cells in a p53-dependent manner. Biochem Biophys REFERENCES FOR EXAMPLE1 40 Res Commun 340, 560-6 (2006). 21. Wingett, D., Long, A., Kelleher, D. & Magnuson, N. S. 1. Wang, Z. et al. PIM-1: a serine/threonine kinase with a role PIM-1 proto-oncogene expression in anti-CD3-mediated T in cell survival, proliferation, differentiation and tumori cell activation is associated with protein kinase C activa genesis. J. Vet Sci 2, 167-79 (2001). tion and is independent of Raf-1. J Immunol 156,549-57 2. Xie, Y. et al. The 44 kDa PIM-1 kinase directly interacts 45 (1996). with tyrosine kinase Etk/BMX and protects human pros 22. Rahman, Z. Yoshikawa, H., Nakajima, Y. & Tasaka, K. tate cancer cells from apoptosis induced by chemothera Down-regulation of PIM-1 and Bcl-2 is accompanied with peutic drugs. Oncogene (2005). apoptosis of interleukin-6-depleted mouse B-cell hybri 3. Bullock, A. N., Debreczeni, J. Amos, A., Knapp, S. & doma 7TD1 cells. Immunol Lett 75, 199-208 (2001). Turk, B. E. Structure and substrate specificity of the PIM-1 50 23. Eiken, H. G. et al. Myocardial gene expression of leu kinase. J. Biol. Chem. M51071 1200 (2005). kaemia inhibitory factor, interleukin-6 and glycoprotein 4. Palaty, C.K. etal. Identification of the autophosphorylation 130 in end-stage human heart failure. EurJ Clin Invest 31, sites of the Xenopus laevis PIM-1 proto-oncogene-en 389-97 (2001). coded protein kinase. J Biol Chem 272, 10514-21 (1997). 24. Hirota, H. etal. Circulating interleukin-6 family cytokines 5. Bachmann, M. & Moroy, T. The serine/threonine kinase 55 and their receptors in patients with congestive heart failure. PIM-1. Int J Biochem Cell Biol 37, 726-30 (2005). Heart Vessels 19, 237-41 (2004). 6. Aho, T. L. et al. PIM-1 kinase promotes inactivation of the 25. Jougasaki, M. et al. Leukemia inhibitory factor is aug pro-apoptotic Bad protein by phosphorylating it on the mented in the heart in experimental heart failure. Eur J Ser112 gatekeeper site. FEBS Lett 571, 43-9 (2004). Heart Fail 5, 137-45 (2003). 7. Hammerman, P. S., Fox, C.J., Birnbaum, M. J. & Thomp 60 26. Sheng, Z. et al. Cardiotrophin 1 (CT-1) inhibition of son, C. B. PIM and Akt oncogenes are independent regu cardiac myocyte apoptosis via a mitogen-activated protein lators of hematopoietic cell growth and survival. Blood kinase-dependent pathway. Divergence from downstream 105,4477-83 (2005). CT-1 signals for myocardial cell hypertrophy. J Biol Chem 8. Krumenacker, J. S. Narang, V. S., Buckley, D. J. & Buck 272, 5783-91 (1997). ley, A. R. Prolactin signaling to PIM-1 expression: a role 65 27. Wollert, K.C. & Chien, K. R. Cardiotrophin-1 and the role for phosphatidylinositol 3-kinase. J Neuroimmunol 113, of gp130-dependent signaling pathways in cardiac growth 249-59 (2001). and development. J Mol Med 75, 492-501 (1997). US 8,617,534 B2 35 36 28. Sato, T., O'Rourke, B. & Marban, E. Modulation of mito proliferation, and 3) intriguing propensity for nuclear accu chondrial ATP-dependent K+ channels by protein kinase mulation. Between PIM-1 and Akt/PKB there are addi C. Circ Res 83, 110-4 (1998). tional connections such as similar target Substrate specifici 29. Sato, T., Saito, T., Saegusa, N. & Nakaya, H. Mitochon ties, coordinate regulation of PIM-1 expression by Akt drial Ca2+-activated K+ channels in cardiac myocytes: a activation, and blunting of activation by treatment with the mechanism of the cardioprotective effect and modulation PI3-K inhibitor LY294.002.7 Collectively, this evidence by protein kinase A. Circulation 111, 198-203 (2005). implicates PIM-1 for an important role in myocardial signal 30. Philipp, S. et al. Postconditioning protects rabbit hearts ing, and Supportive findings documenting PIM-1 expression through a protein kinase C-adenosine A2b receptor cas and function in cardiomyocytes are presented herein. cade. Cardiovasc Res 70, 308-14 (2006). 10 PIM-1 was originally identified as a proto-oncogene and 31. Pekarsky, Y. et al. Tcl 1 enhances Akt kinase activity and Subsequently found to be a highly conserved serine/threonine mediates its nuclear translocation. Proc Natl AcadSci USA kinase. Unlike other serine/threonine kinases (e.g. Akt, 97,3028-33 (2000). MAPK, PKA or PKC), PIM-1 phosphotransferase activity is 32. Jacobs, M. D. et al. PIM-1 Ligand-bound Structures not regulated by upstream kinases—it is active in nascent Reveal the Mechanism of Serine/Threonine Kinase Inhi 15 translated form. Thus, PIM-1 activity is regulated by con bition by LY294.002. J. Biol. Chem. 280, 13728-13734 certed control of gene transcription, mRNA translation, and (2005). protein degradation. The target phosphorylation consensus 33. Rota, M. et al. Nuclear targeting of Akt enhances ven sequence for PIM-1 is found in proteins mediating transcrip tricular function and myocyte contractility. Circ Res 97. tion, cell growth, proliferation, and survival. While PIM-1 1332-41 (2005). overexpression alone is not highly oncogenic, it does predis 34. Kato, T. et al. Atrial natriuretic peptide promotes cardi pose cells to transformation upon exposure to mutagens. In omyocyte survival by c0MP-dependent nuclear accumu general, PIM-1 up-regulation enhances cell Survival whereas lation of Zyxin and Akt. J. Clin Invest 115, 2716-2730 loss of PIM-1 increases apoptotic cell death. The protective (2005). effect of PIM-1 is dependent upon kinase activity as borne out 25 by experiments using a dominant negative kinase dead EXAMPLE 2 mutant construct.''' Occasional exceptions wherein PIM-1 activity increases cell death seem to result from differences in Demonstrating the Therapeutic Efficacy of the cellular backgrounds where PIM-1 was studied. Increased Upregulating PIM-1 PIM-1 expression also associated with cellular differentia 30 tion'''' as well as proliferation.''' Studies with myocar This example also demonstrates that the compositions of dium demonstrate changes in PIM-1 expression during post the invention comprising nucleic acids encoding the serine/ natal development and aging that form the basis of studies for threonine kinase PIM-1, and the methods of this invention, this invention. are effective for inducing cellular proliferation, and protect PIM-1 expression is stimulated by a variety of hormones, ing cells from hypoxia and cellular apoptosis; and to express 35 cytokines and mitogens, many of which are associated with PIM-1 kinase to protect cardiomyocytes from hypertrophy cardioprotective signaling.''” These multiple inductive and/or inhibit myocardial apoptosis induced by infarction, stimuli lead to an accepted Survival kinase in the myocar reducing infarct size. dium: Akt/PKB. However, the connection of Akt-mediated Until relatively recently, dogma held that cardiomyocytes effects to PIM-1 mediated signaling has been overlooked. In rarely underwent programmed cell death, were impervious to 40 fact, expression of PIM-1 is increased by Akt activation' and the effects of aging, and incapable of regeneration. The last studies using LY294.002 to block PI3-K activity were also decade of cardiovascular research has produced major para inadvertently inhibiting PIM-1 kinase activity as well. digm shifts in the perceptions of cardiomyocyte biology. The Despite apparent parallels between PIM-1 and Akt, these emerging picture of the myocardium is quite unlike previous kinases exhibit distinct effects in regulation of cell growth and notions of a tenaciously steadfast contracting cell that persists 45 survival. PIM-1 shares homology with two related family throughout the lifespan of the organism. Instead, cardiomyo members that have largely overlapping functions named cytes like many other cell types in the body possess a finite PIM-2 and PIM-3. Parallels of signal transduction between lifespan characterized by ongoing processes of birth, Sur PIM family members and Akt are a primary focus of ongoing vival, death, and (more controversially) regeneration. Conse research in non-myocyte cells. quently, this new perspective has reinvigorated research into 50 Independent aspects of PIM-1 mediated signaling are wait the molecular mechanisms that regulate Survival and the car ing to be teased apart from overlaps with Akt using knockout diomyocyte life cycle.' mouse lines in conjunction with overexpression approaches, Cellular proliferation and survival are regulated, in part, by thereby providing new insight regarding regulation of myo the action of signaling cascades that lead to activation of cardial survival and proliferation. Such studies with hemato kinases such as protein kinase C (PKC), Akt/PKB, and PIM 55 poeitic cells have revealed that PIM and Akt are critical com 1. Voluminous research in the context of the cardiovascular ponents of overlapping but independent signaling pathways system has established both PKC and Akt/PKB as fundamen responsible for enhancement of growth and survival.'" tal pillars upon which cardiomyocyte function is maintained. Mouse lines engineered with deletion of PIM-1 or triple In contrast, the cardiovascular role of PIM-1 and influences of knockouts deficient for all PIM kinases are viable without this kinase upon cardiomyocyte structure and/or function are 60 severe phenotypic effects." However, we have found car virtually nonexistent. Despite this dearth of cardiac-related diac-specific consequences following ischemia reperfusion knowledge, published studies of hematopoeitic and onco damage in the PIM-1 knockout mouse line. This data vali genic cells Suggest that the effects of PIM-1-mediated signal dates the role of PIM-1 in response to and protection from ing are as significant and far reaching as those ascribed to cardiomyopathic challenge. PKC or Akt/PKB. Similarities between these kinases are 65 Fundamentals of PIM-1 signal transduction are predomi readily apparent: 1) phosphorylation of serine/threonine resi nantly based in studies of hematopoeitic and oncogenic cells dues in target Substrates, 2) regulation of cell Survival and/or where the kinase was first identified. PIM-1 is a downstream US 8,617,534 B2 37 38 effector of many cytokines that operate through "Signal mice Subjected to either infarction by coronary occlusion or Transducers and Activators of Transcription” known by the pressure overload resulting from transverse aortic constric STAT acronym. Both STAT3 or STATS bind directly to the tion (TAC) at four days after procedures. In comparison, PIM-1 promoter and induce expression.” PIM-1 expression PIM-1 is concentrated within the nuclei of selected cardi is inhibited by negative feedback loop regulatory control of 5 omyocytes in chronic heart failure from a genetically engi the Jak/STAT pathway through interaction with Suppressors neered mouse model (tropomodulin overexpressing trans Of Cytokine Signaling (also known as SOCS). '7 PIM-1 pro genic). In all cases, PIM-1 protein level is elevated relative tein stability is also decreased through action of serine/threo to sham-operated control mice. The elevation of PIM-1 under nine phosphatase PP2a. Pivotal roles of STAT, SOCS, and these circumstances is presumably mediated by paracrine PP2a signaling in the myocardium’-24 implicate PIM-1 as 10 cytokine signaling within the challenged myocardium. an attractive candidate effector molecule to mediate biologi FIG. 2 illustrates confocal micrographs showing that car cal effects in cardiomyocytes. diomyopathic stimuli induce Pim-1 expression in Surviving The list of target molecules for PIM-1 kinase continues to myocardium. Confocal micrographs show induction of accumulate new members every year, many of which regulate Pim-1 protein expression relative to sham-operated controls cell cycle progression and apoptosis. Regulation of cell cycle 15 (Sham) in response to acute myocardial injury induced four proliferation by PIM-1 in vascular smooth muscle cells con days after infarction in the border Zone (MI) or near vascula firms a role of PIM-1 in the cardiovascular system." In the ture after pressure overload after four days (TAC). Both acute context of this proposal, the capacity of PIM-1 to inactivate injury models show accumulation of Pim-1 in perinuclear pro-apoptotic Bad protein via phosphorylation and enhance areas, whereas a genetically engineered transgenic model of Bcl-2 activity''' is reminiscent of prior investigations of chronic dilated cardiomyopathy shows Pim-1 accumulation cardiomyocyte survival signaling.’ The capacity of PIM-1 within select nuclei (TOT). Sections were labeled with anti to inhibit apoptotic cell death by preserving mitochondrial body to Pim-1 (green), phalloidin to decorate actin filaments integrity is a fundamental hypothesis in this proposal Studied (red), and TOPRO dye for nuclei (blue). Widefield view (up in Specific Aim 4. Removal/recycling of mitochondria and per row) with selected regions shown in higher magnification other intracellular organelles by autophagy is regulated in 25 to reveal cellular detail (lower row). part by Akt-dependent signaling (reviewed in reference 29, Loss of PIM-1 signaling impairs functional recovery fol below). lowing ischemia-reperfusion injury. Genetically engineered Recent advances support a central role for PIM kinases in mouse lines lacking PIM-1 or a triple knockout lacking PIM proliferative and Survival signaling. Cytokine-responsive 1, 2, and 3 created as described' have been established in our gp130 signaling cascadeslie directly upstream of PIM kinase 30 colony. Hearts from these mice were subjected to ex vivo activation.'" yet extensive studies in the cardiovascular treatment leading to ischemia-reperfusion damage. Func system have yet to explore the contribution of PIM to reported tional recovery of the PIM-knockout lines was significantly protective effects. Furthermore, intermingling of PIM and impaired relative to age, strain, and gender-matched control Akt-mediated effects are established along with the pivotal hearts. Hemodynamic recovery of the triple knockout line role of Akt in the cardiovascular system, (reviewed in refer 35 was comparable to that of the single isoform PIM-1 knockout ences 32 and 33, below) yet the contribution of PIM kinases line, indicating that the PIM-1 isoform is the critical member in myocardial signaling remains virtually unknown. Specific of the PIM family to mediate protective signaling in response Aim 3 is designed to tease apart the relationship of Akt and to ischemia-reperfusion challenge. PIM in the myocardium. Results point to PIM as a pivotal FIG.3 graphically illustrates data showing that Pim-1 pre regulator of proliferation and Survival in the myocardium. 40 serves hemodynamic function in ischemia-reperfusion C. PIM-1 is Expressed in Cardiomyocytes Exposed to Car injury. Hearts harvested from mouse normal (FVB, green or dioprotective Stimuli upper line) as well as genetically engineered lines lacking PIM-1 is expressed in cardiomyocytes exposed to cardio Pim-1 (PIM-1 ko, pink or lower line) or Pim-1, 2, and 3 (PIM protective stimuli. Unlike Akt, PIM-1 is constitutively active 1, 2, 3 ko; blue or middle line) were subjected to ischemia and regulated by protein production/degradation rates. Con 45 reperfusion challenge and hemodynamic recovery of func stitutive low level production of PIM-1 is detectable in car tion was assessed as previously described. Pim knockout diomyocytes under basal conditions both in cultured cells as mouse lines show significant impairment (p<0.01 for time well as normal myocardium. We cultured neonatal rat cardi points beyond one hour of reperfusion). omyocytes, which we treated with IGF-1, PMA, dexametha PIM-1 expression is developmentally regulated in postna Sone, LIF, phenyl-ephedrine, endothelin-1, estradiol, and for 50 tal growth. Elevation of PIM-1 in postnatal development is skolin and then assayed for PIM-1 protein levels. The first consistent with our observation that PIM-1 promotes growth four factors significantly increased PIM-1 expression, and proliferation of cardiomyocytes in the postnatal heart. In whereas little or no increase was seen with the others overa 2 addition, we have also observed PIM-1 expression in cardiac hour period. progenitor cells of adult hearts coincident with c-kit and FIG. 1 illustrates immunoblots demonstrating that cardio 55 Sca-1 stem cell markers. Correlation of PIM-1 expression in protective stimuli induces Pim-1 expression. Cultured neo stem cell populations would be consistent with observations natal rat cardiomyocytes were treated with various factors to from hematopoeitic cell biology demonstrating PIM-1 plays increase Pim-1 protein level as indicated above each lane a role in proliferation and survival.'' including IGF-1, PMA, dexamethasone, and forskolin. FIG. 4 illustrates immunoblots demonstrating Pim-1 Induction is evident in response to IGF-1, PMA and dexam 60 expression is highest in postnatal hearts and decreases with ethasone, whereas forskolin has no discernable effect. Simi age. Immunoblot showing Pim-1 protein expression at the larly, other stimuli including phenylephrine, endothelin-1, or indicated weeks after birth: data including samples from less estradiol did not markedly increase Pim-1 protein expression than one week, and 2, 3, 4, 5, 8, 12, 19 and 39 weeks of age. in this time frame of exposure, which was two hours. Actin is shown as a loading control to Verify comparable PIM-1 is induced in cardiomyocytes in response to cardi 65 protein sample concentration between lanes. omyopathic injury. Low level PIM-1 expression is markedly PIM-1 is expressed by recombinant adenoviral vectors. increased following cardiomyopathic challenge in hearts of Overexpression of PIM-1 or dominant-negative PIM-1 lack US 8,617,534 B2 39 40 ing kinase activity has been accomplished by creation of both transgenic mouse hearts expressing nuclear-targeted Akt adenoviral vectors. We have engineered these constructs with (as illustrated in FIG. 8B) as well as cultured cardiomyocytes GFP fluorescent tags to track their expression without the infected with an adenoviral vector expressing nuclear-tar need for anti-PIM-1 antibodies, allowing to directly visualize geted Akt. exogenous protein expression. These constructs have been 5 In summary, FIGS. 8A and 8B illustrate that nuclear accu valuable for understanding the effects of PIM-1 accumulation mulation of Akt induces expression of Pim-1 kinase in the in cardiomyocytes. myocardium: Immunoblot (FIG. 8A) and confocal micros FIG. 5 illustrates immunoblots demonstrating Pim-1 copy (FIG. 8B) of sections from 6 month old normal (NTG) expression in cardiomyocytes from recombinant adenoviral and transgenic mice expressing cardiac-specific nuclear-tar vectors. Cardiomyocytes were infected (or not infected, not 10 geted Akt. Separated grayscale images in scans correspond ing the “non-infected control) with GFP-tagged constructs of Pim-1 in wild-type (GFP-Pimwt) or kinase-dead (GFP to pim-1, actin, and nuclei that correspond to the overlay Piml)N) forms (and GFP only). Apparent mobility of GFP colors of green, red, and blue respectively. fusion constructs (~65 kDa) differs from native Pim-1 (ap Nuclear accumulation of Akt promotes increased PIM-1 proximately 33 kDa). Note induction of native Pim-1 15 expression detectable by both immunofluorescence as well as resulting from overexpression of GFP-Piml)N, presumably immunoblot analyses. The implications of this result are pro as a compensatory mechanism. GAPDH shown to demon found for Survival signaling in the myocardium, since inhibi strate comparable loadings between lysates. tion of Akt activation would also lead to reduction in PIM-1 PIM-1 overexpression protects againstapoptotic challenge levels. Furthermore, pharmacologic treatment with with doxorubicin. Overexpression of PIM-1 in cultured car LY294.002 that has traditionally been used for inhibition of diomyocytes inhibits apoptosis resulting from exposure to Akt also inhibits PIM-1 kinase activity. These findings pro doxorubicin as measured by TUNEL labeling. Neonatal rat vide strong circumstantial evidence that the protective effects cardiomyocyte cultures were infected with recombinant previously ascribed to Akt activation may be due, in part, to adenoviruses expressing GFP, PIM-1 wild-type (PIMwt), or actions of PIM-1 kinase. Since the role for PIM-1 in myocar PIM-1 dominant negative (DN) overnight prior to apoptotic 25 dial signaling has been overlooked to date, important aspects stimulation with doxorubicin. With reference to FIG.1, non of cardiac Akt biology related to cell survival and growth need infected cells (NI) or GFP-expressing cells show comparable reaSSeSSment. TUNEL labeling following doxorubicin treatment, whereas FIG. 9 illustrates that nuclear accumulation of Akt induces PIMwt expressing cells show significant reductions of Pim-1 expression. FIG. 9(A) illustrates a confocal micros TUNEL positive nuclei (p<0.05). Cells expressing the DN 30 copy of cultured cardiomyocytes infected with adenoviruses construct show enhanced TUNEL labeling. In contrast, the expressing nuclear-targeted B-galactosidase (B-gal), Akt mutant kinase-dead PIM-1 construct accumulates to lower wild-type (Akt wt), or nuclear targeted Akt (Akt-nuc) protein levels than PIM-1 wild-type, yet significantly detected with myc-tag antibody (Tag). Adenovirally encoded increases apoptosis compared to GFP-expressing control proteins are green in overlay. Nuclear-targeted Akt promotes cells. 35 accumulation of Pim-1 in the nucleus (shown blue in over FIGS. 6 and 7 show how Pim-1 inhibits apoptosis in car lay). Phalloidin shows actin filaments (red in overlay). FIG. diomyocytes. Neonatal rat cardiomyocyte cultures were 9(B) illustrates an immunoblot blot showing increased Pim-1 infected with recombinant adenoviruses expressing GFP. expression in cardiomyocyte cells infected with adenovirus Pim-1 wild-type (Pimwt), or Pim-1 dominant negative (DN) encoding nuclear-targeted Akt (Akt-nuc). GAPDH is shown overnight prior to apoptotic stimulation with doxorubicin. As 40 to show comparable loading between samples. graphically summarized in FIG. 6, non-infected cells (NI) or Loss of PIM-1 activity results incompensatory elevation of GFP-expressing cells show comparable TUNEL labeling fol Akt. Previously documented overlaps between PIM-1 and lowing doxorubicin treatment, whereas Pimwit expressing Akt in terms of functional effects and crosstalk warrant fur cells show significant reductions of TUNEL positive nuclei ther investigation to determine the role of PIM-1 kinase in (p<0.05). FIG. 7 illustrates a micrograph demonstrating that 45 myocardial biology. Experiments using adenoviruses cells expressing the DN construct show enhanced TUNEL expressing PIM-1 in either wild-type or dominant negative labeling; while FIG. 6 shows quantitative results, the FIG. 7 forms demonstrate that loss of PIM-1 signaling leads to eleva panels illustrate representative fields of infected cardiomyo tion of Akt protein expression and activity. Similarly, immu cytes showing GFP fluorescence (green) overlay with actin noblot evaluation of the PIM-1 knockoutline shows increased filaments revealed by phalloidin (red) in GFP only, GFP-Pim 50 levels of phospho-Akt' as well as total Akt protein (data not wt and GFP-Pim-DN samples. shown). The basis for this induction of Akt expression may lie PIM-1 overexpression promotes anti-apoptotic signaling with compensatory signaling to counterbalance loss of down via cascades involving Bcl-2 family members as well as stream PIM-1 activity. Since dominant negative PIM-1 is Mdm2. Overexpression of PIM-1 increases accumulation of capable of enhancing cell death, as illustrated in FIG. 10, our Bcl-2 and Bcl-XL family members, both of whomantagonize 55 data are consistent with the conclusion that PIM-1 mediates intrinsic apoptotic signaling by preserving mitochondrial certain facet(s) of Survival signaling in the Akt cascade. integrity, as illustrated in FIG. 8A. Additional signaling to In summary, FIG. 10 illustrates an immunoblot blot show promote survival induced by PIM-1 includes accumulation of ing expression of dominant negative Pim-1 prompts Akt Mdm2 and phosphorylation of Bad. Mdm2 antagonizes p53 accumulation in cardiomyocytes. Immunoblot showing dependent cell death and Badphosphorylation inhibits the 60 infection of neonatal rat cardiomyocytes with adenoviruses pro-apoptotic action of this protein. Thus, PIM-1 impacts expressing Pim-1 in either wild type (wt) or dominant-nega upon cell Survival by promoting the anti-apoptotic action of tive (DN) forms. Levels of phospho-Akt' as well as total Bcl-2 family members as well as enhancing Mdm2. Akt protein levels are elevated in lysates prepared from the PIM-1 expression is induced by nuclear accumulation of cells expressing DN Pim-1. Two separate sets of experimental activated Akt. Induction of PIM-1 promoter activity by Akt 65 results are shown with controls of uninfected cells (NI), GFP kinase indicates that PIM-1 expression lies downstream of expressing cells (GFP), and GAPDH loading controls to stan Akt activation." This observation has now been validated in dardize for variation in protein loading between samples. US 8,617,534 B2 41 42 FIG. 11 illustrates data characterizing founder lines and genes is selectively up-regulated by cytokines promoting T protein expression in Pim-1 transgenic mice. PCR of genomic helper type 1, but not T helper type 2, cell differentiation. DNA samples (FIG. 11 left) and immunoblot of cardiac Immunology. 2005; 116: 82-8. lysates (FIG. 11 right). Confirmation of vertical transmission 14) Katakami N. Kaneto H. Hao H, UmayaharaY. Fujitani Y. of the cardiac-specific Pim-1 wild-type (wt) as well as domi Sakamoto K. Gorogawa, S. Yasuda T. Kawamori D, nant-negative (DN) transgene is confirmed in Samples from Kajimoto Y. Matsuhisa M. YutaniC, Hori MandYamasaki the F1 generation. An immunoblot of cardiac lysates from the Y. Role of PIM-1 in smooth muscle cell proliferation. J Pim-1 wt transgenic line shows accumulation of Pim-1 and Biol. Chem. 2004; 279: 54742-54749. GFP with coincident mobility at approximately 60 kDa (re 15)Bhattacharya N. Wang Z. Davitt C. McKenzie IFC, Xing sulting from Pim-1 with a GFP-tag) indicative of substantial 10 P-X and Magnuson N. S. PIM-1 associates with protein transgene expression in these 6 week old mouse hearts. complexes necessary for mitosis. Chromosoma 2002; 111: GAPDH shown to indicate comparable loading of samples 80-95. between lanes. 16) White E. The PIMs and outs of survival signaling: role for the PIM-1 protein kinase in the suppression of apoptosis by LITERATURE CITED 15 cytokines. Gene & Dev. 2003; 17: 1813-1816. 17) Chen X P. Losman JA, Cowan S, Donahue E, Fay, S, EXAMPLE 2 Vuong B Q, Nawjin MC, Capece D. Cohan V L and Rothman P. PIM serine/threonine kinases regulate the sta 1) Sussman MA and Anversa P. Myocardial again and senes bility of Socs-1 protein. Proc Nat Acad. Sci. 2002; 99: cence: where have the stem cells gone? Ann. Rev. Physiol. 2175-218O. 2004; 66: 29-48. 18) Krishnan N. Pan H. Buckley DJ, Buckley A. Prolactin 2) Bachmann M and Moroy T. The serine/threonine kinase regulated PIM-1 transcription: identification of critical PIM-1. Int J Biochem Cell Biol. 2005; 37: 726-730. promoter elements and Akt signaling. Endocrine 2003; 3) Neri LM, Borgatti P. Capitani S, Martelli AM. The nuclear 20:123-30. phosphoinositide 3-kinase/AKT pathway: a new second 25 19) Mikkers H, Nawijn M. Allen J. Brouwers C, Verhoeven E, messenger system. Biochim Biophys Acta. 2002; 1584:73 Jonkers J and Berns A. Mice deficient for all PIM kinases 8O. display reduced body size and impaired responses to 4) Wang Z, Bhattacharya N. Weaver M, PetersenK, Meyer M, hematopoetic growth factors. Mol Cell Biol. 2004; 24: Gapter L and Magnuson N. S. PIM-1: a serine/threonine 6104–6115. kinase with a role in cell survival, proliferation, differen 30 20) Losman JA, Chen XP, Vuong BQ, Fay S. Rothman P B. tiation, and tumorigenesis. JVet Sci. 2001; 2: 167-179. Protein phosphatase 2A regulates the stability of PIM pro 5) Jacobs MD, Black J, Futer O, Swenson L, Hare B, Fleming tein kinases. J Biol. Chem. 2003: 278:4800-4805. Mand Saxena K. PIM-1 ligand-bound structures reveal the 21) Peltola KJ, Paukku K, Aho T L T, Ruuska M, Silven mechanism of serine/threonine kinase inhibition by noinen O and Koskinen PJ. PIM-1 kinase inhibits STAT LY294.002. J Biol. Chem. 2005; 280: 13728-13734. 35 5-dependent transcription via its interactions with SOCS1 6) Hammerman PS, Fox CJ, Birnbaum M.J. Thompson CB. and SOCS3. Blood. 2004: 103: 3744-3750. PIM and Akt oncogenes are independent regulators of 22) Kunisada K. Negoro S, Tone E, Funamoto M, Osugi T. hematopoietic cell growth and survival. Blood. 2005: 105: Yamada S, Okabe M, Kishimoto Tand Yamauchi-Takihara 4477-83. K. Signal transducer and activator of transcription 3 in the 7) Fox CJ, Hammermann, Cinalli RM, Master SR, Chodosh 40 heart transduces not only a hypertrophic signal but a pro L A and Thompson C B. The serine/threonine kinase tective signal against doxorubicin-induced cardiomyopa PIM-2 is a transcriptionally regulated apoptotic inhibitor. thy. Proc Natl AcadSci USA. 2000:97: 315-9. Genes & Dev. 2003; 17: 1841-1854. 23) Yasukawa H. Yajima T. Duplain H, Iwatate M. Kido M, 8) Bachmann M. Hennemann H. Xing PX, Hoffmann I and Hoshijima M. Weitzman MD, Nakamura T. Woodard S. Moroy T. The oncogenic serine/threonine kinase PIM-1 45 Xiong D. Yoshimura A, Chien K R. Knowlton KU. The phosphorylates and inhibits the activity of Cdc25C-asso Suppressor of cytokine signaling-1 (SOCS1) is a novel ciated kinase 1 (C-TAK1). J Biol. Chem. 2004; 279: therapeutic target for enterovirus-induced cardiac injury. J 48319-48328. Clin Invest. 2003; 111: 469-78. 9) Roh M. Gary B, Song C, Said-Al-Naief N, Tousson A, 24) Brewis N, Ohst K. Fields K. Rapacciuolo A, Chou D. Kraft, Eltoum I-E and Abdulkadir SA. Overexpression of 50 Bloor C, Dillmann W. Rockman H. Walter G. Dilated car the oncogenic kinase PIM-1 leads to genomic instability. diomyopathy in transgenic mice expressing a mutant A Cancer Res. 2003; 63: 8079-8084. subunit of protein phosphatase 2A. Am J Physiol Heart 10) Lilly M. Sandholm J. Cooper J.J. Kosikinen PJ and Kraft Circ Physiol. 2000: 279: H1307-18. A. The PIM-1 serine kinase prolongs survival and inhibits 25)Yan B. Zemskova M, Holder S. Chin V. Kraft A, Koskinen apoptosis-related mitochondrial dysfunction in part 55 PJ and Lilly M. The PIM-2 kinase phosphorylates BAD on through a bcl-2-dependent pathway. Oncogene 1999; 18: Serine 112 and reverses BAD-induced cell death. J Biol. 4022-4031. Chem. 2003: 278: 45358-45367. 11) Kim KT, Baird K, Ahn J.Y. Meltzer P. Lilly M, Levis M 26) Aho T L T, Sandholm J. Peltola K.J. Mankonen H P Lilly and Small D. PIM-1 is up-regulated by constitutively acti M and Koskinen PJ. PIM-1 kinase promotes inactivation vated FLT3 and plays a role in FLT3-mediated survival. 60 of the pro-apoptotic Bad protein by phosphorylating it on Blood 2005: 105: 1759-1767. the Ser112 gatekeeper site. FEBS Lett. 2004: 571: 43-49. 12) Zippo A, De Robertis A, Bardelli M. Galvagni F. Oliviero 27) Uchiyama T. Engelman RM, Maulik N. Das DK. Role of S. Identification of Flk-1 target genes in vasculogenesis: Akt signaling in mitochondrial Survival pathway triggered PIM-1 is required for endothelial and mural cell differen by hypoxic preconditioning. Circulation. 2004: 109:3042 tiation in vitro. Blood. 2004; 103:4536-44. 65 3O49. 13) Aho TL. Lund RJ, Ylikoski E. K. Matikainen S. Lahes 28) Kato K, Yin H. Agata J. Yoshida H. Chao L. Chao J. maa R, Koskinen PJ. Expression of human PIM family Adrenomedullin gene delivery attenuates myocardial inf US 8,617,534 B2 43 44 arction and apoptosis after ischemia and reperfusion. Am J ates dilated cardiomyopathy in Tropomodulin Overex Physiol Heart Circ Physiol. 2003; 285: H1506-14. pressing Transgenic mice. Circ Res. 2002; 90: 649-656. 29) Lum J.J. DeBerardinis RJ. Thompson CB. Autophagy in 44) Kato T. Muraski J. Chen Y. Tsujita Y. Wall J. Glembotski metazoans: cell survival in the land of plenty. Nat Rev Mol C C, Schaefer E. Beckerle M and Sussman MA. Atrial Cell Biol. 2005; 6: 439-48. natriuretic peptide promotes cardiomyocyte Survival by 30) Shirogane T, Fukada T. Muller J M, Shima DT, Hibi M, cGMP-dependent nuclear accumulation of Zyxin and Akt. Hirano T. Synergistic roles for PIM-1 and c-Myc in J Clin Invest 2005; in press. STAT3-mediated cell cycle progression and antiapoptosis. 45) Krishnamurthy J. Torrice C. Ramsey MR, Kovalev G.I. Immunity 1999; 11: 709-19. Al-Regaiey K, Su L, Sharpless N E. Ink4a/Arif expression 31) Hirano T. Ishihara K, Hibi M. Roles of STAT3 in medi 10 is a biomarker of aging. J Clin Invest. 2004; 114:1299 ating the cell growth, differentiation and Survival signals 1307. relayed through the IL-6 family of cytokine receptors. 46) Peng X D, Xu P Z, Chen M. L. Hahn-Windgassen A, Oncogene 2000; 19:2548-56. Skeen J. Jacobs J. Sundararajan D. Chen W. S. Crawford S 32) Matsui Tand Rosenzweig A. Convergent signal transduc E. Coleman KG, Hay N. Dwarfism, impaired skin devel tion pathways controlling cardiomyocyte Survival and 15 opment, skeletal muscle atrophy, delayed bone develop function: the role of PI 3-kinase and Akt. J Mol Cell Car ment, and impeded adipogenesis in mice lacking Akt1 and diol. 2005; 38: 63-71. Akt2. Genes Dev. 2003; 17:1352-1365. 33) Latronico MV, Costinean S, Lavitrano ML, Peschle C, 47) Cho H, Thorvaldsen J. L. Chu Q, Feng F, Birnbaum M.J. Condorelli G. Regulation of cell size and contractile func Akt1/PKBalpha is required for normal growth but dispens tion by AKT in cardiomyocytes. Aim NY Acad. Sci. 2004; able for maintenance of glucose homeostasis in mice. J 101.5: 250-60. Biol. Chem. 2001; 276: 38349-52. 34) Sussman MA, Welch S, Cambon N, Klevitsky R, Hewett 48) Grunweller A. Gillen C, Erdmann V A and Kurreck J. T. Price R L. Witt SA and Kimball T R. Myofibril degen Cellular uptake and localization of a Cy-3-labeled siRNA eration caused by tropomodulin overexpression injuvenile 25 specific for the serine/threonine kinase PIM-1. Oligonucle mice leads to dilated cardiomyopathy.J. Clin. Invest. 1998: otides. 2003: 13: 345-352. 101, 51-61. 49) Sussman MA, Welch S, Gude N, Khoury PR, Daniels S 35) Morrison L. E. Whittaker RJ, Klepper RE, Wawrousek E R. Kirkpatrick D, Walsh R A, Price R L. Lim HW and F, GlembotskiCC. Roles for alphaE-crystallinand HSPB2 Molkentin J D. Pathogenesis of dilated cardiomyopathy: in protecting the myocardium from ischemia-reperfusion 30 molecular, structural, and population analyses in Tropo induced damage in a KO mouse model. Am J Physiol Heart modulin Overexpressing Transgenics. Am. J. Pathol. 2005; Circ Physiol. 2004; 286: H847-55. 15.5: 2101-2113. 36) Yang Y. Li C C, Weissman A. M. Regulating the p53 50) Tsujita Y. Kato T and Sussman MA. Evaluation of Left system through ubiquitination. Oncogene. 2004; 23: 2096 Ventricular Function in Cardiomyopathic Mice by Tissue 106. 35 Doppler and Color M-mode Doppler Echocardiography. 37) Shioi T. McMullen JR, Kang PM, Douglas PS, Obata T. Echocardiography 2005; 22: 245-253. Franke T F, Cantley L. C. Izumo S. Akt/protein kinase B 51) Sussman MA, Welch S, Cambon N, Klevitsky R, Hewett promotes organ growth in transgenic mice. Mol Cell Biol. T. Price R L. Witt SA and Kimball T. R. Myofibril degen 2002; 22: 2799-2809. eration caused by tropomodulin overexpression injuvenile 38) Matsui T, Li L. Wu JC, CookSA, Nagoshi T. Picard MH, 40 mice leads to dilated cardiomyopathy. J. Clin. Invest. 1998, Liao R, Rosenzweig A. Phenotypic spectrum caused by 101, 51-61. transgenic overexpression of activated Akt in the heart. J 52) Sanbe A, Gulick J. Hanks MC, Liang Q. Osinska H, and Biol. Chem. 2002; 277: 22896-22901. Robbins J. Reengineering inducible cardiac-specific trans 39) CondorelliG, Drusco A. Stassi G. Bellacosa A. Roncarati genesis with an attenuated myosin heavy chain promoter. R, Iaccarino G, Russo M A. Gu Y. Dalton N. Chung C, 45 Circ Res. 2003; 92: 609-616. Latronico MV, Napoli C. Sadoshima J. Croce CM, Ross J. 53) Sohal DS, Nghiem M. CrackowerMA, Witt SA, Kimball Jr. Akt induces enhanced myocardial contractility and cell T R. Tymitz K M, Penninger J M, and Molkentin J D. size in vivo in transgenic mice. Proc Natl Acad Sci USA. Temporally regulated and tissue-specific gene manipula 2002; 99:12333-12338. tions in the adult and embryonic heart using a tamoxifen 40) Shiojima I, Yefremashvili M, Luo Z, Kureishi Y. Taka 50 inducible Cre protein. Circ Res. 2001: 89: 20-25. hashi A, Tao J. Rosenzweig A, Kahn CR, Abel E. D. Walsh 54) Schiekofer S, Shiojima I, Sato K and Walsh K. Microar K. Akt signaling mediates postnatal heart growth in ray cDNA profiles of acute and chronic Akt1 activation in response to insulin and nutritional status. J Biol. Chem. transgenic mouse hearts reveal gene expression profiles 2002; 277:37670-37677. associated with compensatory hypertrophy and failure. 41) Shiraishi I, Melendez, J. Ahn Y. Welch S, Schaefer E. 55 Circulation 2003: 108 (supplement); IV-77. Walsh K. Rosenzweig A, Kajstura J. Leri A, Anversa Pand 55) Jin ZQ. Goetzl E J and Karliner J S. Sphingosine kinase Sussman MA. Nuclear targeting of Akt enhances kinase activation mediates ischemic preconditioning in murine activity and survival of cardiomyocytes. Circ Res. 2004; heart. Circulation 110 2004; 110: 1980-1989. 94: 884-891 56) Karliner JS, Honbo N, Summers K, Gray MO and Goetzl 42) Camper-Kirby D. Welch S. Walker A, Setchell KD R, 60 E. L. The lysophospholipids sphingosine-1-phosphate and Schaefer E. Kajstura J. Anversa P and Sussman M. A. lysophosphatidic acid enhance Survival dueing hypoxia in Myocardial Akt activation and gender: increased nuclear neonatal rat cardiac myocytes. J Mol Cell Cardiol. 2001; activity in females versus males. Circ.Res. 2001: 88: 1020 33: 1713-1717. 1027. 57) Karliner J S. Mechanisms of cardioprotection by lyso 43) Welch S, Plank D. Witt S, Glascock B, Chimenti S. 65 phospholipids. J Cell Biochem 2004: 92: 1095-1103. Andreoli AM, Limana F. Leri A, Kastura J. Anversa Pand 58) Liang Q, Wiese RJ, Bueno OF, Dai Y S. Markham B E. Sussman MA. Cardiac-specific IGF-1 expression attenu Molkentin J D. The transcription factor GATA4 is activated US 8,617,534 B2 45 46 by extracellular signal-regulated kinase 1- and 2-mediated function, decreased apoptosis, increases in anti-hypertrophic phosphorylation of serine 105 in cardiomyocytes. Mol Cell proteins, Smaller myocyte size, and inhibition of hypertrophic Biol. 2001; 21: 7460-7469. signaling after challenge. Similarly, Pim-1 overexpression in 59) Gao T. Furnari F, Newton AC. PHLPP:aphosphatase that neonatal rat cardiomyocyte cultures inhibits hypertrophy directly dephosphorylates Akt, promotes apoptosis, and 5 induced by endothelin-1. On the cellular level, hearts of Pim suppresses tumor growth. Mol. Cell. 2005; 18:13-24. wt mice show enhanced incorporation of BrdU into myocytes 60) Wang Z, Bhattacharya N. Mixter P F. Wei W. Sedivy J, as well as a hypercellular phenotype compared to wild-type Magnuson NS. Phosphorylation of the cell cycle inhibitor controls after hypertrophic challenge. In comparison, trans p21Cip1/WAF1 by PIM-1 kinase. Biochim Biophys Acta. genic overexpression of Pim-DN leads to dilated cardiomy 2002: 1593:45-55. 10 opathy characterized by increased apoptosis, fibrosis, and 61) Gottlieb RA, Gruol D L, Zhu JY, Engler R L. Precondi tioning rabbit cardiomyocytes: role of pH. Vacuolar proton severely depressed cardiac function. Furthermore, overex ATPase, and apoptosis. JClin Invest. 1996:97:2391-2398. pression of Pim-DN leads to reduced contractility as evi 62) Karwatowska-Prokopczuk E. Nordberg J A Li H L. denced by reduced Ca" transient amplitude and decreased Engler RL, Gottlieb RA. Effect of vacuolar proton ATPase 15 percent cell shortening in isolated myocytes. These data Sup on pHi, Ca2+, and apoptosis in neonatal cardiomyocytes port a pivotal role for Pim-1 in modulation of hypertrophy by during metabolic inhibition/recovery. Circ Res. 1998; 82: impacting responses on molecular, cellular, and organ levels. 1139-44. Cardiac-Specific Pim-1 Transgenesis 63) Plank DM, Sussman MA. Impaired intracellular Ca2+ The wildtype form of human Pim-1 (Pim-wt) and a kinase dynamics in live cardiomyocytes revealed by rapid line dead mutant that functions as a dominant negative protein scan confocal microscopy. Microsc Microanal. 2005; 11: (Pim-DN) (16) were fused to GFP undercontrol of the cardiac 235-43. specific C-myosin heavy chain promoter. PCR of mouse lines 64)Plank DM, Yatani A, Ritsu H. Witt S, Glascock B, LalliM created with these constructs show incorporation of the trans J. Periasamy M. Fiset C, Benkusky N. Valdivia HH, Sus genes into the genome. Immunoblot of whole heart lysates Sman M.A. Calcium dynamics in the failing heart: restora 25 from transgenic samples revealed a 64-kDa GFP-Pim-1 tion by beta-adrenergic receptor blockade. Am J Physiol fusion protein that is recognized by both Pim-1 and GFP Heart Circ Physiol. 2003; 285: H305-15. antibodies. Bonafide inhibitory function of the Pim-DN con 65)Zorov BZ, Filburn CR, Klotz L-O, Zwier J L and Solott struct was validated using the ability of Pim-1 to activate S.J. Reactive oxygen species (ROS)-induced ROS release: GATA-1 transcription (Magnuson, unpublished data). Pim a new phenomenon accompanying induction of the mito 30 wt phosphorylates the transcription factor GATA-1 and chondrial permeability transition in cardiac myocytes. J induces GATA-1 luciferase reporter expression in C2C12 Exp Med. 2000; 192: 1001-1014. myoblasts, with increasing titration of Pim-DN inhibiting 66) Sayen M. R. Gustafsson AB, Sussman MA, Molkentin J D and Gottlieb R A. Calcineurin transgenic mice have GATA-1 activity. Based on previous studies that showed mitochondrial dysfunction and elevated Superoxide pro 35 Pim-1 phosphorylates p21 (29), in-vitro kinase assays con duction. Am J Physiol Cell Physiol 2003; firmed activity of our Pim-wit construct using whole heart C C II . lysates that were prepared from GFP-Pim-1-wit, GFP-Pim-1- 67) Clarke SJ, McStay GP and Halestrap A P. Sanglifehrin A DN transgenic mice and non-transgenic (NTG) mice. GFP acts as a potent inhibitor of the mitochondrial permeability Pim-1 proteins (wt or KD) were immunoprecipitated from transition and reperfusion injury of the heart by binding to 40 whole heart lysates and incubated in the presence of Y-32P cyclophilin-Data different site from cyclosporin A. J Biol. ATP with GST-p21 as substrates. Samples were resolved on Chem. 2002; 277: 34793-34799. SDS-PAGE, and P-labeled proteins were detected by auto 68)Yuan H. Williams SD, Adachi S, Oltersdorf Tand Gott radiography. Pim-wit overexpression phosphorylates p21 lieb R A. Cytochrome c dissociation and release from while this activity was abolished in the Pim-DN construct. mitochondria by truncated Bid and ceramide. Mitochon 45 Pim-1 Inactivation Increases Cardiomyocyte Apoptosis drion 2003; 2:237-244. and Fibrosis 69) Gustafsson A B, Tsai J. G. Logue SE, Crow M T and Hearts from mice created with genetic deletion of Pim-1 Gottlieb R A. Apoptosis repressor with caspase recruit (Pim-1 KO) exhibit increased apoptosis in myocytes relative ment domain protects against cell death by interfering with to NTG (non-transgenic) controls but show no evidence of Bax activation. J Biol. Chem. 2004; 279: 21233-21338. 50 overt cardiomyopathic remodeling (12). In comparison, Pim DN overexpressing mice suffer from cardiomyopathy char EXAMPLE 3 acterized by progressive wall thinning beginning at 3-4 months of age. FIG. 12 compares the characteristics of the Pim-1 Kinase Antagonizes Aspects of Myocardial wild-type NTG mice with the mice lacking active PIM-1. In Hypertrophy and Compensation to Pathological 55 FIG. 12a, echocardiographic measurement of posterior wall Pressure Overload dimension over time shows the PIM-DN mice have a progres sive thinning. This is also seen in the anterior wall dimension The following data demonstrate that Pim-1 kinase exerts in FIG. 12b. As shown in FIG. 12c, the heart:body weight potent cardioprotective effects in the myocardium down ratio at 10 and 22 weeks after birth is also significantly stream of AKT, and that PIM-1 plays a role in cardiac hyper 60 increased in the PIM-DN mice. Since Pim-DN overexpres trophy. Cardiac-specific expression of Pim-1 (Pim-wt) or the sion induces cardiomyocyte apoptosis in vitro (12), assess dominant-negative mutant of Pim-1 (Pim-DN) in transgenic ment of apoptotic myocytes in the myocardium of Pim-DN mice together with adenoviral-mediated overexpression of animals was performed by TUNEL staining. Pim-DN ani these Pim-1 constructs was used to delineate the role of Pim-1 mals exhibit a two-fold increase in apoptotic cardiomyocytes in hypertrophy. Transgenic overexpression of Pim-1 protects 65 per mm relative to age-matched controls (1.2/mm and 2.4/ mice from pressure overload induced hypertrophy relative to mm respectively, FIG. 12d **p<0.01) resulting in increased wild-type controls as evidenced by improved hemodynamic fibrosis and collagen deposits in the left ventricle. In addition, US 8,617,534 B2 47 48 the amount of necrosis was quantified (p<0.01) and found essary time course to infect and treat with ET1 as evidenced to be significantly increased at basal levels in Pim-DN ani by high levels of TUNEL positive cells. As cardiomyocytes mals. overexpressing Pim-DN protein begin to round up and detach In Summary, FIG. 12 graphically illustrates data showing from the plate, their morphology is drastically changed, that inactivation of Pim-1 in the myocardium increases apo thereby preventing an accurate assessment of cell size (12). ptosis and fibrosis. FIG.12a and FIG.12b graphically illus However, the effect of Pim-DN on hypertrophy can be seen trate echocardiographic measurement of posterior (12a) and using the specific Pim-1 activity inhibitor quercetagetin. anterior (12b) wall dimension (PWD and AWD respectively) Pim-1 expressing NRCM cultures were treated for 1 hour in NTG (n=5) and Pim-DN (n=7) animals at two week inter with or without 10 nM quercetagetin prior to 48 hour incu vals (p<0.05, *p-0.01). FIG. 12c graphically illustrates 10 bation with ET-1 and cell size assessment. Cells treated with heart weight to body weight ratios in NTG and Pim-DN quercetagetin and ET-1 had significantly larger Surface com animals at 10 and 22 weeks of age (n-6, *p-0.01). FIG.12d pared to ET-1 stimulated cells where Pim-1 activity was not graphically illustrates histogram data representing counts of blunted by inhibitor. Collectively these results support an TUNEL positive myocytes per mm in 17-22 week old NTG anti-hypertrophic role when Pim-1 is overexpressed, albeit at and Pim-DN transgenics (n=3, **p<0.01). 15 levels well above normal physiological induction in this cell Pim-DN Hearts Exhibit Depressed Cardiac Function culture system. Hearts of Pim-DN mice show progressive dilation from 17 In Summary, FIG. 13 graphically illustrates data showing weeks of age (p<0.05) with attendant depression of frac that Pim-1 overexpression protects cardiomyocytes from tional shortening and ejection fraction (36.6% and 74.2% endothelin-1 induced hypertrophy. Individual cell surface respectively) by 27 weeks of age (p<0.05, **p<0.01) by area measurements from uninfected control, EGFP, and Pim echocardiographic analyses. Morphometric analysis per wt infected neonatal rat cardiomyocyte cultures treated and formed on both NTG and Pim-DN hearts additionally con untreated with endothelin-1 (ET-1) (n=4, p<0.05, firmed that Pim-DN hearts were significantly dilated. In vivo **p<0.01). hemodynamic assessments verified impaired hemodynamics Pim-1 Overexpression Inhibits Remodeling Induced by with diminished tdP/dt, increased left-ventricular end dias 25 Pressure Overload Hypertrophy tolic pressure (LVEDP), and decreased left-ventricular devel Consequences of Pim-1 overexpression upon hypertrophy oped pressure (LVDP). Mechanistically, Pim-DN myocytes in vivo was assessed with Pim-wit mice subjected to trans displayed reduced Ca" transient amplitude coupled with aortic constriction (TAC) to induce pressure overload relative decreased percent cell shortening in respect to NTG myo to age and gender matched NTG controls. With reference to cytes. Additionally, the time constant (ti) of the Ca" transient 30 FIGS. 14.a fline graphs were generated representing weekly decay was larger in Pim-DN myocytes. These results indicate echocardiographic assessment of NTG and Pim-wit sham and that depressed contractile function of Pim-DN myocytes is TAC banded hearts for anterior wall dimension (AWD 14d. mediated, at least in part, by a decline in Ca" release from the 14a), posterior wall dimension (PWD14d. 14b), end diastolic sarcoplasmic reticulum together with a slower reuptake. Thus dimension (EDD, c), end-systolic dimension (ESD, 14d), inactivation of Pim-1 by Pim-DN in the myocardium has a 35 percent fractional shortening (FS, 14e), and ejection fraction negative effect on cardiac function. (EF, 14f) (NTG sham n=6, Pim-wit sham n=6, NTG TAC n=9, Overexpression of Pim-1 Inhibits Hypertrophy. In Vitro Pim-wit TAC n=9; *p<0.05, **p<0.01) (FIG. 14a-14b, Induction of Pim-1 in the damaged myocardium is thought *p-0.05, **p<0.01). to be a protective Survival response (12) occurring in cardi Results show that TAC of control NTG hearts prompts omyocytes such as those in the infarct border Zone where 40 remodeling at two weeks after challenge evidenced by ante Pim-1 colocalizes to cells expressing atrial natriuretic pep rior and posterior wall thickening. In comparison, Pim-wt tide. ANP is both anti-hypertrophic and cardioprotective (24), animals do not show significant increases in wall thickness so the coincidence of these proteins prompted assessment of for up to 14 weeks after challenge (FIGS. 14a-14b). Simi the role that Pim-1 accumulation plays in mitigation of hyper larly, NTG controls show left ventricular chamber enlarge trophic signaling. 45 ment measured by end diastolic diameter (EDD) within 8 The impact of Pim-wit overexpression upon cardiomyocyte weeks after banding, and end systolic diameter (ESD) hypertrophy was initially examined using neonatal rat cardi increases significantly within 4 weeks. Neither EDD nor ESD omyocytes (NRCMs) infected with adenoviruses encoding parameters show significant changes in Pim-wt transgenics EGFP-Pim-wit or EGFP protein followed by stimulation with throughout the same time period (FIGS. 14C-14d. **p-0.01 endothelin-1 (ET-1) for 24 hours. FIG. 13 shows individual 50 vs. sham, Sp-0.01 vs. Pim-witTAC). Furthermore, NTG con cell Surface area measurements from uninfected control, trols show marked decreases in both fractional shortening EGFP and Pim-wit infected neonatal rat cardiomyocyte cul (FS) and ejection fraction after challenge, while myocardial tures treated and untreated with endothelin-1. As illustrated in function is maintained in Pim-wit hearts (FIGS. 14e-14f. FIG. 13, Pim-wit overexpression inhibits ET-1 induced hyper **p-0.01 vs. Pim-wit TAC). Interestingly, although decreases trophy (p<0.05, *p-0.01) as assessed by cell surface area 55 in cardiac function are seen in NTG animals, Pim-1 protein is measurements relative to the increase in cell size seen in modestly elevated in response to pressure overload during control and EGFP infected myocytes treated with ET-1. early hypertrophy and progression to heart failure. Endog Molecular profiling of the hypertrophic signature of untreated enous levels of Pim-1 expression increase early during adap cultures shows that Pim-wit expression decreases mRNA lev tive hypertrophy and decline shortly thereafter, while during els for atrial natriuretic peptide (ANP) by 60.6% and B-type 60 late -phase hypertrophy (9 weeks post-TAC), Pim-1 appears natriuretic peptide (BNP) by 39.8% while increasing C-skel localized to nuclei within vasculature. These observations etal actin levels 89% compared to EGFP infected controls. Support the conclusion that Pim-1 is induced in response to However, upon treatment with ET-1, Pim-wit cultures exhibit StreSS. a 2.5-fold increase in ANP levels and 10.2-fold decrease in In Summary, FIG. 14 graphically illustrates data showing B-myosin heavy chain levels versus ET-1 treated EGFP con 65 Pim-wt transgenic animals are resistant to pressure overload trols. Unfortunately, cultured cardiomyocytes overexpress induced hypertrophy. FIG. 14a-f) Line graphs representing ing Pim-DN protein show diminished viability after the nec weekly echocardiographic assessment of NTG and Pim-wt US 8,617,534 B2 49 50 sham and TAC banded hearts for anterior wall dimension measurements (FIG. 15a), left ventricular developed pressure (AWDd, a), posterior wall dimension (PWDd, b), end dias (LVDP, b), left ventricular end-diastolic pressure (LVEDP. tolic dimension (EDD, c), end-systolic dimension (ESD, d), FIG. 15c). For 4-week animals NTG sham n=4, NTG TAC percent fractional shortening (FS, e), and ejection fraction n=3, Pim-wt sham n=4, Pim-wit TAC n=4. For 10-week ani (EF, f) (NTG sham n=6, Pim-wit sham n=6, NTG TAC n=9, 5 mals NTG sham n=5, NTG TAC n=10, Pim-wit sham n=14, Pim-wit TAC n=9; *p-0.05, **p<0.01). Pim-wit TAC n=7 (p<0.05, **p<0.01 vs. sham, #p-0.01 vs. Pim-Wt Hearts are Resistant to TACInduced Hypertrophy 4-week TAC, Sp-0.05, SSp-0.01 vs. NTG TAC, p<0.05, NTG mice exhibit significant increases in heart size and pupp-0.01 vs. NTG sham). Succumb at a significantly faster rate compared to Pim-wt The mechanistic basis for preservation of contractile func transgenic mice following TAC challenge. Molecular mRNA 10 tion in Pim-wit hearts may rest with the cellular response in markers of hypertrophy including ANP BNP. C.-skeletal actin TAC challenged animals. NTG and Pim-wit groups injected (CSKA), B-myosin heavy chain (B-MHC) and c-fos are sig with BrdU for 10 days were used to assess stimulation of nificantly increased in NTG TAC challenged hearts compared DNA synthesis and potential cellular proliferation after TAC to shams. In comparison, molecular hypertrophic markers are challenge. Pim-wit hearts possess 67% more BrdU+ myocytes not significantly increased in hearts of Pim-wit mice Subjected 15 relative to NTG controls after TAC challenge. The majority of to TAC challenge, although Pim-wit hearts do express more BrdU+ cells in Pim-wit hearts post-TAC are diploid, support c-foS mRNA under basal conditions. Quantitation of apop ing the premise that increases in BrdU+ cells stemmed from totic myocytes by TUNEL labeling in sections reveals a 3.72 new myocyte formation and not enhanced DNA synthesis in fold increase in NTG TAC-challenged hearts compared to pre-existing cells. Consistent with improved contractility, we shams (3.2/mm and 0.86/mm respectively), whereas Pim now show that in addition to increased SERCA2a levels (12), wt animals exhibit no significant increase in TUNEL positive Pim-wit hearts also show increased levels of phosphorylated cells (1.31/mm versus 1.05/mm). Consistent with improved phospholamban (PLB) while Pim-DN animals show signifi myocardial viability, Pim-wit TAC-challenged hearts show cant decreases in phospho-PLB compared to NTG control decreased peri-vascular fibrosis as well as decreased necrosis animals. These results support the conclusion that in the face relative to NTG TAC-challenged counterparts. Additionally, 25 of decreased cardiac function, overexpression of Pim-1 Pim-wit TAC banded hearts have significantly increased levels allows the heart to maintain function through increased con of anti-apoptotic proteins including Bcl-X1, Bcl-2, and tractility through elevation of SERCA2a and phosphorylated increased phosphorylation of BAD relative to NTG counter PLB. parts. These data support the idea that protection afforded by Pim-1 Increases Myocardial Cellularity Pim-1 overexpression is due in part to increased survival 30 The volume and cellularity of myocytes resulting from signaling. myocardial Pim-1 overexpression was assessed by quantita Pim-Wt Hearts Exhibit Increased Contractile Function in tion of myocyte volume distribution. Results show Pim-wt Response to TAC Banding hearts possess an increased percentage of Small myocytes Decreased fibrosis is present in Pim-wit hearts after TAC relative to NTG controls that is also reflected in decreased banding, Suggesting Pim-1 overexpression preserves contrac 35 average myocyte size in these hearts, resulting in a hypercel tile function. Actions of Pim-1 overexpression upon cardiac lular phenotype of approximately 33% more myocytes in contractility were examined using Pim-wit and NTG controls Pim-wit compared to NTG. Additionally, isolated Pim-DN assessed by in vivo hemodynamic measurements conducted myocytes were 11% larger than NTG myocytes, indicating an at 4 weeks and 10 weeks after TAC challenge. FIGS. 15a-c inverse effect wherein impaired Pim-1 activity prompts for illustrate an in vivo hemodynamic assessment of NTG and 40 mation of larger myocytes in the transgenic heart. Pim-wit hearts 4 and 10 weeks (black and gray bars respec Inhibition of hypertrophy in vivo and in vitro indicates tively) after sham or TAC operation (14 and 20 weeks of age Pim-1 contributes to Akt-mediated blunting of hypertrophic respectively). FIG. 15a shows tdP/dt measurements: FIG. remodeling. Pim-1 is only upregulated in localized regions 15b shows left ventricular developed pressure (LVDP), and close to acute injury or damage and is not increased through FIG. 15c illustrates left ventricular end-diastolic pressure 45 out the myocardium until initiation of transit to end stage (LVEDP). While contractile function is depressed in NTG failure. Thus, Pim-1 likely serves as a survival and protective TAC-challenged hearts at both time points, Pim-wit hearts response to blunt maladaptive hypertrophic remodeling in possess better function after TAC challenge with slight early phases of reactive signaling. In comparison, Pim-1 decreases in +dP/dt and no significant change in-dP/dt com elevation occurring in late stage decompensation probably pared to sham operated NTG controls. Comparison of 4-week 50 represents a terminal effort to preserve function, although and 10-weekdP/dt assessments show significant decreases in beneficial effects can be overridden by the sequelae of end function for both NTG and Pim-wit TAC challenged hearts, stage failure. The differential expression of endogenous although performance of Pim-wit TAC-challenged hearts is Pim-1 during transition from adaptive to maladaptive hyper relatively improved. Measurements reveal increases in left trophy possibly represents a mechanism by which Pim-1 Ventricular developed pressure and end-diastolic pressure in 55 exerts cardioprotection. NTG hearts 4 and 10 weeks after TAC, but Pim-wit hearts Nuclear AKT delayed but did not overcome compensatory show relative preservation of LVDP (FIG. 15b, Pim-wt remodeling after TAC challenge (9), but Pim-wt transgenic 19.75% increase, **p<0.01) and no change in LVEDP (FIG. hearts exhibit persistent blunting of myocardial hypertrophy 15c *p-0.01, SSp-0.01 vs. NTGTAC). Hemodynamic func (see e.g., FIG. 14) without increases in apoptosis, changes in tion reflected in EdP/dt and LVDP is improved in Pim-wt 60 hypertrophic signaling markers or deterioration of function hearts compared to NTG at 4 and 10 week time points (FIGS. (see e.g., FIG. 15). In addition, Pim-wt transgenic hearts 15a-15b, p<0.05, pupp<0.01). perform significantly better functionally than NTG counter In Summary, FIG. 15 graphically illustrates data showing parts at 14 and 20 weeks of age (see e.g., FIG. 15). A potential that Pim-1 enhances cardiac function. FIG. 15a-c) In vivo basis for this remarkable resiliency to pressure overload is in hemodynamic assessment of NTG and Pim-wit hearts 4 and 65 part related to Pim-1-mediated induction of sarco/endoplas 10 weeks (black and gray bars respectively) after sham or mic reticulum Ca"ATP-ase 2a (SERCA2a) (12) and phos TAC operation (14 and 20 weeks of age respectively). EdP/dt pholamban (PLB) expression. Overexpression of Pim-DN in US 8,617,534 B2 51 52 the myocardium increases myocyte apoptosis (see e.g., FIG. phospho-AKT''' (92.55%), phospho-AKT7 (2.24-fold), 12d) associated with dilated cardiomyopathy, whereas total AKT (73.66%), phospho-STAT37 (2.72-fold), total genetic deletion of Pim-1 also results in increased apoptosis STAT3 (2.0-fold), with no significant changes in bcl-2 or although dilated cardiomyopathy is not observed (12). The Pim-2 expression compared to sham-operated controls (FIG. cardiomyopathic consequences of Pim-DN overexpression 5e). In comparison, wild type heart samples show significant Suggest this kinase is critical to cardiomyocyte viability, as increases in bcl-XL (57.0%), phospho-BAD''' (64.58%), compensatory up-regulation of Pim-2 occurs in the Pim-1 phospho-AKT''' (98.32%), phospho-AKT7 (2.81-fold), knockoutline could help account for lack of cardiomyopathic total AKT (2.26-fold), phospho-STAT37 (3.43-fold) total changes (12). These findings are also consistent with our STAT3 (2.02-fold), with no change in Pim-2 or Pim-3 expres previous study that shows the dominant negative form of 10 sion compared to sham (FIG. 16e). Thus, Pim-KO hearts Pim-1 induces PARP and caspase 3 cleavage, increasing car exhibit significant increases in Pim-2 and Pim-3 compared to diomyocyte apoptosis in vitro (12). Furthermore for the effect NTG hearts post-MI, but profound decreases in the other on hypertrophy, Pim-DN seem to be able to mount a hyper survival signaling molecules are observed (FIG. 16e). trophic response as evidenced by increased anterior wall In Summary, FIG. 16 graphically illustrates data demon thickness at one week after TAC challenge (not shown). 15 strating that Pim-1 protects against infarction injury. FIG.16a Overexpression of Pim-1 in the pathologically challenged graphically illustrates a histogram representing infarct size 7 myocardium results in numerous salutary effects including days post-MI as a percent of left-ventricular free wall in decreased apoptosis, increased expression of anti-apoptotic Pim-KO hearts (p<0.05 v NTG MI). FIG. 16b graphically proteins, and decreased fibrosis and necrosis. Pim-1 also illustrates data showing the number of TUNEL positive myo increases the percentage of Small myocytes and an overall cytes per mm 7 days post-MI in Pim-KO hearts (**p<0.01). increase in the number of myocytes constituting the myocar FIG. 16c graphically illustrates in vivo hemodynamic mea dium. Consequently, PIM-1 overexpression provides an surements of NTG and Pim-KO mice 5 days following MI increased capacity to withstand TAC challenge by virtue of (p<0.05). Left ventricular developed pressure (LVDP), left increased cell numbers of small cells and decreased cell ventricular end-diastolic pressure (LVEDP), and change in death. 25 pressure over change in time. FIG. 16e graphically illustrates Genetic Ablation of Pim-1 increases infarction injury. Pro Immunoblot quantitation of survival protein levels 7 days tective effects of Pim-1 were assessed following MI in Pim post-infarction in Pim-KO and NTG control hearts (p<0.05 KO animals. Left ventricular free wall infarct size is increased vs. sham, hip-0.01 vs. sham, Sp-0.01 vs. NTG MI). FIG. 16f 22.7% in Pim-KO hearts compared to wild type controls. graphically illustrates Infarct size measurements 10 days (FIG. 5a). Pim-KO mice possess a minor but significant 30 post-infarction (n=3, **p<0.01). FIG. 16g graphically illus increase in TUNEL positive myocytes in the left ventricle trates the number of TUNEL-labeled CM/m2 in LV 10 days relative to wild type controls (Table S2, Sp-0.01), and this after MI. differential is exacerbated following MI up to a 4.0 fold Materials and Methods increase in TUNEL positive myocytes relative to wild-type Generation of Transgenic Animals and Animal Use samples (FIG. 5b **p-0.01). Hemodynamic performance is 35 Pim-wit and Pim-DN cDNA fragments (16) were sub comparable between Pim-KO and wild type controls under cloned into the C-MHC plasmid for transgenesis. Prior pub normal conditions (FIG.S5), but developed ventricular pres lications describe methods for TAC banding and echo (9), as sure in Pim-KO mice is depressed and end diastolic pressure well as HW:BW ratio determination and hemodynamics (12). is increased with respect to wild type following infarction Further details provided in the online supplement. All animal (FIG. 5c). Further, diastolic wall stress is significantly 40 studies were approved by the Institutional Animal Use and increased in both left ventricular free wall and septum after Care Committee. infarction in Pim-KO hearts (FIG. S5, *p-0.01). Pim-KO Confocal Microscopy, Immunoblotting and Assays mice were noted to possess decreased lymphocyte prolifera GFP-Pim-1 proteins immunoprecipitated from heart tion and hematopoetic cell differentiation'' that could pos lysates were used in an in vitro kinase assay with GST-p21 as sibly decrease inflammatory responses following MI, but no 45 substrate. For luciferase assays, C2C12 cells transfected with significant differences were found in circulating c-kit-- cell indicated plasmids and pGATA-Luc reporter construct were number after MI or c-kit-fisca-1+ bone marrow cell number analyzed for GATA-dependent luciferase activity. Methods pre or post-MI (FIG. S5). Likewise, inflammatory cell for immunofluorescence microscopy were done as described recruitment following MI as indicated by CD45 staining is in reference 26, listed below, immunoblotting were done as comparable between Pim-KO hearts versus controls (FIG. 50 described in reference 24, listed below, quantitative RT-PCR S5). and TUNEL (“terminal deoxynucleotidyl transferase-medi Pim-KO Hearts Exhibit Altered Protective Signaling. ated duTP-biotin nick end labeling) staining were done as Pim-1 may be a relatively promiscuous kinase based upon described in reference 9, listed below. minimal target Substrate recognition sequence require In Vitro Cell Culture and Analyses ments' and capacity for autophosphorylation'', so molecu 55 Neonatal rat cardiomyocyte cultures were prepared as lar mechanisms responsible for Pim-1-mediated cardiopro described previously (10). Adult myocyte isolation, volume tection were examined. calculations, cell shortening and Ca" transient experiments Pim-1-KO heart samples possess increases in phospho performed as previously described in references 12, 22, 25, AKT (90.72%), phospho-AKT7 (2.76-fold), total listed below. AKT (2.10-fold), phospho-STAT3'' (2.61-fold), total 60 Figure Legends STAT3 (68.6%) and Pim-2 (4.6-fold) relative to wild type samples. However, no increases were observed for bcl-2. REFERENCES FOR EXAMPLE 3 bcl-XL, phospho-BAD''', or Pim-3 expression compared to wild type controls (FIG.16d). These survival-signaling mol 1. Neri, L. M., Borgatti, P., Capitani, S. & Martelli, A. M. ecules were also examined seven days after MI, when Pim 65 (2002) The nuclear phosphoinositide 3-kinase/AKT path KO mice exhibit a 2.57-fold increase in Pim-3 expression, but way: a new second messenger system. Biochim Biophys decreases in bcl-X (2.1-fold), phospho-BAD''' (75.9%), Acta 1584, 73-80. US 8,617,534 B2 53 54 2. Sugden, P. H. (2003) Ras, Akt, and mechanotransduction in 22. Rota, M., et al. (2005) Nuclear targeting of Akt enhances the cardiac myocyte. Circ Res 93, 1179-92. ventricular function and myocyte contractility. Circ Res 3. McGowan, B.S., Ciccimaro, E. F., Chan, T.O. & Feldman, 97, 1332-41. A. M. (2003) The balance between pro-apoptotic and anti 23. Seimi, S.K., et al. (2004) Glycogen synthase kinase-3beta apoptotic pathways in the failing myocardium. Cardiovasc is involved in the process of myocardial hypertrophy Toxicol 3, 191-206. stimulated by insulin-like growth factor-1. Circ J 68,247 4. Kumar, D., Lou, H. & Singal, P. K. (2002) Oxidative stress 53. and apoptosis in heart dysfunction. Herz 27, 662-8. 24. Kato, T., et al. (2005) ANP Promotes Cardiomyocyte 5. Hardt, S. E. & Sadoshima, J. (2002) Glycogen synthase Survival by c0MP-dependent Nuclear Accumulation of kinase-3beta: a novel regulator of cardiac hypertrophy and 10 Zyxin and Akt. J Clin Invest 115, 2716-2730. 25. Kajstura, J., et al. (1995) The cellular basis of pacing development. Circ Res 90, 1055-63. induced dilated cardiomyopathy. Myocyte cell loss and 6. Sussman, M.A. & Anversa, P. (2004) Myocardial aging and myocyte cellular reactive hypertrophy. Circulation 92, Senescence: where have the stem cells gone? Annu Rev 2306-17. Physiol 66, 29-48. 15 26. Fransioli, J., et al. (2008) Evolution of The c-kit Positive 7. Latronico, M.V., Costinean, S., Lavitrano, M. L., Peschle, Cell Response to Pathological Challenge in the Myocar C. & Condorelli, G. (2004) Regulation of cell size and dium. Stem Cells 10.1634, 2007-0751. contractile function by AKT in cardiomyocytes. Ann NY 27. Hoshijima, M., et al. (2002) Chronic suppression of heart AcadSci 1015, 250-60. failure progression by a pseudophosphorylated mutant of 8. Condorelli, G., et al. (2002) Akt induces enhanced myo phospholamban via in vivo cardiac ra AV gene delivery cardial contractility and cell size in vivo in transgenic mice. Nature Medicine 8,864-871. Proc Natl AcadSci USA 99, 12333-8. 28. Zhang Y. Wang, Z. Li, X., Magnuson N. (2008) Pim 9. Tsujita, Y., et al. (2006) Nuclear targeting of Akt antago kinase-dependent inhibition of c-Myc degradation. Onco nizes aspects of cardiomyocyte hypertrophy. Proc Natl gene, 1-11. AcadSci USA 103, 11946-51. 25 29. Zhang Y. Wang, Z. Magnuson N. (2007) Pim-1 kinase 10. Shiraishi, I., et al. Nuclear targeting of Akt enhances dependent phosphorylation of p21(Cip1/WAF1 regulates kinase activity and survival of cardiomyocytes. (2004) Circ its stability and cellular localization in H1299 cells. Mol. Res 94,884-91. Cancer Research 5, 909-922. 11. Gude, N., et al. (2006) Akt promotes increased cardi omyocyte cycling and expansion of the cardiac progenitor 30 EXAMPLE 4 cell population. Circ Res 99,381-8. 12. Muraski J., et al. (2007) Pim-1 regulates cardiomyocyte Pim-1 Engineered Cardiac Stem (Progenitor) Cells survival downstream of Akt. Nature Medicine 13, 12, 1467-75. Pim-1 Increases the Proliferation of Cardiac Progenitor 13. Hammerman, P.S., Fox, C.J., Birnbaum, M.J. & Thomp 35 Cells son, C. B. (2005) Pim and Akt oncogenes are independent To evaluate the growth rate of CGW-Pim-wit CPCs (cardiac regulators of hematopoietic cell growth and Survival. progenitor cells), the number of viable cells was determined Blood 105, 4477-83. by trypan blue exclusion over a six day time course (FIG. 14. Fox, C.J., et al. (2003) The serine/threonine kinase Pim-2 17A). At day six CGW-Pim-wit CPCs continued to expand is a transcriptionally regulated apoptotic inhibitor Genes 40 significantly over that of CGW (p<0.05) and non-treated Dev 17, 1841-54. (p<0.001) CPCs. CGW-Pim-wit CPCs also exhibited an 15. Wang, Z. et al. (2001) Pim-1: a serine/threonine kinase increased metabolic rate over CGW CPCs at one (p<0.001) with a role in cell survival, proliferation, differentiation and three days (p<0.001), as determined by MTT assay (FIG. and tumorigenesis. J. Vet Sci 2, 167-79. 17B). A specific Pim-1 activity inhibitor, Quercetagentin, was 16. Bhattacharya, N., et al. (2002) Pim-1 associates with 45 used to confirm that the growth advantage acquired by CGW protein complexes necessary for mitosis Chromosoma Pim-wit CPCs was due to overexpression of Pim-1. When 111, 80-95. added to the culture media, the Pim-1 inhibitor significantly 17. Takizawa, T., et al. (1999) Transcription of the SERCA2 decreased the growth rate of CGW-Pim-wit CPCs at day two gene is decreased in pressure-overloaded hearts: A Study and three (p<0.001) compared to untreated CGW-Pim-wt using in vivo direct gene transfer into living myocardium. 50 CPCs (FIG. 17C). J Mol Cell Cardiol 31, 21.67-74. In summary, FIG. 17 illustrates data showing increased 18. Prasad, A. M., et al. (2007) Phenylephrine hypertrophy, proliferative rate of Pim-1 engineered CSCs: FIG. 17A illus Ca2+-ATPase (SERCA2), and Ca2+ signaling in neonatal trates a cell growth assessment using trypan blue assay of rat cardiac myocytes. Am J Physiol Cell Physiol 292, control, CGW, and CGW-Pim-wt transduced CPCs; FIG. C2269-75. 55 17B illustrates an MTT assay on control, CGW, CGW-Pim 19. Asahi, M., et al. (2004) Cardiac-specific overexpression wt transduced CPCs (meant SEM, n=3); FIG. 17C illustrates of sarcolipin inhibits sarco(endo)plasmic reticulum Ca" the proliferation rate of Pim-1 expressing CPC's treated with ATPase (SERCA2a) activity and impairs cardiac function or without 10 uM of Quercetagentin, a specific Pim-1 activity in mice. Proc Natl AcadSci USA 101, 91.99-204. inhibitor (meanti-SEM, n=3)*p<0.05, **p<0.01, ***p<0.001. 20. Suarez, J., et al. (2004) oxycycline inducible expression 60 Pim-1 Overexpressing CPCs Improve Cardiac Function of SERCA2a improves calcium handling and reverts car Post-Myocardial Infarction diac dysfunction in pressure overload-induced cardiac Previous studies have shown that Pim-1 transgenic mice hypertrophy. Am J Physiol Heart Circ Physiol 287, H2164 elicit a significant resiliency to pathological challenge. To test 72. whether Pim-1 modified CPCs would also confer substantial 21. Kim, Y.K., et al. (2003) Mechanism of Enhanced Cardiac 65 resistance to infarction damage, twelve week old female FVB Function in Mice with Hypertrophy Induced by Overex mice were given a myocardial infarction and intramyocar pressed Akt. J Biol Chem 278, 47622-8. dially injected with CGW or CGW-Pim-wit CPCs surround US 8,617,534 B2 55 56 ing the border Zone (n=15-20/group). Echocardiography and CGW-Pim-wit CPC injected mice over 32 weeks by measurement at two weeks showed mice that received CGW echocardiography and hemodynamic assessment. At 3 days Pim-wit CPCs had a thicker anterior wall dimension (AWD) all groups of mice had decreased FS (FIG. 20A) and EF (FIG. compared to that of saline (p<0.001) and CGW CPC (p<0.01) 20B), and were not statistically different from saline controls. injected mice (FIG. 18A). In order to determine if intramyo As was previously seen, mice that received CGW CPCs had cardial injection of Pim-1 modified CPCs provides long term an initial early improvementatone week with onset of cardiac increased functional improvement after pathological chal failure at six weeks, becoming statistically insignificant to lenge; mice were followed for 12 weeks post infarction. At 6 saline controls by eight weeks. However, mice that received weeks post infarction mice that received CGW-Pim-wit CPCs Pim-1 modified CPCs had an increase inFS and EF at 1 week maintained EF and FS (FIGS. 18B, C), and were statistically 10 that was maintained through 32 weeks (FIGS. 20A, B). improved over CGW CPC injected mice. By 7 weeks, CGW In summary, FIG. 20 graphically illustrates that long term CPCs failed to maintain cardiac function (FS and EF) and cardiac functional recovery is afforded by CGW-Pim-wt were not statistically different than those animals that expressing CPCs 32 weeks after intra-myocardial injection: received saline injections. At 12 weeks, echocardiography FIG.20A-C illustrates electrocardiographic assessment of FS again indicated that CGW-Pim-wit CPC injected animals con 15 (FIG. 20A), EF (FIG. 20B), and AWD (FIG.20C), in sham tinued to maintain EF and FS, whereby animals that received (), PBS injected (O), CGW (A), and CGW-Pim-WT (0) control CPCs had a 2-fold and 1.6-fold decrease, respectively cardiac progenitor cells 32 weeks post CPC transplantation. (FIGS. 18B, C). Hemodynamic measurements of DP (FIG. Echocardiography measurements represent an na7 animals 18D), Ped (FIG. 18E), and changes in tdp/dt (FIG. 18F), for each group. confirmed significant enhanced cardiac function in CGW Exemplary Bicistronic Vectors of the Invention Pim-wit CPC injected mice over CGW CPC and saline Vectors are bicistronic whereby the MND promoter drives injected animals. Pim-1 expression and the reporter, enhanced green florescent In Summary, FIG. 18 graphically illustrates data showing protein (eGFP), is driven off a viral internal ribosomal entry that intra-myocardial injection of Pim-1 expressing CPCs site (VIRES). All constructs are third generation self-inacti improves cardiac function. FIG. 18A-C graphically illus 25 vating (SIN) lentiviral vectors and incorporate several ele trates electrocardiographic assessment of AWD (FIG. 18A), ments to ensure long-term expression of the transgene. The EF (FIG. 18B), and FS (FIG. 18C), in sham (), PBS injected MND (MND, myeloproliferative sarcoma virus LTR-nega (O), CGW (A), and CGW-Pim-WT (0) cardiac progenitor tive control region deleted) promoter allows for high expres cells 12 weeks post CPC transplantation. Echocardiography sion of the transgene, while the LTR allows for long-term measurements represent ne9 animals for each group. FIG. 30 expression after repeated passage. The vectors also include 18D-F graphically illustrates in vivo hemodynamic measure (IFN)-D-scaffold attachment region (SAR) element. The ments of left ventricular developed pressure (LVDP) (18D), SAR element has been shown to be important in keeping the left ventricular end diastolic pressure (LVEDP) (18E), and vector transcriptionally active by inhibiting methylation and dP/dT maximum and minimum (18F) were used to assess protecting the transgene from being silenced. cardiac function 12 weeks post-intramyocardial injection of 35 In order to investigate the potential myocardial benefits of PBS, eGFP, and Pim-1 expressing CPCs (nd5). ANOVA sta long term overexpression of Pim-1 in CPCs, a bicistronic tistical tests were run for echocardiography and in-vivo lentiviral vector was designed to deliver the human Pim-1 hemodynamic measurements, using Tukey's post-hoc test. gene, CGW-Pim-wit, as well as a control vector, CGW (FIG. Results are represented as meant SEM. S1A). Expression of the Pim-1 gene is controlled through a Injection of Pim-1 Modified CPCs Results in a Reduction 40 myeloproliferative sarcoma virus LTR-negative control of Infarct Size region deleted (MND) promoter, while the eGFP reporter is Quantitation of tropomyosin over left ventricular free wall driven off of a viral internal ribosomal entry site (VIRES). area (LVFW) showed mice injected with Pim-1 modified FIG. 21 illustrates an exemplary lentiviral constructs of the CPCs had a significant 2-fold decrease in infarct area invention for e.g., gene expression in cardiac progenitor cells, (p=0.02) (FIG.3B). FIG. 19 graphically illustrates data show 45 e.g., gene expression in c-kit-cardiac progenitor cells ing that CGW-Pim-wit CPCs form myocytes and vasculature (CPCs). The figures illustrates a self-inactivating (SIN) len in infarcted heart tissue reducing infarction area; and shows a tiviral vectors, termed CGW (GFP control) and CGW-Pim quantitation of infarction area 12 weeks post CPC injection. wt; they were designed such that the Pim-1 gene is driven off Results are represented as meant-SEM, n=3 animals, an MND promoter while the eGFP reporter is driven off an *p-0.02. 50 internal ribosomal entry site. Long Term Cardiac Functional Improvement is Only The following sequence is an exemplary lentiviral vector Afforded by Pim-1 Modified CPCs backbone for practicing the invention, e.g., to express PIM-1 In an effort to extend our previous studies we repeated our in a cell, including a human cell, e.g., a stem cell or a cardiac initial experiments and monitored injection of PBS, CGW, or myocyte cell.

(SEQ ID NO : 4) gacggat.cgggagat citc.ccgatc.ccctatogt cact citcagtacaatctgctctgatgcc.gcatagittaa.gc.cagtatctgct coct gcttg tgtgttggaggtogctgagtag tecgcgagcaaaatttalagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgct tagg gttaggcgttittgcgctgct tcgcgatgtacgggc.ca.gatatacgc.gttgacattgattattgactagtt attaat agtaatcaattacggggt ca ttagttcatagoccatatatggagttcc.gcgttacataacttacgg taaatggc.ccgc.ctggctgaccgc.ccaacgaccc.ccgcc cattgac gtcaataatgacg tatgttcc.cat agtaacgc.caatagggactitt C cattgacgt caatgggtggagtatttacggtaaactgcc cacttggca gtacatcaagtgitat catatgccaagtacgc.ccc.ctattgacgt caatgacggtaaatgg.ccc.gc.ctggcattatgcc cagtacatgacctitat

US 8,617,534 B2 75 76 - Continued 1201 acctt cqaag aaatccagaa ccatc catgg atgcaagatgttct cotgcc cc aggaaact 1261 gctgagatcc acctic cacag cctgtc.gc.cg gggcc.ca.gca aatag (SEQ ID NO: 14) 100 a tigctic ct gtc. caagatcaac 121 tocctggcc C acctg.cgc.gc cgc.gc.cctgc aacgacctgc acgccaccala gctggcgc.cg 181 ggcaaagaga aggagcc cct ggagt cqcag taccaggtgg gcc.cgctgtt gggcagcggit 241 ggctt.cggct cqgtctactic tigcatc.cgc gtcgc.cgaca acttgc.cggit ggcc attaag 301 cacgtggaga aggaccggat titc.cgattgg ggagaactgc ccalatggcac cc.gagtgccC 361 atggalagtgg toctgttgaa galaggtgagc ticggactitct cqggcgt cat tag acttctg 421 gactggttcg agaggc.ccga tagtttcgt.g. Ctgat CCtgg agaggc.ccga accggtgcaa. 481 gacct Cttcg acttitat cac Caacgagga gC cct acagg aggacctggc cc gaggattic 541 ttctggCagg tectggaggc cgtgcggcat to caca act gcggggttct coaccg.cgac 6O1 atcaaggacg agaacat citt aatcgacct g agcc.gcgg.cg aaatcaaact catcgacttic 661 ggg.tc.ggggg cqctgct caa ggacacagtic tacacggact ttgatgggaC cc.gagtgtac 721 agt cct c cag agtggatt.cg ctaccatcgc taccacggca gg.tc.ggcagc tigtctggtc.c 781 Cttgggatcc tectictatga catggtctgc ggagatatt C cqtttgagca catgaagag 841 atcatcaagg gccaagtgtt citt caggcaa actgtct citt cagagtgtca gcacct tatt 901 aaatggtgcc tdtcc ct gag accat cagat cqgcc ct cot ttgaagaaat coggaac cat 961 C catggatgc agggtgacct cot.gc.cccag gCagcttctg agat coatct gcacagtctg 1021 to accggggit C cagcaagta g

While the invention is susceptible to various modifications 3s invention is not to be limited to the particular forms or meth and alternative forms, specific examples thereof have been ods disclosed, but to the contrary, the invention is to coverall shown by way of example in the drawings and are herein modifications, equivalents, and alternatives falling within the described in detail. It should be understood, however, that the spirit and scope of the appended claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 3

<21 Os SEQ ID NO 1 &211s LENGTH: 313 212s. TYPE: PRT <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAMEAKEY: DOMAIN <222s. LOCATION: (1) . . . (313) 223 OTHER INFORMATION: human PIM-1

<4 OOs SEQUENCE: 1 Met Lieu Lleu Ser Lys Ile Asn. Ser Lieu Ala His Lieu. Arg Ala Ala Pro 1. 5 1O 15 Cys Asn Asp Lieu. His Ala Thr Llys Lieu Ala Pro Gly Lys Glu Lys Glu 2O 25 3 O Pro Leu Glu Ser Glin Tyr Glin Val Gly Pro Leu Lieu. Gly Ser Gly Gly 35 4 O 45 Phe Gly Ser Val Tyr Ser Gly Ile Arg Val Ser Asp Asn Lieu Pro Val SO 55 60 Ala Ile Llys His Val Glu Lys Asp Arg Ile Ser Asp Trp Gly Glu Lieu. 65 70 7s 8O

Pro Asn Gly Thr Arg Val Pro Met Glu Val Val Lieu. Lieu Lys Llys Val US 8,617,534 B2 77 - Continued

85 90 95 Ser Ser Gly Phe Ser Gly Val Ile Arg Lieu. Lieu. Asp Trp Phe Glu Arg 1OO 105 11 O Pro Asp Ser Phe Val Lieu. Ile Lieu. Glu Arg Pro Glu Pro Val Glin Asp 115 12 O 125 Lieu. Phe Asp Phe Ile Thr Glu Arg Gly Ala Lieu. Glin Glu Glu Lieu Ala 13 O 135 14 O Arg Ser Phe Phe Trp Glin Val Lieu. Glu Ala Val Arg His Cys His Asn 145 150 155 160 Cys Gly Val Lieu. His Arg Asp Ile Lys Asp Glu Asn. Ile Lieu. Ile Asp 1.65 17O 17s Lieu. Asn Arg Gly Glu Lieu Lys Lieu. Ile Asp Phe Gly Ser Gly Ala Lieu. 18O 185 19 O Lieu Lys Asp Thr Val Tyr Thr Asp Phe Asp Gly Thr Arg Val Tyr Ser 195 2OO 2O5 Pro Pro Glu Trp Ile Arg Tyr His Arg Tyr His Gly Arg Ser Ala Ala 21 O 215 22O Val Trp Ser Lieu. Gly Ile Lieu. Lieu. Tyr Asp Met Val Cys Gly Asp Ile 225 23 O 235 24 O Pro Phe Glu. His Asp Glu Glu Ile Ile Arg Gly Glin Val Phe Phe Arg 245 250 255 Glin Arg Val Ser Ser Glu. Cys Glin His Lieu. Ile Arg Trp Cys Lieu Ala 26 O 265 27 O Lieu. Arg Pro Ser Asp Arg Pro Thr Phe Glu Glu Ile Glin Asn His Pro 27s 28O 285 Trp Met Glin Asp Val Lieu. Lieu Pro Glin Glu Thir Ala Glu Ile His Lieu. 29 O 295 3 OO His Ser Leu Ser Pro Gly Pro Ser Lys 3. OS 310

<210s, SEQ ID NO 2 &211s LENGTH: 405 212. TYPE: PRT <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: DOMAIN <222s. LOCATION: (1) . . . (405 <223> OTHER INFORMATION: human pim-1 kinase 44 kDa isoform 22 Os. FEATURE: <221s NAME/KEY: SITE &222s. LOCATION: 214 <223> OTHER INFORMATION: Xaa = any naturally occurring amino acid

<4 OOs, SEQUENCE: 2

Met Pro His Glu Pro His Glu Pro Lieu. Thr Pro Pro Phe Ser Ala Lieu. 1. 5 1O 15 Pro Asp Pro Ala Gly Ala Pro Ser Arg Arg Glin Ser Arg Glin Arg Pro 2O 25 3O Glin Lieu. Ser Ser Asp Ser Pro Ser Ala Phe Arg Ala Ser Arg Ser His 35 4 O 45 Ser Arg Asn Ala Thr Arg Ser His Ser His Ser His Ser Pro Arg His SO 55 6 O Ser Lieu. Arg His Ser Pro Gly Ser Gly Ser Cys Gly Ser Ser Ser Gly 65 70 7s 8O His Arg Pro Cys Ala Asp Ile Lieu. Glu Val Gly Met Lieu. Lieu. Ser Lys 85 90 95 Ile Asin Ser Lieu Ala His Lieu. Arg Ala Ala Pro Cys Asn Asp Lieu. His 1OO 105 11 O US 8,617,534 B2 79 80 - Continued

Ala Thir Lys Lieu Ala Pro Gly Lys Glu Lys Glu Pro Lell Glu Ser Glin 115 12 O 125

Glin Wall Gly Pro Lieu. Lieu. Gly Ser Gly Gly Phe Gly Ser Val Tyr 13 O 135 14 O

Ser Gly Ile Arg Val Ser Asp Asn Lieu Pro Wall Ala Ile His Wall 145 150 155 160

Glu Asp Arg Ile Ser Asp Trp Gly Glu Lieu. Pro Asn Gly Thr Arg 1.65 17O 17s

Wall Pro Met Glu Wal Wall Lieu. Lieu Llys Llys Val Ser Ser Gly Phe Ser 18O 185 19 O

Gly Wall Ile Arg Lieu. Lieu. Asp Trp Phe Glu Arg Pro Asp Ser Phe Wall 195

Lell Ile Luell Glu Arg Xaa Glu Pro Val Glin Asp Lell Phe Asp Phe Ile 21 O 215

Thir Glu Arg Gly Ala Lieu. Glin Glu Glu Lieu. Ala Arg Ser Phe Phe Trp 225 23 O 235 24 O

Glin Wall Luell Glu Ala Val Arg His Cys His Asn Gly Wall Lieu. His 245 250 255

Arg Asp Ile Lys Asp Glu Asn. Ile Lieu. Ile Asp Lell Asn Arg Gly Glu 26 O 265 27 O

Lell Luell Ile Asp Phe Gly Ser Gly Ala Lieu. Lell Lys Asp Thir Wall 28O 285

Thir Asp Phe Asp Gly Thr Arg Val Tyr Ser Pro Pro Glu Trp Ile 29 O 295 3 OO

Arg His Arg Tyr His Gly Arg Ser Ala Ala Wall Trp Ser Lieu. Gly 3. OS 310 315

Ile Luell Luell Tyr Asp Met Val Cys Gly Asp Ile Pro Phe Glu His Asp 3.25 330 335

Glu Glu Ile Ile Arg Gly Glin Val Phe Phe Arg Glin Arg Wall Ser Ser 34 O 345 35. O

Glu Glin His Lieu. Ile Arg Trp Cys Lieu Ala Lell Arg Pro Ser Asp 355 360 365

Arg Pro Thir Phe Glu Glu Ilie Glin Asn His Pro Trp Met Glin Asp Wall 37 O 375

Lell Luell Pro Glin Glu Thir Ala Glu Ile His Lieu. His Ser Luell Ser Pro 385 390 395 4 OO

Gly Pro Ser Llys Lieu 4 OS

SEQ ID NO 3 LENGTH: 26.84 TYPE: DNA ORGANISM: Homo sapiens FEATURE: NAMEAKEY: misc feature LOCATION: (1) . . . (2684) OTHER INFORMATION: human pim-1 kinase message (mRNA) SEQUENCE: 3

CCC9agagga gttcggtggca gcggcggcgg cgggaccggc agcagcagca gcago agcag 6 O cago aaccac tagcct cotg CCC ccggcg Ctgcc.gcacg agc.cccacga gcc.gct cacc 12 O cc.gc.cgttct Cagcgctgcc cgaccc.cgct ggcgc.gc.cct gtc.ccggcag 18O cgcc ct cagt tgtcct coga citcgc cct cq gcc titcc.gcg Ccagcc.gcag ccacagcc.gc 24 O aacgccaccc gcagocacag ccacagocac agc.cccaggc atagoctt.cg gcacago Ccc 3OO

US 8,617,534 B2 83 What is claimed is: 1. A method for treating a cardiac injury in an individual, comprising: introducing into the heart of the individual a population of autologous or allogeneic cardiac progenitor cells that 5 have been engineered to contain an expression vector comprising a heterologous promoter operatively linked to a PIM-1 encoding polynucleotide sequence for over expression of a PIM-1 kinase in the cardiac progenitor cells, wherein the introduced cardiac progenitor cells 10 differentiate into functional cardiomyocytes in the heart in Sufficient numbers to treat said cardiac injury. 2. The method of claim 1, wherein the promoter is an inducible promoter. 3. The method of claim 1, wherein the cardiac progenitor 15 cells are c-kit--cells. 4. The method of claim 1, wherein the cardiac progenitor cells are human cardiac progenitor cells. 5. The method of claim 1, wherein the introduced cardiac progenitor cells provide improved cardiac function in the 20 individual for at least 32 weeks. 6. The method of claim 1, wherein the PIM-1 encoding polynucleotide encodes a human-1. 7. The method of claim 1, wherein the cardiac injury is associated with a myocardial infarction. 25 8. The method of claim 1, wherein the cardiac injury is associated with a congestive heart failure. k k k k k UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 8,617.534 B2 Page 1 of 1 APPLICATIONNO. : 12/742871 DATED : December 31, 2013 INVENTOR(S) : Sussman et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In The Claims

In line 2 of claim 6, delete “human-1 and please insert -- “human PIM-1” --. Claim 6 should read as follows: “The method of claim 1, wherein the PIM-1 encoding polynucleotide encodes a human PIM-1

Signed and Sealed this Fifth Day of April, 2016 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office