Avian Adaptation Along an Aridity Gradient. Physiology, Behavior, And

AVIAN ADAPTATION

ALONG AN ARIDITY GRADIENT

PHYSIOLOGY, BEHAVIOR, AND LIFE HISTORY

B. Irene Tieleman This research was financially supported by Schuurman Schimmel van Outeren Stichting National Wildlife Research Center, Taif, Saudi Arabia Schure Beijerinck Popping Fonds

Lay-out: Heerko Tieleman Figures: Dick Visser Photographs: Irene Tieleman

Avian adaptation along an aridity gradient physiology, behavior, and life history

Proefschrift

ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. F. Zwarts, in het openbaar te verdedigen op dinsdag 10 december 2002 om 13.15 uur

door

Bernadine Irene Tieleman geboren op 15 juni 1973 te Groningen Promotores: Prof. S. Daan Prof. J.B. Williams

Beoordelingscommissie: Prof. W.R. Dawson Prof. R.H. Drent Prof. R.E. Ricklefs Contents

PART I: INTRODUCTION 1. General introduction 11 2. Physiological ecology and behavior of desert birds 19

3. The adjustment of avian metabolic rates and water fluxes to desert 61 environments

PART II: PHYSIOLOGY AND BEHAVIOR OF LARKS ALONG AN ARIDITY GRADIENT 4. Adaptation of metabolism and evaporative water loss along an 89 aridity gradient 5. Phenotypic variation of larks along an aridity gradient: 105 are desert birds more flexible? 6. Physiological adjustments to arid and mesic environments in larks 131 (Alaudidae)

7. Cutaneous and respiratory water loss in larks from arid and 147 mesic environments

8. Energy and water budgets of larks in a life history perspective: 165 is parental effort related to environmental aridity?

PART III: PHYSIOLOGICAL MECHANISMS

9. Flexibility in basal metabolic rate and evaporative water loss 193 among Hoopoe Larks exposed to different environmental temperatures 10. The role of the nasal passages in the water economy of Crested 207 Larks and Desert Larks 11. The role of hyperthermia in the water economy of desert birds 223

12. Physiological responses of Houbara Bustards to high ambient 247 temperatures

PART IV: BEHAVIORAL STRATEGIES

13. Lizard burrows provide thermal refugia for larks in the 267 Arabian Desert 14. Effects of food supplementation on behavioral decisions of 277 Hoopoe Larks in the Arabian Desert: balancing water, energy and thermoregulation

PART V: PHYSIOLOGY, BEHAVIOR, AND LIFE HISTORY: A SYNTHESIS 15. Avian adaptation along an aridity gradient: 299 physiology, behavior, and life history

Nederlandse samenvatting 317 Postscript 329 Publications 337

References 341

Addresses of authors 367

PART I Introduction

CHAPTER 1 General introduction

B. Irene Tieleman FASCINATION The diversity of life has inspired generations of biologists to explore, describe and experiment in an attempt to understand origin, mechanism and function of the living world around us. Early naturalists made careful observations upon which they based the foundation for Biology as a disci- pline, the Theory of Natural Selection (Darwin 1859; Wallace 1858). Their work structured later research that added to the levels of ecosystems and organisms the study of organs, cells and molecules, but still pursued the same questions: What makes up the diversity of life? From where do organisms come? How do they work? Why do they work the way they do? Modern biologists face the extra challenge of integrating the knowledge of the diverse levels of study, from ecosystems to molecules. More than ever it appears that the more we discover, the more questions remain. In pursuit of some answers I have had the opportunity to travel and work in remote areas where I encountered exceptional species, experienced amazing habitats and learned about different cul- tures, but also to marvel at nature close to home. What a privilege and a joy to be part of this search for knowledge.

FASCINATION Incentive for this thesis This thesis was inspired by my interest in the causation and function of the variation in physiology, behavior and life history of birds in relation to environmental conditions. The large diversity in physiological parameters, behavioral strategies and demographic variables found among endotherms of similar size has puzzled many biologists. Yet, few comprehensive studies exist that explore these three components in a single system. Traditional life history theory focuses on demographic parameters, such as growth, reproduction and survival, that optimize the match between organism and environment (Stearns 1992; Roff 1993). Studying the physiological and behavioral mechanisms that constitute adaptations to the environment may well provide insights into the evolutionary forces and constraints that underlie variation in these traditional life history parameters. In this thesis I treat physiological and behavioral traits that give insights into how phenotypes are designed for reproduction and survival in specific environments as additional important attributes of life history. I hope that this approach further advances our understanding of the connections between physiology, behavior and demography in the context of environmental conditions.

Deserts and birds Biologists have long been aware that organisms living in extreme environments provide good examples of evolutionary adaptation (Bartholomew 1986). With scant rainfall, low primary productivity and high ambient temperatures, arid environments combine extreme thermal conditions with a low availability of food and water for their inhabitants. Especially for birds, with their high mass- specific energy and water requirements, occupying deserts may require substantial adjustments in energy and water balance (Dawson 1984; Williams 1996). Because energy and water are potential currencies that underlie life history trade- offs, such adjustments may have far-reaching implications for reproduction and survival of birds in deserts. Chapter 2 provides an introduction to the deserts of the world and a general review of the physiological and behavioral adjustments used by desert birds to survive in their environment. This chapter summarizes the literature up to 1998, questions previous studies that suggest that birds have not evolved physiological specializations for desert life, and presents hypotheses to be tested. Chapter 3 collates literature data to specifically compare the energy and water balance of desert and non-desert birds, in the field and in the laboratory.

A comparative approach INTRODUCTION The comparative method is a powerful tool that establishes correlations among phenotypic traits and between phenotypes and environments to develop and test GENERAL hypotheses about ecological and evolutionary processes (Harvey & Pagel 1991; 13 Schmidt-Nielsen 1997). Comparative studies of desert versus non-desert birds have encountered a number of problems that may have obscured useful biological information. First, species have been categorized as desert or non-desert, whereas in reality natural environments form a continuum that depends on the interaction of meteorological and geographical factors, including temperature, amount and timing of rainfall, latitude, altitude, and continentality. Second, comparative work typically includes a large variety of species and has the inherent interpretational problem that species differ not only in habitat, but also in phylogenetic background, diet and behavior. Third, comparisons among species from different studies may be complicated by the use of a variety of methods to measure different physiological and behavioral characters at diverse times of the year. Restricting comparative analyses to a single clade of closely related species occurring in different habitats along an environmental continuum provides the opportunity for a detailed examination of adaptation of physiology, behavior, and life history. Such an approach potentially limits complications due to markedly different evolutionary history, dissimilar current life styles or varying methodo- logical techniques.

Larks along an aridity gradient: a study model My study model comprised a number of species of larks that occur in habitats along an aridity gradient. The family of larks (Alaudidae) is one of few avian families that has representatives living in environments ranging from hyperarid deserts, through arid, semi-arid and mesic areas, to even arctic habitats (Cramp 1988; Pätzold 1994). Environmental aridity is directly related to primary productivity (Emberger 1955) and provides a proxy for the selection pressures that animals experience with increasing aridity, including decreasing water and food availability and increasing temperatures. Because all larks are ground-foraging and ground-nesting birds that eat similar foods, a mixture of seeds and insects, diet and behavior do not confound comparisons of physiogical, behavioral and demographic traits among species (McNab 1988). The lark family has a number of additional characteristics that make it an attractive study model. First, all species are active during the day and lend themselves to behavioral observations. Second, larks readily adjust to captivity and are therefore suitable for laboratory studies. Third, larks can be captured and recaptured in the field enabling repeated measurements on the same individual as required by techniques such as the doubly labeled water method. Fourth, we have constructed a phylogeny of the lark family and can take into account phylogenetic relationships in analyses when appropriate (Chapter 4). Finally, most species are year-round residents or short-distance migrants and therefore live within a single characteristic geographical area. 14 Patterns in physiology and behavior of larks Part II contains a series of comparative studies that explore the variation in the physiological and behavioral performance among and within species and individuals of larks from different environments in the laboratory and in the field. Chapter 4 presents a study to test the hypothesis that lower levels of basal metabolic rate (BMR) and total evaporative water loss (TEWL) in larks are correlated with increasing aridity. Along with several other investigators, I construct a phylogeny of larks based on two mitochondrial genes and investigate if evolutionary history can explain the present-day variation in BMR and TEWL along an aridity gradient. The physiological variation among larks along an aridity gradient could result from genetic adaptation to the environment by natural selection or from phenotypically plastic adjustments by acclimatization. Chapter 5 explores whether the interspecific differences in physiology among larks can be attributed to acclimation to temperature. In addition, this chapter investigates the hypothesis that in deserts, where the selection pressures on the energy and water balance might be stronger and the temporal heterogeneity of the environment larger, birds show less interindividual variation and more intra-individual flexibility in their physiology than do species from moderate climates. An overview of the physiological performance over a range of environmental conditions, with an emphasis on high temperatures, of larks from the extremes of the aridity gradient is given in chapter 6. Chapter 7 discusses the roles of cutaneous and respiratory water loss in reducing TEWL at moderate ambient temperatures in desert larks compared with mesic species, and in maximizing the potential for evaporative cooling when birds are heat stressed. It also investigates the intra- individual phenotypic flexibility of these avenues of evaporative water loss for four species in response to acclimation to different climates. The final chapter of part II, chapter 8, integrates the laboratory physiology of the previous chapters with data on the energy and water balance of a number of larks in the field during the reproductive season. A combination of information about parental effort, brood size, nestling energy and water budgets, and nestling growth rates enables establishment of energy and water budgets for complete families. This integrative approach provides fuel for a discussion of behavioral, physiological and environmental constraints on annual reproductive efforts in light of life history theory.

Physiological mechanisms Identifying the physiological mechanisms that determine the performance of phenotypes in diverse environments could provide insights into selection pressures and evolutionary constraints. In part III I examine a number of physiologi- INTRODUCTION cal mechanisms and explore which of these are responsible for the variation in

whole-organism traits among species and individuals from different environ- GENERAL 15 ments. Chapter 9, in combination with chapter 5, explores if the reduced BMR and TEWL in desert species can be explained by phenotypically plastic adjustments of these traits to low thermoregulatory requirements, and if phenotypic plasticity itself varies with environment. These chapters investigate if the sizes of internal organs provide a mechanistic explanation for the variation in BMR between and within species. The subsequent three chapters examine the quantitative contributions of three mechanisms that have been proposed to reduce TEWL in desert birds. Chapter 10 describes an experiment to measure the water saving effect of counter-current heat exchange in the nasal passages at a variety of temperatures in two species of larks. Chapter 11 models the effect of hyperthermia, an increase in body temperature, on components of the water balance of birds that vary in body size. Predictions based on this chapter are evaluated in chapter 6 for lark-sized birds, and in chapter 12 for a large desert bird, the Houbara Bustard.

Behavioral strategies How behavioral strategies of desert birds point to environmental and physiological constraints is the topic of part IV. Chapter 13 describes a study of the microsites selected by larks in the Arabian Desert to ameliorate the thermal environment during the hot summers. To investigate how time budgets of desert birds are affected by the thermal environment and by low availabilities of water and food, chapter 14 reports results of a food supplementation experiment on Hoopoe Larks. These birds optimized time spent on foraging and thermoregulation based on a combination of physiological state variables, indicating the presence of both environmental and physiological constraints on the behavior of desert birds.

Physiology, behavior and life history: a synthesis Part V presents an integrative perspective of avian adaptation along an aridity gradient and discusses physiology and behavior in the context of life history variation. In chapter 15 I point out links between physiological adaptations, behavioral strategies, and demographic parameters, such as reproduction and survival, in light of environmental and ecological constraints. In addition, I indicate some directions for future work: Although this thesis is an end product that marks the completion of four years of research, it is also a way station that shows how far along we are on our road of discovery.

16 INTRODUCTION GENERAL

CHAPTER 2 Physiological ecology and behavior of desert birds

Joseph B. Williams and B. Irene Tieleman Current Ornithology. Volume 16. Edited by V. Nolan Jr. and C. F. Thompson. Kluwer Academics/Plenum Publishers, New York. Pp. 299-353. 2001. ABSTRACT We have reviewed the current literature on the physiology and behavior of desert birds. A central theme has been to examine the hypothesis that desert birds do not possess unique physiological adaptations to their environment. This time- honored view was originally formulated from studies of species from the semi-arid deserts of North America, which are probably 15,000 years old. Since this view was promulgated nearly three decades ago, research on the ecological physiology of desert birds has progressed slowly, in part because fewer investigators are actively working in this arena. We hope that our synthesis of the work that has appeared in the last two decades raises questions about the validity of this hypothesis. Using traditional least squares regression analysis and regressions that employ phylogenetically independent contrasts, we have forged new hypotheses that suggest that some desert birds may have evolved physiological mechanisms that promote low basal metabolic rates, low field metabolic rates, and low rates of evaporative water loss. We hope that our views will stimulate colleagues to think about questions involving the evolutionary and ecological physiology of desert birds, and that challenges to the ideas in this review will contribute to a resurgence of effort in this area of physiological ecology.

ABSTRACT Introduction Two major evolutionary events that shaped current vertebrate life forms were the transition from water to land during the Carboniferous and the development of endothermy during the Triassic (Freeman and Herron 1998). As a result of the former, nascent terrestrial animals experienced new ecological opportunities, while at the same time they confronted new physiological challenges such as maintaining an aqueous internal milieu in a desiccating environment (Gordon and Olson 1995). With the advent of endothermy, land animals presumably increased their fitness, but their need for energy also rose by as much as an order of magnitude compared to their ectothermic ancestors (Bennett and Dawson 1976; Bartholomew 1982). Endothermy also exacerbated problems of water loss because high rates of metabolism were associated with elevated respiratory water loss as well as increased water loss via urine and feces.

With low rainfall, low humidity, and high ambient temperatures (Ta), arid environments represent an extreme departure from the aqueous milieu in which vertebrate ancestors once lived. Because deserts differ markedly in climate, and because species living in them are exposed to unique combinations of environmental parameters, the practice of collectively placing all species that reside in these regions under the rubric “desert” limits the resolving power of comparative methods. In this review we use the term desert in the broadest sense to include all arid lands, but we also emphasize the dissimilarity of desert environments by categorizing them as semi-arid, arid, or hyperarid (Meigs 1953). Despite the desirability of making this distinction among desert environments, a paucity of data has forced us in many of our analyses to classify species as desert or non- desert. We hope that future reviews will not be shackled by this impediment. Birds that occupy arid environments face acute problems of energy and water balance because of their high mass-specific water and energy requirements. A lack of rain and consequent low primary productivity means that most deserts

provide scant food resources and little to no drinking water. Thus, only a few spe- BIRDS cies of birds have evolved the capability to occupy desert environments, and the T

ones that do should possess a number of adaptations that permit existence in DESER such extreme environments. Yet, numerous species of birds reside in deserts, OF some during favorable periods, other permanently as residents. VIOR

Physiological ecologists have long been aware that organisms living in extreme BEHA

environments are likely to provide examples of evolutionary adaptation AND (Bartholomew 1986). However, despite the fact that desert environments are

among the most extreme on earth, the current paradigm holds that desert birds ECOLOGY lack unique structural or physiological adaptations for contending with heat and aridity (Maclean 1996). Bartholomew and Cade (1963) first promulgated this view by saying “any bird which can satisfy its other habitat requirements in the desert is a candidate for establishment there because it is likely to be as effective PHYSIOLOGICAL 21 physiologically as most birds already occupying this environment”. Maclean (1996) espoused the same perspective: “what seems to be adaptive in birds to the desert environment is in fact intrinsic to the avian condition”. This chapter is a general review of the physiological mechanisms and behaviors used by desert birds to survive in their environment. A central motif in our work is to question some current thinking about whether birds in deserts have or have not evolved physiological specializations that permit them to occupy desert environments. We develop our ideas around a tripartite conceptual model based on mechanisms that influence energy balance, water balance, and thermoregulation (Figure 1). First, we explore how energy expenditure may differ in desert birds and ask whether basal metabolism and field metabolism are reduced in desert birds. Second, we examine ways in which desert birds might cope without drinking water and ask whether they have evolved mechanisms that promote fluid homeostasis with reduced water intake. Third, because some deserts have the highest environmental temperatures on earth, we investigate behavioral and physiological mechanisms employed by desert birds to maintain their body temperatures below lethal limits. Finally, we emphasize how linkages among energy, water, and thermoregulation function in concert to allow birds to live in deserts.

Comparative Methods Physiological ecologists seek to understand how organisms function in their

Figure 1. A conceptual model relating energy, water, and thermoregulation in desert birds.

22 natural environment (Prosser 1986) and to acquire insights into the evolutionary forces, both past and present, that are responsible for the success of present day phenotypes (Calow 1987; Bennett and Huey 1990). Allometry, the consequences of body size on function in organisms, has been a useful tool in many ecological, physiological, and evolutionary research programs (Calder 1984; Schmidt- Nielsen 1984a; Bradshaw 1986; Randall et al. 1997). Recently the use of traditional least-squares regression (LSR) in comparative analyses has been challenged on the ground that species can not be considered as statistically independent from each other because of their common evolutionary decent (Pagel and Harvey 1988; Garland and Carter 1994). In effect, phylogenetic non-independence reduces the degrees of freedom permitted in hypothesis testing and affects parameter estimation in statistical analyses (Grafen 1989; Martins and Garland 1991). To circumvent this problem, Felsenstein (1985a) designed a method using phylogenetic independent contrasts (PIC) for phenotypic traits that exhibit continuous variation; this method emerged as an often used technique that ostensibly eliminates phylogenetic heritage in analyses (Martins and Garland 1991; Garland and Carter 1994). Because the incorporation of phylogenetic information into questions about evolutionary physiology is in its infancy, it comes as no surprise that disagreement exists concerning the use of techniques that purportedly eliminate historical bias (Miles and Dunham 1993; Westoby et al. 1995; Ricklefs and Starck 1996; Björklund 1997). In truth, no matter whether LSR or PIC is used, problems exist that hinder interpretations. Traditional LSR assumes instantaneous speciation of the taxa being studied, i.e., a star phylogeny (Garland et al. 1992). Few biologists would support the view that a star phylogeny accurately represents past evolutionary history. In contrast, PIC assumes a stochastic model of evolutionary change, that of Brownian motion, which is a questionable assumption. Further, PIC assumes that a phylogeny and its associated branch lengths are known; the

actual evolutionary descent of birds will likely never be completely resolved. In BIRDS using the PIC method, we have employed the phylogenetic tapestry of Sibley T

and Ahlquist (1990), a hypothesis based on DNA-DNA hybridization. When DESER phylogenetic trees of avian descendancy are constructed using morphological OF characters, or combinations of morphological characters and molecular eviden- VIOR

ce, the resulting relationships among taxa differ markedly from the Sibley and BEHA

Ahlquist tree (J. L. Cracraft, pers. comm.). When trait means are subtracted from AND each other as in the PIC method, error variances are additive with the result that

the confidence one has in the estimation of slope and intercept values is wea- ECOLOGY kened (Ricklefs and Starck 1996). Finally, in some situations contrasts may eliminate variation attributable to natural selection (Westoby et al. 1995; Starck 1998). It is this latter variation that we are attempting to identify in this review.

Because of these problems, we employ the conservative strategy of using both PHYSIOLOGICAL 23 conventional LSR and regressions based on PIC in our quest to understand the evolutionary physiology of desert birds.

Deserts of the world Definitions Definitions of deserts abound, varying according to the author’s expertise and/or purpose of enquiry, though regions delimited as deserts broadly overlap regardless of which method is used to describe them (Köppen 1931; Shantz 1956; McGinnies 1979; Shmida 1985; Thomas 1997). Noy-Meir (1973) described deserts as “water-controlled ecosystems with unpredictable rainfall”, whereas El- Baz (1983) suggested that any region receiving less than 250 mm of rain per year qualified as a desert. Some authors have characterized deserts by ascribing boundaries from criteria based solely on precipitation (Noy-Meir 1973; Grove 1977; Shmida 1985). Hunt (1983) considered semi-arid, arid, and hyperarid deserts as regions with an annual rainfall of 254-508 mm, 127-254 mm, and <127 mm, respectively, but conceded that boundaries of deserts as delimited by moisture

shifted depending on such variables as Ta and seasonality of rainfall. We adopt the classification system of Meigs (1953), who categorized deserts along a continuum from semi-arid, to arid, to hyperarid. Meigs based his system on

Thornthwaite’s (1948) index of moisture availability (Im), a complex parameter

incorporating rainfall, maximum air temperature (Ta) of the hottest month, and

minimum Ta of the coldest month. When evapotranspiration exceeds moisture

availability, as it does in deserts, Im obtains a negative value. In the Meigs’ scheme,

the Im of semi-arid, arid, and hyperarid regions is -20 to -40, -41 to -57, and < -57, respectively. In addition, Meigs characterized as hyperarid only if there was one documented occurrence of at least 12 consecutive months without rain.

Causes of aridity Arid conditions occur when evapotranspiration from the earth’s surface exceeds water influx, a situation attributable to one or a combination of four factors: high pressure zones, continentality, rain shadows, and cold ocean currents (Bender 1982; Evenari 1985; Allan and Warren 1993; Thomas 1997). Most deserts lie between 20° - 30° N and S latitude, in or near the sub-tropical zone, along a belt of high pressure created by descending air masses below the sub-tropical jet stream (Smith 1984). Near the equator, air is heated by a combination of intense solar radiation and latent heat of condensation released into the atmosphere by cloud formation. The heated air rises to the troposphere, where it begins to move towards the poles in both hemispheres. Upon reaching the subtropical zone, these large air masses descend, producing a belt of high pressure at the earth’s surface. High pressure coupled with low relative humidity attributable to the warming of the descending air mass, produces conditions unfavorable for cloud

24 formation. The Sahara in northern Africa, the Namib in southern Africa, the Arabian of the Middle East, the Atacama of South America, and the deserts of Australia all lie juxtaposed to the Tropic of Cancer (23°30' N) or the Tropic of Capricorn (23°30' S), within the sub-tropical zone (Figure 2). Some arid regions are formed or their aridity is intensified because they are located in the interior of large continents far from sources of water. The Taklamakan desert of Western China and the Gobi Desert of China and Mongolia are examples of deserts affected by continentality (Chao and Xing 1982). When air masses that move across continents are forced to rise over mountains, air cools, moisture condenses forming clouds, and orographic rain falls. As the moisture-depleted air descends down the lee side of the mountains, it warms and expands, resulting in a further diminution in relative humidity. Beyond the mountains, dry winds extract moisture from the soils, enhancing the “rainsha- dow” effect. The semi-arid Great Basin in North America, situated on the lee side of the Sierra Nevada and Cascade mountain ranges, and the Kalahari in South Africa and Botswana, on the lee side of the Drakensberg mountains, owe their existence largely to this process (Grayson 1993; Werger 1986). Cold ocean currents that move from Antarctica towards the equator travel along the western coasts of South America and Africa, where they cool the air layer above sea and on adjacent land and effectively inhibit the penetration of warm, moist air that potentially could bring rain (Meigs 1966; Walter 1986; Lancaster 1989). Some of the driest regions on earth, such as the Atacama (influenced by the Peru or Humbolt Current) and the Namib (influenced by the Benguela Current), occur along the western coast of continents (Figure 2). BIRDS T DESER OF VIOR BEHA AND ECOLOGY

Figure 2. Semi-arid (light grey), arid (grey), and hyperarid (black) regions of the world, based PHYSIOLOGICAL on Meigs (1953). 25 Extant Deserts of the world Of the approximately 149 million km2 of land surface on earth, deserts (semi- arid, arid, and hyperarid) cover 52.9 million km2, 36.3% of the total (Meigs 1953; Thomas 1997; Figure 2). Though all the regions highlighted in Figure 2 fall under the rubric “desert”, they differ markedly in total area, temperature regime, soils, and degree of aridity, factors of importance to birds because of their influence on food resources, water availability, and thermoregulatory demands (Thornthwaite 1948; Bender 1982; Allan and Warren 1993). The earth’s largest desert, the Sahara in northern Africa, occupies 9 million km2, an expanse of land equivalent to the entire area of the continental United States. Consisting of a hyperarid core circumscribed by semi-arid and arid areas, the Sahara subsumes smaller deserts in eastern Africa, the Nubian Desert of Sudan, the Ogaden Desert of Ethiopia and Somalia, and the Chalbi and Didi Galgala Deserts of Kenya (Smith 1984; Allan and Warren 1993; Thomas 1997). Birds residing in inland subtropical deserts, such as the central Sahara, the Rub’ Al Khali of Saudi Arabia, and the Australian deserts, must contend not only

with the highest Tas on earth, sometimes > 50 °C (Cloudsley-Thompson 1984; Evenari 1985; Williams and Calaby 1985), but also must endure repeated exposure to these daily extremes, sometimes for several consecutive months (Nuttonson 1958). Some species can not thermoregulate adequately at these

extreme Tas and suffer significant mortality when they occur (Serventy 1971; Howell et al. 1974; Rauh 1985). Birds that live in cool, coastal deserts like the Atacama and the Namib are less likely to encounter such extremes of heat. Major areas of sand accumulation, known as sand seas, lie in the old world deserts, the Sahara, the deserts of central Asia, Australia, and the Namib of southern Africa (Lancaster 1989). Birds living in these areas rarely have access to drinking water because rainwater quickly penetrates sand. Further, blowing sand may cover food items, making foraging more problematic. Differences in aridity affect not only the availability of drinking water but also primary productivity, an indirect correlate of food supply for birds (Noy-Meir 1973; Louw and Seely 1982; Walter 1986). Regions with extremely low primary production, such as the hyperarid regions of the world, include the central Sahara, Rub’Al Khali, Taklamakan, Death Valley and portions of the Sonoran Desert (Figure 2). Some coastal deserts like the Atacama, Namib, portions of the Sonoran in Baja California, and sections of the Sahara close to the Atlantic ocean, despite their hyperarid status, receive moisture in the form of advective fog (Meigs 1966; Rauh 1985; Lancaster 1989). When fog occurs, droplets of water develop on vegetation and provide a temporary source of water for the fauna (Seely 1978). Although absolute quantities are difficult to measure, estimates of fog precipitation in the Namib range from 30 mm to 150 mm per year (Lancaster et al. 1984). 26 At Gobabeb, a research station in the central Namib about 50 km from the coast, fog occurs 1-4 days per month (Lancaster et al. 1984). The Namib and other deserts near the ocean experience modest temperature fluctuations; mean daily temperature at Gobabeb varies only 6-8 °C between summer and winter, and the absolute maximum Ta rarely exceeds 40 °C.

Avian Evolution To gain an appreciation of the patterns and processes of adaptations of modern- day birds to arid ecosystems, we need information about the time course of avian evolution, about which taxa have evolved in deserts, and about the types of paleoclimates that created part, at least, of the backdrop of selective pressures ultimately responsible for the behavioral and physiological strategies that we observe today. Unfortunately, the fossil record has remained silent with respect to which groups of birds lived in desert ecosystems in the past. The general plan of avian architecture, embodied by the signature fossil of avian evolution, Archeopteryx, was formed by the mid-Jurassic period, 150 million years before present (BP) (Feduccia 1996). Fossil discoveries from China and Spain indicate that by the early Cretaceous period primitive birds were widely distributed with many distinct forms. Most belonged to the Enantiornithae, or “opposite” birds, named for the unique pattern of fusion of the metatarsal bones, proximal to distal, opposite to that of modern-day forms (Walker 1981; Hou and Zang 1993). At the end of the Cretaceous, 65 million years BP, an extinction event occurred which eliminated entire assemblages of vertebrates including dinosaurs and all Enantiornithine birds (Alvarez 1987; Chiappe 1995; Feduccia 1996). Surviving species of birds, all members of the subclass Ornithurae, likely succeeded because of their ability to live on scant and unpredictable resources, perhaps seeds, or invertebrates that lived on detritus (Janzen 1995). The early Tertiary period witnessed rapid diversification of avian species in a period of 5-10 million years, during which almost all orders of birds except for the passerines evolved BIRDS

(Daniels 1994). By the end of the Eocene, birds occupied all major ecosystems of T the world. During the mid-Tertiary another radiation occurred, during which DESER

species of the order Passeriformes appeared (Feduccia 1996). Hence, all modern OF orders of birds evolved during two radiation events, one in the early Tertiary, the VIOR other in the mid-Tertiary. BEHA

Paleodeserts AND Information about the existence of deserts during the Tertiary, when modern birds diversified, is beyond the purview of this paper. For a general discussion of ECOLOGY the locations of paleodeserts, the reader should consult Van Devender and Spaulding (1983), Dragàn and Airinei (1989), Zubakov and Borzenkova (1990), and Frakes et al. (1992). However, we point out that deserts have been a part of PHYSIOLOGICAL the landscape on earth for millions of years and that the Old World deserts are 27 geologically much older than those of the New World. As a result, one might expect that species that reside in these Old World deserts would have finely tuned physiological specializations to their environment. For example, the deserts of northern Africa, the Middle East, and the Arabian Peninsula originated during the Miocene (25 million years BP), when a decline in global temperatures reduced evaporation from tropical oceans and strengthened the high pressure zones in subtropical latitudes. These regions harbored arid to semi-arid landscapes for over 20 million years (Miocene to Pliocene), although boundaries apparently shifted several times during the Tertiary (Frakes 1979; Gerson 1982). Most agree that by the late Miocene (10 million years BP) arid conditions pre- vailed throughout southern Africa (Namibia, Botswana, and South Africa) in what is now the Namib and Kalahari deserts (Kennett 1980; Jones 1982). In marked contrast to Old World deserts, the deserts of western North America, now composed of the relatively cold Great Basin and of three warmer deserts, the Mojave, Sonoran, and Chihuahuan, appeared less than 11,000 years ago (Axelrod 1983; Van Devender and Spaulding 1983; Mead 1987). During the early Tertiary a variety of forest types covered much of western North America, but in the late Tertiary precipitation began to diminish, with the result that savannah grassland and thorn-scrub assemblages dominated low-lying basins by the Pliocene (Axelrod 1983). Until about 10,000 years ago, piñon pine-juniper woodlands occurred over much of the area that is now semi-arid desert in the southwestern United States (Wells et al. 1982).

Energy With their high rates of mass-specific metabolism and their existence in environments with low primary productivity, desert birds face the challenge of meeting daily energy requirements. Several authors have suggested that desert-dwelling birds have evolved mechanisms that reduce their energy expenditure as a means of coping with low food availability (Dawson and Bennett 1973; Schleucher et al. 1991). Scarcity of water in deserts may be another selective pressure that favors low rates of metabolism, because the resultant low endogenous heat production may reduce water requirements for evaporative cooling (Figure 1; Dawson 1984).

Basal metabolic rate Physiological mechanisms that reduce the energy expenditure of free-living birds are likely to be mirrored in a lower basal metabolic rate (BMR), as measured in the darkened laboratory on inactive, post-absorptive birds at thermally neutral temperatures during the rest-phase of their circadian cycle (Aschoff and Pohl 1970; King 1974). Several authors have suggested that desert birds have a redu-

28 ced BMR (Dawson and Bennett 1973; Weathers 1979; Arad and Marder 1982; Withers and Williams 1990; Schleucher et al. 1991), but a formal comparative analysis was performed only recently (Tieleman and Williams 2000). These authors used traditional LSR and regressions employing PIC on 21 arid and 61 mesic species from a wide range of geographic origins. They found that desert birds have a BMR about 17% less than that of non-desert species (Figure 3). ANCOVA disclosed that the slopes of the least squares regression equations for desert and non-desert species were not significantly different (F1, 78 = 0.247, P = 0.62), but that the intercepts differed (F1, 79 = 9.534, P = 0.003). The relationship between BMR and body mass for birds from mesic habitats is log BMR (kJ/d) = 0.584 + 0.644 log mass (g) and for birds from arid areas is log BMR (kJ/d) = 0.505 + 0.644 log mass (g). The second approach consisted of calculating PICs (Felsenstein 1985a) and performing a stepwise multiple regression of the standardized contrasts for log BMR as the dependent variable and log body mass and environment as the independent variables (Williams 1996). Results confirmed that birds from arid environments had a reduced BMR compared to their mesic counterparts. The equation for BMR of desert birds generated from PICs was log BMR = 0.304 + 0.702 log mass (g). BIRDS T DESER OF VIOR BEHA AND ECOLOGY

Figure 3. Basal metabolic rate (BMR) as a function of body mass in desert and non-desert spe- PHYSIOLOGICAL cies. PIC = phylogenetic independent contrasts. 29 The physiological mechanisms responsible for a diminution in BMR of desert birds are unknown, but may involve a reduction in the amount of metabolically active tissue and/or lower rates of metabolism per unit tissue mass (Daan et al. 1990). The first alternative might be reflected in the size of organs such as the heart, liver, and kidneys, which have been shown to contribute disproportionately to BMR compared to other tissues (Daan et al. 1990; Konarzewski and Diamond 1995; Piersma et al. 1996; Kersten et al. 1998). The second explanation, tissues with lower metabolic intensity, might result from differences at the cellular level, including reduced thyroxine secretion rate (Yousef and Johnson 1975; Scott et al. 1976; Merkt and Taylor 1994), fewer Na+-K+-pumps, or lower mitochondrial density (Rolfe and Brown 1997). We emphasize that the relationships between structural design features such as organ sizes or tissue traits, physiological functions like metabolism, and charac-

teristics of the desert environment such as high Tas or aridity are unresolved. We do not know whether alterations in BMR are a phenotypic response to thermoregulatory demand, or whether they reflect modifications adapted to the environment (Dawson and O’Connor 1996). However, Hudson and Kimzey (1966) found that House Sparrows (Passer domesticus) from Houston, Texas, had a significantly lower BMR than did individuals from more northerly latitudes. They attributed this reduction in BMR to an adaptive modification for living in a hot environment. Efforts to induce an increase in BMR by prolonged exposure to low

Tas in the laboratory were unsuccessful, indicating that a diminution in BMR in this population may have been genetically programmed. Although Tieleman and Williams have found a correlation between a reduction in BMR and living in a desert environment, not all desert birds conform to this pattern. The Dune Lark (Mirafra erythrochlamys), the only species that resides in the Namib sand sea, one of the driest regions on earth, does not show a reduced BMR, at least during the austral winter (Williams 1999). Williams hypothesized that the BMR of Dune Larks is relatively high because of their thermoregulato-

ry requirements, a result of a high lower critical temperature (Tlc = 27.9 °C) and

cool nighttime Tas. High thermoregulatory demands may necessitate maintenance of metabolic machinery for chemical heat production, which in turn may elevate BMR.

Field metabolic rate The finding of a reduced BMR in desert birds in the laboratory gains further evolutionary significance if it translates to a lower overall energy expenditure in the field, thereby reducing energy and water requirements in the wild. Nagy (1987) reported that the field metabolic rate (FMR) of four species of desert birds was 50% lower than that of non-desert species. Recently, Tieleman and Williams (2000) used a larger data set to reevaluate the hypothesis that desert birds have 30 a low FMR when compared to non-desert forms (Figure 4). They generated equations using LSR for FMR of birds in each habitat category and performed an

ANCOVA. The slopes of these two equations were not significantly different (F1,

77 = 1.7, P < 0.20), but the intercept was significantly lower (F1, 78 = 49.6, P < 0.001). The relationship between FMR and body mass (n = 66) for non-desert birds was described by log FMR (kJ/d) = 1.035 + 0.704 log mass (g) and for desert species (n = 15) by log FMR (kJ/d) = 0.741 + 0.704 log mass (g). The FMR of desert species was 49% lower than that of non-desert species. Tieleman and Williams (2000) also calculated regression equations using PICs. They performed a stepwise multiple regression forced through the origin, with log FMR as the dependent variable and standardized contrasts of log body mass and environment as independent variables. Results confirmed the finding that FMRs of desert birds are lower than those of their non-desert counterparts (t = 2.11, P < 0.04). The equation for desert birds, generated by this method, was log FMR (kJ/d) = 0.719 + 0.691 log mass (g). BIRDS T DESER OF VIOR BEHA

Figure 4. Field metabolic rate (FMR) as a function of body mass in desert and non-desert spe- AND cies. PIC = phylogenetic independent contrasts. ECOLOGY PHYSIOLOGICAL

31 Water The hot conditions in many deserts, coupled with the scarcity of drinking water, create the potential for physiological problems associated with inadequate hydration. These problems might be especially acute for birds, which have the highest mass-specific water loss rates of all terrestrial vertebrates. Selection pressures to minimize water loss through excretion and evaporation may be counterbalanced by short-term needs for effective evaporative cooling to prevent overheating during episodes of heat stress (Figure 1). Therefore it is appropriate to inquire whether desert species possess special mechanisms that minimize water loss in the long run but that, when necessary, enable efficient cooling during short bouts.

Water deprivation For birds in deserts, the “struggle for existence” includes the task of maintaining an adequate state of hydration, a necessary requisite for the manifold chemical reactions that occur in living organisms. Many desert species rely on a combination of metabolic water formed during catabolism of energy substrates and on preformed water in their diet to supply their entire water requirements. In the laboratory when supplied with dry foods, most birds die within a few days unless drinking water is provided (Bartholomew 1972). However, more than a dozen species have been identified that at moderate temperatures can survive indefinitely in the laboratory solely on a diet of air-dried seeds (< 15% water) (Bartholomew 1972; Dawson et al. 1979; Maclean 1996). This group includes parrots from Australia, larks and finches from Africa, and sparrows from the New World. With the exception of the salt marsh Savannah Sparrow (Passerculus sandwichensis), all of them live in arid or semi-arid habitats, suggesting that these environments may have selected for occupants that use water efficiently.

Many desert birds go through periods of water deprivation, when high Tas and intense solar radiation force them to seek shade (Williams et al. 1995), when strong winds and blowing sand prevent foraging, or when sources of water are located far from feeding areas (Heim de Balsac 1936, Dawson 1976). In such circumstances these animals continue to lose water through evaporation, egestion, and excretion. The loss of this fluid is accompanied by a loss of solids, both con- tributing to a substantial reduction in body mass. Tolerance of mass loss during dehydration ranges widely, from less than 30% of initial mass in House Finches (Carpodacus mexicanus; Bartholomew and Cade 1956), 35% in Brewer’s Sparrows (Spizella breweri; Dawson et al. 1979), 37% in Mourning Doves (Zenaida macroura; Bartholomew and MacMillen 1960), to almost 50% in California Quail (Callipepla californica; Bartholomew and MacMillen 1961). For Brewer’s Sparrows, a species that breeds in semi-arid sage brush associations and winters in the deserts of the southwestern United States, mass loss was a result of a reduc- 32 tion in body solids and water. Interestingly, in dehydrated individuals the percentage of body water (~ 67%) was similar to that of hydrated birds. Body composition rather than fluid volume appears to be the variable regulated during water deprivation in birds, as is also the case for mammals (Chew 1951; Chew 1961; Dawson et al. 1979).

Metabolic water To understand avian water budgets it is useful to determine the extent to which metabolic water production can replenish evaporative losses (Bartholomew and Dawson 1953; MacMillen 1990; Williams 1999). In the catabolism of seeds (millet), 1 ml of oxygen consumed yields 0.62 mg metabolic water (Schmidt-Nielsen 1984b). Although an incomplete assessment of a bird’s water budget in its natural environment, the ratio of metabolic water production to total evaporative water loss (TEWL) approaches ecological significance when one considers that TEWL in small birds comprises > 70% of total water losses (Bartholomew 1972; Dawson 1982; MacMillen and Baudinette 1993). A comparison of this ratio among desert species (Figure 5; Williams 1999) shows that Dune Larks produce o more metabolic water than is lost by evaporation when Tas drop below ~ 20 C.

Dune Larks may achieve a positive water balance when nighttime Ta falls and draw upon this reserve during the daylight hours when Tas are higher. For this species metabolic water production may play a significant role in its water economy. For other species metabolic water contributes less to TEWL. Australian Zebra Finches (Poephilia guttata), which can live on air-dried seeds in the laboratory, achieve a positive ratio at ~15 °C. For the Inca Dove (Columbina inca) and Black-throated Sparrow (Amphispiza bilineata), metabolic water production BIRDS T DESER OF VIOR BEHA AND ECOLOGY

Figure 5. A comparison, in four species, of the ratio of metabolic water production (MWP) to PHYSIOLOGICAL total evaporative water loss (TEWL) as a function of ambient temperature. 33 equals TEWL only at very low Tas, indicating that these species are more dependent on preformed water in their diet. Bartholomew (1972) reasoned that small birds have greater preformed water requirements than do larger birds. He based his idea on the fact that the slope of the allometric equation for TEWL scaled as M0.59 (Crawford and Lasiewski 1968) whereas the slope for standard oxygen consumption was higher, M0.72 (Lasiewski and Dawson 1967; Aschoff and Pohl 1970). Ratios of metabolic water production (MWP) to TEWL were thought to be positively related to body size. Williams (1996) reassessed TEWL in birds and found that small birds have slightly higher ratios (MWP/TEWL) than larger birds, at least at moderate temperatures. Because small birds do not have greater preformed water requirements, there is no evidence that they are at a disadvantage in desert environments.

Renal structure and function The avian kidney regulates the concentrations of electrolytes in body fluids, + + - - including Na , K , HCO3 , and Cl ; eliminates potentially deleterious nitrogenous

end products, such as uric acid, and to a lesser extent NH3 and urea; and reab- sorbs sugars, amino acids, and water from the filtrate. When one considers that a 35-g bird filters 360 ml of water through its kidneys each day, 16 times its total body water, the biological significance of water conservation becomes apparent. Reclamation of this water is especially relevant to birds living in water-limited environments (Williams et al. 1991a). One might expect that natural selection has endowed arid-adapted species with unique features in their osmoregulatory system, allowing them to eliminate nitrogenous wastes and excess ions in a smaller volume of water than is required by species from more mesic environments (Dantzler 1970).

Kidney structure The architectural design of the avian kidney and its blood supply have been detailed by Braun and Dantzler (1972), Skadhauge (1981), and Braun (1985 1993). Though both birds and mammals have the capacity to excrete a hyperos- motic urine relative to blood plasma, there are major differences between the structure and function of their osmoregulatory systems. In birds most nephrons are loopless, whereas in mammals all nephrons have loops of Henle, albeit of varying lengths. When birds experience dehydration, they reduce their glomerular filtration rate (GFR), primarily by reducing filtration of the loopless nephrons (Braun and Dantzler 1972; Williams et al. 1991a), but mammals increase tubular reabsorption of fluids to conserve water (Valtin 1983). Rather than reducing GFR during dehydration, as many other birds do, the chicken (Gallus domesticus) increases tubular reabsorption to conserve water (Stallone and Braun 1985). The mammalian kidney is divided into two discrete regions, the cortex, which con-

34 tains the glomeruli, Bowman’s capsules, and proximal tubules, and the medulla, the location of the vasa recta, loops of Henle, and collecting ducts (Valtin 1983; Koeppen and Stanton 1997). Because in birds these latter three structures, along with collecting ducts from loopless nephrons, are encapsulated in the medullary cone, the division of the avian kidney into cortex and medulla is less clear.

Adaptive significance of renal structure To compare renal structure among mammals of different size, Sperber (1944) calculated relative medullary thickness, i.e., the longest axis of the medullary region times 10, divided by the cube root of the three linear dimensions of the kidney (height x width x depth). He noticed that this ratio was larger in species from arid habitats than in species from more mesic areas. Subsequent studies on small mammals supported Sperber’s findings and buoyed the notion that renal structure is different in desert mammals (Schmidt-Nielsen and O’Dell 1961; Heisinger and Breitenbach 1969). The assumption underlying these findings was that selection had fashioned a large medullary mass relative to total kidney mass in species from deserts, and, more importantly, relatively long loops of Henle, and as a result arid-adapted species excreted a more concentrated urine. Presumably, the increase in medullary thickness allows a steeper osmotic gradient to be formed by the counter-current multiplier system. Searching for a similar relationship between kidney structure and function in birds, Johnson (1974) constructed a measure of relative medullary cone length, calculated as the mean length of the medullary cones times 10, divided by the cube root of kidney volume. He found that the medullary cone length of birds from semi-arid and arid habitats, such as Brewer’s Sparrows, Black-throated Sparrows, Zebra Finches, and Verdins (Auriparus flaviceps), is greater than that of more mesic species. Johnson and Skadhauge (1975) extended these observations by showing that relative medullary cone length was positively related to urine concentrating ability. Unfortunately, these authors measured concentrations in cloacally voided urine, now known to differ from ureteral urine as a result of BIRDS modification in the lower gastrointestinal tract. Using more modern methods, T Goldstein and Braun (1989) quantified ureteral urine osmolalities of dehydrated DESER

birds and related those measurements to relative medullary cone length. They OF found no association between relative cone length and maximal ureteral urine VIOR concentration (Umax), nor did their data suggest that birds from arid habitats BEHA could concentrate their urine more than non-desert species. However, their AND sample size was only seven species, two of which were seabirds with salt glands; birds with salt glands have larger kidneys than other species, which may complicate comparisons (Calder and Braun 1983). Goldstein and Braun (1989) suggested ECOLOGY that small species could concentrate urine more than larger species, regardless of habitat affinity, and that Umax and the length of Henle’s loop was negatively cor-

related in birds. Such a relationship also occurs in mammals and has been PHYSIOLOGICAL 35 explained, at least in part, by a decline in mass-specific metabolism as body size increases (Greenwald and Stetson 1988; Beuchat 1990).

The absence of a positive association between Umax and loop length in interspecific comparisons among mammals prompted Greenwald and Stetson (1988) to

suggest that Umax is influenced by transport capacities of the tissues of the thick ascending limb. They believed that transport capacity is directly related to mass- specific metabolic rate, but inversely correlated with body mass. Thus, the relatively lower metabolic rate in larger mammals may be attributable to fewer ion pumps in renal tissues. Although this hypothesis is largely untested for birds, the idea that the level of metabolism influences kidney structure may have interesting implications for desert birds. If the desert environment has selected inhabitants for a reduced FMR, then total metabolic waste that needs to be eliminated by the kidney may be less in these species than in those from mesic environ-

ments, evaluated on a mass-specific basis. This suggests that Umax may generally scale with mass-adjusted rates of field metabolism. Another ramification of a relationship between level of metabolism and kidney structure is that kidney tissue has a high rate of oxygen consumption relative to other body tissues (Daan et al. 1990; Konarzewski and Diamond 1995). Selective pressures to conserve water may increase the size of the kidney, or the density of transport enzymes in the tubule epithelia, but also may have to be optimized against antagonistic pressures to maintain a low BMR.

Urine concentration and habitat The capability of mammals from desert environments, particularly small rodents, to produce a more highly concentrated urine than species from more mesic habitats embodies a familiar example of environmental adaptation (Schmidt-Nielsen 1964; Beuchat 1990; Schmidt-Nielsen 1997). Some small rodents that live in deserts concentrate their urine to ~7,000-9,000 mOsm when deprived of water. Another way of looking at the functional capacity of kidneys is the examination of the ratio between the osmolalities of urine and plasma, the U:P ratio, which ranges from about 20 to 30 among small desert rodents when they are dehydrated. Exceptional water conservation by reabsorption of water in the kidneys may explain, in part, how desert rodents can live solely on dry food in the laboratory (Schmidt-Nielsen 1964; Chew 1965). U:P ratios in water-deprived arid-zone birds, which rarely exceed 2.5, pale in comparison to values for desert rodents. Some colleagues assert that birds have not evolved special renal mechanisms in response to arid conditions (Goldstein and Braun 1989), and some have noted that the ability of birds to fly to distant water sources in deserts mitigates their need to conserve water (Maclean 1996). We think that comparisons of renal concentrating ability, specifically of U:P ratios, between mammals and birds are potentially misleading; we recommend 36 caution when using them for three reasons. First, birds excrete primarily uric acid, a molecule with four nitrogen atoms, which contributes little to the osmotic activity of avian urine (Anderson 1980; Wright 1995). In contrast, mammals synthesize urea, a highly soluble molecule with only two nitrogen atoms, which contributes significantly to the osmotic gradient in the medulla and the osmotic concentration of the urine. Second, spherical, colloidal precipitates of urate in avian urine sequester electrolytes, removing them from the liquid phase and eliminating them as a contributor to osmotic pressure (Braun 1993). Third, the denominator of the U:P ratio, plasma osmolality, remains relatively stable in mammals, whereas in water-deprived birds plasma osmolality can vary by 50-80 mOsm over normal hydration states (Ramsay and Thrasher 1984; Williams et al. 1991a). Comparisons of renal concentrating ability among birds are few. McNabb (1969) compared U:P ratios among three species of quail, Bobwhite (Colinus virgianus), California Quail, and Gambel’s Quail (Callipepla gambelii), whose respective habitats increase in aridity. Gambel’s Quail, the most xeric species, tended to produce the most concentrated urine as determined by measurements of cloacally voided urine during periods of water deprivation. Bobwhite quail excreted urine with the lowest concentration. However, scrutiny of McNabb’s paper reveals that none of these trends was statistically significant. Moreover, the concentrations of electrolytes in the precipitated urate fraction were not measured in this study and could vary among species. Hence, support for the idea that quail from arid environments concentrate their urine more than species from more mesic environments is inconclusive. An alternative way to evaluate the concentrating ability of the avian kidney, which can be used for comparisons among birds and for interclass contrasts, is to compare the moles of nitrogen relative to the moles of water excreted under different regimes of hydration. Kangaroo Rats (36 g), often regarded as the quin-

tessential desert mammal, produce a maximally concentrated urine that contains BIRDS 7.7 mmoles nitrogen per ml water lost (Schmidt-Nielsen 1964). Desert quail T

(150 g), when hydrated, produce 0.71 mmole urate per ml water lost as urine, or DESER

2.9 mmole nitrogen from urates per ml (Anderson and Braun 1985). If 25% of OF the total nitrogen lost is in a form other than urate (McNabb and McNabb 1975; VIOR

McNabb et al. 1980), then total nitrogen loss is 3.9 mmole N per ml water lost BEHA

in urine. Assuming that dehydrated birds produce the same amount of nitroge- AND nous metabolites, and that they concentrate their urine 2.5 fold (Williams et al.

1991a; Braun 1993), these birds would lose 7.7 mmole of nitrogen per ml water ECOLOGY in urine. Similar treatment of data from Pigeons (500 g; Columba livia; McNabb and Poulson 1970), which occupy both mesic and arid environments, indicates that at the maximum they excrete 13.6 mmoles N per ml water lost. While we acknowledge that these calculations, along with their assumptions, are specula- PHYSIOLOGICAL 37 tive, the necessary data required to assess nitrogen loss for any species of water- deprived bird are not available. Still, these speculations suggest that arid-zone birds may be as efficient at eliminating catabolic end products as are desert rodents. An assessment of nitrogen loss by an array of water-deprived individuals from species from both arid and mesic environments would make a meaning- ful contribution toward our understanding of the selective forces responsible for systems of avian osmoregulation. The foregoing discussion does not include the contribution of the lower intestinal tract to water reclamation in birds. Ureters convey urine to the cloaca, where it is moved by retrograde peristalsis into the rectum (Akester et al. 1967; Brummermann and Braun 1994). Here the epithelial tissues actively transport Na+-ions from the intestinal lumen into the extracellular fluid, and water passively follows, a process that potentially reduces water loss in urine when it is finally voided (Skadhauge 1981; Anderson and Braun 1985). Solute-linked water transport functions to recover water up to luminal osmotic concentrations of 200 mOsm above plasma concentrations (Bindslev and Skadhauge 1971). This in- tegration of kidney function and intestinal water recovery should be included in calculations of water conservation. During periods of severe dehydration, when urine osmolalities reach maximum values, waves of reverse peristalsis slow, apparently because the high concentration of urine inhibits water recovery (Brummermann and Braun 1994). In a study of 12 species of birds, some inhabitants of the Kara-Kum desert of central Asia and others from more mesic regions in Eurasia, Amanova (1984) reported that lumen contents of the lower intestine in desert birds had a 15% lower water content than lumen contents of non-desert species. Amanova proposed that desert species have a greater capacity for absorbing water in their lower intestine against an osmotic gradient. Because few data were presented to evaluate this assertion, the hypothesis needs further testing.

Evaporative water loss Total evaporative water loss Total evaporative water loss, the sum of evaporative water losses through the skin and from the respiratory passages, is the major avenue of water efflux in birds, especially for small species in which TEWL is five time greater than urinary-fecal water loss (Bartholomew 1972; Dawson 1982). Given the central importance of water balance in the survivorship of arid-zone birds, one might expect adaptations that reduce TEWL in these species. In an early study, Bartholomew and Dawson (1953) examined the TEWL of 13 North American species from both mesic and arid habitats and concluded that TEWL did not differ between the two groups. Williams (1996) tested this hypothesis on a larger data set and

showed that the TEWL of arid-adapted species at a Ta of 25 °C is lower, the dimi-

38 Figure 6. Total evaporative water loss (TEWL) as a function of body mass in desert and non- desert species. nution amounting to as much as 33% (Figure 6). He first used LSR to determine the relationship between TEWL and body mass. For birds from mesic areas (n = 64), log TEWL (g/d) = -0.438 + 0.661 log mass (g) and for birds from arid regions (n = 38), log TEWL (g/d) = -0.754 + 0.75 log mass (g).

The slopes of these two equations were significantly different (Fslope = 4.0, P < 0.05). His second approach involved PICs and confirmed that birds from arid regions had a reduced TEWL. Natural selection has apparently reduced evaporative water losses in desert species, but the mechanism(s) that produce this result are unknown. BIRDS

3.4.2. Cutaneous Water Loss T Early investigators assumed that almost all evaporative cooling took place in the DESER

respiratory passages and that cutaneous water loss (CWL) was unimportant in OF the process of thermoregulation (Rawles 1960; Bartholomew and Cade 1963; VIOR Mount 1979). More recent work has shown that CWL can equal or exceed eva- BEHA poration from the respiratory passages at moderate Tas, at least at temperatures AND below body temperature (Tb) (Bernstein 1971; Dawson 1982; Webster and King 1987; Wolf and Walsberg 1996b). Few studies have investigated CWL at high ECOLOGY Tas when Tb must be regulated below lethal limits solely by evaporative water loss (Marder and Ben-Asher 1983; Wolf and Walsberg 1996b). From the data available, two patterns have emerged (Table 1): some species, especially mem-

bers of the Columbiformes, rely primarily on CWL to regulate Tb when Ta PHYSIOLOGICAL 39 TABLE I. Cutaneous water loss (CWL) among species of birds.

a Species Habitat Body Mass CWL Ta Source (g) (g H2O/d)

Verdin d 7 0.55 30 Wolf and Walsberg 1996 Auriparus flaviceps 0.87 40 1.22 45 1.73 50 Zebra Finch d 12.5 1.68 30 Bernstein 1971 Taeniopygia guttata Budgerigar d 31.6 4.02 30 Bernstein 1971 Meloposittacus undulatus Common Poor-will d 43.2 3.11 35 Lasiewski et al. 1971 Phalaenoptilus nuttallii Spinifex Pigeon d 89 5.45 25 Withers and Williams 1990 Geophaps plumifera Laughing Dove d? 112 8.60 20 Marder and Ben-Asher 1983 Streptopelia senegalensis 25.81 40 28.76 45 30.64 52 Spotted Sandgrouse d 260 15.6 27 Marder et al. 1986 Pterocles senegallus 133.53 42 172.22 45 164.11 51 Greater Roadrunner d 269 9.04 30 Lasiewski et al. 1971 Geococcyx californianus 274 9.86 35 Chukar Partridge d 472 9.29 20 Marder and Ben-Asher 1983 Alectoris chukar 6.46 36 22.31 40 23.67 45 White-necked Raven d 480 25.46 22 Bernstein 1981 Corvus albicollis Emu d 40000 758.4 45 Maloney and Dawson 1998 Dromaius novaehollandiae Ostrich d 95400 595.3 25 Withers 1983 Struthio camelus White-crowned Sparrow m 27 1.43 20 Robinson et al. 1976 Zonotrichia leucophrys Painted Quail m 42.3 2.13 30 Bernstein 1971 Coturnix chinensis Village Weaver m 42.6 3.47 30 Bernstein 1971 Ploceus cucullatus Mourning Dove m,d 109.4 4.41 25 Webster and Bernstein 1987 Zenaida macroura Japanese Quail m 118 7.6 20 Marder and Ben-Asher 1983 Coturnix japonica 2.26 36 8.21 40 7.36 45 Ringed Turtle Dove m 146.3 3.26 21 Appleyard 1979 Streptopelia decaocto Collared Dove m 168 11.41 20 Ben-Asher 1983 Streptopelia decipiens 44.75 45 68.94 52 Rock Dove m,d 285 14.29 20 Marder and Ben-Asher 1983 Columba livia 13.47 36 49.93 40 74.55 45 114.22 52 Domestic Fowl m 2040 49.94 25 Richards 1976 Gallus gallus 54.84 30 64.63 40 Rhea m 21500 273.48 25 Taylor et al. 1971 Rhea americana 619.2 43

40 ad = birds from desert habitats; m = birds from mesic habitats. exceeds Tb. Other species, members of the Galliformes and Passeriformes, employ a combination of CWL and respiratory evaporative water loss (REWL), the latter facilitated by panting or gular flutter (Bouverot et al. 1974; Wolf and Walsberg 1996b; Tieleman et al. 1999). However, because only a few observations have been made at high Tas, our understanding of CWL and REWL and of how these variables are partitioned remains rudimentary A model that describes CWL is -2 -1 ρ ρ CWL (g H2O m s ) = ( s - a)/rv , ρ -3 where s is the water vapor density (g m ) at the surface of the skin (assumed to ρ be saturated at skin temperature), a is the water vapor density of external air, -1 and rv (s m ) is the total resistance to vapor diffusion (Tracy 1982; Marder and Ben-Asher 1983; Webster et al. 1985). Mautz (1982) described some of the important underlying assumptions of this model. Although this equation is rather simple, a number of factors that affect the variables, and as a result the magnitude of CWL, should be borne in mind. Changes in the vapor density gradient ρ ρ ρ ρ ( s - a), attributable to either an alteration of s or of a, affect CWL. During periods of heat stress, CWL may increase because skin temperature increases, and ρ s is a function of skin temperature. However, birds can reduce their CWL by ρ selecting microsites in which a is higher than in the general environment. ρ ρ -1 The conductance of water vapor, CWL/ ( s - a) (in m s ), across the skin, feathers, and boundary layer can be visualized as the slope of the equation that relates -2 -1 -3 CWL (g H2O m s ) to the vapor density gradient (g H2O m ) (Appleyard 1979). If this conductance is thought of as the velocity of water vapor movement from skin to air per unit of gradient, then the reciprocal of this value provides information about the time required for water to move across a unit of space, a parameter called resistance. Values of resistance are preferred over measures of conductance because they can be used in calculations involving parallel resistances, analogous to resistances in electrical circuits. Total resistance varies interspecifi- -1

cally from ~ 25 to 250 s m , depending on skin temperature, the degree to which BIRDS feathers are fluffed, and species; but the mechanisms that drive this variation are T

largely unexplored (Campbell 1977; Webster et al. 1985; Wolf and Walsberg DESER OF 1996b). Components of rv include resistance to water vapor diffusion across skin

(rs), feathers (rf), and boundary layer (rb); rs accounts for 75 - 90% of rv, at least VIOR

at moderate Tas (Appleyard 1979; Webster et al. 1985). Resistances across plu- BEHA

mage and boundary layers become larger components of the total rv as Ta incre- AND ases and rs decreases. Birds often compress their feathers when exposed to high

Tas, which presumably minimizes rf (McFarland and Baher 1968; Appleyard ECOLOGY 1979; Withers and Williams 1990). Avian skin is composed of an epidermis and a well vascularized dermal layer

(Lucas and Stettenheim 1972). For rs to change, birds must vary the diffusion path length or alter the permeability of the skin to water vapor. During heat PHYSIOLOGICAL 41 stress, birds can increase CWL by vasodilation of the dermal capillary bed, effectively reducing the diffusion path length (Peltonen et al. 1998). Rock Doves under heat stress not only dilate capillaries but also alter the permeability of skin to water vapor. As skin temperature increases, the level of hydration in the epidermal cells also increases (Smith 1969; Arieli et al. 1995). In response to high

Tas or dehydration, changes in epidermal lipid conformation within the stratum

corneum may reduce rs by reducing the permeability of the skin to water vapor, although there are few data to support this idea (Webster et al. 1985; Menon et al. 1988; Menon et al. 1989; Menon et al. 1996). We suggest that natural selec-

tion may have elevated rs in species that occupy hot, dry environments in which water conservation is of paramount importance.

Cutaneous water loss at thermal neutral temperatures To test the hypothesis that rs in arid-zone species is higher, and thus CWL lower, we collated data on CWL (Table 1). The variety of methods used to evaluate CWL may add significant variation to the data. We adjusted the values for CWL reported by Marder and Ben-Asher (1983) because they used estimates of external 2 0.667 surface area (SAe) as given by the equation SAe (cm ) = 8.11 mass (g) rather than 2 predictions for skin surface (SAs) area from Meeh’s equation SAs (cm ) = 10 mass (g)0.667 (Walsberg and King 1978).

CWL at moderate Tas (20 - 25 °C) has been reported for 16 species equally divided between occupants of arid and mesic environments (Figure 7). A comparison of slopes and intercepts of regression lines from these two subsets revealed no

significant difference (slope: F1,14 = 0.14; P > 0.5; intercept: F1,14 = 1.9; P > 0.2).

Figure 7. Cutaneous water loss (CWL) as a function of body mass in desert and non-desert species. 42 With data combined, log CWL (g H2O/d) = -0.74 + 0.73 log mass (g). Although the result is no support for the hypothesis that CWL is reduced in desert birds, the data are few and hence conclusions tentative. Some species listed in Table 1, even though assigned to the desert category, were raised in captivity at moderate

Tas with food and water provided ad libitum, conditions which may have altered properties of the skin that influence resistance. With the exception of the Verdin, CWL has not been measured in species from hyperarid regions where selection for water conservation mechanisms is perhaps most intense.

Cutaneous water loss at 45 °C One can imagine a selective advantage to species that can significantly increase CWL during bouts of heat stress. Unfortunately measurements of CWL at 45 °C are available for only five desert species and three non-desert species (Table 1), too few to make reliable comparisons. For the data combined, log CWL (g/d) = -0.16 + 0.71 log mass (g). CWL at 45 °C is about 3.5 times higher than values at thermal neutral temperatures, but the data are inadequate to address the question whether differences in CWL exist between species that have evolved in different habitats.

Respiratory water loss Respiratory evaporative water loss (REWL), a parameter influenced by both physiological and environmental variables, can be measured directly or calculated as ρ ρ REWL = V ( e - i), ρ ρ -3 where e and i are the water vapor densities (g m ) of expired and inspired air, respectively, and V is respiratory ventilation volume, a product of breathing frequency and tidal volume (Welch and Tracy 1977; Tieleman and Williams 1999). In most studies, exhaled air is assumed to be saturated, although some authors question this assumption (Withers et al. 1981; Kaiser and Bucher 1985). Condensation of water vapor from the exhaled air stream, as it courses over previously cooled membranes of the nasopharynx, is thought to reduce REWL in BIRDS T birds and mammals (Jackson and Schmidt-Nielsen 1964; Murrish 1973; DESER Hillenius 1992). When air is inhaled, its temperature rises to that of Tb, and the OF air becomes saturated with water vapor from the respiratory passages and the lungs. Convective heat exchange and evaporation of water in the nasal passages VIOR during inhalation presumably cool the associated membranes, and upon exhala- BEHA tion the air is cooled by these nasal surfaces with the result that water condenses AND on them. Schmidt-Nielsen (1981) proposed that counter-current heat exchange in the nasal passages is an adaptation to arid environments and that desert ani- ECOLOGY mals should have more complex nasal turbinates that allow cooling of exhaled air to temperatures below those of non-desert species, resulting in a larger reduction in REWL in desert species. PHYSIOLOGICAL

Working in the Negev Desert of Israel on Crested Larks (Galerida cristata, 33 g), 43 a widely distributed mesic to semi-arid species typically found near water, and on Desert Larks (Ammomanes deserti, 19 g), a species restricted to much drier habitats, Tieleman et al. (1999) tested the hypothesis that water recovery in the nasal passages diminished REWL (and as a result, TEWL) more in Desert Larks than in Crested Larks. With the nares of Crested Larks occluded, experimental birds

lost from 27% to 0% more evaporative water than did controls over a Ta range of 15 to 45 °C. Blocking the nares of Desert Larks did not affect their TEWL over

the same Ta range. This study, the only direct test to date of water recovery from the exhaled airstream in birds, indicates that some birds reduce REWL by reco-

very of water in the nose, at least at moderate to low Tas, but that others do not.

At high Tas, water recovery in the nares is apparently insignificant. Tieleman et al. (1999) also examined Schmidt-Nielsen’s (1981) suggestion that

the temperature of exhaled air (Tex) is lower as a result of passage over previous-

ly cooled nasal membranes. They compared Tex taken from the nares of Crested

Larks and Tex taken from the open mouth when the nares were occluded. If air flow through the nasal passages was prevented, nasal membranes would not func-

tion as a heat exchanger and Tex should be higher. At moderate Tas, measure-

ments of Tex with the nares blocked gave values 1 - 4 °C higher than those with the nares open, indicating some cooling of the air stream, but at 35 °C differen-

ces were insignificant. They proposed that Tex which probably closely tracks Ta instead of being determined by evaporation of water on the nasal membranes, is determined primarily by the temperature of the bill and surrounding tissue.

Effect of hyperthermia on evaporative water loss

The high Tb of birds, around 41 °C (Prinzinger et al. 1991), may “preadapt” them to desert life because it results in an more favorable thermal gradient between environment and animal (Bartholomew 1964; Dawson and Schmidt-Nielsen 1964; Dawson 1984; Maclean 1996). Several authors have proposed that tole-

rance of Tb 2-3°C above normal (hyperthermia) could decrease the amount of water required for evaporative cooling (Calder and King 1974; Weathers 1981; Dawson 1984; Withers and Williams 1990). However, Tieleman and Williams (1999) suggested that the amount of water saved by hyperthermia is a function of body size and of the duration of the hyperthermic bout, and they pointed out that gaps in our knowledge of hyperthermia prevent a complete understanding of its effects on water savings. Discussions about the potential benefits of hyperthermia have focused on two

factors. First, an increase in the gradient between Tb and Ta causes an increase in

the dry heat flux (Calder and King 1974). If Ta exceeds Tb, the rate of heat gain from the environment will be reduced. Second, heat stored and dissipated later when the environment has cooled saves water that otherwise would be used for evaporative cooling (Schmidt-Nielsen 1964; Dawson and Bartholomew 1968; Calder and King 1974). Few have considered features of hyperthermia that may 44 increase water loss, such as the augmentation of REWL as a result of greater water vapor pressures in the lungs when Tb is elevated (Tieleman and Williams

1999). When Tb increases, exhaled air temperature will increase, as does the amount of water vapor exhaled. In addition, ventilation patterns vary markedly with Tb, and elevated Tb potentially results in increased ventilation volumes. The combination of higher water vapor density and increased volume of exhaled air negates some of the hypothesized advantages of hyperthermia (Tieleman and Williams 1999). Exploring the combined effects of an improved thermal gradient, heat storage, and altered respiratory variables in reducing or augmenting water loss in hyperthermic birds, Tieleman and Williams (1999) calculated that during acute (1 hour) exposure to high Ta, birds over a size range of 10-1000 g save about 50% of their total evaporative water loss by elevating their Tb 3 °C. For chronic (5 hour) episodes of hyperthermia, small birds again save about 50% of their TEWL, but larger birds save far less. A 1000-g bird may actually lose more water as a consequence of its elevated Tb than it does if it remains normothermic for 5 hours. These results suggest the hypothesis that, when exposed to high Tas, small birds should always regulate their Tb at higher levels, but that under some circumstances larger species should not become hyperthermic. This analysis considers only water balance. Hyperthermia also has an impact on a suite of other factors, like energy balance (Seymour 1972), protein stability, and tissue function (Marder et al. 1989), and this should be kept in view when thinking about optimal levels of Tb of desert birds (Tieleman and Williams 1999).

Field water flux Nagy and Peterson (1988) reported that field water flux of desert forms is lower than that of species from mesic environments. Their analysis included 18 data points derived from five desert species; such multiple measurements on individual species inflate degrees of freedom and adds bias to estimates of slope and BIRDS intercept in the regression analysis (Pagel and Harvey 1988). Recently, Tieleman T and Williams (2000) collated field water flux rates for 17 desert and 41 non- DESER

desert species, and employed two comparative techniques to reevaluate the OF hypothesis that desert birds have lower water flux rates than more mesic species VIOR (Figure 8). ANCOVA revealed no significant difference between the slopes of BEHA regression lines for desert and non-desert species, but disclosed a lower intercept AND for the equation for desert birds. The relationship between water flux and body mass in desert birds was described by log water flux (ml/day) = - 0.126 + 0.724 log mass (g) ECOLOGY and in species from mesic areas by log water flux (ml/day) = 0.263 + 0.724 log mass (g).

The water flux rates of desert birds amounted to 41% of values for non-desert PHYSIOLOGICAL species. 45 Tieleman and Williams’ regressions using PICs indicated that water flux rates did not differ significantly between birds from arid and mesic environments, despite the wide variety of taxa. Comparisons using PICs and LSR usually yield similar conclusions when the data are phylogenetically diverse (Weathers and Siegel 1995; Ricklefs and Starck 1996). Given the lack of agreement between these two comparative approaches, a definitive answer to the question whether desert birds have a reduced field water flux cannot be given. The effectiveness of mechanisms that conserve water is often expressed as the water economy index (WEI; ml water kJ-1), calculated as the ratio of water flux to FMR (Nagy and Peterson 1988). Nagy and Peterson (1988) tested the hypo-

Figure 8. Water flux rate as a function of body mass for desert (dashed line) and non-desert (solid line) species; LSR = least squares regression.

thesis that desert birds conserve water more effectively than their mesic relatives as judged by lower WEI values, but found no statistical support. Utilizing a larger data set, Tieleman and Williams (2000) showed that the average WEI for desert birds was 0.16 ± 0.06 (n = 14), whereas for non-desert species it was 0.20 ± 0.09 (n = 40), values which differ significantly (P = 0.05). However, inferences about water-conserving mechanisms based on WEI values should be interpreted with caution because water flux values in the field do not necessarily reflect minimum water requirements. Animals that take in large amounts of dietary and/or drinking water could have large values for WEI, whereas animals that do not drink and that consume food with a low water content may be characterized by low WEI values. Therefore, relatively low WEI in desert birds 46 may simply reflect the fact that animals outside desert environments take in excessive amounts of water, exceeding their minimum requirements. Because birds living in deserts may lose substantial amounts of water used for cooling and may have low FMRs, one may not expect unusually low values of WEI. The combination of a reduced FMR and a low WEI in desert birds suggests that these species exploit non-evaporative pathways for heat loss, reducing the amount of water required for cooling, or that they compensate for large quantities of evaporative water loss by a small loss of water through excretion.

Thermoregulation

Adult birds maintain their Tb within a few degrees of the upper lethal limit, 46- 47 °C (Dawson and Schmidt-Nielsen 1964; Calder and King 1974). Controlling

Tb within narrow limits requires a balance of heat gain from metabolic heat production and from the environment and heat loss from radiation, evaporation, conduction, and convection (Figure 1). Desert environments pose complex challenges to the heat balance of birds. Solar radiation and high Tas during the day mandate an efficient cooling system and behaviors that reduce thermal loading, whereas, in some deserts, nighttime Tas may require a high capacity for regulatory thermogenesis. Anecdotal evidence indicates that the capabilities of birds to regulate their Tb can be exceeded. Periods of extreme heat, with Tas exceeding 50 °C, have caused significant mortality among populations of desert birds (McGilp 1932; Miller 1963; Serventy 1971). One can imagine that events like these have selected for behavioral and physiological adaptations to regulate Tb below upper lethal limits. In this section we focus on physiological and behavioral thermoregulation under hot conditions (Figure 1). We only briefly review data on heat balance during cold nights and their consequences for energy expenditure. We survey several laboratory studies that provide insights into physiological thermoregulation in BIRDS response to Ta, wind, and solar radiation. Finally, we consider microhabitat selec- T tion and how it plays a role in balancing thermoregulatory requirements with DESER

water and energy availability (Williams et al. 1999). OF VIOR Responses to high Ta Metabolism and evaporation BEHA AND The patterns of thermoregulatory responses of birds to Ta do not differ between desert and non-desert forms (Scholander et al. 1950; Calder and King 1974;

Dawson 1982, 1984). However, some desert birds have remarkable thermal tole- ECOLOGY rance, withstanding higher Tas than reported for any non-desert species. Most species have a thermal neutral zone (TNZ), a range of Tas in which metabolism is minimal and the requirements for evaporative cooling are generally low. At Tas below the TNZ, metabolism increases owing to regulatory thermogenesis, while PHYSIOLOGICAL 47 evaporative water loss is relatively constant. Above the TNZ evaporative water loss increases exponentially, whereas metabolism increases linearly. Because few studies have reported thermoregulatory responses of birds exposed to

Tas above 45 °C, it is difficult to detect patterns of heat tolerance that may have adaptive significance (Tieleman and Williams 1999). When raised as nestlings at

high Tas, Rock Doves, a species found in both mesic and xeric habitats, can with-

stand Tas exceeding 60 °C for more than 2 hours. These birds maintained their

Tb between 41.2 and 42.0 °C by elevating evaporative heat loss to 304% of metabolic heat production (Marder and Arieli 1988). Spinifex Pigeons (Geophaps

plumifera), birds that inhabit the hot, dry interior of Australia, tolerated a Ta of

50 °C for 1 hour in the laboratory. Their Tb increased to 43.4 °C, and the ratio of total evaporative heat loss to metabolic heat production varied between 200 and 350% (Withers and Williams 1990). When exposed to 55 °C for 2 hours, Houbara Bustards (Chlamydotis undulata macqueenii), birds from deserts in North

Africa and the Middle East, maintained Tb at 42.4 °C by elevating their evaporative heat loss to 214% of metabolic heat production (pers. obs.). Responses to extreme heat among these three species include a relatively low metabolic heat production, increased resistance of the feather layer to heat flux, high rates of evaporative cooling compared to metabolic heat production, and increased contribution of cutaneous water loss to total evaporative water loss. In addition,

Rock Doves and Houbara Bustards, two species that can tolerate Tas greater than

50 °C for several hours, maintain Tb at levels close to normal when exposed to

high Tas and do not become hyperthermic.

Body temperature at high Ta Tolerance of hyperthermia may enable birds to inhabit hot environments, presumably because tolerance reduces requirements for evaporative cooling by improving the thermal gradient between the environment and the animal (Bartholomew 1964; Dawson and Schmidt-Nielsen 1964; Dawson 1984; Maclean 1996; Tieleman and Williams 1999). We have already discussed the influence of hyperthermia on rates of evaporative water loss. Here we consider

whether desert species regulate their Tb at higher levels than non-desert species, a result that one might expect if hyperthermia is advantageous for birds living

under hot conditions. Unfortunately, data on Tbs of birds in the field are una- vailable, forcing us to resort to measurements from the laboratory. Various desert

and non-desert species increase their Tb within and above the TNZ (Weathers and Schoenbaechler 1976; Weathers 1981; Tieleman and Williams 1999). In an analysis of 23 species, ranging in body mass from 6.4 g to 412 g, Tieleman and

Williams (1999) found that Tbs were on average 3.3 ± 1.28 °C (SD) higher at a

Ta of 45 °C than at the lower critical temperature. The mean elevation in Tb of desert species was not significantly different from that of non-desert birds.

48 Hence, the idea that desert species regulate their Tb differently than non-desert forms at high Tas finds no support (Tieleman and Williams 1999).

Dry heat transfer coefficient

When exposed to Tas >50 °C, Rock Doves, Spinifex Pigeons and Houbara Bustards assume a compact body posture and erect their feathers, presumably to minimize surface area and to improve the insulation of their integument (Marder et al. 1989; Withers and Williams 1990). This suggests that birds minimize dry heat gain from the environment when Ta exceeds Tb. An integrated measure of dry heat transfer, including specific heat transfer coefficients for conduction, convection, and radiation, is provided by the dry heat-transfer coefficient (h). As a property of the bird, h is influenced by characteristics of insulation, vasodilation, body size, and surface to volume ratios. Calculation of h using the equation

M - E - C(dTb/dt) h = Tb - Ta requires information about metabolic heat production (M; J h-1), evaporative -1 -1 heat loss (E; J h ), rate of heat gain in or loss from body tissue (C(dTb/dt); J h ),

Tb and Ta (Birkebak 1966; Porter and Gates 1969; Calder and King 1974; Tieleman and Williams 1999).

Below the TNZ, h is often assumed to be minimal (but see McNab 1980). As Ta increases within the TNZ, birds dissipate metabolic heat by dry heat loss over a decreasing thermal gradient. Therefore, one might expect that birds continuously adjust the thickness of their feather layer and blood supply to the skin, such that h increases (Tieleman and Williams 1999). At Tas above Ta = Tb, where the direction of heat flow is reversed and the bird gains heat from its environment, BIRDS one might predict a decrease to minimal h. A review of values reported for h at T

Tas above Ta = Tb shows considerable variation (Tieleman and Williams 1999). DESER

Some studies suggest a decrease to a minimal value, while others show no ap- OF parent trend (Hinds and Calder 1973; Weathers and Caccamise 1975; Weathers VIOR and Schoenbaechler 1976; Dmi’el and Tel Tzur 1985; Withers and Williams BEHA 1990). Tieleman and Williams (1999) point out that some of the variation in h AND results from the fact that none of these studies took into account the rate of heat gain C(dTb/dt), despite the significant contribution of this factor to the heat ECOLOGY balance at high Tas. Calculations of h near Ta = Tb have frequently been problematical because small errors in measurements of the variables in the equation in the preceding paragraph can translate into large errors in h. The error in h

should be reduced by including C(dTb/dt) in the calculations. PHYSIOLOGICAL 49 In the past, h has not been calculated at Ta = Tb because both numerator and -1 denominator are zero. Despite the fact that heat transfer (J h ) is zero at Ta=Tb, the heat transfer coefficient (J h-1 °C-1), which is a property of the bird, does not become zero. Tieleman and Williams (1999) describe a method of calculating h

at Ta = Tb using l'Hôpital's rule (Apostol 1967), a differentiation technique that provides a polynomial approximation of h when both numerator and denominator are zero.

Incorporating C(dTb/dt) and applying l'Hôpital's rule to calculations of h at Ta =

Tb, Tieleman and Williams (1999) found that 22 species of birds (6 - 412 g) did

not reduce h when Ta > Tb, a result in contrast to expectations. Most species

were measured at 45 °C, a Ta only slightly higher than Tb. These authors compared this result with results from Rock Doves (Marder and Arieli 1988) and

Houbara Bustards (unpubl. data), which tolerate Tas above 50 °C. These heat-

tolerant species decreased h at Tas exceeding Tb, which supports the hypothesis that behaviors which reduce surface area and increase insulation minimize dry

heat uptake at high Tas.

Macroclimate Wind Wind decreases the thickness of the boundary layer and disturbs the air layer within the feathers, which increases convective heat transfer between the animal

and its environment. At Tas below body-surface temperature, birds must increase their metabolism in response to increasing wind speeds to maintain a constant

Tb. Most studies have focused on energetic costs of exposure to wind at low Tas,

and only a few investigators have extended their measurements to Tas in and above the TNZ (Gessaman 1972; Robinson et al. 1976; Goldstein 1983; Webster and Weathers 1988; Bakken 1990; Bakken et al. 1991; Wolf and Walsberg 1996a). In several studies, metabolic rate increases linearly with the square root of wind speed (Robinson et al. 1976; Webster and Weathers 1988; Bakken 1990; Bakken et al. 1991; but see Goldstein 1983). The increase in metabolism as a

function of wind speed depends on mass and Ta (Goldstein 1983; Webster and Weathers 1988). As body mass increases, surface to volume ratio decreases and mass-specific heat loss at a given wind speed falls. Further, the effect of convec-

tive heat loss on metabolic rate increases as Ta decreases (Goldstein 1983; Webster and Weathers 1988). Changes in the thermal conductance and in the temperature difference that drives heat flux between the bird’s body and the environment explain this finding (Campbell 1977; Goldstein 1983; Webster and Weathers 1988). In wintering Verdins, the additional thermoregulatory costs due to a moderate increase in mean daily wind speed has been estimated to comprise 20-30% of their daily energy expenditure (Webster and Weathers 1988).

The effect of wind on metabolic rate at Tas around the lower critical tempera-

50 ture, Tlc, is not well understood (Goldstein 1983; Bakken et al. 1991). Tlc is higher in wind than under free convection conditions, such as in metabolic chambers, but the magnitude of the shift remains to be quantified (Goldstein 1983). If a given wind velocity increased thermal conductance by a constant amount, one could estimate the shift in Tlc. However, the only study on this issue found an abrupt onset of wind sensitivity around the Tlc and a discontinuity between metabolic rate in and below the TNZ in the presence of wind (Bakken et al. 1991).

Knowledge of the effect of wind on the upper critical temperature, Tuc, on metabolism, and on water loss at Tas above the TNZ could yield important information about thermoregulatory consequences of microclimate selection by desert birds. If Tuc does not exceed Tb, increased convective heat loss due to wind may elevate Tuc, and extend the TNZ. At Tas above Tb, wind might increase convective heat flux from the environment to the bird, elevating the internal heat load and the requirements for evaporative cooling. Gambel’s Quail became frantic when placed in wind at high Tas (Goldstein 1984), a possible indication that convection increases heat stress owing to increased heat flow to the animal.

Solar radiation Solar radiation has a large impact on the water and energy budgets of birds (Lustick 1969; Lustick et al. 1970; Ohmart and Lasiewski 1971; De Jong 1976;

Wolf and Walsberg 1996a). Sunlight is absorbed by feathers and at low Tas this decreases the thermal gradient from the skin to the feather surface, which reduces conductive heat loss (Lustick 1969). Below the TNZ, absorption of solar radiation substantially reduces energy expenditure (Lustick 1969; Ohmart and

Lasiewski 1971; De Jong 1976). Insolation can decrease Tlc and Tuc by as much as 15 °C (De Jong 1976). At high Tas, solar radiation increases the temperature of the feather layer and heat flow to the animal, augmenting heat stress and requirements for evaporative cooling (De Jong 1976). In a study of Verdins (7 g), Wolf and Walsberg (1996a) measured the decrease in metabolic heat production BIRDS

at 15 °C as a function of simulated solar radiation and wind speed. Exposure to T radiation significantly reduced metabolic rate at wind speeds of 0.4 - 1.7 m s-1, but DESER -1

not at 3.0 m s . The effects of insolation on the water and energy budgets of birds OF are influenced by the intensity of solar radiation, Ta, and wind (Lustick 1969; De VIOR Jong 1976; Wolf and Walsberg 1996a), but the precise relationships between BEHA these parameters await further study. AND Substrate temperature

The temperature of the ground surface, tree bark, or any other substrate that is ECOLOGY in contact with or close to a bird contributes to its microclimate through conduction and radiation. Heat transfer by conductance between a substrate and an animal is a function of the temperature gradient, the area of contact surface, and PHYSIOLOGICAL the conductance between the substrate and the animal. The heat that birds gain 51 by radiation from the substrate depends on its temperature and on the emissivi- ty of the substrate surface. The thermoregulatory consequences of avoiding or seeking specific substrates have not been explicitly studied, even though behavioral observations suggest that they have a prominent role in the heat balance of desert birds. Ground foraging desert birds often run from shade spot to shade spot when foraging during the middle part of the day (pers. obs.). This strategy minimizes not only time exposed to direct solar radiation, but also time spent on the hot ground surface, where temperatures can exceed 65 °C. When the soil surface becomes too hot, some species (e.g. chats and larks) interrupt their movements to perch on small shrubs or grasses, elevated above the ground, to avoid contact with the hot surface (Willoughby 1971). Desert birds sometimes press the body against the cool surface of shaded soil, tree bark, or moist plants to conduct away heat during the hottest part of the day (Wolf et al. 1996; Shobrak 1998; Williams et al. 1999).

Microclimate Effect of body size Most desert birds are diurnal, do not dig burrows, and thus are directly confronted with the extremes of their environment (Dawson and Bartholomew 1968; Wolf et al. 1996; Williams et al. 1999). Thermoregulatory requirements under hot conditions vary with body size. Large species have a low mass-specific heat production and a low surface to volume ratio, resulting in slower heat gain when

Tas are elevated. In addition, large birds benefit from greater thermal inertia and increased capacity to store energy and water. In contrast, smaller species, as result of their relatively high mass-specific metabolism, higher surface to volume ratio, and lower thermal inertia, gain heat from the environment more rapidly and require relatively large amounts of evaporative water for thermoregulation under hot conditions. On the other hand, small birds benefit from small-scale spatial variation in microhabitats and may be able to find favorable locations that are unaccessible to larger birds.

Integrated measures of microclimate: Te and Tes Microclimates created by spatial variation in microhabitat result from the inter-

play of Ta, wind, solar radiation, substrate temperature, and humidity. Although water vapor pressure may vary among microsites and may influence water loss in birds, few field measurements have been made. Knowledge of the effect of variation in water vapor pressure on rates of evaporative water loss comes only from laboratory studies (Lasiewski et al. 1966). Descriptions of microclimates have improved with the use of integrated meas-

ures, such as operative environmental temperature (Te) and standard operative

environmental temperature (Tes) (Bakken and Gates 1975; Bakken 1976). Te

52 reflects the temperature of a model that duplicates all external conductive, convective and radiative properties of the focal animal in thermodynamic equilibrium with its environment, but without heat produced by metabolism or lost by evaporation (Bakken and Gates 1975; Bakken 1976). Tes is defined as the temperature of a standard environment in which an animal with a constant Tb requires the same effective net metabolic heat production (metabolic heat production minus evaporative heat loss) to maintain Tb as it does in the natural environment (Bakken 1976). The latter concept permits data obtained in laboratories to be translated directly to field situations. Unheated and heated taxidermic mounts have proved useful to measure Te and Tes (Bakken 1976; Bakken 1980; Bakken et al. 1981; Chappell and Bartholomew 1981; Salzman 1982; Goldstein 1984; Chappell et al. 1984; Wolf et al. 1996), although Walsberg and Wolf (1996) for some species questioned the accuracy of data obtained with taxidermic mounts. They compared responses of heated and unheated mounts to those of live animals. For models of two mammal species, predictions of Tes based on unheated mounts deviated up to 28.5 °C from actual values when body thermal resistance was unknown, and up to 7.6 °C when it was known. Predictions of Tes from Verdin models were within 1.8 °C of actual values when thermal resistance between animal surface and environment and body thermal resistance were known (Walsberg and Wolf 1996). Larochelle (1998) identified problems with Walsberg and Wolf’s study and concluded that their data were insufficient to cast doubt on the ability of mounts to yield reliable measures of Te and Tes. Most studies that have used taxidermic mounts have been carried out in cold environments; their application in hot environments deserves further attention.

No studies on desert birds have applied heated mounts to measure Tes. Some workers have employed unheated mounts to determine Te under hot conditions, but none of these reported calibration data at high Tas or provided information about the amount of variation between individual mounts (Salzman 1982; Chappell et al. 1984; Goldstein 1984; Williams et al. 1995). Walsberg and Wolf (1996) meas-

ured Te using mounts of Verdins exposed to combinations of wind and solar BIRDS T radiation and found that estimates of Tes varied by 2-3 °C among mounts. These

results indicate the importance of using several mounts simultaneously to provide DESER OF estimates of Te and Tes. Some investigators have calibrated heated taxidermic mounts in a wind tunnel (following Bakken et al. 1981) to determine the ratio VIOR

of the thermal conductance in the general environment to that in the laborato- BEHA

ry and used this information to calculate Tes from Te (Goldstein 1984; Williams AND et al. 1995). Unfortunately these calibrations were performed over Tas of 6-25 °C

(Goldstein 1984) and 0-36 °C (Williams et al. 1995) and in the absence of solar ECOLOGY radiation. Field measurements of Te in these studies far exceeded 40 °C, and estimates of Tes required extrapolation beyond empirically derived values. Calculation of Tes based on Te at temperatures in and above the TNZ, and especially at Tas PHYSIOLOGICAL > Tb, has not been validated. Estimates of Tes at high Tes should therefore be 53 regarded with caution, because they require untested assumptions about conduc-

tance (Goldstein 1984). Changes in conductance of live birds at high Tas under laboratory conditions are poorly understood (Tieleman and Williams 1999), and

values for conductance at high Tas in the presence of wind and solar radiation

are lacking. In addition to the problem of translating Te to Tes, measurement of

Te itself is sometimes problematic. When conductance of an animal and a mount differ greatly, as is the case when an extensive part of a live animal’s body touches

a substrate, Te as measured with mounts may deviate significantly from actual Te (Bakken 1976)

Microsites providing protection from cold Selection of microsites by desert birds depends on either energy or water balance and may vary during the course of the day or seasons. To minimize energy requirements for heat production under cold conditions, especially during winter nights, some species, e.g. Phainopepla (Phainopepla nitens) and Black-tailed Gnatcatcher (Polioptila melanura), occupy roost nests (Walsberg 1986; Walsberg 1990). Hoopoe Larks (Alaemon alaudipes) and Crested Larks in Arabia spend the night sitting in small depressions that they dig in sand (pers. obs.). For most desert species nocturnal roost sites are unknown.

Microsites providing protection from heat Birds select favorable microsites under hot conditions to avoid excessive heat

gain and to minimize evaporative water loss. As Ta increases during the day, small ground-foraging species like Gray’s Larks (Ammomanes grayi), Spike-heeled Larks (Chersomanes albofasciata) (Willoughby 1971), Dune Larks, Dunn’s Larks (Eremalauda dunni), and Hoopoe Larks (Shobrak 1998; pers. obs.) perch on stones or vegetation above the ground surface, with wings held away from the body to expose thinly feathered areas under the wings. These birds can be exposed to direct sunlight, and convective heat loss apparently exceeds solar heat

gain under these circumstances. To avoid high Tas close to the ground, raptors soar during the middle part of the day (Madsen 1930; Dawson 1976). When the intensity of solar radiation increases, many other species choose shade created by rocks, vegetation, or burrows that are dug by rodents or lizards (Ricklefs and Hainsworth 1968; Willoughby 1971; Cox 1983; Hinsley 1994; Wolf et al. 1996; Shobrak 1998; Williams et al. 1999). During hot days some desert species press the ventral parts of the body against cool substrates to conduct away heat without excessive loss of water for evaporation. Black-tailed Gnatcatchers (Wolf et al. 1996), larks, and shrikes (pers. obs.) lie prostrate in sandy spots that are shaded by vegetation. Hoopoe Larks and Dunn’s Larks fashion small cups in the sand against tufts of grass that provide shade, pressing their ventral surface against the cool substrate. Occasionally

54 Hoopoe Larks lie with their wings spread on the mat-like plant Corchorus depres- sus, apparently benefitting from the relatively cool, damp foliage (Shobrak 1998). Black-tailed Gnatcatchers and Verdins seek cool substrates on the bark of Paloverde trees (Cercidium floridum), where they spend the hottest part of the afternoon (Wolf et al. 1996). Finally, during hot summer days in the Arabian Desert Hoopoe Larks, Dunn’s larks, Bar-tailed Desert Larks (Ammomanes cincturus), and Black-crowned Finch Larks (Eremopterix nigriceps) use burrows of the large herbivorous lizard Uromastyx aegypticus as thermal refugia (Williams et al. 1999).

Thermoregulatory benefits of microsite selection The energetic cost of thermoregulation has been defined as either the sum of thermostatic costs plus basal metabolic rate, i.e. maintenance metabolism, or as the sum of thermostatic costs alone (Dawson and O’Connor 1996). Estimates of avian maintenance metabolism vary from nil to 90% (Dawson and O’Connor 1996), but generally constitute 40-60% of field metabolic rates (Walsberg 1983). Dawson and O’Connor (1996) review data on energetic costs of thermoregulation in birds inhabiting hot environments and conclude that these costs comprise a lower proportion of field metabolic rate than those for species in cold climates. Studies that report costs of thermoregulation usually focus on energetic costs and often fail to estimate evaporative water loss, despite the high rates of evaporation measured on birds in the laboratory at high Tas (Walsberg 1983; Dawson and O’Connor 1996). The large energy expenditure and water loss required to maintain heat balance creates a potential for substantial savings by selecting favorable microsites. Estimates of energy and water saved by selecting specific microclimates under hot conditions are few, and those that have been made are usually based on inter- polations of measurements of metabolism and water loss from the laboratory. By roosting in dense vegetation during winter in the Sonoran desert, Phainopelas increased Tes by ~9.5 °C, a 20% decrease in resting energy expenditure BIRDS

(Walsberg 1986). The increase in Tes in these roost sites was largely due to wind T shielding (8.0 °C) and to a smaller extent to changes in the radiative environ- DESER

ment (1.5 °C) (Walsberg 1986). During summer Phainopeplas occur inland in OF regions of western North America where daily maximum temperatures average VIOR 39.7 °C. Walsberg (1993) estimated that selection of the coolest microsites re- BEHA duced evaporative water loss to less than 5% of that predicted for the hottest AND available microhabitat. During winter at Tas of 15 °C, Verdins in the Sonoran desert can reduce resting metabolic rates by 50% by moving to a sunny site protected from wind (Wolf and Walsberg 1996a). At midday in summer, Verdins ECOLOGY and Black-tailed Gnatcatchers selected small shady depressions in the bark of

Paloverde trees, which reduced their Te by approximately 15 °C and, as a conse-

quence, their evaporative water loss by 75-80% (Wolf et al. 1996; Wolf and PHYSIOLOGICAL 55 Walsberg 1996a). Hoopoe Larks in the Arabian desert reduce their evaporative -1 water loss by 66% when they move out of the sun (3.99 g H2O h ) into a shady -1 spot (1.35 g H2O h ) during the heat of the day (Williams et al. 1999). By ret- reating underground to the shade of lizard burrows, Hoopoe Larks decreased TEWL by an additional 65%, compared to their TEWL in above-ground shade. If they press their ventral apteria against the burrow substrate, TEWL is reduced -1 to 0.25 g H2O h . In total, the TEWL of Hoopoe Larks that lie on the floor of lizard burrows is potentially 94% lower than that of individuals exposed to direct solar radiation (Williams et al. 1999).

Mobility Some species evade desert extremes by flying to regions in which food is plenti- ful, typically after rainfall (Davies 1984; Schulz and Seddon 1996). How these nomadic birds locate these favorable areas is unresolved. Other species periodi- cally visit the desert each year in times of mild environmental conditions and sufficient food supply and migrate elsewhere prior to the onset of summer (Walsberg 1977; Walsberg 1993). Birds that fly long distances to migrate or to follow pulses of rain may lose significant amounts of water and use substantial amounts of energy while moving from one site to another. Comparisons of the costs and benefits of migratory, nomadic, and resident strategies are needed to understand how considerations of water, energy balance, and thermoregulatory capabilities are involved in the movements of desert birds. Nomadism is a common phenomenon among birds from arid environments, especially in the southern hemisphere (Keast 1959; Maclean 1996), but unifying explanations that might account for this behavior have not emerged (Davies 1982). At least 26% of Australian bird species are nomadic (Keast 1959). Most nomads eat seeds and apparently utilize sources of drinking water regularly (Maclean 1970a; Willoughby 1971; Davies 1982). Migratory species that visit deserts in times of mild environmental conditions are common in most deserts. However, few studies have examined the advantages of such movements. For species that annually emigrate from the desert during the hottest portions of the summer, it would be of interest to compare thermoregulatory costs in their summer habitats with costs that they would accrue if they had remained in the desert. Walsberg (1993) quantified the thermal consequences of microsite selection of male Phainopeplas in three habitats during breeding. These small (24 g) primarily frugivorous birds range from the southern portion of the Mexican Plateau into the southwestern United States and occupy the Sonoran and Colorado deserts during fall, winter, and spring, when mistletoe berries (Phoradendron californicum) are abundant and environmental temperatures are moderate (Walsberg 1977). They breed during March and April (Sonoran desert) when insects, important food for their young, become abundant. Prior to

56 the onset of summer, they emigrate to oak and riparian woodlands in California, Arizona, and New Mexico and breed a second time. Walsberg (1993) estimated

Tes in three study sites: the Sonoran desert (spring), semi-arid woodlands along the coast of California (summer), and semi-arid woodlands in Arizona (summer). Although the interior woodland (Arizona) was markedly hotter than the other two sites, Phainopeplas adjusted their daily time-budgets such that the Tes that they encountered were similar in all three areas, suggesting that migration is a form of behavioral thermoregulation. Because he lacked information on rates of water loss at various Tes, Walsberg could not estimate their rates of water loss in the respective environments. It would have been informative to estimate the potential costs to Phainopeplas of remaining in the Sonoran during summer.

Optimization processes For heuristic purposes our conceptual model compartmentalizes aspects of energy expenditure, water balance, and thermoregulation that are potentially important for the survival of desert birds (Figure 1). We end this paper with the thought that, in reality, each of these compartments is inextricably linked to the others. For resident birds that do not drink, foods that they choose must contain adequate water, energy, and other nutrients to satisfy their requirements (MacMillen 1990). The dietary items selected by birds, such as insects, seeds, or other vegetable material, have consequences for both energy and water balance. A diet of seeds alone (< 10% H2O) may be able to satisfy energy requirements, but may fall short of fulfilling water needs. This explains why granivorous birds typically drink during hot periods in the desert. Insects contain ample water (~ 65% H2O) and energy, but may not be abundant enough to meet all nutrient requirements. Opportunism and omnivory would seem to be the best strategy of diet selection among desert birds, especially in hyperarid deserts. Choice of dietary items can be viewed as an optimization process governed BIRDS by availability of foods and current needs. As environments become less harsh, T e.g., in more semi-arid areas, and as primary production increases, criteria for diet DESER

selection should change. OF

Episodes of high Ta, common during summers in some deserts, pose a serious VIOR challenge to the physiological capacities of birds. Elevated heat loads require BEHA evaporative water loss by means of increased cutaneous and respiratory water AND loss. The evolution of reduced rates of metabolism can lead to lower rates of water loss. In addition, evaporative water loss can be minimized by seeking patches of shade, and sometimes these spots are large enough to permit foraging. ECOLOGY

However, at extreme Tas when thermoregulatory costs are highest, seeking deep shade and pressing the body against cooler substrates limit foraging. Hence,

when evaporative demands are potentially the highest, water intake is lowest. PHYSIOLOGICAL 57 Birds may allow their Tb to rise in these situations, reducing evaporative water

loss that otherwise would be necessary to regulate Tb at lower levels, but they can

not afford to allow Tb to rise much higher than 45 °C. The costs associated with

elevated Tb have not been determined but may take the form of a compromised immune function or enzyme function. Although the costs and benefits of behavioral and physiological adjustments to heat and aridity are not sufficiently understood, it is clear that models of survival in desert environments must combine energy, water, and thermoregulation, rather than consider each as a discreet unit.

Acknowledgments Funding for this project has been supplied by the National Science Foundation (JBW), the Columbus Zoo (JBW), the National Wildlife Research Center, Taif, Saudi Arabia (JBW and BIT), the Stichting Dr. Catharine van Tussenbroek (BIT) and the Schuurman Schimmel van Outeren Stichting (BIT). We thank C. Beuchat, D. Goldstein, and B. Mauck for helpful comments on selected portions of the manuscript and W. Dawson and M. Webster for commenting on the entire manuscript. We thank V. Nolan for his efforts at editing our work and Heerko Tieleman for making Figure 1.

58 BIRDS T DESER OF VIOR BEHA AND ECOLOGY PHYSIOLOGICAL

CHAPTER 3 The adjustment of avian metabolic rates and water fluxes to desert environments

B. Irene Tieleman and Joseph B. Williams Physiological and Biochemical Zoology 73: 461-479. 2000. ABSTRACT We tested the hypothesis that birds in arid environments, where primary productivity is low and surface water is scarce, have reduced energy expenditure and water loss compared with their mesic counterparts. Using both conventional least squares regression and regression based on phylogenetically independent contrasts, we showed that birds from desert habitats have reduced basal and field metabolic rates compared with species from mesic areas. Previous work showed that desert birds have reduced rates of total evaporative water loss when exposed to moderate environmental temperatures in the laboratory. We tested whether reduced rates of total evaporative water loss translate into low field water fluxes. Conventional analysis of covariance indicated that desert birds have reduced water fluxes, but an analysis based on phylogenetically independent contrasts did not support this finding, despite the wide array of taxonomic affiliations of species in the data set. We conclude that the high ambient temperatures, the low primary productivity, and the water scarcity in desert environments have selected for or resulted in reduced rates of energy expenditure and evaporative water loss in birds that live in these climes.

ABSTRACT Introduction

High ambient air temperatures (Ta), low primary productivity and lack of surface water place deserts among the most extreme terrestrial environments on earth. One might expect that birds living in desert conditions require specific physiological and behavioral adaptations. Low primary productivity could constrain energy intake and potentially favors individuals with low rates of energy expenditure (Louw and Seely 1982; Williams and Tieleman 2001). Likewise, lack of surface water ostensibly limits water intake and could select for low evaporative and excretory water losses. Despite these predictions, early work on metabolism and water flux of birds did not show any general physiological differences between desert and non-desert species (Bartholomew and Cade 1963; Bartholomew 1964; Dawson and Schmidt-Nielsen 1964; Serventy 1971; Dawson 1984). Since then, some studies on desert birds, typically on a single species, have reported low basal metabolic rate (BMR; Dawson and Bennett 1973; Weathers 1979; Arad and Marder 1982; Withers and Williams 1990), field metabolic rate (FMR; Nagy 1987), and water flux (Nagy and Peterson 1988). Still, apparently due to the lack of general comparisons, the idea that desert birds do not possess unique physiological adaptations to their environment has persisted (Maclean 1996). Dawson and Bartholomew (1968), who originally suggested a lack of physiological adaptations among desert birds, cautioned that most early work was based on birds from North American deserts, regions that are relatively young on an evolutionary time scale (Axelrod 1983; Mead 1987), and suggested that adding species from Old World deserts might alter our concepts about physiological adjustments of birds to desert environments. During the past 2 decades, studies of birds in the deserts of Africa, the Middle East, and Australia have substantially increased the number of species for which data on energy and water balance are available. A first step towards understanding the physiological adaptations that enable birds to exist in arid environments, might come from a comparison of laboratory traits like BMR and total evaporative water loss (TEWL) between desert and non-desert species. Laboratory measurements gain evolutionary significance if one finds consistent patterns in data collected in the field, where natural selection operates on a combination of physiology and behavior. Since the FLUXES TER advent of the doubly labeled water technique (Lifson and McClintock 1966; A W Nagy 1975; Speakman 1997), there are now sufficient field data on energy AND expenditure and water flux of birds to determine if the results from laboratory TES measurements can be extended to field situations. In addition, the introduction RA of statistical methods that take into account phylogeny (Felsenstein 1985a; Harvey and Pagel 1991; Garland et al. 1992) justifies a re-evaluation of BMR, ABOLIC MET FMR, and water flux in desert birds compared with their non-desert counter- VIAN parts. A 63 A review based on 102 species showed that TEWL is lower in desert birds compared with non-desert species, at least when measured in the laboratory at 25 °C (Williams 1996). This finding suggests one or more physiological mechanisms that may reduce evaporative water loss (Tieleman and Williams 1999; Tieleman et al. 1999) and that may affect field water fluxes in desert birds. In a compila- tion of field water fluxes, Nagy and Peterson (1988) found that desert birds (n = 5) had lower water fluxes than non-desert birds. However, their conventional least squares regression analysis included multiple data for the same species, an approach that inflates the degrees of freedom for statistical tests and that may bias estimates of the slope and intercept in regression analysis (Pagel and Harvey 1988). Desert birds can potentially reduce TEWL and water flux if they reduce BMR and FMR, respectively, thereby producing less heat. Although several authors have suggested that desert birds have a reduced BMR compared with non-desert species (Dawson and Bennett 1973; Weathers 1979; Arad and Marder 1982; Withers and Williams 1990; Schleucher et al. 1991), a formal comparative analysis has not been performed. Recently, Nagy et al. (1999) have reported that FMR of desert species was 50% of FMR for non-desert birds, but their analysis did not take into account phylogenetic relatedness between species. In this paper, we examine the relationships between BMR, FMR, water flux, and body mass in birds, and investigate whether these traits are reduced in desert birds compared with birds from mesic environments. First, we use conventional least squares regression, a technique that assumes an evolutionary model where all species have radiated from a common ancestor and have evolved at equal rates (Purvis and Garland 1993). Second, we use Felsenstein’s (1985a) method of phylogenetically independent contrasts to attempt to control for relatedness between species in an evolutionary model where species are placed in a branching hierarchical phylogeny. The specific questions that we address are: 1. Do birds from desert environments have a lower BMR than birds from mesic habitats? 2. Do birds from desert regions have a reduced FMR compared with birds from mesic areas? 3. Do birds from desert environments have a low water flux in comparison with birds from non-desert areas?

Material and Methods Basal metabolic rate (BMR) is measured under a specified set of experimental conditions that renders it an important basis of comparison among species (King 1974). We assembled data for BMR that were obtained on post-absorptive, inactive birds in darkened metabolic chambers during the rest-phase of their circa-

dian cycle at thermally neutral Tas. Some species show seasonal variation in BMR, whereas others do not (Weathers 1980; Piersma et al. 1995; Dawson and 64 O’Connor 1996). We included species in our analysis regardless of the time of year measurements were made. We excluded studies that did not adequately describe experimental conditions (e.g., Kendeigh et al. 1977), studies that reported resting metabolic rate (sensu Bennett and Harvey 1987) instead of BMR, and studies that did not establish a thermoneutral zone (e.g., Yarbrough 1971). FMR and water flux have been determined in a wide variety of field situations, often during the nestling phase of the breeding season. We included data from studies that used the doubly labeled water (DLW) technique on free living birds without regard to time of the year, but excluded data on incubating birds. This excluded eight species, all from mesic areas, and excluded data on several penguins that fast for extensive periods during incubation. In cases where studies reported several values (e.g., per season) for one species, or in cases where a number of independent studies reported values for the same species, we averaged the data to obtain one value per species. We excluded data for water flux of species that were not in water balance during the study (Weathers and Nagy 1980; Weathers and Nagy 1984). The classification of species as desert or non-desert is problematic because desert conditions are the result of a variety of factors, such as solar radiation, rainfall,

Ta and wind, which taken together form a continuum. We followed the judge- ment of the original authors in placing a species in the desert or non-desert category. We used the topology of Sibley and Ahlquist (1990), based on DNA-DNA hybridization, to construct a phylogeny of the 139 bird species in our analysis (Figure 1). Species that were not included in Sibley and Ahlquist (1990) were placed close to sister species, either with the advice from specialists or based on the classification scheme of Sibley and Monroe (1990). Branch lengths were based on ∆T50H values, unless the species were part of an unresolved polytomy, in which case we assigned an arbitrary branch length of one (Williams 1996). Common and taxonomic species names follow Sibley and Monroe (1990). For each analysis (BMR, FMR, water flux), we used the appropriate subset (Table 1) of the phylogenetic tree (Figure 1). We used the PDTREE module of the Phylogenetic Diversity Analysis Program (version 4.0, Garland et al. 1993, Garland et al. 1999) to compute Felsenstein’s FLUXES TER (1985a) standardized independent contrasts for log-transformed values of body A W mass (g), BMR (kJ day-1), FMR (kJ day-1) and water flux (ml day-1). To test AND whether the contrasts were adequately standardized, we regressed the absolute TES values of the standardized contrasts against the standard deviations and verified RA that none of the variables (log BMR, log FMR, log water flux, log body mass) showed a linear trend (Garland et al. 1992; Garland 1993). When a variable ABOLIC MET showed a linear trend, we performed a square root transformation of the branch VIAN lengths and obtained proper standardization (Díaz-Uriarte and Garland 1998). A 65 Figure 1. Hypothesized phylogenetic relationship of nonpasserine (1-77) and passerine (78- ∆ 139) birds. Branch lengths are T50H values based on DNA-DNA hybridization (Sibley and ∆ Ahlquist 1990). Total T50H units = 28.0. Numbers refer to the species in Table 1.

66 ,

Reference Withers 1983, Williams et al. 1993 Maloney and Dawson 1993 Goldstein and Nagy 1985 Pekins et al. 1992, 1994 Johnson 1968, Thomas et al. 1994 Roberts and Baudinette 1986 Roberts and Baudinette 1986 Alkon et al. 1982, 1985, Degen 1983 Kam et al. 1987 Degen et al. 1983, Kam 1987 Weathers et al. 1990 Williams et al. 1991b Reyer and Westerterp 1985 Bryant et al. 1984 onments. 17.7 29.3 66.8 20.5 3129 WF (ml/day) 90.8 77.4 om arid and mesic envir 656.7 326.0 195.0 269.7 160.3 210.0 18040.0 ds fr FMR (kJ/day) . 57.0 31.8 54.9 63.8 58.0 25.7 espectively 428.3 205.6 5195.2 3240.8 , r BMR (kJ/day) , FMR and WF 95400, 88250, 88250 40700 145 1131 326, 368.3, - 44.9 95.8 -, 426.3, 446.2 -, 187.7, 184.9 73.1, 82.3, 82.3 75.9 76 33.8 mass (g) 1 efer to BMR a a a m m m a a a m m m m E

eus

ovided they r us FLUXES

micivor e pr TER

us A

ops viridis W

Mer AND dix heyi udis Lagopus leucur

Phoeniculus purpur Melanerpes for yle r TES

nix pectoralis

Cer RA migan

Callipepla gambelii nix chinensis Ammoper

Cotur

Dendragapus obscur

Cotur uthio camelus oodpecker oodhoopoe oated Bee-eater ABOLIC tridge

Str Alectoris chukar ouse Body mass, basal metabolic rate, field rate and water flux (WF) of bir omaius novaehollandiae n W

Dr MET een W ee values for body mass ar VIAN opidae A ylidae 12 Pied Kingfisher 2 Emu 3 Gambel's Quail 10 Acor 11 Gr 4 Blue Gr 5 White-tailed Ptar 6 King Quail 7 Stubble Quail 8 Chukar 9 Sand Par 13 Blue-thr 1 Ostrich uthionidae ABLE 1. iciformes If thr T Species Struthioniformes Str Casuariidae Galliformes Phasianidae P Picidae Upupiformes Phoeniculidae Coraciiformes Cer Mer 67 Reference Bartholomew and Trost 1970 Calder and Schmidt-Nielsen 1967 Williams et al. 1991c Williams et al. 1991c Williams et al. 1991c Williams et al. 1991c Bucher 1981 Weathers and Schoenbaechler 1976, Williams et al. 1991c Lindgren 1973 Williams et al. 1991c Williams et al. 1991c Williams et al. 1991c Weathers and Caccamise 1975, Weathers and Caccamise 1978 Bucher 1985 Powers and Conley 1994 Powers and Nagy 1988 Weathers and Stiles 1989 Powers and Conley 1994 Weathers and Stiles 1989 6.3 7.35 44.1 25.1 11 11.1 14.47 15.2 11.72 WF (ml/day) 59.1 29.1 31.8 58.1 81.7 37.9 349.0 189.0 106.1 FMR (kJ/day) 25.3 68.4 37.8 31.8 54.2 54.8 52.7 126.2 295.3 107.9 273.7 256.4 103.1 128.5 BMR (kJ/day) 4.9 50 284.7 776.1 268.7, 307.0, 307.0 549.9 131.8, 145.0, 145.0 55.7 33.7, 27.9, 27.9 48.9 48.4, 62.8, 62.8 535.3 137.1 81.7 337.8 3.7 4.5 7.2 8.8 mass (g) 1 m a m a m a m a m m a m m m m m m m m E

ysia

ochr

nis clemenciae

hynchus magnificus

ostris chilochus alexandri

Ar Lampor nianus d Calyptor d Chalybura ur ophila dius zonarius Cacatua galerita Amazona viridigenalis Thalurania colombica

nar hynchus lineola Calypte anna Colius striatus

Bar d Cacatua tenuir

d richoglossus haematodus T ot Bolbor r Myiopsitta monachus ella Neophema elegans oseicapilla

Geococcyx califor Neophema petr ot

Melopsittacus undulatus oodnymphs r ot r ested Cockatoo oated Hummingbir

Cacatua r Continued. unner -cr ed Parakeet t Lincoln Par r een-cheeked Amazon onze-tailed Plumeleteer owned W 28 Black-chinned Hummingbir 14 Speckled Mousebir 15 Roadr 16 Sulfur 17 Galah 18 Long-billed Cor 19 Por 20 Bar 21 Budgerigar 22 Elegant Par 23 Rock Par 24 Red-tailed Black Cockatoo 25 Rainbow Lorikeet 26 Monk Parakeet 27 Gr 29 Anna's Hummingbir 30 Br 31 Blue-thr 32 Cr ochiliformes ochilidae ABLE 1. sittaciformes r r

68 T Species Coliiformes Coliidae Cuculiformes Neomorphidae P Psittacidae T T Reference Ganey et al. 1993 Gessaman 1972, Ganey et al. 1993 Dawson and Fisher 1969 Withers and Williams 1990, et al. 1995 Vleck and 1979 Calder and Schmidt-Nielsen 1966, Calder and Schmidt-Nielsen 1967 Lasiewski and Seymour 1972, MacMillen and Trost 1967 Hinsley et al. 1993 Williams and Little, unpubl. Hinsley et al. 1993 Vander Haegen et al. 1994 Speakman 1984 Kersten and Piersma 1987 Castro et al. 1992 Piersma, Cadee and Daan 1995 Kersten and Piersma 1987 Kersten and Piersma 1987 18.4 17.4 WF (ml/day) 73.5 141.0 FMR (kJ/day) 35.2 36.5 77.0 23.2 84.8 92.1 85.5 76 231.1 384.7 284.3 150.1 168.3 134.8 153.8 251.4 BMR (kJ/day) 571 2024 1000 88 89, 86.9, 86.9 131 314.6 40.4 242.9 195 386.4 156.7 149 114 54.6 130 226 554 mass (g) 1 m m m a a m m m a a a m m m m m m m E

gus FLUXES

ocles bicinctus es

eauxi TER r ocles orientalis A Pter W

ola ostopodus ar ocles alchata ginianus Pter

Eur AND Pter ouse

Scolopax minor ringa totanus

ouse T enaria interpr

Leptotila ver

Bubo vir Ar TES ouse

Geophaps plumifera RA

Haematopus ostralegus

Strix occidentalis Pluvialis squatar Nyctea scandiaca oodcock ed Nightjar Calidris alba Columbina inca nstone Calidris canutus ned Owl ur Columba livia ABOLIC catcher Continued. MET ey Plover eat Hor VIAN oclididae A ostopodoidae 36 Spotted-ear 33 Spotted Owl 37 Spinifex Pigeon 44 American W 49 Gr 34 Snowy Owl 35 Gr 38 White-tipped Dove 39 Pigeon 40 Inca Dove 42 Double-banded Sandgr 43 Black-bellied Sandgr 45 Common Redshank 46 Ruddy T 47 Sanderling 48 Red Knot 50 Oyster 41 Pin-tailed Sandgr ABLE 1.

T Species Strigiformes Strigidae Eur Columbiformes Columbidae Ciconiiformes Pter Scolopacidae Charadriidae 69 Reference Gabrielsen et al. 1991 Cairns et al. 1990 Roby and Ricklefs 1986 Mehlum et al. 1993, Roby and Ricklefs 1986 Roby and Ricklefs 1986 Gabrielsen et al. 1987 Flint and Nagy 1984 Masman et al. 1988 Birt-Friesen et al. 1989 Adams et al. 1991 Ballance 1995 Kooyman et al. 1992 Davis et al. 1989 Nagy and Obst 1992 Moreno and Sanz 1996 Davis et al. 1989 Gales and Green 1990 Nagy et al. 1984 Drent and Stonehouse 1971 Obst et al. 1987 Montevecchi et al. 1992, Ricklefs 1986 Furness and Bryant 1996 Roby and Ricklefs 1986 Roby and Ricklefs 1986 Costa and Prince 1987 Adams et al. 1986 25.1 71.1 25.3 336 136.6 210.52 206 803 615.5 389.3 418.4 104.5 123.5 1419.6 1010 1430 WF (ml/day) 131.8 696.1 750.0 357.9 995.0 340.4 331.3 157.0 463.5 556.6 4865.0 4670.0 1789.0 1475.0 1224.3 4492.8 5603.0 5597.0 8294.4 1758.4 2414.3 1444.5 2401.9 3354.0 11232.0 FMR (kJ/day) 46.2 701 731 820.65 BMR (kJ/day) 163.7 940 834 -, 400, 380 83.5 391.6 184 196.2 3030, 3210, - 2620 1069.9 13000 -, 4233.3, 3900 3985 3806 -, 6000, 6100 1043.8 3170 3870 42.2 47.5, 45.1, 47.7 755.4 119.2 132.3 3706.5 8417 mass (g) 1 m m m m m m m m m m m m m m m m m m m m m m m m m m E

gicus

hoa

ysostoma ctica

ysolophus oma leucor

Pelecanoides geor

ylle el

Rissa tridactyla us glacialis Pelecanoides urinatrix Oceanites oceanicus Diomedea chr Oceanodr

us bassanus el Diomedea exulans el

Spheniscus humboldti el Pygoscelis antar os Uria lomvia Sula sula Eudyptes chr Spheniscus demersus

Falco tinnunculus Mor os e us capensis Fulmar Uria aalge Pygoscelis papua

r Cepphus gr Pygoscelis adeliae

na fuscata el e Eudyptula minor Aptenodytes patagonicus r

Mor m-petr Aethia pusilla m-petr

Ster gia Diving-petr n

Alle alle n Gannet n Fulmar er oni Penguin Continued. ther ther ey-headed Albatr ilson's Stor andering Albatr 51 Dovekie 58 Common Kestr 59 Nor 62 King Penguin 70 W 52 Common Mur 53 Thick-billed Mur 54 Black Guillemot 55 Least Auklet 56 Black-legged Kittiwake 60 Cape Gannet 61 Red-footed Booby 63 Macar 64 Adelie Penguin 65 Chinstrap Penguin 66 Gentoo Penguin 67 Little Penguin 68 Jack-ass Penguin 69 Humboldt Penguin 71 Leach's Stor 72 Nor 73 South Geor 74 Common Diving-petr 75 Gr 76 W 57 Sooty T ocellariidae ABLE 1.

70 T Species Laridae Falconidae Sulidae Spheniscidae Pr Reference Pettit et al. 1988 Vleck and 1979 Vleck and 1979 Vleck and 1979 Vleck and 1979 Weathers and Stiles 1989 Weathers et al. 1996 Rooke et al. 1983 Weathers et al. 1996 Weathers et al. 1996 Rooke et al. 1983 Degen et al. 1992 Hayworth and Weathers 1984 Hayworth and Weathers 1984 Veghte 1964 Weathers and Nagy 1980 Bryant and Tatner 1988 Mock 1991 Moreno and Carlson 1989, et al. 1995 8.7 7.7 9.4 5.4 10.7 12.5 12.3 525 WF (ml/day) 52.9 77.6 75.9 95.0 69.8 34.0 79.1 112.1 251.9 2072.0 FMR (kJ/day) 38.7 29.6 25.7 24.1 21.5 27.4 27.8 48.1 59.1 36.5 21.1 126.9 103.2 BMR (kJ/day) 3064 45.2 21 14.5 15.6 8.2 9.7 12.4 17.3 14.6 11.4 61.8 151.9 158.9 71.2 22.7 64.2 27.5 15, 12.4, - mass (g) 1 m m m m m m m a m m a a m m m a m m m E

ostris

ontalis hoptera r ons FLUXES

hynchus guttatus

nis fr TER A

Xiphor W

Sericor Manacus vitellinus hynchus tenuir Phylidonyris novaehollandiae

us cyaneus en AND Ficedula hypoleuca

eeper Pipra mentalis Phylidonyris pyr Pica nuttalli

Pica pica Ephthianura albifr

Malur TES Diomedea immutabilis ubwr Acanthor Lanius excubitor RA oodcr Thamnophilus punctatus eus canadensis en Sialia mexicana oss ed Manakin Phainopepla nitens d ywr

Perisor owed Scr onted Chat ABOLIC oated W n Shrike Cinclus cinclus n Spinebill Continued. MET n Bluebir ther f-thr ey Jay escent Honeyeater ellow-billed Magpie opean pied Flycatcher ester VIAN A vidae dalotidae nariidae 78 Buf 87 White-br 79 Slaty Antshrike 80 Red-capped Manakin 82 Superb Fair 83 Easter 88 Nor 92 Phainopepla 93 Dipper W Eur 77 Laysan Albatr 81 Golden-collar 84 White-fr 85 New Holland Honeyeater 86 Cr 90 Black-billed Magpie 91 Gr 89 Y ABLE 1. asseriformes yrannidae

T Species P Fur Thamnophilidae T Maluridae Meliphagidae Par Laniidae Cor Bombycillidae Cinclidae Muscicapidae 94 95 71 Reference Moreno 1989, Tatner 1990, Moreno and Hillstrom 1992 Tatner and Bryant 1986 Utter 1971 Ricklefs and Williams 1984 Webster and Weathers 1988 Dykstra and Karasov 1993 Moreno et al. 1988 Carlson et al. 1993 Moreno et al. 1988 Daan et al. 1990 Carlson et al. 1993, Moreno 1988 Bryant and Westerterp 1980, Hails 1979, Westerterp and Bryant 1984 Westerterp and Bryant 1984 Bryant et al. 1984 Williams 1988 Utter and LeFebvre1973, 1971 Westerterp and Bryant 1984 Rooke et al. 1983 Ambrose et al. 1996 Anava and Degen, unpubl. Williams unpubl. 3.1 7.8 5.6 9.66 3.6 4.5 4.9 20.4 42.1 18.4 31.9 18.1 28.5 WF (ml/day) 91.4 30.0 76.6 44.2 93.0 64.8 60.8 47.4 51.4 40.6 44.2 87.2 81.7 43.0 121.0 299.5 101.0 109.6 130.7 156.2 117.4 FMR (kJ/day) 35.4 13.4 16.6 16.4 35.6 BMR (kJ/day) 22.5, 24.3, 24.3 18.6 46.9 75.5 6.6 10.5 9.5 12.8 11.1 18 -, 11.4, 11.3 18.1 19.1 14.1 19.7 49 14.3 -, 9.9, 9.5 11.7, 12, 12 73.3 27.3, 27.1, 27.1 mass (g) 1 m m m m a m m m m m m m m m m m m m a a a E

ochlamys teri

ubecula

Delichon urbica ythr ustica

Mimus polyglottos

nus vulgaris tin nis car

d doides squamiceps undo tahitica Oenanthe oenanthe ur Stur undo r T Hir ogne subis ops lateralis Erithacus r emior oglodytes aedon us cinctus achycineta bicolor us cristatus Hir Pr r T thilauda er us flaviceps us montanus Er T Riparia riparia Par us major

Par d us ater tin Cer Par Zoster it en tin it

r Par it Par n House Mar

Auripar it n Mockingbir n Wheatear it -eye Continued. ther n Swallow din ther ther eat T ested T opean Robin illow T ee Swallow er r opidae nidae thiidae 100 V 113 Silver 98 Nor 102 Coal T 107 Nor 114 Spinifex-bir 116 Dune Lark 96 Nor 97 Eur 99 Common Starling 101 House W 103 Siberian T 104 Cr 105 Gr 106 W 108 Bar 109 Pacific Swallow 110 T 111 Purple Mar 112 Sand Mar 115 Arabian Babbler undinidae ABLE 1.

72 T Species Stur Cer Paridae Hir Zoster Sylviidae Alaudidae ence

Refer Marschall and Prinzinger 1991 Marschall and Prinzinger 1991 Marschall and Prinzinger 1991 Weathers and Nagy 1984 Weathers 1977 Marschall and Prinzinger 1991 Calder 1964, Marschall and Prinzinger 1991 Williams and DuPlessis 1996 Pohl and West 1973 Dawson and Carey 1976 Weathers 1981, et al. 1980 Weathers 1981 Weathers et al. 1983 Weathers and Van Riper III 1982 Dawson and Carey 1976 Weathers and Sullivan 1993 Weathers and Sullivan 1993 Weathers 1981 Stephenson and Minnich 1974 Williams and Hansell 1981, 1987, Williams and Nagy 1985a Weathers 1981 Hinds and Calder 1973 Hinds and Calder 1973 7.7 4.6 9.4 11.1 15.5 WF(ml/day) 57.4 71.7 77.8 48.7 76.6 FMR(kJ/day) 8.6 18.5 18.7 11.3 15.2 26.6 17.5 27.9 30.0 32.0 26.8 25.8 40.0 29.0 31.2 17.3 26.2 41.7 43.4 34.2 BMR(kJ/day) 17.2 15.5 7.5 6.7 9.5 25.4 12.1 25.5 14.5 13.8 26.8 20.4 13.5 36 13.6 19.6 19.7, 19.5, 19.7 11.6 20 17.7, 18.1, 19.1 46.3 41.3 32 mass (g) 1 m m m m m m a a m m m a m m m m m a m m m m a E FLUXES

oglodytes dinalis TER A W culus sandwichensis

us socius Amphispiza bilineata duelis tristis l Estrilda melpoda Estrilda tr Agelaius phoeniceus yzivora dinalis car duelis flammea AND Car d ow Junco phaeonotus Passer r Car axbil Car Junco hyemalis Philetair TES

Chloebia gouldiae axbill

ow dinalis sinuatus duelis pinus Carpodacus cassinii Melospiza melodia

Padda or r RA Lonchura fuscans aeniopygia guttata Carpodacus mexicanus

T dinal Car Car Amadina fasciata ow eaver ow r

r Himatione sanguinea oated Spar n Car oat umped W

Loxioides bailleui ABOLIC Continued huloxia ther r MET ellow-eyed Junco onment: a = arid, m mesic VIAN A 125 Common Redpoll 117 Cut-thr 118 Gouldian Finch 119 Orange-cheeked W 120 Black-r 121 Dusky Munia 122 Java Spar 123 Zebra Finch 124 Sociable W 126 Pine Siskin 127 Cassin's Finch 128 House Finch 129 Apapane 130 Palila 131 American Goldfinch 132 Dark-eyed Junco 133 Y 134 Black-thr 135 Song Spar 136 Savannah Spar 137 Red-winged Blackbir 138 Nor 139 Pyr ABLE 1. E Envir Fringillidae T Species 1 Passeridae 73 Regression analyses of the standardized independent contrasts for log BMR, log FMR, and log water flux against those for log body mass, forced through the origin (Garland et al. 1992; Garland and Janis 1993), yielded estimates of the slopes of these relationships without the effects of genealogical history. To determine the intercepts, we solved the equation Y = a + bX, where X and Y are the root-node contrast values for log BMR (or log FMR or log water flux) and log body mass, respectively (Garland et al. 1999). The degrees of freedom were calculated as the number of independent contrasts minus the number of unresolved branches (Purvis and Garland 1993). To determine whether desert birds differed from those from mesic environments with respect to BMR, FMR and water flux, we calculated independent contrasts for environment scored as 0 for desert and 1 for non-desert (Williams 1996). Plots of the standardized independent contrasts of environment and their standard deviations revealed whether standardization had been adequate. If standardization was inadequate we performed square root transformations of the branch lengths that successfully eliminated the linear trends. Using stepwise multiple regression through the origin, we tested for the influence of environment on BMR, FMR and water flux in birds with the standardized contrasts of these log- transformed variables as the dependent variable and the standardized contrasts of environment and log body mass as independent variables (Williams 1996). The entry criterion for selection of variables in the equation was P = 0.05. Statistical tests were carried out with the PDTREE module in the Phylogenetic Diversity Analysis Program (version 4.0, Garland et al. 1992; Garland et al. 1999) or with SPSS version 7.5 for Windows (SPSS Inc., Chicago, USA). Means are presented ± 1 SD.

Results Basal Metabolic Rate Based on conventional analysis, log BMR varied positively with log body mass among all birds with a slope of 0.638 (equation 1, Table 2). Analysis of covariance (ANCOVA) for equations for desert and non-desert species (Table 2)

revealed that the slopes of these two equations did not differ significantly (F1, 78 = 0.247, P = 0.62). Assuming a common slope, the intercept was significantly lower for the equation for desert birds (equation 2) than for non-desert species

(equation 3) (F1, 79 = 9.534, P = 0.003). Using phylogenetically independent contrasts, log BMR varied positively with log body mass among all birds with a slope of 0.677 (equation 4, Table 3). A stepwise multiple regression through the origin of standardized contrasts for log BMR as dependent variable and standardized contrasts of log body mass, environment, and the interaction between log body mass and environment as independent

74 TABLE 2. Allometric equations based on conventional least squares regression analyses. Equations are presented as log Y = a + b log M, where Y can be basal metabolic rate (BMR; kJ/day), field metabolic rate (FMR; kJ/day) or water flux (WF; ml/day), and M is mass (g).

2 equation Y a b n r SEintercept SEslope P

1 all birds BMR 0.575 0.638 82 0.96 0.030 0.014 <0.001 2 desert BMR 0.505 0.644 21 0.036 0.014 <0.001 3 non-desert BMR 0.584 0.644 61 0.028 0.014 <0.001 7 all birds FMR 0.983 0.703 81 0.93 0.046 0.021 <0.001 8 desert FMR 0.741 0.704 15 0.050 0.017 <0.001 9 non-desert FMR 1.035 0.704 66 0.037 0.017 <0.001 13 all birds WF 0.159 0.719 58 0.87 0.079 0.037 <0.001 14 desert WF -0.126 0.724 17 0.075 0.028 <0.001 15 non-desert WF 0.263 0.724 41 0.062 0.028 <0.001 variables disclosed that the latter interaction had an insignificant effect (t = 0.28, P = 0.78), while environment had a significant effect in the equation (t = 2.82, P < 0.01). We then separated the data on BMR based on the environment, generated a phylogenetic tree for each subset of data (based on Figure 1), and calculated an equation for desert and non-desert birds (equations 5 and 6, Table 3). Hence, desert birds had a reduced BMR using both methods of analysis (Figure 2).

Field Metabolic Rate Conventional analysis of log FMR versus log body mass for all birds yielded a slope of 0.703 (equation 7, Table 2). We compared FMR between desert birds FLUXES TER A W AND TES RA

Figure 2. Logarithmic plot of basal metabolic rate in desert birds (unfilled symbols) and non- ABOLIC desert birds (filled symbols) versus body mass. The allometric equations obtained by the method MET VIAN of phylogenetically independent contrasts are plotted for desert birds (dotted line) and non-desert A species (solid line). 75 TABLE 3. Allometric equations based on phylogenetically independent constrast analyses. Equations are presented as log Y = a + b log M, where Y can be basal metabolic rate (BMR; kJ/day), field metabolic rate (FMR; kJ/day) or water flux (WF; ml/day), and M is mass (g). CI is 95% confidence interval.

2 equation Y a b df r CIintercept CIslope Fslope

4 all birds BMR 0.416 0.677 52 0.89 0.204-0.628 0.623-0.731 626.5 5 desert BMR 0.304 0.702 17 0.96 0.061-0.547 0.632-0.772 442.2 6 non-desert BMR 0.595 0.616 41 0.80 0.326-0.864 0.535-0.697 233.5 10 all birds FMR 0.907 0.671 56 0.85 0.639-1.175 0.606-0.736 431.9 11 desert FMR 0.719 0.691 12 0.96 0.456-0.982 0.610-0.772 351.6 12 non-desert FMR 0.969 0.676 44 0.83 0.892-1.046 0.383-0.969 316.2 16 all birds WTO 0.150 0.659 41 0.64 -0.356-0.656 0.525-0.793 98.7

and non-desert species with ANCOVA and found that the slopes of equations

were not significantly different (F1, 77 = 1.7, P < 0.20). Assuming a common slope, equation 8, for desert birds, had a significantly lower intercept than did

equation 9, for non-desert species (F1, 78 = 49.6, P < 0.001). The relationship between log FMR and log body mass among all birds, that resulted from a regression of independent contrast analysis, had a slope of 0.671 (equation 10, Table 3). Stepwise multiple regression of standardized contrasts for log FMR as dependent variable and standardized contrasts of log body mass, environment, and the interaction between log body mass and environment as independent variables revealed that environment had a significant effect in the equation (t = 2.11, P < 0.04), whereas the interaction had no significant influence (t = -1.57, P = 0.12). We then separated the data on FMR based on environment, constructed a phylogenetic tree for each data det (based on Figure 1), and calculated equations for each environmental category (equations 11 and 12, Table 3). Birds from deserts had a significantly lower FMR in both methods of analysis (Figure 3A).

Field Water Flux Based on conventional analysis of data for all birds, log water flux related to log body mass with a slope of 0.719 (equation 13, Table 2). We tested for differences in water flux between desert and non-desert birds using ANCOVA, and found that the slopes of the regression lines for desert and non-desert species did not

differ significantly (F1, 54 = 0.9, P = 0.34) (Figure 3B). Assuming a common slope, equation 14, for water flux in desert birds, had a significantly lower intercept

than equation 15, for non-desert species (F1, 55 = 40.7, P < 0.001). The regression for log water flux and log body mass in all birds, based on phylogenetically independent contrasts, had a slope of 0.659 (equation 16). Stepwise multiple regression of standardized contrasts for log water flux as dependent variable and standardized contrasts of log body mass, environment, and the interaction between the latter two as independent variables revealed that neither the 76 Figure 3A. Logarithmic plot of field metabolic rate in desert birds (unfilled symbols) and non- desert birds (filled symbols) versus body mass. The allometric equations obtained by the method of phylogenetically independent contrasts are plotted for desert birds (dotted line) and non-desert species (solid line). Figure 3B. Logarithmic plot of field water flux in birds from desert (unfilled symbols) and non-desert (filled symbols) habitats versus body mass. The allometric equations generated with conventional analysis are plotted for desert (dotted line) and non-desert species (solid line). The equation for all birds obtained with the method of phylogenetic independent contrasts is represented by the thick solid line. FLUXES TER A W AND

interaction term (t = -0.52, P = 0.60) nor environment had a significant effect TES in the equation (t = 0.68, P = 0.50). In contrast to our conventional analysis, the RA phylogenetic analysis did not reveal a significantly reduced water flux in desert ABOLIC

birds compared with their non-desert counterparts. MET VIAN A

77 Elimination of seabirds from analyses Our initial analyses could be questioned because we included seabirds and terrestrial birds into our category of non-desert species. We repeated the comparison of BMR, FMR and water flux between desert and non-desert birds with both comparative methods, but eliminated seabirds (Laridae, Sulidae, Procellariidae, and Spheniscidae) from the data set. Results were consistent with our analyses that included all birds: BMR and FMR were reduced in desert birds compared with their mesic counterparts, irrespective of the comparative method used. Water flux was significantly lower in desert birds based on conventional analysis, but not based on independent contrasts.

Discussion We have shown that birds from desert habitats have a reduced BMR and FMR compared with species that live in mesic areas. The low energy expenditure of desert birds is accompanied by reduced rates of total evaporative water loss (TEWL) in the laboratory (Williams 1996). Water flux was reduced in desert birds when evaluated using conventional ANCOVA, but the analysis based on phylogenetically independent contrasts did not yield a significant reduction in water flux in desert birds. Usually, if data are phylogenetically diverse as in this study, phylogenetic and conventional analysis arrive at similar conclusions (Weathers and Siegel 1995; Ricklefs and Starck 1996). The broad representation of taxa in our analyses (Table 1) and in the analysis of TEWL (Williams 1996) supported the hypotheses that reductions in the rates of energy expenditure and evaporative water loss of desert birds are adjustments to their environment where primary productivity is low and surface water is scarce, and indicated that these conclusions were not solely based on a few taxonomic groups that have reduced rates of metabolism and water loss in general. The extent to which reduced rates of metabolism and water loss in desert birds are attributable to genetic differences, to acclimatization, or to a combination of both remains unresolved.

Basal Metabolic Rate We used two comparative methods to determine the relationship between BMR and body mass for all birds. Although the slope and intercept of our conventional least squares regression equation fell within the 95% confidence intervals around the slope and intercept of the equation based on phylogenetically independent contrasts, the predictions made by the two lines differed considerably (Table 4). BMR of a 10-g bird as predicted by equation (4) based on independent contrasts was 24% lower than when predicted by conventional analysis. Comparing our equation (4) for BMR with another phylogenetically corrected equation for BMR in birds, based on a Monte Carlo simulation (log BMR =

78 0.625 + 0.635 log M, Reynolds and Lee 1996), we found a steeper slope and a TABLE 4. Comparison of predicted rates of BMR from equation (1), based on conventional analysis, equation (4), based on phylogenetically independent contrasts and the equation provided by Reynolds and Lee (1996).

BMR (kJ d-1) equation (1) equation (4) Reynolds and Lee (1996) mass (g) CA PIC

10 16.3 12.4 18.2 100 71.0 58.9 78.6 1000 308.3 279.9 339.2 lower intercept. This resulted in lower predictions for BMR when the predictions were based on our phylogenetic analysis (Table 4). The allometric equation of Reynolds and Lee should be used with caution, because there is no evidence that Monte Carlo simulations give unbiased estimates of slope and intercept. In addition to the Monte Carlo simulation, Reynolds and Lee analyzed their data using phylogenetically independent contrasts and found a slope of 0.722. Compared with the slope from our analysis using independent contrasts, 0.677, their slope is larger, but still falls within our 95% confidence interval of 0.632 - 0.731. The differences between our equations and the ones published by Reynolds and Lee (1996) may be partly the result of different criteria for BMR. Their analyses are based to a large degree on data from Bennett and Harvey (1987), who did not restrict their analysis to BMR, but included data for resting birds that might include some costs of thermoregulation. Furthermore, Bennett and Harvey (1987) included data published by Kendeigh et al. (1977), who did not provide a detailed description of their methods. To test if the night-time measurements of BMR for 121 species, that were reported by Kendeigh et al. (1977) but had not been published in peer-reviewed journals, were consistent with data published in peer-reviewed journals, we compared these two data sets with conventional ANCOVA. The slopes of the regression lines through each data set did not differ significantly (F1, 200 = 1.4, P > 0.24), but the intercept was significantly higher by

10% for the equation based on the data of Kendeigh et al. (1977) (F1, 201 = 15.2, P < 0.001). If allometric equations for BMR are to provide a reference for comparative work, data should be carefully selected prior to analyses. FLUXES Both comparative methods support the hypothesis that desert birds generally TER A have a reduced BMR (Table 5). Based on conventional ANCOVA, we found a W

reduction of 17% in BMR from desert birds compared with their non-desert AND

counterparts, independent of body mass. Based on the analysis that took into TES account the phylogeny of birds, the reduction in BMR varied from 38% in a 10- RA g bird to 7% in a 1000-g bird. Despite the agreement of both methods that desert ABOLIC

birds generally have a reduced BMR, problems arise when one attempts to com- MET pare predictions for mesic birds with those for desert birds. For example, predic- VIAN tions of BMR for desert birds using conventional analysis correspond closer to A 79 Table 5. BMR, FMR and water flux as predicted for 10, 100 and 1000-g birds using the allometric equations obtained by conventional ANCOVA and by the method of phylogenetically independent contrasts. Values are geometric means.

Conventional analysis Phylogenetic analysis mass (g) arid mesic arid mesic

BMR (kJ d-1) 10 14.1 16.9 10.1 16.3 100 62.1 74.5 51.1 67.1 1000 273.5 328.1 257.0 277.3 FMR (kJ d-1) 10 27.9 54.8 25.7 44.2 100 140.9 277.3 126.2 209.4 1000 712.9 1402.8 619.4 993.1 water flux (ml d-1) 10 4.0 9.7 100 21.0 51.4 1000 111.2 272.3

predictions for non-desert species than to those for desert species based on independent contrasts (Table 5). Reductions in BMR can result from a smaller amount of metabolically active tissue, and/or metabolic tissue that is less active per unit mass. Less metabolically active tissue, can be reflected in the size of a number of organs that have been shown to contribute substantially to BMR, e.g. heart, kidneys, brain and intestine (Daan et al. 1990; Konarzewski and Diamond 1995; Piersma et al. 1996; Kersten et al. 1998). Less active metabolic tissue, can result from differences at the cellular level, such as reduced thyroxine secretion rates (Yousef and Johnson 1975; Scott et al. 1976; Merkt and Taylor 1994), fewer Na+-K+-pumps, fewer mitochondria per unit tissue, a decreased total mitochondrial inner membrane area, or lower protein turnover (Rolfe and Brown 1997).

Field Metabolic Rate Using two comparative methods we obtained allometric equations that relate FMR to body mass in all birds. The slope and intercept of the conventional least squares regression were within the 95% confidence intervals of those for equation (10) based on independent contrasts. The slopes and intercepts of earlier allometries for FMR, based on conventional least squares regression analyses (Nagy et al. 1999) and smaller sample sizes (Nagy 1987; Williams et al. 1993), also fell within the 95% confidence intervals for slope and intercept of equation (10). Despite the general agreement between methods, the difference in predictions of FMR from conventional and phylogenetic analyses is a concern. Predictions based on independent contrasts (equation 12) are 22 - 33% lower for birds over a body size range of 10 - 1000-g than predictions based on conventional least squares regression (equation 7). 80 Desert birds had a significantly lower FMR than non-desert species, irrespective of the comparative method used for this analysis. Based on conventional ANCOVA we found that FMR was reduced by 49% in desert birds compared with non-desert species, a confirmation of the conclusion by Nagy et al. (1999). In agreement with this result, the independent contrast comparison revealed a reduction of about 40% in desert birds. Despite general agreement about the reduced FMR of desert birds, predictions for FMR of desert and non-desert species based on either of the comparative methods may differ (Table 5). Reductions in FMR can be brought about by physiological and/or behavioral adjustments. The corresponding finding of a 17% reduction in BMR in desert birds suggests that the reduction in FMR is only partially attributable to physiological differences. The relatively high Tas in many deserts might decrease the energetic costs for thermoregulation compared with some non-desert areas, thereby reducing FMR in desert birds. In addition, some desert species spend long periods at rest in the shade during the middle part of the day, a behavior that could reduce FMR. Desert environments have three characteristics that might influence selection on FMR and BMR. First, the low primary productivity would favor individuals with low FMR. Low FMR would be accompanied by relatively low reproductive outputs, and reflected in reduced BMR and small organs (Daan et al. 1990).

Second, the relatively high Tas in deserts reduce thermoregulatory requirements and might result in a combined reduction of FMR and BMR. As food intake likely decreases in parallel to energy demand, organ systems involved in catabolism or elimination of wastes can decrease in size when food intake decreases, thereby reducing BMR (Williams 1999, Williams and Tieleman 2000). Third, lack of drinking water may influence the energy balance of desert birds. In an environment where water is scarce, the need for evaporative cooling can be reduced by lowering endogenous heat production. Most likely, low primary productivity, high Tas and lack of drinking water act in concert to select for a combination of reduced FMR and BMR in desert birds. The relative importance of the different selective pressures may vary with season and might be revealed by experimental manipulations of energy and water resources. FLUXES TER

Field Water Flux A We described the relationship between water flux and body mass in all birds with W two allometric equations based on different statistical methods. The slope and AND TES

intercept of our conventional least squares regression equation, and those from RA earlier studies (Nagy and Peterson 1988; Williams et al. 1993), fell within the

95% confidence intervals around the slope and intercept of our equation based ABOLIC on phylogenetic analysis. Despite this general agreement, the equation based on MET VIAN independent contrasts predicted lower rates of water flux than the equation A based on conventional analysis. 81 Water fluxes of desert birds were 59% lower than those for non-desert species when the comparison was based on conventional ANCOVA (Table 5). In contrast, the stepwise multiple regression analysis using independent contrasts revealed no significant effect of environment on the water fluxes of birds. The con- flicting results produced by the different comparative methods caught us by surprise after the seemingly striking difference between the data for desert and non- desert species (Figure 3B). We have investigated the reasons for this disparity. The variance around the equation based on independent contrasts is considerably larger (r2 = 0.64, Table 3) than the variance around the equation based on conventional analysis (r2 = 0.87, Table 2). We explored whether differences could be attributed to a few outlying contrasts, but visual inspection of plots of contrasts did not reveal this to be a problem. A reduced water flux of desert birds in the field would correspond with the low TEWL rates for desert birds measured in the laboratory (Williams 1996), and would suggest the presence of physiological and behavioral mechanisms that reduce water loss in desert birds. Tolerance of hyperthermia has been suggested to reduce evaporative water loss in birds (Calder and Kink 1974; Weathers 1981; Dawson 1984; Withers and Williams 1990), but no evidence is available to suggest that desert birds elevate their body temperature more than non-desert species (Tieleman and Williams 1999). Second, some birds may reduce cutaneous water loss by altering the lipid composition of their skin (Webster and Bernstein 1987; Menon et al. 1989). Third, desert birds may have the ability to minimize water lost during expiration, either by exhaling unsaturated air (Withers et al. 1981), or by recovering water with the aid of counter-current heat exchange in the nasal passages (Schmidt-Nielsen et al. 1970). An experimental test of the latter hypothesis confirmed water recovery in one of two lark species, but only at

Tas up to 25 °C (Tieleman et al. 1999). A fourth way to reduce evaporative water loss would be an improved potential for dry heat loss, through an increased dry

heat transfer coefficient (h) when Tas are below body temperature, and through

a decreased h when Tas exceed body temperature. Fifth, desert birds may minimize excretory water loss, although currently there is no evidence that the concentrating ability of their kidneys is improved over non-desert species (Goldstein and Braun 1989; Williams and Tieleman 2001). Sixth, reduced metabolic heat production would decrease the need for evaporative cooling in desert birds. Seventh, desert birds may increase their oxygen extraction efficiency to reduce ventilation and concurrent evaporative water loss. In addition to these physiological mechanisms, behavioral adjustments, including microclimate selection (Wolf et al. 1995; Wolf and Walsberg 1996; Williams et al. 1999) and reduced activity during the middle part of the day (Schleucher 1993; Hinsley 1994), probably play an important role in minimizing water loss in desert birds in the field. An oft-applied measure to express the effectiveness of mechanisms that conserve 82 water is the water economy index (WEI; ml water kJ-1), calculated as the ratio of water flux and FMR (Nagy and Peterson 1988). Nagy and Peterson (1988) hypothesized that desert vertebrates conserve water more effectively than their non-desert relatives, but found no statistical support when they tested this hypothesis in birds. After calculating the WEI, and verifying that the WEI was not related to body mass, we compared the WEI for desert and non-desert birds. The average WEI for desert species (0.16 ± 0.061, n = 14) was significantly lower than for non-desert birds (0.20 ± 0.089, n = 40; t = -1.65, P = 0.05). Interpretations of the WEI are complex because water flux values do not necessarily reflect minimum water requirements, confounding inferences about water conserving mechanisms based on WEI values. The WEI can be interpreted in light of the environmental context of a species only if one makes assumptions about drinking and about water and energy content of the diet. Assuming that water and energy intake reflect minimum requirements, one might expect a low WEI for animals in cold environments, where little or no evaporative cooling is required and a high metabolism is needed for thermoregulation. In contrast to this situation, many desert birds live in environments with high Tas where the need for evaporative cooling is potentially large. Given the low rates of metabolism of desert birds, one would not expect an unusually low WEI if water flux reflected these thermoregulatory needs. A reduced water flux can only be accomplished if either a large amount of water lost for evaporative cooling is compen- sated by a small loss of water through excretory pathways, or if the potential for heat loss via non-evaporative pathways is increased, reducing the amount of water required for evaporative cooling. Therefore, under the assumption that water and energy intake reflect minimum requirements, the combination of a reduced FMR and a low WEI in desert birds suggests that water may dictate energy expenditure in desert environments.

Different Results from Different Comparative Methods This article addresses the question if birds in desert environments differ from non-desert species with respect to three potentially adaptive traits (BMR, FMR, and water flux), using multi-species comparisons that included species from the entire taxonomic spectrum of the modern-day avifauna. In light of the ongoing FLUXES debate about the proper statistical analysis for multi-species allometries TER A

(Weathers and Siegel 1995; Westoby et al. 1995; Ricklefs and Starck 1996; W

Martins and Hansen 1996; Starck 1998), we used two comparative methods, AND

namely conventional ANCOVA and regression analysis based on phylogeneti- TES cally independent contrasts (Felsenstein 1985a; Garland et al. 1992). Although RA Ricklefs and Starck (1996) have found that the results of these two methods are usually in agreement, we found some striking differences in our results. ABOLIC Qualitatively, the two methods agreed that desert birds have reduced BMR and MET VIAN

FMR, but disagreed about whether this was also the case for water flux. A 83 Quantitatively, predicting BMR, FMR and water flux from the allometric equations obtained by the two comparative methods resulted in large differences. The discussion about comparative methods has focused on finding the correct statistical approach, but considering the variety of goals for which comparative analyses are used, one can imagine that different purposes require different approaches. As long as the issue of how to correct for phylogeny is subject to debate (Miles and Dunham 1993; Weathers and Siegel 1995; Westoby et al. 1995; Ricklefs and Starck 1996; Martins and Hansen 1996; Björklund 1997; Starck 1998), it might be wise to combine broad multi-species comparisons with intra-family or intra-specific comparisons to strengthen conclusions about adaptation.

Acknowledgments A. Anava, A. Degen and R. Little allowed us to use their unpublished data. We thank S. Daan, M. Starck, T. Garland, R. Taylor and four anonymous reviewers for comments on a previous draft. Financial support for this work was provided by the Foundation Dr. Catharine van Tussenbroek (B.I.T.).

84 FLUXES TER A W AND TES RA ABOLIC MET VIAN A

PART II Physiology and behavior of larks along an aridity gradient

CHAPTER 4 Adaptation of metabolism and evaporative water loss along an aridity gradient

B. Irene Tieleman, Joseph B. Williams, and Paulette Bloomer Proceedings of the Royal Society London B: in press. 2002. ABSTRACT Broad scale comparisons of birds indicate the possibility of adaptive modification of basal metabolic rate (BMR) and total evaporative water loss (TEWL) for species from desert environments, but these might be confounded by phylogeny or phenotypic plasticity. This study relates variation in avian BMR and TEWL to a continuously varying measure of environment, aridity. We test the hypotheses that BMR and TEWL are reduced along an aridity gradient within the lark family (Alaudidae), and investigate the role of phylogenetic inertia. For 12 species of larks, BMR and TEWL decreased along a gradient of increasing aridity, a finding consistent with our hypotheses. We constructed a phylogeny for 22 species of larks based on sequences of two mitochondrial genes, and investigated whether phylogenetic affinity played a role in the correlation of phenotype by environment. A test for serial independence of the data for mass-corrected TEWL and aridity showed no influence of phylogeny in our findings. However, we did discover a significant phylogenetic effect in mass-corrected data for BMR, a result attributable to common phylogenetic history or to common ecological factors. A test of the relationship between BMR and aridity using phylogenetic independent constrasts was consistent with our previous analysis: BMR decreased with increasing aridity.

ABSTRACT Introduction Terrestrial vertebrates continuously expend energy to carry out chemical processes necessary to sustain life, and constantly lose water through respiration, cutaneous evaporation and excretion. Rates of energy expenditure and water loss vary considerably among and within vertebrate taxa even under standard laboratory conditions. The reasons underlying this variation have been the focus of an intensive area of research, and are still only partially understood (Kleiber 1961; Bartholomew & Cade 1963; Crawford & Lasiewski 1968; Aschoff & Pohl 1970; McNab 1986; Nagy 1987; Bennett 1988; Williams 1996; Mueller & Diamond 2001). Basal metabolic rate (BMR), minimal energy expenditure of a fasted endotherm in its rest phase at thermoneutral temperatures (King 1974), integrates all catabolic energy transformations required for bodily maintenance. BMR correlates with energy expenditure of free-living animals (Nagy 1987; Daan et al. 1990; Ricklefs et al. 1996), and with life history attributes such as growth and reproduction (Kleiber 1961; Bennett 1988; Harvey et al. 1991; Trevelyan et al. 1990; Hulbert & Else 2000). Total evaporative water loss (TEWL), the sum of respiratory and cutaneous water losses, constitutes a significant proportion of an animal's total water loss, up to 70-80% in small birds, when measured at 25 °C (Lee & Schmidt-Nielsen 1971; Bartholomew 1972; Dawson 1982; Williams 1996). Both BMR and TEWL appear in part genetically determined suggesting that natural selection could operate on these variables (Konarzewski & Diamond 1995; Furuyama & Ohara 1993). After correcting for body mass and higher level taxonomic affiliations, a large variation in metabolism and TEWL remains (Kleiber 1961; Crawford & Lasiewski 1968; Dawson 1982; McNab 1988; Williams 1996). Differences in BMR and TEWL have been reported between species or populations differing in diet, altitude, latitude, temperature and aridity (Dawson & Bennett 1973; Weathers 1979; Nagy 1987; McNab 1988; Nagy et al. 1999; Williams & Tieleman 2001), but a unifying environmental characteristic that determines the metabolic physiology of animals has not been identified. Mueller and Diamond LARKS

(2001) reported that primary productivity explains 88% of the variation in BMR OF among five species of Peromyscus mice, and suggested that food availability, a LOSS correlate of primary productivity, might be a unifying explanatory variable for TER A metabolic physiology. One might predict also that water availability is a major W

factor explaining variation in TEWL. TIVE Previous work on BMR and TEWL has compared species from disparate envi- APORA ronments such as tropics versus temperate or desert versus non-desert EV

(Scholander et al. 1950; Bartholomew & Cade 1963; Dawson & Schmidt- AND Nielsen 1964; Dawson & Bennett 1973; Weathers 1979; Dawson 1984; Williams

1996; Tieleman & Williams 2000). However, use of a dichotomous categoriza- ABOLISM tion of environments might obscure useful biological information. Climatologists MET 91 have long recognized that environments form a continuum with respect to meteorological parameters, and have emphasized that, for example, the environment of a given desert depends on the interaction of a number of variables including temperature, amount and timing of rainfall, relative humidity and wind (Thornthwaite 1948; Meigs 1953). Our study is the first to relate variation in avian physiological variables to a continuously varying measure of environment, aridity. Aridity is directly related to primary productivity (Emberger 1955) and provides a proxy for the selection pressures that animals experience with increasing aridity, including decreasing water and food availability and increasing air temperatures. The challenge in understanding interspecific phenotype by environment correlations is to distinguish the contributions of the various processes that underlie the pattern, including genetic adaptation, phylogenetic inertia (Gould & Lewontin 1979; Westoby et al. 1995; Hansen 1997) or phenotypic responses (acclimatization). Our limited understanding of the time scale at which natural selection and other evolutionary processes operate has resulted in two main approaches to questions in evolutionary biology, the phylogenetic comparative method and the optimality approach. Comparative methods that take into account potential effects of phylogeny emphasize the historical component of adaptation (Gould & Vrba 1982), and implicitly rule out the possibility that a trait is maintained as an adaptation by stabilizing selection (Frumhoff & Reeve 1994; Westoby et al. 1995; Hansen 1997). In contrast, optimality studies assume that traits with ample genetic variation, such as most quantitative characters (Houle 1992; Lynch 1988), are likely maintained by stabilizing selection (Hansen 1997). A comparative approach with an optimality viewpoint of adaptation would assume that each species is at an optimum (Hansen 1997). One way to reduce problems relating to differences in phylogenetic history is to compare traits among closely related species (Coddington 1988; Bennett 1988; Price 1991; Leroi 1994). The family of larks (Alaudidae) occurs over a wide range of environments and continents with representatives in habitats ranging from hyperarid deserts to mesic grasslands (Cramp 1988; Pätzold 1994). Because all larks eat similar foods, a mixture of insects and seeds, diet is not a confounding variable in our analyses. This family provides a model to investigate physiological adaptation to environment. This study tests the hypotheses that lower levels of BMR and TEWL in birds are correlated with increasing aridity, and investigates the role of phylogenetic inertia in shaping the relationship between physiology and environment. We constructed a phylogeny of larks based on two mitochondrial genes and investigated if phylogeny could explain the variation in BMR and TEWL. We used conventional and, when appropriate, phylogenetically corrected analyses to examine 92 the relationships between aridity, BMR and TEWL. Material and Methods Animals We mist-netted Hoopoe Larks (Alaemon alaudipes), Dunn’s Larks (Eremalauda dunni), Desert Larks (Ammomanes deserti), Black-crowned Finchlarks (Eremopterix nigriceps) and Crested Larks (Galerida cristata) at various sites in the west-central Arabian Desert (Table 1), and housed them in outdoor aviaries at the National Wildlife Research Center, near Taif, Saudi Arabia. Calandra Larks (Melanocorypha calandra) from Iran were transported to Saudi Arabia and kept at the NWRC. We caught Skylarks (Alauda arvensis) and Woodlarks (Lullula arborea) in the province of Drenthe, The Netherlands, and kept them in outdoor aviaries at the Zoological Laboratory of the University of Groningen. We measured metabolism and evaporative water loss of all birds in Saudi Arabia and in The Netherlands between June and August of 1998-2001. Birds were measured in postabsorptive state and during their nocturnal phase by standard flow-through respirometry and hygrometry methods (Williams & Tieleman 2000; Tieleman et al. 2002c). In addition we used data for Spike-heeled Larks (Chersomanes albofasciata) from Kimberley, South Africa (C. Brown, unpublished), for Short-toed Larks (Calandrella brachydactyla) and Lesser Short-toed Larks (Calandrella rufescens) from the North Caspian region, USSR (Shishkin 1980), for Stark’s Lark (Eremalauda starki) and Grey-backed Finchlarks (Eremopterix verticalis) from the Namib Desert (Willoughby 1968), and for Horned Larks (Eremophila alpestris) from North America (Trost 1972). For all of these species, birds were measured during spring or summer, in post-absorptive state, and during their rest phase.

Environmental aridity

We calculated an aridity index as Q = P/((Tmax + Tmin)(Tmax - Tmin)) * 1000, where

P is average annual precipitation (mm), Tmax is the mean maximum temperature of the hottest month (°C) and Tmin is the mean minimum temperature of the coldest month (°C) (Emberger 1955). Although perhaps intuitively not straightforward, this index has been empirically derived to describe primary productivity in arid and semi-arid areas (Emberger 1955). The index is low in hot, dry deserts LARKS OF and high in cool, wet areas. We collected climatic data from local or national meteorological institutes, from literature (Walter & Lieth 1967; Williams 2001) LOSS TER and from http://www.worldclimate.com/ or http://www.onlineweather.com/ A W (Table 1). Because Q increases rapidly when environments become more mesic, TIVE we avoided unequal weighing of data for mesic species by using log Q in our analyses (Table 1). APORA EV

Phylogeny of larks AND The geographical origins of the DNA samples of all larks in our phylogeny are available on request from the authors. DNA was extracted from blood or tissue ABOLISM MET samples using standard protocols (50 mM Tris, pH 7.6, 100 mM NaCl, 1 mM 93 .com; C) ° ( 8.1 8.1 2.7 -1.2 -2.4 -0.7 -0.7 10.7 10.7 10.7 10.0 10.0 -13.7 -13.7 ger (1955) based min T .onlineweather C) http://www 4 ° ( 34.8 40.2 40.2 40.2 33.0 33.0 35.7 35.7 37.0 30.2 30.2 32.6 21.7 21.7 max T alter and Lieth (1967); W 3 89.6 89.6 89.6 57.2 57.2 309.9 209.1 209.1 250.0 281.0 281.0 420.4 750.0 750.0 P (mm) ecipitation; onmental aridity index (Q) was calculated following Ember ologisch Instituut. ). 2.41 1.78 1.78 1.78 1.76 1.76 2.24 2.24 2.26 2.59 2.59 2.60 3.20 3.20 Log Q min e (T illiams (2001), includes fog pr 06' W ° 2 40'/W 118 ° 50' 50' 09' 03' 03' 42' 42' 00' 51' 51' 42' 52' 52' Koninklijk Nederlands Meteor 7 ° ° ° ° ° ° ° ° ° ° ° ° ° aif, Saudi Arabia; E 15 E 15 E 24 E 41 E 41 E 41 E 41 E 41 E 51 E 46 E 46 E 52 E 52 W 116 Longitude , T ) and minimum temperatur max e (T ch Center 35' ° .worldclimate.com; onmental aridity for 14 species of larks. The envir 15' 15' 55' 15' 15' 00' 17'/N 34 25' 25' 52' 52' 34' 34' 48' ildlife Resear ° ° ° ° ° ° ° ° ° ° ° ° ° ° http://www 6 N 22 N 22 N 22 S 23 S 23 N 21 N 21 N 35 N 33 N 49 N 49 S 28 N 52 N 52 Latitude vice; 1 National W 3, 6 1 2 3, 6 ces: eather Ser 3, 6 3, 4 1 1 5 1 t-toed lark 2 Geographic origin and envir 1 7 owned Finchlark 7 ecipitation (P), maximum temperatur t Lark t-toed Lark ned Lark ey-backed Finchlark ested Lark oodlark ABLE 1. U.S. National W Shor Black-cr Calandra Lark W Hor Skylark Climate data sour Dunn's Lark Deser Stark's Lark Gr Cr Lesser Shor Spike-heeled Lark T Species 5 on pr 94 Hoopoe Lark EDTA, pH8.0, 0.5% SDS, 1mg/ml Proteinase K and 0.1 mg Rnase A). Impurities were removed by phenol/chloroform extraction and total genomic DNA was ethanol-precipitated and eluted in sterile distilled water. Polymerase chain reaction amplification (PCR) (Saiki et al. 1988) followed standard protocols (Kocher et al. 1989). The cytochrome b gene was amplified using two primer sets: L14990 (shortened primer L14841 of Kocher et al. (1989)) and H15696 (primer H15547 of Edwards et al. (1991)); L15245 (modified primer CB4a-L of Palumbi et al. (1991)) and H16064 (located in the tRNAthr). A portion of the 16S rRNA gene was amplified using primers L2313 and H4015 (Lee et al. 1997). Successful amplicons were purified using a High PureTM PCR Purification kit (Roche Diagnostics). We sequenced DNA using the four PCR primers for the cytochrome b gene, and H4015 and an internal primer L2925, designed for passerines in our laboratory (5' AGCCATCAACAAAGAGTGCG 3'), for the 16S rRNA gene. Sequences of the light and heavy strands were determined using dye-terminator cycle sequencing (Big Dye DNA sequencing kit, Applied Biosystems) and an ABI377 or ABI3100 automated DNA sequencer (Applied Biosystems). Sequences for each taxon were proofread in Sequence Navigator and complete sequences were aligned in Clustal X (Thompson et al. 1997). We analyzed the aligned sequences with PAUP 4.0 using multiple heuristic searches with default settings (Swofford 1998). We assessed the resolution of internal nodes with 1000 bootstrap replicates with random replacement (Felsenstein 1985b). Phylogenetic signal was determined by evaluating tree-length distribution of 1000 randomly generated trees (Hillis & Huelsenbeck 1992). In addition to unweighted parsimony analysis, we attempted to reduce homoplasy by down- weighting characters based on their consistency indices (Farris 1969). Pairwise estimates of nucleotide sequence divergence were calculated using the HKY85 model (Hasegawa et al. 1985). Gene sequences are deposited in GenBank.

Phylogenetic effect Correlations among species may be statistically biased if sister taxa tend to be LARKS OF similar to one another as a result of common ancestry (Felsenstein 1985a; Cheverud et al. 1985; Harvey & Pagel 1991). To evaluate whether a phylogene- LOSS TER A

tic effect [sensu Grafen (1989) and Harvey and Pagel (1991)] exists among the W larks in this study, we used a test for serial independence to determine if there TIVE was a significant positive autocorrelation for either mass-corrected BMR, mass- APORA

corrected TEWL or aridity (Reeve & Abouheif 1999; Abouheif 1999). In each EV

simulation the topology was randomly rotated 2000 times per iteration and the AND original data were shuffled 2000 times in order to provide the null hypothesis

sampling distribution (Reeve & Abouheif 1999). We calculated mass-corrected ABOLISM x BMR and mass-corrected TEWL by dividing BMR and TEWL by mass , where x MET 95 is the slope of the allometric equations relating log BMR and log TEWL to log body mass in 12 species of larks, respectively (see results). The test for serial independence is more suitable for smaller data sets than other phylogenetic autocorrelation methods (Cheverud et al. 1985; Gittleman & Kot 1990; Martins & Hansen 1996; Abouheif 1999). If no phylogenetic effect exists, then incorporating phylogeny in statistical methods is unnecessary (Gittleman & Kot 1990; Björklund 1997; Abouheif 1999). If a phylogenetic effect does exist, this may be attributable to phylogenetic constraint or to ecological factors and corrections for phylogenetic relationships may or may not be appropriate (Westoby et al. 1995).

Statistics We performed analyses of variance and regression analyses with SPSS 10.0 and calculated phylogenetic independent contrasts (Felsenstein 1985a) with the PDTREE module in the computer program PDAP (Garland et al. 1992). We calculated the degrees of freedom as N - Pu, where N is the number of independent contrasts and Pu is the number of unresolved polytomies (Purvis & Garland 1993).

Results Physiology and environment For 12 species of larks BMR was related to body mass as log BMR (kJ/day) = 2 0.225 + 0.901 log mass (g) (r = 0.53, df = 11, SEslope = 0.269, P = 0.007; Table 2). A multiple regression analysis with log BMR as the dependent variable and log mass and log Q (aridity) as independent variables showed that both body mass (t = 6.17, P < 0.0001) and aridity (t = 6.08, P < 0.0001) had a significant effect on BMR: log BMR = -0.194 + 0.845 log mass + 0.208 aridity (r2 = 0.91, df = 11, P < 0.0001). BMR of larks increased as the environment became more mesic (Figure 1A). Total evaporative water loss among larks was related to body mass as log TEWL 2 (g/day) = -0.814 + 0.816 log mass (g) (r = 0.72, df = 11, SEslope = 0.162, P = 0.001; Table 2). We used multiple regression analysis to assess the effect of aridity on TEWL: log TEWL = -0.903 + 0.684 log mass + 0.121 aridity (r2 = 0.87, df = 11, P < 0.0001). Mass and aridity both had a significant effect on TEWL (log mass t = 5.50, P < 0.0001, aridity t = 3.12, P = 0.011), a finding consistent with the hypothesis that larks have a lower TEWL with increasing aridity (Figure 1B). Because aridity was correlated with latitude (Table 1, r = 0.84, n = 9, P = 0.005), we performed stepwise multiple regression analyses with log BMR or log TEWL as the dependent variable and log mass, latitude and aridity as independent variables. The models with the best fit to the data (see above) included log mass

96 and aridity, but not latitude (BMR, t = 1.85, P = 0.10; TEWL, t = 1.17, P = 0.28). 6 2 6 10 15 14 6 16 21 n 0.24 0.57 0.36 0.53 0.88 0.70 0.26 0.49 0.62 SD TEWL 2.44 3.03 1.34 2.08 3.33 3.47 2.41 1.31* 1.31* 1.60 1.69 2.59 TEWL 31.2 50.6 15.2 26.0 25.0 31.7 25.5 15.1 15.6 21.5 20.5 36.9 mass ) for 14 species of larks (mass; g). -1 6 2 6 27 8 20 29 20 6 22 21 n 2.30 1.07 1.10 3.08 6.73 4.98 8.43 9.96 2.46 2.61 4.45 SD BMR own (unpublished). C.Br 4 BMR 32.2 49.5 16.5 28.6 31.6 35.6 29.1 62.4 49.4 20.1 24.7 32.8 ) and total evaporative water loss (TEWL; g day LARKS -1 OF ; kJ day LOSS TER Shishkin (1980); 3 A W 31.2 50.6 15.2 26.0 23.6 24.0 25.7 32.0 25.6 21.5 20.9 36.9 mass TIVE ost (1972); r 3 APORA 1 T 2 EV 4 AND 3 2 t-toed Lark 1 Basal metabolic rate (BMR owned Finchlark ABOLISM t Lark t-toed Lark ned Lark MET illoughby (1968); ey-backed Finchlark ested Lark oodlark W ABLE 2. Calandra Lark Hor Cr * day-time values Lesser Shor Shor Spike-heeled Lark Skylark W Stark's Lark Deser Dunn's Lark Hoopoe Lark Black-cr T Species 1 Gr 97 Figure 1. Mass-adjusted basal metabolic rate (BMR) and total evaporative water loss (TEWL) of 12 species of larks as a function of environmental aridity. Symbols are species averages.

Hence aridity explained more of the variation in BMR and TEWL than latitude after body mass was taken into account.

Phylogeny of larks Cytochrome b (975 bases) and 16S rRNA (566 bp) sequences were generated for 22 species. In addition to the species for which ecophysiological data were available, we included other African species in an attempt to improve the resolution of the phylogenetic placement of our focal taxa. A heuristic search of the combined data set yielded two equally most parsimonious trees (length 1424 steps, CI = 0.407, RI = 0.492, g1 = -1.018 p < 0.001). One round of reweighting (using a base weight of 1) yielded a single tree of 579.27 steps (Figure 2; CI = 0.490, RI 98 = 0.559). Of the 378 parsimony informative characters, 41 had a weight of 1 and 337 a weight of <1, reflecting homoplasy in the data set. We performed bootstrap analysis with 1000 iterations using the Hoopoe Lark as outgroup (Figure 2). Several highly supported clades (>70% bootstrap support) were consistently retrieved (also in separate analyses of the two genes, trees not shown): basal placement of Spike-heeled Lark clade; Finchlarks/Desert Larks clade; Singing Bush Lark/Monotonous Lark clade; Lesser Short-toed/Athi Short-toed Lark clade; Skylark/Woodlark clade. Several currently recognized genera appear to be polyphyletic (e.g. Ammomanes, Certhilauda, Mirafra). A lack of resolution of some of the terminal nodes may be due to the relatively short internal branch lengths compared with the long terminal branch lengths. The divergence among these lark clades is also indicated by genetic distances ranging from 7-19% based on the cytochrome b gene and between 2.5-8% based on the 16S rRNA frag- ment. We did not have DNA sequence information for Calandra Lark, Horned Lark and Short-toed Lark. To apply the test for serial independence to all species for which we had ecophysiological data, we placed the Calandra Lark in the polytomy with Dune Lark/Sabota Lark, the Finchlark/Desert Lark clade, and a third clade containing Galerida, Lullula, Calandrella and others. We placed the Horned Lark as sister species to the Temminck's Horned Lark. For the Short-toed Lark we assumed that it was closely related to the Athi Short-toed Lark.

Phylogenetic constraint on BMR and TEWL? We found no significant phylogenetic autocorrelation in the data for mass-corrected TEWL or aridity, but a significant autocorrelation in the data for mass- corrected BMR (mass-corrected TEWL, P = 0.44; aridity, P = 0.09; mass-corrected BMR, P = 0.01). Therefore, the positive association between TEWL and aridity was not influenced by phylogenetic constraint. The significant phylogenetic autocorrelation in the data of mass-corrected BMR could be attributable to phylogenetic constraint or to ecological factors, indistinguishable alternatives (Westoby et al. 1995). Therefore, in addition to our conventional analysis, we LARKS OF tested if the relationship between mass-corrected BMR and aridity would be confirmed using phylogenetic independent contrasts (Felsenstein 1985a). A LOSS TER A

stepwise multiple regression analysis with contrasts of log BMR as dependent W variable, and contrasts of log mass and of aridity as independent variables, TIVE showed significant effects of log mass and aridity on log BMR (r2 = 0.88, df = 9, APORA

F = 32.36, P < 0.001; log mass t = 6.07, P < 0.001; aridity t = 4.83, P = 0.001). EV

Hence the result of the phylogenetic analysis was consistent with that of the AND conventional analysis; BMR of larks decreased with increasing aridity. ABOLISM MET

99 Figure 2. Phylogenetic tree of 22 species of larks based on cytochrome b and 16S rRNA sequences and analyzed using maximum parsimony criteria. Numbers above the branches indicate reweighted branch lengths and, between parentheses, percent bootstrap recovery in 1000 replications.

100 Discussion Basal metabolic rate and total evaporative water loss of 12 species of larks decreased along a gradient of increasing aridity, consistent with our hypothesis. These results confirm previous studies that found reduced BMR and TEWL in desert birds compared with species from mesic habitats (Dawson & Bennett 1973; Weathers 1979; Arad & Marder 1982; Williams 1996; Tieleman & Williams 2000), but the use of a continuous environmental classification in this study makes the argument more compelling. Whereas body mass alone explained 53% of the interspecific variation in BMR, adding aridity increased the explained variance to 91%. Similarly, body mass explained 72% of the variance in TEWL, while adding aridity increased the explained variance to 87%. A combination of low BMR and TEWL could be favorable in birds from dry, hot environments because it reduces food and water requirements and minimizes heat production. The value of comparisons within a group of closely related species is illustrated by the deviations of the allometries for BMR and TEWL of larks from those of all birds. The equation relating log body mass to log BMR in larks deviated from an allometry for all birds by -9% for a 15-g lark and by +25% for a 50-g lark (Tieleman & Williams 2000). BMR of desert larks was close to allometric predictions, in contrast to BMR of mesic larks that far exceeded predictions. Predictions of TEWL based on the lark allometry were lower than those based on an allometry including all birds (Williams 1996) by -26% for a 15-g lark and by -12% for a 50-g bird. Although TEWL of a lark from the desert was below allometric predictions, as expected, larks in general had a low TEWL. Hence, comparing BMR or TEWL of a single lark species to the all-bird allometry would have led to erroneous conclusions about the adaptive significance of these traits. The phylogeny of larks was characterized by long terminal branches and short internal branch lenghts (Figure 2). This, combined with the occurrence of larks in a wide array of habitats, may indicate that lark species rapidly radiated into different environments and lived a significant part of their evolutionary history in diverse habitats. One might predict that phylogenetic constraints are small, LARKS

that natural selection has had ample time to eliminate suboptimal phenotypes, OF and that the current trait values are of adaptive significance in the current envi- LOSS ronment. The lack of phylogenetic effect in the data of mass-corrected TEWL TER A implies that phylogenetic relatedness is not a major evolutionary factor explai- W

ning interspecific differences in TEWL. The positive phylogenetic autocorrela- TIVE tion in the data of mass-corrected BMR could indicate a phylogenetic constraint APORA or closely related species experiencing common ecological factors (Westoby et al. EV

1995). The correlation between BMR and aridity is not the result of phylogene- AND tic constraint, because the results of the contrast analysis are consistent with those of the conventional statistics. Therefore, other evolutionary forces than ABOLISM phylogenetic constraint are likely to underlie the correlations between BMR, MET 101 TEWL and environmental aridity. Interspecific phenotype by environment correlations can indicate genetic differences brought about by natural selection, or phenotypically plastic responses to environmental conditions. Plastic responses include changes in adult phenotype depending on the environment (acclimatization or acclimation) and differences among phenotypes resulting from developmental conditions (ontogenetic plasticity). In a separate study we found that the decrease in BMR and TEWL in larks along an aridity gradient can not be attributed to acclimation to thermal environment, food availability or photoperiod (Tieleman et al. 2003). In summary, decreasing levels of BMR and TEWL in larks correlate with increasing aridity. These physiological traits may have adaptive significance in the current environment and natural selection is a likely process to explain our findings. Identifying evolutionary processes that cause correlative associations between traits remains difficult (Leroi 1994), but we have eliminated phylogenetic constraint and acclimatization as likely alternative explanatory processes. The results of this study combined with the decrease in BMR in mice along an environmental gradient of decreasing primary productivity (Mueller & Diamond 2001) suggest that the decrease in energy and water requirements with decreasing food and water availability is a general pattern found in birds and mammals.

Acknowledgments We thank P. Paillat, A. Khoja, P. Seddon, M. Shobrak, S. Ostrowski, J.-Y. Cardona and the other staff at the National Wildlife Research Center, Taif, Saudi Arabia, for logistic support throughout this study. Wildlife research programs at the NWRC are possible through the generous support of HRH Prince Saud al Faisal and under guidance of A. Abuzinada of the National Commission of Wildlife Conservation and Development. We are grateful to C. Brown and K. Barnes for providing unpublished data on Spike-heeled Lark and Athi's Short- toed Lark, respectively, and to A. Kuzmenko for translating a russian article. We are grateful to W. Delport for assistance with DNA sequencing. G. Overkamp and the animal caretakers at the Zoological Laboratory provided valuable help and advice. We thank S. Daan and R. Ricklefs and two anonymous referees for commenting on a previous draft. Financial support for this study was made available by the Schuurman Schimmel van Outeren Foundation, the Schure Beijerinck Popping Foundation, the National Wildlife Research Center, the University of Groningen, the Ohio State University, and the National Science Foundation.

102 LARKS OF LOSS TER A W TIVE APORA EV AND ABOLISM MET

103

CHAPTER 5 Phenotypic variation of larks along an aridity gradient: are desert birds more flexible?

B. Irene Tieleman, Joseph B. Williams, Michael E. Buschur, and Chris R. Brown Ecology: in press. 2003. ABSTRACT We investigated interindividual variation and intra- individual phenotypic flexibility in basal metabolic rate (BMR), total evaporative water loss (TEWL), body tem-

perature (Tb), the minimum dry heat transfer coefficient (h) and organ and muscle size of five species of larks geographically distributed along an aridity gradient. We exposed all species to constant environments of 15 °C or 35 °C, and examined to what extent interspecific differences in physiology can be attributed to acclimation. We tested the hypothesis that birds from deserts display larger intra-individual phenotypic flexibility and smaller interindividual variation than species from mesic areas. Larks from arid areas had lower BMR, TEWL and h, but did not have internal organ sizes different from birds from mesic habitats. BMR of 15 °C-acclimated birds was 18.0%, 29.1%, 12.2%, 25.3% and 4.7% higher than of 35 °C- acclimated Hoopoe Larks, Dunn's Larks, Spike-heeled Larks, Skylarks and Woodlarks, respectively. TEWL of 15 °C-acclimated Hoopoe Larks exceeded values for 35 °C- acclimated individuals by 23%, but did not differ between 15 °C- and 35 °C-acclimated individuals in the other species. The dry heat transfer coefficient was increased in 15 °C-acclimated individuals of Skylarks and Dunn's Larks, but not in the other species. Body temperature was on average 0.4 °C (S.E.M. 0.15 °C) lower in 15 °C- acclimated individuals of all species. Increased food intake in 15 °C-acclimated birds stimulated enlargement of intestine (26.9-38.6%), kidneys (9.8%-24.4%), liver (16.5%-27.2%) and stomach (22.0%-31.6%). The pectoral muscle increased in 15 °C-acclimated Spike-heeled Larks and Skylarks, remained unchanged in Hoopoe Larks, and decreased in 15 °C-acclimated Woodlarks and Dunn's Larks. We conclude that the degree of intra-individual flexibility varied between physiological traits and among species, but that acclimation does not account for interspecific differences in BMR, TEWL and h in larks. We found no general support for the hypothesis that species from desert environments display larger intra-individual phenotypic flexibility than those from mesic areas. The coefficient of variation of larks acclimated to their natural environment was smaller in species from arid than from mesic areas for mass-corrected BMR and surface-specific h, but not for mass-corrected TEWL. The high repeatabilities of BMR, TEWL and h in several species indicated a within-individual consistency on which natural selection could operate. ABSTRACT Introduction Efforts to understand physiological diversity have traditionally concentrated on explaining variation among species from different environments whereas few studies have focused on intraspecific variation in physiological phenotypes, either between or within individuals. Because the geographical distribution of most species includes different environments, it is unlikely that a single phenotype has high fitness in all conditions. Phenotypic plasticity, a concept that includes changes in adult phenotypes depending on the environment (acclimatization or acclimation) and differences among phenotypes resulting from developmental conditions (ontogenetic plasticity), can be a solution to the problem of adaptation to spatially or temporally heterogeneous environments (Via et al. 1995; Schlichting & Pigliucci 1998). Variation in physiological phenotypes among species (interspecific variation) or among individuals within a species (interindividual variation) may involve a combination of genotypic diversity, that is potentially influenced by natural selection, and irreversible and/or reversible phenotypic adjustments. Reversible changes in individual phenotypes that reflect flexible responses to changing tasks have been termed phenotypic flexibility (Piersma & Lindström 1997). Although this intra-individual phenotypic flexibility is not mediated by heritable change, the capacity to change could be under the influence of natural selection. Why some species are more phenotypically plastic and/or genetically diverse than others has been strongly debated (Parsons 1987; Via et al. 1995; Parsons 1996; Schlichting & Pigliucci 1998). One hypothesis predicts that intra-individual phenotypic flexibility will be large in species from temporally heterogeneous environments where ecological situations vary in the course of an individual's life (Schlichting & Pigliucci 1998). The maintenance of interindividual variation among phenotypes appears dependent on the frequency of environmental change and on the spatial or temporal nature of heterogeneity of the environment. Spatial heterogeneity can maintain genetic variation and temporal heterogeneity favors phenotypic plasticity, both potentially resulting in phenotypic variation (Hedrick 1986; Schlichting & Pigliucci 1998). Despite a lack of water, scarce food resources and high ambient temperatures

(Ta), deserts harbor a number of bird species. Interspecific comparisons have shown that in these species basal and field metabolic rates are on average 17% and 49% lower, respectively, and total evaporative water loss rates (TEWL) LARKS about 35% lower than in birds from mesic areas (Williams 1996; Tieleman & OF

Williams 2000). These findings are consistent with the idea that birds in deserts TION ARIA have adjusted their physiology to the environment (Bartholomew & Cade 1963; V Dawson & Schmidt-Nielsen 1964; Serventy 1971; Dawson 1984; Withers & Williams 1990). The extent to which the differences in basal metabolic rate

(BMR) and TEWL between desert and non-desert species can be attributed to PHENOTYPIC 107 genetic adaptations or phenotypic plasticity remains obscure. Some birds adjust BMR in response to season (Kendeigh 1969; Pohl & West 1973; Piersma et al. 1995; Cooper & Swanson 1994) or to varying temperatures during acclimation experiments (Gelineo 1964; Williams & Tieleman 2000), whereas others do not change BMR in the field or in the laboratory (Hudson & Kimzey 1966; O’Connor 1995). Not only metabolic rates but also organs show flexibility in some birds, usually in response to alterations in diet or environment (Karasov 1996; Piersma & Lindström 1997). The flexibility of other components

of an individual’s physiology such as TEWL, body temperature (Tb) and the dry heat transfer coefficient (h) has received less attention (Williams & Tieleman 2000). Total evaporative water loss can be reduced in small granivorous birds in response to water deprivation (Cade et al. 1965; Dawson et al. 1979), but this

feature is usually not considered in the context of acclimation to Ta. We investigated intra-individual phenotypic flexibility and interindividual

variation in BMR, TEWL, h, Tb and organ sizes of five species of larks that are distributed over an aridity gradient. When aridity increases, decreasing water and

food availability and increasing Tas could exert stronger selection on the rates of metabolism and water loss in birds. Hoopoe Larks (Alaemon alaudipes) and Dunn's Larks (Eremalauda dunni) occur in arid deserts, Spike-heeled Larks (Chersomanes albofasciata) in semi-arid regions, and Woodlarks (Lullula arborea) and Skylarks (Alauda arvensis) live in mesic temperate habitats (Cramp 1988;

Pätzold 1994). We examined the extent to which acclimation to Ta contributes to interspecific differences in physiology. In addition, we tested the hypothesis that with increasing aridity, when selection pressures on the energy and water balance might be stronger and the temporal heterogeneity of the environment larger, birds display more intra-individual flexibility and less interindividual variation in their physiology than do species from more moderate climates.

Methods Animals Skylarks and Woodlarks were mist-netted in the late spring of 2000 in the northern part of the Netherlands (52°52'N 06°20'E), and housed in outdoor aviaries at the Zoological Laboratory of the University of Groningen. We captured Hoopoe Larks and Dunn’s Larks during June 2001 in Mahazat as-Sayd, a reserve in the west-central Arabian Desert (22°15'N 41°50'E) and transported them to the National Wildlife Research Center, near Taif, Saudi Arabia. Spike-heeled Larks were captured in May and October of 2001 on Benfontein game farm, Northern Cape, South Africa (28°50'S 24°50'E) and transferred to Rhodes University, Grahamstown. All birds spent 3-6 weeks in captivity prior to experimentation. Studies were carried out under license DEC 2425 from the Animal 108 Experimentation Committee of the University of Groningen. Protocol We measured BMR and TEWL of all birds before assignment to one of two groups, each with equal numbers of males and females; birds were similar in body mass in both assemblages for all species. Before pre-acclimation measurements birds were kept in outdoor aviaries under natural day length and climate conditions. One group of each species was then housed in a constant Ta room at 15±2

°C (12L:12D), a Ta below the thermoneutral zone of all species and close to the average Ta experienced by larks in the Netherlands during the breeding season.

We placed the other group in a room with a Ta of 35±2 °C (12L:12D), to mimic environmental temperatures of the Arabian Desert during spring. Birds were housed in cages of 1m x 1m x 2m. Absolute humidities were not controlled but 3 measured to be 5 to 7 g H2O/m in the 15 °C-rooms in all locations, and 9 to 12 3 g H2O/m in the 35 °C-rooms in the Netherlands and Saudi Arabia and 32 g 3 H2O/m in South Africa. We fed birds a mixture of seeds, insects, raw beef heart, and boiled eggs.

Metabolism and evaporative water loss We measured basal rates of oxygen consumption and TEWL for postabsorptive birds during their nocturnal phase using standard flow-through respirometry and hygrometry methods (Gessaman 1987; Williams & Tieleman 2000).

Measurements of BMR were made at Ta-values previously established to be within the thermoneutral zone of all species; 25 - 30 °C for Skylarks (n = 14), 30 °C for Woodlarks (n = 14), and 35 °C for Dunn's Larks (n = 16), Hoopoe Larks (n = 14) and Spike-heeled Larks (n = 20). The initial and final values for TEWL, the minimum h and Tb were based on measurements at 25 °C for all species. For the Spike-heeled Lark, we combined data for BMR of the experiments in May (cold + warm: n = 10) and in October (cold + warm: n = 10). For TEWL, h and

Tb for this same species we used data from October only, because we did not measure TEWL and Tb at 25 °C in May. Details of our laboratory set-up and measurement protocol in Saudi Arabia and the Netherlands and calculations of oxygen consumption and evaporative water loss are given elsewhere (Williams & Tieleman 2000; Tieleman et al. 2002c). In brief, birds were fasted for 3 hours prior to the start of our metabolism trials. They were then placed in a metabolic chamber on a wire-mesh platform over a layer

of mineral oil which trapped feces, thus excluding feces as a source of water in LARKS the measurements. Air coursed through drierite, soda lime and drierite, the OF

chamber, a General Eastern dewpoint hygrometer (M4-DP), and again through TION

drierite, soda lime and drierite, before passing through the Brooks mass flow con- ARIA V troller (model 5850E), a diaphragm pump and into an overflow from which the O2-analyzer sampled air (Applied Electrochemistry S3A-II in Saudi Arabia,

Servomex Xentra 4100 in the Netherlands). After a 2-3 h equilibration period, PHENOTYPIC

109 we recorded the oxygen concentration and dewpoint of inlet and outlet air, the

Ta of the dewpoint hygrometer and the chamber, using a Campbell Scientific data logger model 21X or CR23X. Outlet air had a relative humidity that was always below 25% (Lasiewski et al. 1966) and an oxygen concentration between 20.55 and 20.85%. When, during the third hour of measurements, the traces for oxygen consumption and dewpoint were stable for at least 10 min, we noted these times and used these data for calculations. In South Africa, Spike-heeled larks were fasted for 3 hours, weighed to ±0.1 g and then placed in a perspex metabolic chamber (29 x 18 x 18 cm) with an air- tight lid and on a wire mesh platform over a layer of mineral oil to trap feces. The chamber was placed inside a darkened constant temperature cabinet. A thermocouple was inserted into the chamber through a rubber stopper to measure cham-

ber Ta and a passive infra-red sensor mounted inside the chamber detected activity. Air, drawn from outside the laboratory, passed through columns of Drierite,

Ascarite and Drierite to remove CO2 and water vapor. Air then passed through a Sierra Side-Trak mass flow controller set at 700 ml min-1 before entering the chamber. Air exiting the chamber passed again through columns of Drierite, Ascarite and Drierite before a sub-sample was drawn through a Sable Systems

FC-1B O2-analyser. After a 60 min equilibration period, readings of %O2, flow rate, chamber temperature and bird activity were recorded at 20 s intervals for 2 hours using DATACAN V data acquisition software (Sable Systems, Las Vegas).

Percentage O2 of inlet air, assumed to be 20.95%, was measured before and after each experimental run using the Sable Systems computer-controlled baselining system. Calculations of oxygen consumption were carried out with the DATACAN V analysis program using equation 4a in Withers (1977) and were -1 converted to heat production assuming 20.08 J ml O2 (Schmidt-Nielsen 1997). BMR was calculated from the lowest, stable 10 minutes of oxygen consumption. For Spike-heeled Larks, we calculated TEWL by measuring the difference in the amount of water vapor in the air immediately before entering and after leaving the chamber using an MCS 174 relative humidity probe (MC Systems, Cape Town). Measurements of RH and temperature were recorded at 1 min intervals onto an MC-120E data logger (MC Systems, Cape Town). The amount of water vapor in the inlet and outlet air (mg min-1) was subsequently calculated from

measurement of RH and Ta (Smithsonian Tables; CRC Handbook of Physics and Chemistry). TEWL was determined as the difference between the amount of water vapor entering and leaving the chamber and averaged over the last 30 min of measurement.

After metabolism measurements we immediately measured cloacal Tb in all larks with an OMEGA or Sensortek thermometer and a copper-constantan thermo-

couple (30-gauge). Because we did not have continuous recordings of Tb, we cal-

culated the dry heat transfer coefficient (h) as h = M - E/(Tb - Ta), and assumed 110 that the change in Tb during our measurements was zero (Tieleman & Williams 1999). In this equation M equals metabolic heat production (kJ/d) and E is evaporative heat loss (kJ/d). To establish if a 3-week period was sufficiently long for birds to complete any adjustments to their metabolic rate (MR) and TEWL, we measured these variables at 25 °C in Woodlarks and Skylarks after 2 weeks and after 3 weeks. We calculated the change in body mass, MR, TEWL and h and tested for differences in change between 35 °C and 15 °C treatments with an ANOVA, but found no significant differences (mass, treatment F1, 25 = 1.05, P = 0.32, species F1, 25 = 1.5,

P = 0.71; MR, treatment F1, 25 = 0.34, P = 0.57, species F1, 25 = 0.98, P = 0.33;

TEWL, treatment F1, 25 = 2.24, P = 0.15, species F1, 25 = 0.34, P = 0.57; h, treatment F1, 25 = 0.02, P = 0.88, species F1, 25 = 2.18, P = 0.15). We then pooled the data for 35 °C and 15 °C-acclimated groups and tested if the changes in mass, MR, TEWL and h differed significantly from zero, but found no statistical support (mass, t = 0.05, df = 27, P = 0.96; MR, t = 1.08, df = 27, P = 0.29; TEWL, t = 1.79, df = 27, P = 0.09; h, t = 0.47, df = 27, P = 0.64). We concluded that 3 weeks of acclimation was ample time for birds to adjust their physiology to these environments. For Woodlarks and Skylarks we used the average values after 2 and 3 weeks as finals for TEWL, h and Tb.

Food intake We measured food intake of Woodlarks, Skylarks, Hoopoe Larks and Dunn's Larks in the cold and warm rooms during week 3 of the acclimation period by isolating individual birds in small cages (50 cm x 30 cm x 30 cm) for 24 hours. We fed Skylarks and Woodlarks a diet of mealworms and dry insects, Dunn's Larks mealworms and seeds, and Hoopoe Larks mealworms only. Food was weighed to ± 0.1 g before and after the 24 h trial period. We also placed a weighed amount of food outside the cage and reweighed it after the 24 h trial period to account for desiccation of the food in our calculations. Birds maintained mass during the food intake measurements.

Body composition At the end of the 3 week acclimation period, we sacrificed the birds and dissected out their organs and muscles of the pectoral region on the left side of the body. Organs and muscles were dried to constant mass for 2 days at 75 °C and LARKS

weighed on a Mettler analytical balance to ±0.1 mg. OF

Repeatability TION ARIA Repeatability (r) is a measure of within-individual consistency of a character, V estimated from multiple measurements of the same individual, and sets an upper limit to heritability (Lessells & Boag 1987; Boake 1989; Falconer & Mackay PHENOTYPIC 1996). The repeatability is defined as r = (VG + VEg)/VP, where VP = VG + VEg + VEs 111 is the total phenotypic variance, VG is the genotypic variance, VEg is the general environmental variance common to all repeated measurements of the same indi-

vidual due to permanent effects, and VEs is the special environmental variance within individuals due to temporary factors (Falconer & Mackay 1996). 2 2 2 2 Repeatabilities can be calculated as: r = SA / (S + SA ), where SA is the among- individual variance and S2 the within-individual variance (Falconer & Mackay 1996). The variance components were derived from mean squares in a one-way analysis of variance with BMR, TEWL or h as the dependent variables and indi- 2 2 vidual and treatment as fixed factors: S = MSW and SA = (MSA - MSW) / n0,

where MSW is the error mean square, MSA the mean square among individuals

and n0 a coefficient related to the sample size per individual (Lessells & Boag 1987). Incorporating treatment as fixed factor in the analyses accounted for the effect of acclimation. Standard errors were calculated following Becker (1984).

Statistical analyses Statistical analyses were performed using SPSS 10.0 (1999). Means are presented ± 1 S.D. unless noted otherwise. We used analysis of covariance (ANCOVA) with BMR, TEWL or h as the dependent variable, treatment as fixed factor and mass as a covariate. Although we always tested the interaction between covariate and fixed factor we do not always report the results of insignificant interactions. Proportional data were arcsine square-root transformed before performing parametric statistics (Zar 1996).

Results Body mass Before acclimation average body mass did not differ between the 15 °C and 35 °C groups in any of the species, but during the acclimation period individuals in all groups gained mass, except for those in the 35 °C-group of the Skylarks and in the 15 °C-group of the Spike-heeled Larks (Table 1). Woodlarks acclimated to 15 °C gained significantly more mass and were heavier after 3 weeks than 35 °C- acclimated conspecifics, but the change in mass during acclimation did not significantly differ between treatments in the other four species (Table 1). When we combined all five species in an ANOVA with change in mass as the dependent variable and species and treatment as fixed factors, we found a significant

effect of treatment (F1, 72 = 5.45, P = 0.022), but no significant effects of species

(F4, 72 = 0.87, P = 0.48) or of the interaction term (species x treatment F4, 68 = 1.95, P = 0.11). We concluded that the overall effect of the acclimation period for all species was a larger increase in mass in the 15 °C group than in the 35 °C group, even though species-specific differences were only evident between groups of the Woodlarks.

112 TABLE 1. Body masses (g, mean ± SD) of 35 °C and 15 °C treatment groups before and after 3 weeks of acclimation for Skylark, Woodlark, Spike-heeled Lark, Dunn's Lark and Hoopoe Lark. Significance of differences between 35 °C and 15 °C group are indicated with P-values based on t- tests.

Species Treatment N Initial mass P Final mass P Differencea P

Skylark 35 °C 7 31.4 ± 3.31 32.2 ± 3.59 0.8 ± 1.72 0.84 0.23 0.11 15 °C 7 31.7 ± 2.69 34.9 ± 4.46 3.2 ± 3.31*

Woodlark 35 °C 7 25.8 ± 1.39 27.0 ± 1.24 1.2 ± 1.08* 0.36 0.03 0.006 15 °C 7 25.3 ± 0.48 28.7 ± 1.44 3.5 ± 1.49*

Spike-heeled Lark 35 °C 10 23.9 ± 3.67 25.5 ± 3.26 1.7 ± 1.23* 0.32 0.31 0.96 15 °C 10 25.4 ± 3.04 27.1 ± 3.23 1.6 ± 2.37

Dunn's Lark 35 °C 8 20.7 ± 1.47 22.2 ± 1.65 1.5 ± 0.92* 0.66 0.53 0.64 15 °C 8 20.3 ± 2.13 21.6 ± 2.26 1.3 ± 1.02*

Hoopoe Lark 35 °C 7 37.1 ± 3.76 39.0 ± 3.73 1.9 ± 1.92* 0.56 0.90 0.28 15 °C 7 35.9 ± 3.78 38.8 ± 4.18 2.9 ± 1.15*

a Differences significantly different from zero (P < 0.05) are indicated with *.

Basal metabolic rate Prior to acclimation, BMR did not differ between groups in any of the species, except for the Woodlark (Figure 1), where random assignment of individuals to the two groups resulted, accidentally, in a significant effect of the interaction between mass and group (ANCOVA F1, 10 = 6.11, P = 0.033). After 3 weeks of acclimation, the two groups of Woodlarks did not differ significantly in BMR

(F1, 11 = 1.37, P = 0.27), although the 15 °C-acclimated birds tended to have a higher BMR than the 35 °C-acclimated individuals. Skylarks, Spike-heeled Larks, Dunn's Larks and Hoopoe Larks in the 15 °C groups had significantly higher BMR than birds in the 35 °C-groups (Skylark, F1, 11 = 26.96, P < 0.001;

Spike-heeled Lark, F1, 17 = 4.66, P = 0.045; Dunn’s Lark, F1, 13 = 42.71, P < 0.001;

Hoopoe Lark, F1, 11 = 11.72, P = 0.006) (Figure 1). Corrected for body mass differences between treatments and expressed as a percentage of BMR of the 35 °C- group, BMR in the 15 °C-group was increased by 4.7% in the Woodlark, 25.3% LARKS in the Skylark, 12.2% in the Spike-heeled Lark, 29.1% in the Dunn's Lark and OF

18.0% in the Hoopoe Lark. TION ARIA

To facilitate comparisons among species, we calculated residuals of BMR based V on an allometric equation for 12 species of larks: log BMR (kJ day-1) = 0.225 + 0.901 log mass (g) (Tieleman et al. 2002b) (Figure 2A). Woodlark and Skylark had higher residual BMR values than the other three species (Figure 2A). We PHENOTYPIC 113 Figure 1. Basal metabolic rate (BMR, kJ d-1) as a function of body mass of birds assigned to acclimation at 35 °C (open symbols) and 15 °C (black symbols) for Woodlark, Skylark, Spike-heeled Lark, Dunn’s Lark and Hoopoe Lark when acclimated to their natural environment (pre-acclimation) and after acclimation to 35 °C and 15 °C (post-acclimation). Lines indicate significant 114 differences between groups acclimated to 15 °C and 35 °C. used univariate ANOVA with the residual BMR of all initials, or of the finals after acclimation to 15 °C and 35 °C as dependent variables to test for differences between species. Species had a significant effect on residual BMR (initials, F4,

79 = 57.26, P < 0.0001; 15 °C, F4, 34 = 94.52, P < 0.0001; 35 °C, F4, 34 = 61.00, P < 0.0001) and subsequent post-hoc tests indicated that BMR was below predictions in the Hoopoe Larks, near predictions in Dunn’s Larks and Spike-heeled Larks, and exceeded predictions in Skylarks and Woodlarks (Figure 2A).

Total evaporative water loss Initial rates of TEWL at 25 °C did not differ between birds assigned to the 35 °C and 15 °C groups in Woodlark, Spike-heeled Lark, Dunn's Lark and Hoopoe Lark (P > 0.05). In Skylarks, TEWL was significantly higher in the 15 °C group than in the 35 °C group despite random assignment of individuals (Figure 3; F1,

11 = 13.02, P = 0.004). Final rates of TEWL did not differ between 15 °C- and 35 °C-acclimated groups in Woodlarks, Spike-heeled Larks and Dunn’s Larks

(Woodlark, F1, 11 = 0.74, P = 0.41; Spike-heeled Lark, F1, 7 = 0.24, P = 0.64;

Dunn’s Lark, F1, 13 = 0.04, P = 0.85), but were significantly higher in the 15 °C- acclimated groups of Hoopoe Lark and Skylark (Hoopoe Lark, F1, 11 = 7.85, P =

0.017, Skylark, F1, 11 = 5.80, P = 0.035) (Figure 3). Hoopoe Larks had TEWL- rates 23% higher in 15 °C-acclimated birds. Because initial values of Skylarks differed between birds assigned to the 15 °C and 35 °C group we calculated the difference in TEWL between pre- and post-acclimation TEWL for each individual and tested if these differences were the same for the 15 °C-acclimated and the 35 °C-acclimated group. The average difference between pre- and post-acclimation TEWL in the 15 °C group was 0.05 ± 0.85 g day-1 and in the 35 °C group -0.28 ± 0.53 g day-1, values not significantly different (t = 0.89, df = 12, P = 0.38). We concluded that Skylarks did not change their TEWL in response to a 3-week acclimation period at either 15 °C or 35 °C. We calculated residuals of TEWL based on the allometric equation for 12 species of larks: log TEWL (g day-1) = -0.814 + 0.816 log mass (g) (Tieleman et al. 2002b) (Figure 2B). TEWL for Dunn’s Lark and Hoopoe Lark were below predictions, whereas TEWL for the other three species exceeded predictions (Figure 2B). We used ANOVA with pre- or post-acclimated TEWL as the dependent variable to test for differences between species. Because TEWL of Skylarks

differed between 15 °C and 35 °C room birds but did not change in response to LARKS acclimation, we combined data of 15 °C-acclimated and 35 °C-acclimated OF

Skylarks as final values in the analyses. Species had a significant effect on resi- TION ARIA

dual TEWL (initials, F4, 63 = 11.40, P < 0.0001; 15 °C, F4, 36 = 6.98, P < 0.0001; V

35 °C, F4, 36 = 8.73, P < 0.0001) and subsequent post-hoc tests indicated that residuals of TEWL did not differ between Dunn’s Larks and Hoopoe Larks, or

between Skylarks and Woodlarks (Figure 2B). PHENOTYPIC 115 Figure 2. A. Residuals of basal metabolic rate (BMR, mean ± S.E.M.) of Hoopoe Lark, Dunn’s Lark, Spike-heeled Lark, Skylark and Woodlark when acclimated to the outside environment (pre-acclimation) and after acclimation to 15 °C or 35 °C. Common letters indicate no statistically significant difference between species when analyzed with separate Tukey-tests for pre- acclimation values, and for post-acclimation values for 15 °C and 35 °C groups (critical P = 0.05). B. Residuals of total evaporative water loss (TEWL, mean ± S.E.M.) of Hoopoe Lark, Dunn’s Lark, Spike-heeled Lark, Skylark and Woodlark when acclimated to the outside environment (pre-acclimation) and after acclimation to 15 °C or 35 °C. C. Surface-specific minimum dry heat transfer coefficient (h, mean ± S.E.M.) of Hoopoe Lark, Dunn's Lark, Spike-heeled Lark, Skylark and Woodlark when acclimated to the outside environment (pre-acclimation) and

116 after acclimation to 15 °C or 35 °C. LARKS OF TION ARIA Figure 3. Total evaporative water loss (TEWL) as a function of body mass of birds assigned to V acclimation at 35 °C (open symbols) and 15 °C (black symbols) for Woodlarks, Skylarks, Spike- heeled Larks, Dunn’s Larks and Hoopoe Larks when acclimated to their natural environment PHENOTYPIC (pre-acclimation) and after acclimation to 35 °C and 15 °C (post-acclimation). Lines indicate 117 significant differences between groups acclimated to 15 °C and 35 °C. Dry heat transfer coefficient The initial values of the minimum dry heat transfer coefficient (h) did not differ between the 35 °C and 15 °C-groups of Dunn’s Larks, Hoopoe Larks or Spike-

heeled Larks (Dunn’s Lark, F1, 13 = 0.36, P = 0.56; Hoopoe Lark F1, 11 = 0.82, P =

0.39; Spike-heeled Lark, F1, 7 = 3.73, P = 0.10), but were different between the 35 °C and 15 °C-groups of Skylarks and Woodlarks (Figure 4). The interaction between mass and treatment had a significant effect on h in Woodlarks

(Woodlark, F1, 9 = 12.18, P = 0.007), whereas Skylarks in the 35 °C-group had a

significantly higher h than those in the 15 °C-group (F1, 11 = 5.62, P = 0.04).

Post-acclimation h did not differ between treatments in the Woodlarks (F1, 11 =

1.24, P = 0.29) and the Hoopoe Larks (F1, 11 = 2.48, P = 0.14), but was higher in the 15 °C-acclimated Skylarks and Dunn’s Larks than in their 35 °C-acclimated

conspecifics (Skylark F1, 11 = 28.53, P < 0.001, Dunn’s F1, 13 = 36.44, P < 0.001). In the Spike-heeled Lark we found a significant interaction between mass and

treatment (F1, 6 = 7.94, P = 0.030), but average values for h did not differ between treatments (t = 0.36, df = 8, P = 0.73). To account for body mass differences in interspecific comparisons we calculated surface-specific h' by dividing h by surface area calculated from Meeh's equation (Walsberg & King 1978) (Figure 2C). Skylarks and Woodlarks had higher h' than the semi-arid and arid species (Figure 2C). We tested pre-acclimation, and 15 °C and 35 °C post-acclimation h' for differences between species. In all three

analyses, species had a significant effect on h' (initial, F4, 62 = 38.05, P < 0.0001;

15°C, F4, 29 = 24.95, P < 0.001; 35°C, F4, 29 = 24.30, P < 0.0001). Subsequent post- hoc tests showed no differences in h' between Hoopoe Lark and Dunn's Lark and between Skylark and Woodlark (Figure 2C).

Body temperature

Pre- and post-acclimation Tb-values varied between species and between treat-

ments (Table 2). Pre-acclimation Tb did not differ between birds assigned to the

35 °C and 15 °C groups (F1, 53 = 0.57, P = 0.45), but differed significantly between

species (F3, 53 = 3.15, P = 0.03). Post-hoc analysis revealed that Tb of Woodlarks was significantly higher than that of Dunn’s Lark (Tukey, mean difference ± S.E.M. 1.1 ± 0.36 °C, P = 0.02), but that other species did not differ significant-

ly from each other (Tukey, P < 0.05). Post-acclimation Tb differed among species

(F4, 62 = 72.63, P < 0.001) and between treatments, and was 0.4 ± 0.15 °C (mean ± S.E.M.) lower in the 35 °C-acclimated birds than in the 15 °C-acclimated birds

for all species combined (F1, 62 = 7.22, P = 0.01). Post-hoc analysis showed that Tb of Dunn’s Lark was lower than that of any of the other four species (all Tukey P <

0.001), and that Tb did not differ between Hoopoe Lark and Spike-heeled Lark (mean difference ± S.E.M. 0.5 ± 0.25 °C, Tukey P = 0.33) or between Woodlark and Skylark (0.5 ± 0.23 °C, Tukey P = 0.21). All other pair-wise combinations of

118 species indicated significant differences in Tb (Tukey, all P < 0.001). LARKS OF TION ARIA V Figure 4. Minimum dry heat transfer coefficient (h) as a function of body mass of birds assigned to acclimation at 35 °C (open symbols) and 15 °C (black symbols) for Woodlarks, Skylarks, Spike-heeled Larks, Dunn’s Larks and Hoopoe Larks when acclimated to their natural environment (pre-acclimation) and after acclimation to 35 °C and 15 °C (post-acclimation). Lines indi- PHENOTYPIC 119 cate significant differences between groups acclimated to 15 °C and 35 °C. TABLE 2. Body temperatures (°C, mean ± SD) of 15 °C- and 35 °C-treatment groups before and after 3 weeks of acclimation for Skylark, Woodlark, Spike-heeled Lark, Dunn's Lark and Hoopoe Lark.

Species Treatment N Initial Tb Final Tb Difference

Skylark 35 °C 7 40.6 ± 1.70 42.1 ± 0.80 1.5 ± 1.21 15 °C 7 41.3 ± 1.45 42.7 ± 0.60 1.3 ± 1.44 Woodlark 35 °C 7 41.4 ± 0.90 42.7 ± 0.48 1.2 ± 0.99 15 °C 7 41.6 ± 1.28 43.1 ± 0.39 1.5 ± 1.17 Spike-heeled Lark 35 °C 5 41.0 ± 0.39 15 °C 5 41.2 ± 0.69 Dunn's Lark 35 °C 8 40.5 ± 0.26 39.5 ± 0.77 -1.0 ± 0.66 15 °C 8 40.4 ± 0.49 39.8 ± 0.64 -0.6 ± 0.45 Hoopoe Lark 35 °C 7 40.8 ± 0.69 40.4 ± 0.69 -0.4 ± 0.95 15 °C 7 40.7 ± 0.35 40.8 ± 0.44 -0.1 ± 0.59

Food intake Individuals of all species in the 15 °C-room ate more food than conspecifics in the 35 °C-room. Skylarks and Woodlarks consumed 78% and 71% more food, respectively, when exposed to 15 °C than to 35 °C (Table 3). Dunn’s Larks at 15 °C ate 163% more seeds and 101% more mealworms than conspecifics at 35 °C, and Hoopoe Larks ate 89% more mealworms in the 15 °C-room than in the 35 °C- room (Table 3).

Body composition After 3 weeks of acclimation, larks in the 15 °C and 35 °C environments had developed differences in the size of several organs (Table 4). In all species the dry masses of organs involved in digestion or catabolism of food, such as intestine, kidney, liver and stomach, were larger in the 15 °C-groups than in the 35 °C- groups. The magnitude of the difference ranged from 26.9 - 38.6% for the intestine, 9.8 - 24.4% for the kidney, 16.5 - 27.2% for the liver and 22.0 - 31.6% for the stomach (Table 4). Using ANOVA with treatment and species as fixed factors we tested if organ dry mass differed between treatments and found significant effects of species and significant increases in 15 °C compared with 35 °C-accli-

mated birds for intestine (species F4, 72 = 21.00, P < 0.001, treatment F1, 72 =

39.80, P < 0.001), kidney (species F4, 72 = 39.09, P < 0.001, treatment F1, 72 =

TABLE 3. Food intake (g/d, mean ± S.D.) of 15 °C and 35 °C treatment groups during week 3 of the acclimation period for Skylark, Woodlark, Dunn's Lark and Hoopoe Lark.

Species 15 °C N (15 °C) 35 °C N (35 °C)

Skylark 15.1 ± 2.7 7 8.5 ± 3.1 7 Woodlark 9.7 ± 2.1 7 5.7 ± 0.6 7 Dunn's Lark (seeds) 2.3 ± 1.1 5 0.9 ± 0.9 5 Dunn's Lark (mealworms) 6.7 ± 2.2 5 3.3 ± 1.3 5 Hoopoe Lark 11.8 ± 3.6 7 6.3 ± 2.0 7 120 19.32, P < 0.001), liver (species F4, 72 = 29.97, P < 0.001, treatment F1, 72 = 28.92,

P < 0.001) and stomach (species F4, 72 = 10.32, P < 0.001, treatment F1, 72 = 16.24, P < 0.001). The interaction between species and treatment was not significant in any of these analyses. Organs involved in the respiratory system did not show a consistent difference between 15 °C and 35 °C-acclimated birds in the 5 species (Table 4). The differences in dry heart mass ranged from -7.0 to +13.2% and in mass of dry lung from -2.0 to +1.1%. Although heart and lung mass differed significantly between species (heart, F4, 72 = 32.29, P < 0.001; lungs, F3, 53 = 61.96, P < 0.001), differences between the 15 °C and 35 °C groups were not significant

(heart F1, 72 = 1.26, P = 0.27, lungs F1, 53 = 0.006, P = 0.94). Brain mass differed significantly between species, but not between treatments (species F4, 72 = 14.83,

P < 0.001, treatment F1, 72 = 2.68, P = 0.11). Pectoral muscle dry mass did not differ between 15 °C and 35 °C-groups in Hoopoe larks, was 5.7% larger and 12.6% larger in 15 °C-acclimated compared with 35 °C-acclimated Spike-heeled Larks and Skylarks, respectively, and was smaller in the 15 °C-acclimated individuals of Dunn’s Lark and Woodlark by 44.1% and 36.5% (Table 4). The significant interaction between species and treatment in our ANOVA indicates that the response of the pectoral muscle to acclimation differed between species

(F4, 68 = 15.25, P < 0.001). To take into account differences in body mass between species, we expressed organ size as a percentage of dry body mass, assuming a total body water content of 65% of wet mass (Williams 1985; Williams 1999), and tested if relative organ size differed between treatments and species (Table 4, Table 5). When expressed as proportion of total body mass, intestine, kidney, liver and stomach were larger in the 15 °C-acclimated than in the 35 °C-acclimated birds (Table 5). The remaining organs and the pectoral muscle did not differ significantly between 15 °C and 35 °C-acclimated birds (Table 5). Relative size of all organs and the pectoral muscle differed among species, but the post-hoc tests did not reveal systematic differences between the arid, semi-arid and mesic larks (Table 5). The only distinctive difference between Hoopoe Lark, Dunn’s Lark and Spike-heeled Lark on the one hand and Skylark and Woodlark on the other was the relatively smaller pectoral muscle in the arid-zone species.

Interindividual variation and repeatability of BMR, TEWL and h

The interindividual variation in phenotypes of birds acclimated to their natural LARKS climatic conditions was about 50% less in the Hoopoe Lark and the Dunn’s Lark OF

compared with the Skylark and Woodlark for mass-adjusted BMR and h', but not TION ARIA

related to environment for mass-adjusted TEWL (Table 6). Interindividual V variation in mass-adjusted BMR of the Spike-heeled Lark was similar to that of the two mesic species, whereas variation in h' resembled values for the two arid-

zone species (Table 6). PHENOTYPIC 121 C or ° e-heeled 0.13 0.11 0.32 0.11 0.40 0.09 0.46 0.13 0.10 0.10 0.27 0.12 0.32 0.12 0.83 0.10 0.26 0.15 0.43 0.17 0.51 0.48 0.55 0.17 0.15 0.30 0.11 0.37 0.07 0.80 0.07 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± C ylark, n = 7; Spik ° 1.69 Mass (%) 35 0.96 1.86 0.74 2.89 0.71 8.45 1.90 1.60 1.04 2.23 0.79 2.73 0.87 8.45 1.78 1.86 0.97 3.07 0.58 2.69 6.56 2.06 1.95 0.87 2.06 0.72 2.26 0.55 6.96 1.57 0.12 0.11 0.49 0.26 0.05 0.38 0.06 0.12 0.17 0.76 0.09 0.36 0.06 0.46 0.17 0.29 0.13 0.09 0.95 0.17 0.44 0.58 0.84 0.14 0.79 0.09 0.62 0.18 0.63 0.11 0.38 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± C ° oodlark, n = 7; Sk 1.60 1.02 8.42 Mass (%) 15 2.23 0.82 3.37 0.66 2.28 1.51 7.72 1.01 2.64 0.78 3.07 0.79 2.06 1.76 0.96 3.64 0.64 2.87 6.89 2.03 2.02 7.24 0.89 2.67 0.85 2.76 0.55 2.12 e: W gans and muscle of larks after 3 weeks at 15 oup ar 0.870 0.102 0.000 P 0.010 0.039 0.011 0.795 0.000 0.300 0.078 0.508 0.011 0.175 0.027 0.168 0.026 0.088 0.075 0.003 0.047 0.420 0.078 0.009 0.759 0.000 0.983 0.024 0.109 0.111 0.811 0.001 y body mass) of or -2.0 -2.1 +0.5 +4.0 +6.9 +9.8 +0.3 +5.3 +5.7 +1.5 +0.1 % change -36.5 -44.1 +13.2 +26.9 +16.7 +23.3 +26.9 +12.6 +30.6 +24.7 +27.8 +10.3 +29.8 +23.7 +16.5 +10.4 +27.0 +15.7 +19.0 +31.6 S.D., as % of dr ± y body mass. Sample sizes in each gr 10.7 12.1 33.3 12.1 43.9 10.9 62.9 13.3 14.7 72.4 25.3 46.1 11.5 44.1 13.3 32.6 29.9 18.3 54.9 14.2 57.5 90.5 52.4 16.6 24.9 10.5 37.6 6.0 161.9 6.8 13.4 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± C ° y mass (mg) 96.7 75.3 71.6 93.0 83.3 49.3 57.8 43.9 70.0 Dr 35 170.3 187.9 292.4 855.3 192.0 189.4 901.1 124.3 265.2 322.9 102.3 212.2 159.2 263.7 231.9 590.0 177.0 156.8 166.0 182.5 126.5 1028.0 y mass (mean 9.5 14.8 28.6 7.2 40.2 8.4 64.4 13.3 11.4 137.1 54.2 12.2 68.6 19.0 52.1 25.17 21.5 16.4 74.6 19.4 34.4 82.4 86.8 14.4 42.2 11.0 43.9 7.5 94.3 22.4 5.7 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± elative dr C ° y mass (mg) 87.9 70.2 91.9 61.0 66.9 43.0 70.1 15 Dr 171.2 109.5 238.4 360.4 543.4 243.6 197.0 346.3 102.1 402.6 102.6 271.1 167.6 132.9 342.2 270.2 623.8 195.4 159.2 210.9 217.2 574.3 166.5 1014.3 S.D., in mg) and r t t t t gan ± Hear Brain Or Intestine Kidney Liver Lungs Pect. Muscle Stomach Brain Hear Intestine Kidney Liver Lung Pect.Muscle Stomach Brain Hear Intestine Kidney Liver Lung Pect.Muscle Stomach Brain Hear Intestine Kidney Liver Lung Pect. Muscle Stomach y mass (mean Dr e assumed a body water content of 65% to calculate dr C. W ° oodlark ABLE 4. W Skylark T Spike-heeled Lark 35 Lark, n = 10; Dunn's 8; Hoopoe 7. 122 Dunn's Lark cd b b a ab a a c ood W ey tests. uk bc c b a b a a bc Sky 0.15 0.14 0.29 0.06 0.38 0.07 0.61 0.11 ± ± ± ± ± ± ± ± C ° e obtained with T Mass (%) 35 1.39 0.94 1.83 0.62 2.03 0.60 7.23 1.21 d a a ab b b bc esults wer 0.20 0.10 0.41 0.05 0.20 0.06 1.01 0.20 ± ± ± ± ± ± ± ± C Spike-heeled ° Mass (%) 15 1.48 0.86 2.49 0.76 2.51 0.59 6.71 1.47 ost-hoc test r ds. b ab a b ab a ab a Hoopoe oups within each species that have been acclimated for 3 weeks able 4. P 3 P 0.187 0.420 0.006 0.004 0.010 0.916 0.891 0.030 esults C-acclimated bir ° a a a a a a a ab ukey-test r T Dunn's -7.0 +8.5 +1.1 +1.6 +38.6 +24.4 +27.2 +22.0 % change ed with the 15 oot transformed data in T e-r P . Criterion for significance: P < 0.05. 0.006 ds compar 13.6 21.4 37.1 8.4 38.8 14.9 19.6 27.1 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 ± ± ± ± ± ± ± ± C ° y mass (mg) 86.8 84.0 Dr 35 193.4 131.7 255.4 281.4 947.4 170.4 csine squar C-acclimated bir ° 9.28 3.96 7.77 9.30 4, 72 24.56 24.47 17.29 21.87 28.2 19.44 63.9 13.4 54.1 16.5 204.6 29.9 Species F ± ± ± ± ± ± ± ± C gan size between five species of larks and gr ° y mass (mg) e based on ar 84.9 15 Dr 209.9 122.5 354.0 108.0 358.0 962.4 207.9 e indicated with the same letter gan ar gans in the 35 elative or P 0.506 0.202 0.108 0.005 0.887 0.006 < 0.001 < 0.001 t . gan LARKS Or Brain Hear Intestine Kidney Liver Lung Pect. Muscle Stomach 1 As for each or 3, 53 OF V 0.45 1.67 2.65 8.57 0.02 7.88 TION eatment 26.87 16.20 1, 72 r ences between species ar T F ences indicate smaller or C. ANO ARIA ; Species F ° fer V fer 1, 53 esults of comparisons r Continued. R C or 35 ° 2 t PHENOTYPIC eatment F r gan ABLE 4. Significant dif T Insignificant dif ABLE 5. Hoopoe Lark T T Or 1 2 3 to 15 Brain Hear Pect. Muscle Stomach Intestine Kidney Liver Lungs 123 Repeatability estimates for BMR varied between 0.48 and 0.66 in the larks from semi-arid and arid areas, but were not significantly different from zero in the two mesic species (Table 6). Repeatabilities of h showed the reverse pattern with higher values for the mesic species than for the Dunn’s Lark and the Hoopoe Lark. Repeatabilities of TEWL were 0.73 and 0.50 in the Skylark and the Dunn’s Lark, respectively, 0.22 in the Woodlark, and zero in the Spike-heeled Lark and the Hoopoe Lark.

Discussion Individuals of five closely related species of larks showed considerable short-term phenotypic flexibility of physiological and morphological characters when acclimated to 15 °C or 35 °C. The interspecific variation among the five larks was consistent with results of a previous study that showed that among 12 species of larks increasing aridity correlated with decreasing BMR and TEWL (Tieleman et al. 2002b). Phenotype-by-environment correlations based on interspecific comparisons have been criticized because of the difficulty in distinguishing the effects of phylogenetic inertia, genetic adaptation as a result of natural selection, and phenotypic adjustment to the environment (Leroi 1994; Westoby et al. 1995; Hansen 1997). In a previous study we have construced a phylogeny of the larks and excluded phylogenetic relatedness as a factor explaining the decrease in BMR and TEWL with increasing aridity (Tieleman et al. 2002b). This study shows that the effects of acclimation were insufficient to explain the interspecific differences in physiology among five species of larks. Therefore, the reductions in BMR and TEWL in larks from arid environments are likely to have a genetic component, although we can not rule out that developmental conditions play a role. The magnitude of intra-individual flexibility varied between physiological traits and depended largely on species, but was not correlated with aridity. In addition, the interindividual variation in physiological phenotypes and the repeatability of physiological traits differed between species and appeared correlated with environment for BMR and h, but not for TEWL. Differences between species in BMR have been attributed to the size of internal organs, especially heart, liver and kidneys, that have relatively high tissue-specific metabolic rates (Krebs 1950; Martin & Fuhrman 1955; Kersten & Piersma 1987; Daan et al. 1990; Williams & Tieleman 2000). The reduced mass-corrected BMR in arid larks prompted us to ask if these differences could be explained by smaller organs or muscles. With the exception of the relative size of the pectoral muscle, that is smaller in Dunn's Lark, Hoopoe Lark and Spike-heeled Lark compared with Skylark and Woodlark, we found no evidence for systematic differences in body composition between larks from different environments (Table 4, Table 5). The pectoral muscle accounted for on average 13.9% of the total 124 - ees eedom, numerator degr 0.270 ees of fr 0.269 0.184 ± ± ± 13,12 12,12 13,12 14 -0.10 14 14 0.12 0.57 0.016 19.7 0.635 9.4 0.348 Hoopoe Lark 8.0 2 2 2 3.63 0.82 1.26 denominator degr = F-value 0.253 0.192 0.196 ± ± ± ,ndf 15,14 15,14 15,14 ddf 16 0.50 16 16 -0.07 0.48 0.029 33.9 0.025 14.2 0.605 Dunn's Lark 9.0 2 2 2 2.84 2.96 0.87 0.324 0.236 0.128 ± ± ± 19,18 9,8 9,8 10 10 20 -0.04 0.52 0.66 19.1 11.2 0.001 0.555 0.058 Spike-heeled Lark 16.7 2 2 2 4.88 0.92 3.20 A (Lessells and Boag 1987); F e based on mass-adjusted values of BMR and TEWL, surface-specific h befo 0.178 0.162 0.265 ± ± ± 13,12 13,24 13,23 oodlark oup in the ANOV 14 14 14 0.22 0.49 0.17 28.0 21.7 0.285 0.090 0.003 1.40 1.87 3.78 W 23.0 2 3 2.93 0.184 e- and post-acclimation whole animal data. 0.104 0.178 ± ± ± 13,17 13,24 13,24 14 14 14 0.73 0.27 -0.17 26.8 19.4 0.788 <0.0001 0.056 Skylark 2.42 0.64 3 9.24 3 2.10 18.2 epeatability estimates (r) for basal metabolic rate (BMR), total evaporative water loss (TEWL), and the minimum e based on pr elated to the sample size per gr ., %) and r ficient r ,ddf ,ddf ,ddf S.E. S.E. S.E. . . . ± ± ± 0 0 0 ndf ndf ndf N N N N N N r r r F F F C.V C.V P P P C.V epeatabilities ar = coef LARKS 0 OF TION ARIA V Coefficients of variation (C.V . PHENOTYPIC eedom y heat transfer coefficient (h) for five species of larks. Coefficients variation ar ABLE 6. e the acclimation period. R of fr TEWL h N = number of individuals; T dr BMR r 125 body mass of the former three species and 16.5% of the Skylarks and Woodlarks. Therefore the relative size of the pectoral muscle is 16% smaller in the arid-zone birds, a reduction unlikely to explain the 50% reduction in BMR. We hypothe- size that in larks not only the size of internal organs, but also the intensity of the tissue-specific metabolic rates of various organs may influence BMR. Individuals of all five species showed large phenotypic flexibility of the organs of the digestive system in response to exposure to 15 °C and 35 °C (Table 4). When acclimated to 15 °C birds consumed more food, which apparently stimulated hypertrophy of intestine, kidney, liver and stomach compared with birds acclimated to 35 °C. The increase in size of the digestive organs was parallelled by a significant increase in BMR in the 15 °C-acclimated birds of all species except the Woodlark. These results support data from a previous study that reported larger liver, intestine, kidney and possibly stomach correlated with increased BMR in cold-acclimated compared with warm-acclimated Hoopoe Larks (Williams & Tieleman 2000). The pectoral muscle responded to acclimation by an increase in size in Spike-heeled Larks and Skylarks from the 15 °C room, a decrease in size by Dunn's Larks and Woodlarks in the 15 °C room, and no change in the Hoopoe Lark. The increase in pectoral muscle mass may have resulted from increased thermoregulatory demands that required shivering thermogenesis in the 15 °C-acclimated Spike-heeled Larks and Skylarks. The opposite finding in the Dunn's Larks and Woodlarks might be attributed to different activity levels; individuals of these species at 35 °C appeared more active than conspecifics at 15 °C. The combination of a decreased pectoral muscle mass and increased digestive organ sizes in the Woodlark may have resulted in no net difference in BMR between treatments. Organs and muscles may have not only changed in size, but also in structure. Capillary density, capillary surface area and mitochondrial volume density in aerobic fibers increased in the pectoral muscles of cold-acclimated Pigeons (Columba livia) to meet the increased energetic demands of shivering (Mathieu-Costello et al. 1998). If a parallel change occurred in larks, the increase in BMR in 15 °C-acclimated birds may be partially attributable to higher metabolic rates of the muscle tissue. Similar studies in mammals have found larger internal organs together with increased BMR in cold-acclimated mice (Toloza et al. 1991; Konarzewski & Diamond 1995). The magnitude of the changes in organ size fell within the range for other birds in response to dietary changes or in preparation for migration (Karasov 1996; Piersma & Lindström 1997). In general, the phenotypic flexibility of the size of digestive organs and pectoral muscle within individuals was as large as the variation in organ mass between species, when corrected for body mass differences. Interspecific differences in TEWL can not be explained by acclimation to temperature. Examination of the role of developmental plasticity is necessary to further support a genetic basis for the variation in TEWL among larks from different 126 environments. Although acclimatory responses to humidity remain untested in birds, Kangaroo rats (Dipodomys merriami merriami) from the Sonoran Desert, reared at different humidities but constant Ta and later acclimated to the opposite humidity regime, showed that developmental plasticity and acclimation accounted for all variation between individuals from different geographic areas (Tracy & Walsberg 2001). Mechanisms responsible for the intra-individual flexibility of TEWL in Hoopoe Larks may lie in the variability of their cutaneous water loss (CWL) which accounts for more than two thirds of TEWL in these larks (Tieleman & Williams 2002b). Differences in the structure and lipid composition of the skin possibly correlate with differences in CWL between species and within individuals acclimated to different conditions. Zebra Finches (Taeniopygia guttata), for example, appear able to decrease CWL in response to water deprivation by increasing the deposition of multigranular bodies in the epidermal stratum corneum (Menon et al. 1989). In contrast, water-deprived Pigeons (Columba livia) do not alter CWL at moderate Ta, although at high Ta they do have lower CWL than hydrated birds (Arad et al. 1987). Cold-acclimated Pigeons have a lamellar, extracellular water barrier in the epidermis that minimizes evaporation through the skin, whereas heat-acclimation leads to the formation of structurally heterogeneous skin that facilitates CWL (Peltonen et al. 2000).

Maintenance of a constant Tb when metabolic heat production is increased requires either an adjustment in evaporative heat loss or in dry heat loss. In contrast to Hoopoe Larks that adjusted their TEWL when acclimated to cold and warm environments, Skylarks and Dunn's Larks elevated their minimum dry heat transfer coefficient during the 3-week period of exposure to 15 °C compared with 35 °C. The intra-individual flexibility in these species was insufficient to explain the interspecific differences in h' between arid- and mesic-zone birds by effects of acclimation only (Figure 2C). The lower dry heat loss in arid-zone species compared with mesic birds might contribute to mimizing their energy requirements, but the mechanisms that explain this difference remain elusive. Accurate statements about the selective value of a physiological trait and about its inheritance can only be made if one understands how variable that trait is both between and within individuals. The hypothesis that species in deserts experience stronger selection for a frugal energy and water balance, and therefore show less interindividual variation in physiological phenotypes was supported by LARKS the coefficients of variation (C.V.) of BMR and h', but not TEWL (Table 6). The OF

C.V. for TEWL was lower in the Hoopoe Lark than in both mesic species, but TION ARIA higher in the Dunn's Lark. These results do not comply with the idea that phe- V notypic variation is larger in species from harsh environments (Parsons 1987; Parsons 1996). The high repeatabilities of BMR (0.48 - 0.66) for Hoopoe Larks,

Dunn's Larks and Spike-heeled Larks, of TEWL (0.50 - 0.73) for Skylarks and PHENOTYPIC 127 Dunn's Larks, and of h (0.49 - 0.52) for Spike-heeled Larks and Woodlarks, indicate a within-individual consistency on which natural selection could operate, although we do not know if the variation among individuals has a genetic basis and therefore could respond to selection. At the level of intra-individual flexibility of physiological traits all species appear flexible in at least one of the studied traits and we found no general support for the hypothesis that species from the temporally more heterogeneous arid environments display a larger intra-individual plasticity (Parsons 1996). The intraspecific heterogeneity in phenotypes and the intra-individual phenotypic flexibility of desert larks allow some optimism in view of the prediction of an

increase in annual Ta of 5 °C over the next 100 years in Saudi Arabia (Mitchell & Hulme 2000). Studying the capacity for phenotypic change of physiological traits will benefit from a broad approach in which genetic and environmental influences on phenotypes of different species are distinguished and species are no longer viewed as genetically fixed entities.

Acknowledgments We thank Abdulrahman Khoja, Patrick Paillat, Stéphane Ostrowski, Stéphane Hemon, Jean-Yves Cardona and the other staff at the National Wildlife Research Center, Taif, Saudi Arabia for logistic support throughout this study. Wildlife research programs at the NWRC are possible through the generous support of HRH Prince Saud al Faisal and under guidance of A. Abuzinada of the National Commission for Wildlife Conservation and Development. We are grateful to Gerard Overkamp and the animal caretakers at the Zoological Laboratory for practical help and advice, to Serge Daan for comments on a previous draft, and to Niels Dingemanse for suggesting and helping with the calculations of repeatability. We appreciate the help of Mark Anderson of the Northern Cape Nature Conservation Service for arranging permits, for helping to capture birds, and for his hospitality. We also thank Graham Main for permission to catch larks on the De Beers Mine's Benfontein Farm and for his hospitality, and Peter Gibbs, for allowing the use of the lodge. We are grateful to two anonymous reviewers and Tony Williams who provided comments that improved the manuscript. Financial support for this study was provided by the Schuurman Schimmel van Outeren Foundation (BIT), the Schure Beijerinck Popping Foundation (BIT), the National Wildlife Research Center (BIT, JBW, MEB), the Ohio State University (MEB, JBW), and the Rhodes University Joint Research Committee (CRB).

128 LARKS OF TION ARIA V PHENOTYPIC

129

CHAPTER 6 Physiological adjustments to arid and mesic environments in larks (Alaudidae)

B. Irene Tieleman, Joseph B. Williams, and Michael E. Buschur Physiological and Biochemical Zoology 75: 305-313. 2002. ABSTRACT Because deserts are characterized by low food availability, high ambient temperature extremes and absence of drinking water, one might expect that birds that live in these conditions exhibit a lower basal metabolic rate (BMR), a reduced total evaporative water loss (TEWL) and a greater ability to cope with high air temperatures than their mesic counterparts. To minimize confounding effects of phylogeny, we compared the physiological performance of four species of larks at

ambient temperatures (Ta) ranging from 0 °C to 50 °C: Hoopoe Larks (Alaemon alaudipes) and Dunn's Larks (Eremalauda dunni) live in hot and dry deserts, whereas Skylarks (Alauda arvensis) and Woodlarks (Lullula arborea) occur in temperate mesic areas. Mass-adjusted BMR and TEWL were indistinguishable between Hoopoe Lark and Dunn's Lark and between Skylark and Woodlark. Combining the two desert birds and the two mesic larks, larks from the desert had levels of BMR 43% lower and values of TEWL 27% lower than the mesic species. Their body temperatures

(Tb) were 1.1 °C lower and the minimal dry heat transfer coefficients (h) were 26% below values

for the mesic larks. When Ta exceeded Tb, the h of Hoopoe Larks and Dunn's Larks was high and indistinguishable from h at 40 °C, in contrast to the prediction that h should be decreased to minimize heat gain through conductance, convec-

tion or radiation from the environment when Ta

exceeds Tb.

ABSTRACT Introduction Animals that live in deserts might be expected to possess behavioral and physiological adaptations that would enable them to cope with high ambient temperatures (Ta), low food resources and lack of drinking water, the main characteristics of these environments (Bartholomew & Cade 1963; Dawson & Schmidt- Nielsen 1964; Williams & Tieleman 2001). Unlike small mammals, that are generally nocturnal and as a result do not experience the temperature extremes of the desert environment, desert birds are exposed to Tas that are among the highest on earth. Shade Ta can exceed 50 °C in some deserts and anecdotical evidence suggests that extreme heat can be a major source of mortality in some bird populations (Serventy 1971). Avian physiological mechanisms that favor survival during extended periods of high Tas are poorly understood. Exposure to high Ta not only requires mechanisms of heat tolerance, but also puts additional strain on the water and energy balance that may already be compromised by lack of drinking water and low food availability.

Early investigators hypothesized that low primary productivity, high Ta and absence of drinking water in deserts would select for low levels of basal metabolic rate (BMR) and total evaporative water loss (TEWL) in desert birds, but found no general support for this idea (Bartholomew & Cade 1963; Bartholomew 1964; Dawson & Schmidt-Nielsen 1964; Serventy 1971; Dawson 1984). Subsequent studies reported levels of BMR and TEWL below allometric predictions, but because these investigations were often based on a single species, conclusions were tentative (Dawson & Bennett 1973; Weathers 1979; Arad & Marder 1982; Withers & Williams 1990). Across species comparisons between desert and non-desert species support the hypothesis that arid-zone birds have on average a lower BMR (Tieleman & Williams 2000) and a lower TEWL (Williams 1996). Broad-scale interspecific comparisons of BMR and TEWL have the inherent interpretational problem that species not only differ in habitat but also in phylogenetic background, diet and behavior. In addition, knowledge of minimum ENVIRONMENTS

levels of metabolism and TEWL provides limited understanding of the physiolo- MESIC

gical responses to varying environmental circumstances, including Ta. AND Restricting comparative analyses to a small group of closely related species occu- ARID

ring in different environments provides the opportunity for a more detailed exa- TO mination of physiological adjustment while potentially limiting complications due to markedly different evolutionary history or current dissimilar life styles.

At high Ta, birds increase TEWL to maintain body temperature (Tb) below lethal ADJUSTMENTS limits (Calder & King 1974), even when water is in short supply. To minimize evaporative water loss at high Ta, birds could reduce heat production from metabolism. Another strategy to reduce water requirements for evaporative cooling PHYSIOLOGICAL at high Ta entails minimizing dry heat gain from the environment, quantified by 133 the equation Heat gain = h (Tb - Ta), where Tb - Ta is the gradient between the

bird’s Tb and the environment and h is the dry heat transfer coefficient (Dawson & Schmidt-Nielsen 1966; Hinds & Calder 1973; Weathers & Caccamise 1975; Tieleman & Williams 1999). Influenced by feather insulation, skin vasodilation, surface to volume ratios and subcutaneous fat reserves, h is a complex variable that combines heat transfer coefficients for conduction, convection and radia-

tion (Calder & King 1974). The optimal response of h to Ta presumably includes adjustments to minimal levels below the thermoneutral zone, an increase to

maximum values when Ta approaches Tb, and a decrease to minimal values again

when Ta exceeds Tb (Dawson & Schmidt-Nielsen 1966; Hinds & Calder 1973; Tieleman & Williams 1999). We hypothesized that increasing aridity selects for gradually decreasing levels of BMR and TEWL in birds, and for improved physiological performance under exposure to extreme heat. To test these ideas, we studied the temperature regulation of four closely related birds, Dunn's Larks and Hoopoe Larks from the hyperarid and arid deserts in Arabia and northern Africa, and Skylarks and Woodlarks that live in the mesic temperate zones of Europe and Asia. We determined metabolism, total evaporative water loss, dry heat transfer coefficient and

body temperature at Tas ranging from 0-40 °C in the mesic birds and from 0-50 °C in the arid-zone species. We predicted that the desert species would display reduced levels of BMR and TEWL compared with the mesic larks and were capa-

ble of controlling their Tb when exposed to high temperatures by a reduced dry

heat uptake and/or a rapidly elevated evaporative heat loss when Ta exceeded Tb.

Material and Methods We mist-netted Hoopoe Larks (Alaemon alaudipes, mass 37.7 ± 2.72 g, n = 7) and Dunn’s Larks (Eremalauda dunni, 20.6 ± 1.60 g, n = 16) in Mahazat as-Sayd, a reserve in the Arabian Desert (N 22° 15' E 41° 50'), and housed them in outdoor aviaries at the National Wildlife Research Center, near Taif, Saudi Arabia.

Average yearly rainfall in Mahazat equals 90 mm and maximum Ta in July averages 40.2 °C with some daily maxima reaching 50 °C (National Wildlife Research Center, unpubl.). In the Netherlands we caught Skylarks (Alauda arvensis, 31.7 ± 2.85 g, n = 15) and Woodlarks (Lullula arborea, 25.5 ± 1.03 g, n = 14) in the province of Drenthe (N 52° 52' E 06° 20') and kept them in outdoor aviaries at the Zoological Laboratory of the University of Groningen. In our study area in the Netherlands rainfall averages 750 mm per year and mean

maximum Ta in July is 21.7 °C (Koninklijk Nederlands Meteorologisch Instituut). We measured metabolism and TEWL of all birds after they had been in captivity for 3-6 weeks during June, July or August of 1998-2001. Larks in Arabia were fed ad libitum with mealworms, crickets, cockroaches and seeds, 134 whereas larks in the Netherlands had access to ad libitum water and food similar to the Arabian birds with the addition of chopped raw heart. To measure the phylogenetic relatedness betweeen Hoopoe Lark, Dunn’s Lark, Skylark and Woodlark, we determined nucleotide sequences of the cytochrome b and the 16S rRNA genes of the mitochondrial DNA. Skylarks and Woodlarks showed a sequence divergence of 5.0%, Dunn's Larks were related to the Skylark/Woodlark group by a 5.6% divergence, and Hoopoe Larks were basal in this phylogeny with a 8.9% divergence from the clade that contains the previous three species (Tieleman, Williams and Bloomer, unpublished data). We measured rates of oxygen consumption and TEWL for postabsorptive birds during their nocturnal phase by standard flow-through respirometry and hygrometry methods (Gessaman 1987). Birds in Saudi Arabia were placed in water- jacketed steel metabolic chambers (24 cm x 20 cm x 28 cm) that had an air-tight

Plexiglas lid. During measurements, Ta in the chamber was controlled by a Neslab circulating water bath (RTE-140) to within 0.2 °C. Larks in the Netherlands were placed in steel metabolic chambers of identical dimensions where Ta was controlled by a Heraeus Vötsch environmental chamber. Birds were placed on a wire-mesh platform over a layer of mineral oil which trapped feces, thus excluding feces as a source of water in the measurements. In Saudi Arabia, we used a positive pressure system for the Hoopoe Lark measurements and a negative pressure system for the Dunn’s Lark measurements, and in the Netherlands we used a negative pressure system for Skylark and Woodlark. In the positive pressure system, air coursed through columns of drierite, soda lime, and drierite to remove water and CO2 from the air stream, through a previously calibrated (Levy 1964) Brooks mass flow controller (model 5850E) set between 500 and 1700 ml/min (STP) depending on species and Ta, then through the chamber. Exiting air passed through a General Eastern Dewpoint Hygrometer (M4- DP) before a subsample was routed through silica gel, ascarite and silica gel before entering into an Applied Electrochemistry oxygen analyzer (S3A-II) to ENVIRONMENTS determine the fractional concentration of oxygen in dry, CO2-free outlet air. Our

negative pressure system consisted of air coursing through drierite, soda lime and MESIC

drierite, the chamber, the dewpoint hygrometer, and again through drierite, soda AND lime and drierite, before passing through the mass flow controller, a diaphragm ARID

pump and into an overflow from which the O2-analyzer sampled air (Applied TO Electrochemistry S3A-II in Saudi Arabia, Servomex Xentra 4100 in the Netherlands). After a 2-3 h equilibration period, we recorded the oxygen con-

centration and dewpoint of inlet and outlet air, the temperature of the dewpoint ADJUSTMENTS hygrometer, and Ta in the chamber, using a Campbell Scientific data logger model 21X or CR23X. Outlet air had a relative humidity that was always below 25% (Lasiewski et al. 1966) and an oxygen concentration between 20.55 and

20.85%. Oxygen consumption was calculated with equation 2 of Hill (1972) for PHYSIOLOGICAL 135 the positive pressure system and with equation 4a of Withers (1977) for the

negative pressure system. We used 20.08 J/ml O2 to convert oxygen consumption to heat production (Schmidt-Nielsen 1997). When, during the third hour of measurements, the traces for oxygen consumption and dewpoint were stable for at least 10 min, we noted these times and used these data for calculations. For measurements of Hoopoe Larks at 50 °C and of Dunn's Larks at 48 °C we equi-

librated birds during 2 hours at 40 °C, before increasing the Ta to 50 °C or 48 °C, respectively, and took our measurement after a 45 min period of exposure to

these high Tas. We did not measure Skylarks and Woodlarks at Tas exceeding 40 °C, because judged from the heavy panting birds were visibly heat-stressed at 40 °C and we did not want to risk mortality.

Evaporative water loss was calculated using the equation TEWL (g/day) = [(Ve ρ ρ -3 ρ ρ out - Vi in)] · 1.44 · 10 , where in and out are the absolute humidities (g 3 H2O/m ) of inlet and outlet air, Vi is the flow rate (ml/min) of air entering the

chamber, and Ve is the flow rate of exiting air. Absolute humidity (STP) was ρ 3 determined with the equation (g/m ) = 216.7 es / (Tdp + 273.15) · (P0 (Tdp +

273.15)) / (Pa (T0 + 273.15)), where es is the saturation vapor pressure (mbar) at

a given dewpoint, Tdp is the temperature (°C) of the air in the dewpoint hygro-

meter, P0 is standard pressure (1013 mbar), Pa is barometric pressure (mbar), and

T0 is standard temperature (0 °C). We calculated Ve and Vi following Williams and Tieleman (2000) for the positive pressure system. For the negative pressure

system we calculated Vi = Vflow controller + VO2, and Ve = Vflow controller + 0.71(VO2) +

VH2O. In this equation, Vflow controller (ml/min), the flow rate through the mass flow

controller, and oxygen consumption (VO2; ml/min) are known, RQ is assumed to ρ equal 0.71 (King & Farner 1961), and VH2O is calculated as VH2O = (Vflow controller ρ ρ + VCO2)/(1- ). The latter equation is derived from the absolute humidity =

VH2O/(Vflow controller + VCO2 + VH2O), the fraction of water in air flowing through the dewpoint hygrometer.

After the completion of metabolism measurements we immediately measured Tb of birds with an OMEGA thermometer and a 36 gauge copper-constantan ther-

mocouple. Because we did not have continuous recordings of Tb, we calculated

the dry heat transfer coefficient h as h = (M - E)/(Tb - Ta), and assumed that the

change in Tb during our measurements (dTb/dt) was zero (Tieleman & Williams 1999). In this equation M equals metabolic heat production and E is evapora-

tive heat loss. At Ta = Tb we calculated h with l’Hôpital’s rule (Tieleman & Williams 1999). Analyses of variance and post-hoc tests were carried out using GLM procedures in SPSS 10.0. Averages are reported ±1 S.E.M., unless noted otherwise. Experiments were performed under license of the University of Groningen (DEC nr. 2425).

136 Results

For all species of larks metabolic rate as a function of Ta had the general shape of the Scholander model with increased levels of metabolism below and above a distinct thermoneutral zone, where levels of metabolism were lower in the two desert species than in the two mesic birds (Figure 1, Table 1). The lower and upper critical Ta of the two mesic larks were lower than those of the two desert species (Table 1). We used analysis of variance with body mass as covariate and species as fixed factor to compare BMR between the four species, and found no significant effect of the interaction between body mass and species (F3, 70 = 0.75,

P = 0.52) but a significant effect of species on BMR (F3, 51 = 51.42, P < 0.001). To test for differences in mass-adjusted rates of BMR we divided BMR by mass0.940, where 0.940 is the exponent of an allometric equation of 14 species of larks (Tieleman and Williams, unpubl.). Mass-adjusted rates of basal metabolism (n as in Table 1) were indistinguishable between Hoopoe Lark (1.21 ± 0.14 kJ day-1 g-0.940) and Dunn’s Lark (1.41 ± 0.08 kJ day-1 g-0.940, Tukey test P = 0.64), and between Woodlark (2.35 ± 0.08 kJ day-1 g-0.940) and Skylark (2.43 ± 0.07 kJ day-1 g-0.940, Tukey test P = 0.91), but differed in comparisons of the other species pairs ENVIRONMENTS MESIC AND ARID TO ADJUSTMENTS

Figure 1. Metabolic rate as a function of air temperature in Hoopoe Lark (A), Dunn’s Lark (B), Skylark (C) and Woodlark (D). PHYSIOLOGICAL 137 TABLE 1. Metabolic rate as function of Ta for Hoopoe Lark, Dunn’s Lark, Skylark and Woodlark. The -1 equations are in the form metabolic rate (kJ day ) = a * Ta + b. Average basal metabolic rates (BMR ± SD) are based on the following numbers of observations (n) (N is number of individuals): Hoopoe Lark n=7, N = 7; Dunn's Lark n=22; N=16; Skylark n=29, N=14; Woodlark n=20, N=14. Tlc (°C) is the lower critical temperature and Tuc (°C) is the upper critical temperature of the thermoneutral zone.

2 -1 Species a (SE) b n r P Tlc Tuc BMR (kJ day ) (SD)

Hoopoe Lark < Tlc -2.00 (0.15) 102.21 34 0.85 <0.001 32.7 37.5 36.87 (3.97) > Tuc 2.22 (0.51) -46.41 18 0.54 0.001 Dunn's Lark < Tlc -1.23 (0.06) 62.78 40 0.92 <0.001 31.5 43.6 24.01 (1.87) > Tuc 3.89 (0.43) -145.48 10 0.91 <0.001 Skylark < Tlc -1.39 (0.21) 93.34 27 0.64 <0.001 22.2 35.1 62.41 (8.43) > Tuc 1.66 (1.02) 4.11 14 0.18 0.13 Woodlark < Tlc -1.61 (0.14) 93.81 37 0.80 <0.001 27.6 35-40 49.39 (9.96)

(Tukey test P < 0.001). Categorizing Hoopoe Larks and Dunn’s Larks as arid birds and Skylarks and Woodlarks as mesic birds, we concluded that BMR of the arid- zone larks was 43% lower than that of the mesic species.

All larks maintained relatively constant minimum levels of TEWL at low Tas,

and rapidly increased TEWL at higher Tas (Figure 2).When we compared TEWL at 25 °C using analysis of covariance with body mass as covariate and species as

fixed factor, we found that the interaction term was not significant (F3, 44 = 2.13,

P = 0.11), but that species had a significant effect in the model (F3, 47 = 7.88, P < 0.0001). We calculated mass-adjusted TEWL by dividing TEWL by mass0.883, where 0.883 is the exponent of an equation relating TEWL to body mass of 14 species of larks (Tieleman and Williams unpubl.), and performed a post-hoc test to determine differences between species. Mass-adjusted TEWL was significantly different between Hoopoe Larks (0.104 ± 0.0096 g day-1 g-0.883, n = 7) and Skylarks (0.166 ± 0.011 g day-1 g-0.883, n = 15, Tukey test P = 0.007), and between Dunn’s Larks (0.119 ± 0.010 g day-1 g-0.883, n = 16) and Skylarks (Tukey test P = 0.010), but were indistinguishable in the remaining pairwise comparisons (Tukey test P > 0.23). Mass-adjusted TEWL of Woodlarks (0.138 ± 0.010 g day-1 g-0.883, n = 14) was intermediate between Skylarks on the one hand and Hoopoe Larks and Dunn's Larks on the other hand. Combining mass-adjusted TEWL for the two arid birds and for the two mesic larks, the two arid-zone larks had a mass- adjusted TEWL at 25 °C that was on average 27% lower than that of the two mesic species. We performed a similar analysis for TEWL at 40 °C and found no

significant interaction between body mass and species (F3, 17 = 0.46, P = 0.72),

but a significant effect of species (F3, 20 = 17.42, P < 0.0001). Post-hoc analysis of mass-adjusted TEWL showed no significant difference between Hoopoe Lark and Dunn's Lark (Tukey test P = 0.15), or between Skylark and Woodlark (Tukey test P = 0.84), but significant differences between all pairs of arid and

mesic species (Tukey test P < 0.005). With rising Ta, the two mesic larks, Skylark 138 Figure 2. Total evaporative water loss as a function of air temperature in Hoopoe Lark (A), Dunn’s Lark (B), Skylark (C) and Woodlark (D).

and Woodlark, started increasing their TEWL at lower Ta than the two species from the desert. Using TEWL at 25 °C as baseline, Skylark and Woodlark augment TEWL at 40 °C by factors of 4.3 and 4.6, respectively, whereas Hoopoe Lark and Dunn’s Lark increase TEWL by 3.9 and 2.2, respectively.

In all four species of larks, Tbs were fairly constant at Tas up to 35 °C, but increased ENVIRONMENTS at higher Ta (Figure 3). We tested if Tb at Tas up to 35 °C varied between species

using ANOVA with species and Ta as fixed factors. The interaction between Ta MESIC

and species, and Ta had no significant effects on Tb, but Tb differed significantly AND between species (interaction F15, 158 = 1.00, P = 0.46; Ta F6, 173 = 1.23, P = 0.29; spe- ARID

cies F3, 173 = 19.10, P < 0.001). Post-hoc contrast analysis of the type “repeated” TO showed no significant difference between Hoopoe and Dunn’s Larks (contrast -0.17 ± 0.20, P = 0.40) or between Sky and Woodlarks (contrast 0.06 ± 0.21, P

= 0.76). Comparing the two arid species with the two mesic larks revealed a Tb ADJUSTMENTS that was on average 1.1 °C higher in the latter group (F1. 175 = 56.87, P < 0.001).

At Ta = 40 °C, Tbs of the different species were indistinguishable (F3, 21 = 2.41, P = 0.10).

The heat transfer coefficients of Hoopoe Lark, Dunn’s Lark, Skylark and PHYSIOLOGICAL 139 Figure 3. Body temperature (± 1 SD) as a function of air temperature in Hoopoe Lark, Dunn’s Lark, Skylark and Woodlark.

Woodlark were minimal and constant at low Tas, and increased rapidly with

increasing Ta in the thermoneutral zone up to 40 °C (Figure 4). To test if h

differed between species and between the Tas we performed an analysis of cova-

riance with mass as covariate, and species and Ta as fixed factors. We included

Tas of 20 °C, when h was minimal for all species, and 40 °C, when h was maxi-

mal at the highest Ta with data for all species. After removing the insignificant interactions between the fixed factors and the covariate from the model, we

found a significant interaction between species and Ta and significant effects of

species and Ta, but no significant effect of mass on h (interaction F3, 41 = 3.93, P

= 0.015, species F3, 41 = 6.04, P = 0.002, Ta F1, 41 = 86.62, P < 0.0001, mass F1, 41 = 0.45, P = 0.51). To investigate in more detail differences in minimal h between species, we performed an analysis of covariance for h at 20 °C, and found that the interaction between mass and species was not significant, but that species

and mass had significant effects on h (interaction F3, 18 = 0.24, P = 0.87; species

F3, 21 = 8.75, P = 0.001; mass F1, 21 = 6.45, P = 0.019). To test which species differed from each other we performed a post-hoc contrast analysis that showed no significant difference in h between Skylark and Woodlark (contrast 0.090 ± 0.35 kJ day-1 °C-1, P = 0.80) or between Hoopoe Lark and Dunn’s Lark (contrast -0.54 ± 0.68 kJ day-1 °C-1, P = 0.44), but a significant difference between Woodlark and Hoopoe Lark (contrast 1.14 ± 0.52 kJ day-1 °C-1, P = 0.042). When we combined the data for Skylark and Woodlark, the mesic species, and for Hoopoe Lark and Dunn’s Lark, the arid birds, environment had a highly signifi-

cant effect on minimal h (F1, 23 = 26.79, P < 0.0001). For a hypothetical 30-g lark from a mesic environment minimal h would be 3.07 kJ day-1 °C-1, whereas for a 140 Figure 4. Dry heat transfer coefficient as a function of air temperature in Hoopoe Lark (A), Dunn’s Lark (B), Skylark (C) and Woodlark (D). Unfilled circles are calculated using l'Hôpital's rule. bird from arid regions this value would equal 2.26 kJ day-1 °C-1, 26% lower. Using Meeh’s equation to estimate body surface (Walsberg & King 1978), we also calculated surface-specific h for all birds at 20 °C. Average surface-specific h was 3.69 ± 0.71 (SD) W m-2 °C-1 (n = 7) for Skylarks, 3.59 ± 0.32 (SD) W m-2 °C-1 -2 -1

(n = 6) for Woodlarks, 2.79 ± 0.42 (SD) W m °C (n = 7) for Hoopoe Larks, ENVIRONMENTS and 2.53 ± 0.29 (SD) W m-2 °C-1 (n = 6) for Dunn’s Larks. We performed an identical series of analyses for h at 40 °C. The analysis of cova- MESIC AND riance resulted in a significant effect of species (F3, 19 = 4.49, P < 0.015), and the consecutive post-hoc test revealed a significant difference between Woodlark ARID and Hoopoe Lark (contrast 4.31 ± 1.95 kJ day-1 °C-1, P = 0.040), but no signifi- TO cant differences between Woodlark and Skylark (contrast -2.65 ± 2.12 kJ day-1 °C-1, P = 0.23), or between Hoopoe Lark and Dunn’s lark (contrast 2.05 ± 2.32 kJ day-1 °C-1, P < 0.39). Combining data for the two mesic and for the two arid ADJUSTMENTS birds, we found a significant effect of environment (F1, 21 = 9.07, P < 0.007). A hypothetical 30-g lark from a mesic area would have a h at 40 °C of 10.06 kJ day-1 °C-1, and a lark from arid environments would possess a h 40% lower, 6.05 PHYSIOLOGICAL -1 -1 kJ day °C . 141 Hoopoe Larks and Dunn’s Larks did not decrease h when Ta exceeded Tb, contra

the expectation that birds should decrease the dry heat uptake at these Tas (Figure 4A, 4B). For Hoopoe Larks, h at 50 °C was indistinguishable from h at 40 °C (paired-t = 2.16, df = 4, P = 0.10), and for Dunn's Larks, h at 48 °C h was not significantly different from h at 40 °C (t = 1.77, df = 9, P = 0.11).

Discussion This study of the physiological adjustments of four closely related species of larks, two from hot and dry deserts and two from mesic temperate areas, supports the idea that within the lark family desert species have reduced levels of BMR and TEWL compared with their mesic counterparts. Categorizing Hoopoe Larks and Dunn’s Larks as desert species and Woodlarks and Skylarks as mesic birds, mass- adjusted BMR of arid-zone larks was 43% lower than that of mesic larks, and mass-adjusted TEWL was reduced by 27% in desert species. The magnitude of these differences was larger than the 17% decrease in BMR (Tieleman & Williams 2000) but smaller than the 35% decrease in TEWL (Williams 1996) reported in multispecies comparisons for lark-sized desert birds. When compared with an allometric equation for BMR based on all birds (Tieleman & Williams 2000) Hoopoe Larks and Dunn’s Larks exhibited BMR values 3% and 7% below predictions, whereas Skylarks and Woodlarks surpassed predictions by 83% and 67%. In comparison with predicted values of TEWL from an equation for all birds (Williams 1996), TEWL of Hoopoe Lark and Dunn’s Lark were 27% and 28% lower, and values for Skylark and Woodlark were 11% above and 11% below predictions, respectively. Although several mechanisms that influence BMR have been identified, an integrative understanding of the wide variation in BMR between species of similar body size remains elusive. Gaps in our knowledge include the genetic basis of BMR (Konarzewski & Diamond 1995) and the extent to which presumably genetically programmed levels of BMR can be adjusted by acclimatization to the environment. Acclimatization to the environment has been reported in studies of seasonal variation in BMR (Kendeigh 1969; Pohl & West 1973; Cooper & Swanson 1994), and in studies that temporarily expose birds to different temperatures (Gelineo 1964; Hudson & Kimzey 1966; Chaffee & Roberts 1971; Williams & Tieleman 2000). In nine studies of temperate-zone birds, BMR increased on average by 32 ± 7.8% when birds were transferred from warm (29- 33 °C) to cold environments (0-15 °C) and kept there for 3-4 weeks (Gelineo 1964). When Hoopoe Larks were exposed to 35 °C and 15 °C during three weeks, birds from the 35 °C-group had a 30% lower BMR than birds from the 15 °C-group, an indication that the difference in BMR between larks from mesic and arid areas may be at least partially attributable to acclimatization (Williams 142 & Tieleman 2000). The extent to which mesic larks are capable of decreasing

BMR when exposed to high Ta remains to be quantified. Important determinants of BMR appear to be the size of internal organs, especially heart, kidney, liver and intestines (Daan et al. 1990; Chappell et al. 1999; Williams & Tieleman 2000). One may expect that selection pressures for low food requirements, low water loss and low heat transfer coefficients in desert birds have led through dynamic optimization to relatively small ratios of BMR and metabolic organ size to body mass. Mechanisms that determine TEWL have received less attention than those that affect BMR despite the crucial importance of water loss in the maintenance of water balance for terrestrial vertebrates. The adaptive significance of TEWL is likely to be essential especially for survival in the most extreme terrestrial environments, deserts. TEWL is the sum of respiratory and cutaneous water losses, and differences in TEWL between species could be due to variation in respiratory variables and/or skin resistance to water vapor. When Hoopoe Larks were exposed to 35 °C and 15 °C for three weeks, the 35 °C-group had a TEWL 30% below that of the 15 °C-group, suggesting a potential role for phenotypic plasticity in explaining differences between desert and non-desert birds (Williams & Tieleman 2000). A property potentially explaining the differences in TEWL between arid and mesic birds and allowing for a flexible response to environment is the composition and structure of the stratum corneum of the skin that may influence cutaneous water loss (Webster & Bernstein 1987; Arad et al. 1987; Menon et al. 1989; Menon et al. 1996; Peltonen et al. 1998). Reduced BMR and TEWL in the two desert lark species were accompanied by a lower setpoint of Tb at Ta up to 35 °C compared with the larks from mesic areas.

At 40 °C, Tbs of arid and mesic species were similar. A low Tb might result from a low rate of metabolism, which we found in the Hoopoe Larks and Dunn’s Larks, and from a high dry heat loss, not supported by our data that showed a larger h in the mesic species than in the arid larks. Although a high Tb might be useful for desert animals to facilitate dry heat loss by increasing the temperature diffe- ENVIRONMENTS

rence between animal and environment, there is no evidence that desert birds MESIC

have higher Tb than non-desert species (Tieleman & Williams 1999). In fact, AND one could imagine that a low Tb is beneficial because animals have a larger buffer ARID

to store heat before reaching lethal temperatures, assuming that the latter are TO similar in desert and non-desert animals (McNab & Morrison 1963). Reciprocal transplantation experiments where animals are exposed to conditions

of the other species’ environment may give insights into physiological perfor- ADJUSTMENTS mance that can not be gained from comparisons of minimal metabolism and

TEWL. Exposure to a range of Tas showed that the two larks from the desert have higher lower and upper critical Tas than the two mesic species (Table 1). In the PHYSIOLOGICAL field all four species experience Tas below or above their thermoneutral zones on 143 a daily basis. The high lower critical Ta will force the desert species to increase

metabolism when Tas are still fairly high, but the low heat transfer coefficient enables them to increase their metabolism by a relatively small amount compa-

red with the mesic birds once they experience Tas below the thermoneutral zone.

At Ta = 40 °C the mesic birds markedly increased their TEWL, whereas the desert species maintained TEWL at low levels (Figure 2). Interindividual varia-

tion in h is larger at this Ta (Figure 4), but on average h was 40% lower in the desert birds. The resulting low dry heat loss combined with the low evaporative

heat loss suggests that desert birds are better able to cope with a Ta of 40°C because they have a lower metabolic heat production than mesic birds and therefore do not need to dissipate as much heat through either evaporation or avenues of dry heat loss.

At Ta = Tb birds can no longer dissipate heat through conductance, convection or radiation, and must rely on evaporative cooling to prevent overheating.

Describing the response of h at these high Tas has been problematic because at

Ta = Tb the denominator of h, Tb - Ta, and the numerator, M - E, are zero and h can not be calculated directly. However, with the use of l’Hôpital’s rule, a differentiation technique, we calculated a polynomial approximation of h (Tieleman & Williams 1999) and found that Hoopoe Larks and Dunn’s Larks did not decre-

ase h once Ta reached Tb (unfilled symbols, Figure 4A, B). At higher Ta, values of h remained high and indistinguishable from those at 40 °C. These results do

not support the prediction that birds should minimize h when Ta exceeds Tb to minimize heat gain from the environment in order to reduce the costly loss of water for evaporative cooling. These patterns are similar to findings of h at high

Tas for other small birds like Black-rumped Waxbill (Estrilda troglodytes), Black- throated Sparrow (Amphispiza bilineata), Monk Parakeet (Myiopsitta monachus), and Dune Lark (Mirafra erythrocephalus) (Cade et al. 1965; Weathers & Caccamise 1975; Weathers 1981; Tieleman & Williams 1999; Williams 1999).

Acknowledgments We thank Abdulrahman Khoja, Patrick Paillat, Stéphane Ostrowski, Jean-Yves Cardona and the other staff at the National Wildlife Research Center, Taif, Saudi Arabia for logistical support. Wildlife research programs at the NWRC are possible through the generous support of HRH Prince Saud al Faisal and under guidance of A. Abuzinada of the National Commission for Wildlife Conservation and Development. We are grateful to Gerard Overkamp and the animal caretakers at the Zoological Laboratory for practical help and advice, and to Serge Daan for comments on an earlier draft. Financial support for this study was provided by the Schuurman Schimmel van Outeren Foundation, the Schure Beijerinck Popping Foundation, the National Wildlife Research Center and the 144 Ohio State University. ENVIRONMENTS MESIC AND ARID TO ADJUSTMENTS PHYSIOLOGICAL

145

CHAPTER 7 Cutaneous and respiratory water loss in larks from arid and mesic environments

B. Irene Tieleman and Joseph B. Williams Physiological and Biochemical Zoology 75: in press. 2002. ABSTRACT Birds from deserts generally have lower total evaporative water loss (TEWL), the sum of cutaneous (CWL) and respiratory water loss (RWL), than species from mesic areas. We investigated the role of CWL and RWL as a function of air

temperature (Ta) in Hoopoe Larks (Alaemon alaudipes) and Dunn’s Larks (Eremalauda dunni) from the Arabian Desert and Skylarks (Alauda arvensis) and Woodlarks (Lullula arborea) from temperate mesic grasslands. The proportional contribution of CWL to TEWL in all larks at

moderate Ta ranged from 50 to 70%. At high Ta (40-45 °C), larks enhanced CWL by only 45%- 78% and relied on an increase in RWL by 676%- 2733% for evaporative cooling. Surface-specific CWL at 25 °C was 29% lower in the arid-zone species than in the mesic larks. When acclimated

to constant Ta, 15 °C-acclimated Hoopoe Larks increased CWL by 22% compared with 35 °C- acclimated birds, but the other species did not change CWL. This study is consistent with the hypothesis that larks from deserts have a reduced

CWL at moderate and low Ta, but provided no

support for the hypothesis that at high Ta larks from arid regions rely more on CWL than larks from mesic environments. Interspecific differences in CWL can not be attributed to acclimatory responses to environmental temperature and are possibly the result of genetic differences due to natural selection or of phenotypically plastic responses to divergent environments during ontogeny.

ABSTRACT Introduction Total evaporative water loss (TEWL), the sum of cutaneous water loss (CWL) and respiratory water loss (RWL), is the main avenue of water loss in birds and of major importance in maintaining heat balance, especially for birds living in hot and dry environments (Bartholomew 1972; Dawson 1982; Williams & Tieleman 2001). Birds from deserts generally have lower TEWL than species from mesic areas (Williams 1996), although the mechanisms responsible for this finding remain unresolved. Understanding these mechanisms might provide insights into the evolutionary processes that underly the correlation between TEWL and environment. The variation in physiological traits such as TEWL and their adjustment to environmental conditions may be the result of genetic differences or phenotypic plasticity. Forms of plasticity include acclimatization or phenotypic flexibility of adult phenotypes in response to changing environments, and developmental plasticity that can determine an individual's phenotype during ontogeny. Genetic variation in physiological traits may result from natural selection or genetic drift, or may be a consequence of phylogenetic constraint (Gould & Lewontin 1979). To minimize the confounding effect of phylogenetic factors we compared TEWL and basal metabolic rate (BMR) within a closely related group of birds, all members of the lark family (Alaudidae), that are distributed over a gradient from mesic to arid habitats. We found a decline in TEWL and BMR with increasing aridity (Tieleman et al. 2002b). To investigate the extent to which interspecific differences in TEWL and BMR result from acclimatization, we acclimated five species of larks to 15°C and 35°C (Tieleman et al. 2003). Hoopoe Larks (Alaemon alaudipes) and Dunn’s Larks (Eremalauda dunni) live in arid deserts, Spike-heeled Larks (Chersomanes albofasciata) inhabit semi-arid areas, and Skylarks (Alauda arvensis) and Woodlarks (Lullula arborea) dwell in mesic environments. When measured at 25 °C, the 15 °C-acclimated Hoopoe Larks increased their mass-specific TEWL by 23% compared with the 35 °C-acclimated individuals, but the other species did not alter their TEWL in response to acclimation LARKS

(Williams and Tieleman 2000; Tieleman et al., 2003). All species increased IN their BMR when acclimated to 15 °C compared with 35 °C. If metabolic rate LOSS is correlated with RWL, and therefore RWL has increased in the 15 °C-accli- TER A mated birds, the fractional contributions of CWL and RWL to TEWL may have W changed in these larks, even if TEWL is not different. Y TOR Several mechanisms have been proposed to explain the reduced TEWL in desert

birds: hyperthermia (Calder & King 1974; Weathers 1981; Dawson 1984), coun- RESPIRA

tercurrent heat exchange in the nasal passages that lowers RWL (Schmidt- AND Nielsen et al. 1970), and adjustment of the lipid structure in the skin to reduce

CWL (Menon et al. 1989; Menon et al. 1996). Previously, we explored the role ANEOUS of hyperthermia (Tieleman & Williams 1999) and of water recovery in the nasal CUT 149 turbinates in reducing TEWL in birds (Tieleman et al. 1999). Based on this work we concluded that these factors could not account for the difference in TEWL between desert and non-desert forms. Desert birds could reduce their TEWL by decreasing their CWL (Menon et al. 1989; Menon et al. 1996; Williams 1996). Although early investigators surmised that most evaporative cooling takes place in the respiratory passages (Rawles 1960; Bartholomew & Cade 1963; Mount 1979), later work showed that CWL is an important avenue of water loss in the thermoregulatory process, at least at

air temperatures (Ta) below body temperature (Smith 1969; Bernstein 1969; Dawson 1982; Webster & Bernstein 1987; Webster & King 1987; Wolf & Walsberg 1996; Michaeli & Pinshow 2001). Collating data from the literature, we were unable to identify any significant differences in CWL at thermally neu-

tral Ta between species from arid and mesic environments (Williams & Tieleman 2001). However, conclusions were tentative because data were few and obtained in a variety of ways (Appleyard 1979; Marder & Ben-Asher 1983; Withers & Williams 1990).

Few studies have investigated CWL and RWL at high Ta when Tb must be regulated below lethal limits solely by evaporative water loss, from the skin and from the respiratory passages (Marder & Ben-Asher 1983; Wolf & Walsberg 1996; Hoffman & Walsberg 1999). Some species, especially members of the

Columbiformes, seem to rely primarily on CWL when Ta exceeds Tb, whereas other species seem to emphasize the use of RWL, facilitated by panting or gular flutter (Bouverot et al. 1974; Wolf & Walsberg 1996; Tieleman et al. 1999; Hoffman & Walsberg 1999; Williams & Tieleman 2001). Our understanding of

CWL and RWL at high Ta and how water loss is partitioned remains rudimentary. Our hypothesis is that natural selection should have equipped desert birds with

a mechanism that impedes water loss through the skin, at least at moderate Ta, to save water. Under heat stress, when evaporative cooling is crucial for survival, evaporation through the skin should be elevated. Birds from mesic environments

on the other hand, which experience neither water scarcity nor high Ta, would

not have been selected for reduced CWL at moderate Ta, or for the capacity to

enhance evaporation at high Ta. Rates of CWL in desert birds may be governed by two selective pressures, a long-term requirement of minimizing CWL, and as

a result TEWL, and a short-term goal of maintaining Tb below lethal limits during episodes of extreme heat by means of increased RWL and CWL. CWL may be influenced by the structure and content of lipids in the epidermis (Menon et al. 1989; Menon et al. 1996), changes in which could be directed by natural selection in birds of arid environments.

In this study we investigated CWL and RWL as a function of Ta in Hoopoe Larks and Dunn’s Larks from the Arabian Desert, and Skylarks and Woodlarks from 150 temperate grasslands in the Netherlands. Data on the complete heat balance, including metabolism, TEWL, Tb and the dry heat transfer coefficient per species and on the phylogenetic relationships between these four larks can be found in Tieleman et al. (2002c). We examined if CWL and RWL at moderate Ta were lower in the two arid-zone larks than in the two mesic birds, and if, when birds were heat stressed, CWL increased more in the arid-zone larks than in those from the mesic areas. In addition, we explored the phenotypic flexibility of CWL and RWL of all four species in response to acclimation to 15 °C and 35 °C.

Methods We mist-netted Hoopoe Larks (mass 36.5 ± 3.7 g, n = 14) and Dunn’s Larks (20.5 ± 1.8 g, n = 16) in Mahazat as-Sayd, a reserve in the Arabian Desert (22° 15'N 41° 50'E), and housed them in outdoor aviaries at the National Wildlife Research Center, near Taif, Saudi Arabia. Average yearly rainfall in Mahazat equals 90 mm and maximum Ta in July averages 40.2 °C with some daily maxima reaching 50 °C (National Wildlife Research Center, unpubl.). Temperatures in Taif resemble those in Mahazat during the summer. In the Netherlands we netted Skylarks (31.5 ± 2.9 g, n = 14) and Woodlarks (25.5 ± 1.0 g, n = 14) in the province of Drenthe (52° 52'N 06° 20'E) and kept them in outdoor aviaries at the Zoological Laboratory of the University of Groningen, 30 km from the capture site. In Drenthe rainfall averages 750 mm/year and mean maximum Ta in July is 21.7 °C (Koninklijk Nederlands Meteorologisch Instituut). We used an open flow system for indirect calorimetry to measure CWL, RWL and metabolic rate (MR) of all birds during day-time after they had been in captivity for 3-6 weeks during June, July or August of 1999-2001. Larks were fed ad libitum a mixture of insects and seeds. In addition, larks in the Netherlands had access to water ad libitum. Hoopoe Larks and Dunn’s Larks do not drink, even when provided with water or after rains when temporary pools are available (pers. obs.). Previous investigators have used a two-compartment system with the head and neck of the bird extending through a dental dam barrier to quantify CWL and LARKS IN RWL separately (Bernstein 1971; Webster & King 1987; Wolf & Walsberg 1996; Hoffman & Walsberg 1999). We developed a system that reduces the contribu- LOSS TER tion of the eyes, head and neck to RWL, while measuring RWL and CWL simul- A W taneously (Figure 1). We placed a bird fitted with a plastic mask in a metabolism Y TOR chamber into which dry, CO2-free outside air was drawn. The mask covered the entire bill and was held snug against the front of the bird’s head with strips of soft RESPIRA leather. Thin pieces of thread attached to the mask and tied behind the head AND held the mask in place. Because the mask left the eyes and head of the bird ex-

posed to the chamber, evaporation from eyes and head contributed to CWL. Air ANEOUS

flowed into the mask through spaces at the mask-forehead junction. Birds grew CUT 151 Figure 1. Laboratory setup to simultaneously measure cutaneous and respiratory water loss in birds.

accustomed to wearing this set-up in about 15 minutes and did not appear stressed when we removed them from the chamber. This method is an improvement over the chamber with a ventilatory and cutaneous partition. In the latter method the bird is restrained with its head snug in a latex sheet and “ventilatory” water loss includes evaporative water loss from respiratory passages, from the eyes and from the head (Bernstein 1971; Webster & King 1987; Wolf & Walsberg 1996; Hoffman & Walsberg 1999). In Saudi Arabia steel metabolic chambers (24 cm x 20 cm x 28 cm, height x width x length) had an air-tight Plexiglas lid and were water-jacketed to control

Ta by a Neslab circulating water bath (RTE-140) ±0.2 °C. In the Netherlands

larks were placed in steel metabolic chambers of identical dimensions but Ta was controlled by a Heraeus Vötsch environmental chamber. Prior to measurements birds had fasted 3 hours. Birds were then placed on a wire-mesh platform over a layer of mineral oil which trapped excrement, thus excluding feces as a source of water in the measurements. Birds became accustomed to experimental conditions in about 15 minutes and generally remained inactive during the measurement

period, as judged from the stable and flat traces of delta O2 (i.e. the differential out-

put of the two-celled O2-analyzer) and dewpoint. Any activity showed up on the

graphs within three minutes because the response time of the O2-analyzer and dewpoint hygrometer to changes in respiratory values of occasional activity by the bird was within a few minutes. After air passed through a column of Drierite, we measured the dewpoint from which we calculated the water vapor density ρ ( v_in, STP) of inlet air. Air, pulled through the mask, contained all respiratory gases, and was routed through PTFE-tubing, a General Eastern dewpoint hygro-

meter (M4), columns of Drierite and Ascarite to remove H2O and CO2, a Brooks mass flow controller (model 5850E) that was calibrated with a bubble meter (Levy 1964), a vacuum pump, and into an oxygen analyzer (Applied 152 Electrochemisty S3A-II in Saudi Arabia and Servomex Xentra 4100 in the Netherlands). The dewpoint hygrometers were factory calibrated with a primary standard traceable to the National Institute of Standards and Technology. Their response times were less than 3 minutes for dew points of -20 °C and faster at higher dew points. We calculated the flow rate through the dewpoint hygrometer (V'e1) by adjusting the value recorded at the mass flow controller for H2O and

CO2 added (Tieleman et al. 2002c), the latter estimated assuming an R.Q. of 0.71 (King & Farner 1961). In practice these adjustments were less than 1%. To ρ ρ calculate RWL we used the equation RWL = ( v_mask - v_chamber) (V'e1), where ρ 3 v_chamber is the water vapor density (g/m , STP) of air going into the mask from ρ the chamber, v_mask is the water vapor density (STP) coming out of the mask and

V'e1 is the corrected flow rate at the dewpoint hygrometer. Oxygen consumption was calculated with equation 4a of Withers (1977). We used 20.08 J/ml O2 to convert oxygen consumption to heat production (Schmidt-Nielsen 1997). Air was also drawn from the chamber through a second port, and passed along a second train identical to the first, except that air from the vacuum pump was vented to the room. Calculation of CWL was complicated by the fact that air that contained water vapor from the skin was exiting through two ports. We calculated air flow leaving the chamber by summing the flow rates from the mask

(V'e1) and from the chamber (V'e2), and determined CWL with the equation ρ ρ CWL = ( v_chamber - v_in)(V'e1 + V'e2). After a 2-3 h equilibration period, we recorded %O2 and dewpoints of inlet, chamber and mask air, the temperature of the air in the dewpoint hygrometers and Ta in the chamber using a Campbell Scientific data logger (model 21X or CR23X). When, during the third hour of measurements, the traces for O2 consumption and dewpoints were stable for at least 10 min, we noted these times and used these data for calculations. To investigate the relationship between CWL and RWL and Ta, we measured these variables over a range from 15 °C to 45 °C in Hoopoe larks (n = 7 at each Ta) and Dunn’s larks (n = 6), and from 15 °C to 40 °C in Skylarks (n = 7) and Woodlarks (n = 6). Relative humidities in the chamber were below 16% at all temperatures LARKS

for all species and were unlikely to have impeded CWL (Lasiewski et al. 1966). IN

Relative humidities of the air in the mask were for all species below 20% at Tas LOSS up to 35 °C and between 13% and 32% at 40 °C, values low enough not to res- TER A trict RWL (Lasiewski et al. 1966). At 45 °C the relative humidity of the air in W the mask of Hoopoe Larks and Dunn’s Larks varied between 26% and 65%. Flow Y TOR rates at this high Ta were a compromise between maintaining relative humidity

sufficiently low not to impede RWL and delta O2 sufficiently high (above 0.09%) RESPIRA

to obtain enough accuracy in measurements of O2 consumption. AND

To ensure that all respiratory gases were captured by the mask, we set Ve1 > Ve2.

Depending on Ta and species, Ve1 was set between 540 ml/min and 1475 ml/min ANEOUS CUT and Ve2 between 360 ml/min and 510 ml/min. In preliminary testing of our sys- 153 tem, we placed a bird with a mask in the chamber and verified that the O2 con-

centration of the air stream leaving the chamber always equaled the O2 concentration of air entering the chamber, indicating that expired air of the bird was not mixing with the chamber air. Further, we confirmed that measurements of TEWL given as the sum of RWL and CWL in this system were not different from measurements of TEWL on the same individual birds when a conventional system was used (paired-t = 1.56, df = 24, P = 0.13). Likewise, we confirmed that metabolic rates (MR) were indistinguishable between both systems (paired-t = 1.72, df = 24, P = 0.10). Therefore, our system did not appear to be more stressful than the conventional metabolic chamber system. To assess the flexibility of CWL and RWL we measured TEWL and MR of Skylarks and Woodlarks at night and CWL, RWL and MR of Hoopoe Larks and Dunn's Larks during the day at 25 °C before we randomly assigned individuals to two groups with equal proportions of males and females and verified that the birds were similar in body mass in both assemblages. One group of each species

was housed in a room with a constant Ta of 15±2 °C (12L:12D), below the thermoneutral zone of all species involved, and close to the average environmental

Ta experienced by larks in the Netherlands during the breeding season. We

placed the other group in rooms with a constant Ta of 35±2 °C (12L:12D), to

mimic environmental Ta of the Arabian Desert during spring. Birds were housed in groups of 7 or 8 individuals in cages of 1m x 1m x 2m in the environmental rooms. Humidities were not controlled but were recorded on 3 occasions in Saudi Arabia with a Vaisala relative humidity probe and on 2 occasions in the Netherlands with the General Eastern dewpoint hygrometer. The Vaisala relative humidity probe is generally not as accurate as the dewpoint hygrometer, but we calibrated the probe over a NaCl solution and against the dewpoint hygrometer and found it to be consistent with the latter. Absolute humidities were about 5 g/m3 and 7 g/m3 in the 15 °C-rooms, and 12 g/m3 and 9 g/m3 in the 35 °C-rooms in Saudi Arabia and the Netherlands, respectively. After 3 weeks we measured final values for CWL, RWL and MR at 25 °C for all birds during the day. Analyses of variance (ANOVA) and post-hoc tests were carried out using General Linear Models procedures in SPSS 10.0. Averages are reported ±1 S.D. Experiments were performed under license of the University of Groningen (DEC 2425).

Results All larks maintained low and relatively constant levels of CWL and RWL up to

35 °C, but RWL increased rapidly at higher Ta (Figure 2). Comparing values at 25 °C and 40 °C, CWL remained unchanged in Dunn’s Larks (1.51 ± 0.53 g day-1; 154 paired t = 0.60, df = 5, P = 0.57) and Hoopoe Larks (2.04 ± 0.55 g day-1; paired t = 0.27, df = 5, P = 0.80), increased by 72% in Skylarks, from 2.56 ± 0.41 g day-1 to 4.39 ± 2.15 g day-1 (paired t = 2.01, df = 5, P = 0.10), and by 45% in Woodlarks, from 2.07 ± 0.58 g day-1 to 3.01 ± 0.96 g day-1 (paired t = 3.09, df =

5, P = 0.03). In contrast, RWL increased rapidly at high Ta in all species. Comparing RWL at 25 °C and 40 °C, values increased by 332% in Dunn's Larks, from 1.16 ± 0.20 g day-1 to 5.01 ± 1.41 g day-1 (paired t = 6.02, df = 5, P = 0.002), by 665% in Hoopoe Larks, from 1.00 ± 0.35 g day-1 to 7.63 ± 3.49 g day-1 (paired t = 4.59, df = 5, P = 0.006), by 676% in Skylarks, from 1.28 ± 0.36 g day-1 to 9.92 ± 1.51 g day-1 (paired t = 12.58, df = 5, P < 0.0001), and by 993% in Woodlarks, from 1.00 ± 0.15 g day-1 to 10.97 ± 2.84 g day-1 (paired t = 8.52, df = 5, P < 0.0001). Adjusting the significance level of the t-tests with a sequential Bonferroni's correction did not alter the results (Rice 1989). Dunn’s Larks and Hoopoe Larks did not increase CWL and RWL at 40 °C by as much as Skylarks and Woodlarks. However, at 45 °C Dunn’s Lark and Hoopoe Lark had increased RWL by 1248% and 2733% compared with values at 25 °C, whereas CWL only increased by 75% and 78%, respectively.

When Ta increased from 15 °C to 35 °C, CWL varied from 55 to 70% of TEWL LARKS IN LOSS TER A W Y TOR RESPIRA AND

Figure 2. Cutaneous and respiratory water loss as a function of air temperature in Hoopoe Larks ANEOUS (A), Dunn’s Larks (B), Skylarks (C) and Woodlarks (D). CUT 155 Figure 3. Proportional contribution of cutaneous water loss (CWL) to total evaporative water loss (TEWL) as a function of air temperature in Hoopoe Larks, Dunn’s Larks, Skylarks and Woodlarks. Error bars indicate 1 S.D.

in all four species (Figure 3). When Ta exceeded 35 °C, all species increased RWL considerably and the contribution of CWL to TEWL decreased to around 25% at 40 °C. Hoopoe Larks and Dunn’s Larks increased RWL even further at 45 °C, where CWL constituted only 12% of TEWL. Therefore, we conclude that in all four lark species CWL is a significant proportion of TEWL at moderate and

low Ta, but that RWL is the primary avenue for evaporative heat loss at high Ta. To normalize CWL and RWL, we calculated surface-specific CWL with Meeh’s equation for skin surface area (Walsberg & King 1978) and mass-specific RWL by dividing RWL by body mass (Figure 4). At 25 °C, surface-specific CWL and

mass-specific RWL differed significantly between species (CWL, species F3, 22 =

3.44, P = 0.034; RWL, species F3, 22 = 7.69, P = 0.001). Post-hoc analysis showed a lower surface-specific CWL in Hoopoe Larks than in Skylarks and no difference between Dunn’s Larks and Hoopoe Larks or between Skylarks and Woodlarks (Figure 4A), and a lower mass-specific RWL in Hoopoe Larks compared with Dunn’s Larks (Figure 4C). To provide an estimate of the magnitude of differences between arid and mesic larks, we combined Woodlark and Skylark as mesic birds and Dunn’s Lark and Hoopoe Lark as arid birds. Surface-specific CWL was 26.5 ± 9.59 mg cm-2 d-1 in the former and 18.8 ± 3.25 mg cm-2 d-1 in the latter, a reduction of 29% in the desert species. Mass-specific RWL at 25 °C averaged 39.0 ± 9.47 mg d-1 g-1 in the mesic larks and 40.6 ± 11.64 mg d-1 g-1 in the desert

birds, almost identical values. At 40 °C, the highest Ta with data for all larks, species also differed significantly in surface-specific CWL and mass-specific RWL

(CWL, species F3, 22 = 4.72, P = 0.011; RWL, species F3, 22 = 9.86, P < 0.0001). 156 Figure 4. Surface-specific cutaneous water loss (CWL, mean ±1 S.D.) at 25 °C (A) and 40 °C (B) and mass-specific respiratory water loss (RWL, mean ±1 S.D.) at 25 °C (C) and 40 °C (D) of Hoopoe Larks, Dunn’s Larks, Skylarks and Woodlarks. Identical letters indicate that bars were not significantly different from each other when analyzed with a Tukey test following a univariate analysis of variance (critical P = 0.05).

Skylarks had a higher surface-specific CWL than Dunn’s Larks and Hoopoe LARKS Larks, but did not differ from Woodlarks (Figure 4B). Woodlarks had a higher IN

mass-specific RWL than Dunn’s Larks and Hoopoe Larks, but did not differ from LOSS TER

Skylarks, whereas Hoopoe Larks had a lower RWL than both mesic species, but A W were not different from Dunn’s Larks (Figure 4D). When we compared the aver- Y age surface-specific CWL and the mass-specific RWL of the two arid species TOR combined (CWL, 18.8 ± 8.54 mg cm-2 d-1; RWL, 215.7 ± 72.23 mg d-1 g-1) with the values of the two mesic species combined (CWL, 37.5 ± 16.51 mg cm-2 d-1; RESPIRA RWL, 356.2 ± 92.53 mg d-1 g-1) to obtain an idea of the magnitude of differences AND between larks from both environments, we found reductions in the arid birds of 50% and 39%, respectively. ANEOUS CUT

Because Skylarks and Woodlarks have higher rates of metabolism than Dunn’s 157 Figure 5. Energy-specific cutaneous (A) and respiratory (B) water loss as a function of air temperature in Hoopoe Larks, Dunn’s Larks, Skylarks and Woodlarks. Error bars indicate 1 S.D.

Larks and Hoopoe Larks (Tieleman et al. 2002c) we also compared evaporative water loss per unit energy expenditure among species (Figure 5). CWL norma-

lized for metabolism (mg water/kJ) increased little with increasing Ta, and was 61% higher at 40 °C than at 25 °C for all species combined (Figure 5A). It did

not differ among species at either 25 °C (F3, 22 = 1.08, P = 0.38) or 40 °C (F3, 22 = 0.87, P = 0.47). In all four species, RWL normalized for metabolism (mg

water/kJ) increased little between 15 °C and 35 °C, but rapidly when Ta increased to 40 °C and 45 °C (Figure 5B). At 25 °C, normalized RWL differed significant-

ly between species (F3, 22 = 6.12, P = 0.003) and post-hoc analysis showed that normalized RWL of Dunn’s Larks was higher than that of Hoopoe Larks (Tukey P = 0.037), Skylarks (Tukey P = 0.014) and Woodlarks (Tukey P = 0.003), but that the other three species were indistinguishable from each other (Tukey all P > 0.63). At 40 °C, differences in normalized RWL between species were signifi-

cant (F3, 22 = 4.35, P = 0.015) and post-hoc analysis showed that RWL of the 158 Figure 6. Cutaneous (CWL, A) and respiratory (RWL, B) water loss (mean ± 1 S.E.M.) of Hoopoe Lark, Dunn’s Lark, Skylark and Woodlark when acclimated to the outside environment (pre-acclimation) and after a 3-week acclimation period in constant temperature rooms of 15 °C or 35 °C. Asterisk indicates significant difference in CWL between 15 °C and 35 °C-acclimated Hoopoe Larks.

Woodlark was higher than that of the Skylark (Tukey P =0.011), but that the LARKS other species pairs did not differ (Tukey all P > 0.07). IN CWL, measured at 25 °C, of Hoopoe Larks acclimated at 15 °C was significant- LOSS

ly higher by 22% than that of conspecifics acclimated at 35 °C, but CWL of TER A Dunn’s Larks, Skylarks and Woodlarks did not differ between treatments W Y

(Hoopoe Lark, F1, 11 = 4.92, P = 0.049; Dunn’s Lark, F1, 13 = 0.05, P = 0.82; TOR

Skylark, F1, 11 = 2.94, P = 0.11; Woodlark, F1, 11 = 1.67, P = 0.22) (Figure 6A).

RWL, measured at 25 °C, did not differ between larks acclimated to 15 °C and RESPIRA

35 °C in any of the four species (Hoopoe Lark, F1, 11 = 3.61, P = 0.08; Dunn’s AND

Lark, F1, 13 = 0.004, P = 0.95; Skylark, F1, 11 = 2.43, P = 0.15; Woodlark, F1, 11 =

0.02, P = 0.88) (Figure 6B). Although metabolic rates of Skylarks and Dunn’s ANEOUS Larks acclimated to 15 °C were significantly higher than those of individuals CUT 159 TABLE 1. Metabolic rate (MR, kJ day-1) at 25 °C of Dunn's Larks, Hoopoe Larks, Skylarks and Woodlarks acclimated to 15 °C or 35 °C.

Species 15 °C 35 °C -1 -1 MR (kJ d ) SD n MR (kJ d ) SD n Fndf, ddf P

Dunn's Lark 49.7 3.17 8 44.8 3.38 8 10.141,13 0.007 Hoopoe Lark 67.7 10.56 7 62.4 5.78 7 1.431,11 0.26 Skylark 113.8 15.25 7 90.3 11.94 7 10.501,11 0.008 Woodlark 91.8 5.38 7 88.1 6.20 7 0.591,11 0.46

acclimated to 35 °C (Table 1), we did not find differences in RWL. Neither Hoopoe Larks nor Woodlarks acclimated to 15 °C and 35 °C differed in metabolic rate (Table 1).

Discussion

CWL and RWL as function of Ta

When exposed to moderate and low Ta, Hoopoe Larks, Dunn’s Larks, Skylarks and Woodlarks maintained relatively low and constant levels of CWL and RWL,

but when Ta exceeded 35 °C only RWL rapidly increased (Figure 2). The con-

tribution of CWL to TEWL at Ta ranging from 15 °C to 35 °C was 50-70% in all four larks, values within the range reported for the few other species measured, including the similar-sized passerines Budgerygah (Melopsittacus undulatus), Sociable Weaver (Ploceus cucullatus) and Zebra Finch (Taeniopygia guttata) (Bernstein 1971; Calder & King 1974; Dawson 1982; Marder & Ben-Asher

1983; Webster et al. 1985). When Ta exceeded 35 °C all larks increased relian- ce on RWL for thermoregulation. The contribution of CWL to TEWL decreased to around 25% at 40 °C and to 12% at 45 °C, the latter for Dunn’s Larks and Hoopoe Larks. At 25 °C, CWL of Hoopoe Larks, 2.16 g/day, and Dunn’s Larks, 1.43 g/day, were 17% and 15% below allometric predictions, respectively, whereas CWL of Skylarks, 2.56 g/day, and Woodlarks, 2.07 g/day, were 11% and 3% above allometric predictions (Williams & Tieleman 2001). Surface-specific CWL at 25 °C was 29% lower in the two arid-zone larks than in the two species from mesic habitats, but mass-specific RWL did not differ. These results are consistent with

the hypothesis that, at moderate Ta, CWL is reduced in birds from arid environments, a reduction that accounts for most of the difference in TEWL between desert and non-desert birds. Mass-adjusted TEWL at 25 °C was 27% lower in Dunn’s Larks and Hoopoe Larks compared with Skylarks and Woodlarks (Tieleman et al. 2002c). When heat-stressed, Woodlarks and Skylarks at 40 °C increased their CWL by 45% and 72% compared with 25 °C, whereas Hoopoe larks and Dunn’s Larks at 160 45 °C increased their CWL by 78% and 75%, respectively. This pattern differs from that of pigeons and doves, Chukar (Alectoris chukar), Spotted Sandgrouse (Pterocles senegallus) and Rhea (Rhea americana), where the increase in CWL at 45 °C is 230%-1104% (Marder & Ben-Asher 1983; Marder & Ben-Asher 1983; Hoffman & Walsberg 1999; Williams & Tieleman 2001). All four species of larks relied less on CWL at high Ta than did the Verdin (Auriparus flaviceps), the only other passerine for which CWL has been measured at high Ta, which increased its CWL by 122% (Wolf & Walsberg 1996). We found no support for the hypothesis that larks from deserts increase their CWL at high Ta more than non- desert larks. Instead, when heat-stressed, all larks relied on RWL for evaporative cooling. CWL has been assumed to be more efficient than RWL at high Ta because CWL is a passive diffusion process that does not require muscle activity. Increased RWL by panting and gular flutter would require muscle activity and therefore result in increased heat production (Arad et al. 1987). However, Hoffman and Walsberg (1999) suggest that ultimately both routes of evaporative heat loss are passive diffusional processes and although CWL may not require muscular activity, it needs delivery of water to the stratum corneum, a process that could be energetically costly. The combination of high CWL and high MR of mesic larks and that of low CWL and low MR of arid larks resulted in indistinguishable rates of energy-specific CWL. However, assessing the energetic costs of CWL will require an experimental approach.

Phenotypic flexibility of CWL and RWL The reduced CWL of Hoopoe Larks and Dunn’s Larks compared with Skylarks and Woodlarks could result from genetic differences brought about by natural selection or drift, or by phenotypic responses to different environments during either ontogeny or adult life. Only the Hoopoe Lark increased its CWL by 22% when acclimated to 15 °C compared with 35 °C, but the difference in CWL was too small to account for the interspecific differences in CWL, suggesting that acclimatization to Ta plays a minor role in determining CWL. Possible effects of the humidity of the environment, of water availability in food items or as drin- LARKS IN king water, or of conditions during development remain to be studied in birds. In Merriam's kangaroo rats (Dipodomys merriami) adults from mesic and arid sites LOSS TER differed in CWL but the arid-site individuals increased CWL to the same level A W Y as the mesic-site animals when acclimated to constant humidity and Ta in the laboratory (Tracy & Walsberg 2000). Developmental plasticity and acclimation TOR can account completely for the intraspecific differences in TEWL in this species RESPIRA (Tracy & Walsberg 2001). Compared with adults, nestling Zebra Finches AND (Taeniopygia guttata) have a lower CWL and a higher lipid content in the epidermis, a structure that is thought to form the basis of the integumentary per- ANEOUS

meability barrier for water (Menon et al. 1987). However, evidence that CWL CUT of adults may depend on developmental conditions is not available. 161 Potential mechanisms Mechanisms that might explain the difference in CWL between larks from arid and mesic habitats and that could account for the flexibility of CWL in the Hoopoe Lark might include alterations of the permeability of the skin to water vapor or of the diffusion path length. CWL is a function of the water vapor gradient between skin and air, and the total resistance to water vapor diffusion across skin, feathers, and boundary layer (Appleyard 1979; Webster & King 1987; Wolf & Walsberg 1996). Resistance to vapor diffusion across the skin

accounts for 75-90% of the total at least at moderate Ta (Tracy 1982; Marder & Ben-Asher 1983; Webster et al. 1985). For resistance across the skin to change, birds must vary the diffusion path length, or alter the permeability of the skin to water vapor. The skin of birds is composed of an epidermis and a well vascularized dermal layer (Lucas & Stettenheim 1972). During heat stress, birds can reduce the diffusion path length by vasodilation of the dermal capillary bed, effectively increasing CWL (Peltonen et al. 1998). Rock Doves (Columba livia) under heat stress not only dilate capillaries but also increase the permeability of the skin to water vapor (Smith 1969; Arieli et al. 1995; Peltonen et al. 1998). In response to dehydration, changes in epidermal lipid conformation within the stratum corneum may reduce the permeability of the skin to water vapor, although data are few (Menon et al. 1987; Menon et al. 1989; Menon et al. 1996).

Evolutionary perspective

Evaporative heat loss at high Ta follows contrasting pathways in birds from different taxonomic groups. Heat-stressed Columbiformes rely primarily on CWL (Marder & Ben-Asher 1983; Arad et al. 1987), whereas Passeriformes rely largely on RWL to dissipate excess heat (Wolf and Walsberg 1996b; this study). Although species from both taxa occur in deserts and are able to withstand high

Ta, pigeons and doves rely on drinking water daily (Arad et al. 1987), but larks do not. When drinking water is denied, dehydrated Rock Pigeons diminish CWL, become hyperthermic, and develop signs of thermal distress (Arad et al. 1987). However, even after rainfall, we have never observed Hoopoe Larks and Dunn’s Larks drinking in the Arabian Desert, while many other birds do. We sug-

gest that taxon-specific responses of CWL to high Ta might result from divergent selection for heat tolerance mechanisms depending on whether species have access to drinking water or are selected for a frugal water economy. The generally low TEWL of larks (Tieleman et al. 2002b) may result from adjustments in the skin that do not allow a rapid increase in CWL under acute heat stress. Instead,

when exposed to Ta exceeding Tb, larks rely on increasing RWL for thermoregulation.

162 Acknowledgments We thank Abdulrahman Khoja, Patrick Paillat, Stéphane Ostrowski, Jean-Yves Cardona and the other staff at the National Wildlife Research Center, Taif, Saudi Arabia for logistic support. Wildlife research programs at the NWRC are possible through the generous support of HRH Prince Saud al Faisal and under guidance of A. Abuzinada of the National Commission for Wildlife Conservation and Development. We are grateful to Gerard Overkamp and the animal caretakers at the Zoological Laboratory for practical help and advice. Serge Daan and two anonymous reviewers provided comments to improve a previous draft. We thank Dick Visser for making the figures. Financial support was provided by the Schuurman Schimmel van Outeren Foundation, the Schure Beijerinck Popping Foundation, the NWRC and the Ohio State University. LARKS IN LOSS TER A W Y TOR RESPIRA AND ANEOUS CUT

163

CHAPTER 8 Energy and water budgets of larks in a life history perspective: is parental effort related to environmental aridity?

B. Irene Tieleman, Joseph B. Williams, and G. Henk Visser Submitted to Ecology ABSTRACT We compared physiological, demographic and ecological variables of larks to gain insights into life history variation along an aridity gradient, incorporating phylogenetic relationships in analyses when appropriate. Quantifying field metabolic rate (FMR) and water flux (WF) of parents feeding nestlings as measures of parental effort, we found that parental FMR and WF were lower by 24-39% and 39-61%, respectively, in larks from arid environments compared with species from mesic areas. Water and energy requirements of 6-8 day old nestlings were reduced in desert species. Nestling growth rate, clutch size and number of clutches decreased with increasing aridity, and nest predation rates increased with increasing aridity. We combined FMR and WF of parents and chicks, energy and water accumulated during growth, and brood size to establish energy and water budgets of parent-brood units. Parent-offspring energy budgets equaled 101 kJ d-1 for Bar-tailed Desert Lark, 265 kJ d-1 for Hoopoe Lark, 162 kJ d-1 for Dunn’s Lark, 389 kJ d-1 for Skylark, and 345 kJ d-1 for Woodlark, a 28% reduction in the desert species when taking into account mass differences. Family unit water fluxes were 23.8 g d-1 for Bar-tailed Desert Lark, 48.6 g d-1 for Hoopoe Lark, 37.5 g d-1 for Dunn’s Lark, 101.4 g d-1 for Skylark, 82.8 g d-1 for Woodlark. Parent-brood units of arid-zone species used 28-50% less water per gram mass than species from mesic areas. These results support the hypothesis that decreasing food and water availability favor lower energy and water requirements of parents and young, reduced growth rates, and smaller clutch sizes with increasing aridity. The decrease in parental effort with increasing aridity might reflect a lower fitness value of a single brood for arid-zone species than for larks from mesic habitats, suggesting that the probability of adult survival is higher in arid than in mesic areas.

ABSTRACT Introduction A central tenet of life history theory is that current reproductive investment is traded off against residual reproductive value (Williams 1966; Stearns 1992; Roff 1993). This trade-off, or cost of reproduction, is fundamental in predicting the optimal life history in a variety of environments. The difficulty of obtaining direct measures of fitness costs to demonstrate a cost of reproduction has stimulated investigators to find quantifiable currencies that are related to fitness. A frequently used measure of current reproductive investment is parental effort, the proportion of available resources devoted to reproduction as opposed to growth and maintenance (Reznick 1985), that can be expressed in terms of energy, assuming that life history trade-offs are the result of energy allocation (Drent & Daan 1980; Bryant 1988). Because separating resources allocated to reproduction and to maintenance is problematic in field studies on birds, many studies use total daily energy expenditure as a measure of parental effort (Bryant 1988; Weathers & Sullivan 1989; Tinbergen & Verhulst 2000). In this study we use parental energy and water expenditure in the field as proxy to quantify parental effort, and we relate these variables to basal metabolic rate and total evaporative water loss from laboratory studies. In addition, we investigate variation in clutch size as an independent measure of parental effort. Whereas clutch size is ultimately evaluated in light of parental fitness allocation to current and future reproduction (Perrins & Moss 1975; Boyce & Perrins 1987), it may also be viewed as the outcome of a trade-off between growth rate and nutrient requirements of the young, and depend on environmental conditions such as food availability and risk of nest predation. Lack (1968) argued that nestling mortality due to predation could be reduced by shortening the nestling period, but that this would require faster growth and result in higher energy demands of the young. He suggested that growth rates are a compromise between food availability and risk of predation. Environments with a higher predation risk should select for faster growing young, and thereby force parents to raise fewer young per nesting attempt. In contrast with this prediction however, high FIELD nest predation, slow growth, and small broods occur together in the tropics, THE whereas low nest predation, fast growth and large broods coincide in temperate IN zones (Skutch 1966; Ricklefs 1979). Adding knowledge of the relationships between LARKS

growth rate, clutch size and nest predation over an environmental continuum of OF increasing aridity may provide new insights into the effect of environmental factors on demography and physiology. BUDGETS Deserts are characterized by high ambient temperatures (T ), unpredictable, low

a TER A rainfall and reduced primary productivity, resulting in limited food and water W availability for their inhabitants. One might expect that birds exposed to these AND conditions require specific physiological and behavioral adaptations that permit survival and reproduction (Serventy 1971; Dawson 1984; Williams & Tieleman ENERGY 167 2001). Low food and water availability could constrain energy and water intake, and the thermal environment may limit time available for foraging and force birds to minimize activity during the middle part of the day (Williams et al. 1999; Tieleman & Williams 2002a). In such an environment, natural selection potentially favors individuals with low rates of energy expenditure and water loss (Louw & Seely 1982; Williams & Tieleman 2001). However, during the reproductive season, parents not only provide food and water for themselves, but also for their offspring, and may need to elevate their own energy and water requirements in order to produce young. Whereas the amount of energy and water that can be invested per brood may be determined by the time available for foraging and the availability of food and water, the number of chicks that can be reared per brood depends also on the daily energy and water requirements per young. Reductions in these requirements could be accomplished by reducing nestling metabolism, growth rate, and evaporative and excretory water losses (Klaassen & Drent 1991). To date, few studies have investigated how energy and water are allocated to different components of the energy and water balance of a parent- brood complex in different environments. Early work on metabolism and water flux did not show any general physiological differences between desert and non-desert species (Bartholomew & Cade 1963; Dawson & Schmidt-Nielsen 1964; Serventy 1971; Dawson 1984). Subsequent studies, typically on single species of desert birds, have reported low basal metabolic rate (BMR), total evaporative water loss (TEWL) (Dawson & Bennett 1973; Weathers 1979; Arad & Marder 1982; Withers & Williams 1990), and low field metabolic rate (FMR) (Nagy 1987) and water flux (WF) (Nagy & Peterson 1988). More recently, across species comparisons between desert and non-desert species supported the hypothesis that arid-zone birds have on average lower BMR, FMR (Tieleman & Williams 2000) and TEWL (Williams 1996), also when taking into account phylogenetic relatedness among species. Results for comparisons of field water flux were equivocal, with conventional analysis showing differences between desert and non-desert species, but independent contrast analysis not (Tieleman & Williams 2000). Broad-scale interspecific comparisons of metabolism and water loss have the inherent problem that species differ not only in habitat but also in phylogenetic background, diet and behavior. Restricting comparative analyses to a small group of closely related species occurring in different environments provides the opportunity for a more detailed examination of physiological adaptations while limiting complications due to dissimilar lifestyles or evolutionary history (Coddington 1988; Bennett 1988; Price 1991; Leroi 1994). The lark family (Alaudidae) has representatives living in environments ranging from hyperarid deserts to mesic grasslands (Cramp 1988; Pätzold 1994). Because all larks are ground-foraging birds that eat similar foods, a mixture of insects and seeds, beha- 168 vior and diet are not confounding factors in our analyses. In addition, knowledge of the phylogeny of the lark family based on molecular evidence (Tieleman et al. 2002b) allows us to select species with phylogenetic relatedness in mind. This family provides an appropriate model to study physiological and behavioral adaptation to the environment (Williams & Tieleman 2000; Tieleman & Williams 2002b; Tieleman et al. 2002c; Tieleman et al. 2003). Among larks, BMR and TEWL decrease along a gradient of increasing aridity (Tieleman et al. 2002b; Tieleman et al. 2002c). The variation in BMR and TEWL can not be explained by phylogeny (Tieleman et al. 2002b), or be attributed to acclimatization to temperature, food availability or day length, and is likely to have a genetic component (Tieleman et al. 2003). These laboratory measurements gain evolutionary significance if one finds consistent patterns in data collected in the field, where natural selection operates on a combination of physiology and behavior. In this study we compare physiological, demographic and ecological variables of larks to gain insights into the connection between life history variation and physiology along an aridity gradient. We quantify FMR and water flux of parents feeding nestlings as a measure of parental effort, and investigate if nestling FMR, water flux, and growth rate vary with environmental aridity. This information allows construction of energy and water budgets for the parent-offspring complex, and provides an integrative perspective of a series of components on which natural selection might act. We test the hypothesis that energy and water requirements of the parent-offspring complex are reduced in deserts, and that parental effort decreases with increasing aridity. In addition, we measure clutch size, nestling growth rate and nest predation risk to explore how this set of variables varies with decreasing food availability in the environment. We predict that arid environments where primary productivity is low provide less nest cover, resulting in higher nest predation rates, and less food, increasing clutch size and growth rate, and potentially overriding the effect of high predation risk favoring increased growth rate (Lack 1968). FIELD THE IN Methods

Study areas LARKS We studied Hoopoe Larks (Alaemon alaudipes), Dunn’s Larks (Eremalauda dunni), OF Bar-tailed Desert Larks (Ammomanes cincturus) and Black-crowned Finchlarks (Eremopterix nigriceps) from April to June 2001 in Mahazat as-Sayd, a nature BUDGETS TER A

reserve in the Arabian Desert (N 22°15', E 41°50'). Characterized by hot and dry W summers, the Arabian Desert is classified as an arid inland desert, similar to large AND parts of the Sahara (Meigs 1953). The flat gravel plains in Mahazat are intersec-

ted by wadis and dominated by a sparse vegetation of perennial grasses, including ENERGY

169 Stipagrostis sp, Panicum turgidum and Lasurius scindicus, and small acacia trees Acacia sp.. Yearly rainfall averages 90 ± 76 mm (SD) in Mahazat, but varies largely with some years receiving less than 35 mm and others more than 140 mm

(National Wildlife Research Center, unpublished data). Records for Ta show nighttime lows of about 5 °C and daytime highs of 25 °C for January, and minima of 28 °C and maxima up to around 49 °C for June/July (National Wildlife Research Center, unpublished data). During the breeding season average daily

Tas vary from below 30 °C at the beginning of April, to around 35 °C in the first

week of June, while maximum Tas increase from about 40 °C to 48 °C (Tieleman & Williams 2002a). Depending on rainfall, the breeding season can start in March and end in June, but in drought years birds do not breed at all. Skylarks (Alauda arvensis) and Woodlarks (Lullula arborea) were studied from April to June 2002 in Aekingerzand, a nature reserve in the Netherlands (N 52°52', E 06°20'). Aekingerzand is covered with low vegetation dominated by heather (Calluna vulgaris, Erica sp.), grasses (Festuca sp., Molinia caerulea) and scattered trees. Free standing water is available year round in lakes and ponds. Average yearly rainfall in this area is 773 mm. Mean minimum and maximum temperatures vary from -0.8 °C and 4.4 °C in January to 11.3 °C and 21.4 °C in July (Koninklijk Nederlands Meteorologisch Instituut). During the breeding

season average daily Tas increase from 7.5 °C in April to 14.4 °C in June, while

maximum Tas increase from 12.2 °C to 19.4 °C (Koninklijk Nederlands Meteorologisch Instituut). Woodlarks and Skylarks in the Netherlands breed from April until July.

Larks All species in this study nest on the ground in open cup nests (Cramp 1988). Dunn’s Larks, Bar-tailed Desert Larks and Black-crowned Finchlarks usually nest under small bushes or grasses. Hoopoe Larks choose more exposed nest sites, often adjacent to or on top of small bushes or grass clumps. Skylarks and Woodlarks construct nests that are typically concealed in heather or in grass. In the desert species males and females both incubate and share brooding duties during the nestling phase, but in the Skylarks and Woodlarks only the female incubates and broods nestlings. In all species both parents feed the nestlings.

Doubly labeled water Measurements of water flux and FMR were obtained using the doubly labeled water (DLW) technique, in which the rate of decline of 2H in the body water pool provides a measure of water flux (Nagy & Costa 1980), and the loss rates of 2 18 both H and O yield an estimate of CO2 production (Lifson & McClintock 1966; Nagy 1980; Speakman 1997). We mist-netted birds, injected them with a 1:2 mixture of 99.9 atom % 2H and 95.5 atom % 18O using a 100 or 250 µl

170 Hamilton syringe. The injection volume equaled 4.3 µl per gram mass. We weighed birds with a Pesola spring balance that had been calibrated against a Mettler analytical balance. After a 1 hour equilibration period (Williams & Nagy 1984a; Williams 1985), a 80-100 µl sample of blood (initial) was removed from the bra- chial vein, and birds were banded and released. After about 24 or 48 hours we recaptured birds, took a second blood sample (final), measured body mass and released them. We obtained blood samples of 3 uninjected individuals per species to determine background levels of isotopes. Isotope ratios of 2H/1H and 18O/16O were determined in duplicate (initial) or triplicate (final) for each sample at the Center for Isotope Research, University of Groningen (Visser & Schekkerman 1999). The coefficient of variation of the duplicate or triplicate measurements was generally less than 2%. We calculated water influx with equation 3 of Nagy and Costa (1980), and corrected for isotope fractionation effects assuming an evaporative water loss of 25% and a fractionation factor of 0.941 (equation 7.6 (Speakman 1997; Visser et al. 2000b)).

Total body water was estimated from isotope dilution. Rates of CO2-production were calculated with equation 7.17 of Speakman (1997). Validation studies on adult birds have shown that estimates of water flux using isotopes of hydrogen are usually within ±10% of values obtained by standard laboratory methods (Nagy & Costa 1980), and estimates of CO2 production from DLW are within 8-10% (Williams & Nagy 1984a; Speakman 1997). In growing birds the possibility exists that isotopes are differentially incorporated into growing tissues leading to errors in estimates of CO2 production (Williams & Nagy 1985b; Klaassen et al. 1989). However, three validation studies on growing chicks suggest that the errors in the estimates of CO2 production are in the same range as for adult birds (Klaassen et al. 1989; Visser & Schekkerman 1999; Visser et al. 2000a). We measured metabolism and water flux of 6-8 day old nestlings after growth had slowed, and metabolism and water flux approached a maximum. All nestlings increased mass during the measurement period.

CO2 production can be converted to energy expenditure when the composition of the diet is known (Gessaman & Nagy 1988; Weathers & Sullivan 1989). We FIELD assumed that seeds contain 13.5% protein, 5.1% lipid, and 81.4% carbohydrate THE

(MacMillen 1990) and that insects contain 62.0% protein, 14.9% lipid, and IN 15.0% carbohydrate (Williams & Prints 1986). We assumed for all species of LARKS

larks that adults during the breeding season consume a diet of 90% insects and OF -1 10% seeds, and calculated a conversion factor of 24.16 kJ l CO2 based on standard conversion factors for protein, fat and carbohydrate metabolism (Gessaman BUDGETS & Nagy 1988). For nestlings, that consume a diet of exclusively insects, this fac- TER A

-1 W tor equaled 24.39 kJ l CO2. AND Nest monitoring

We visited nests with eggs or young at 1-6 day intervals to determine nest survi- ENERGY val. When all eggs or nestlings disappeared we assumed that predation was the 171 cause. Calculations of nest mortality were made using the Mayfield-method (Mayfield 1975; Johnson 1979) for the total nest period, including laying, incubation and nestling phase. Daily survival rate was calculated as DSR = 1 - daily nest mortality.

Environmental aridity

We calculated an aridity index as Q = P/((Tmax + Tmin)(Tmax - Tmin)) * 1000, where

P is average annual precipitation (mm), Tmax is the mean maximum temperature

of the hottest month (°C) and Tmin is the mean minimum temperature of the coldest month (°C) (Emberger 1955; Tieleman et al. 2002b). Although perhaps intuitively not straightforward, this index has been empirically derived to describe primary productivity in arid and semi-arid areas (Emberger 1955). This index is low in hot, dry deserts and high in cool, wet areas. Because Q increases rapidly when environments become more mesic, we avoided unequal weighing of data on mesic species by using log Q in our analyses (Tieleman et al. 2002b). Climate data for the geographical regions of the larks in this study have been reported in Tieleman et al. (2002b).

Statistical analysis and phylogenetic effect We used General Linear Models procedures in SPSS 10.0 for analysis of variance (ANOVA) and covariance (ANCOVA) to investigate differences in FMR and WF among species. We always tested the two-way interaction terms and removed them from the model when insignificant. After one-way ANOVAs we used the Tukey test for multiple comparisons (Zar 1996). In comparisons among species ANOVA has proven useful because it takes into account intraspecific variation. However, this approach has been criticized because each species is treated as independent, whereas phylogenetic relatedness may cause non-independence among species (Felsenstein 1985a). Regression analysis with average values for species ignore intraspecific variation, but can take into account phylogenetic relationships when appropriate (Felsenstein 1985a; Garland et al. 1992). In addition to our analyses using ANOVA, we performed regression analysis using species averages taking into account phylogeny when appropriate. For these analyses we added data on FMR and water flux of the Dune Lark (Williams 2001) to our data set and correlated these variables with environmental aridity. We used the phylogeny of larks from Tieleman et al. (2002b), and placed the Thekla Lark, for which the phylogenetic relationships were not established, as sister species to the Crested Lark. To evaluate whether a phylogenetic effect [sensu Grafen (1989) and Harvey and Pagel (1991)] exists among the larks in this study, we used the test for serial independence (TFSI) to determine if there was a significant positive autocorrelation for mass-corrected field metabolic rate, mass-corrected water flux, growth rate,

172 clutch size, number of clutches and daily nest survival (Reeve & Abouheif 1999; Abouheif 1999). In each simulation the topology was randomly rotated 2000 times per iteration and the original data were shuffled 2000 times in order to provide the null hypothesis sampling distribution (Reeve & Abouheif 1999). The test for serial independence is more suitable for smaller data sets than other phylogenetic autocorrelation methods (Cheverud et al. 1985; Gittleman & Kot 1990; Martins & Hansen 1996; Abouheif 1999). If no phylogenetic effect exists, then incorporating phylogeny in statistical methods would be unnecessary (Gittleman & Kot 1990; Björklund 1997; Abouheif 1999). If a phylogenetic effect does exist, this may be attributable to phylogenetic constraint or to ecological factors and corrections for phylogenetic relationships may or may not be appropriate (Westoby et al. 1995). For the cases where we found a phylogenetic effect, we provided results of phylogenetic independent contrast analysis using the Phylogenetic Diversity Analysis Package (Garland et al. 1992) in addition to results from conventional statistics. Averages are reported ± 1 SD unless noted otherwise.

Results Field metabolic rate of parents We compared FMR of adults feeding 5-8 day old nestlings of six species of larks from arid and mesic environments (Figure 1C, Table 1). To take into account differences in body mass we calculated mass-corrected FMR as FMR divided by mass0.879. The exponent 0.879 was the common slope for all species determined by ANCOVA with log FMR as dependent variable, species as fixed factor and log mass as covariate in a model without interaction term (log mass F1, 51 = 19.48, P < 0.0001), after verifying that the interaction had no significant effect on log

FMR (species x log mass F5, 46 = 0.27, P = 0.93). Mass-corrected FMR differed significantly between species (F4, 52 = 31.81, P < 0.0001), and a Tukey test indicated that one homogeneous subset consisted of Bar-tailed Desert Lark, Hoopoe Lark, Dunn’s Lark and Black-crowned Finchlark (all species pairs, P > 0.51), another of Woodlark and Skylark (P = 1.00) (Figure 1A). Mass-corrected FMR FIELD of the arid-zone species was 24-39% lower than of the mesic larks. Because the THE IN number of nestlings per nest varied (Table 1), we calculated parental energy expenditure per chick by dividing mass-corrected FMR by the number of chicks LARKS OF the parent was feeding, and found no significant differences between species (F5,

52 = 0.96, P = 0.45) (Figure 1B). A relative measure of parental workload commonly used for comparisons across BUDGETS TER A

species is the ratio of FMR and basal metabolic rate (BMR) (Drent & Daan W 1980; Daan et al. 1990). We have determined BMR for all species of larks inclu- AND ded in this study, except the Bar-tailed Desert Lark (Tieleman et al. 2002b;

Tieleman et al. 2002c; Tieleman et al. 2003). From these studies, we used the ENERGY

173 n 2 2 10 7 8 7 SD 1.41 0.71 1.16 0.49 0.53 0.82 ents of six species larks. 2.7 3.5 4.0 2.0 2.5 2.7 #chicks per nest Nests e fed by par 11 11 11 3 2 20 n FMR/WF 2.86 3.05 3.19 0.99 0.68 2.33 SD verage A WF (g/day) 6.4 4.9 8.2 13.1 23.5 16.2 7.41 1.61 8.09 13.26 15.54 10.36 SD ds, and average number of chicks per nest that wer ent bir verage A FMR (kJ/day) 34.9 34.3 41.3 72.2 82.2 101.5 3 20 13 12 12 2 n 1.78 1.80 6.30 3.80 1.32 0.04 SD verage 16.5 21.5 39.8 33.6 27.0 13.6 A Mass (g) t Lark owned Finchlark -tailed Deser oodlark able 1. Body mass, field metabolic rate, water flux of par Bar Black-cr Dunn's Lark Hoopoe Lark Skylark W Species 174 T FIELD THE IN LARKS OF Figure 1. Field metabolic rate (average ± SE) of parents (a, b, c) and nestlings (d, e, f) of six species of larks taking into account mass-differences (a, d), expressed per nestling (b, e), and BUDGETS expressed per brood (c, f). Metabolizable energy intake of the entire brood, Ebrood (1f, see text) TER A is the sum of FMR (dark grey) and tissue production (light grey). Letters indicate homogeneous W

subsets based on Tukey tests (significance level P = 0.05). AND ENERGY

175 average BMR for Black-crowned Finchlark, Dunn's Lark, Woodlark and Skylark, species in which we found no significant relationship between log BMR and log mass with regression analysis. For Hoopoe Larks we estimated BMR based on body mass using the regression equation log BMR = 0.436 + 0.674 log mass 2 (SEslope = 0.226, r = 0.43, df = 13, P = 0.01). For the Bar-tailed Desert Lark we estimated BMR using data of the Desert Lark (Ammomanes deserti), a sister species that occurs in habitats of similar aridity (Tieleman et al. 2002b). Because Bar-tailed Desert Larks are about 23% smaller than Desert Larks, we used BMR per gram body mass of the Desert Lark to estimate BMR for the Bar-tailed Desert Larks. Parental FMR varied among species from 1.7 to 2.2 times BMR (Figure 3A). A Tukey test showed significant differences only of Bar-tailed Desert Lark compared with Woodlark and Dunn's Lark (F5, 52 = 6.61, P < 0.0001).

Water flux of parents For comparison of water flux among species, we calculated mass-corrected values as water flux/mass0.730 (Figure 2C, Table 2). The exponent 0.730 was the common slope for all species in an ANCOVA with log water flux as dependent

variable (log mass F1, 51 = 7.06, P = 0.01), after removing the insignificant inter-

action term from the model (F5, 46 = 0.16, P = 0.98). Mass-corrected water flux

differed significantly among species (F5, 52 = 33.65, P < 0.0001), and a Tukey test showed identical subsets of arid-zone larks and mesic-zone species as for mass- corrected FMR (Figure 2A). Mass-corrected water flux for arid-zone larks feeding nestlings was 39-61% lower than for larks from mesic areas. To compare the water flux of parents per chick, we divided mass-corrected water flux by the number of nestlings that each parent fed. Parental water flux per chick was similar among most species (Tukey all P > 0.05), with only a significantly lower mass- corrected water flux per chick in Bar-tailed Desert Larks compared with Skylarks

(ANOVA species F5, 52 = 3.25, P = 0.013, Tukey P < 0.05) (Figure 2B). Analogous to the ratio FMR/BMR, we calculated the ratio of water flux and total evaporative water loss (TEWL) as an index of parental water requirements relative to a physiological minimum of evaporation. Using data of TEWL per species from previous laboratory studies (Tieleman et al. 2002b; Tieleman et al. 2002c; Tieleman et al. 2003), we followed the same procedure as outlined above for

TABLE 2. Field metabolic rate and water flux of 6-8 day old nestlings of five species of larks.

Mass (g) FMR (kJ/day) WF (g/day) Species Average SD n Average SD Average SD N chicks

Bar-tailed Desert Lark 12.2 1 15.0 6.7 1 Dunn's Lark 13.0 1.58 4 22.7 3.86 7.1 1.58 4 Hoopoe Lark 20.4 2.34 13 31.1 4.98 6.7 1.40 13 Skylark 21.1 1.48 6 45.5 8.28 14.7 3.53 6 Woodlark 17.5 1.41 10 36.1 3.95 11.6 1.45 10 176 FIELD THE IN Figure 2. Water flux (average ± SE) of parents (a, b, c) and nestlings (d, e, f) of six species of larks taking into account mass-differences (a, d), expressed per nestling (b, e), and expressed per LARKS brood (c, f). Water requirements of the entire brood are the sum of water flux (dark grey) and OF water accumulated in tissue (light grey). Letters indicate homogeneous subsets based on Tukey tests (significance level P = 0.05). BUDGETS TER A W AND ENERGY

177 estimating BMR. Water flux varied among species (F4, 45 = 13.56, P < 0.0001), and was about 6.7 x TEWL in the mesic species and about 4.3 x TEWL in the arid-zone larks (Figure 3C).

Differences in parental FMR and water flux between sexes? To explore if males and females worked equally hard we used ANCOVA with log FMR or log water flux as dependent variable, species and sex as fixed factors and log mass as covariate. Neither log FMR nor log water flux differed significantly

between the sexes (log FMR F2, 49 = 2.71, P = 0.08; log water flux F2, 49 = 0.33, P = 0.72).

Field metabolic rate of nestlings We compared energy expenditure of 6-8 day old nestlings among five species of larks from arid and mesic environments (Figure 1E, Table 2). At 6-8 days nestling energy expenditure reaches an asymptote (Williams 2001) and therefore

Figure 3. Parental FMR (a) and water flux (b) expressed in multiples of BMR and TEWL, respectively, per brood for six species of larks. Letters indicate homogeneous subsets based on 178 Tukey tests (significance level P = 0.05). enables calculation of peak energy demand of the brood. In an ANCOVA with log FMR as dependent variable, species as fixed factor and log mass as covariate, the interaction between species and log mass was insignificant (F3, 25 = 0.97, P =

0.42). We found no significant influence of log mass (F1, 28 = 0.47, P = 0.50) but a significant effect of species on log FMR (F4, 28 = 10.73, P < 0.0001). Therefore, we removed mass from the model and investigated differences in FMR between species, excluding the Bar-tailed Desert Lark data from analysis due to low sample size. Skylark chicks had a higher FMR than nestlings of Woodlark and Hoopoe Lark, that were indistinguishable from each other, and Dunn’s Lark chicks had a lower FMR than the previous three species (Figure 1E). Mass-specific FMR (kJ -1 -1 day g ) of nestlings also differed among species (F4, 29 = 7.64, P < 0.0001) and was 16-43% lower in the arid-zone species than in the mesic larks (Figure 1D).

Water flux of nestlings For a comparison of water requirements of 6-8 day old nestlings (Figure 2E, Table 2) we tested the effect of species and log mass on log water flux with an ANCO-

VA and found no significant effects of the interaction (F3, 25 = 0.56, P = 0.65) or log mass (F1, 28 = 0.05, P = 0.82), but a significant effect of species (F3, 28 = 23.88, P < 0.0001). After removing mass from the analysis, we used a Tukey test with water flux as dependent variable to investigate differences between species, excluding Bar-tailed Desert Lark data from analysis due to low sample size. Nestlings of Dunn’s Larks and Hoopoe Larks had indistinguishable water fluxes, that were lower than the value for Woodlark chicks. Skylark young had higher water fluxes than nestlings of the other three species (Figure 2E). Mass-specific -1 -1 water flux (g day g ) differed significantly among species (F4, 29 = 17.78, P < 0.0001). Hoopoe Lark nestlings had a lower mass-specific water flux than the other three larks (Figure 2D).

Nestling growth rates We measured body mass of known-age nestlings to determine their growth rates

(Figure 4). Growth is commonly described by a logistic curve of the form W(t) FIELD THE = A / (1 + exp (-K (t - ti)), where W(t) (in g) is the weight at age t (day), A is IN the asymptote of the growth curve (g), K is the growth rate constant (day-1), and

ti is the inflexion point or age at maximal growth rate (day) (Ricklefs 1979). LARKS

Some chicks of the desert species did not grow and starved to death (Figure 4). OF These data were excluded when we constructed growth curves (Table 3).

To explore if growth rates are correlated with aridity, we added data for Dune BUDGETS TER

Larks from the Namib Desert (Williams 2001) and for Desert Larks and Crested A W Larks from the Negev Desert (Shkedy & Safriel 1992b) to our results (Table 4, AND Figure 5A). A regression model (r2 = 0.60, n = 9, P = 0.065) with growth rate constant as dependent variable showed a decrease in growth rate with increasing ENERGY aridity (slope ± SE = 0.115 ± 0.044, t = 2.63, P = 0.04), but no significant effect 179 of adult body mass (slope ± SE = -0.005 ± 0.003, t = 1.84, P = 0.12). Phylogeny was not a significant factor affecting growth rate (TFSI, P = 0.14).

Energy and water budgets of the parent-brood complex A budget of energy requirements for parents and brood combined can be com-

posed as Efam = 2 x FMRpar + Ebrood, where FMRpar is parental FMR (Figure 1c,

Table 1) and Ebrood is the metabolizable energy requirements of the nestlings

(Figure 1f). Ebrood can be calculated as n x (FMRnestling + ETnestling), where n is the

number of nestlings per nest (Table 1), FMRnestling is FMR per nestling (Figure 1e,

Figure 4. The relationship between body mass and age of nestlings, and the growth constant K (±

180 SE) for six species of larks. Day 0 is hatching day. TABLE 3. Logistic growth curve variables for growing nestlings of six species of larks. The logistic function is W(t) = A / (1 + exp (-K (t - ti)), where W(t) is the weight at age t, A is the asymptote of the growth curve, K is the growth rate constant, and ti is the inflexion point or age at maximal growth rate. The 95% confidence interval around K was calculated as K ± tdf x SE.

2 Species A ti K SE K 95% CI K r df

Bar-tailed Desert Lark 13.79 3.42 0.52 0.077 0.36 - 0.68 0.92 30 Black-crowned Finchlark 10.58 2.73 0.62 0.079 0.46 - 0.78 0.95 24 Dunn's Lark 15.81 3.63 0.50 0.056 0.39 - 0.61 0.90 71 Hoopoe Lark 26.12 4.93 0.41 0.038 0.33 - 0.49 0.91 105 Skylark 24.92 2.97 0.61 0.027 0.56 - 0.66 0.97 93 Woodlark 21.01 3.67 0.55 0.024 0.50 - 0.60 0.98 87

Table 2), and ETnestling is energy accumulated in new tissue. ETnestling can be estimated from the increase in wet mass per day (Table 3) and the energy density of wet tissue given by kJ/g wet mass = 3.51 + 4.82 x u, where u is the proportion of adult mass attained (Weathers 1996). Absolute Efam averaged 101 kJ/d for Bar- tailed Desert Lark, 265 kJ/d for Hoopoe Lark, 162 kJ/d for Dunn’s Lark, 389 kJ/d for Skylark, and 345 kJ/d for Woodlark. Expressed per gram of family to take into account mass-differences between species, these values equaled 1.98 kJ d-1 g-1, 1.96 kJ d-1 g-1 2.08 kJ d-1 g-1, 2.75 kJ d-1 g-1, and 2.79 kJ d-1 g-1, respectively, or about 28% lower in the desert species compared with the mesic-zone larks.

A family's water budget can be constructed as Wfam = 2 x WFpar + WFbrood, where

WFpar is parental water flux (Figure 2c, Table 1), and WFbrood is the water flux of the nestlings calculated as n x (WFnestling + WTnestling), with n the number of chicks per nest (Table 1), WFnestling the water flux per nestling (Figure 2e, Table

2), and WTnestling the amount of water accumulated in new tissue. WTnestling can be estimated from the increase in wet mass per day (Table 3) and the assumption that a 6-8 day old chick has a body water content of 69.4%, the average based on the dilution spaces of the chicks injected with doubly labeled water. The -1 -1 absolute Wfam equaled 23.8 g d for Bar-tailed Desert Lark, 48.6 g d for Hoopoe Lark, 37.5 g d-1 for Dunn’s Lark, 101.4 g d-1 for Skylark, 82.8 g d-1 for Woodlark. FIELD

Accounting for mass-differences among species, Wfam expressed per gram of fami- THE -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 ly averaged 0.46 g d g , 0.36 g d g , 0.48 g d g , 0.72 g d g , 0.67 g d g , IN respectively. Families of the desert larks used 28-50% less water per gram than species from mesic areas. LARKS OF

Field metabolic rate and water flux along an aridity gradient: conventional and phylogenetic analyses BUDGETS TER

We reanalyzed FMR and WF of Dune Lark adults and nestlings (Williams 2001), A W correcting for fractionation effects, and found for adults (27.0 ± 1.81 g, n = 11) AND an average FMR of 49.0 ± 17.05 kJ d-1 and WF of 5.99 ± 1.10 g d-1, and for nestlings at day 8 (mass 15.0 g) a FMR of 25.7 kJ d-1 and a WF of 5.29 g d-1 based on ENERGY logistic equations. Adding these data to the results of the present study we regres- 181 , ence vival rate (DSR 3, 5, 6 5, 6 7, 8, 9 2 2 3, 5 3, 4, 5 3 2 Refer 2 3, 4 1 2 2 16 13 26 n 21 29 93 ), and daily sur -1 0.0097 0.0206 0.0230 SE DSR 0.0290 0.0332 0.0188 SD, n) and number (year ez and Manrique (1992). 7. Maclean (1970b). 8. Lloyd ± 0.9379 0.9380 0.9491 0.9862 0.9636 0.9412 0.9618 0.8968 DSR 0.8638 0.9340 0.8162 0.8016 2 3.5 2.5 2 2 2 1 1 1 1 1 ez (1997). 6. Suár # Clutches 12 14 n 30 21 24 68 anes and Suár 0.900 0.730 SD 0.679 0.768 0.741 0.723 owth constant K, clutch size (average e. 3.24 3.60 2.58 3.92 4.07 3.50 4.15 4.20 Clutch size 2.57 3.24 3.11 1.90 2.88 2.99 a owth constant 0.612 0.553 0.473 Gr 0.622 0.520 0.540 0.307 0.498 0.409 t, aridity = 2.05. om this study and literatur 2.59 2.59 2.60 3.20 3.20 2.59 2.24 2.26 Aridity 2.24 1.78 2.05 1.76 1.78 1.78 . 3. Cramp (1988). 4. Shkedy and Safriel (1992b). 5. Y om Tieleman et al.(2002b)), nestling gr om Negev Deser t Lark SE, n) for 14 larks fr t-toed Lark ± owned Finchlark t Lark t-toed Lark owth constant fr -tailed Deser ested Lark oodlark Gr able 4. Aridity index (fr Thekla Lark Spike-heeled Lark Skylark W Lesser Shor 1. Boyer (1988). 2.This study (1999). 9. Lloyd (1998). Calandra Lark Shor T Species a Cr average Deser Black-cr Dune Lark 182 Dunn's Lark Hoopoe Lark Bar sed species-average values of FMR and WF against an index describing the aridity of the environment (Emberger 1955; Tieleman et al. 2002b), using both conventional regression and phylogenetic independent contrast analysis when appropriate. Lower values of this index indicate more extreme aridity. Conventional analysis showed that mass-corrected FMR and mass-corrected WF of adults decreased significantly with increasing aridity (FMR in kJ day-1 g-0.879, r2 = 0.99, slope ± SE = 1.23 ± 0.054, n = 7, P < 0.0001; WF in g day-1 g-0.730, r2 = 0.81, slope ± SE = 0.60 ± 0.128, n = 7, P = 0.006). For nestlings, mass-specific FMR and mass-specific WF also decreased with increasing aridity, but the latter was not significant (FMR in kJ day-1 g-1, r2 = 0.71, slope ± SE = 0.394 ± 0.127, n = 6, P = 0.037; WF in g day-1 g-1, r2 = 0.64, slope ± SE = 0.169 ± 0.064, n = 6, P = 0.057). Using the TFSI we found no significant phylogenetic effect in the data for mass-corrected FMR (P = 0.12) and mass-corrected WF of adults (P = 0.06), but significant phylogenetic autocorrelation in the data for mass-specific FMR (P = 0.047) and mass-specific WF of nestlings (P = 0.006). The latter two results and the marginal insignificance of adult water flux prompted us to additionally analyze these data using phylogenetic independent contrast analysis. This analysis showed that adult mass-corrected WF decreased significantly with increasing aridity, confirming the results of the conventional analysis (contrasts water flux r2 = 0.71, slope ± SE = 0.565 ± 0.162, df = 5, P = 0.017). Contrast analysis of the nestling data revealed trends of decreasing mass-specific FMR and WF with increasing aridity, identical to the conventional analysis, but insignificant (contrasts FMR r2 = 0.60, slope ± SE = 0.335 ± 0.136, df = 4, P = 0.07; contrasts WF r2 = 0.71, slope ± SE = 0.145 ± 0.071, df = 4, P = 0.11).

Clutch size and number of larks along an aridity gradient We combined information on clutch size and number of clutches per breeding season of larks from the Arabian Desert and the Netherlands with data from eight other lark species from the literature to test if clutch size and number of clutches varied with aridity (Table 4). When aridity increased, clutch size decreased (Figure 5B, slope ± SE = 0.746 ± 0.333, P = 0.045, r2 = 0.30, n = 14) and FIELD THE

number of clutches per season decreased (Figure 5C, slope ± SE = 1.39 ± 0.181, IN P < 0.0001, r2 = 0.87, n = 11). On average larks from hyperarid deserts have one clutch per year with 2.8 eggs, whereas species from mesic areas lay three clutches LARKS OF of 3.9 eggs per year. We determined if phylogeny might confound our analyses and found no significant phylogenetic autocorrelation for clutch size (TFSI, P = 0.06), but a significant autocorrelation for number of clutches (TFSI, P = 0.001). BUDGETS TER A

Therefore, we also analyzed the correlation between aridity and number of W

clutches using phylogenetic independent contrasts and found a significant AND regression confirming the results of the conventional analysis (slope ± SE = 1.37 2 ± 0.271, r = 0.74, t = 5.05, df = 7, P = 0.001). ENERGY 183 Nest predation along an aridity gradient We collated daily survival rates of nests for six species from the literature in addition to our own data on six species of larks from the Arabian Desert and the Netherlands (Table 4, Figure 5D). There was no significant phylogenetic effect in the daily survival rates (TFSI, P = 0.08). Using regression analysis we found that daily survival rate significantly increased with decreasing aridity (slope ± SE = 0.0969 ± 0.021, P = 0.001, r2 = 0.68, n = 12). Because the total nest period, the sum of laying, incubation and nestling-phase, is similar among all larks, daily survival rate directly reflects the probability that a nest survives until fledging. If we assume a total nest period of 24 days and use the regression equation to determine average daily survival rate, the probability that a lark nest in a hyperarid desert survives is about 2%, compared with 87% for a nest in a mesic habitat.

Discussion Field metabolic rate of parents Results of this study support the hypothesis of reduced FMR in desert birds and correspond with differences in BMR previously found among the same species of larks from arid and mesic environments (Tieleman et al. 2002b; Tieleman et al. 2002c). FMR was below allometric predictions based on body mass by 50% for Bar-tailed Desert lark, 44% for Hoopoe Larks, 50% for Dunn’s Larks, 43% for

Figure 5. Growth constant K (A), clutch size (B), number of clutches (C) and daily nest survival 184 rate (D) of larks along an aridity gradient. Data and sources are listed in Table 4. Black-crowned Finchlarks, 11% for Skylarks, and 16% for Woodlarks (Tieleman & Williams 2000). The association between levels of BMR and FMR has been attributed to selection for the size of the metabolic machinery required to maintain levels of energy expenditure during the period when parents care for nestlings, the suggested time of peak energy demand (Daan et al. 1990). However, when variation in body mass is taken into account, organ sizes do not differ among Hoopoe Larks, Dunn’s Larks, Skylarks and Woodlarks (Tieleman et al. 2003). The differences in BMR and FMR among these species may be related to variation in tissue-specific metabolic rates of various organs rather than on their size, an avenue for future work. Although the reduced FMR in desert larks could be partly attributable to low levels of BMR, the physiological mechanisms that link BMR and FMR are poorly understood (Ricklefs 1996; Ricklefs et al. 1996), and behavioral differences may also play a role. Larks in the desert are inactive during a long period of the middle part of the day, when it is too hot to forage (Tieleman & Williams 2002a), whereas the mesic-zone larks are active throughout the day. The significance of the ratio between FMR and BMR in birds and mammals has been heavily debated since Drent and Daan (1980) first suggested that the optimal working capacity of birds tending broods is around 4 times BMR (Weathers & Sullivan 1989; Daan et al. 1990; Ricklefs 1996). The larks in this study had lower ratios, between 1.7 and 2.2 times BMR (Figure 3A), and similar to other ground-foraging passerines (Weathers & Sullivan 1989). In spite of this fairly constant ratio across larks from arid and mesic environments, workload when defined as the absolute power output in energy per unit time is 24-39% lower in the arid-zone larks. The amount of work that these species do is perhaps not the direct result of physiological constraints, but appears limited by the amount of time available for activity. The combinations of hard working birds with a high BMR and less hard working species with a low BMR result in identical ratios that would unjustly suggest identical parental efforts. Absolute levels of FMR and BMR placed in an ecological context might provide a more instructive measure FIELD of parental effort assuming that they are closely related to fitness-components THE such as survival, via potential effects of body condition, immune system and IN aging, and reproductive success, through brood size and feeding rates. LARKS

Water flux of parents OF Water flux was 39-61% lower in the arid-zone larks than in those from mesic areas, when taking into account variation in body mass (Figure 2A). Compared BUDGETS TER A

with allometric predictions water flux was reduced by 41% in Bar-tailed Desert W larks, 36% in Hoopoe Larks, 37% in Dunn’s Larks, and 48% in Black-crowned AND Finchlarks, and increased by 30% in Skylarks and 5% in Woodlarks (Tieleman

& Williams 2000). These results correspond with differences in TEWL pre- ENERGY viously found among the same species of larks from arid and mesic environments 185 and are consistent with the hypothesis of reduced water flux in desert birds (Tieleman et al. 2002b; Tieleman et al. 2002c). The association between TEWL and water flux is likely to result from both physiological adjustments, including increased skin resistance to evaporative water loss (Tieleman & Williams 2002b), and behavioral adaptations, including selection of favorable microclimates and reduced activity during hot hours (Williams et al. 1999; Tieleman & Williams 2002a). Larks in the desert spend a significant period of the hot part of the day at the nest, providing shade or even cooling the nestlings (Personal observation). This behavior presumably requires a significant amount of water for evaporative cooling and makes the low water flux of these species more remarkable. One might predict that the proportions of evaporative and excretory water loss differ markedly between birds from arid and mesic environments, with larks from the latter group losing larger quantities of surplus water by excretion. Larks in the desert have lower water fluxes and TEWL than species from mesic areas. The ratio WF/TEWL is 36% lower in the desert species, despite their

exposure to higher Tas and concurrent higher requirements for evaporative cooling. The more frugal water economy of larks in the desert may be interpreted as the result of selection in an environment where water is a limiting factor. Alternatively, the higher ratio of WF/TEWL might indicate the overabundance of water in temperate zones, and lack of selection in environments where water may be a waste product.

Energy and water requirements of nestlings The energy and water demands placed upon the parents by the brood depend on the energy and water requirements per nestling, and on the number of chicks in the nest. One might expect that nestlings with low energy and water requirements are favored by natural selection in environments where food and water are in short supply. In support of this idea, we found that mass-specific FMR was 16- 43% lower in 6-8 day old nestlings of Bar-tailed Desert Lark, Hoopoe Lark and Dunn’s Lark than in chicks of Skylark and Woodlark (Figure 1D). Although water flux per nestling was reduced in Hoopoe Larks, Bar-tailed Desert Larks and Dunn’s Larks (Figure 2E), mass-specific values were only significantly lower in Hoopoe Lark chicks, compared with young of Skylarks and Woodlarks (Figure 2D). In addition, the growth rates of larks in the desert were reduced and contributed to lowering the daily energy and water requirements of nestlings in these arid environments (Figure 5A).

Parental effort per nestling Larks from deserts expend less energy and lose less water while rearing young than larks from temperate areas, but because their broods were smaller losses per

186 chick were the same (Figure 1B, Figure 2B). Parental energy expenditure and water loss per chick may be viewed as an index of parental effort because it provides a total measure of the amount of energy and water required by a parent to provide resources to a nestling. However, it does not separate costs of parental self maintenance from costs of work that is specifically carried out to raise the young and therefore does not provide a prediction of the energy and water costs to rear an additional chick. Still, it is noteworthy that despite lower energy and water requirements per chick, parental energy and water expenditure to supply a chick’s requirements is as high in deserts as in mesic areas. Parents in deserts may be constrained by low water availability that reduces their evaporative cooling capacity and forces them to minimize activity during the hot part of the day. The resulting narrow window of time available to provision the brood leads to a smaller total amount of food that can be gathered per day. Therefore parental self- maintenance costs, although low per time unit in deserts, contribute a large proportion to the daily parental energy and water expenditure per chick.

Growth rate, clutch size and nest predation: Lack's dilemma With increasing aridity nest predation increased, growth rate decreased and clutch size decreased. This result does not support Lack’s (1968) prediction that growth rates should decrease with increasing risk of predation. We propose that food availability may have a larger selective influence on growth rate, overriding the effect of nest mortality. Low food availability should select for reduced overall daily energy requirements of the brood, a prediction that is confirmed by the combination of reduced metabolism and water loss per nestling, low growth rate and small clutch sizes in arid environments. The combination of high nest predation, slow growth and small broods is also found in birds from the tropics (Skutch 1966; Ricklefs 1979). Although food may not be intuitively assumed to be a limiting factor on reproduction in the tropics, the reduced daily energy requirements per nestling (Weathers 1992) in addition to their slow growth rate, potentially also indicate selection for lower food requirements of nestlings. The more influential role of food availability than mortality on nestling growth rate does not contradict Lack’s original idea that growth rate might be a com- FIELD THE

promise between food supply and mortality, but shifts the emphasis of his subse- IN quent prediction from mortality to food supply. Along an aridity gradient food supply and mortality are correlated, and distinguishing the effect of each factor LARKS OF separately is not possible. To test if growth rate is the outcome of a trade-off between food supply and nest mortality would require an experimental approach. BUDGETS TER

Energy and water budgets of the parent-brood complex: a life history perspective A W Compared with temperate environments, the daily energy and water budgets of a family of larks in the desert, where food and water are scarce, are markedly AND lower not only when expressed in absolute terms but also per gram of family mass ENERGY

(Figure 1F, 2F). The frugal use of energy and water in arid-zone families are the 187 result of a combination of low parental and nestling FMR and water flux, slow growth, and small broods. Although in proximate terms the reduced energy and water budgets can be intuitively understood in light of the environmental conditions, our insights at the ultimate level are less complete. A central prediction of the evolutionary theory of life histories is that parental investment should vary directly with the fitness of current offspring and inversely with adult survival. If parental effort as measured by energy expenditure, water loss and clutch size is correlated with parental investment, i.e. the fitness consequence of the parental effort (Trivers 1972; Daan & Tinbergen 1997; Tinbergen & Verhulst 2000), we would conclude that the fitness value of a single brood is lower for an arid-zone species than for a lark from mesic habitats and predict that an adult lark in the desert has a higher probability of survival. Insights into the physiological, ecological and environmental factors affecting adult survival might provide the key to understanding how evolution has fashioned these distinct sets of physiological, behavioral and demographic variables in arid and mesic environments.

Acknowledgments We thank Abdulrahman Khoja, Patrick Paillat, Stéphane Ostrowski and the other staff at the National Wildlife Research Center, Taif, Saudi Arabia, for logistic support throughout this study. Wildlife research programs at the NWRC are possible through the generous support of HRH Prince Saud al Faisal and under guidance of A. Abuzinada of the National Commission of Wildlife Conservation and Development, Saudi Arabia. Vince Schuler and Riek van Noordwijk helped with field work in Saudi Arabia. We are grateful to Wouter de Vlieger and Staatsbosbeheer for permission to work at the Aekingerzand, to Berthe Verstappen for conducting the isotope analyses so quickly, and to Serge Daan for commenting on an earlier draft. Financial support for this study was made available by the Schuurman Schimmel van Outeren Foundation, the Schure Beijerinck Popping Foundation, the National Wildlife Research Center, and the National Science Foundation.

188 FIELD THE IN LARKS OF BUDGETS TER A W AND ENERGY

189

PART III Physiological mechanisms

CHAPTER 9 Flexibility in basal metabolic rate and evaporative water loss among Hoopoe Larks exposed to different environmental temperatures

Joseph B. Williams and B. Irene Tieleman Journal of Experimental Biology 203: 3153-3159. 2000. ABSTRACT The “energy demand” hypothesis for short-term adjustments in basal metabolic rate (BMR) posits that birds adjust the size of their internal organs relative to food intake, a correlate of energy demand. We tested this hypothesis on Hoopoe Larks (Alaemon alaudipes), inhabitants of the Arabian Desert, by acclimating birds for 3 weeks at 15 °C and at 36 °C, then measuring their BMR and total evaporative water loss (TEWL). Thereafter we determined the dry masses of their brain, heart, liver, kidney, stomach, intestine, and muscles of the pectoral region. Though initially average body mass did not differ between the two groups, after 3 weeks, birds in the 15 °C group had gained mass (44.1 ± 6.5 g), whereas larks in the 36 °C group had maintained constant mass (36.6 ± 3.6 g). Birds in the 15 °C group had an average BMR of 46.8 ± 6.9 kJ/d whereas birds in the 36 °C group had a BMR of 32.9 ± 6.3 kJ/d, values which were significantly different when we controlled for differences in body mass. When measured at 35 °C, larks in the cold-exposure group had a TEWL of

3.55 ± 0.60 g H2O/d, whereas TEWL for birds in

the 36 °C group averaged 2.23 ± 0.28 g H2O/d, a 59.2% difference. Mass-independent TEWL differed significantly between groups. Larks in the 15 °C group had a significantly larger liver, kidney, stomach, and intestine than larks in the 36 °C group. These increases in organ mass contributed 14.3% towards the total mass incre- ment in the cold exposure group. Apparently increased food intake among larks in the cold group resulted in enlargement of some of the internal organs, and the increase in mass of these organs required higher oxygen uptake to support them. As oxygen demands increased, larks apparently lost more evaporative water, but the relationship between increases in BMR and TEWL remains unresolved.

ABSTRACT Introduction Studies of basal metabolism, the minimum metabolic rate of inactive, postabsorptive, endotherms while in their rest-phase and thermal neutral zone, have contributed significantly to our understanding of animal energetics (King and Farner 1961; Aschoff and Pohl 1970; Calder and King 1974; Hayssen and Lacy 1985; Reynolds and Lee 1996). Although animals in nature may only rarely function at basal levels of energy expenditure, this parameter has been useful as a physiological standard for assessing energy costs of thermoregulation (Dawson and O’Conner 1996), increments in energy expenditure due to activity in the wild (Drent and Daan 1980; Bryant and Tatner 1991; Ricklefs et al. 1996; Nagy et al. 1999), for investigating limits to maximum physiological performance (Peterson et al. 1990; Weiner 1993; Hinds et al. 1993; Chappel et al. 1999), in evaluating the role of body size and circadian phase on energy flux (Aschoff and Pohl 1970; Hayssen and Lacy 1985; Tieleman and Williams 2000), and in searches for evolutionary adjustments of metabolic rates to specific environments (Weathers 1979; Ellis 1984; Piersma et al. 1996; Williams and Tieleman 2001). Of the total ATP produced in the basal state, among mammals, most is used in protein synthesis or by ion pumps, with a smaller proportion being consumed by myosin ATPase, by gluconeogenesis, and by ureagenesis (Rolfe and Brown 1997). Although detailed studies that compartmentalize ATP usage in birds have yet to be done, it is likely that patterns for mammals and birds are similar. Basal metabolism varies widely between species of the same body mass, often by 200-300%, but the proximate and ultimate factors responsible for this variation remain an enigma (McNab 1988; Daan et al. 1990; Dawson and O’Connor 1996). Among temperate zone birds, seasonal adjustments in BMR have been documented with some species showing an elevated BMR in winter compared to summer (Pohl and West 1973; Cooper and Swanson 1994), and others displaying a reduced BMR in winter (Kendeigh 1969; Barnett 1970). Other species show no seasonal adjustments in BMR (Hart 1962; O’Conner 1995). Trends in BMR with habitat and/or latitude have been described for several subsets of birds (Weathers 1979; Hails 1983; Ellis 1984; Piersma et al. 1996), although exceptions are often ARKS found that complicate our understanding of environmental influences on BMR L (Vleck and Vleck 1979; Williams 1999). It has been suggested that birds that OOPOE live in deserts have a reduced BMR compared to species that live in more mesic H areas (Hudson and Kimzey 1966; Withers and Williams 1990; Hinsley et al. IN 1993). The generality of this idea was recently explored by Williams and

Tieleman (2001) who found that desert birds have a BMR 17-25% lower than FLEXIBILITY that of non-desert forms. These differences could be derived from selection for genotypes with a reduced BMR in deserts, from phenotypic adjustment of BMR, or from a combination of both.

Trying to explain why species of shorebirds at high latitudes have a higher BMR PHYSIOLOGICAL 195 than do shorebirds from tropical latitudes, Kersten and Piersma (1987) suggested that the former have a high daily energy expenditure, the result of high energy usage by the skeletal muscles, either from locomotory activity or thermogenesis, which in turn requires enlarged abdominal organs for support. Larger organ masses, according to them, mandate a high BMR. Later, also using interspecific comparisons, Daan et al. (1990) found a positive association between mass-independent measurements of BMR in birds, their heart and liver dry masses, and their field metabolic rate while caring for young. They hypothesized that natural selection adjusted the size of the internal organs to match energy requirements during parental care, the putative period of maximum energy expenditure, and that size- independent variation in BMR reflects the relative size of internal organs such as the liver, kidney, and heart which are thought to have high mass-specific rates of oxygen consumption (Krebs 1950; Martin and Fuhrman 1955). According to this idea, birds will posses organs that are fixed at some optimal size, a reflection of their energy needs during peak metabolic demand (Taylor et al. 1996; Weibel 1998). The idea that organ masses are invariant has been shown to be incorrect; some animals vary their organ sizes over short time periods in response to alterations in diet or environment (Toloza et al. 1991; Piersma et al. 1996; Piersma and Lindström 1997; Stark 1998). Some birds increase their BMR when exposed to low temperatures in the laboratory, whereas other species show no acclimatory change in BMR. Hudson and Kimzey (1966) reported that House Sparrows (Passer domesticus) from Houston, TX, had a lower BMR than conspecifics from more northerly regions, and proposed that these differences were genetically programmed, because, when sparrows from Houston were subjected to the cold, their BMR did not change (see also West 1972). However, in a review of 9 studies of temperate-zone birds, Gelineo (1964) concluded that birds elevated their BMR by an average of 32 ± 7.8% when removed from a warm environment (29-33 °C) and kept at low temperatures (0-15 °C) for 3-4 weeks. Less effort has been devoted to understanding the ecological and evolutionary significance of variation in total evaporative water loss (TEWL), the sum of respiratory water loss (RWL) and cutaneous water loss (CWL), than has been applied to questions about variation in BMR. Williams (1996) showed that desert birds have a reduced TEWL compared to mesic species using analyses of conventional least squares regressions, and regressions of phylogenetic independent contrasts. Both approaches supported the idea that birds from arid environments have a statistically lower TEWL than do birds from more mesic environments. In studies on small granivorous species, some individuals reduce their TEWL in response to water deprivation (Cade et al. 1965; Greenwald et al. 1967; Dawson et al. 1979), but the mechanism for this diminution remains unresolved. Finding a reduced TEWL in Zebra Finches (Poephila guttata) that were 196 living without drinking water compared with individuals that had drinking water available, and ruling out changes in RWL for water-deprived individuals, Lee and Schmidt-Nielsen (1971) proffered the idea that the reductions in TEWL were likely attributable to a change in CWL. Menon et al. (1989) confirmed the observation that water-deprived Zebra Finches have a reduced CWL, and showed that these birds deposited more lipids in the intercellular spaces of the stratum corneum than did individuals with drinking water available. Presumably birds deposited lipids in the skin as an acclimatory response to enhance water conservation. In this study we examined the short-term plasticity of BMR, TEWL, and organ sizes, of Hoopoe Larks (Alaemon alaudipes). We test the “energy demand” hypothesis which postulates that organ sizes, BMR, and TEWL, are influenced by the amount of food consumed, which in turn parallels energy requirements. As energy demand increases because of lower ambient temperatures (Ta), or because of greater activity levels, birds ingest more food with the result that key organs involved in catabolism (stomach, intestine, and liver), in oxygen transport to tissues (heart and lungs), and in elimination of waste (kidneys), are stimulated to hypertrophy. Because these organs have high metabolic intensity, total oxygen demand under basal conditions increases as these structures become larger. When oxygen needs are elevated, ventilation rate increases with a concomitant increase in RWL.

Methods Hoopoe Larks are distributed across most of the Sahara and throughout the Arabian Peninsula, including the hyperarid Rub ‘Al Khali, one of the largest sand seas in the world (Cramp 1984; Lancaster 1989). Although similar in appear- ance to females, males tend to be larger, sometimes by as much as 20%. Hoopoe Larks typically establish permanent territories (± 1 km2) along sandy wadis or on flat gravel plains where they forage for arthropods, lizards, and to a lesser extent seeds (Cramp 1984). During the spring, females lay 2-3 eggs; both sexes incuba- ARKS

te eggs and feed the young. In the summer when Tas often exceed 45 °C, Hoopoe L Larks avoid solar radiation during the middle part of the day by shading beneath OOPOE

clumps of grass, or by descending into lizard burrows (Williams et al. 1999). H

We mist-netted 12 Hoopoe Larks in Mahazat as-Sayd, a reserve in the east-cen- IN tral Arabian Desert (22° 15' N 41° 50' E), and transported them to the National Wildlife Research Center, near Taif, Saudi Arabia. We randomly assigned individuals to two groups, 3 males and 3 females in each, verified that birds were FLEXIBILITY similar in body mass in both assemblages, and placed one group in a constant temperature room at 15 ± 2.0 °C, the other in a room at 36 ± 2.0 °C. Birds were

fed mealworms, cockroaches, crickets, and small seeds ad libitum. Both groups PHYSIOLOGICAL were exposed to a 12L:12D light regime. 197 After larks were exposed to either 15 °C or 36 °C for 3 weeks, we measured basal

rates of oxygen consumption (VO2) and TEWL for postabsorptive birds during their nocturnal phase by standard flow-through respirometry and hygrometry methods (Gessaman 1987). Because allometric equations for TEWL are based on measurements at 25 °C (Williams 1996), we also measured TEWL of Hoopoe Larks at this temperature. Birds were placed in water-jacketed steel metabolic chambers (24 cm x 20 cm x 28 cm) that had an air-tight Plexiglas lid. During

measurements, Ta within the chamber was controlled by a Neslab circulating water bath (RTE-140) at 35 °C, a temperature previously determined to be within the thermal neutral zone of Hoopoe Larks (Tieleman et al. 2002c), or at 25 °C. Birds were placed on a wire-mesh platform over a layer of mineral oil which trapped feces, excluding it as a source of water in measurements. Air under positive pressure coursed through columns of drierite, soda lime, and drierite to

remove water and CO2 from the air stream, through a previously calibrated (Levy 1964) Brooks mass flow controller (model 5850 E) set at 700 ml/min, then through the chamber. Exiting air passed through a General Eastern Dewpoint Hygrometer (M4-DP) before a subsample was routed through an Applied Electrochemistry oxygen analyzer (S3A-II) to determine the fractional concen-

tration of oxygen in dry, CO2-free outlet air. After a 1 h equilibration period, we recorded the oxygen concentration and dew point of inlet and outlet air, the

temperature of the dew point hygrometer, and Ta within the chamber, using a Campbell Scientific Data Logger model 21X, for 2 more h. Calculations of oxygen consumption were performed using equation 2 of Hill (1972). We used 20.08

J/ml O2 to convert oxygen consumption to heat production (Schmidt-Nielsen 1997). When, during the third hour of measurements, the trace for oxygen consumption was stable for at least 10 min, we noted these times and used these data for calculations.

Evaporative water loss was calculated using the equation, TEWL (g/day) = [(Ve ρ ρ -3 ρ ρ 3 out - Vi in)] x 1.44 x 10 , where in and out is the absolute humidity (g H2O/m )

of inlet air and outlet air, respectively, Vi is the flow rate (ml/min) of air entering

the chamber as given by the mass flow controller, and Ve is the flow rate of exi- ρ ρ 3 ting air. Absolute humidity ( ) was determined using the equation (g H2O/m )

= 216.7 (es)/Tdp + 273.15 where es is the saturation vapor pressure at a given dew

point and Tdp is the temperature of the dew point hygrometer (List 1951). We

calculated Ve as Ve = Vi - [VO2 (1- RQ)] + VH2O. In this equation, Vi (ml/min),

the flow rate into the chamber, and oxygen consumption (VO2; ml/min), are

known, R.Q. is assumed to equal 0.71 (King and Farner 1961), and VH2O is cal- ρ ρ culated as VH2O = (Vi + VCO2 -VO2)/(1- ). The latter equation is derived from the ρ fact that = VH2O/(Vi + VCO2 - VO2 + VH2O), the fraction of water in air flowing through the dew point hygrometer. After measurements, we sacrificed birds, and dissected out their brain, heart, 198 liver, kidney, stomach, intestine, and muscles of the pectoral region (pectoral and supracoracoideus) on the right side of the body. Internal organs and muscles were dried to constant mass for 3 days at 75 °C, and weighed on a Sauter scale (model RE 1614) to ± 0.1 mg. Statistics were performed using SPSS 9.0 (1999). Means are presented ± SD. In making simultaneous multiple comparisons, like we have done on organ sizes between groups, the probability of a Type I error escalates rapidly. To compare organ sizes between groups, we used t-tests after a sequential Bonferroni correction in the level of significance was made (Hochberg and Tamhane 1987; Rice 1989).

Results Body mass At the beginning of the experiment, birds that were assigned to the 15 °C group averaged 41.3 ± 7.0 g (n = 6), and those placed in the 36 °C group averaged 37.2 ± 4.7 g (n = 6), values which did not differ significantly (t = 1.2, P > 0.25). After 3 weeks, birds in the 15 °C group were significantly heavier (44.1 ± 6.5 g) than birds in the 36 °C group (36.6 ± 3.6 g) (t = 2.5, P < 0.04). Birds in the 15 °C group gained on average 2.77 ± 0.8 g, an increase that was significantly different from zero (t = 8.7, P < 0.001), but birds in the 36 °C group decreased in mass by -0.57 ± 1.2 g, a value indistinguishable from zero (t = 1.2, P > 0.3).

Basal metabolism Basal metabolism of Hoopoe Larks from the 15 °C group averaged 46.8 ± 6.9 kJ/d, whereas BMR of larks from the 36 °C group equaled 32.9 ± 6.3 kJ/d. Larks in the 15 °C group had a BMR that was 42.2% higher than birds in the warmer group. In an ANOVA with BMR as the dependent variable, group as a main effect, and body mass as a covariate, we found that BMR differed significantly between groups (F = 6.2, P < 0.03; Fig. 1A). In addition we compared measures of BMR relative to tarsus length, the latter a proxy for structural size, independent of organs, that might contribute disproportionately to BMR. The ratio of ARKS BMR (kJ/d) to tarsus length (mm) averaged 1.35 ± 0.11 for the 15 °C group and L 0.99 ± 0.18 for the 36 °C group (t = 4.18, P < 0.002). OOPOE H

Total Evaporative Water Loss IN

For larks in the 15 °C group, TEWL averaged 3.55 ± 0.60 g H2O/d, whereas

TEWL for birds in the 36 °C group averaged 2.23 ± 0.28 g H2O/d, a 59.2% dif- FLEXIBILITY ference. In an ANOVA with TEWL as the dependent variable, group as a main effect, and body mass as a covariate, we found that TEWL, measured at 35 °C, differed significantly between groups (F = 17.1, P < 0.003; Fig. 1B). Birds with a higher BMR tended to have a higher TEWL, a relationship described by TEWL PHYSIOLOGICAL 199 Figure 1. (A). The relationship between basal metabolism (kJ/d) and body mass (g) in Hoopoe Larks from the Arabian Desert. Solid circles represent birds acclimated to 36 °C, open circles represent birds acclimated to 15 °C. (B) The relationship between total evaporative water loss

(g H2O/d) to body mass (g) in Hoopoe Larks from the Arabian Desert. Symbols as in A.

2 (g H2O/d) = -0.21 ± 0.078 BMR (kJ/d) (r = 0.83, F = 50.4, P < 0.001). When measured at 25 °C, TEWL of larks in the 15 °C group averaged 3.11 ± 0.4

g H2O/d, whereas larks in the 36 °C group averaged 2.17 ± 0.7 g H2O/d, values significantly different (t = 3.3, P < 0.008).

Organ masses After 3 weeks, larks acclimated to 15 °C had a significantly larger liver, kidney, and intestine than larks in the 36 °C group (Table 1). Although the stomach was not significantly heavier among birds in the 15 °C group, it was nearly so (P = 0.016; minimum level for significance = 0.013). The total increase in organ mass, exclusive of changes in pectoral muscle, amounted to 403 mg (Table 1), representing 14.3% of the mass gain in the cold group. Masses of internal organs were positively associated with basal metabolism (Fig. 2). We also calculated partial correlation coefficients for BMR and organ mass for our entire data set while

200 controlling for body size, using tarsus length as an index of body size (Hayes and TABLE 1. Dry masses (mean ± 1 SD; mg) of organs and muscle of Hoopoe Larks after 3 weeks at 15 oC or 36 oC.

Category 15 oC 36 oC % Change Probability a

Brain 213.6±17.4 203.4±22.2 5.0 0.39 Heart 122.0±13.3 111.9±13.6 9.0 0.22 Liver 345.5±66.4 241.2±16.8 43.2 0.004* Kidney 108.2±10.3 78.9±7.0 37.2 0.001* Stomach 253.3±54.3 181.6±26.4 39.5 0.016 Intestine 445.9±78.4 268.5±51.6 66.1 0.001* Pectoral muscleb 939.9±152.1 914.8±95.2 2.7 0.74

a statistical significance determined by t-test after sequential Bonferroni correction (Rice 1987). b pectoral muscle includes the supracoracoideus muscle. * indicates significance after Bonferroni correction.

Shonkwiler 1996). In these calculations BMR was significantly related to liver mass (P = 0.03), to kidney mass (P = 0.04), to stomach mass (P = 0.025), but only marginally so to intestine mass (P = 0.06).

Discussion Our data are consistent with the “energy demand” hypothesis for short-term adjustments in BMR (Williams 1999). When exposed to a Ta of 15 °C during 3 weeks of acclimation, larks expended more energy in thermoregulation than did the control birds housed at thermally neutral temperatures. At 15 °C, the resting metabolic rate of hoopoe larks is 98.7 kJ/d, whereas at 36 °C, the BMR is 32.9 kJ/d, a three-fold difference (Tieleman et al. 2002c). We fed larks in the cold group about 420 g/d of our insect mixture, about 140 g/d for birds in the warm group. Birds in the 15 °C group consumed more food, which apparently stimulated the enlargement of organs like the liver, kidney, intestine, and perhaps the stomach. Based on histological measurements, Brugger (1991) reported that absorptive cells of the gut (enterocytes) increased in size and number in hyper-

phagic Red-winged Blackbirds (Agelaius phoeniceus). The increase in mass of the ARKS L intestine that we have documented, 66%, is among the largest so far reported for

birds (Karasov 1996; Piersma et al. 1999; Battley et al. 2000). Because some of OOPOE H

these organs, such as the liver and kidney, have high mass-specific metabolic IN rates (Krebs 1950), these morphological adjustments translate into higher mass- independent BMR in birds exposed to colder Tas. We have not located other studies on birds that have examined variation in FLEXIBILITY organ masses as a consequence of acclimation to temperature and in conjunction with changes in BMR, but some investigations have been performed on mammals. Konarzewski and Diamond (1995) acclimated nude house mice (Mus mus- PHYSIOLOGICAL culus) at either 23 °C or 30 °C for 8 days, measured their BMR, and then deter- 201 Figure 2. The relationship between organ mass and basal metabolism in Hoopoe Larks from the Arabian Desert. Solid circles represent birds acclimated to 36 °C, open circles represent birds acclimated to 15 °C.

mined the dry masses of their internal organs. The lower acclimation temperature resulted in mice having a significantly higher mass-independent BMR than

mice exposed to the higher Ta, and cold-exposed mice had a significantly larger liver, intestine, kidney, and heart. Working with haired strains of mice, Toloza et al. (1991) also found that when mice were exposed to colder temperatures, animals elevated their BMR and enlarged their organs. Recent studies in comparative ecophysiology, ones that attempt to eliminate historical bias by incorporating adjustments for phylogeny, often assume that physiological traits are invariant, and that physiological adaptation can be deduced from interspecific comparisons (Huey 1987; Garland et al. 1997). However, the phenotypic flexibility that we have found in BMR and TEWL within Hoopoe Larks prompts caution when interpretations of differences in physiological traits among species are made. Presumably BMR and TEWL are optimized within the phenotype for a given set of environmental circumstances (Lewontin 1969; Feder 1987), an equilibrium that has both a genetic and a phenotypic compo- 202 nent. These facts should be borne in mind when making broad scale comparisons among species, and have significance when making interpretations based on phylogenetic independent contrasts (Felsenstein 1985a). Traits measured on individuals at different times of the year or from different geographic locations may vary not because of genetic differences, but rather because of acclimatization. Tieleman and Williams (2000) produced an equation that relates BMR to body mass among 21 species of desert birds which predicts a BMR of 32.5 kJ/d for a 36.6 g lark. Our measurement of 32.9 kJ/d for birds at 36 °C corresponds closely to this prediction, and may lead one to speculate that BMR shows adaptation to environment in this species (Weathers 1979). Similarly, TEWL for Hoopoe Larks in the 36 °C group, measured at 25 °C, was 36.9% below allometric predictions for desert birds (Williams 1996) which may suggest evolutionary specia- lization that reduces evaporative water loss. However, if we measured these traits for larks during the winter when they were exposed to colder temperatures, we may have found that their BMR and TEWL were above allometric predictions for desert birds, as we have found in the cold-exposure group. We found that, in the group acclimated to 15 °C, TEWL, measured at 35 °C, increased by 59.2% and BMR increased by 42.2%. However, the nature of the relationship between BMR and TEWL is unclear. One might predict that higher metabolic rates mandates increased ventilation, accomplished by increasing breathing frequency or by increasing tidal volume, resulting in an elevated respiratory water loss (RWL). In a separate study on Hoopoe Larks, we determined that RWL accounts for 31.7% of TEWL at 35 °C, and that CWL accounts for the remaining 68.3% (Tieleman and Williams, 2002b). Assuming that the increase of 42.2% in BMR is correlated with a parallel increase in RWL and no change in CWL, one would predict an increase in TEWL of 13.4%. Our finding that TEWL increased by 59.2% suggests that the birds in the cold-exposure group may have altered the permeability of their skin to water vapor diffusion. Parsons (1987) posited that phenotypic and genotypic variability tend to be high in organisms that live in conditions of severe environmental stress, especially for ARKS quantitative traits important in survival. Although consensus has not emerged L on this issue (Via et al. 1996), we use this as a working hypothesis for phenoty- OOPOE pic flexibility in terrestrial birds, especially those that live in deserts. These indi- H viduals survive for long periods on scant resources, before an unpredictable pulse IN of rain occurs, stimulating a shift in resource abundance. The necessity of mini-

mizing energy expenditure and water needs is paramount in order to survive long FLEXIBILITY periods of heat and drought. During periods when energy demand is increased, such as in winter or when breeding after a pulse of rain, we envision that the birds eat more food, increase their organ sizes, and elevate their BMR and their

FMR. One can imagine that in more mesic environments at higher latitudes, PHYSIOLOGICAL 203 selection pressures for down regulation of internal organs may not be as great, and as a result the physiological phenotype will not be as variable. If Parsons is correct, then we predict that the phenotypic flexibility in BMR and TEWL among desert birds is greater than genetically similar birds that live in mesic areas.

Acknowledgments We thank Patrick Paillat, Abdulrahman Khoja, Stephane Hemon, Stephane Ostrowski, Phil Seddon, and the staff of the National Wildlife Research Center, Taif, Saudi Arabia for their help during all aspects of this study. This project would not have been possible without the financial support of the National Wildlife Research Center (JBW), and of the Schuurman Schimmel van Outeren Foundation, The Netherlands (B.I.T.). We thank S. Daan and T. Piersma for their critical comments on a previous version of the manuscript.

204 ARKS L OOPOE H IN FLEXIBILITY PHYSIOLOGICAL

205

CHAPTER 10 The role of the nasal passages in the water economy of Crested Larks and Desert Larks

B. Irene Tieleman, Joseph B. Williams, Gilead Michaeli, and Berry Pinshow Physiological and Biochemical Zoology 72: 219-226. 1999. ABSTRACT Condensation of water vapor, in the exhaled air stream as it passes over previously cooled membranes of the nasopharynx, is thought to be a mechanism that reduces respiratory water loss in mammals and birds. Such a mechanism could be important in the overall water economy of these vertebrates, especially those species occupying desert habitats. However, this hypothesis was originally based on measurements of temperature of

exhaled air (Tex), which provide an estimate of the water recovered from the exhaled air as a proportion of the water added upon inhalation, but do not yield a quantitative measure of the reduction in total evaporative water loss (TEWL). In this study we experimentally occluded the nares of Crested Larks (Galerida cristata), a cosmopoli- tan species, and Desert Larks (Ammomanes deserti), a species restricted to arid habitats, to test the hypothesis that counter-current heat exchange in

the nasal passages reduces TEWL. Tex of Crested

Larks increased linearly with air temperature (Ta)

as Tex = 8.93 + 0.793Ta. Following Schmidt-

Nielsen and based on measurements of Tex, we predicted that Crested Larks would recover 69%, 49%, 23%, and -5% of the water added to the

inhaled air at Tas of 15 °C, 25 °C, 35 °C and 45 °C, respectively. However, with the nares occluded, Crested Larks increased TEWL by only 27,

10 and 6% at Tas of 15, 25 and 35 °C, respecti-

vely. At Ta = 45 °C TEWL of the Crested Lark was not affected by blocking the nares. In contrast to our expectation, occluding the nares of

Desert Larks did not affect their TEWL at any Ta.

ABSTRACT Introduction Many birds live in deserts, places that are characterized by high ambient temperatures (Ta), often in excess of 40 °C, and scarcity of drinking water (Louw and Seely 1982). In these environments, one can imagine that natural selection has favored species that minimize evaporative water loss, leading to a frugal water economy. Williams (1996) collated data from 102 species and found that total evaporative water loss (TEWL), the sum of respiratory and cutaneous water losses, was lower in desert birds compared to non-desert species at the thermally unstressful Ta of 25 °C. This finding supported the hypothesis that natural selection has equipped desert birds with specific adaptations that reduce their TEWL, but the mechanisms that produce this result remain unclear. Several processes have been suggested to play a role in decreasing evaporative water loss in birds, especially in desert species: hyperthermia (Calder and King 1974; Weathers 1981; Dawson 1984; Withers and Williams 1990), an increase in lipid content of the skin (Menon et al. 1989), and reduction in basal metabolic rates (Dawson 1984). A fourth mechanism, temporal counter-current heat exchange in the nasal passages of some species, can ostensibly recover significant quantities of water from the exhaled air stream, thus lowering respiratory evaporative water loss (REWL) (Jackson and Schmidt-Nielsen 1964; Schmidt- Nielsen et al. 1970; Berger et al. 1971; Murrish 1973). Temporal counter-current heat exchange in the nasal passages affects the temperature of the exhaled air (Tex), which determines the water vapor density, assuming that exhaled air is saturated with water vapor. When air is inhaled, its temperature rises to that of body temperature (Tb), and the air is saturated with water vapor from the respiratory passages and lungs. Convective heat exchange and evaporation of water in the nasal passages during inhalation presumably cool the associated membranes, and upon exhalation the air is cooled by these nasal sur- LARKS faces, with the result that water condenses on them. Measurements of Tex and Ta OF allow estimates of the amount of water that is recovered from the exhaled air stream based on the amount of water that is added to the air upon inhalation. ECONOMY Influenced by variation in Tb, Ta, and evaporative processes throughout the entire TER A

respiratory system, measurement of Tex does not directly assess the effect of the W

nasal passages on reducing the water content of exhaled air. THE

It has been argued that counter-current heat exchange in the nasal passages plays IN an important role in water recovery in mammals (Jackson and Schmidt-Nielsen ASSAGES

1964; Getz 1968; Schmidt-Nielsen et al. 1970; Collins et al. 1971), reptiles P (Murrish and Schmidt-Nielsen 1970) and birds (Schmidt-Nielsen et al. 1970; Berger et al. 1971; Murrish 1973). Schmidt-Nielsen (1981) proposed that coun- NASAL ter-current heat exchange in the nasal passages is an adaptation to arid environ- OF ments, and that desert animals should have more complex nasal turbinates that ROLE THE allow cooling of Tex to temperatures below those of non-desert species, resulting 209 in a larger reduction in REWL in desert animals. However, to date no one has proffered data to support such an idea. By measuring TEWL and assuming that CEWL was constant, Hillenius (1992) showed for 5 species of small mammals that complex nasal turbinates reduced REWL. When animals were forced to breath orally, REWL was increased by 36%

to 143% over that of control animals using nasopharyngeal breathing, at a Ta of 15 °C. The data from Hillenius’ study did not support the idea that desert mammals reduced their TEWL more than non-desert species. Given the differences in anatomical design between the taxa (Bang 1971), it is not clear that studies on water recovery in the noses of mammals can be extra- polated to birds. For birds, a direct determination of the amount of water recovered by counter-current heat exchange in the nasal passages has not been made. However, the presence of counter-current heat exchange in combination with complex nasal turbinates, similar to those in mammals, has led to the notion that this process significantly reduces REWL in birds as well (Schmidt- Nielsen et al. 1970; Berger et al. 1971; Schmidt-Nielsen 1981; Hillenius 1992; Hillenius 1994; Ruben 1996). In this paper we tested the hypothesis that counter-current heat exchange in the nasal passages reduces TEWL of Crested Larks (Galerida cristata) and Desert

Larks (Ammomanes deserti) over a range of Tas. In addition, we compared direct

measurements of recovery of REWL with predictions based on Tex in Crested Larks. Crested Larks occur over a wide range of both mesic and arid habitats, while Desert Larks are restricted to arid habitats, where drinking water is scarce (Shkedy and Safriel 1991; Shkedy and Safriel 1992a). If water recovery in the nasal passages is an adaptation to environmental conditions, one might expect that this mechanism is quantitatively more important in reducing TEWL of Desert Larks than of Crested Larks.

Material and methods Animals We captured Crested Larks in the kibbutz Sde Boqer, and Desert Larks near a permanent pool of water (En Avdat), both located in the Negev Desert Highlands, Israel, where both species are resident (Cramp 1988). The birds were transported to the Mitrani Center for Desert Ecology, Midreshet Ben-Gurion, and housed in outdoor cages. They were provided with water and food ad libitum, the latter consisting of mealworms, hard-boiled eggs and millet. Mean body mass was 33 ± 1.3 g (SD) for the Crested Larks (n = 6), and 19 ± 1.5 g (SD) for the Desert Larks (n = 6). Birds were collected under permit of the Israel Nature Reserves Authority.

210 Temperature of the exhaled air In order to estimate the amount of water that is recovered from the exhaled air stream as previous workers have done, we measured Tex in 3 Crested Larks, at Tas from 15 to 40 °C. Birds were placed in a dark environmental chamber that maintained Ta ± 0.1 °C. We situated the birds in a plastic container that was cut in half lengthwise, and covered them with plastic screening to restrict movement but to allow some freedom for plumage adjustments. We inserted a 48-gauge copper-constantan thermocouple 2 mm into the nasal opening, using a rack and pinion device. After verifying with a magnifying glass that the thermocouple did not touch the nasal membranes, we taped the thermocouple wire to the bill. When a regular breathing pattern was achieved, we monitored the temperature cycle of inspired and expired air (20 readings per second) during at least 3 minutes with an A/D board and computer software (Strawberry Tree - Workbench PC for Windows 2.60). The time constant of the thermocouple was 0.2 seconds. Tex typically plateaued, indicating that equilibrium was reached. For a measurement of Tex, we averaged values of 10 consecutive plateaus. To measure Tex with the nares occluded, we inserted a small piece of cotton in the nasal opening, through which we inserted the thermocouple. After taping the thermocouple to the bill, we occluded the nares with plastic dental resin (see below).

Experimental treatment to prevent air flow through the nares To determine the role of the nasal passages in the water economy of the larks, we measured evaporative water loss when the external nares were open and normal nasopharyngeal breathing was possible, and when the external nares were experimentally closed, forcing the bird to breathe orally. Air flow through the nasal passages was prevented by occluding the nares with plastic dental resin (Kerr Heavy Bodied Permlastic) that was applied as a mixture of base and catalyst. This

viscous paste would flow around the opening of the nares and within 5 minutes LARKS would harden, forming an air tight seal. The resin could easily be removed after OF a measurement, without damage to the bird. We assumed that cutaneous evaporative water loss (CEWL) was not affected by the treatment, and measured ECONOMY TER

TEWL, the phenotypic trait that could affect survivorship. In contrast with A measurements of REWL, TEWL could be assessed without restraining the ani- W THE

mals. IN

Measurements of TEWL and oxygen consumption ASSAGES We constructed two metabolic chambers, one from a 5 l metal can (Crested P Larks), the other from a 3 l metal can (Desert Larks). The inner surface of each NASAL

chamber was coated with flat black paint to reduce the reflectance of long-wave OF radiation (Porter 1969). Each day prior to measurements we checked the lids of ROLE the chambers for leaks with soap solution. The birds were placed in the chamber THE on wire mesh, above a layer of mineral oil that trapped excrement. We placed 211 the metabolic chamber in an environmental cabinet that had the capability of

controlling Ta to within ± 0.1 °C.

Rates of TEWL and oxygen consumption (VO2) were determined for birds that

had been without food during at least 3 h prior to the measurements. Dry, CO2- free outside air was pulled through the metabolic chamber with a GAST-pump at a constant rate, regulated using a mass flow controller (Brooks model 5810) that was calibrated with a bubblemeter (Levy 1964). We varied the flow rate -1 between 1180 and 1840 ml min , depending on species and Ta, to maintain relative humidity in the metabolic chamber below 15%. Excurrent air was passed through a dewpoint hygrometer (General Eastern model Hygro M4), and then routed through a column of drierite to remove water vapor. The dry air then flowed through the mass flow controller prior to passage through columns of

drierite, ascarite, drierite, and an O2-analyzer (Taylor Servomex model 1400B).

Before each measurement, we calibrated the O2-analyzer with dry CO2-free outs-

ide air. We recorded dewpoint and O2-concentration of the excurrent air continuously with a Campbell 21X data logger and PC208W software, and graphed the results in real time. Visual inspection of our results allowed us to determine when steady state conditions were achieved. Birds were usually quiet when in the metabolism chamber and often were asleep when we opened the lid. Typically

equilibration took about 90 minutes, after which we averaged dewpoint and O2- concentration of the excurrent air stream over a minimum of 10 minutes for our measurements. Water vapor density of the incurrent and excurrent air was calculated from measurements of dewpoint using equations in the General Eastern’s

Humidity Handbook (1993). VO2 was calculated with equation 4b of Withers (1977). Initial metabolic trials consisted of 3 consecutive measurements (90 minutes each) on the same individual: either with nares open, closed, and then open, or with the nares closed, open, and then closed. The initial treatment (nares open or closed) was alternated. When we were convinced that the first and last measurements gave statistically indistinguishable results, we reduced the metabolic trials to 2 runs: with the nares open, then closed, or vice versa. Metabolic trials were performed both during day and night, but because our measurements were paired, the time when measurements were made should not affect our comparisons. Body mass was determined before and after the metabolic trial using an Ohaus top loading balance (model CT1200-S). Mass changes during the trials at

lower Tas were small, increasing to 2.9 ± 0.39 g (n = 6) for Crested Larks and 1.8

± 0.32 g (n = 3) for Desert Larks at Ta = 45 °C.

Body temperature

To determine whether oral breathing affected Tb, prior to and immediately after

each measurement we assessed Tb with a 36-gauge thermocouple attached to an 212 OMEGA thermometer (model 450 ATT). Our thermometer was calibrated against a standard mercury in glass thermometer (Taylor) with a certificate of calibration traceable to the N.I.S.T. If there was a significant increase in Tb -1 during a measurement, we calculated the rate of heat storage as CdTb/dt (J h ). Here, C is the specific heat of the bird in J °C-1, calculated as the product of body mass and the specific heat of tissue, 3.35 J g-1 °C-1 (Calder and King 1974, -1 Schmidt-Nielsen 1983), and dTb/dt is the change in Tb with time (°C h ).

Measurements of REWL To measure REWL of the Crested Larks we constructed a plastic mask out of the barrel of a syringe, and held it to the bird’s face with a velcro band behind its head. The bird was restrained as described previously before it was placed in our environmental chamber. Birds quieted quickly and visually appeared calm throughout the measurements. Air was pulled through the mask with a GAST- pump at a flow rate of 351 ± 1.2 ml min-1. A rotameter (Brooks model R2 15D) that was calibrated with a bubblemeter (Levy 1964) maintained a constant flow rate. Excurrent air passed through an EG&G Dewpoint Hygrometer (model 660). Dewpoint measurements were recorded every 10 s with our data acquisition software. Note that equilibration took less time (usually <5 minutes) than for the TEWL measurements, because the mask method does not require the washout of a large volume of air as does a metabolism chamber. During a trial, dewpoint measurements of the air in the environmental chamber determined the water vapor density of the air flowing into the mask. These baseline measurements were alternated with dewpoint measurements of the exhaled respiratory air. After an equilibration period of about 15 minutes, we averaged the data over a 5-minute interval for a dewpoint measurement. At Tas of 15, 25 and 35 °C a trial consisted of two consecutive measurements of the first treatment (either open or closed nares) followed by two measurements of the other LARKS OF treatment (either closed or open nares). At Ta = 45 °C a trial consisted of one measurement of the first treatment (open or closed nares), followed by one measurement of the second treatment (closed or open nares). The maximal relative ECONOMY TER

humidities in the environmental chamber during the measurements were 56% A W (Ta = 15 °C), 39% (Ta = 25 °C), 25% (Ta = 35 °C) and 18% (Ta = 45 °C). THE IN Experimental design and statistical analyses Our experimental design was counterbalanced with repeated measurements on ASSAGES the same individuals (Stevens 1992). To determine the role of the nasal passages P at the different Tas, we used repeated measures ANOVA with individual birds as NASAL

the between factor, temperature as a within factor, and nares treatment nested OF within temperature (Stevens 1992). If missing values left the experimental ROLE design incomplete, we used the difference between closed and open nares as THE dependent variable in a mixed model ANOVA with temperature as fixed effect 213 and individual birds as random effect (Zar 1984). When temperature significantly affected the difference between closed and open nares, we calculated à priori contrasts of the type “difference”. Computations were performed with the procedures GLM-repeated measures or GLM-general factorial in SPSS 7.5 for Windows (SPSS Inc, Chicago, IL). Values are presented as means ± 1 SD.

Results Amount of water recovered by cooling exhaled air

In the Crested Larks that were breathing normally Tex increased linearly with Ta: 2 Tex = 8.93 + 0.793Ta (SEslope = 0.045, n = 14, r = 0.96). With nares occluded Tex

of the larks was 24.7 °C at Ta = 15 °C, 30.8 °C at Ta = 25.3 °C and 37.7 °C at

Ta = 35.7 °C. The estimated amount of water recovered by cooling of the exhaled air, as a pro-

portion of the water added upon inhalation, decreased with increasing Ta in the Crested Lark (Figure 1). We emphasize that this predicted decrease in water recovery is the result of cooling processes in the complete respiratory system, which would include the upper respiratory tract and the nasal passages, and that it is not equivalent to the actual reduction in TEWL as a result of counter-current heat exchange in the nasal passages only. To facilitate comparison with the calculations for the Cactus wren (Campylorhynchus brunneicapillum), we assumed that the relative humidity of the inhaled air was 25%, analogous to Schmidt-

Figure 1. The amount of water vapor added to the air upon inhalation (solid arrows pointing upwards), the amount recovered upon exhalation (solid arrows pointing downwards), and the amount of water vapor lost upon exhalation. The temperature of the inhaled air is indicated by the location of the upward pointing arrows, and that of the corresponding exhaled air by the posi- 214 tion of the downward pointing arrows. Nielsen et al. (1970). The solid arrows pointing in upward direction in Figure 1 indicate the amount of water added to the inhaled air as it is brought to saturation at Tb. The solid arrows pointing down, placed at the corresponding Tex, indicate the amount of water recovered due to cooling of the air. The predicted amount of water recovered decreased from 69% at Ta = 15 °C to -5% at Ta = 45 °C.

The effect of breathing through the nares on TEWL Crested Larks With their nares occluded, Crested Larks lost more water by evaporation than when they were breathing through open nares (Figure 2A). The increase was 27,

10, and 6% at Tas of 15, 25 and 35 °C, respectively (temperature F15, 3 = 368.1,

P < 0.001, nares F5, 1 = 0.14, P = 0.73, interaction F15, 3 = 7.87, P = 0.002). At Ta = 45 °C, blockage of the nares did not affect TEWL (contrast t = 3.06, P = 0.03). Note that because the interaction term in this ANOVA was significant, we performed a contrast analysis to test at which Tas the difference in TEWL between closed and open nares treatments was significant. The latter P-value reported here signifies that TEWL was higher for the closed nares treatments at Tas of 15,

25 and 35 °C, but not at Ta = 45 °C. In addition, inspection of the standard deviations of our groups might lead one to conclude that no differences existed at any temperature. However, we point out that our statistical tests are based on paired comparisons rather than overall means. The increase in TEWL could have been the effect of increased ventilation resulting from elevated metabolism if the birds were stressed by occluding the nares. When we compared the effect of the treatments on oxygen consumption (Table

1), it did not differ between treatments (nares F5, 1 = 0.08, P = 0.79, interaction

F15, 3 = 2.04, P = 0.15). We concluded that blocking the nares did not cause

increased ventilation rates compared to the control measurements with nares LARKS open. OF ECONOMY TABLE 1. Oxygen consumption (ml min-1) of Crested Larks and Desert Larks. TER A W Ta 15 °C 25 °C 35 °C 45 °C

mean ± SD n mean ± SD n mean ± SD n mean ± SD n THE IN Crested Lark nares open 1.93 ± 0.46 6 1.18 ± 0.17 6 1.28 ± 0.23 6 1.88 ± 0.42 6

nares closed 1.95 ± 0.40 6 1.22 ± 0.18 6 1.34 ± 0.27 6 1.74 ± 0.40 6 ASSAGES P Tb 39.9 ± 0.81 12 39.7 ± 0.78 23 40.8 ± 0.53 21 43.9 ± 0.60 12

Desert Lark NASAL nares open 1.46 ± 0.09 5 0.87 ± 0.22 6 0.69 ± 0.05 4 1.05 ± 0.42 3 OF nares closed 1.46 ± 0.26 5 0.81 ± 0.20 6 0.65 ± 0.10 4 1.10 ± 0.42 3 ROLE Tb 39.8 ± 1.59 10 38.9 ± 0.92 11 41.1 ± 0.70 8 44.2 ± 0.54 8 THE

215 Figure 2. A. Total evaporative water loss (TEWL) of Crested Larks measured with open nares

and with closed nares at various Tas. The error bars represent 1 SD. B. Total evaporative water

loss (TEWL) of Desert Larks measured with open nares and with closed nares at various Tas. Note the difference in scale on the y-axes.

Desert Larks

Blocking the nares did not significantly affect TEWL or VO2 in the Desert Larks

(Figure 2B, Table 1). The difference in TEWL and VO2 between birds with clo-

sed and open nares was not significant (TEWL: F1, 4.3 = 0.004, P = 0.95; VO2: F1,

4.1 = 0.08, P = 0.79) and was not affected by temperature (TEWL: F3, 9 = 0.70, P

= 0.58; VO2: F3, 9 = 0.41, P = 0.75). By looking at Figure 2, one might think that the increase in TEWL when the nares are occluded, expressed as proportion of TEWL, is equal for Crested Larks and Desert Larks. However, also when expressed in this relative measure Crested Larks increased their TEWL by a larger extent than Desert Larks as a result of

occluding the nares. At Ta = 15 °C TEWL was increased by 27% for Crested 216 Larks, and by 10% for Desert Larks. The effect of breathing through the nares on REWL Closing the nares to prevent counter-current heat exchange in the nasal turbinates significantly increased REWL in the Crested Larks (Figure 3). The difference in REWL between birds with closed and open nares was significant (F1, 5.3

= 26.01, P = 0.003) and was not affected by temperature (F3, 14 = 0.38, P = 0.77). When breathing through their open beaks, REWL of Crested Larks was greater than in control animals using nasopharyngeal breathing by 38, 47, 29 and 2% at

Tas of 15, 25, 35 and 45 °C, respectively (Figure 3).

Respiratory versus cutaneous evaporative water loss The contribution of REWL to TEWL in Crested Larks decreased with increasing

Ta from 59% at Ta = 15 °C to 35% at Ta = 45 °C. The Crested Larks relied increasingly on CEWL for evaporative cooling at higher Tas. REWL and TEWL were measured under different circumstances, and therefore the effects of closing the nares on REWL and TEWL are not statistically comparable. However, our estimate of the contribution of CEWL to TEWL is likely conservative, because if restraint caused stress, REWL would have been higher in these birds.

Body temperature

Treatment of the nares did not affect Tb in the Crested (F1, 8 = 0.1, P = 0.74) and the Desert Larks (F1, 6 = 3.7, P = 0.11) at any Ta (Crested Lark: F3, 32 = 0.3, P =

0.82, Desert Lark: F3, 9 = 3.0, P = 0.09).

Crested Larks

Body temperature was relatively constant at Tas of 15 and 25 °C and averaged

39.8 ± 0.79 °C. Tb increased to 40.7 °C at Ta = 35 °C and to 43.9 °C at Ta = 45

°C (Table 1, temperature F3, 59 = 111.1, P < 0.001, contrast P < 0.05). At Tas of LARKS OF ECONOMY TER A W THE IN ASSAGES P NASAL OF ROLE

Figure 3. Respiratory evaporative water loss (REWL) of Crested Larks measured with open THE 217 nares and with closed nares at various Tas. The error bars represent 1 SD. 15, 25 and 35 °C the birds maintained a stable Tb during the measurements, but

at Ta = 45 °C Tb increased significantly with time, at a rate of 0.53 ± 0.183 °C -1 h (temperature F3, 32 = 9.3. P < 0.001, contrast P < 0.05). This continuous incre- -1 ase in Tb corresponds to a rate of heat storage of 59 ± 19.9 J h .

Desert Larks

Desert Larks maintained a constant Tb of 39.3 ± 1.32 °C at Tas of 15 and 25 °C,

and significantly increased their Tb to 41.1 at Ta = 35 °C and to 44.2 °C at Ta

= 45 °C (Table 1, temperature F3, 28 = 41.5, P < 0.001, contrast P < 0.05). Desert

Larks maintained a stable Tb during the measurements at all Tas (temperature

F3, 9 = 0.94, P = 0.46).

Discussion The role of the nasal passages in reducing TEWL of Crested Larks

Following the protocol of Schmidt-Nielsen et al. (1970) and measuring Tex, we predicted that Crested Larks recovered 69% of the water that was added to the air upon inhalation, as a result of expiring air with a temperature of 21 °C, at a

Ta of 15 °C. This estimate is close to the recovery of 74% of the water added upon inhalation reported for the Cactus Wren (Schmidt-Nielsen et al. 1970). These calculations, however, do not reveal the relative importance of the nasal passages in reducing REWL or TEWL. A direct test of the hypothesis that the nasal passages reduce evaporative water loss in the Crested Lark showed that experimentally closing the nares increased TEWL by 27% and REWL by 38% at

Ta = 15 °C. These comparisons demonstrate that direct measurement is the only way to ascertain the effect of nasal passages on the reduction of REWL and TEWL. Further, the method of Schmidt-Nielsen et al. (1970) predicted that water reco-

very decreases with increasing Ta, a result of a smaller difference between Tex and

Tb at higher Tas (Figure 1). Our experimental test in which we occluded the

nares in Crested Larks supported this prediction: at Ta = 15 °C TEWL was in-

creased by 27% compared to the control measurements, and at a Ta of 45 °C the

difference had declined to nil. At high Tas one might expect that water recovery

in the nasal passages would be minimized because Tex is near Tb, and because birds were panting.

TEWL at 25 °C and 45 °C To test the hypothesis that the Desert Lark, a species that is restricted to drier habitats than the Crested Lark, has a lower TEWL, we compared TEWL of both

species with an allometric equation for TEWL of desert birds at Ta = 25 °C (Williams 1996). TEWL of the Desert Lark was 77% of that predicted for desert birds with a similar body mass, while TEWL of the Crested Lark was 104% of the 218 value predicted for desert birds of the same size. To statistically compare TEWL between species, we divided TEWL by body mass0.75, the exponent of the equation that relates TEWL to body mass in desert birds (Williams 1996). After adjusting for body mass, Desert Larks had a significantly lower TEWL than

Crested Larks at a Ta of 25 °C (t = 2.29, df = 10, P < 0.05).

At Ta = 45 °C TEWL of the Desert Lark was 69% of the predicted TEWL based on an allometric equation for TEWL at Ta = 45 °C (Tieleman and Williams

1999). At this Ta, TEWL of the Crested Lark was 87% of the value predicted for a similar sized bird. After correcting for body mass by dividing TEWL by body mass0.56, the exponent of the allometric equation found by Tieleman and Williams, Desert Larks had a significantly lower TEWL than Crested Larks at

Ta = 45 °C (t = 2.68, df = 7, P = 0.03).

Crested Larks and Desert Larks compared Desert Larks had lower mass-specific rates of TEWL than Crested Larks, supporting the hypothesis that Desert Larks are better adapted to arid habitats than Crested Larks. If complex nasal turbinates are an adaptation to environmental conditions, as hypothesized by Schmidt-Nielsen (1981), one would expect that Desert Larks possess turbinates that are more complex than those of Crested Larks, with the result that Desert Larks might reduce their TEWL more. Contra this prediction, we were surprised to find that occluding the nares does not affect TEWL in Desert Larks, while it results in an increase in TEWL in Crested Larks, at least at the lower Tas. Therefore, this study does not support the hypothesis that water recovery in the nasal passages has evolved more extensively in desert species, in response to environmental conditions. Hillenius (1994) suggested that the shape of the bill determines the complexity of the nasal cavity, and could affect the olfactory and cooling functions of the nasal turbinates in birds. We found a larger reduction in TEWL in Crested Larks, LARKS which have a significantly longer bill (18.4 ± 1.2 mm) than Desert Larks (15.1 OF ± 1.1 mm) (t = 4.4, df = 8, P = 0.002). A positive correlation between bill length and the cooling capacity of the nasal turbinates possibly explains the observed ECONOMY TER

difference in reducing TEWL between the two species, a hypothesis in need of A testing. W THE IN Temporal counter-current heat exchange in the nasal passages Schmidt-Nielsen and his co-workers suggested that temporal counter-current ASSAGES P heat exchange in the nasal passages explains the low Tex found in many animals (Jackson and Schmidt-Nielsen 1964; Getz 1968; Schmidt-Nielsen et al. 1970; NASAL

Murrish and Schmidt-Nielsen 1970; Collins et al. 1971; Berger et al 1971; OF Murrish 1973; Schmidt-Nielsen 1981). This hypothesis predicts that when air ROLE flow through the nasal passages is prevented, the nasal membranes would not THE function as a heat exchanger and Tex would be higher. Our measurements of Tex 219 made with the nares occluded give values only slightly higher than those determined when the nares were open. We suggest an alternative hypothesis that in

birds Tex is determined by the temperature of the uninsulated bill and surroun-

ding tissue, which probably closely follow Ta, instead of by counter-current heat exchange as a result of evaporative processes at the nasal membranes.

Acknowledgments We thank M.H. Bernstein, T.E. Hetherington, W.J. Hillenius, R.E. MacMillen, J. Ruben, M. Webster, L.M. Witmer, and 3 anonymous reviewers for critically reviewing an earlier version of the manuscript. Financial support for this project was received from The Blaustein International Center for Desert Studies, The Ohio State University and the University of Groningen. This is paper 261 of the Mitrani Center for Desert Ecology.

220 LARKS OF ECONOMY TER A W THE IN ASSAGES P NASAL OF ROLE THE

221

CHAPTER 11 The role of hyperthermia in the water economy of desert birds

B. Irene Tieleman and Joseph B. Williams Physiological and Biochemical Zoology 72: 87-100. 1999. ABSTRACT A number of authors have suggested that hyper-

thermia, the elevation of body temperature (Tb) 2-4 °C above normal, contributes to a reduction in total evaporative water loss (TEWL) in birds. Information about the role of hyperthermia in the water economy of birds is scattered throughout the literature. We purposed to collate the available information on this subject, to re-evaluate the benefits and costs of this process, and to assess its net effect on the water economy of birds, especially species living in deserts. In this review we first consider the current model of heat balance in birds at high ambient temperatures

(Ta), and show that in most studies performed at

these high Tas, birds were increasing their Tb, a violation of the assumption of steady state conditions. Next we incorporate the rate of heat gain into calculations of the dry heat transfer coefficient (h), below and above temperature equality

(Ta = Tb). We develop a method to calculate h at

Ta = Tb, using l’Hôpital’s rule. The combined result of our approach suggests that birds increase

their dry heat transfer even at Tas above Ta = Tb, contrary to our prediction. Finally, we explore aspects of hyperthermia that reduce water loss, such as an improved thermal gradient and heat storage, and aspects that may augment water loss, the latter a result of increased respiratory water

loss when Tb is elevated. Our analysis of the combination of these three factors, suggests that

during acute exposure to high Ta (1 h), birds over a size range of 10-1000 g save about 50% of their TEWL by becoming hyperthermic. For chronic

episodes of high Ta (5 h), small birds save water by hyperthermia but large birds do not.

ABSTRACT Introduction Deserts are harsh regions characterized by intense solar radiation, temperature extremes, low primary productivity, and scarcity of drinking water (Louw and Seeley 1982). For avian species, living in these areas is especially challenging, because, unlike many of their mammalian counterparts, birds are diurnal and non-fossorial, and as a consequence, experience the full brunt of the desert environment. Their successful occupation of these rigorous climes is even more remarkable when one considers that birds have relatively high rates of water loss, a feature attributable to processes that accompany high metabolic rates (Aschoff and Pohl 1970). Moreover, high rates of metabolism result in high body temperatures (Tb), averaging around 41 °C (Prinzinger et al. 1991), close to the upper lethal limit of 46-47 °C (Dawson and Schmidt-Nielsen 1964). During periods of heat stress, their water economy must be compromised, because birds defend their Tb from exceeding the lethal limit by means of evaporative cooling, a mechanism that mandates substantial water loss.

The physiological capacity of birds to regulate their Tb by evaporative cooling can be exceeded in some natural situations: periods of extreme heat, with air temperatures (Ta) exceeding 50 °C, have caused significant mortality among populations of desert birds (Miller 1963; Serventy 1971). One can imagine that, because of similar episodes of temperature extremes coupled with a pervasive scarcity of drinking water, natural selection has equipped extant populations of desert birds with a suite of behavioral and physiological adaptations that minimize water loss. Early work that compared desert and non-desert species failed to elucidate physiological differences, leading to the consensus that, in general, birds are pre-adapted to desert life (Chew 1961; Bartholomew and Cade 1963; Dawson and Schmidt-Nielsen 1964; Dawson 1982; Maclean 1996). However, recently Williams (1996) has shown that birds from arid environments have lower total evaporative water loss rates (TEWL) than do birds from more mesic

environments, at least when tested in the laboratory at a Ta of 25 °C. This fin- BIRDS ding leads to the possibility that some desert birds have evolved specific adapta- OF tions that reduce their TEWL, but the mechanism(s) that produce this result

remain unknown. ECONOMY

The literature contains a number of suggestions for mechanisms that reduce TER A TEWL, the sum of respiratory and cutaneous water losses. A counter-current W heat exchange system in the nasal passages of some species can ostensibly recover THE IN significant quantities of water from the exhaled air stream, thus lowering respiratory water loss (Schmidt-Nielsen et al. 1970). During dehydration, adult THERMIA Zebra finches (Poephila guttata) reduce cutaneous water loss by altering the lipid composition in their epidermis (Menon et al. 1989). A number of authors have HYPER OF suggested that hyperthermia, the elevation of body temperature 2-4 °C above normal, contributes to a reduction in TEWL among birds (Calder and King ROLE 1974; Weathers 1981; Dawson 1984; Withers and Williams 1990). THE 225 Discussions about the potential benefits of hyperthermia to the water economy of birds have focused on 3 factors. First, an improved thermal gradient between

Tb and ambient air temperature (Ta) increases the potential for dry heat loss, thereby decreasing the need for evaporative cooling (Calder and King 1974).

Second, heat that is temporarily stored in body tissues during bouts of high Ta

could be dissipated by non-evaporative means when Tas become more favorable (Schmidt-Nielsen 1964; Dawson and Bartholomew 1968; Calder and King 1974). And third, Weathers and Schoenbaechler (1976) found that, for some

species, Tb increased in the thermoneutral zone (TNZ) while metabolism remained

constant. They reasoned that this absence of a Q10-effect would reduce evaporative water loss, because ventilation rates and metabolic heat production would be lower. Weathers (1981) used the three factors above to estimate that Pyrrhuloxia (Cardinalis sinuatus) reduce their TEWL by 50% as a result of 2.3 °C

increase in Tb at a Ta of 38 °C. Few studies have focused explicitly on the role of hyperthermia in the water economy of birds. Much of the information that does exist on this issue is scattered throughout the literature and much of the data were collected in studies of temperature regulation, often more than a decade ago. Moreover, most interpretations of the significance of hyperthermia that we have found in the literature suggest a positive effect on water savings. Few have delved into the complex features of hyperthermia, some of which may negatively impact water loss rates.

Consider, for example, that when birds have an elevated Tb, exhaled air tempe-

rature (Tex) will be higher than it would be at normothermic Tb. The result is that the exhaled air will contain more water vapor, assuming that air in the lungs is saturated with water (Schmidt-Nielsen et al. 1970; Withers and Williams 1990). Second, if birds become hyperthermic they may start panting, increasing the volume of exhaled air by as much as 5 times above volumes for normothermic birds (Bernstein 1987). The combination of higher water vapor density and increased volume of exhaled air, results in an augmentation of respiratory water loss, negating some of the hypothesized advantages of hyperthermia. The above considerations prompted us to collate the available information on hyperthermia in birds, to re-evaluate the benefits and costs of this process, and to assess its net effect on the water economy of birds, especially species living in deserts. In this report we first re-evaluate the current model of heat balance in birds at

high Tas. Next, we examine the variation in Tb over a range of Tas in desert and

non-desert species, testing the hypothesis that desert species have a higher Tb at

a given Ta. Then, using our model of heat balance, we assess the roles of an

improved thermal gradient, of heat storage, of Q10, and of altered respiratory variables in reducing or augmenting water loss in birds. We do so by comparing

water loss of birds with an elevated Tb with the hypothetical situation where Tb is normothermic. Finally, we specify the kind of data needed to arrive at a more 226 complete understanding of the process of hyperthermia and of its role in the water economy of desert birds.

Materials and methods We found 28 studies that reported laboratory measurements of metabolic rate, ≥ evaporative water loss, and Tb of birds at Tas 45 °C. Most of these investigations used species which weighed less than 200 g (see Appendix A); information on larger species is lacking. Two studies reported data up to 44 °C; we estimated data in these cases by solving the appropriate equations at 45 °C. Six studies did not contain all variables required for calculations of the dry heat transfer coefficient (h), and were not used in our calculations of water savings. All studies used open-circuit respirometry, but different experimental conditions under which measurements were made, along with diverse techniques used to determine Tb, metabolism and evaporative water loss, add variation to the data. We included studies without regard to when measurements were made during the day (α or ρ phase) or year, the length of time animals had been in captivity, or their digestive state (postabsorptive vs non-postabsorptive). We excluded studies in which birds were water stressed, or in which low air flow rates were used, a situation that can adversely affect rates of TEWL (Lasiewski et al. 1966). Our rationale for selecting data at 45 °C was that many desert species experience equivalent Tas in the field, most species have an elevated Tb at this Ta, and considerations of water economy are important for survival at this high Ta. In classifying a species as desert or non-desert we followed the judgment of the original author(s). Statistical analyses were performed using SPSS/PC+ or following Zar (1984). Means are presented ± SD.

Results BIRDS Heat balance in and above the thermoneutral zone OF

An appreciation of the heat balance of birds at high Tas is important when trying to understand the impact of hyperthermia on the rate of water loss. The classic ECONOMY TER model of heat balance, originally designed for moderate and cold air temperatures A W (Scholander et al. 1950; Calder and King 1974), requires re-evaluation before it THE can be applied to situations of heat stress. IN

Dry heat loss THERMIA The rate of dry heat loss H (J h-1) of an animal is described by (following Bakken 1976; Gates 1980): HYPER OF

H = M - E - C(dTb/dt), (1) in which M = metabolic heat production (J h-1), E = total evaporative heat loss ROLE

-1 THE (J h ), and C(dTb/dt) = rate of heat gain in or loss from the animal’s body tissue 227 Figure 1. A. Tb as a function of Ta. B. Metabolic heat production (M, solid line), evaporative

heat loss (E, dotted line), and rate of heat gain (CdTb/dt, dashed line), as functions of Ta. C.

Dry heat transfer coefficient (h, solid line) as a function of Ta. The upper thin line indicates the

expected maximal h reached at the Tuc (see text). The lower thin line indicates the minimal h, at

the Tlc.

-1 (J h ). All three components are functions of Ta (Figure 1). Note that C, the specific heat capacity for the entire bird, is calculated by multiplying the specific

heat of tissue by body mass. C(dTb/dt) is a time-dependent variable that can be

determined by continuously monitoring Tb at constant Ta, and should not be confused with calculations of total heat storage that are based on steady state

situations. C(dTb/dt) is positive if there is a significant increase in Tb with time.

Metabolic heat production

Metabolic heat production (M) varies with Ta, and for most species, there exists a thermoneutral zone (TNZ) where metabolic rate is minimal and constant over 228 a range of Ta (Figure 1B, Scholander et al. 1950; Calder and King 1974). Below the lower critical temperature (Tlc), metabolism increases in response to decreasing

Ta to maintain a constant Tb. Above the upper critical temperature (Tuc), birds often pant or gular flutter, augmenting their ventilation rate as requirements for evaporative cooling increase, and as a consequence, their metabolic rate increases (Calder and King 1974).

Evaporative heat loss Empirical evidence shows that birds have a relatively constant total evaporative heat loss (E) below the Tlc (Dawson and Bennett 1973; Calder and King 1974; Withers and Williams 1990; Williams et al. 1991b; Weathers 1997), whereas in the TNZ, E gradually increases with increasing Ta. Above the Tuc, where a decreasing potential for dry heat loss and an elevation in metabolic rate combine to form an increasing heat load, E increases rapidly (Figure 1B). Note that E is calculated from TEWL (g water d-1), the sum of respiratory and cutaneous water losses.

Rate of heat gain

The rate of heat gain in or loss from an animal’s body (C(dTb/dt)) is zero inste- ady state situations, where Tb does not change with time. The oft applied assumption of steady state seems valid for measurements in the TNZ, but for those made above the TNZ, where heat stress becomes more severe, C(dTb/dt) may become a significant factor. Although C(dTb/dt) can be quantified by measuring Tb continuously during measurements, most studies assess Tb only after the metabolic trial is completed. In a separate study, we have made measurements of Tb on Crested Larks (Galerida cristata, body mass 33 ± 1.3 g, n=6) during exposure of 3-5 h to constant Tas, a much longer period than most resear- chers use when measuring metabolism at high temperatures. At lower Tas, Tb

-1 BIRDS remained constant, but at 45 °C, Tb increased by 0.5 ± 0.18 °C h . This corresponds to a rate of heat gain of 59 ± 19.9 J h-1 per animal (25% of dry heat pro- OF -1 - duction H at Ta = 45 °C), assuming that the specific heat of tissue is 3.35 J g °C 1 (Calder and King 1974; Schmidt-Nielsen 1984b). Implicit in this calculation is ECONOMY TER the assumption that core Tb equals the average Tb over the bird’s body. While at A W low Tas core Tb is typically higher than the average Tb, at high Tas this difference THE is small (Bartholomew 1982), justifying our assumption that core Tb equals mean IN

Tb.

Although there are no direct measurements of C(dTb/dt) at temperature equali- THERMIA ty (Ta = Tb), there should be no net dry heat transfer between a bird and its envi- HYPER

ronment at this temperature (H = 0), and C(dTb/dt) can be calculated as OF

C(dTb/dt) = M - E. For 22 studies we tested whether steady state conditions were ROLE met by calculating a value for C(dTb/dt) at Ta = Tb, using values or equations for THE

Tb as provided by the individual authors. When plotted as a function of body 229 mass, C(dTb/dt) was positive at Ta = Tb in 19 of 22 studies (Figure 2). If one divides

by the specific heat of tissue, C(dTb/dt) can be converted to the rate of change

in Tb. For these 22 studies, Tb was increasing at an average rate of 2.1 ± 0.67 (SE) °C h-1, a value significantly different from zero (t = 3.18, P < 0.005). This analysis suggests that steady state conditions may have been violated in some of these

studies at high Tas. In future experiments, we recommend that practitioners

continuously monitor Tb when investigating questions concerning heat balance

in birds, especially at higher Tas. The ramifications for the above finding are complex, but one message seems clear: calculations of heat transfer within our

data set can not ignore C(dTb/dt). However, because there are no direct meas-

urements of C(dTb/dt) available, and because we can only estimate C(dTb/dt) at

Ta = Tb, the relationship between C(dTb/dt) and Ta is not known. In our model

we assume, for simplicity, that C(dTb/dt) is a linear function defined by two -1 -1 points: C(dTb/dt) = 0 (J h ) at the Tuc, and C(dTb/dt) = M - E (J h ) at Ta = Tb

(Figure 1B). Continuous measurements of Tb in future metabolism experiments will have to test the validity of this model.

Our analysis of C(dTb/dt) could be criticized because one may argue that net dry

heat transfer is zero at Ta = Tskin, the temperature of the skin surface, and not at

Ta = Tb (Seymour 1972). However, data that relate Tskin to core Tb in heat stressed birds are scarce and most work in this area has focussed on temperatures of the evaporative surfaces in the respiratory tract, which can be 0.9-5.1 °C lower

than core Tb (Schmidt-Nielsen et al. 1969; Lasiewski and Snyder 1969; Seymour 1972). While the temperatures of the evaporative surfaces in the respiratory tract

of the Ostrich were 2.2 °C lower than its core Tb, Tskin equalled Tb during heat

stress (Schmidt-Nielsen et al. 1969). In our analysis of C(dTb/dt), the assumption

230 Figure 2. The rate of heat gain (C(dTb/dt)) of birds at Ta = 45 °C as a function of body mass. that net dry heat transfer is zero at Ta = Tb gives a conservative estimate of

C(dTb/dt). If Tskin were lower than Tb, estimates of C(dTb/dt) = M - E would be larger than at Ta = Tb. For example, if one assumes that dry heat transfer equals zero at Ta = Tskin = Tb - 2 (following Seymour (1972) for the temperature of the respiratory passages) our estimate of C(dTb/dt) would be on average 2.6 times larger than when calculated at Ta = Tb.

Heat balance When a bird is in heat balance the following equation applies (Birkebak 1966; Porter and Gates 1969; McNab 1970; Calder and King 1974; Gates 1980):

M - E - C(dTb/dt) = h(Tb - Ta), (2) in which M, E, C(dTb/dt) and Tb are defined above, and h = dry heat transfer -1 -1 coefficient (J h °C ). Both Tb and h are functions of Ta (Figure 1).

Body temperature

In the TNZ birds have average Tbs of 38.5 ± 0.96 °C (n = 203) during the rest phase and 41.0 ± 0.94 °C (n = 74) during the active phase (Prinzinger et al.

1991). Although these data may suggest that birds maintain their Tb at fairly constant levels in the TNZ, many species showed a marked increase in Tb within and above the TNZ (see also Weathers and Schoenbaechler 1976; Weathers 1981), presumably under steady state conditions (Figure 3). All birds within our data set were hyperthermic at a Ta of 45 °C. Tb was on average 3.3 ± 1.28 °C (n

= 23) higher at Ta = 45 °C than at the Tlc. The degree of hyperthermia was independent of body mass as judged by the slope of a regression through the data -3 -3 2 points (slope = 2.9 x 10 , SEslope = 2 x 10 , r = 0.06, P = 0.3), but we emphasize that our data include birds from 6.4 g to 412 g.

The hypothesis that desert birds increase their Tb above the level of non-desert birds was not supported. Comparison of the mean elevation in Tb at a Ta of 45 °C for desert and non-desert species revealed no difference (t = -0.7, df = 21, P = 0.5). BIRDS OF Dry heat transfer coefficient

The dry heat transfer coefficient is a property of the bird influenced by charac- ECONOMY

teristics of insulation, vasodilation, size, and surface to volume ratios. It includes TER A specific heat transfer coefficients for conduction, radiation and convection, and W is described by rearranging equation (2) to THE IN THERMIA M - E - C(dTb/dt) h = (3) HYPER Tb - Ta OF ROLE THE

231 Figure 3. Tb as a function of Ta in and above the TNZ for 26 species. Some lines have an inflec-

tion point because authors reported two separate functions for Tb versus Ta. Squares represent the lower critical temperature, circles represent the upper critical temperature, and the dotted line

Ta = Tb. If lines do not have symbols for lower or upper critical temperature, original authors did not report these temperatures. Unfilled symbols represent desert species, filled symbols represent non-desert species.

Below the TNZ, h is often assumed to be minimal (but see McNab 1980). As Ta increases within the TNZ, a bird has to dissipate its metabolic heat by dry heat loss over a decreasing thermal gradient. Therefore, intuitively one might expect that the bird would continuously make adjustments in feather erection and blood

supply to the skin, such that h increases to a maximum at Tuc (huc, Figure 1C).

Above Tuc, where the thermal gradient Tb - Ta becomes smaller, the relative importance of h in dissipating heat decreases and evaporative cooling becomes

increasingly important in maintenance of Tb. At Tas above Ta = Tb, where the direction of heat flow is reversed and the bird gains heat from its environment,

one might predict a decrease to minimal h (hlc, Figure 1C). The values reported

for h at Tas above Ta = Tb show considerable variation in all species. Some stu-

dies suggest a decrease to a minimal value (hlc), while in others there is no apparent trend (Dawson and Schmidt-Nielsen 1966; Hinds and Calder 1973; Weathers and Caccamise 1975; Weathers and Schoenbaechler 1976; Dmi’el and Tel Tzur 1985; Withers and Williams 1990). These studies did not take into

account the rate of heat gain C(dTb/dt), which would explain some of the variation in h (see below). 232 Calculations of h near Ta = Tb have been problematical in many studies, because small errors in measurements of the variables in equation (3) can translate into large errors in h. We have shown that C(dTb/dt) is a significant factor at Ta = Tb

(Figure 2). Therefore the error in h should be reduced by including C(dTb/dt) in calculations of the numerator of equation (3), M - E - C(dTb/dt). In a commonly used method to calculate h as (M - E) / (Tb - Ta), the numerator is usually a positive number when Ta = Tb, because C(dTb/dt) is not included. Algebraic rules dictate that in this approach h goes to infinity when Ta approaches Tb, as in the dashed line of Figure 4, a result that seems biologically unrealistic.

At Ta = Tb, h has not been calculated because here both numerator and denominator are zero, a mathematical impediment, not a biological problem. We cau- -1 tion readers that despite heat transfer (J h ) being zero at Ta = Tb, the heat transfer coefficient (J h-1 °C-1), a property of the bird, does not become zero. To calculate h at Ta = Tb, we have applied l’Hôpital’s rule (Apostol 1967), a differentiation technique that provides a polynomial approximation of h when both numerator and denominator are zero. L’Hôpital’s rule assumes that both numerator, [M(Ta) - E(Ta) - C(dTb/dt)(Ta)], and denominator, [Tb(Ta) - Ta], approach zero when Ta approaches Tb. The addendum (Ta) indicates that the given variable (M, E, etc.) is a function of Ta. L’Hôpital’s rule states that if the quotient of the derivatives tends to a finite limit as Ta approaches Tb, the quotient of the functions approaches the same limit:

M(T ) - E(T ) - C(dT /dt)(T ) → a a b a h(Ta = Tb) = lim(Ta Tb) Tb (Ta) - Ta

M’(Ta) - E’(Ta) - C(dTb/dt)’(Ta) → BIRDS = lim(Ta Tb) OF T’b (Ta) - 1 ECONOMY TER A W We applied this technique to our calculations of h at Ta = Tb when there is no THE dry heat transfer and both Tb - Ta and M - E - C(dTb/dt) are zero (Figure 4). IN

Because this is a new method for calculating h at Ta = Tb, we provide an example for our colleagues that may want to duplicate our approach on other species. THERMIA Consider a study of the Black-throated Sparrow in which Weathers (1981) pro- HYPER vides functions that relate Tb, M and E to Ta (Table 1, Figure 4). To establish the OF equation for C(dTb/dt) we determined temperature equality, Ta = Tb = 43.3 °C, ROLE for this species, where net dry heat transfer is zero, and we calculated C(dTb/dt)

-1 THE at this Ta : C(dTb/dt) = M - E = 1368.0 - 1045.1 = 322.9 J h . Fitting a linear 233 -1 -1 Figure 4. The dry heat transfer coefficient (h, in J h °C ) as a function of Ta in (A) the Black- rumped Waxbill, (B) the Black-throated Sparrow and (C) the Monk Parakeet. The grey line

represents h when calculated as M - E / (Tb - Ta), a commonly used approach. The unfilled

squares represent h above the Tuc when calculated with equation (3), see text. The unfilled cir-

cle represents h at Ta = Tb, and is calculated by using l’Hôpital’s rule (see text). The solid line

represents h as a function of Ta above the Tuc.

234 TABLE 1. Heat balance equations and their derivatives for the Black-throated Sparrow -1 o (Weathers 1981). M, E and C(dTb/dt) in J h , Tb in C.

Heat balance equations Derivativesa Temperature

o Tb (Ta) = 31.66 + 0.268 x Ta Tb’ (Ta) = 0.268 For Ta > 29 C o M (Ta) = -2700.4 + 94.0 x Ta M’ (Ta) = 94.0 For Ta > 36.3 C

-3 0.108 -3 0.108Ta o E (Ta) = 22.02 x 10 x 10 x Ta E’ (Ta) = 5.475 x 10 x 10 For Ta > 33.5 C o C(dTb/dt) (Ta) = -1672.6 + 46.1 x Ta C(dTb/dt)’ (Ta) = 46.1 For Ta > 36.3 C

aIf f(x) = c x abx, then f’(x) = c x abx x b x ln a.

function that relates C(dTb/dt) to Ta requires at least 2 values for C(dTb/dt), and for our second value we assume that C(dTb/dt) is zero at Tuc = 36.3 °C. The function relating C(dTb/dt) to Ta is given in Table 1. Equation (3) and the functions for Tb, M, E and C(dTb/dt) given in Table 1 allow one to calculate h at temperatures above Tuc. At Ta = Tb equation (3) is undefined and we have used the derivatives of each function (Table 1) in the previously described method to calculate h at Ta = Tb:

M’(43.3) - E’(43.3) - C(dT /dt)’(43.3) → b h(43.3) = lim(Ta 43.3) Tb (43.3) - 1

94.0 - 259.9 - 46.1 = = 289.6 J h-1 0.268 - 1 BIRDS We have used our method to calculate the pattern of variation in h vs Ta for 22 OF species; all species showed the same trend in h above Ta = Tb. We summarized the results of our calculations in a general model for h (Figure 1C). Apparently, ECONOMY the mostly small birds in our data set do not reduce their dry heat uptake at Tas TER above their Tbs by decreasing h. A W THE IN Thermal gradient The rate of dry heat transfer [h(T - T )] is a linear function of the thermal gra- b a THERMIA dient (Tb - Ta) between a bird and its surroundings if the insulation is held constant. Because heat flows from higher to lower temperatures, hyperthermia incre- HYPER OF ases the dry heat loss if Ta < Tb, and decreases the dry heat uptake if Ta > Tb (Calder and King 1974). ROLE Calder and King (1974) hypothesized that the importance of hyperthermia in THE 235 increasing heat loss or retarding heat gain, is inversely related to body size. The amount of water saved as a result of an improved thermal gradient can be estimated from the rate of dry heat transfer when comparing a bird with a hypothe-

tical normothermic Tb with its actual hyperthermic Tb. We tested the hypothesis of Calder and King (1974) that smaller birds save relatively more water by an

improved thermal gradient by calculating h at Ta = 45 °C for each species. We rearranged equation (2) to

E = M - C(dTb/dt) - h(Tb - Ta), (4)

and assumed that M, C(dTb/dt), and h were constant at this temperature. At 45

°C, Tb is elevated by 0.7 - 5.2 °C above normothermic Tb. In order to examine only the effect of thermal gradient on water savings, we assumed that all species

had a normothermic Tb of 3°C below their actual Tb at 45°C. Then we solved equation (4) for evaporative heat loss of the hypothetical normothermic birds,

Figure 5. A. Water savings (mg h-1, solid line) at 45 °C as a result of an improved thermal gra-

dient for birds that have a standardized elevation in Tb of 3 °C, as a function of body mass (symbols as in figure 3). TEWL (mg h-1) at 45 °C is represented by the dotted line. B. Water savings (mg, dashed line) at 45 °C as a function of body mass for birds that have a standardized eleva-

tion in Tb of 3°C. The solid line represents the increased respiratory evaporative water loss -1 (REWL) (mg h ) at a Ta of 45 °C as a result of a 3 °C increase in Tb. The dotted line represents TEWL (mg h-1) at 45 °C. 236 En. The difference between the measured hyperthermic evaporative heat loss Eh and En, yielded the maximal amount of water saved by the 3 °C elevation in Tb at 45 °C (Appendix A contains all the variables that we used).

At a Ta of 45 °C water savings as a result of an improved thermal gradient varied with body mass: log water saved (mg h-1) = 1.98 + 0.47 log mass (g) (5) 2 (SEslope = 0.092, n = 22, r = 0.57) (Figure 5A). The analysis supports the hypothesis that as a result of the improved thermal gradient, smaller species save more water relative to body mass than do larger species when hyperthermic.

An expression for TEWL at a Ta of 45 °C as a function of body mass has not been published. To compare our calculations of water savings to TEWL, we first regressed TEWL at a Ta of 45 °C against body mass: log TEWL (mg h-1) = 2.13 + 0.56 log mass (g) (6) 2 (SEslope = 0.061, n = 28, r = 0.77) (Figure 5A). The similarity of slopes for the equations (5) and (6) (t = 1.21, df = 46, 0.20 < P < 0.50) suggests that water saved as a result of an improved thermal gradient is a constant proportion of

TEWL at Ta = 45 °C, independent of body mass.

Heat storage Another contribution of hyperthermia to water savings occurs when heat is temporarily stored in body tissues during bouts of high Ta, and later passively dissipated by non-evaporative means when Tas have become more favorable (Schmidt-Nielsen 1964; Dawson and Bartholomew 1968; Calder and King 1974). The amount of water that is saved depends on the specific heat of tissue (Calder and King 1974), heat of vaporization of water (1 mg water = 2.426 J, Schmidt-Nielsen 1984b), the difference between hyperthermic and normothermic Tb, and body mass. These variables allow one to calculate the theoretical maximum savings of water assuming that all the heat stored is subsequently lost by non-evaporative avenues. The amount of water saved (heat stored) is inde- BIRDS OF pendent of the duration of the hyperthermic state. Based on allometric equations for heat storage and resting metabolism, Calder and King (1974) hypothesized that the significance of heat storage in the water ECONOMY TER A economy of birds increased with body size. Our analysis supports this hypothesis. W

When we standardized the elevation in Tb as 3 °C, water savings as a result of THE IN heat storage at a Ta of 45 °C varied proportionally with body mass (Figure 5B): log water saved (mg) = 0.62 + 1.0 log mass (g). (7) The unity of the slope indicates that mass-specific water savings as a result of THERMIA

heat storage does not vary with body size. However, equation (7) had a signifi- HYPER cantly higher slope than equation (6) that relates TEWL and body mass (t = 7.2, OF

df = 52, P < 0.001), indicating that larger species save a larger proportion of their ROLE

TEWL by heat storage than do smaller species. THE

237 Q10-effect

Within the TNZ, some species increase their Tb as Ta increases without a con-

comitant increase in metabolic heat production. This apparent lack of a Q10- effect has been proposed as a factor that contributes to the water economy of

hyperthermic birds (Weathers and Schoenbaechler 1976; Weathers 1981). Q10 describes the effect of temperature on chemical reaction rates and typically varies between 2 and 3 for biochemical reactions (Schmidt-Nielsen 1984b). Weathers

and Schoenbaechler (1976) suggested that if Q10 = 2.5, one might expect oxy-

gen consumption to increase in the TNZ when Tb increases (as in Figure 3). The absence of an increase in oxygen consumption was predicted to contribute to a lower TEWL because (1) the reduced metabolic heat production requires dissipation of a smaller quantity of heat, and (2) the increase in respiratory water loss, that would have been associated with an increase in ventilation if oxygen consumption had increased, does not occur (Weathers and Schoenbaechler 1976).

We question whether one should expect small changes in Tb to alter metabolic rate, a complex phenomenon regulated by numerous factors in endothermic

birds. Q10 has traditionally been used in studies on ectothermic or poikilothermic

animals under experimental conditions where changes in Tb coincide with, and

are predictable from, changes in Ta (Snyder and Nestler 1990). In contrast to

ectotherms, the Tb of endotherms is the result of regulatory processes for heat loss and heat production that are still poorly understood. Several authors have shown

that apparent Q10s in mammals and birds undergoing hibernation or daily torpor are artifacts produced by changes in the heat transfer coefficient (Snyder and Nestler 1990), the thermal gradient (Heldmaier and Ruf 1992), or both, and have no relevance to the metabolic state of the animal (Snyder and Nestler 1990; Heldmaier and Ruf 1992). Active thermoregulatory control of metabolic rate of birds in the TNZ implies that there is no a priori reason to assume that metabolic rate is governed by passive temperature effects. The laws of thermo- dynamics remain valid for single biochemical processes in endotherm tissues, but the integrated control of an endotherm overrides direct temperature effects.

Therefore we do not expect metabolic rate to increase when Tb increases in the

TNZ in birds. As a result we do not regard Q10 as a factor of hyperthermia that is involved in water savings of birds within the TNZ.

Respiratory variables: temperatures and volume of the exhaled air In the previous sections our analysis supported the idea that hyperthermia can save water by means of an improved thermal gradient and heat storage. However, changes in respiratory variables that accompany the transition from normother- mia to hyperthermia in birds may impact their water economy negatively. An

elevation in the temperature of the exhaled air (Tex), which increases the air’s

capacity to carry water vapor, and an increase in minute volume (VI), which 238 enlarges the total volume of exhaled air, combine to increase respiratory evaporative water loss (REWL) in hyperthermic birds compared to normothermic birds. We used the available data on respiratory variables, that are usually reported in relation to gas exchange within the lungs, and a few simplifying assumptions to predict REWL in hyperthermic and normothermic birds at a Ta of 45 °C.

Though birds do not typically remain normothermic at a Ta of 45 °C, we used these hypothetical values as a baseline for comparison. Few studies have focussed on the relationship between Tb, REWL and respiratory variables, such as tidal volume, ventilation frequency and Tex. Therefore, we emphasize that the results presented here are based on few data. Our aim is to encourage future work in this field.

Most birds experiencing Tas below 35 °C exhale air at a temperature linearly related to, but consistently greater than, the temperature of the inhaled air (Schmidt-Nielsen et al. 1970; Kaiser and Bucher 1985; Withers and Williams

1990). At Tas around 35 °C, the upper limit of current data, Tex and Ta converge.

In our calculations at a Ta of 45 °C, we assumed that both hyperthermic (Tb = 44

°C) and normothermic (Tb = 41 °C) birds exhaled air that was evaporatively cooled 2 °C below Tb to Texs of 42 °C and 39 °C, respectively. The assumption that exhaled air is saturated with water vapor is commonly applied in studies of respiratory water loss (Schmidt-Nielsen et al. 1970; Withers and Williams 1990; but see Withers et al. 1981). We calculated the saturation ρ -3 ρ -4 point (g water m ) = H2O / [4.62 x 10 x (Tex + 273)] (Campbell 1977) to be 48.50 g m-3 for normothermic birds and 56.34 g m-3 for hyperthermic birds, using ρ values for water vapor pressure H2O in saturated air (List 1971). -1 VI (ml min ) is determined by the product of breathing frequency and tidal volume. Based on 22 species, Maloney and Dawson (1994) determined an allo- -1 metric equation for VI (ml min ) of resting birds, presumably with normothermic

Tbs: BIRDS

log VI = 0.38 + 0.69 log mass (g). (8) OF

Calder and King (1974) reported an equation for VI of heat-stressed, presumably

hyperthermic, panting birds (n = 5): ECONOMY

log VI = 0.57 + 0.85 log mass (g). (9) TER A W We have multiplied equation (8) by the water vapor content of saturated air (Tex

-1 THE = 39 °C) to obtain REWL (mg water h ) of normothermic birds (Tb = 41 °C) at IN a Ta of 45 °C as a function of body mass:

log REWLnormothermic = 0.84 + 0.69 log mass (g). (10) THERMIA

To estimate REWL of hyperthermic birds at a Ta of 45 °C, we have multiplied equation (9) by the water vapor content of saturated air at 42 °C, to obtain the HYPER OF equation: ROLE log REWLhyperthermic = 1.10 + 0.85 log mass (g). (11) The increased REWL as a result of hyperthermia was given by the difference THE 239 between the equations (10) and (11): -1 log REWLincreased (mg h )= 0.83 + 0.91 log mass (g). (12) Changes in respiratory variables resulted in a higher mass-specific increase in REWL for smaller birds when they became hyperthermic than for larger birds as

suggested by the slope < 1. However, at a Ta of 45 °C, the increased REWL represents a larger proportion of their TEWL (equation 6) for larger birds than for smaller birds (Figure 5B).

Discussion Net effect of hyperthermia: all factors combined In this review, we have partitioned the effects of hyperthermia on water loss into categories of an improved thermal gradient, of heat storage, and of altered respiratory variables, and we have generated allometric equations that describe the effect of each category on water loss. The first two categories tend to reduce TEWL, the latter augments REWL. In order to assess the net effect of hyperthermia, we summed the contributions of each category to examine the net water

savings for a hypothetical 10, 100 and 1000 g bird. As before, we assumed a Tb

of 41 °C for a normothermic and 44 °C for a hyperthermic bird, and a Ta of 45 °C. Further we compared the net water savings for birds that were hyperthermic for 1 and 5 hours, the latter period representing a maximal exposure to heat stress that birds might experience in nature on a given day. For a hyperthermic bout of 1 h, our calculations reveal that net water savings for all three body sizes is positive (Table 2). Whereas, for a hyperthermic bout of 5 h, our analyses predict that

TABLE 2. The net effect of hyperthermia on the water balance of 10, 100 and 1000 g hypothetical birds, that were hyperthermic during periods of 1 h and of 5 h. Calculations are based on an o o increase in Tb from 41 to 44 C at Ta of 45 C.

Bird mass Improved thermal Heat storage Increased REWL Net savings TEWL gradient (g) (g water)1 (g water)2 (g water)3 (g water) (g water)4

1 hour 10 0.28 0.04 -0.05 0.27 0.49 100 0.83 0.42 -0.46 0.79 1.78 1000 2.45 4.16 -3.63 2.98 6.46

5 hours 10 1.41 0.04 -0.27 1.18 2.45 100 4.16 0.42 -2.31 2.27 8.89 1000 12.27 4.16 -18.18 -1.75 32.28

1 Savings by improved thermal gradient calculated from equation (5). 2 Savings by heat storage calculated from equation (7). 3 Costs of increased REWL gradient calculated from equation (12). 4 Total evaporative water loss at 45 °C calculated from equation (6). 240 large birds actually lose more water by becoming hyperthermic than they would if they remained normothermic. In order to make interspecific comparisons we have standardized net water savings due to hyperthermia by expressing these savings relative to TEWL at the same Ta and for the same three hypothetical bird sizes (Figure 6). During a hyperthermic bout of 1 h, all three bird sizes saved an amount of water equal to around 50% of their TEWL (Figure 6A). If these same sized birds are hyperthermic for a period of 5 h, the amount of water saved as a proportion of TEWL was inversely related to body mass (Figure 6B). During 5 h of hyperthermia, larger birds are predicted to lose more water than they would if they maintained their Tb at normothermic levels. This finding is the result of the decreased contribution of heat storage to the net water savings. Heat storage is independent of time, and its positive contribution to water savings is averaged over the duration of the hyperthermic bout, whereas the negative contribution to water savings of the altered respiratory variables, and the positive contribution to water savings of the impro- BIRDS OF ECONOMY TER A W THE IN THERMIA Figure 6. A. The relative contributions of the improved thermal gradient, heat storage, and HYPER

increased REWL to the total effect of hyperthermia on the water balance of various sizes of birds, OF when the duration of the hyperthermic state is 1 h. B. The relative contributions of the same ROLE variables to the total effect of hyperthermia on the water balance of various sizes of birds, when THE

the duration of the hyperthermic state is 5 h. 241 ved thermal gradient are dependent on the duration of the hyperthermic bout. Our calculations indicate that smaller birds that are hyperthermic for periods up to at least 5 h save water as a net result of hyperthermia, whereas larger birds only save water as a result of hyperthermia when the hyperthermic bout is short, and actually increase their TEWL when they are hyperthermic for longer periods.

These results suggest the hypothesis that large birds should maintain their Tb at

or near normothermic levels at high Tas. In support of this hypothesis, the

Ostrich (100 kg, Struthio camelus), maintained a normothermic Tb during expos-

ure to a Ta of 51 °C for a period of 7.5 h (Crawford and Schmidt-Nielsen 1967).

TEWL at 45 °C versus 25 °C

This paper contains the first equation that relates TEWL at a Ta of 45 °C to body

mass. Williams (1996) presented an allometric equation for TEWL at a Ta of 25 °C, based on a phylogenetic analysis of 102 bird species from both arid and mesic environments, that were measured in the laboratory. Comparison of TEWL at

Tas of 25 °C and of 45 °C (equation (6)), reveals that smaller birds augment their

TEWL by a larger factor than do larger birds in response to high Tas. A 10 g bird

increases its TEWL at a Ta of 45 °C by as much as 8 times, whereas a 100 kg bird,

the size of an Ostrich, increases its TEWL less than 3 times when Ta increases from 25 °C to 45 °C. Larger birds have a smaller surface to volume ratio, which reduces the mass-specific heat load from the environment, and a lower mass-specific metabolic rate, which reduce the internal heat load. A smaller mass-specific total heat load requires less evaporative cooling and can result in lower TEWL rates.

Summary and prospectus In this paper we reviewed the variation in hyperthermia in desert and non-desert birds, and we attempted to assess the role of hyperthermia in the water economy of desert species. Within our data set, there existed no evidence that the degree

of hyperthermia at a Ta of 45 °C differed between desert and non-desert birds.

Our search of the literature has revealed that precious few data exist on Tbs at

high Tas, especially for mesic species, and more data are needed. In order to assess the role of hyperthermia in the water economy of desert birds, we evaluated the contributions of an improved thermal gradient, of heat storage and of altered respiratory variables to the net water savings. The contribution of the improved thermal gradient can be estimated from the complete heat ba-

lance of a bird. We have shown that at Ta = Tb the rate of heat gain, C(dTb/dt), is a significant factor, and should be incorporated in the heat balance equation

at high Tas. Therefore, during metabolic measurements at high Tas, continuous

measurements of Tb are of critical importance to our understanding of the heat

balance of birds at high Tas. Furthermore, at the Tas where C(dTb/dt) is a signi-

242 ficant factor, Tb is continuously increasing, and is likely to influence metabolism and evaporation. The contribution of the altered respiratory variables to the net effect of hyperthermia on the water economy of birds, as discussed in this paper, should be viewed in light of the scarcity of data on the relationship between respiratory variables and REWL. First, the allometric equations for minute volumes of resting and panting birds (equations (8) and (9)), are based on sample sizes of 22 and 5 birds, respectively. An extension of these data sets and a re-evaluation of the allometric equations would be welcome. Second, respiratory variables are usually reported in relation to Ta, whereas to understand their effect on REWL in hyperthermic birds, respiratory variables should be related to Tb and to REWL. Third, we found few data on Tex at high Ta. More measurements on Tex, especially at Tas close to and above Ta = Tb are necessary to gain understanding how respiration at high

Tas affects water loss. Hyperthermia not only impacts the water economy of birds, but also a suite of other factors; energy balance (Seymour 1972), protein stability, and tissue- functioning (Marder et al. 1989). This implies that an elevated Tb may be the result of an optimization process in which the optimal Tb is the result of simultaneously minimizing water loss, energy expenditure and protein damage. Insights in the latter two factors are poor, and future work is desired to come to an integrated understanding of the role of hyperthermia in birds.

Acknowledgments We thank W. Weathers for providing original data, and G. Bakken for stimulating discussions about heat transfer. Discussions with F. Weissing helped our understanding of l’Hôpital’s rule. The paper was improved by comments from W. Weathers, G. Bakken, S. Daan and two anonymous reviewers on previous ver- sions of the manuscript. Financial support was provided by the Stichting BIRDS

Groninger Universiteitsfonds to B.I.T. and by the Ohio State University to OF J.B.W. ECONOMY TER A W THE IN THERMIA HYPER OF ROLE THE

243 Source Frumkin et al. 1986 Frumkin et al. 1986 Weathers 1981 Weathers 1981 Calder and Schmidt-Nielsen 1966 Weathers and Schoenbaechler 1976 Weathers and Caccamise 1975 Bartholomew et al. 1962 Calder and Schmidt-Nielsen ‘66, ‘67 Withers and Williams 1990 Dawson and Bennett 1973 Schleucher et al. 1991 Lasiewski and Seymour 1972, MacMillen and Trost 1967 Hinsley 1992, Thomas and Maclean 1981 Dmi'el and Tel-Tzur 1985 Dmi'el and Tel-Tzur 1985 Williams, unpublished data Trost 1972 Cade et al. 1965 Cade et al. 1965 Willoughby 1969 Weathers 1981, et al. 1980 (˚C) b 43.8 43.4 41.5 43.5 44.6 42.7 42.8 43.3 41.1 41.5 42.6 42.8 42.7 45.4 43.6 45.8 44.1 45 42 44.5 44.2 43 T y heat transfer coefficient (h), and body om the equations or values in original ) -1 ˚C /dt), dr b -1 615 925 947 496 323 829 948 797 259 394 191 152 221 103 1344 1439 h (J e calculated fr ar ) b -1 0 65 /dt (J h 358 549 395 142 399 363 218 210 b -129 -357 3316 1184 3186 -1094 CdT ) -1 944 6899 7993 6313 9534 4766 7582 3104 2627 4308 1557 3272 2737 1306 1899 6788 2887 1907 1394 1009 2995 11414 E (J h ) -1 683 850 9478 5259 3739 6917 9539 2634 7232 2220 4263 1519 1725 1160 1408 7083 2597 1551 1501 1137 2089 M (J h onments. Body mass, M, E, and T . 6.4 33.7 80.4 40 89 82.3 34.4 40.4 83 27.3 26 11.5 10.9 26.8 172 412 100.6 125.5 284.7 314.6 196.7 123 body mass (g) b y oduction (M), total evaporative heat loss (E), rate of gain (CdT d d n d d d n d n d d d n d d n d d n d d n categor om desert and non-desert envir ds fr nianus

ocles bicinctus

oglodytes

Pter

e calculated as described in this paper nix C of bir o ochlamys

dix heyi ouse ythr Estrilda tr Lonchura malabarica nus vulgaris

Geococcys califor nix cotur Onychognatus tristrami Phalaenoptilus nuttallii Stur ) at 45 Body mass, metabolic heat pr b Geophaps plumifera Geophaps plumifera axbill Ammoper Cotur Myiopsitta monachus Geopelia cuneata Callipepla gambelii Carpodacus cassinii emophila alpestris will

/dt and h ar dafella inca unner thilauda er Columba livia b Er aeniopygia guttata

e (T Melopsittacus undulatus T Cer Scar oated Munia tridge

a Alectoris chukar ygar umped W ned Lark eater Roadr ristram's Starling temperatur APPENDIX A. Species Sand Par Chukar Common Quail Gambel's Quail Gr Budger Monk parakeet Common Poor Rock Pigeon Spinifex Pigeon Spinifex Pigeon Diamond Dove Inca Dove Double-banded Sandgr T Common Starling Dune Lark Hor Black-r Zebra Finch White-thr Cassin's Finch 244 papers. CdT Source Weathers 1981 Weathers 1981 Weathers 1997 Weathers 1981 Hinds and Calder 1973 Hinds and Calder 1973 (˚C) b 44.6 43.7 44.4 44.2 43.8 43.7 T ) -1 ˚C -1 666 360 236 316 401 1728 h (J ) -1 /dt (J h 125 401 160 471 390 159 b CdT ) -1 1924 1595 1142 4735 2354 2136 E (J h ) -1 1782 1528 1160 3823 2364 1773 M (J h 20.4 11.6 10.5 46.3 41.3 32 BIRDS body mass (g) OF b y d d n n n d oe (1990). categor ECONOMY TER A W THE IN t.

Amphispiza bilineata

ophila aurita THERMIA Agelaius phoeniceus ding to Sibley and Monr ow d dinalis r Spor Continued. HYPER

dinalis sinuatus OF Carpodacus mexicanus

Car dinalis car t, n = non deser

oated Spar Car ROLE a huloxia THE dinal r ariable seedeater d = deser Species names accor

APPENDIX A. Species House Finch Black-thr V Red-winged Blackbir Car Pyr a b 245

CHAPTER 12 Physiological responses of Houbara Bustards to high ambient temperatures

B. Irene Tieleman, Joseph B. Williams, Frédéric Lacroix, and Patrick Paillat Journal of Experimental Biology 205: 503-511. 2002. ABSTRACT Desert birds often experience scarcity of drinking water and food, and must survive episodes of

high ambient temperatures (Ta). Physiological mechanisms that promote survival during exten-

ded periods of high Ta have received little attention. We investigated the physiological responses of wild-caught and captive-reared Houbara

Bustards to Tas ranging from <0 to 55 °C, well above those in most studies of birds. Captive- reared Houbara Bustards (1245 g) in summer have a resting metabolic rate (RMR) of 261.4 kJ day-1, 26% below allometric predictions, and a total evaporative water loss (TEWL) at 25 °C of

-1 25.8 g day , 31% below predictions. When Ta

exceeded body temperature (Tb) the dry heat transfer coefficient decreased, a finding in support of the prediction that birds should minimize

dry heat gain from the environment at high Tas.

Houbara Bustards withstand high Tas without

becoming hyperthermic; at 45 °C, Tb was on average 0.9 °C higher than at 25 °C. RMR and TEWL of captive-bred Houbara Bustards were 23% and 46% higher in winter than in summer, respectively. Captive-reared Houbara Bustards had a 17% lower RMR and a 28% lower TEWL than wild-born birds with similar genetic backgrounds. Differences in body composition between wild-caught and captive-reared birds were correlated to differences in physiological performance.

ABSTRACT Introduction Birds that occupy arid regions often experience lack of drinking water and limited food supplies, and must survive episodes of high ambient temperatures (Ta); shade temperatures can exceed 50 °C in some deserts. Physiological adjustments that reduce water loss and energy expenditure in free-living desert birds include low rates of total evaporative water loss (TEWL) (Williams 1996) and basal metabolism (BMR) (Dawson 1984; Tieleman and Williams 2000; Williams and Tieleman 2001). Although anecdotal evidence suggests that extremes of heat can be a major source of mortality in some populations (Serventy 1971), physiological mechanisms that promote survival during extended periods of high Tas have received little attention.

When exposed to high Tas, most birds elevate their TEWL, sometimes by two orders of magnitude, to maintain body temperature (Tb) below lethal limits (Calder and King 1974; Dawson 1984). Without replenishment of lost body water, defense of Tb by evaporative cooling can not be sustained for long periods because of the associated changes in physiological function with dehydration.

Presumably to reduce dependency on evaporative cooling, Tbs of many birds are elevated by 2-4 °C when exposed to high Tas, called hyperthermia (Calder and King 1974; Weathers 1981; Dawson 1984; Tieleman and Williams 1999). Using water as a currency, Tieleman and Williams (1999) modeled the costs and benefits of hyperthermia, and showed that small birds reduced TEWL when hyperthermic, but that larger species lost more water if they became hyperthermic during chronic heat stress (5 h) than if they maintained normothermic Tb. This latter finding was attributable primarily to an increased minute volume and a higher saturation vapor density in the lungs at higher Tb.

At high Tas, birds should minimize heat gain from their environment, a parameter quantified as h (Tb - Ta), where Tb - Ta is the gradient between the bird and the environment, and h is the dry heat transfer coefficient (Dawson and

Schmidt-Nielsen 1966; Hinds and Calder 1973; Weathers and Caccamise 1975; TURES Tieleman and Williams 1999). Influenced by characteristics of feather insulation, skin vasodilation, and surface to volume ratios, h is a complex variable that TEMPERA combines heat transfer coefficients for conduction, convection and radiation HIGH (Calder and King 1974). Minimal below the thermal neutral zone, h should TO increase to a maximum when Ta approaches Tb, whereas at Tas above Tb, where ARDS UST heat flow is reversed, h should return to lower values (Dawson and Schmidt- B Nielsen 1966, Hinds and Calder 1973, Frumkin et al. 1986, Tieleman and

Williams 1999). A review of studies on 22 species failed to support this predic- OUBARA H

tion, but conclusions were tentative because previous workers had not conti- OF nuously measured Tb, and therefore had not accounted for heat gain in body tissues in their calculations, and few studies have examined thermoregulation at Tas exceeding 45 °C (Tieleman and Williams 1999). RESPONSES 249 To minimize the need for evaporative cooling at high Tas birds could also reduce their heat production. One could predict that birds from hot deserts benefit

especially from a low BMR during summer, when Tas are high. Seasonal variation in BMR has been observed in several temperate-zone birds: some species elevate BMR in winter compared to summer (Pohl and West 1973; Cooper and Swanson 1994), and others show the opposite pattern (Kendeigh 1969; Barnett 1970) or no seasonal differences (O'Connor 1995). Houbara bustards (Chlamydotis undulata) inhabit semi-arid and arid areas from Asia through the Middle East westward across North Africa (Cramp 1988). Although traditionally three subspecies have been recognized, Gaucher et al. (1996) proposed that the subspecies C. u. macqueenii, which occurs in the Arabian peninsula and northward into Mongolia, should be regarded as a distinct species. In Arabia, C. macqueenii have declined in numbers over the past decades due to overhunting and habitat degradation (Seddon et al. 1995). A captive breeding program, sponsored by the National Commission for Wildlife Conservation and Development, Saudi Arabia, now exists for the purpose of reintroducing this species into its former habitat. To achieve this goal, attention has been devoted to the genetic composition of released birds assuring that genotypes resemble wild stocks (Seddon et al. 1995). However, genetic similarity of reintroduced individuals does not ensure that released birds bear the same phenotype as wild-born birds because of the potential for accrual of ontogenetic differences during the captive-rearing process. Because birds in Arabia are often

exposed to Tas that exceed 50 °C, one might imagine that an alteration in phenotype as a result of captive-rearing could carry survival costs, especially if physiological function of captive-reared individuals is compromised compared with wild types. We investigated the physiological responses of wild-caught and captive-reared

Houbara Bustards to Tas ranging from <0 to 55 °C, the latter Ta well above those in most studies of birds (Marder and Arieli 1988). In addition to documenting seasonal changes in physiological function, we tested the predictions that

Houbara Bustards minimize dry heat transfer at Tas exceeding Tb, and that birds >1 kg do not use hyperthermia as a strategy to reduce evaporative water loss

during chronic exposure to high Tas (Tieleman and Williams 1999). We provide evidence that captive-rearing, as it is now practiced, alters the physiological phenotype of Houbara Bustards. We explored whether differences in body composition of wild-caught and captive-reared Houbara Bustards could account for the observed differences in physiological performance between groups.

250 Material and Methods Animals For metabolism trials during summer, we used captive-reared Houbara Bustards from the National Wildlife Research Center, Taif, Saudi Arabia. The founders of the captive breeding program originated from Pakistan, and are genetically indistinguishable from current populations in Saudi Arabia (Seddon et al. 1995). The birds were housed separately in outdoor cages (4 x 4 x 2 m), and provided daily with water ad libitum, mealworms, crickets, fresh alfalfa, and commercially pre- pared pellets. The body mass averaged 1462 ± 113 g (1 SD) for 7 males and 1013 ± 40 g for 8 females, values which differed significantly (t = 11.1, P < 0.001). We measured 6 or 7 birds at each Ta, equally divided between males and females. Measurements made on separate groups of birds during the day and night were performed during September 1997 after birds had molted. During the winter of 1999, we obtained 16 wild-caught Houbara Bustards from Afghanistan. Birds were transported to the National Wildlife Research Center, housed in outdoor cages, and provided with the same food as captive-reared birds. We allowed 6 weeks for wild birds to acclimate to their environment before measurements were made. Body masses of 8 captive-reared birds averaged 1248 ± 206 g, and of 8 wild-born individuals 1323 ± 257 g.

Measurements of TEWL and oxygen consumption A 113-liter metabolic chamber was constructed from steel plate with a flat black interior (Porter 1969), and surrounded with an insulated water jacket. A rubber gasket rendered the plexiglass lid air-tight when bolted shut. We covered the lid during measurements so that the inside of the chamber was dark. Birds were placed in the chamber on wire mesh above mineral oil that trapped excrement.

A Neslab RTE -140 water bath controlled chamber Ta to within ± 0.1 °C. To maintain Tas below 5°C we placed the chamber in a freezer in addition to the Neslab cooler.

Rates of TEWL and oxygen consumption (VO2) were determined for birds that TURES had been without food 3 h prior to measurement. An air compressor pushed air through two drying columns filled with Drierite, through a mass flow controller TEMPERA

(Brooks model 5851E), calibrated with a 5-l bubblemeter (Levy 1964), and then HIGH into the metabolic chamber. We varied the flow rate between 5.3 and 10.4 l TO -1

min , depending on Ta, to maintain relative humidity in the metabolic chamber ARDS below 22%. Subsamples of excurrent air passed through a dewpoint hygrometer UST B (General Eastern model Hygro M4), and through columns of silica gel, ascarite

and silica gel, before passing through an O2-analyzer (Applied Electrochemistry OUBARA model S-3AII), the latter calibrated with dry CO -free air. We monitored dew- H

2 OF point and O2-concentration of the excurrent air continuously with a Campbell CR10 data logger and PC208W software. Visual inspection of our results allowed us to determine when steady state conditions were achieved. Birds remained in RESPONSES 251 the chamber for 3 hours, before we averaged dewpoint and O2-concentration of the excurrent air stream over a 20 minute period. Water vapor density of the incurrent and excurrent air, and TEWL were calculated following Williams and

Tieleman (2000). We calculated VO2 with equation 4 of Hill (1972). In summer

(September), we performed metabolic trials during day at Tas ranging from 0 °C to 55 °C, and during night at 0 °C, 25 °C and 45 °C on captive-reared bird. In winter (December), we measured captive-reared and wild-born birds at 35 °C and 50 °C during the day. Body mass was determined before and after metabolic trials using a Philips top loading balance (model HR 2385/A) to ±1 g.

Body temperature

During each measurement we recorded Tb of birds continuously with a 36-gauge thermocouple surrounded by a protective cotton swab that was inserted 5-8 cm in the cloaca. We affixed the thermocouple wire to the tail feathers with a plastic tie to assure that it remained in place. The thermocouple was calibrated against a standard mercury in glass thermometer (Taylor) with a certificate of calibration traceable to the N.I.S.T.

If there was a change in Tb during a measurement, we calculated the rate of heat -1 -1 storage as CdTb/dt (J h ). Here, C is the specific heat of the bird (J °C ), and -1 dTb/dt is the change in Tb with time (°C h ). We calculated C from body mass and the specific heat of tissue (3.35 J g-1 °C-1) (Calder and King 1974; Schmidt-

Nielsen 1984b), and dTb/dt from the slope of a regression through data for Tb for the final 60 minutes of the 3-h trial.

Dry heat transfer coefficient

We calculated the dry heat transfer coefficient (h) as (M-E-CdTb/dt)/(Tb-Ta)

(Birkebak 1966; Porter and Gates 1969). At Tas near Tb calculations of h are problematic because small errors in measurements of variables can translate into

large errors in h. Therefore we used l’Hôpital’s rule to calculate h at Ta = Tb (Tieleman and Williams 1999). For each bird we fitted lines through metabo-

lism, TEWL, Tb and CdTb/dt as functions of Ta to calculate h at Ta = Tb (Tieleman and Williams 1999).

Organ size After measurement of their metabolism in winter, we sacrificed 6 captive-bred and 6 wild Houbara Bustards and dissected out their brain, proventriculus, stomach, heart, intestine, liver, kidney, left pectoral muscle (including supracori- coidus), thyroids, spleen and gonads. Organs were dried 3 days at 75°C before we measured dry mass with an electronic balance to ± 1 mg (Sauter RE 164).

Statistical analysis Although we used individuals from the same group of 16 birds for the measure- 252 ments during the summer, we did not obtain measurements of each individual at each Ta, and therefore could not use a repeated measures model in our analyses. Some individuals lost more than 100 g even though we only handled them every third day, and we deemed it prudent not to cause additional stress in these birds. Hence, we treated each data point as independent and performed analyses of covariance with body mass as a covariate. We tested for significant interactions of the main factors with the covariate in all cases, but report only those that were significant. To analyze the differences between summer and winter data of captive-reared Houbara, and between captive-reared and wild-born birds during winter, we performed separate analyses of covariance with body mass as covariate and group as fixed factor for Tas of 35 °C and 50 °C. When group had a significant effect, we used contrast analyses of the type repeated as post hoc tests. Proportions were arcsine square root transformed before applying parametric statistics (Zar 1996). In making simultaneous multiple comparisons we used a sequential Bonferroni correction, to avoid an increase in the probability of a Type I error (Rice 1989). All statistical analyses were performed using SPSS (1999). Values are presented as means ± 1 SD, unless noted otherwise.

Results Captive-reared Houbara Bustards in summer The metabolic rate of captive-reared Houbara Bustards during summer can be -1 2 described as MR (kJ day ) = 682.3 - 14.76 Ta (°C) (r = 0.80, F1, 22 = 85.1, P <

0.001) at Tas below the thermoneutral zone (Figure 1A). From 29 °C to 56 °C, resting metabolic rate (RMR) remained constant averaging 261.4 ± 36.8 kJ day-1 (n = 32). The intersection between the previous equation and RMR provided an estimate of the lower critical temperature (Tlc), 28.5 °C. Metabolic rate at 25 °C

and 45°C did not differ between day and night or between the two Tas (day- TURES night: F1, 21 = 1.97, P = 0.18; Ta: F1, 21 = 1.28, P = 0.27).

Below 35 °C, TEWL varied little with Ta, while above 35 °C TEWL increased TEMPERA rapidly (Figure 1B). At 25 °C, TEWL equaled 25.1 ± 6.9 g day-1 during day-time HIGH -1 and 26.5 ± 6.6 g day during the night, whereas at 45 °C, TEWL was 129.0 ± TO 20.3 g day-1 during the day and 151.7 ± 33.9 g day-1 at night. We detected no sig- ARDS

nificant differences in TEWL between day and night (F1, 21 = 2.15, P = 0.16), but UST B found that TEWL was significantly higher at 45 °C than at 25 °C (F1, 21 = 229.9, P < 0.001). OUBARA H Body temperatures varied between 39.2 °C and 42.5 °C at Tas ranging from -1.9 OF

°C to 55.2 °C (Figure 1C). During the day Tb equaled 40.4 ± 0.5 °C (n = 6) at

Ta = 25 °C and 41.6 ± 0.6 °C (n = 6) at Ta = 45 °C, while at night Tbs were 40.1

± 0.2 °C (n = 6) and 40.8 ± 1.0 °C (n = 7) at the same Tas, respectively. When RESPONSES

253 Figure 1. Metabolic rate, total evaporative water loss and body temperature of captive-reared Houbara Bustards during summer.

we tested for differences in Tb between day and night, and between Tas of 25 °C

and 45 °C, analyses revealed that Tb was 0.6 ± 0.26 °C (SE) lower during the

night (F1, 21 = 4.54, P = 0.045), and that Tb was 0.9 ± 0.27 °C (SE) lower at 25

°C (F1, 21 = 12.5, P = 0.002). -1 At a given Ta, changes in Tb with time were generally less than 0.5°C h , even

at high Tas (Figure 2A). The difference in dTb/dt between day and night was not 254 Figure 2. Change in body temperature (dTb/dt) and dry heat transfer coefficient (h) of captive- reared Houbara Bustards during summer. Line in lower panel connects the average h at each Ta.

significant (F1, 21 = 2.57, P= 0.12), but dTb/dt was significantly higher at 45 °C than at 25 °C (F1, 21 = 5.16, P = 0.034). Combining day and night measurements, -1 -1 dTb/dt averaged 0.16 ± 0.41 °C h (n = 13) at 45 °C and -0.04 ± 0.32 °C h (n

= 12) at 25 °C. Although these average values of dTb/dt differed from each other, TURES neither of them was significantly different from zero (Ta = 25 °C: t = -0.44, P =

0.67; Ta = 45 °C, t = 1.4, P = 0.18). TEMPERA The dry heat transfer coefficient (h) had a minimal value of 16.8 ± 3.2 kJ day-1 °C-1 or 1.60 ± 0.26 W °C-1 m-2 (n = 24) below the thermoneutral zone, increased HIGH TO gradually to a maximum of 34.6 ± 3.2 kJ day-1 °C-1 (n = 6) at 35 °C, and then decreased to 24.4 ± 8.7 kJ day-1 °C-1 (n = 7) at 50 °C (Figure 2B). In a test for dif- ARDS UST ferences in h between 10 °C, 35 °C and 50 °C, temperature had a significant B effect (F2, 15 = 14.0, P < 0.001). Post-hoc contrast analysis showed significant dif- OUBARA ferences between h at 10 °C and 35 °C (contrast -17.4 ± 3.3 (SE), P < 0.001), H and between h at 35 °C and 50 °C (contrast 9.8 ± 3.2 (SE), P = 0.008). Houbara OF

Bustards significantly increased h when Ta increased to 35 °C, and significantly decreased h when Ta exceeded Tb at 50 °C. When we tested if h-values differed RESPONSES between day and night, and between Tas of 25 °C and 45 °C, we found no signi- 255 ficant difference between day and night (F1, 21 = 4.2, P = 0.053), but a significant

effect of Ta (F1, 21 = 7.0, P = 0.015). When we confined our analysis to Ta = 25 °C,

we found no significant effect of time of day on h (F1, 9 = 0.80, P = 0.39).

Effects of captive-rearing and seasonality We compared metabolic rate of captive-reared Houbara Bustards between sea-

sons, and of captive-reared and wild-born individuals during winter at Tas of 35 °C and 50 °C (Figure 3A,B). At 35 °C, we found a significant group effect for

metabolic rate (F2, 18 = 14.37, P < 0.001). Post-hoc analyses indicated significant differences between summer and winter in captive-reared Houbara Bustards (contrast = -54.1 ± 21.3 kJ day-1 (SE), P = 0.02), and between captive-reared and wild-born birds (contrast = -59.7 ± 19.9 kJ day-1 (SE), P = 0.008). At 50 °C, we

found a significant group effect (F2, 19 = 4.58, P = 0.024) on metabolic rate. Post- hoc analyses revealed a significant difference in metabolic rate between summer and winter birds (contrast = -77.1 ± 35.7 kJ day-1 (SE), P = 0.044) but not between captive-reared and wild-born birds (contrast = -28.3 ± 35.1 kJ day-1 (SE), P = 0.43).

Total evaporative water loss varied with body mass and with Ta in all three groups (Figure 3C,D). At 35 °C, a significant interaction between group and body mass indicated that the slopes differed between groups (Figure 3C). The 95%-confidence intervals of the slopes of the captive birds in summer (b = 0.019, CI: -0.014 - 0.052) and winter (0.039, CI: 0.0005 - 0.078) overlapped broadly, in contrast to the small overlap with the slope of wild birds in winter (b = 0.103, CI: 0.073 - 0.133). Therefore, we combined data for summer and winter of the captive birds, recalculated the ancova model, and calculated the increase in the error variance. The significant increase in error variance compared with the model that included all three groups indicated that the slope through the data of

the wild birds differed significantly from the slope of the captive birds (F2, 15 = 4.12, P < 0.05). Houbara of wild origin showed a larger increase in TEWL with body mass. Although the slopes of the relationship between TEWL and mass did

not differ significantly between seasons in the captive-reared birds (F1, 9 = 0.83,

P = 0.39), the intercept was higher for birds in winter than in summer (F1, 10 =

8.85, P = 0.014). At 50 °C TEWL did not differ significantly between groups (F2,

19 = 4.61, P = 0.10). Body temperature of Houbara Bustards at 35°C was dependent on mass and

group (mass: F1, 18 = 5.68, P = 0.028, group: F2, 18 = 6.67, P = 0.007, Figure 3E,F).

Post-hoc analysis elucidated a significant difference in Tb between captive-reared and wild-born birds in the winter (contrast = 0.45 ± 0.15 °C (SE), P = 0.007), but no significant difference in captive birds between summer and winter (con-

trast = 0.05 ± 0.16 °C (SE), P = 0.75). At 50 °C, Tb did not differ between groups

(F2, 19 = 1.30, P = 0.30). 256 TURES

Figure 3. Metabolic rate, total evaporative water loss and body temperature of captive reared TEMPERA

Houbara Bustards during summer (unfilled triangles, solid line) and during winter (filled triang- HIGH les, dotted line), and of wild birds during winter (filled circles, dashed line) at 35 °C and 50 °C. TO

Significant differences among groups are indicated in the top left corner: ns = not significant; *, ARDS

P < 0.05; **, P < 0.01. UST B OUBARA H Change in Tb with time, dTb/dt, was independent of body mass in Houbara OF Bustards (Figure 4A,B, Ta = 35 °C: F1, 18 = 0.03, P = 0.88; Ta = 50 °C: F1, 19 = 0.70,

P = 0.41). At 35 °C, dTb/dt was significantly different between groups (F2, 18 = 5.05, P = 0.018), and post-hoc analysis revealed that dT /dt of captive-reared

b RESPONSES -1 birds differed between winter and summer (contrast = -0.25 ± 0.11°C h (SE), P 257 Figure 4. Change in body temperature (dTb/dt) and dry heat transfer coefficient of captive-reared Houbara Bustards during summer (unfilled triangles, solid line) and during winter (filled triangles, dotted line), and of wild birds during winter (filled circles, dashed line) at 35 °C and 50 °C. Significant differences among groups are indicated in the top left corner: ns = not significant; *, P < 0.05.

= 0.035), but that dTb/dt did not differ between captive-reared and wild-born birds in winter (contrast = -0.09 ± 0.10°C h-1 (SE), P = 0.38). Neither captive-

rearing, nor season affected the rate of heat storage at 50 °C (F2, 19 = 3.32, P = 0.058). The dry heat transfer coefficient of Houbara Bustards did not vary with body

mass (Figure 4C,D, Ta = 35 °C: F1, 17 = 2.17, P = 0.16; Ta = 50 °C: F1, 19 = 1.57, P = 0.23). We calculated h at 35 °C and 50 °C and found no significant differences between wild and captive birds, or between summer and winter (35 °C:

F2, 17 = 3.29, P = 0.062; 50 °C: F2, 19 = 0.93, P = 0.41).

Organ masses of captive-reared and wild-born Houbara Bustards in winter Captive-reared Houbara Bustards had different organ masses than wild-born birds (Table 1), despite no significant differences in body mass (captive: 1196 ± 198 g, n = 6, wild: 1397 ± 299 g, n = 6, t = 1.37, P = 0.20), or structural size as 258 measured by tarsus (captive: 97 ± 6.6 mm, wild: 97 ± 6.3 mm, t = 0.04, P = 0.97). The sum of the wet masses of brain, proventriculus, stomach, heart, instestine, liver, kidney, left pectoral muscle, thyroid, and spleen was larger in wild birds (246 ± 54 g, n = 6) than in captive birds (173 ± 27 g, n = 6, t = 2.9, P = 0.015). When the size of each organ was expressed as a proportion of total body mass, proventriculus, stomach, intestine, liver and thyroid were significantly larger in wild birds than in captive-reared animals (Table 1). Although pectoral muscle, heart, kidney and spleen also tended to be larger in wild birds, the differences with captive-reared birds were not significant. We compared the dry masses of each organ between wild and captive birds using an ancova with tarsus as covariate, to control for the effect of body size. In this analysis we found a significantly larger proventriculus, stomach, intestine, liver, and pectoral muscle in the birds of wild origin, but no significant differences in brain, heart, kidney, thyroid and spleen, although these latter organs also tended to be larger in wild birds (Table 1). We calculated the relationships between BMR and body mass, and between each organ and body mass for our entire data set (Table 2). The association between BMR and body mass was given by the equation BMR (kJ day-1) = 24.6 + 0.237 mass (g) (n = 12, r2 = 0.67). All body components were closely associated with body mass as shown by the regressions and the large fractions of explained variance (r2) in Table 2. For each bird we calculated the residual BMR (BMR measured - BMR predicted from allometric equation) and the residual of each organ dry mass (organ measured - organ predicted from allometric equation). We calculated the correlations of residual BMR with each organ and found that none of these were significant (Table 2). Therefore, we concluded that larger birds had higher BMR and larger organs, but that none of the organs contributed disproportionately to BMR.

TABLE 1. Mean organ mass ± 1 SD of wild-born and captive-bred Houbara Bustards during winter (n = 6 in each group). Wet mass is expressed as percentage of total body mass, and was arc-

sine square root transformed before applying t-tests. Dry masses (g) of wild and captive birds are TURES compared with ancova, using tarsus length as covariate. Significant P-values after sequential Bonferroni correction are indicated by a *. TEMPERA Wet mass (% total mass) Dry mass (g) Organ Wild Captive P Wild Captive % change P HIGH TO Brain 0.32±0.09 0.36±0.04 0.33 0.93±0.04 0.87±0.08 -6.5 0.035 Proventriculus 0.30±0.04 0.19±0.02 <0.001* 1.08±0.32 0.62±0.14 -43.6 0.001* ARDS UST

Stomach 1.51±0.14 1.05±0.10 <0.001* 7.30±0.16 4.52±1.02 -38.1 <0.001* B Heart 0.87±0.14 0.71±0.08 0.040 3.47±1.30 2.25±0.30 -35.2 0.028 Intestine 2.67±0.33 1.45±0.28 <0.001* 7.60±2.45 3.93±0.96 -48.3 0.003*

Liver 1.84±0.28 1.38±0.11 0.003* 8.34±3.50 4.82±0.89 -42.2 0.010* OUBARA H Kidney 0.61±0.04 0.50±0.18 0.17 2.08±0.85 1.31±0.47 -37.0 0.035 Pectoral Muscle1 9.38±0.48 8.77±0.39 0.038 42.32±9.31 29.68±4.39 -29.9 0.004* OF Thyroid 0.014±0.004 0.008±0.003 0.008* 0.08±0.04 0.03±0.01 -62.5 0.023 Spleen 0.048±0.010 0.059±0.011 0.10 0.16±0.06 0.16±0.03 0 0.95 RESPONSES 1 Only includes the left pectoral muscle. 259 TABLE 2. Regressions of BMR (kJ d-1) and organ masses (dry g) vs body mass (wet g) for Houbara 2 Bustards (n = 12). r1 is the fraction of variance explained by body mass. P1 is the significance level of the regression line and r2 is the coefficient of correlation between residuals of BMR and of organ mass. P2 is the significance level of this correlation.

2 y Log y r1 P1 r2 P2

BMR 24.6 + 0.237 mass 0.67 0.001 Brain 0.647 + 0.00019 mass 0.53 0.007 0.04 0.90 Proventriculus -0.558 + 0.00109 mass 0.72 0.001 0.23 0.47 Stomach -2.384 + 0.00640 mass 0.76 <0.001 0.48 0.12 Heart -1.293 + 0.00320 mass 0.59 0.004 0.21 0.52 Intestine -4.525 + 0.00794 mass 0.64 0.002 0.15 0.64 Liver -6.490 + 0.01008 mass 0.76 <0.001 0.27 0.41 Kidney -1.707 + 0.00262 mass 0.82 <0.001 0.02 0.95 Pectoral muscle1 -6.324 + 0.03265 mass 0.81 <0.001 -0.12 0.72 Thyroids -0.066 + 0.00009 mass 0.43 0.020 0.10 0.75 Spleen -0.006 + 0.00013 mass 0.52 0.008 -0.02 0.95 Gonads 0.053 + 0.00002 mass 0.09 0.34 0.08 0.81

1 Only includes the left pectoral muscle

Discussion Captive-reared Houbara Bustards in summer During the past 10 years captive-reared Houbara Bustards in Saudi Arabia have been reintroduced into Mahazat as-Sayd, a reserve in the west-central Arabian Desert (N 22° E 41°) and within the original distribution area of the species.

Mahazat as-Sayd receives on average 90 ± 70 (SD) mm of rain per year and Tas range from an average maximum of 40.2 °C during June to an average minimum of 10.7 °C during January (National Wildlife Research Center, unpublished).

Daily extreme Tas in summer regularly reach 50 °C. When Houbara Bustards incubate eggs during late spring, they are exposed to the full sun and sit on a soil surface that reaches maximum temperarutures exceeding 65 °C (Tieleman and Williams, unpublished). There is no free-standing water available for drinking in Mahazat, except for short periods after rains. The relative humidity in the area varies between 20-40% in summer and 40-80% in winter. The physiological responses of Houbara Bustards to temperature are consistent with expectations for birds adapted to hot and arid environments. RMR of captive-reared birds in summer was 261.4 kJ day-1, 26% below allometric predictions of BMR for a 1245 g bird (Tieleman and Williams 2000). We did not find significant differences in RMR between day and night, supporting the idea that desert birds have minimal heat production during the day. Unlike most birds, Houbara

Bustards had an upper critical Ta that markedly exceeded Tb; they maintained a stable RMR for 3 h at 55 °C. Few other species extend their thermoneutral zone

to Tas exceeding 50 °C. Heat acclimated Rock Pigeons (Columbia livia), that

have been reared in environmental chambers, have an upper critical Ta of at 260 least 60 °C, although non-acclimated birds have an upper critical Ta of 40 °C (Marder and Arieli 1988). Among wild-caught desert species, Withers and

Williams (1990) recorded an upper critical Ta of at least 50 °C for the Spinifex pigeon (Geophaps plumifera). At 25 °C, TEWL of Houbara Bustards averaged 25.8 g day-1, 31% below allometric prediction (Williams 1996), whereas at 45 °C their TEWL equaled 140.3 g day-1, 20% below prediction (Tieleman and Williams 1999). Low rates of TEWL would be beneficial to birds in deserts, because of their lack of drinking water. However, mechanisms that reduce TEWL may compromise the capability for evaporative cooling, and may be feasible only when alternative avenues for heat dissipation are well developed (Williams and Tieleman 2001).

When Ta exceeded Tb, the dry heat transfer coefficient of Houbara Bustards decreased, a finding in support of the prediction that birds should minimize heat gain by convection, conduction and radiation from the environment at high Tas (Hinds and Calder 1973; Weathers and Schoenbaechler 1976; Tieleman and Williams 1999). Apparently Houbara Bustards were not able to decrease h to the minimal values that h reached at Tas below the thermoneutral zone. Because h is not only determined by ptiloerection, but also by vasodilation in the dermal bed, h at high Tas may be a compromise of minimizing dry heat gain, while maintaining the ability for cutaneous water loss that might be an important avenue for evaporative cooling at these Tas (Marder and Arieli 1988; Menon et al. 1989; Menon et al. 1996). The apparently efficient mechanisms for evaporative cooling and dry heat loss of

Houbara Bustards led to remarkably constant low Tbs also when the birds were exposed to high Tas. When Houbara Bustards were exposed to 45 °C for 3 h, Tb was on average 0.9 °C higher than at 25 °C for the same time period. This finding lends credence to the idea that larger birds may not save water when hyperthermic during chronic episodes of high Ta (Tieleman and Williams 1999). TURES Seasonal variation in captive-bred birds

Among captive-bred Houbara Bustards, RMR differed significantly between TEMPERA seasons. For a Houbara Bustard of 1300 g at 35 °C, RMR averaged 243 kJ day-1 HIGH -1 during summer, 299 kJ day during winter, 33% and 18% below allometric pre- TO dictions, respectively (Tieleman and Williams 2000). RMR in winter was 23% ARDS -1 higher than in summer. TEWL at 35 °C averaged 32.7 g day in summer and 47.9 UST B g day-1 in winter, a significant increase of 46%, but TEWL at 50 °C did not differ between seasons. Although the increase in TEWL may be partly due to increased OUBARA ventilation rates associated with the higher RMR in winter compared with sum- H OF mer, the percentage increase is larger in TEWL than in RMR, and it is likely that other factors are involved. The reduction of TEWL in summer may require struc-

tural changes in the skin that might involve the transport of lipids from intra- to RESPONSES 261 extracellular spaces and vice versa (Menon et al. 1996), or may result from differences in neurological processes that might be involved in regulating vapor diffusion through bird skin (Arieli et al. 2000).

Captive-bred versus wild-born Houbara Bustards The physiological phenotypes of wild-caught and captive-reared Houbara Bustards with similar genetic backgrounds (Seddon et al. 1995) differed with

respect to RMR, TEWL and Tb at 35 °C, but revealed no difference in response to exposure to 50 °C. RMR of a 1300-g bird from the captive breeding program was 17% lower than RMR from a wild caught individual (Figure 3). The latter had an estimated RMR of 358 kJ day-1, only 2% below allometric predictions (Tieleman and Williams 2000). Similarly, TEWL at 35 °C was 28% lower in captive-reared birds (47.9 g day-1) than in birds from wild populations (66.3 g day-1). The identical physiological responses to exposure to 50 °C suggested that capti-

ve- reared and wild-born birds both have similar abilities to cope with high Tas. However, the difference in RMR at 35 °C indicated that the physiology does differ between these groups of birds. Differences in metabolism could, at least in part, be accounted for by differences in size of the metabolically active organs of the digestive system (proventriculus, stomach, intestine and liver) and the pectoral muscles, which were larger in birds from wild populations (Table 1). Larger organs may have resulted in higher rates of metabolism. Because previous studies found a significant effect of kidney and heart on BMR (Daan et al. 1990), we explored if any of the organs contributed disproportionately to RMR, but found no significant correlations in our analysis of residuals (Table 2). The low RMR of captive-bred birds could have consequences for their aerobic performance once these individuals are released into the wild. It is often suggested that a link exists between resting and maximum levels of oxygen consumption (Bennett and Ruben 1979; Hayes and Garland 1995; Chappell et al. 1999). This effect on the physiological performance of released animals could have consequences for their ability to escape from predators, or to migrate when local conditions are poor. The observed physiological differences between the wild-born and captive- reared phenotypes might be due to different conditions during development. In other studies, periods of a few days or weeks have been sufficient for acclimation to occur (Piersma and Lindström 1997; Williams and Tieleman 2000). In this study, the primary difference between the captive-bred and wild-born birds is probably due to differences in their environment during chick growth. As chicks, captive-reared birds had access to food and water ad libitum, and locomotion was minimized as a result of living in outdoor aviaries. Houbara Bustard chicks in the wild travel large distances as they follow the female parent in search of food, and thereafter as adults rely far more on locomotion than do their captive-reared counterparts. However, to gain insight into the flexibility and reversibility of 262 variables like BMR, we suggest a study in which captive-bred birds are measured before and after their release into the wild. Such a study could reveal if captive- reared birds are able to adjust their physiology and to obtain identical levels of metabolism as birds from wild populations.

Acknowledgments We thank HRH Prince Saud Al Faisal and A. Abuzinada of the National Commission for Wildlife Conservation and Development for their support during this study. This work would not have been possible without the help of the staff of the National Wildlife Research Center, Taif, Saudi Arabia. We especially thank A. Khoja, S. Ostrowski, P. Seddon, and J.-Y. Cardona for logistical support. P. Seddon and two anonymous referees provided comments on an earlier draft. TURES TEMPERA HIGH TO ARDS UST B OUBARA H OF RESPONSES

263

PART IV Behavioral strategies

CHAPTER 13 Lizard burrows provide thermal refugia for larks in the Arabian Desert

Joseph B. Williams, B. Irene Tieleman, and Mohammed Shobrak Condor 101: 714-717. 1999. ABSTRACT A common perception is that desert birds experience greater extremes of heat and aridity than their mammalian counterparts, in part, because birds do not use burrows as a refuge from the desert environment. We report observations of Dunn’s Larks (Eremalauda dunni), Bar-tailed Desert Larks (Ammomanes cincturus), Black- crowned Finchlarks (Eremopterix nigriceps), and Hoopoe Larks (Alaemon alaudipes) using burrows of the large herbivorous lizard Uromastyx aegypticus as thermal refugia during hot summer days in the Arabian Desert. We document this unusual behavior, describe the thermal environment of these burrows, and estimate the consequences of their use for the water economy of the Hoopoe Lark. Continuous recordings of shade air tempe-

rature (Ta), soil surface temperature (Tsurface), bur-

row air temperature (Ta-burrow), and burrow sub-

strate temperature (Tsubstrate) showed that Tsurface

exceeded 60 °C on most days. Ta typically excee-

ded 45 °C, whereas Ta-burrow was around 41 °C during midday. Calculations of total evaporative water loss at different temperatures indicated that Hoopoe Larks can potentially reduce their water loss by as much as 81% by sheltering in Uromastyx burrows during the hottest periods of the summer day.

ABSTRACT Introduction Environments of hot deserts can include periods of high ambient air temperature (Ta), sometimes in excess of 50 °C, intense solar radiation, desiccating winds, lack of surface water for drinking, and low primary production, conditions which in combination may pose a serious challenge to the survival and reproduction of inhabitants (Meigs 1953; Louw and Seely 1982). Studies on vertebrate animals that live in these habitats have often revealed both physiological and behavioral specializations which function in concert enabling species to maintain a positive water balance. For birds, behavioral strategies, such as selection of favorable microenvironments, are often identified as the most effective means of water conservation (Dawson and Bartholomew 1968; Williams et al. 1995; Maclean 1996). Many small mammals that live in deserts evade the vicissitudes of their environment because they forage at night, and remain within a subterranean burrow during the day where Tas are less thermally stressful (Schmidt-Nielsen 1964). Desert birds, which are mostly diurnal, usually seek shade during midday when solar radiation is most intense and Tas are highest, but the physiological consequences of this microsite selection have been seldom explored (Walsberg 1985; Wolf et al. 1996; Wolf and Walsberg 1996). Knowledge about how birds perform under these conditions provide insights that are fundamental to the understanding of the ecology of species that live in deserts. It is often stated that arid-zone birds do not use burrows as a shelter, and as a result, experience greater extremes of heat and aridity than many of their mammalian counterparts (Dawson and Bartholomew 1968; Wolf et al. 1996). Although birds do not dig underground tunnels to avert exposure to high Tas of the desert, we observed Dunn’s Larks (Eremalauda dunni), Bar-tailed Desert Larks (Ammomanes cincturus), Black-crowned Finchlarks (Eremopterix nigriceps), and Hoopoe Larks (Alaemon alaudipes) using burrows of the large herbivorous lizard Uromastyx aegypticus as thermal refugia during hot summer days in the Arabian Desert. We document this unusual behavior, describe the thermal environment of these burrows, and estimate the consequences of their use for the water eco-

nomy of the Hoopoe Lark. T DESER

Methods THE IN Our study area consisted of the eastern portion of Mahazat as-Sayd, a 2,244 km2 fenced reserve located in the west-central region of the Arabian Desert (22°15’N LARKS

41°50’E), among the hottest regions of the world (Meigs 1953). The terrain of FOR this area consisted of flat gravel plains, known as regs, occasionally interdigita- ted by dry sandy wadis. Air temperatures (Ta) in Mahazat, as recorded in a stan- REFUGIA dard weather shelter, often exceed 43 °C during the summer, and occasionally -1 reached 50 °C (Seddon 1996; Shobrak 1996). Rainfall averages ca. 100 mm year . THERMAL 269 The Egyptian Spiny-tailed Lizard, Uromastyx aegypticus, common throughout the Arabian Peninsula, feeds primarily on leaves and seeds (Al Sadoon et al. 1994). Weighing from 1.0-1.6 kg as adults, these large lizards excavate a single burrow which typically extends 3-4 m in length at a depth of >1 m. In Mahazat, densities of Uromastyx burrows averaged 28.5 ± 8.5 burrows km-2 along two 15 km transects (Shobrak, unpubl. data). Observations made in early June 1998 suggested that several species of larks were entering Uromastyx burrows during periods of extreme heat, a behavior that we hypothesized reduced water loss. Judging from the depth of bird feces in burrows, of circular depressions in burrows presumably fashioned by the birds, and of three Hoopoe Larks that we observed while they occupied a burrow, we estimated that birds were usually descending 20-30 cm into these tunnels. For the remainder of June and all of July 1998, we spent numerous hours driving off-road across the gravel plains of Mahazat. When the noise of our vehicle flushed a bird from a burrow, we recorded both the time and species, and on 25 occasions the shade

air temperature (Ta) taken 10 cm above ground, soil temperature (Tsurface) 1 mm

below the surface, burrow air temperature (Ta-burrow), and burrow substrate tem-

perature (Tsubstrate). The latter two temperatures were measured at a depth of 20 cm from the burrow entrance, a distance deemed to be a conservative estimate of the depth larks were descending into burrows. To measure temperatures, we used a 30 gauge copper-constantan thermocouple attached to an Omega 450 ATT thermometer. We compared temperatures given by this system against a mercury-in-glass thermometer that had a calibration traceable to the National Institutes of Standards and Technology. Additionally we measured the height and width of each burrow entrance and its orientation. As the season progressed, we focused our attention on Hoopoe Larks because a large proportion of the population in Mahazat seemed to be utilizing Uromastyx burrows during midday. To determine the exact time that Hoopoe Larks entered burrows, we watched nine burrows from a vehicle beginning at 09:00 until birds entered burrows. We continued our vigil at least 1 hr after the birds arrived. To ascertain the daily pattern of burrow use, we watched burrows known to be used by Hoopoe Larks continuously from 06:00 to 18:00 h on two different days. On five occasions when we found a bird using a burrow during midday, we watched until it left. In three burrows, previously used by Hoopoe Larks, we continuously recorded 15

min averages of Ta, Tsurface, Ta-burrow, and Tsubstrate over a period of 2-3 days using a

Campbell 21X data logger. Here, we measured Ta 10 cm from the ground with a 36-gauge thermocouple inside a cylindrical cone fashioned from aluminum foil,

Tsurface and Tsubstrate were measured using a 30-gauge thermocouple soldered to a piece of fine-gauged wire mesh (4 x 5 cm) that was covered with 1 mm of sand,

and Ta-burrow was measured with a 36-gauge thermocouple 20 cm into the burrow 270 and attached to a stick 5 cm above the burrow floor. Although these methods provided a reliable measure of Ta, they only yielded approximations of surface temperatures. To estimate the consequences of using a burrow for the water economy of Hoopoe Larks, we used data from laboratory measurements of their total evaporative water loss (Tieleman and Williams, unpubl. data), combined with our measurements of temperatures in the field. We recognize that measurements of

Ta only provide a crude index of environmental temperatures experienced by animals (Gates 1980), but below ground where convection and solar radiation are minimal, measurements of Ta may closely approximate operative temperature (Te) (Bakken 1976; Robinson et al. 1976). Statistical analyses were performed following Zar (1984). Means are reported ± SD.

Results We recorded 70 Hoopoe Larks, 32 Dunn’s Larks, 8 Bar-tailed Desert Larks, and 1 Black-crowned Finchlark using Uromastyx burrows during June and July 1998 (Figure 1A). Larks typically utilized burrows between 11:00 and 16:00 h. During this period Ta averaged 44.1 ± 1.2 °C (n = 25), Tsurface = 57.9 ± 3.6 °C (n = 25),

Ta-burrow = 41.5 ± 1.7 °C (n = 25), and Tsubstrate within the burrow averaged 38.6 ± 1.3 °C (n = 17). Entrances of burrows used by larks averaged 20 ± 5 cm in width and 14 ± 5 cm in height. We found no evidence that larks selected burrows based χ2 on the compass orientation of the entrance ( 3 = 0.8, P > 0.7, n = 23). From daylong watches using our vehicle as a blind, we noted that Hoopoe Larks began foraging in the shade of vegetation, often Panicum turgidum, between 08:00 and 09:00 h (see also Shobrak 1998). As the sun reached its zenith, making shade less available, and as Ta increased, Hoopoe Larks sought lizard burrows for refuge. During these observations, birds entered burrows at 10:54 h ± 0.8 (n = 9) and exited them at 16:36 h ± 0.2 (n = 5). If birds remained in burrows continuously, they would spend 5 h 42 min in them. In practice, birds came to T the burrow entrance several times each hour, and occasionally foraged near the burrow for a few minutes, and thereafter returned below ground. On two days of DESER continuous observation from 06:00 h to 18:00 h, birds did not leave their burrow THE IN for more than 5 min between 11:00 h and 16:00 h. For four days, from July 19-

22, data recorded by our logger indicated that at the times that birds entered bur- LARKS rows, Ta, Tsurface, Ta-burrow, and Tsubstrate averaged 46.4 ± 2.2°C, 57.7 ± 4.8 °C, 39.5 FOR ± 1.7 °C, and 37.1 ± 0.1 °C, respectively, and when they exited them, these same values averaged 48.5 ± 1.6 °C, 54.5 ± 1.7 °C, 41.8 ± 0.8°C, and 38.1 ± 0.3 °C, REFUGIA respectively.

On three occasions we watched a Hoopoe Lark while it was inside of a burrow. THERMAL After entering the burrow, birds shuffled their feet, as if to remove the surface 271 Figure. 1. (a). The relationship between the number of birds observed in Uromastyx burrows

and the time of day. (b). The relationship between ambient temperature Ta, the temperature of

the soil surface Tsurface, the air temperature in the burrow Ta-burrow, and the burrow substrate tem-

perature Tsubstrate and the time of day.

layer of soil, and then lay prostrate on the floor of the burrow pressing their chest and neck on the substratum. By using this behavior the bird would conduct heat away from its body that otherwise would require water for evaporation. Much of the ventral region of the body of Hoopoe Larks is devoid of feathers which would enhance dry heat loss to the soil. When we purposefully flushed Hoopoe Larks from lizard burrows during the hottest part of the day, forcing them to find other shade, without exception, birds flew to another burrow and disappeared from our view (n = 10). If we evicted them from this second burrow, birds would either return to the first, or find another one. On 17 July, after we forced a bird from its burrow, it flew to one nearby, and was vigorously attacked by the Hoopoe Lark that was the occupant. On several days we observed an adult sharing a burrow with a second bird, presumably one 272 of its offspring. The large proportion of the Hoopoe Lark population employing burrows as refuge, their unwillingness to use alternative sites, and their vigorous defense of burrows, together suggest that this microsite is important to their survival.

Tsurface often exceeded 60 °C during the middle part of the day (Figure 1B). At these extreme environmental temperatures larks must find microsites of lower temperature or suffer fatal consequences (Tieleman and Williams unpub. data).

Larks that remain above ground experience Tas in excess of 45 °C, a temperature above their upper critical temperature (Tieleman and Williams, unpubl. data).

At these high Tas, we noted that birds were usually resting in the shade with the ventral parts of their bodies pressed tightly to the ground, a behavior that would dissipate heat by conductance instead of by evaporative cooling and may result in significant water savings. However, we also noted that birds sometimes pan- ted, an indication that metabolic heat could not be totally dissipated by conduction to the soil.

Discussion Our data show that occupancy of lizard burrows is a common behavior among larks in the Arabian Desert, and that Hoopoe Larks, the largest of the species (40-50 g), select this microsite more frequently than do smaller species, even though Hoopoe Larks were less common than either Dunn’s Larks or Black- crowned Finchlarks (Newton and Newton 1997; Shobrak unpubl. data). Although two earlier reports have mentioned that desert birds may seek shelter in underground burrows, Spike-heeled Larks Cherosomanes albofasciata in the Kalahari (Maclean 1974), and Anteating Chats Myrmecocichla formicivora in Bushman land, South Africa (Watkeys 1987), neither presented data describing the frequency that these microsites were selected, the environmental circumstances accompanying such behavior, or the physiological consequences of such behavior. Our data represent the first detailed assessment of this behavior among desert-dwelling birds, and the first observations of this behavior for birds in the T Arabian Desert. DESER TABLE 1. Estimates of total evaporative water loss for Hoopoe Larks exposed to different environmental temperatures. THE IN

Water Loss

o -1 -1 -1 a LARKS Temperature ( C) g H2O h g H2O 5h % Body Mass h FOR 60.7 3.99 19.96 8.9 48.9 1.35 6.74 3.0

41.9 0.47 2.34 1.0 REFUGIA 39.0 0.25 1.27 0.6

Based on a body mass of 45 g. THERMAL

273 From our recordings of temperatures, from 17-22 July Ta, Tsurface, Ta-burrow, and

Tsubstrate averaged 48.9 °C, 60.7 °C 41.9 °C, and 39.0 °C, respectively, between 11:00 h and 16:00 h. In the laboratory, over a temperature range of 35-50 °C, total evaporative water loss (TEWL) of Hoopoe Larks increases curvilinearly: -1 2 2 TEWL (g day ) = 142.6 - 8.41Ta + 0.126 Ta (r = 0.96) (Tieleman and Williams, unpubl. data). Based on the relationship between measurements of TEWL and

Ta for Hoopoe Larks, we have estimated TEWL for this species at the average

temperatures given above (Table 1). If Te of a Hoopoe Lark in full sun on the

ground approaches Tsurface (Williams et al. 1995), then water loss would be nearly 9% of its body mass h-1, a rate that could be sustained for only short periods (Table 1). Wolf et al. (1996) calculated that Verdins (7 g) in the full sun in the Sonoran Desert would lose 7% of their body mass hr-1.

If Hoopoe Larks (40-45 g) remained above ground, but sought shade, at a Ta of -1 48.9 °C, they would evaporatively lose 1.35 g H2O hr , or 3.0% of their body mass (Table 1). By seeking underground shade, larks could reduce their TEWL -1 to 0.47 g H2O hr , or 2.34 g H2O over 5 hr, a 65% reduction. By pressing their ventral apteria to the burrow substrate, Hoopoe Larks can further reduce their -1 TEWL, perhaps as low as 0.25 g H2O hr , a value 81% lower than for water loss in above ground shade. These calculations emphasize that the use of burrows can provide a significant savings to the water economy of Hoopoe Larks, and indicate that this behavior is potentially important to their survival.

Acknowledgments We thank the entire staff of the National Wildlife Research Center, Taif, Saudi Arabia, for their support and encouragement, especially P. Paillat and Phil Seddon. A. H. Abuzinada kindly granted us permission to work in Mahazat as- Sayd. J. Williams was supported, in part, from funds provided by NSF grant no. 9696134, and I. Tieleman received monies from the Doctor Catharine van Tussenbroek Foundation.

274 T DESER THE IN LARKS FOR REFUGIA THERMAL

275

CHAPTER 14 Effects of food supplementation on behavioral decisions of Hoopoe Larks in the Arabian Desert: balancing water, energy and thermoregulation

B. Irene Tieleman and Joseph B. Williams Animal Behaviour 63: 519-529. 2002. ABSTRACT Patterns of time allocation to different activities can help reveal how natural selection has solved optimality problems that involve simultaneous environmental constraints. To investigate how time budgets of desert birds are affected by ambient temperature, lack of drinking water and low food availability, we provided food and water to Hoopoe Larks, Alaemon alaudipes, in the Arabian Desert during years in which no larks reared young. We followed birds continuously from sunrise to sunset on unsupplemented and supplemented days, and recorded their behaviour every 15 s. Taking into account the variation in temperature between days, Hoopoe Larks decreased foraging time by 13-29% of total daytime, and increased resting and preening time by 7- 16% and 8%, respectively, when they had access to supplemental food. When birds had access to extra food, they began and ended their midday resting period when shade temperature was on average 2.2 ± 2.4 °C (n =18) lower and operative temperature was on average 3.1 ± 3.5 °C (n = 18) lower than on unsupplemented days, a significant effect of food supplementation. We concluded that birds optimized time spent on foraging and thermoregulating based on a combination of physiological state variables, including body temperature, hydration state and level of energy reserves. Our results do not support a previous hypothesis that activity budgets of desert birds are dictated by thermal constraints alone.

ABSTRACT Introduction Many studies on the allocation of time and energy resources have focused on how temperate zone birds maximize breeding success, and more specifically on the effects of timing of laying, clutch size and parental effort on current and future reproduction (e.g. Svensson 1995; Daan et al. 1990, 1996; Nager et al. 1997). In contrast, in deserts, where rainfall and concomitant food supply are scarce and unpredictable, birds encounter years during which the trade-off between current and future reproduction ostensibly leads to the decision not to breed at all. This decision may be based on a combination of resource availability, state of an animal's nutrient reserves, and abiotic factors, like temperature, that may constrain the time that can be allocated to caring for young. In these non-breeding years, the only contribution to fitness is future reproductive success, which depends to a large extent on survival (Stearns 1992). Given the environmental conditions that have led to the omission of breeding, survival may be a considerable challenge during such years. Time budgets, patterns of time allocation to different activities, can help reveal how natural selection has solved optimality problems that involve simultaneous environmental constraints. Behavioral allocation patterns are influenced by a plethora of factors, including time of year (Bryant et al. 1985; Carmi-Winkler et al. 1987; Enoksson 1990), temperature (Askenmo et al. 1992), and water and food availability (Davies and Lundberg 1985; Enoksson 1990). Investigating time budgets in deserts may provide insights into the combined roles of temperature, water, and food resources in determining these patterns of desert birds. Environmental manipulations are frequently used to study environmental constraints, and the accompanying trade-offs that animals face when allocating time and energy resources. Food supplementation experiments have provided insights into how reproductive decisions, such as timing of breeding and clutch size, are affected by resource availability (e.g. Lack 1954; Högstedt 1981; Arcese and Smith 1988; Svensson and Nilsson 1995; Nager et al. 1997), and insights into the trade-off between current and future reproduction by changing the level of parental effort (Daan et al. 1990; Wiehn and Korpimäki 1997). Few studies have investigated the effect of food availability on time budgets outside the breeding ARKS season (Enoksson 1990). However, food supplementation studies could also L

increase our understanding of optimal resource allocation strategies and of the OOPOE existence of potential environmental constraints in times when an individual's H OF main concern is to maximize the chance of survival, either in non-breeding sea- TION sons or years. A Despite general avian characteristics like high rates of metabolism and evaporative water loss, that do not seem to favor desert occupancy (Dawson 1984; SUPPLEMENT Williams and Tieleman 2001), several bird species are able to obtain adequate water and food while avoiding potentially lethal heat stress in desert environ- FOOD 279 ments. Studies on time budgets have shown that desert birds have bimodal activity patterns, with a period of rest during the middle part of the day when

ambient temperatures (Ta) are high (Goldstein 1984; Carmi-Winkler et al. 1987; Hinsley 1994; Williams 2001). Although the birds in these studies spent a significant part of their time in activities other than foraging or resting, they extended their foraging time on cooler days, a finding that led to the suggestion that the thermal environment constrains foraging time. This "thermal constraint" hypothesis suggests that the risk of overheating increases in the course of the

morning as Ta increases, and that body temperature (Tb) potentially plays a role in determining the onset of thermoregulatory behaviors like shading or perching in the wind. This simplistic view does not consider that the cues used by birds to minimize the risk of overheating while meeting water and energy requirements,

might be a combination of several physiological state variables, including Tb, hydration state and level of energy reserves. The optimal pattern of time allocated to various behaviors, and the time at which to switch from one behavior to another, e.g. from foraging to shading, may shift when one of these state variables alters (Houston and McNamara 1999). In this study we focus on how environmental variables that influence the physiological state affect behavior, although we recognize that other characteristics of the environment, particularly predation risk, may also influence behavioral decisions (McNamara and Houston 1986). Years or seasons in which birds do not breed lend themselves well to stu-

dying the influence of Ta, water and energy balance on behavior, without the need to consider complicating effects of reproductive activities. To investigate whether and how the time budgets of desert birds are constrained

by Ta, water or food resources, we provided food and water to Hoopoe Larks (Alaemon alaudipes) in the Arabian Desert during the late spring of two years in which no larks raised young. We predicted that if thermal constraints alone dictate the time spent active, supplemental food and water would not change the time allocated to thermoregulation. However, if birds optimize time spent fora-

ging and thermoregulating based on a combination of Tb, hydration state, and level of energy reserves, an increase in food and water intake on supplemented days would decrease foraging time, increase time spent on thermoregulation, and

decrease the Ta at which birds start thermoregulating. We point out that throughout this paper the term thermoregulation describes behavioral thermoregulation, i.e. shading and perching in the wind, as opposed to physiological thermoregulation, which includes panting or shivering. This is the first study to report the effects of manipulating food and water resources on the time budgets of a desert bird, established by following individuals continuously from sunrise to sunset.

280 Methods Study area Mahazat as-Sayd is a 2244 km2 reserve in central-west Saudi Arabia (N22°E41°), an area that receives on average 96 ± 70 mm (SD) of rain per year (National Wildlife Research Center, unpubl.). The flat gravel plains in this part of the Arabian Desert are intersected by wadis and dominated by a sparse vegetation of perennial grasses, including Stipagrostis sp., Panicum turgidum, and Lasiurus scindicus, and small acacia trees (Acacia sp.) (Mandeville 1990).

Macro- and microclimate During the field seasons of 1999 and 2000, we obtained daily temperature and wind records from a weather station that we established about 5 km from our study area. We measured Ta 10 cm above the soil surface, using a thermocouple surrounded by a cone of aluminum foil to shield it from solar radiation and reradiation from the soil surface. Soil temperature (Ts) was estimated using a thermocouple soldered to a 25-cm2 piece of wire mesh, which was covered with a thin layer of sand (1 mm) to mimic the radiative properties of the soil. Operative temperature (Te) is an integrated index of environmental temperature that reflects the external conductive, convective and radiative properties of an animal without internal heat production or evaporative water loss (Bakken 1976).

We measured Te with thermocouples inside two or three differently oriented, plumage covered copper mounts (Bakken et al. 1981), that were protected from shrikes (Lanius sp.) by a wire cage with 8-cm2 mesh. Two Thornthwaite cup anemometers, previously calibrated in a wind tunnel, and placed at 12.5 cm and 1 m above the surface, measured wind speed. The output of thermocouples and anemometers was recorded every minute and averaged over 15-minute periods by a Campbell Scientific datalogger, model 21X. On three days when microclimate records were unreliable, e.g. sandstorms damaged the setup or predators attacked the taxidermic mounts, we substituted records for a day earlier or later to correlate with behavioral observations.

Natural history of Hoopoe Larks

The natural history of Hoopoe Larks (35-45 g) has only partially been described ARKS L and varies among populations (Cramp 1988). Here, we describe some aspects that are relevant to the population in Mahazat as-Sayd. Hoopoe Larks are ground OOPOE H

foraging birds with a diet that consists mainly of adult and larval insects, and spi- OF

ders, although seeds and an occasional lizard are eaten. Drinking water is not TION A available except for short periods after rains. Due to a lack of banding studies, little is known about individual movement patterns. Although Hoopoe Larks are

known as resident birds (Cramp 1988), some individuals may leave their territo- SUPPLEMENT ries in extremely dry years. Hoopoe Larks ostensibly breed in Mahazat from FOOD

February to June. After a wet winter with 127 mm of rain, a locust plague in 281 spring and summer 1998 resulted in large numbers of successful breeding pairs. During the two following years, Mahazat had very little rain and, despite some nestbuilding activity of a few pairs that responded to a late local rain, none raised young. In 1999 and 2000, despite not breeding, pairs of larks in Mahazat defen- ded territories that averaged 0.41 ± 0.18 (SD) km2 (n = 9), at least during our presence from March until August. Pairs remain together throughout most of the day, mutually calling while foraging or shading.

Behavioral observations Time budget observations can be biased when the visibility of the animal depends on its activities or on time of day (Altmann 1974; Rugg and Buech 1990). Because Hoopoe Larks in Mahazat as-Sayd are ground-foraging birds that are reluctant to fly, in an area with low vegetation cover, we were able to follow color-banded individuals from sunrise (0600 hours) to sunset (1830 hours), avoiding sampling bias. We attempted to obtain continuous observations throughout the day. On four occasions we lost sight of animals and returned the following day to collect data for the time period without observations. Each bird was observed one complete day with supplemental food, and one complete day without supplemental food. Total observation time on supplemented days averaged 699 ± 73 minutes, and on unsupplemented days 697 ± 41 minutes (n=9). We quantified time-activity budgets of birds by recording behavior and position of the bird in the sun or shade every 15 seconds at the signal of an electronic metronome. For analyses, we placed behaviors in the categories forage, rest, preen, and other. Foraging included walking over gravel plains or along vegetation strips with intermittent stops to inspect bushes for insects, pecking at insects, digging for prey at the base of vegetation, and short aerial chases of gras- shoppers that jumped from the surface. Resting, or thermoregulatory behavior, was a combination of standing, sitting or laying down in the shade, and perching on top of a bush or rock exposed to wind. The preen-category was the sum of preening while standing or sitting, and preening while perched on a bush. All other activities, including territorial interactions, pairbond interactions, and vocalizations were included in the “other” category. Our intention was to distinguish thermoregulatory behaviors (resting) from non-thermoregulatory behaviors (foraging, preening, other). However, birds sometimes combined preening and thermoregulation when they preened while sitting in the shade, or while perching on a bush. Therefore, excluding these activities from our resting category provided a conservative estimate of the time allocated to thermoregulatory behavior.

Food supplementation We established feeding sites in 9 territories with color-banded birds, where we

282 provided birds daily between 0530 hours and 0600 hours with 200 g of mealworms and 100 g of canary seeds, and with water in a drinking basin. Because Hoopoe Larks did not eat seeds that we provided, we only considered mealworm intake in our analyses. The resident pair found the food usually within a few hours, and kept visiting the site during the rest of the day, and during the following days. We focused our observations on males, but did not succeed in captu- ring the male of the last pair. Therefore we made observations on 8 males and 1 female from 9 different pairs. Time budgets of males and females are very similar because pairs spend most of their time foraging together, and stay in contact by frequently calling each other when they shade. We supplied food and water in 7 territories on 23 ± 7.5 days between 15 April and 7 June 1999, and in 2 territories between 27 April and 7 May 2000. To habi- tuate the birds to the feeding sites, we provided food and water for at least 2 days before we made behavioral observations. After completion of the observations on these supplemented days we stopped providing food for at least 2 days before making observations on the same individuals on unsupplemented days. Observations on unsupplemented days were made on average 7.7 ± 4.4 days after observations on supplemented days (n = 9). Because we observed the same individuals on supplemented and unsupplemented days, we analyzed the data in a pairwise manner. We realize that a balanced experimental design would have been more appropriate, and that time is a potentially confounding variable in the analysis of our data, because observations on unsupplemented days were always conducted after observations on supplemented days. However, we do not think that the results are significantly altered by our experimental design. A potential problem could have arisen when the natural food situation varied with season, but our insect sampling data for 1999 do not show a seasonal trend (Tieleman and Williams, unpubl.). One could imagine that birds are less motivated to forage on unsupplemented days if they have built up substantial reserves during previous supplemented days. This effect of a previous good meal would reduce the chance to find a difference in foraging time between unsupplemented and supplemented days, and renders the size of the difference that we report in this study a conservative estimate. ARKS Body mass L In 1999 we captured 13 members of the seven food supplemented pairs of OOPOE Hoopoe Larks during the first week of our experiment and measured body mass. H In week five of our experiment, we recaptured eight individuals and determined OF TION body mass again. We calculated the mass gain during food supplementation of A each individual by dividing the difference between final and initial mass by the number of days that the bird had access to supplemental food. In 2000, we captured both pairs at the beginning of our food supplementation, before we carried SUPPLEMENT

out behavioral observations. The average mass (± SD) of Hoopoe Larks in the FOOD field was 42.2 ± 5.3 g (n = 17). 283 Statistical analysis We used the general linear model procedures for analyses of variance in SPSS 10.0. For repeated measures analysis we specified the repeated factor as random factor in the analysis of variance. Proportions were arcsine-square root transformed prior to analyses (Zar 1996). Means are reported ± 1 SD.

Results Macro- and microclimate Characterized by long, hot and dry summers, the Arabian Desert is classified as an arid inland desert, similar to large parts of the Sahara (Meigs 1953). Weather

records for Mahazat as-Sayd in January show night-time low Tas of about 5 °C

and day-time high Tas of 25 °C, whereas in June/July minima around 28 °C and maxima of 49 °C are common (National Wildlife Research Center, unpubl.).

During our field seasons, average daily Tas varied from below 30 °C in the begin-

ning of April, to around 35 °C in the first week of June, while maximum Tas in the shade increased from about 40 °C to 48 °C (Figure 1). Operative temperatu-

re in the shade (Te_shade) is equal to Ta, and optimally describes the microclimate

that larks experience in the shade (Bakken 1980). In the sun, Te averaged around 38 °C, and reached maxima between 54 and 61 °C, well above the upper critical temperature of 37 °C measured for Hoopoe Larks in the laboratory (Tieleman and Williams, unpubl.). Because Hoopoe Larks foraged on the ground, they were

in contact with the soil surface that reached Tss exceeding Te by about 10 °C (Figure 1). Temperatures showed a daily pattern during our observations, with average mini-

mum Ta, Te, and Ts of 23.0, 21.4, and 22.6 °C, respectively, early in the morning, and average maximum values of 43.6, 52.6, and 62.8 °C during the middle part

of the day (Figure 2A). Although Ta was fairly constant from 1000 hours until

1700 hours, Te and Ts showed higher and narrower peaks between 1200 hours and 1500 hours due to the effect of solar radiation. Wind speeds varied more between days than temperatures, and although there was generally little wind in the early morning, there was no clear daily trend (Figure 2C). On days with a strong breeze, birds perched on bushes during the middle part of the day, whereas on days with little wind, birds laid down in the shade with their ventral apteria pressed to the ground (Pers. Obs.). Presumably the increased heat load from solar radiation when perching can be offset by convective heat loss when wind speeds are high. Perching on bushes not only would decrease a bird’s heat load caused by reradiation from the surface, but also could increase the capacity for convective cooling by doubling the experienced wind speed compared to ground level.

We calculated the average Ta and Te per time block of one hour experienced by 284 each individual on unsupplemented and supplemented days (Figure 2B). In a repeated measures ANOVA with Ta or Te as the dependent variable, individual and time block as random factors, and food supplementation as a fixed factor, we tested if temperatures were significantly different between supplemented and unsupplemented days. The significant interaction between food supplementation and individual (F8, 204 = 18.21, P < 0.001), and the significant food supplementation effect (F1, 8 = 6.23, P = 0.037) indicated that on some unsupplemen- ARKS L OOPOE H OF TION A SUPPLEMENT Figure 1. Minimum, maximum and daily 24-h averages of air temperature (Ta), soil tempera-

ture (Ts) and operative temperature (Te) in Mahazat as-Sayd in the late spring of 1999 (black FOOD symbols) and 2000 (unfilled symbols). 285 Figure 2A. Daily patterns of Ta, Ts and Te on unsupplemented and supplemented days. B.

Average difference in Ta and Te between unsupplemented and supplemented days, calculated for each individual bird, as a function of time of day. C. Daily patterns of wind speed on observation days at 12.5 cm (unfilled symbols) and 100 cm (black symbols) above ground level.

286 ted days Ta was higher than on supplemented days. Likewise, Te was significantly different between unsupplemented and supplemented days as shown by the significant interaction between individual and food supplementation (F8, 108 = 15.32, P < 0.001). Because one might expect that birds spend less time foraging on hotter days, but also when they have access to supplemental food, the slightly lower temperatures on supplemented days lead to a conservative estimate of the effect of food supplement on thermoregulatory resting behavior of Hoopoe

Larks. The significant effect of individual in our analyses (Ta: F8, 8 = 6.01, P =

0.010; Te: F8, 8.5 = 4.75, P = 0.018) confirmed that temperatures varied between days or changed during the field season (Figure 1). Although the temperature differences between unsupplemented and supplemented days averaged only 1-2 °C (Figure 2B), we were careful to incorporate temperature as a covariate in our analyses.

Supplemental food intake On supplemented days, birds frequently visited the feeding site to eat mealworms. We counted the number of mealworms consumed by five birds that allowed close approach. Combining these data with simultaneous time-activity observations at 15 second intervals, we calculated the regression of mealworm intake and number of pecks at the feeding site (r2 = 0.89, n = 64, P < 0.001) to estimate mealworm consumption of the remaining four birds from their time budgets. Mealworm intake averaged 158 ± 69 mealworms (n = 9), or 16.3 ± 7.1 g wet, per bird per day. To determine water content, we dried 20 mealworms for two days in a oven at 68 °C, and found that they contained 65% water. Only one of nine pairs of larks was observed to drink from the water that we provided.

Time-activity budgets on unsupplemented and supplemented days On unsupplemented days, birds spent 95% of the day foraging or resting. The first two hours after sunrise and the last hour before sunset were allocated almost exclusively to foraging, whereas the middle part of the day was devoted to resting (Figure 3). From 0800-1000 hours and 1600-1700 hours birds foraged from shade spot to shade spot, interrupted by resting bouts during which they perched or ARKS

shaded, sometimes with intermittent short periods of preening (Figure 3C). Of L the total day, unsupplemented birds (n = 9) allocated 5.5 ± 1.4 h to foraging, 6.3 OOPOE

± 1.5 h to resting, 0.4 ± 0.3 h to preening, and 0.3 ± 0.2 h to other activities. H

In contrast, when birds had access to supplemental food, they allocated only 81% OF

of the daytime to resting and foraging. The 20-40% reduction in foraging time TION A early in the morning and late in the afternoon (Figure 3A), led for most birds to extra preening (Figure 3C). On supplemented days (n = 9), birds allocated 3.8 ±

0.5 h to foraging, 6.9 ± 0.7 h to resting, 1.3 ± 0.3 h to preening, and 0.5 ± 0.5 h SUPPLEMENT to other activities. Even on days with unlimited access to mealworms and seeds, FOOD larks spent a significant amount of time digging for insect larvae at the base of 287 Figure 3. Percent of time allocated to (A) foraging, (B) resting, (C) preening, and (D) other activities on unsupplemented and supplemented days, as a function of time of day.

plants and chasing an occasional grasshopper or lizard. If we define thermoregulatory resting behavior less conservatively and include preening while birds were in the shade or perched in the wind, total resting time increased on unsupplemented days by 17 minutes to 6.6 ± 1.5 h, and on supplemented days by 26 minutes to 7.3 ± 0.6 h. Taking into account the variation in temperature between days, Hoopoe Larks 288 decreased foraging time by 13-29% of total daytime (at Tas ranging from 40-34 °C), and increased resting and preening time by 7-16% and 8%, respectively, when they had access to supplemental food (Figure 4). We compared the fraction of the day spent foraging on unsupplemented and supplemented days using an analysis of variance, with the average Ta during the observation period (0600-

1830 hours) as covariate. The interaction between food supplementation and Ta was not significant (F1, 6 = 3.26, P = 0.12), indicating no difference between slopes, but the effect of food supplementation was highly significant (F1, 7 = 6.41, P = 0.003), showing that birds on supplemented days spent less time foraging. To investigate how birds allocated the remaining time on supplemented days, we performed a similar analysis on the fraction of resting time, and found that access to supplemental food significantly increased resting time (F1, 7 = 10.01, P = 0.016; ARKS L OOPOE H OF TION A SUPPLEMENT Figure 4. Percent of total day time allocated to (A) foraging, (B) resting, and (C) preening on FOOD unsupplemented and supplemented days, as a function of the average Ta between 6:00 and 18:30h. 289 interaction F1, 6 = 2.81, P = 0.15). Likewise, food supplementation increased time

spent preening (F1, 7 = 43.93, P < 0.001; interaction F1, 6 = 0.37, P = 0.57). Other activities, including interactions with mates or neighbors, and vocalizing, were

not affected by the extra food (F1, 7 = 2.13, P = 0.19; interaction F1, 6 = 1.82, P = 0.23).

Temperatures at the onset and end of the rest period The optimal temperature at which an individual stopped foraging and began resting in the morning, and ended resting and resumed foraging in the afternoon, could have depended on food and water intake of the bird earlier in the day. We defined the onset of resting as the first continuous bout of the day that lasted 5 minutes or longer during which the bird either shaded or perched. The end of resting was defined as the last bout of the day with at least 5 minutes of inactivity. When birds foraged during the warmer parts of the day, they moved between

patches of shade where they experienced Te_shade (equal to Ta), crossing sunny ter-

ritory where they experienced Te. Birds might base their decision to start or stop

resting on Te_shade or Te, depending on the proportion of time spent in the shade

or the sun. On unsupplemented days, birds (n = 9) started resting at Te_shade =

40.0 ± 2.1 °C and Te = 47.1 ± 2.6 °C, and stopped resting at Te_shade = 41.9 ± 2.1

°C and Te = 47.3 ± 2.7 °C. With access to supplemental food birds began resting

when Te_shade = 38.1 ± 2.0 °C and Te = 44.2 ± 2.0 °C, and ended resting at Te_shade

= 39.4 ± 1.6 °C and Te = 44.0 ± 3.0 °C. To analyze if there was a difference in temperature between the onset and end of resting, and between supplemented

and unsupplemented birds, we performed an ANOVA with Te_shade or Te as dependent variable, food supplementation and start/stop of resting as fixed factors, and individual as random factor. On both unsupplemented and supplemen-

ted days, birds started resting in the morning at significantly lower Te_shades, but

not Tes, than when they stopped resting in the afternoon (Te_shade: F1, 17 = 16.69,

P = 0.001; Te: F1,25 = 0.00, P = 1.0). When birds had access to extra food, they

began and ended resting when Te_shade was on average 2.2 ± 2.4 °C lower (n =

18), and Te was on average 3.1 ± 3.5 °C lower, a significant effect of food sup-

plementation (Te_shade: F1, 8 = 9.51, P = 0.015; Te: F1, 8 = 11.08, P = 0.010). The

difference in Te_shade between the start and the end of the resting period was not affected by supplying extra food as indicated by the insignificant interaction

between food supplementation and start/stop of resting (F1, 8 = 0.55, P = 0.48).

Discussion When supplemented with food and water during a non-breeding year, Hoopoe Larks in the Arabian Desert decreased foraging time, increased time allocated to thermoregulation during the middle of the day, and started resting in the mor-

290 ning or resumed foraging in the afternoon at lower temperatures. In addition, food supplemented birds allocated more time to preening than unsupplemented birds. These results suggest that Hoopoe Larks face a trade-off between foraging, thermoregulation, and potentially feather maintenance. They support the hypothesis that birds optimize time allocated to these behaviors based on a combination of physiological state variables, including hydration state, level of energy reserves and Tb, as opposed to the idea that the thermal environment alone dic- tates activity patterns of desert birds. The natural low availability of water and food resources during some years or seasons forces larks to expose themselves to higher temperatures while foraging, and to invest little time in feather maintenance. This riskier life style of larks when energy and water intake are constrained is analogous to the decision of starlings (Sturnus vulgaris) that choose a more dangerous flight path when deprived of food (Cuthill and Guilford 1990), and consistent with theoretical work that predicts changes in patterns of behavior as physiological state alters (McNamara and Houston 1986; Houston and McNamara 1999). Although this study was done before the hottest months of the year, Hoopoe Larks spent little time on activities other than foraging and resting compared with other desert birds: these together accounted for 95% of daylight time on unsupplemented days. Tes during the middle part of the day in the Arabian Desert were so high that larks were forced to be inactive to avoid overheating. Chukars (Alectoris chukar) during the summer in the Negev Desert allocated 76% of their time to foraging and resting, which left 3 h per day for other activities (Carmi-Winkler et al. 1987). Similarly, Black-bellied (Pterocles orientalis) and Spotted Sandgrouse (P. senegallus) in the same area in April and May spent about 75% of the day foraging or inactive (Hinsley, 1994). The sandgrouse had access to drinking water, which left only energy requirements to be met by foraging. In a study on another lark species, Williams (2001) reported differences in time budgets between female and male Dune Larks (Mirafra erythroclamys) in the Namib Desert during the breeding season, before nests were built. Although males spent only about 80% of the day time foraging and shading, females allocated 95% of their time to these activities, presumably building up reserves for egg laying. ARKS Hoopoe Larks increased preening time on supplemented days, especially when L

Tes were moderate early or late in the day, when there was no need for shading OOPOE or perching, and the birds' mealworm intake possibly had reached the limits of H OF their digestive systems. Hoopoe Larks allocated only 2.4% of the day to preening TION on unsupplemented days, a small amount compared with the average of 9.2% A reported for 62 species of birds (Cotgraeve and Clayton 1994). The increase in preening time to 10.4% on supplemented days suggested that this behavior was SUPPLEMENT subordinate to foraging, despite the significant fitness consequences that lack of preening could entail. Functions of preening include the removal of ectopara- FOOD 291 sites and feather maintenance (Cotgraeve and Clayton 1994). Since we did not find any ectoparasites on the birds that we handled during this study, we propose that the benefit of preening for Hoopoe Larks comes mainly from feather maintenance. Feather maintenance could not only improve flight ability to escape from predators, but perhaps more importantly also augment thermoregulatory properties of the feather layer, which contributes to the regulation of dry heat transfer and of the water vapor gradient for transcutaneous water loss. Our emphasis on thermoregulatory benefits from resting, that includes shading and perching in the wind, does not exclude reduction of predation risk as a benefit from the increased resting time of larks on supplemented days. However, we think that predation risk may be less important than thermal environment in shaping the behavioral patterns of Hoopoe Larks. Although we spent many hours in the field, we have never observed predators attacking Hoopoe Larks. Most potential predators in Mahazat, including foxes and snakes, are nocturnal and unlikely to influence lark behavior during the day. Diurnal predators could include birds of prey, such as harriers (Circus sp.), that migrate through the area in spring. If predation risk was a primary factor, food supplemented birds should

be indifferent to Ta, that is, they should be motionless as much as possible regard-

less of Ta. This prediction is not supported by our data that show a significant

relationship between time spent resting and Ta in food supplemented birds 2 (Figure 4, r = 0.49, n = 9, Pslope = 0.036). We estimated energy and water expenditure of a 42 g Hoopoe Lark on unsupplemented and supplemented days based on the time budgets of a day when Ta averaged 37 °C (Table 1). Metabolic rate and total evaporative water loss for each behavioral category were estimated for a 42 g lark based on measurements of field metabolic rate and water influx rate of Hoopoe Larks using doubly labeled water (Nagy 1980; Speakman 1997) in July 1998, in combination with time budgets during the same period (Tieleman et al. unpubl.), and laboratory

data on metabolism and evaporation as a function of Ta during day and night (Table 2, Tieleman and Williams, unpubl.). A comparison of the time-energy

TABLE 1. Costs in terms of energy (E) and evaporation of water (W) of the behavioral allocation patterns of Hoopoe Larks on unsupplemented and supplemented days. Energy and water costs for each behavior are calculated from Table 2.

unsupplemented supplemented time* (h) E (kJ) W (g) time* (h) E (kJ) W (g)

forage 6.5 42.12 7.28 3.9 25.27 4.37 rest 5.3 9.33 2.17 6.7 11.79 2.75 preen 0.3 0.95 0.03 1.3 4.12 0.14 other 0.4 4.22 0.17 0.6 6.34 0.25 night 11.5 20.24 1.27 11.5 20.24 1.27 total 76.86 10.92 67.76 8.78

*based on Fig.4, at T =37°C. 292 a budgets of larks showed that access to supplemental food reduced energy expenditure by 12%, and evaporative water loss by 20% (Table 1). Our experiment could not determine the separate effects of energy intake or water intake on the behavioral decisions of Hoopoe Larks, because larks generally do not drink, excluding the possibility of supplementing water only, and because food manipulations simultaneously affect water and energy availability. However, we emphasize that water is a critical resource in desert ecosystems, especially because water availability limits the capacity for evaporative cooling, an important mechanism to avoid overheating during the hot hours of the day. The preference of Hoopoe Larks for mealworms, that contained 65% water, as opposed to seeds, with a water content of 10% (Bartholomew 1972), indicates that water might be a major consideration in the selection of food items. Additional support for the idea that foraging time may be determined by the amount of water ingested with the food comes from a comparison of the amount of food required on unsupplemented days to meet either energy needs (76.9 kJ) or water needs (10.9 g for evaporation (Table 1) and 2.2 g for excretion, assuming birds excrete one sixth of their total water efflux (Bartholomew 1972)). To meet their energy requirements, larks have to eat 13.0 g of insects, assuming a water content of 65%, an energy content of 22.5 kJ/g dry weight (Golley 1961), and an assimilation efficiency of 75.1% (Williams and Hansell 1981). In contrast, to match water needs, larks have to take in 16.9 g of insects, if each kJ of energy expended yields 27.2 mg of metabolic water (Williams 2001), and the water content of the food is 65%. The average mealworm intake on supplemented days, 16.3 g, yielded 10.6 g water and 5.7 g dry mass, which converted into 128 kJ of metabolizable energy, if energy content of dry mealworms was 30.0 kJ/g and their assimilation efficiency 75.1% (Williams and Hansell 1981). Metabolizable energy intake exceeded daily energy expenditure on supplemented days (Table 1), suggesting that larks

TABLE 2. Calculations of costs in terms of energy (E) and evaporation of water (W) of the various behaviors of Hoopoe Larks, based on laboratory data of resting metabolic rate (RMR) and total evaporative water loss (TEWL) during the day and at night, and on a combination of time budgets and measurements of field metabolic rate (FMR) and water influx rate (WIR) in July 1998. We assumed

that 83.3% of WIR was used for evaporation (Bartholomew, 1972) and that RMRnight = RMRday = ARKS L 1.76 kJ/h, TEWL35°C = 0.11 g/h, and TEWL40°C = 0.41 g/h (Tieleman and Williams, unpubl.)

a OOPOE

time (h) Ta (°C) E (*RMR) E (kJ) W (*TEWL) W (g) E cost (kJ/h) W cost (g/h) H OF forage 4.2 3.7b 27.2b 1.1c 4.70c 6.48 1.12

rest 8.1 40 1 14.3 1 3.28 1.76 0.41 TION A preen 0.16 35 1.8 0.52 1 0.02 3.17 0.11 other 0.04 35 6 0.40 4 0.02 10.56 0.42 night 11.5 35 1 20.2 1 1.21 1.76 0.11

FMR=62.6 WIR=11.1 SUPPLEMENT a based on Williams and Nagy (1984b) b

calculated as FMR-RMRnight-RMRrest-MRpreen-MRother FOOD c calculated as 0.83*WIR-TEWLnight-TEWLrest-TEWLpreen-TEWLother 293 were in a positive energy balance, a result confirmed by the average gain in body mass of 0.48 ± 0.44 g/week (n = 8, t = 3.05, P = 0.02) during the period of food supplementation. Water influx rate on supplemented days, the sum of water intake from food (10.6 g) and metabolic water production (1.8 g), exceeded total evaporative water loss (Table 1) by 3.6 g, a potential excretory water loss of 29% that suggests larks were in positive water balance. This study suggests that Hoopoe Larks maintain a precarious balance between food intake and thermoregulation. On the one hand foraging time is restricted by high temperatures during the middle part of the day, on the other hand food intake is restricted by foraging time. We suggest that in years that larks do not breed, food availability may be too low to meet requirements of growing young, in addition to self maintenance. The window of breeding opportunity might be the result of an interaction between food availability and temperature. Early in the season, thermal constraints are mild, and food intake will be less affected by availability, as long as the latter exceeds a threshold. Reproduction late in the season, when the thermal environment severely restricts foraging time, can only be successful in years of food abundance, like the locust plague of 1998, when food requirements of young and adults can be met with little foraging time. When food availability in desert ecosystems decreases as a result of overgrazing or other human impact, or when climate changes increase daily temperatures, the balance between food and thermoregulatory requirements of desert birds can be compromised, with potential effects for their reproduction and survival.

Acknowledgments We wish to express our appreciation to the National Commission for Wildlife Conservation and Development, Riyadh, for support during our research. Wildlife research programs at the National Wildlife Research Center have been made possible through the initiative of His Royal Highness Prince Saud Al Faisal, and under the guidance of Dr. A. H. Abuzinada. We thank A. Khoja, P. Paillat, S. Ostrowski, M. Shobrak, P. Seddon and J. Judas for logistical support throughout this study. T. Grubb, T. Waite, S. Daan, Y. Yom-Tov and an anonymous referee provided helpful comments on an earlier version of the manuscript. Funding for this project was received from the NWRC, and from the Schuurman Schimmel van Outeren Foundation (B.I.T.).

294 ARKS L OOPOE H OF TION A SUPPLEMENT FOOD

295

PART V Physiology, behavior, and life history: a synthesis

CHAPTER 15 Avian adaptation along an aridity gradient: physiology, behavior, and life history

B. Irene Tieleman

Introduction The theory of natural selection proposes that individuals of a population that are better adapted to the environment than others have a higher evolutionary fitness as measured by the production of descendents, and that as a result their characters dominate within the population or species (Darwin 1859). Acting simultaneously on all properties of an organism, natural selection has resulted in a large diversity of physiological, behavioral and demographic characters among birds. These characters represent components of fitness because they are related to performance in specific environments, and therefore can be viewed as life history variables. The connections between physiology, behavior and demography in the context of environmental variation might provide insights into evolutionary mechanisms that shape life history variation. Still, the relationships between physiological parameters such as metabolic rate and water flux, behavioral strategies like microsite selection and time activity patterns, and demographic variables including growth, reproduction and survival, are poorly understood. The central prediction of life history theory is that evolutionary fitness is maximized by a trade-off between current and future reproduction (Williams 1966; Stearns 1992). The balance between the fitness costs and benefits of investment in reproduction and in self-maintenance is influenced by the value of the brood and the probability of adult survival. The value of the brood is related to environmental characteristics such as food availability and nest predation, that potentially limit the number of young that can be nourished and determine the probability of raising young successfully. The probability of adult survival is likewise determined by environmental factors, including thermal conditions, food supply and vulnerability to predators, and also by physiological variables such as body condition and aging. Hence, when food supply, predation and other environmental factors vary, the balance between investment in reproduction and self-maintenance is likely to shift. Predictions about the direction of these shifts in different environments can be evaluated by correlations between physiological, behavioral and demographic factors that reflect evolutionary responses. Attempts to integrate physiology into the demographic theory of life history evolution have focused on the relationship between metabolism and fecundity and GRADIENT mortality. The hypothesis that a higher metabolic rate is associated with higher

fecundity but a shorter life span has been supported by some intraspecific studies ARIDITY on birds, but not by others (Calder & King 1974; Ricklefs 1974; Hails & Bryant AN 1979; Ettinger & King 1980; Bryant & Westerterp 1983; Ricklefs & Williams 1984; Daan et al. 1996). An interspecific analysis including 325 species of birds ALONG TION did not reveal a consistent association between metabolic rate and demographic A parameters related to fecundity and longevity, after correcting for body mass and ADAPT taxonomic affiliation (Trevelyan et al. 1990). Unfortunately, this study used the VIAN metabolic rates compiled by Bennett and Harvey (1987) who combined basal A 301 metabolic rates (BMR), strictly defined as minimal energy expenditure of a fasted endotherm in its rest phase at thermoneutral temperatures (King 1974), and metabolism measurements outside this definition, including thermoregulatory costs. Including metabolic rates measured under varying conditions adds substantial variation to the data set and might have confounded analyses. In addition, other physiological variables such as field metabolic rate (FMR) or water flux (WF), integrative measures of energy expenditure and water influx rate of free-living animals measured over a 24-h interval using the doubly labelled water technique (Nagy 1980; Speakman 1997), were not considered by Trevelyan et al. (1990). A more detailed exploration that relates a variety of carefully defined and measured physiological and behavioral variables to variation in growth, reproduction and survival might provide a more powerful test of the putative association between physiological, behavioral and demographic properties. This paper summarizes the variation in physiology, behavior and demography among a group of closely related species of larks that occur along an environmental continuum of aridity. First, the physiological mechanisms underlying the variation in energy, water and heat balance are explored to identify the selection pressures that are responsible for the physiological variation among larks. Second, I discuss behavioral strategies including microclimate selection and activity patterns in the context of environmental and physiological constraints. Third, I correlate demographic parameters related to growth, reproduction and survival with aridity. And finally, I evaluate our knowledge of the variation in physiology, behavior, and demography in relation to environmental aridity in light of predictions from life history theory. My central prediction is that along a gradient of increasing aridity, decreasing availabilities of energy, water and time limit investments in current reproduction and cause a shift towards investment in self-maintenance. Specifically, I predict that with increasing aridity larks expend less energy and lose less water, grow slower as nestlings, reproduce less frequently, lay smaller clutches, and live longer.

Physiological mechanisms Physiological variation along an aridity gradient Lark species that occur along a gradient of increasing aridity have gradually reduced energy and water budgets reflected in lower BMR (Chapter 4, 6) and FMR (Chapter 8), lower total evaporative water loss (TEWL) (Chapter 4, 6) and WF (Chapter 8) (Figure 1a,b). In addition, larks from hot deserts are better able to cope with high ambient temperatures than larks from temperate climates (Chapter 6). The variation in physiological phenotypes of larks along an aridity gradient can not be attributed to acclimation to temperature, food availability or day length (Chapter 5), or to phylogenetic relationships (Chapter 4). The phys-

302 iological diversity therefore probably results from genetic differences due to natural selection, although future work is required to investigate the role of developmental plasticity.

Mechanisms to reduce metabolism Several authors have proposed that interspecific variation in FMR and BMR may be attributable to variation in organ size, because tissue-specific metabolic rates of organs such as heart, brain, liver and kidney are relatively high (Kersten & Piersma 1987; Daan et al. 1990; Chappell et al. 1999). Large organs presumably provide the machinery for a high metabolic output in the field, and result in high BMR. This thesis does not support this hypothesis at the interspecific level: desert lark species do not have smaller organs than mesic larks depite their reduction in BMR of about 50% and in FMR of 24-39% (Chapter 5, 8). However, at the intraspecific level variation in BMR resulting from acclimation to different environmental conditions is at least partly correlated with the size of intestine, liver, kidneys and stomach (Chapter 5, 8). Alternative mechanisms that might underlie the reduction in BMR with increasing aridity are lower tissue-specific metabolic rates and lower energetic costs of the immune system. Low tissue-specific metabolic rates have the advantage of minimizing energy requirements and heat production, while large organs can be maintained to act as water reserves for periods of acute heat stress. A gram of protein tissue not only contains more water than a gram of fat, protein metabolism also produces less heat per unit water than fat metabolism. If the immune system requires significant input of energy, birds living in desert environments, where the risk of infection may be low, may have relatively low metabolic costs to maintain adequate immunity. Unfortunately, our understanding of the energetic costs of maintaining an immune system is still rudimentary (Lochmiller & Deerenberg 2000).

Mechanisms to minimize water loss The literature contains a number of suggestions for mechanisms that might reduce TEWL in desert birds. Counter-current heat exchange in the nasal passages of some species can ostensibly recover significant quantities of water from the exhaled air stream, thus lowering respiratory water loss (Schmidt-Nielsen et al. GRADIENT 1970). A number of authors have suggested that hyperthermia, the elevation of body temperature 2-4 °C above normal, can reduce TEWL (Calder & King 1974; ARIDITY Weathers 1981; Dawson 1984; Withers & Williams 1990). A third mechanism AN

suggested to reduce TEWL is the adjustment of the lipid structure and composi- ALONG tion in the skin affecting cutaneous water loss (Menon et al. 1989; Menon et al. TION 1996). A

In larks from deserts reductions in water loss rates at moderate air temperatures ADAPT

are not the result of more efficient counter-current heat exchange in the nasal VIAN A passages (Chapter 10), or of hyperthermia (Chapter 6, 11), but appear attributa- 303 Figure 1. Physiology, behavior, growth, reproduction, and survival of larks along an aridity gradient. Solid and hatched lines represent regression equations through the data. Grey lines stand for hypothesized relationships. Original data can be found in the appropriate chapters or in the text. a. Basal metabolic rate (BMR, kJ d-1 g-0.884, filled symbols, solid line, Chapter 4) and field metabolic rate (FMR, kJ d-1 g-0.879, unfilled symbols, hatched line, Chapter 8). b. Total evaporative water loss (TEWL, g d-1 g-0.770, filled symbols, solid line, Chapter 4) and field water flux (WF, x 3, g d-1 g-0.730, unfilled symbols, hatched line, Chapter 8). c. Proportion of total day-time spent active. d. Field metabolic rate per nestling (kJ d-1 g-1, Chapter 8). e. Field water flux per nestling (g d-1 g-1, Chapter 8). f. Growth constant K (days-1, Chapter 8).

304 Figure 1 (continued). g. Average number of breeding seasons per year. h. Average clutch size (Chapter 8). i. Average number of clutches per breeding season (Chapter 8). j. Probability of daily nest survival (day-1, Chapter 8). k. Survival of young from fledging to recruitment in the breeding population as predicted from the length of the post-fledging parental care period. l. Probability of adult survival (year-1) for Hoopoe Larks and Skylarks. Dotted line represents hypothesized relationship between survival and aridity. GRADIENT ARIDITY AN ALONG TION A ADAPT VIAN A

305 ble to differences in cutaneous water loss, possibly influenced by the lipid composition of the epidermis and changes in the vascularization of the skin (Chapter 7). Cutaneous water loss constitutes 50-70% of TEWL in larks at moderate air temperatures (Chapter 7). The suggestion that low metabolic rates are correlated with low ventilation rates and therefore should result in reduced respiratory water loss (Dawson 1982), is not supported by our findings that larks from arid environments have similar mass-specific values of respiratory water loss despite lower metabolic rates compared with species from mesic areas (Chapter 7). Skin lipid structure and composition and skin vasodilation can probably vary independently of metabolism, ambient temperature, and body temperature, and thereby provide flexible mechanisms to adjust cutaneous water loss depending on environmental conditions or physiological state. In contrast, counter-current heat exchange and hyperthermia are less efficient and appear to have disadvan- tageous side-effects. Empirical evidence shows that counter-current heat exchange in the nasal turbinates saves only 10% of TEWL in Crested Larks and 0% in Desert Larks measured at 25 °C instead of the predicted 49%, and that its effectiveness decreases when ambient temperature increases (Chapter 10). Hyperthermia would presumably only be used during short time periods and might affect not only water loss but also protein structure and enzyme function. A higher body temperature setpoint would require a permanently increased metabolism.

Mechanisms to cope with heat The combination of a low metabolic heat production and a low dry heat transfer coefficient enables larks from deserts to better cope with high ambient temperatures than species from mesic areas (Chapter 6). The dry heat transfer coefficient is a complex variable that combines the effects of feather insulation, skin vasodilation and surface to volume ratios. The common body shape of all larks suggests that the latter factor can not explain the interspecific variation. It will be interesting to investigate the first two components in the future.

Evolutionary significance The mechanisms that underlie the variation in physiological phenotypes among larks suggest that in arid environments three selection pressures act independently and simultaneously: lack of water, food scarcity, and high ambient temperatures. Larks from deserts have evolved a mechanism to reduce water loss that functions independently of metabolism and body temperature. This suggests that the frugal water economy of desert species is not merely a byproduct of constraints on the energy balance, but an adaptation to water scarcity per se. In addition, the reduction in metabolism potentially is accomplished without compro- mising the water storage capacity of the internal organs. Low food availability is

306 presumably the selective agent responsible for the reduced energy requirements and concurrent low expenditure in arid environments. Low metabolic heat production is also favorable in light of the high ambient temperatures that have apparently selected for a reduced dry heat transfer coefficient.

Behavioral strategies Variation in behavior along an aridity gradient The time available per day for activities such as foraging or providing for young depends on the time of the year, the thermal conditions and the food availability. During spring, we observed that larks in temperate areas can be active during the entire daylight period, whereas species in hot deserts, such as Hoopoe Larks (Chapter 14) and Bar-tailed Desert Larks (unpublished data), are forced to spend the middle part of the day inactive in the shade to avoid overheating (Figure 1c). Consequently, temperate-zone larks can invest more time per day in raising offspring than species in deserts.

Behavioral mechanisms and adaptive significance Larks in the desert spend the middle part of the day inactive in sites with favorable microclimates to avoid overheating (Chapter 13, Chapter 14). This behavioral pattern indicates that the thermal environment presents a constraint on the time available for activity. In addition, the selection of relatively cool microsites probably reduces water requirements for evaporative cooling (Chapter 13). A period of inactivity during the day also reduces energy expenditure and thereby food requirements. In response to an experimental increase in food availability Hoopoe Larks reduced the time spent foraging, increased the time spent inactive during the middle part of the day, and increased the time devoted to maintenance activities such as preening (Chapter 14). With access to extra food, they started and ended their midday shading period when temperatures were lower than when they had no access to supplemental food. These results indicate that the desert environment poses constraints on food and water intake, foraging time, and thermoregulation. In addition, they show that birds optimized the time spent foraging and thermoregulating depending on a combination of

physiological state variables including body temperature, hydration state and GRADIENT level of energy reserves. ARIDITY AN Demography along an aridity gradient Growth ALONG TION

Nestling growth rate bears a relation to evolutionary fitness through energy and A nutrient requirements of growing young and through survival of offspring to the ADAPT end of the growth period (Lack 1968; Ricklefs 1979) and is thus an important VIAN component of the life history of species. The growth rate constant K (days-1) of A 307 the logistic equation provides an overall measure of weight increase and is commonly used to express growth rate (Ricklefs 1979). In a data set including nine species of larks, growth rate decreased along a gradient of increasing aridity (Chapter 8, Figure 1f). What determines growth rate in birds is not completely understood, and suggestions vary from physiological and structural constraints (Ricklefs 1979; Starck & Ricklefs 1998) to ecological factors such as food supply and nest predation (Lack 1968; Perrins 1977; Lima 1987). Physiological and structural constraints may vary between species with different developmental strategies such as altricial and precocial birds, but are unlikely to explain the variation within a group of closely related species with similar development patterns such as the lark family. Along a gradient of increasing aridity, and concurrent decreasing resource availability, food and water supply forms a more likely explanation for the decrease in growth rate. However, an effect of nest predation can not be excluded and future research will be required to identify the mechanisms responsible for the variation in growth rates among larks from diverse environments. Environments where food and water are in short supply might favor young with low energy and water requirements not only for growth, but also for metabolism, evaporation and excretion. In support of this hypothesis, mass-specific FMR of 6-8 day old nestlings of six species of larks decreases with increasing aridity (Chapter 8, Figure 1d). A similar pattern of decreasing mass-specific water flux with increasing aridity was marginally insignificant (P = 0.057) (Chapter 8, Figure 1e). Based on these regression analyses, nestlings in hyperarid deserts are estimated to expend on average 28% less energy for metabolism and lose on average 37% less water than counterparts in mesic habitats.

Reproduction Understanding life history variation among species along an aridity gradient requires knowledge of timing and intensity of reproductive periods during an individual's life time. This section describes the frequency of reproduction as the number of breeding seasons per year, and the intensity of reproduction per breeding season measured by clutch size and number of clutches. In temperate zones, birds breed each spring, yet in many arid-zone environments breeding depends on rainfall that is generally low and can be unpredictable (Immelmann 1973). Information on the frequency of reproduction of individual larks from varying environments is limited, evoking the need to use population- level measures, such as the proportion of birds with territories that breed in a given season. From 1998 to 2002 we monitored the breeding activities of Hoopoe Larks in the Arabian Desert, and found that reproduction is related to rainfall (Figure 2). Hoopoe Larks are present in the nature reserve Mahazat as-Sayd year-round, but 308 Figure 2. Nest-building and tending nests with eggs or young by Hoopoe Larks in relation to rainfall in Mahazat as-Sayd, Saudi Arabia, during the period 1998-2002. Total rainfall per breeding season is separated in rain prior to the breeding season (June-February) and during the breeding season (March-May). their breeding activities are seasonal and restricted to the period February-June. Observations of colorbanded birds show that at least some individuals stay in the same territory for a minimum of four consecutive years. Our core study area consists of about 35 territories that were occupied by territorial Hoopoe Lark pairs each spring. Territories are large, about 0.4-0.5 km2, and the spatial pattern of rainfall frequently causes variation among territories even within the study area. In two years following low winter rainfall, 1999 and 2000, the majority of the GRADIENT population did not attempt to breed (Figure 2). In 1999, two females responded ARIDITY

to a late and local spring rain by building nests, but they did not initiate egg- AN laying. In 2000, ten females were observed nest-building after a small rain, but most individuals did not complete their nests and only one of these birds layed ALONG

eggs. Food availability and temperature interact to form a window of breeding TION A opportunity for the birds in the Arabian Desert. Early in the season the threshold of food supply required to meet the requirements of growing young and of self- ADAPT VIAN maintenance is relatively low. In the course of the season the threshold level of A 309 food supply increases because time available for foraging decreases as a result of higher temperatures (Chapter 14). During drought years the minimum threshold of food supply is not reached, and birds do not breed at all. I collated observations on breeding frequency of different species of larks and found a decrease with increasing aridity (Figure 1g). The patterns of breeding activities in relation to rainfall of Bar-tailed Desert Larks and Dunn’s Larks, two other species that are present year-round in Mahazat as-Sayd, are identical to that of Hoopoe Larks during the period 1998-2002 (personal observation). In contrast, during the period 1989-1993 Dune Larks in the Namib Desert bred each year at predictable times, between December and March, despite complete lack of rainfall during these years (Williams 2001). Yearly breeding activities are also found in Woodlarks and Skylarks in the temperate zones. Unfortunately information on breeding frequencies of semi-arid larks is difficult to interpret due to its qualitative nature (Maclean 1970a; Lloyd 1999). Breeding densities of resident insectivorous larks in the semi-arid Nama Karoo in South Africa vary with rainfall; fewer nests are found in dry years (Lloyd 1999). The granivorous nomadic lark species in South Africa disappear from areas in drought years and appear in areas that have received rain, where they can breed at any time during the year (Maclean 1970a; Lloyd 1999). The lack of information on movements of individual birds or even populations of these nomads precludes an estimate of their breeding frequency. The intensity of reproduction in years that larks breed can be measured by the clutch size and the number of clutches per breeding season. Clutch size varies among and within species but decreases when the environment becomes more arid (Chapter 8, Figure 1h). Based on a regression of clutch size as a function of aridity (Figure 1h), I calculated that larks in hyperarid deserts have an average clutch size of 2.8 eggs, whereas species in mesic areas lay an average of 3.9 eggs. In addition, the number of clutches per breeding season decreases with increasing aridity from an average of three per year in mesic habitats to one per year in hyperarid deserts (Chapter 8, Figure 1i). Hence, the total number of eggs produced per breeding season averages 2.8 for larks in hyperarid deserts and 11.7 for species in mesic environments, more than a four-fold difference in intensity of reproduction. A trade-off between current and future reproduction assumes that the annual reproductive investment is associated with fitness costs (Williams 1966; Stearns 1992). Although these costs are difficult to quantify, they might be approached by indirect measures. If the reproductive investment is correlated with parental effort as measured by energy expenditure, water loss and clutch size, then the reproductive value of a single brood should be lower for an arid-zone species than for a lark from mesic habitats (Chapter 8). This hypothesis leads to the prediction that fewer young are recruited into the breeding population per year in arid 310 habitats than in mesic environments, and that an adult arid-zone lark should have a higher annual survival than an adult of a mesic-zone species.

Survival The investment in current reproduction should depend on the probabilities that the reproductive attempt will successfully produce offspring and that the parents will have other opportunities to reproduce in the future. Defining successful production of offspring as recruitment into the breeding population, and assuming that all larks can reproduce in the first breeding season after hatching, recruitment depends on nestling mortality and post-fledging survival. The chance of future reproduction for parents is largely determined by the probability of survival to the next year, although body condition may also play a role. Nest predation increases with increasing aridity and causes a higher nestling mortality in deserts (Chapter 8, Figure 1j). The probability that a lark nest survives until fledging in a hyperarid environment is about 2%. In contrast, 87% of the nests in mesic habitats successfully produce fledglings. The probability of nestling survival does not only depend on nest predation but also on food provi- sioning by the parents. Woodlarks and Skylarks in mesic areas normally provide sufficient food to successfully rear all nestlings in a brood. In contrast, at least one chick starved to death in the majority of nests of four species of larks in the Arabian Desert (Chapter 8). Although insufficient information precludes the incorporation of renesting attempts in the pattern, it is obvious that the combination of clutch size, number of clutches, nest survival, and nestling starvation results in a yearly production of fledglings that markedly decreases with increasing aridity. Quantitative information about the probability of fledgling survival is not available, but an indirect estimate of recruitment can be made using the post-fledging parental care period of various species. Post-fledging parental care has been measured in few lark species, but data on Skylark (6 days (Cramp 1988)), Short- toed Lark (1-3 weeks (Cramp 1988)), Dune Lark (3 weeks, J.B. Williams personal communication), and Hoopoe Lark (> 1 month, Cramp (1988) and personal observation) suggest that the parental care period is longer when environments are more arid (Figure 1k). If post-fledging parental care is an index of fled- GRADIENT ging survival, recruitment is higher in arid environments. Considering that arid-zone larks do not breed each year and invest less in repro- ARIDITY AN ductive attempts during a breeding season (Chapter 8), one might expect that adult survival is higher in these species than in larks from temperate zones ALONG

(Figure 1l). The probability of annual survival of adult birds can be measured by TION A monitoring individually marked birds over the course of several years, information that is available for few lark species. The literature contains several esti- ADAPT VIAN mates of annual survival for Skylarks in Europe (Delius 1965; Spaepen 1991; A 311 Schläpfer 1988; Wolfenden & Peach 2001), but the study of Wolfenden and Peach (2001) seems by far the most robust. These authors have monitored a population of colorbanded Skylarks in a dune area near Liverpool for twenty years and used mark-recapture models to estimate survival, taking into account the probability of recapture. Annual survival rates of Skylarks increased from around 0.39 during 1980-1985 to 0.66 during 1995-1998, with an average of 0.51 (SE 0.024) over the entire study period (Figure 1l). An estimate for the Hoopoe Lark, a species at the arid extreme of the aridity gradient, comes from four years of colorbanding birds in our study population in the Arabian Desert (Figure 1l). To my knowledge this is the first estimate of annual survival for a desert bird. Using resightings of marked individuals in a mark-recapture model, we calculated that the probability of survival was 0.58 (95% CI: 0.33 - 0.80) with a higher value for males (0.65) than females (0.34) (Tieleman, Williams and Doherty, unpublished data). Because these models assume that missing birds are dead while they might have permanently emigrated from the study area, the differences in survival estimates between sexes might indicate that females move over larger distances than males. Survival estimates for other larks are not available, but anecdotal information on longevity of 3 individuals shows that Dune Larks in the Namib Desert can live for at least 6 years (Williams 1992). Evaluation of the hypothesis that adult survival increases with increasing aridity awaits future work on larks from arid, semi-arid and mesic environments.

Life history evolution along an aridity gradient Predictions from life history theory are based on the central tenet that evolutionary fitness is maximized by a trade-off between current and future reproduction (Williams 1966; Stearns 1992). The balance between current reproductive investment and self-maintenance is reflected in their inverse relationship and is responsive to environmental conditions that affect expectations of reproductive success and adult survival. Along a gradient of increasing aridity, with concurrent decreasing availabilities of energy, water and time, I hypothesized that the environment limits investments in current reproduction causing a shift in favor of investment in self-maintenance. The physiological and behavioral adaptations of larks along an aridity gradient indicate that food supply, water availability and thermal environment constitute selection pressures that presumably also act on growth, reproduction and survival. With increasing aridity less energy, water and time are used by the parents during the reproductive season, nestling energy and water requirements are reduced and growth is slower, reproductive effort measured by clutch size and number of clutches decreases, yearly reproductive success is lower, and adult annual survival is presumably higher. These correlations between physiology, behavior, 312 demography and environment are consistent with predictions from life history theory, and open up the challenge to understand the mechanisms that link physiology and behavior directly to growth, reproduction and survival. The physiology of growth has been extensively studied, but although we have gained insights into the differences between development strategies of the extremes of the precocial-altricial spectrum (Starck & Ricklefs 1998), the cause of variation in growth rate among closely related species with similar development remains an enigma. An important step will be to determine whether the variation in growth rates among larks results from genetic differences or from phenotypic plasticity. One might expect a role for food in explaining the variation in growth rates along an aridity gradient, perhaps through levels of essential nutrients (Ricklefs 1979). Physiological variables such as body condition and hormone balance probably play an important role in the timing and intensity of reproduction. How predictable environmental factors such as daylength and seasonal changes in temperature interact with unpredictable factors such as rain and food supply to form a window of breeding opportunity in arid environments is poorly understood (Hau 2001). An integrative approach that combines energetics and endocrinology with behavior under varying environmental conditions may be required to explore the cues that trigger the onset of breeding and determine the motivation of parents to tend their eggs and young. A plethora of behavioral and physiological factors has been proposed to affect adult survival, some based on experimental studies, others based on correlative evidence. Mortality as a result of predation may be related to activity patterns, or to nest microsite selection that influences the exposure of incubating parents (Ricklefs 1969; Martin 1993). Low BMR and FMR may cause a lower risk of starvation or poor body condition through reduced food requirements. Reduced metabolism also could result in a slower build up of oxygen free radicals that cause deterioration of physiological processes and thereby influence aging. In these cases low BMR and FMR correlate with each other and with high investments in self-maintenance. In contrast, studies focusing on individuals within a species have attributed low BMR to low levels of self-maintenance and high investments GRADIENT in reproduction (Deerenberg et al. 1998; Wikelski et al. 1999). Low levels of

metabolism in arid environments may also be explained by an energetically inex- ARIDITY pensive immune system in environments where vectors for parasites are scarce. AN A better understanding of survival along an aridity gradient will benefit from future work on the relationship between predation risk and behavior, and on the ALONG TION interaction between metabolism, immune system and body condition. A The challenge for the future will be to further integrate physiology and behavior ADAPT into the demographic theory of life history evolution in order to increase our VIAN understanding of causation and function of life history variation. The major A 313 obstacle will be to overcome the different time scales of evolved and individual responses. Therefore, a combination of comparative studies, modeling, and experiments might prove most fruitful to explore patterns of phenotype-by-environment correlation, to illuminate mechanisms underlying these patterns, and to connect trait values with fitness.

314 GRADIENT ARIDITY AN ALONG TION A ADAPT VIAN A

315

NEDERLANDSE SAMENVATTING Aanpassingen van vogels langs een droogtegradiënt: fysiologie, gedrag en levensloop 318 Iedereen kent de leeuwerik in Nederland als klein vogeltje dat hoog in de lucht uitbundig zingend het voorjaar aankondigt. Na minutenlang zijn liedje ten geho- re gebracht te hebben duikt hij dan naar beneden om in de natte graslanden waar hij zich het meest thuisvoelt een maaltje van insecten en zaden bij elkaar te scharrelen. In de loop van april wordt een nest gebouwd op de grond tussen het gras, waarin vier of vijf eieren gelegd worden. Tijdens het voorjaar en de zomer brengt een leeuweriken-paar in het vruchtbare Nederland vaak drie of vier nesten met jongen groot. Onze leeuwerik, de Veldleeuwerik, is één van de ongeveer 80 soorten leeuweriken die er zijn in de wereld. Een aantal soorten komt voor in veel minder vruchtbare gebieden, zoals de woestijn. Hoe past een leeuwerik zich aan aan deze totaal andere situatie?

Variatie en aanpassing De grote verscheidenheid aan soorten en de wijze waarop ze zijn aangepast aan hun omgeving zijn een bron van inspiratie voor veel biologen. Het verklaren van de variatie aan soorten en aanpassingen vormde de aanleiding voor de evolutie- theorie, die de fundering voor veel biologisch onderzoek vormt. De theorie van evolutie door natuurlijke selectie neemt aan dat individuen in een populatie die beter zijn aangepast aan hun omgeving dan anderen een grotere evolutionaire fitness hebben. Met andere woorden, individuen die het best zijn aangepast aan hun omgeving krijgen de meeste overlevende nakomelingen (inclusief kleinkin- deren, achterkleinkinderen, enz.). Daardoor gaan hun eigenschappen overheer- sen binnen de populatie en de soort. Bij eigenschappen kan men denken aan fysiologische kenmerken zoals stofwisseling en lichaamstemperatuur, aan gedragsmatige factoren waaronder de verdeling van tijd over verschillende akti- viteiten, en aan levensloop- of demografische factoren zoals aantal jongen en veroudering. Door veel biologen wordt aangenomen dat de evolutionaire geschiedenis van de meeste soorten zo lang is geweest dat natuurlijke selectie zijn werk heeft kunnen doen. De eigenschappen van een soort worden daarom vaak als aanpassingen van die soort aan zijn omgeving beschouwd. Soorten komen voor in verschillende omgevingen, en hebben dus verschillende aanpassingen nodig. Daardoor is de grote variatie aan soorten en eigenschappen ontstaan. Aanpassingen zijn op allerlei niveaus en op verschillende manieren te bestuderen (Box 1). Uitgaande van een organisme als individu kan men de aandacht TTING

richten op steeds lagere niveaus. Organismen zijn immers opgebouwd uit orga- A nen, zoals hart en longen, die op hun beurt zijn samengesteld uit cellen. Cellen bestaan uit een celmembraan, plasma en organellen die verschillende functies SAMENV binnen de cel hebben. Deze celonderdelen zijn opgebouwd uit moleculen. De bekendste moleculen in een cel zijn de DNA-moleculen, die de genetische code

bevatten waarmee fysiologie, gedrag en levensloop van een organisme zijn gepro- NEDERLANDSE 319 grammeerd. Naar hogere niveaus gedacht vormen individuen samen een populatie. Individuen van één of meerdere populaties, die onderling kruisbaar zijn en dus voortdurend hun genetische materiaal uitwisselen, vormen een soort. En elke soort heeft een unieke plaats in een ecosysteem. Met moderne technieken kunnen we steeds kleinere details bestuderen, bijvoorbeeld expressie van genen, maar ook steeds grotere kaders, zoals mondiale effecten van verstoringen in eco- systemen.

Box 1. Verschillende soorten vragen Variatie en aanpassingen kunnen niet alleen op allerlei niveaus maar ook op allerlei manieren bestudeerd worden, afhankelijk van het soort vragen waarin men geïnteresseerd is. Vier soorten vragen worden vaak gesteld in de Biologie en ze komen ook alle vier in dit proefschrift aan bod: 1. Waaruit bestaat de variatie? Dit is de vraag naar de overeenkomsten en verschillen tussen eigenschappen van soorten of van individuen binnen een soort. Vaak wordt de variatie in eigenschappen in verband gebracht met variatie in omgevingsfactoren. Meestal kunnen we weinig zeggen over oorzaak en gevolg, maar de patronen kunnen wel aanleiding geven voor hypothesen over het ontstaan, de werking en de evolutionaire betekenis van de variatie. Antwoord op deze vraag is dan ook nodig voor men andere vragen kan stellen. 2. Hoe is de variatie ontstaan? De vraag naar de oorsprong en evolutionaire geschiedenis van soorten en eigenschappen is moeilijk te onderzoeken. De evolutionaire geschiedenis kan worden gereconstrueerd met behulp van fossielen, maar veel soorten en eigenschappen zijn niet bewaard in fossielen. Daarnaast kunnen we genetische verwantschappen van huidige soorten bepalen en met die informatie stambomen construeren die een beeld geven van het ontstaan en de evolutie van soorten en hun eigenschappen. Het proces van evolutie kunnen we hiermee niet goed bestuderen omdat we niet kunnen meten wat de selectiedrukken waren in het verleden. De vraag naar het ontstaan van soorten en eigenschappen grenst aan vragen naar hoe die variatie tegenwoordig blijft bestaan. Onderzoek aan deze vragen in het heden kan ons daarom misschien wijzer maken over het verleden. 3. Waardoor bestaat de variatie? De directe oorzaak van een eigenschap is meestal gelegen in de mechanismen die op een lager niveau werken. Zo kan bijvoorbeeld de verklaring voor een laag waterverbruik van een dier gevonden worden in de fysiologische werking van delen van het dier, zoals efficiënte nieren. Naast fysiologische mechanismen zijn er gedragsstrategieën, zoals het in de schaduw blijven om minder water te verdampen als het heet is. De fysiologische en gedragsme- chanismen die verantwoordelijk zijn voor de aanpassingen op het niveau van het organisme kunnen antwoord geven op de vraag welke omgevingsfactoren een rol spelen bij natuurlijke selectie. 4. Waarom bestaat de variatie? De spannendste vragen zijn misschien wel de vragen naar de evolutionaire functie van bepaalde eigenschappen omdat die inzicht geven in het proces van evolutie. De reden voor het bestaan van eigenschappen wordt vastgesteld door het meten van het effect van die eigenschappen op de evolutionaire fitness, ofwel de productie van nakomelingen. De belangrijkste parameters die van invloed zijn op de evolutionaire fitness zijn overleving en jaarlijkse voortplanting. Om inzicht te krijgen in het proces van evolutie richt onderzoek zich op de

320 effecten van verschillen in omgevingsfactoren en eigenschappen op overleving en voortplanting. Vogels in de woestijn Extreme klimaten lenen zich goed voor onderzoek naar aanpassingen, want onder extreme omstandigheden zijn ook extreme aanpassingen te verwachten. Men krijgt de kans om als het ware de uitvergrote versies van eigenschappen te bestuderen waarin de details duidelijk te zien zijn. Het extreme klimaat van mijn onderzoek, de woestijn, wordt gekenmerkt door droogte, hitte en een lage pri- maire produktie waardoor er weinig voedsel is. Men zou verwachten dat de bewo- ners van deze omgeving, in dit onderzoek de vogels, zijn aangepast aan deze kenmerken door zuinig met energie (voedsel) en water om te gaan. Bovendien moeten ze hoge temperaturen kunnen tolereren zonder zelf oververhit te raken. Een woestijnomgeving zou ook bepaalde eisen kunnen stellen aan de levensloop, die beschreven wordt door groei, voortplanting en overleving. Tegen de verwachting in hebben biologen in de jaren 60, 70 en 80 geen algemene verschillen kunnen vinden tussen de fysiologie van woestijnvogels en die van vogels uit andere gebieden. Daarna is er een tijd weinig onderzoek gedaan aan vogels in de woestijn. Hoofdstuk 2 introduceert de woestijnen van de wereld en geeft een overzicht van de literatuur over woestijnvogels tot 1998. De nadruk ligt op onze kennis over de fysiologische en gedragsmatige aanpassingen van vogels aan het woestijnleven en op het opnieuw vergelijken van woestijnen niet-woestijnsoorten. De onderlinge verbanden tussen energiebalans, waterhuishouding en warmteregulatie vragen TTING A SAMENV

Figuur 1. Schematische weergave van de verbanden tussen energiebalans, waterhuishouding en NEDERLANDSE warmteregulatie. 321 om een integrale benadering (figuur 1). De conclusie is dat zowel fysiologie als gedrag wel degelijk zijn aangepast aan het leven in de woestijn. Met name energie- en waterverbruik zijn lager bij woestijnvogels dan bij soorten van buiten de woestijn (hoofdstuk 3). De minimum stofwisseling, de energetische kosten voor onderhoud van het lichaam, is gemiddeld 17% lager bij woestijnvogels. Uit een eerder gepubliceerde studie bleek dat ook de verdamping lager was. Deze metingen zijn gedaan in het laboratorium. In het veld verbruiken vrij-levende woestijnvogels 49% minder energie en 59% minder water dan soorten uit gebieden buiten de woestijn.

Opzet en inhoud van mijn onderzoek Na de hierboven genoemde inleidende hoofdstukken in deel I beschrijft deel II van dit proefschrift de variatie in fysiologie, gedrag, en levensloop van verschillende soorten leeuweriken, die voorkomen in biotopen langs een droogtegra- diënt. Deze patronen geven inzicht in de aanpassingen die nodig zijn om te leven in verschillende biotopen. Deel III bevat onderzoek naar de mechanismen die ten grondslag liggen aan de aanpassingen in de fysiologie van woestijnvogels. Deel IV behandelt gedragsstrategieën die van belang zijn voor de overleving van leeuweriken in woestijngebieden. Deel III en IV leggen de basis voor inzicht in de belangrijkste selectiedrukken die hebben geleid tot de aanpassingen van fysiologie en gedrag. Deel V integreert kennis van de variatie in fysiologie, gedrag en levensloop langs een droogtegradiënt, en plaatst de resultaten in het perspectief van de evolutionaire theorie van levenslopen. Het doel van dit onderzoek is te begrijpen waarom bepaalde combinaties van fysiologie, gedrag en demografische factoren voorkomen in bepaalde biotopen. Belangrijk voordeel van dit onderzoek is dat deze factoren tegelijk zijn bestudeerd in hetzelfde systeem.

Leeuweriken langs een droogtegradiënt De familie van de leeuweriken is één van de weinige vogelfamilies met soorten die voorkomen in biotopen langs een droogtegradiënt, variërend van kurkdroge woestijnen tot natte graslanden. Deze droogtegradiënt weerspiegelt de gradiënt van selectiedrukken die dieren ervaren met toenemende droogte, namelijk afne- mende water- en voedselbeschikbaarheid en hogere temperaturen. Het voordeel van dit onderzoekssysteem is dat soorten niet langer worden ingedeeld in de cate- gorieën woestijn en niet-woestijn, maar geplaatst worden langs een continue gra- diënt van omgevingsfactoren. Dit maakt een meer gedetailleerd onderzoek naar de aanpassing van fysiologie, gedrag en levensloop mogelijk. Alle leeuweriken zijn genetisch nauw met elkaar verwant en hebben vergelijkbare gewoontes wat betreft voedsel zoeken, nestelen, enz. Daardoor zijn verschillen tussen soorten

322 eenvoudig toe te schrijven aan verschillen tussen biotopen, en wordt de verklaring daarvan niet gecompliceerd door verschillen in evolutionaire geschiedenis, voedselkeuze, nestplaats, enz. Leeuweriken zijn geschikte vogels voor onderzoek. Ze zijn goed te observeren. Ze wennen snel aan gevangenschap en kunnen dus ook in het laboratorium gemeten worden. Ze zijn te vangen en terug te vangen in het veld, en lenen zich dus voor herhaalde metingen aan hetzelfde individu. En de meeste soorten blijven het hele jaar op dezelfde plek, of trekken maar kleine afstanden, zodat hun aanpassingen aan één karakteristieke biotoop kunnen worden toegeschreven.

Patronen in fysiologie en gedrag Naarmate de omgeving droger is neemt het energie- en waterverbruik van leeuweriken geleidelijk af (hoofdstuk 4-8). Als men beide extremen van de gradiënt vergelijkt zijn de energetische onderhoudskosten van het leeuwerikenlichaam 54% lager in de woestijn dan in natte graslanden (hoofdstuk 4, 6). De verdamping, gemeten in het laboratorium, is 36% lager. In het veld is het energieverbruik van vrijlevende vogels 40% lager bij de woestijnsoorten en hun wateropname is 57% lager (hoofdstuk 8). De laboratoriumresultaten geven aan dat er verschillen zijn in fysiologie tussen leeuweriken uit de woestijn en soorten uit nattere gebieden. De veldgegevens zijn gebaseerd op de combinatie van fysiologie en gedrag, waar uiteindelijk natuurlijke selectie op werkt. Niet alleen zijn de fysiologische kosten lager bij de woestijnsoorten, ook hun gedrag kost minder water en energie. Het verschil in gedrag zit vooral in de lange siësta van leeuweriken in de woestijn als het te heet is om aktief te zijn (hoofdstuk 14). De zuiniger energie- en waterbalans van leeuweriken uit droge gebieden gemeten in het laboratorium zou het resultaat kunnen zijn van genetische aanpassingen door natuurlijke selectie of van ‘fenotypische’ aanpassingen als gevolg van acclimatisatie van het individu aan de omgeving. Acclimatisatie aan temperatuur, daglengte of voedselbeschikbaarheid kan de verschillen tussen de leeuweriksoorten niet verklaren. Dat blijkt uit een experiment waarin vijf soorten gedurende drie weken zijn blootgesteld aan verschillende temperaturen, constante daglengte en een overschot aan voedsel in gevangenschap (hoofdstuk 5). Overeenkomsten en verschillen in fysiologie en gedrag kunnen ook het gevolg zijn van verwantschappen: twee zustersoorten kunnen op elkaar lijken omdat ze dezelfde voorouder hebben. Daarom hebben we een stamboom met 22 soorten TTING

leeuweriken gemaakt op grond van twee genen (hoofdstuk 4). Analyses waarin A deze stamboom betrokken is laten zien dat de afname in energie- en waterverbruik van leeuweriken langs een droogtegradiënt niet verklaard kan worden door SAMENV onderlinge verwantschappen van soorten (hoofdstuk 4, 8). De stamboom geeft ook informatie over de evolutionaire geschiedenis van de leeuweriken: de ver-

schillende soorten lijken relatief lang geleden in relatief korte tijd te zijn ont- NEDERLANDSE staan. 323 Fysiologische mechanismen Welke fysiologische mechanismen zijn verantwoordelijk voor het lagere energie- en waterverbruik en de betere tolerantie tegen hitte van leeuweriken in de woestijn vergeleken met soorten daarbuiten? Het energieverbruik is in het verleden gerelateerd aan de grootte van organen, zoals hart, hersenen en nieren, omdat die delen van het lichaam een relatief hoge stofwisseling hebben per gram weefsel. Bij de verschillende leeuweriksoorten bleek er echter geen verschil te bestaan in de grootte van de organen (hoofdstuk 5, 9). Alleen de vliegspier was een beetje groter bij de soorten uit natte gebieden, maar niet zo veel dat het verschil in stofwisseling ermee verklaard kan worden. De verschillen in minimale stofwisseling tussen individuen binnen een soort zijn wel gedeeltelijk gerelateerd aan de grootte van maag, darmen, nieren en lever. Het is mogelijk dat de verschillen tussen soorten liggen in een lagere stofwisseling per gram weefsel van de verschillende organen, maar dat moet toekomstig onderzoek uitwijzen. De verschillende mechanismen die zijn voorgesteld in de literatuur om het lage waterverbruik van woestijnvogels te verklaren worden stuk voor stuk in dit proefschrift ge-evalueerd. Allereerst zou een complexe botstructuur in de neus van vogels kunnen leiden tot afkoeling van uitgeademde lucht (hoofdstuk 10). Afgekoelde lucht kan minder water bevatten, dus tijdens de afkoeling in de neus zou water teruggewonnen kunnen worden voor hergebruik in het lichaam. Om de efficiëntie van dit mechanisme te testen hebben we een experiment gedaan waarbij we de neusgaten van leeuweriken tijdelijk afsloten zodat ze gedwongen waren via hun snavel uit te ademen. Met afgesloten neusgaten was de verdamping niet of slechts een klein beetje hoger dan met open neusgaten, afhankelijk van soort en temperatuur. Dit mechanisme lijkt dus niet de verklaring te zijn voor de lage verdamping van woestijnvogels. Het tweede mechanisme om water te besparen dat is voorgesteld is hyperthermie, een verhoging van de lichaamstemperatuur met 2-4°C (hoofdstuk 11). Een hogere lichaamstemperatuur zou onder andere als voordeel hebben dat een dier minder hoeft af te koelen en dus weinig water aan verdamping kwijtraakt. Er is echter geen verschil in lichaamstemperatuur tussen woestijnvogels en niet-woestijnvogels. Dus dit mechanisme kan het verschil in verdamping tussen leeuweriken uit verschillende gebieden niet verklaren. Vogels die tijdelijk een hogere lichaamstemperatuur hebben, voor hooguit een paar uur, besparen daarmee wel water. De hoeveelheid hangt af van onder meer de lichaamsgrootte en de duur van de hyperthermie. Zo besparen kleine soorten als leeuweriken een aanzienlij- ke hoeveelheid water, en deze soorten worden dan ook hyperthermisch als ze zijn blootgesteld aan hoge temperaturen (hoofdstuk 6). Maar een Kraagtrap, ongeveer zo groot als een kip, bezuinigt niet op zijn waterverbruik en wordt dan ook niet hyperthermisch zelfs niet in een omgeving van 55 °C (hoofdstuk 12). 324 Het derde mechanisme waarmee vogels misschien hun waterverbruik kunnen reduceren zit in aanpassingen van de huid (hoofdstuk 7). Deze lijken een grotere rol te spelen dan de aangepaste neusstructuur en hyperthermie. In tegenstel- ling tot zoogdieren hebben vogels geen zweetklieren en lange tijd dacht men dat vogels geen water verdampten door de huid. Leeuweriken echter verliezen 50- 70% van de totale water verdamping door de huid, de rest via hun snavel. Soorten uit de woestijn verliezen minder water via hun huid dan leeuweriken uit natte gebieden. De verwachting is dat de structuur en samenstelling van vetten in de huid bepaalt hoe groot de verdamping is. Vervolgonderzoek is er op gericht om te bepalen of leeuweriken uit de woestijn inderdaad meer en andere vetten hebben in hun huid, waardoor deze minder goed doorlaatbaar wordt voor water. De fysiologische mechanismen waarmee leeuweriken in de woestijn zijn aangepast aan de hoge temperaturen bestaan uit een laag energieverbruik en een grotere isolatie (hoofdstuk 6). Een laag energieverbruik is gunstig omdat dan ook weinig warmte geproduceerd wordt. Met een grotere isolatie is het makkelijker om warmte buiten te houden.

Gedragsstrategieën Vogels in de woestijn passen hun gedrag aan aan de droogte, de hitte en het gebrek aan voedsel. Een belangrijke aanpassing is het selecteren van microkli- maten die relatief koel zijn, zoals de schaduw van vegetatie en zelfs de holen van Stekelstaarthagedissen (hoofdstuk 13). Tijdens het heetst van de zomer zitten leeuweriken vaak 5 tot 6 uur per dag in deze holen. Het voordeel van het selecteren van koele plekken is een geringer waterverlies voor afkoeling. Daarnaast is het aktiviteitenpatroon van woestijnvogels aangepast: leeuweriken in de woestijn foerageren aan het begin en aan het eind van de dag, terwijl ze rusten mid- den overdag als het heet is. Hoofdstuk 14 rapporteert over een experiment om te onderzoeken of het aktiviteitenpatroon bepaald wordt door alleen omgevingstemperatuur of door een combinatie van omgevingstemperatuur, voedselbeschikbaarheid en fysiologische staat. Witbandleeuweriken die werden bijgevoerd besteedden minder tijd aan foerageren, meer tijd aan poetsen, en hielden een langere siësta in de schaduw. Bovendien begon en eindigde deze siësta bij lagere omgevingstemperaturen. Dit experiment laat duidelijk zien dat het woestijnkli- maat beperkingen oplegt aan voedsel- en wateropname, foerageertijd, en warm- TTING

tehuishouding. Vogels optimaliseren de tijd die ze besteden aan voedsel zoeken A en aan rusten. De keus om verder te foerageren of ermee te stoppen hangt af van de combinatie van lichaamstemperatuur (risico van oververhitting) en hoeveel- SAMENV heid reeds opgenomen voedsel (risico van verhongeren of uitdrogen). NEDERLANDSE

325 Demografie De aanpassingen in fysiologie en gedrag wijzen erop dat droogte, hitte en lage voedselbeschikbaarheid onafhankelijk en simultaan selecteren voor zuinig energie- en waterverbruik in woestijnvogels. Men zou verwachten dat onder invloed van dezelfde omgevingsfactoren ook de levensloop is aangepast aan het leven in de woestijn. De belangrijkste demografische onderdelen van de levensloop zijn groei, voortplanting en overleving. De verwachting is dat de beperkte beschikbaarheid en de onvoorspelbaarheid van hulpbronnen, zoals voedsel, water en tijd, hebben geleid tot lagere groeikosten, minder investeren in de jaarlijkse voortplanting en meer investeren in de kans op overleving. Met toenemende droogte van de omgeving zijn de groeikosten van kuikens lager, zowel in termen van energie als van water (hoofdstuk 8). Kuikens in de woestijn groeien langzamer, en hebben dus per dag minder energie en water nodig voor hun groei. Daarnaast verbruiken ze ook minder energie en water voor stofwisseling, verdamping en faeces. Dankzij deze aanpassingen kunnen kuikens in de woestijn groot worden met minder voedsel per dag. De investering van oudervogels in jaarlijkse voortplanting neemt af met toenemende droogte (hoofdstuk 15). Leeuweriken in kurkdroge woestijnen broeden alleen in jaren waarin voldoende regen is gevallen. De Witband-, Dunn’s en Rosse Woestijnleeuweriken in de woestijn in Saudi Arabië hebben tijdens de afgelopen 5 jaar in 2 jaar niet gebroed, omdat door droogte de voedselbeschikbaarheid te laag was. Als we ons beperken tot jaren waarin gebroed wordt zien we dat het aantal broedsels per jaar ook afneemt met toenemende droogte van de omgeving. Leeuweriken in gematigde streken maken 2 tot 4 broedsels per jaar, terwijl de soorten in de woestijn gemiddeld 1 legsel produceren. Het gemiddelde aantal eieren per legsel neemt af van 3.9 in gematigde streken tot 2.8 in de woestijn. Geboorte en sterfte moeten met elkaar in balans zijn, omdat een populatie anders uitsterft. Leeuweriken die niet elk jaar broeden en weinig jongen per jaar produceren moeten daarom wel langer leven dan soorten die jaarlijks veel jongen voortbrengen. De kans op overleven kan worden opgesplitst in overleving van eieren en nestjongen, de recrutering van uitgevlogen jongen in de broedpopula- tie, en de jaarlijkse overleving van volwassen vogels. Door hoge nestpredatie in woestijnen is de kans dat een nest met eieren ook werkelijk vliegvlugge jongen produceert maar 2%, terwijl deze kans voor leeuweriken in gematigde streken 87% is. In halfwoestijnen ligt de kans op overleving van nesten daartussenin. Directe gegevens over recrutering zijn er niet. Maar de periode dat de ouders voor uitgevlogen jongen zorgen is langer naarmate de biotopen droger worden. Dat kan erop wijzen dat de kans op recrutering van uitgevlogen jongen in de broed- populatie groter is in woestijngebieden. Ook over de jaarlijkse overlevingskans voor volwassen vogels is nog weinig bekend. Het meten van overleving vergt 326 langdurig onderzoek aan een populatie waarin vogels worden gemerkt met kleur- ringen, waardoor ze individueel herkenbaar zijn. Op grond van onze eigen gegevens van gekleurringde Witbandleeuweriken in de woestijn van Saudi Arabië schatten we de jaarlijkse overleving voor deze soort op 58%. Uit een studie aan Veldleeuweriken in Engeland volgt een kans op overleving van 51% voor deze leeuwerik van natte graslandgebieden. Deze gegevens zijn nog onvoldoende om de verwachting van een hogere overlevingskans in de woestijn te evalueren.

Fysiologie, gedrag en levensloop: een geïntegreerd perspectief De belangrijkste leerstelling van de evolutionaire theorie van levenslopen is dat evolutionaire fitness gemaximaliseerd wordt door het afwegen van huidige tegen toekomstige voortplanting. Met andere woorden, potentiële oudervogels moeten kiezen hoeveel ze investeren in jongen en in hun eigen kans op overleven (en daarmee toekomstige jongen). Het grootbrengen van jongen gaat namelijk ten koste van de overlevingskansen van de ouders. Wanneer omgevingsfactoren ver- anderen, verschuift ook de beste balans van investeren in nakomelingen in het heden en in de toekomst. Deze theorie is gebaseerd op demografische factoren. Het onderzoek in dit proefschrift laat zien dat fysiologie en gedrag nauw verbonden zijn met demografie. Ze verdienen dan ook een grotere plaats in de theorie. Langs een gradiënt van toenemende droogte van de omgeving, en daarmee afne- mende beschikbaarheid van voedsel, water en tijd, zijn de mogelijkheden steeds meer beperkt om te investeren in nakomelingen in een bepaald jaar. Met toenemende droogte verschuift de balans daarom naar grotere investering in eigen overleving, zodat de kans groter is om in de toekomst jongen groot te brengen. De belangrijkste aanpassingen van fysiologie en gedrag in de woestijn, namelijk zuinig energie- en waterverbruik, zijn onlosmakelijk verbonden met aanpassingen van de demografie: langzame groei van kuikens, weinig jongen per jaar en een waarschijnlijk grote kans op overleving. Toekomstig onderzoek zal ons nog veel moeten leren over de interacties tussen fysiologie, gedrag en levensloop. TTING A SAMENV NEDERLANDSE

327

POSTSCRIPT 330 One night last spring as I walked back from White Jebel to our bedu tent, I lis- tened to the fox pups playing around their den and watched the amazing panop- ly of stars overhead. The stars are nowhere so bright as in the desert. How did I get here? Not everyone who enjoys being outside and is interested in animals and plants ends up getting paid to study birds in amazing places. Was it my parents, mixing genes for theology and didactics, and stimulating me to follow my interest in nature? Was it the NJN, where I spent many years enjoying and exploring all accessible and prohibited pieces of nature in the Netherlands: counting ducks, measuring bivalves, watching bumblebees visit plants, catching dragonflies, ... Or was it learning biology from inspiring teachers at the university? In any case, the past four years the stars have lined up for me in a miraculous way. I am grateful to all who contributed to this wonderful constellation. Serge Daan had faith in my enterprise even before it was born, and kept faith ever since, giving me much appreciated freedom. I am grateful to Serge for his encouragement throughout the past years and for his efforts to facilitate my work. When I finished my “doctoraal” (MSc), he suggested that I should apply for a PhD-fellowship, offered by the Schuurman Schimmel Van Outeren Foundation, that would allow me to develop and pursue my own project. Setting up my own research was exactly what I had in mind, but I did not yet have a plan to overcome the practical limitations. One of these limitations is the scarcity of opportunities for PhD-students to develop their own research program. The initiative of the Schuurman Schimmel Van Outeren Foundation therefore is praiseworthy and it came at a perfect time for me. I have appreciated the pleasant communication with and flexibility of Mr. J.H. Dantuma, Prof. L.P.M. Timmermans, Mrs. C. Wiethoff and the other members of the board of the Schuurman Schimmel Van Outeren Foundation. My project turned me into a nomad, moving in fairly regular patterns between three base camps each year. Still, Groningen and the Zoological Laboratory have remained my real home. The Animal Behaviour and Animal Ecology groups have provided a stimulating environment with seminars, lunch meetings, book discussions, the journal club, and other activities. Many people that have parti- cipated in these activities and contributed to the friendly atmosphere have come and gone, many are still there. I find it hard to construct a complete list of names, but to all of you: thanks! I have very much enjoyed being part of such a lively group. I am grateful to many people in Groningen for support with practical issues and for involvement in different aspects of the work: Suus Bakker and Aukje Adams were always there when I needed administrative help. Dick Visser made profes- sional figures for this dissertation. The animal caretakers, Sjoerd, Roelie and Adriana, were “gezellige” nextdoor-neighbours. I have appreciated their help and advice during the summer when I had larks in captivity in Groningen. During POSTSCRIPT 331 that summer, and on other occasions, Karel Visser and Herman van Hengelaar (Central Instrument Workshop), and Wim Beukema and Edzo Paap (Electronics) fabricated and ordered equipment that was indispensable for the research. Gerard Overkamp was always available for equipment-questions. Peter Tolsma and Riek van Noordwijk contributed to the field work in Saudi Arabia as students; I hope you learned as much from this experience as I have. Rob Bijlsma introduced me to Wouter de Vlieger (Staatsbosbeheer), who gave permission to work on Woodlarks and Skylarks in the Drents-Friese Wold. After the last field season Henk Visser went out of his way to complete the isotope analyses as quickly as possible. I am happy that Julia Stahl has taken the time to com- ment on the introductory and final chapters. My second base camp was the Ohio State University, where I spent several months each fall or winter in the group of Joe Williams. It has been an interesting experience to spend so much time at another university and to be immersed in the culture of the American Midwest. I have greatly appreciated the help and guidance of Cathy Drake in all practical Ohio State matters, and the warm welcome she gave me every time I arrived. I will never forget my first Thanksgiving dinner. From the start Joe has gone out of his way to make me feel at home in Columbus. Through him I found a friendly welcome in the home of Tom and Jill Grubb. I also encountered Bob Mauck, first at the basketball court and later at other occasions, and enjoyed getting to know him and his most unusual career path. Somewhat a brother in arms at Ohio State, until he decided to finish his PhD and get serious about life, was Paul Doherty. Paul, it has been fun to talk science, play basketball, and be introduced to life of an american PhD-student. I have enjoyed the visits and especially the political discussions with various students in Joe's lab group. My most fond memories are of the interactions and col- laborations with Mike Buschur, who also spent three months in Groningen working on larks in the lab, and Mike Haugen. Both Mikes and Vince Schuler were part of our team during the 2001 season in Saudi Arabia. The third base camp during my nomadic wanderings was Saudi Arabia, with two important sites: the National Wildlife Research Center outside Taif, and the protected area Mahazat as-Sayd, 3 hours further inland in the central Arabian Desert. What a great place to do research. And what an impossible task to describe this world to someone who has not been there. Imagine a free-spirited Dutch girl: She is not allowed to drive on the public roads, but does so with impunity in the fenced reserve Mahazat. She has to wear an abbaya in the cities, attrac- ting attention from everyone anyway because she doesn’t (have to) cover her head and towers above all men. She is told to sit in the claustrophobic “women’s section” on the ferry, because the “mutawa” (religious police) mention to the captain that one of the four guys sitting on deck is a girl. She greatly enjoys the remoteness of White Jebel, ‘Uruq Bani Ma’arid and Jebel Amud, knowing that 332 the closest people are miles away. Dependence and independence take on new meaning in this place that could be on a different planet. I have only encountered friendly people. And it has been an amazing experience to live and work here, one that would not have been possible without the NWRC. Wildlife research programs at the NWRC have been made possible through the initiative of HRH Prince Saud Al Faisal and under guidance of Dr. A.H. Abuzinada. Abdulrahman Khoja and Patrick Paillat have always supported and encouraged my work and provided much appreciated logistical assistance. Only one example of Abdul’s invaluable help was when he recovered the equipment that was confiscated by the customs in Jeddah. Stéphane Ostrowski has gone out of his way to facilitate my work and to share some of his knowledge about parasites, oryx, foxes, genets, and pretty much everything else in the desert. Even about making pâté d’alouette. His great sense of humor and sharp mind made all interactions and discussions a lot of fun. And as a big brother he kept an eye out, especially during the times that I was in Mahazat or the Center alone, organizing transport to Mahazat, trips to Taif, or pieces of equipment when I needed them. The other staff of the NWRC, including Cathi Tsagarakis, Eric Bedin, Phil Seddon, Yolanda van Heezik, Jacky Judas, Frédéric Lacroix, Mohammed Shobrak, Stéphane and Morgane Hemon, Christophe Marin and Jean-Yves Cardona, have supported my work in many ways and on many occasions. Their support often involved efforts by Musthafa Ali and Mohammed Kunhi for travel letters, tickets and other Saudi paperwork, by Seree and his workshop-crew for keeping the trucks going and building various pieces of lab equipment, by Waly and Basheer for cooking and running the Bird Camp in Mahazat, and by many of the other Thai, Pakistani and Indians. The rangers in Mahazat as-Sayd, and also in Harrat al Harrah and other protected areas, have always given me a friendly welcome, and taught me much about Arabs and Arabia. I am very grateful to all at the NWRC who contributed to my research. Equally important, I want to thank everyone for the nice atmosphere, mountain excursions, soccer games, snorkling and scuba trips, and other diversions from work. The Arabia- experience has added an extra dimension to the past years for me. The work of and interactions with Rudi Drent, Bob Ricklefs, and William Dawson have been a source of inspiration throughout the years. I am grateful that they have agreed to form the manuscript committee and to invest their time and effort in reading this dissertation. I feel very fortunate to have worked with Joe Williams in the various places where the lark-work took us. He has been a great mentor and friend. His dedi- cation and enthusiasm have been invaluable for the research, and made collabo- rating a lot of fun. I have very much enjoyed discussing ideas, and learned a lot, especially from our disagreements. Joe’s creativity in tackling practical problems has impressed me from the start and has convinced me that every problem has a POSTSCRIPT 333 solution. His insistence on “calibrating the hell out of everything” was frustra- ting when you wanted to start making measurements, but proved invaluable in the end, when you know that you can trust the numbers. His perseverance to “polish text” until all ambiguity was erased has often taken me far past the point at which I was convinced that the writing was crystal clear. Joe, you showed me what it takes to be a scientist. For many of my friends, NJN-buddies and comrades abroad, it has not always been easy to keep up with my movements in the past four years. When I was spotted at home, usually the first question “when did you come back?” was immediately followed by “and when are you going again?”. Maybe our contacts have been less frequent, they have not been less valuable to me. I am very happy that you have done your best to stay in touch and look forward to more camping trips, birthdays, excursions and other activities together in the future. For the very near future, I am glad that Nicole, Hajo and Julia have agreed to help orga- nize the festivities for my dissertation defense, and I hope to welcome you all in Groningen that day. De invloed van mijn familie op het tot stand komen van dit proefschrift mag dan niet zo concreet zijn, hij is wel groot. Peter, je bent nu wel ver weg, maar het blijft toch leuk om ervaringen uit te wisselen met een grote broer die vaak een stap verder is. Heerko en Anne, jullie betrokkenheid bij alle facetten van mijn onderzoek heb ik altijd erg gewaardeerd. Ik vind het ook heel leuk om via jullie een kijkje te krijgen in de kunstwereld en de overeenkomsten te ontdekken tussen wetenschap en kunst. Heerko, bedankt voor het enthousiasme waarmee je mijn werk tot een boek hebt omgetoverd. Papa en mama, de ruimte die ik altijd heb gehad om mijn eigen interesse te volgen, het verantwoordelijkheidsgevoel dat jullie me van jongsaf aan bijbrachten en jullie belangstelling voor alles wat ik deed zijn gelukkig altijd vanzelfsprekend geweest. Jullie vertrouwen, waardering en betrokkenheid zijn onvervangbaar. En mama, dit proefschrift is ook een beetje voor opa Bos, die vast trots was geweest. Ik hoop dat jullie allemaal ook in de toekomst zo betrokken kunnen blijven.

Groningen, October 2002 Irene Tieleman

334 POSTSCRIPT

335

PUBLICATIONS 338 Tieleman, B. I., J. B. Williams and G. H. Visser. Energy and water budgets of larks in a life history perspective: Is parental effort related to environmental aridity? Submitted. Williams, J.B., S. Ostrowski, B.I. Tieleman, and A. Munoz-Garcia. A phylogenetic analysis of basal metabolism and total evaporative water loss among foxes from deserts and mesic environments. Submitted. Tieleman, B. I., J. B. Williams, M. E. Buschur and C. R. Brown. 2003. Phenotypic variation of larks along an aridity gradient: are desert birds more flexible? Ecology: in press. Tieleman, B. I., J. B. Williams and P. Bloomer. 2002. Adaptation of metabolism and evaporative water loss along an aridity gradient. Proceedings of the Royal Society London B: in press. Tieleman, B. I. and J. B. Williams. 2002. Cutaneous and respiratory water loss in larks from arid and mesic environments. Physiological and Biochemical Zoology 75: in press Williams, J. B., D. Lenain, S. Ostrowski, B. I. Tieleman and P. Seddon. 2002. Energy expenditure and water flux in Rüppell's foxes in Saudi Arabia. Physiological and Biochemical Zoology 75: in press. Tieleman, B. I., J. B. Williams, M. E. Buschur. 2002. Physiological adjustments to arid and mesic environments in larks (Alaudidae). Physiological and Biochemical Zoology 75: 305-313. Tieleman, B. I., J. B. Williams, F. Lacroix, P. Paillat. 2002. Physiological responses of Houbara Bustards to high ambient temperatures. Journal of Experimental Biology 205: 503-511. Tieleman, B. I. and J. B. Williams. 2002. Effects of food supplementation on behavioral decisions of Hoopoe Larks in the Arabian Desert: balancing water, energy and thermoregulation. Animal Behaviour 63: 519-529. Williams, J. B. and B. I. Tieleman. 2002. Ecological and evolutionary physiology of desert birds: a progress report. Integrative and Comparative Biology 42: 68-75. Williams, J. B. and B. I. Tieleman. 2001. Physiological Ecology and Behavior of Desert Birds. Pp. 299-353 in: Current Ornithology, Volume 16 (eds. V. Nolan Jr. and C. F. Thompson). New York: Kluwer Academics/Plenum Publishers. Tieleman, B. I. and J. B. Williams. 2000. The adjustments of avian metabolic rates and water fluxes to desert environments. Physiological and Biochemical Zoology 73: 461-479. Williams, J. B. and B. I. Tieleman. 2000. Flexibility in basal metabolism and evaporative water loss among Hoopoe Larks exposed to different environmental temperatures. Journal of Experimental Biology 203: 3153-3159. Tieleman, B. I. and J. B. Williams. 1999. The evolution of rates of metabolism and water flux in desert birds. Acta Ornithologica 34: 173-174. Williams, J. B., B. I. Tieleman, and M. Shobrak. 1999. Lizard burrows provide thermal refugia for larks in the Arabian Desert. Condor 101: 714-717. Tieleman, B.I., Williams, J.B., Michaeli, G. and B. Pinshow. 1999. The role of nasal passages in the water economy of Crested Larks and Desert Larks. Physiological and Biochemical Zoology TIONS 72: 219-226. Tieleman, B.I. and J.B. Williams. 1999. The role of hyperthermia in the water economy of PUBLICA desert birds. Physiological and Biochemical Zoology 72: 87-100. 339

REFERENCES 342 Abouheif, E. (1999) A method for testing the assumption of phylogenetic independence in comparative data. Evolutionary Ecology Research, 1, 895-909. Adams, N. J., Brown, C. R. & Nagy, K. A. (1986) Energy expenditure of free-ranging Wandering Albatrosses Diomedea exulans. Physiological Zoology, 59, 583-591. Adams, N. J., Abrams, R. W., Siegfried, W. R., Nagy, K. A. & Kaplan, I. R. (1991) Energy expenditure and food consumption by breeding Cape Gannets Morus capensis. Mariene Ecology Progress Series, 70, 1-9. Akester, A. R., Anderson, R. S., Hill, K. J. & Osbaldiston, G. W. (1967) A radiographic study of urine flow in the domestic fowl. Britisch Poultry Science, 8, 209-212. Al Sadoon, M. K., Al Johany, A. M., Abu-Tarboush, H. M. & AL Harbi, R. J. (1994) Studies on some aspects of the biology of Uromastyx aegypticus, and ways to conserve the species from extinction in Saudi Arabia. National Commission for Wildlife Conservation and Development, Riyadh, Saudi Arabia. Alkon, P. U., Pinshow, B. & Degen, A. A. (1982) Seasonal water turnover rates and body water volumes in Desert Chukars. Condor, 84, 332-337. Alkon, P. U., Degen, A. A., Pinshow, B. & Shaw, P. J. (1985) Phenology, diet and water turnover rates of Negev Desert Chukars. Journal of Arid Environments, 9, 51-61. Allan, T. & Warren, A. (1993) Deserts: The Encroaching Wilderness. Mitchell Beazly International Ltd., London. Altmann, J. (1974) Observational study of behavior: sampling methods. Behavior, 69, 227-267. Alvarez, L. W. (1987) Mass extinctions caused by large bolide impacts. Physics Today, July, 24-33. Amanova, M. B. (1984) The ecological-physiological adaptations of water metabolism in desert birds. Journal of Arid Environments, 7, 199. Ambrose, S. J., Bradshaw, S. D., Withers, P. C. & Murphy, D. P. (1996) Water and energy balance of captive and free-ranging Spinifexbirds (Eremiornis carteri) North (Aves: Sylviidae) on Barrow Island, Western Australia. Australian Journal of Zoology, 44, 107-117. Anderson, G. L. (1980) Kidney function and post-renal modification of urine in Desert Quail. PhD University of Arizona. Anderson, G. L. & Braun, E. J. (1985) Postrenal modification of urine in birds. American Journal of Physiology, 248, R93-R98. Apostol, T. M. (1967) Calculus: One - Variable Calculus, with an Introduction to Linear Algebra. John Wiley and Sons, New York. Appleyard, R. F. (1979) Cutaneous and respiratory water losses in the Ring Dove, Streptopelia risoria. MSc-thesis Washington State University. Arad, Z. & Marder, J. (1982) Comparative thermoregulation of four breeds of fowls (Gallus domesticus) exposed to gradual increase of ambient temperatures. Comparative Biochemistry and Physiology, 72A, 179-184. Arad, Z., Gavrieli-Levin, I., Eylath, U. & Marder, J. (1987) Effect of dehydration on cutaneous water evaporation in heat-exposed Pigeons (Columba livia). Physiological Zoology, 60, 623-630. Arcese, P. & Smith, J. N. M. (1988) Effects of population density and supplemental food on reproduction in Song Sparrows. Journal of Animal Ecology, 57, 119-136. Arieli, Y., Feinstain, N., Raber, P. & Marder, J. (1995) The ß-adrenoreceptor antagonist propranolol increases blood-vessels permeability in heat-acclimated Rock Pigeons (Columba livia). European Journal of Physiology, 430, 214. Arieli, Y., Feinstein, N., Raber, P., Horowitz, M. & Marder, J. (2000) Heat stress induces ultrastructural changes in the cutaneous capillary wall of heat-acclimated Rock Pigeon. American Journal of Physiology, 227, R969-R974. Aschoff, J. & Pohl, H. (1970) Rhythmic variations in energy metabolism. Federation Proceedings, 29, 1541-1552. Askenmo, C., Neergaard, R. & Arvidsson, B. L. (1992) Pre-laying time budgets in Rock Pipits: prio-

rity rules of males and females. Animal Behaviour, 44, 957-965. REFERENCES Axelrod, D. I. (1983) Paleobotanical history of the western deserts. Origin and Evolution of Deserts 343 (eds S. G. Wells & D. R. Haragan), pp. 113-129. University of New Mexico Press, Albuquerque. Bakken, G. S. & Gates, D. M. (1975) Heat transfer analysis of animals: Some implications for field ecology, physiology and evolution. In: Perspectives of Biophysical Ecology (eds D. M. Gates & R. B. Schmerl), pp. 225-290. Springer-Verlag, New York. Bakken, G. S. (1976) A heat transfer analysis of animals: unifying concepts and the application of metabolism chamber data. Journal of Theoretical Biology, 60, 337-384. Bakken, G. S. (1980) The use of standard operative temperature in the study of the thermal energetics of birds. Physiological Zoology, 53, 108-119. Bakken, G. S., Buttemer, W. A., Dawson, W. R. & Gates, D. M. (1981) Heated taxidermic mounts: a means of measuring the standard operative temperature affecting small animals. Ecology, 62, 311-318. Bakken, G. S. (1990) Estimating the effect of wind on avian metabolic rate with standard operative temperature. Auk, 107, 587-594. Bakken, G. S., Murphy, M. T. & Erskine, D. J. (1991) The effect of wind and air temperature on metabolism and evaporative water loss rates of Dark-eyed Juncos, Junco hyemalis: A standard operative temperature. Physiological Zoology, 64, 1023-1049. Ballance, L. T. (1995) Flight energetics of free-ranging Red-footed Boobies (Sula sula). Physiological Zoology, 68, 887-914. Bang, B. G. (1971) Functional anatomy of the olfactory system in 23 orders of birds. Acta Anatomica, 79 (suppl. 58), 1-76. Barnett, L. B. (1970) Seasonal changes in temperature acclimatization of the House Sparrow. Comparative Biochemistry and Physiology, 33, 559-578. Bartholomew, G. A. & Dawson, W. R. (1953) Respiratory water loss in some birds of the southwestern United States. Physiological Zoology, 26, 162-166. Bartholomew, G. A. & Cade, T. J. (1956) Water consumption of House Finches. Condor, 58, 406-412. Bartholomew, G. A. & MacMillen, R. E. (1960) The water requirements of Mourning Doves and their use of sea water and NaCl solutions. Physiological Zoology, 33, 171-178. Bartholomew, G. A. & MacMillen, R. E. (1961) Water economy of the California Quail and its use of sea water. Auk, 78, 505-514. Bartholomew, G. A., Hudson, J. W. & Howell, T. R. (1962) Body temperature, oxygen consumption, evaporative water loss and heart rate in the Poor-will. Condor, 64, 117-125. Bartholomew, G. A. & Cade, T. J. (1963) The water economy of land birds. Auk, 80, 504-539. Bartholomew, G. A. (1964) The roles of physiology and behavior in maintenance of homeostasis in the desert environment. Symposium of the Society for Experimental Biology, 18, 7-29. Bartholomew, G. A. & Trost, C. H. (1970) Temperature regulation in the Speckled Mousebird, Colius striatus. The Condor, 72, 141-146. Bartholomew, G. A. (1972) The water economy of seed-eating birds that survive without drinking. Proceedings 15th International Ornithological Congress, The Hague, 237-254. Bartholomew, G. A. (1982) Body temperature and energy metabolism. In: Animal Physiology: Principals and Adaptations (ed M. S. Gordon), pp. 333-406. MacMillan Publishing Co., Inc., New York. Bartholomew, G. A. (1986) The role of natural history in contemporary biology. Bioscience, 36, 324-329. Battley, P. F., Piersma, T., Dietz, M. W., Tang, S., Dekinga, A. & Hulsman, K. (2000) Empirical evidence for differential organ reductions during trans-oceanic bird flight. Proceedings of the Royal Society of London - Series B, 267, 191-195. Becker, W. A. (1984) A Manual of Quantitative Genetics. Academic Enterprises, Pullman, Washington. Bender, G. L. (1982) Introduction. In: Reference Handbook on the Deserts of North America (ed G. L. Bender), pp. 1-6. Greenwood Press, Westport, CT. Bennett, A. F. & Dawson, W. R. (1976) Metabolism. In: Biology of the Reptilia (eds C. Gans & W. 344 R. Dawson), pp. 127-223. Academic Press, New York. Bennett, A. F. & Ruben, J. (1979) Endothermy and activity in vertebrates. Science, 206, 649-654. Bennett, A. F. (1988) Structural and functional determinates of metabolic rate. American Zoologist, 28, 699-708. Bennett, A. F. & Huey, R. B. (1990) Studying the evolution of physiological performance. Oxford Surveys in Evolutionary Biology (eds D. J. Futuyma & J. Antonovics), pp. 251-284. Oxford University Press, Oxford. Bennett, P. M. & Harvey, P. H. (1987) Active and resting metabolism in birds: allometry, phylogeny and ecology. Journal of Zoology, 213, 327-363. Berger, M., Hart, J. S. & Roy, O. Z. (1971) Respiratory water and heat loss of the Black Duck during flight at different ambient temperatures. Canadian Journal of Zoology, 49, 767-774. Bernstein, M. H. (1969) Cutaneous and respiratory evaporation in the Painted Quail Excalfactoria chinensis. American Zoologist, 9, 1099. Bernstein, M. H. (1971) Cutaneous water loss in small birds. Condor, 73, 468-469. Bernstein, M. H. (1987) Respiration in flying birds. In: Bird Respiration (ed T. J. Seller), pp. 43-74. CRC, Boca Raton, Fla. Beuchat, C. A. (1990) Body size, medullary thickness, and urine concentrating ability in mammals. American Journal of Physiology, 258, R298-R30. Bindslev, N. & Skadhauge, E. (1971) Salt and water permeability of the epithelium of the coprodeum and large intestine in the normal and dehydrated fowl (Gallus domesticus): in vivi perfusion studies. Journal of Physiology (London), 216, 753-768. Birkebak, R. C. (1966) Heat transfer in biological systems. International Review of General and Experimental Zoology, 2, 269-344. Birt-Friesen, V. L., Montevecchi, W. A., Cairns, D. K. & Macko, S. A. (1989) Activity-specific metabolic rates of free-living Northern Gannets and other seabirds. Ecology, 70, 357-367. Björklund, M. (1997) Are 'comparative methods' always necessary? Oikos, 80, 607-612. Boake, C. R. B. (1989) Repeatability: its role in evolutionary studies of mating behavior. Evolutionary Ecology, 3, 173-182. Bouverot, P., Hildwein, G. & Le Goff, D. (1974) Evaporative water loss, respiratory pattern, gas exchange and acid-base balance during thermal panting in Pekin Ducks exposed to moderate heat. Respiration Physiology, 21, 255-269. Boyce, M. S. & Perrins, C. M. (1987) Optimizing Great Tit clutch size in a fluctuating environment. Ecology, 68, 142-153. Boyer, H. J. (1988) Breeding biology of the Dune Lark. Ostrich, 59, 30-37. Bradshaw, S. D. (1986) Ecophysiology of Desert Reptiles. Academic Press, Sydney, Australia. Braun, E. J. & Dantzler, W. H. (1972) Function of mammalian-type and reptilian-type nephrons in kidney of Desert Quail. American Journal of Physiology, 222, 617-629. Braun, E. J. (1985) Comparative aspects of the urinary concentrating process. Renal Physiology, 8, 249-260. Braun, E. J. (1993) Renal function in birds. In: New Insights in Vertebrate Kidney Function (eds J. A. Brown, R. J. Balment & J. C. Rankin), pp. 167-188. Cambridge University Press, Cambridge. Brugger, K. E. (1970) Anatomical adaptation of the gut to diet in Red-winged Blackbirds (Agelaius phoeniceus). Auk, 198, 562-567. Brummermann, M. & Braun, E. J. (1994) The role of the lower intestinal tract in avian osmoregulation. In: Integrative and Cellular Aspects of Autonomic Functions: Temperature and Osmoregulation (eds K. Pleschka & R. Gerstberger), pp. 517-525. John Libbey Eurotext, Paris. Bryant, D. M. & Westerterp, K. R. (1980) The energy budget of the House Martin (Delichon urbica). Ardea, 68, 91-102. Bryant, D. M. & Westerterp, K. R. (1983) Time and energy limits to brood size in House Martins (Delichon urbica). Journal of Animal Ecology, 52, 905-925.

Bryant, D. M., Hails, C. J. & Tatner, P. (1984) Reproductive energetics of two tropical bird species. REFERENCES The Auk, 101, 25-37. 345 Bryant, D. M., Hails, C. J. & Prys-Jones, R. (1985) Energy expenditure by free-living Dippers (Cinclus cinclus) in winter. Condor, 87, 177-186. Bryant, D. M. & Tatner, P. (1988) Energetics of the annual cycle of Dippers Cinclus cinclus. Ibis, 130, 17-38. Bryant, D. M. (1988) Energy expenditure and body mass changes as measures of reproductive costs in birds. Functional Ecology, 2, 23-34. Bryant, D. M. & Tatner, P. (1991) Intraspecies variation in avian energy expenditure: correlates and constraints. Ibis, 133, 236-245. Bucher, T. L. (1981) Oxygen consumption, ventilation and respiratory heat loss in a parrot, Bolborhynchus lineola, in relation to ambient temperature. Journal of Comparative Physiology B, 142, 479-488. Bucher, T. L. (1985) Ventilation and oxygen consumption in Amazona viridigenalis. Journal of Comparative Physiology B, 155, 269-276. Cade, T. J., Tobin, C. A. & Gold, A. (1965) Water economy and metabolism of two estrildine finches. Physiological Zoology, 38, 9-33. Cairns, D. K., Montevecchi, W. A., Birt-Friesen, V. L. & Macko, S. A. (1990) Energy expenditures, activity budgets, and prey harvest of breeding Common Murres. Studies in Avian Biology, 14, 84-92. Calder, W. A. (1964) Gaseous metabolism and water relations of the Zebra Finch, Taeniopygia cas- tanotis. Physiological Zoology, 37, 400-413. Calder, W. A. & Schmidt-Nielsen, K. (1966) Evaporative cooling and respiratory alkalosis in the Pigeon. Proceedings of the National Academy of Sciences, 55, 750-756. Calder, W. A. & Schmidt-Nielsen, K. (1967) Temperature regulation and evaporation in the Pigeon and the Roadrunner. American Journal of Physiology, 213, 883-889. Calder, W. A. & King, J. R. (1974) Thermal and caloric relationships of birds. In: Avian Biology (eds D. S. Farner & J. R. King), pp. 259-413. Academic Press, New York. Calder, W. A. & Braun, E. J. (1983) Scaling of osmotic regulation in mammals and birds. American Journal of Physiology, 244, R601-R606. Calder, W. A. (1984) Size, Function and Life History. Harvard University Press, Cambridge. Calow, P. (1999) Evolutionary Physiological Ecology. Cambridge University Press, Cambridge. Campbell, G. S. (1977) An Introduction to Environmental Biophysics. Springer-Verlag, New York. Carlson, A., Moreno, J. & Alatalo, R. V. (1993) Winter metabolism of coniferous forest tits (Paridae) under arctic conditions: a study with doubly labeled water. Ornis Scandinavica, 24, 161-164. Carmi-Winkler, N., Degen, A. A. & Pinshow, B. (1987) Seasonal time-energy budget of free-living Chukars in the Negev desert. Condor, 89, 594-601. Castro, G., Myers, J. P. & Ricklefs, R. E. (1992) Ecology and energetics of Sanderlings migrating to four latitudes. Ecology, 73, 833-844. Chaffee, R. R. J. & Roberts, J. C. (1971) Temperature acclimation in birds and mammals. Annual Reviews in Physiology, 33, 155-195. Chao, S. C. & Xing, J. M. (1982) Origin and development of the Shamo (sandy deserts) and the Gobi (stony deserts) of China. Geological Story of the World's Deserts. Striae 17 (ed T. L. Smiley), pp. 79-91. Uppsala. Chappell, M. A. & Bartholomew, G. A. (1981) Standard operative temperatures and thermal energetics of the Antelope Groundsquirrel Ammospermophilus leucurus. Physiological Zoology, 54, 81-93. Chappell, M. A., Goldstein, D. L. & Winkler, D. W. (1984) Oxygen consumption, evaporative water loss, and temperature regulation of California Gull chicks (Larus californicus) in a desert rookery. Physiological Zoology, 57, 204-214. Chappell, M. A., Bech, C. & Buttemer, W. A. (1999) The relationship of central and peripheral organ masses to aerobic performance variation in House Sparrows. Journal of Experimental Biology, 202, 2269-2279. Cheverud, J. M., Dow, M. M. & Leutenegger, W. (1985) The quantitative assessment of phylogenetic constraints in comparative analyses: Sexual dimorphism in body weight among primates. Evolution, 39, 346 1335-1351. Chew, R. M. (1951) The water exchange of some small mammals. Ecological Monographs, 21, 215-225. Chew, R. M. (1961) Water metabolism of desert-inhabiting vertebrates. Biological Reviews Cambridge Philosophical Society, 36, 1-31. Chew, R. M. (1965) Water metabolism of mammals. In: Physiological Mammalogy (eds W. V. Mayer & R. G. Van Gelder), pp. 43-160. Academic Press, New York. Chiappe, L. M. (1995) The first 85 million years of avian evolution. Nature, 378, 349-355. Cloudsley-Thompson, J. L. (1984) Introduction. In: Sahara Desert (ed J. L. Cloudsley-Thompson), pp. 1-15. Pergamom Press, Oxford. Coddington, J. A. (1988) Cladistic tests of adaptational hypotheses. Cladistics, 4, 3-22. Collins, J. C., Pilkington, T. C. & Schmidt-Nielsen, K. (1971) A model of respiratory heat transfer in a small mammal. Biophysical Journal, 11, 886-914. Cooper, S. J. & Swanson, D. L. (1994) Seasonal acclimatization of thermoregulation in the Black- capped Chickadee. Condor, 96, 638-646. Costa, D. P. & Prince, P. A. (1987) Foraging energetics of Grey-headed Albatrosses Diomedea chryso- stoma at Bird Island, South Georgia. Ibis, 129, 149-158. Cotgraeve, P. & Clayton, D. H. (1994) Comparative analysis of time spent grooming by birds in relation to parasite load. Behaviour, 131, 171-187. Cox, G. W. (1983) Foraging behaviour of the Dune Lark. Ostrich, 54, 113-120. Cramp, S. (1988) Handbook of the Birds of Europe, the Middle East and North Africa. Oxford University Press, Oxford. Crawford, E. C. & Schmidt-Nielsen, K. (1967) Temperature regulation and evaporative cooling in the Ostrich. American Journal of Physiology, 212, 347-353. Crawford, E. C. & Lasiewski, R. C. (1968) Oxygen consumption and respiratory evaporation of the Emu and Rhea. Condor, 70, 333-339. Cuthill, I. & Guilford, T. (1990) Perceived risk and obstacle avoidance in flying birds. Animal Behavior, 40, 188-190. Daan, S., Masman, D. & Groenewold, A. (1990) Avian basal metabolic rates: their association with body composition and energy expenditure in nature. American Journal of Physiology, 259, R333-R340. Daan, S., Deerenberg, C. & Dijkstra, C. (1996) Increased daily work precipitates natural death in the Kestrel. Journal of Animal Ecology, 65, 539-545. Daan, S. & Tinbergen, J. M. (1997) Adaptation of life histories. In: Behavioural Ecology. An Evolutionary Approach (eds J. R. Krebs & N. B. Davies), pp. 311-333. Blackwell Science Ltd., Oxford. Dantzler, W. H. (1970) Kidney function in desert vertebrates. In: Memoirs of the Society for Endocrinology. Hormones and the Environment (eds G. K. Benson & J. G. Phillips), pp. 157-190. Cambridge, London. Darwin, C. (1859) On the origin of species by means of natural selection, or the preservation of favoured races in the struggle for life. Davies, N. B. & Lundberg, A. (1985) The influence of food on time budgets and timing of breeding of the Dunnock Prunella modularis. Ibis, 127, 100-110. Davies, S. J. J. F. (1982) Behavioural adaptations of birds to environments where evaporation is high and water is in short supply. Comparative Biochemistry and Physiology, 71A, 557-566. Davies, S. J. J. F. (1984) Nomadism as a response to desert conditions in Australia. Journal of Arid Environments, 7, 183-195. Davis, R. W., Croxall, J. P. & O'Connell, M. J. (1989) The reproductive energetics of Gentoo (Pygoscelis papua) and Macaroni (Eudyptes chrysolophus) Penguins at South Georgia. Journal of Animal Ecology, 58, 59-74. Dawson, T. & Schmidt-Nielsen, K. (1966) Effect of thermal conductance on water economy in the

Antelope Jack Rabbit. Journal of Cellular Physiology, 67, 463-472. REFERENCES Dawson, W. R. & Schmidt-Nielsen, K. (1964) Terrestrial animals in dry heat: desert birds. In: 347 Handbook of Physiology: Adaptation to the Environment (eds C. G. Wilber, E. F. Adolph & D. B. Dill), American Physiological Society, Washington, D.C., USA. Dawson, W. R. & Bartholomew, G. A. (1968) Temperature regulation and water economy of desert birds. In: Desert Biology (ed Jr. G. W. Brown), pp. 357-394. Academic Press, New York. Dawson, W. R. & Fisher, C. D. (1969) Responses to temperature by the Spotted Nightjar (Eurostopodus guttatus). Condor , 71, 49-53. Dawson, W. R. & Bennett, A. F. (1973) Roles of metabolic level and temperature regulation in the adjustment of Western Plumed Pigeons (Lophophaps ferruginea ) to desert conditions. Comparative Biochemistry and Physiology, 44A, 249-266. Dawson, W. R. (1976) Physiological and behavioural adjustments of birds to heat and aridity. Proceedings 16th International Ornithological Congress, 455-467. Dawson, W. R. & Carey, C. (1976) Seasonal acclimatization to temperature in cardueline finches. I. Insulative and metabolic adjustments. Journal of Comparative Physiology, 112, 317-333. Dawson, W. R., Carey, C., Adkisson, C. S. & Ohmart, R. D. (1979) Responses of Brewer's and Chipping Sparrows to water restriction. Physiological Zoology, 42, 529-541. Dawson, W. R. (1982) Evaporative losses of water by birds. Comparative Biochemistry and Physiology, 71A, 495-509. Dawson, W. R. (1984) Physiological studies of desert birds: present and future considerations. Journal of Arid Environments, 7, 133-155. Dawson, W. R. & O'Connor, T. P. (1996) Energetic features of avian thermoregulatory responses. Avian Energetics and Nutritional Ecology (ed C. Carey), pp. 85-124. Chapman and Hall, New York. De Jong, A. A. (1976) The influence of simulated solar radiation on the metabolic rate of White- crowned Sparrows. Condor, 78, 174-179. Deerenberg, C., Overkamp, G. J. F. , Visser, G. H. & Daan, S. (1998) Compensation in resting metabolism for experimentally increased activity. Journal of Comparative Physiology B, 186, 507-512. Degen, A. A., Pinshow, B. & Alkon, P. U. (1983) Summer water turnover rates in free-living Chukars and Sand Partridges in the Negev desert. Condor, 85, 333-337. Degen, A. A., Pinshow, B., Yosef, R., Kam, M. & Nagy, K. A. (1992) Energetics and growth rate of Northern Shrike (Lanius excubitor) nestlings. Ecology, 73, 2273-2283. Delius, J. D. (1965) A population study of Skylarks Alauda arvensis. Ibis , 107, 466-492. Díaz-Uriarte, R. & Garland, T., Jr. (1998) Effects of branch length errors on the performance of phylogenetic independent contrasts. Systematic Biology, 47, 654-672. Dmi'el, R. & Tel-Tzur, D. (1985) Heat balance of two starling species (Sturnus vulgaris and Onychognathus tristami) from temperate and desert habitats. Journal of Comparative Physiology, 155, 395-402. Dragàn, J. C. & Airinei, S. (1989) Geoclimate and History. Nagard Publ., Rome. Drent, R. H. & Stonehouse, B. (1971) Thermoregulatory responses of the Peruvian Penguin, Spheniscus humboldti. Comparative Biochemistry and Physiology, 40A, 689-710. Drent, R. H. & Daan, S. (1980) The prudent parent: Energetic adjustments in avian breeding. Ardea, 68, 225-252. Dykstra, C. R. & Karasov, W. H. (1993) Nesting energetics of House Wrens (Troglodytes aedon) in relation to maximal rates of energy flow. The Auk, 110, 481-491. Edwards, S. V., Arctander, P. & Wilson, A. C. (1991) Mitochondrial DNA resolution of a deep branch in the genealogical tree of perching birds. Proceedings of the Royal Society of London - Series B, 243, 99-107. El-Baz, F. (1983) A geological perspective of the desert. In: Origin and Evolution of Deserts (eds S. G. Wells & D. R. Haragan), pp. 163-183. University of New Mexico Press, Albuquerque. Ellis, H. I. (1984) Energetics of free-ranging seabirds. In: Seabird Energetics (eds G. C. Whittow & H. Rahn), pp. 203-234. Plenum Press, New York. Emberger, L. (1955) Afrique du Nord-Ouest. In: Plant Ecology: Reviews of Research (ed UNESCO), 348 pp. 219-249. UNESCO. Enoksson, B. (1990) Time budgets of Nuthatches Sitta europea with supplementary food. Ibis, 132, 575-583. Ettinger, A. O. & King, J. R. (1980) Time and energy budgets of the Willow Flycatcher (Empidonax traillii) during the breeding season. Auk, 97, 533-546. Evenari, M. (1985) The desert environment. In: Hot Deserts and Shrublands (eds M. Evenari, I. Noy- Meir & D. W. Goodall), pp. 1-22. Elsevier, Amsterdam. Falconer, D. S. & Mackay, T. F. C. (1996) Introduction to Quantitative Genetics. Longman, New York. Farris, J. S. (1969) A successive approximation approach to character weighting. Systematic Zoology, 18, 374-385. Feder, M. E. (1987) The analysis of physiological diversity: the prospects for pattern documentation and general questions in ecological physiology. In: New Directions in Ecological Physiology (eds M. E. Feder, A. F. Bennett, W. Burggren & R. B. Huey), pp. 38-75. Cambridge University Press, Cambridge. Feduccia, A. (1996) The Origin and Evolution of Birds. Yale University Press, New Haven. Felsenstein, J. (1985a) Phylogenies and the comparative method. American Naturalist, 125, 1-15. Felsenstein, J. (1985b) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783-791. Flint, E. N. & Nagy, K. A. (1984) Flight energetics of free-living Sooty Terns. The Auk, 101, 288-294. Frakes, L. A. (1979) Climates Throughout Geologic Time. Elsevier, Amsterdam. Frakes, L. A., Francis, J. E. & Syktus, J. I. (1992) Climate Modes of the Phanerozoic. Cambridge University Press, Cambridge. Freeman, S. & Herron, J. C. (1998) Evolutionary Analysis. Prentice-Hall, Inc., Upper Saddle River, New Jersey. Frumhoff, P. C. & Reeve, H. K. (1994) Using phylogenies to test hypotheses of adaptation: a critique of some current proposals. Evolution, 48, 172-180. Frumkin, R., Pinshow, B. & Weinstein, Y. (1986) Metabolic heat production and evaporative heat loss in desert phasianids: Chukar and Sand Partridges. Physiological Zoology, 59, 592-605. Furness, R. W. & Bryant, D. M. (1996) Effect of wind on field metabolic rates of breeding Northern Fulmars. Ecology, 77, 1181-1188. Furuyama, F. & Ohara, K. (1993) Genetic development of an inbred rat strain with increased resistance adaptation to a hot environment. American Journal of Physiology, 265, R957-R962. Gabrielsen, G. W., Mehlum, F. & Nagy, K. A. (1987) Daily energy expenditure and energy utilization of free-ranging Black-legged Kittiwakes. The Condor, 89, 126-132. Gabrielsen, G. W., Taylor, J. R. E., Konarzewski, M. & Mehlum, F. (1991) Field and laboratory metabolism and thermoregulation in Dovekies (Alle alle). The Auk, 108, 71-78. Gales, R. & Green, B. (1990) The annual cycle of Little Penguins (Eudyptula minor). Ecology, 71, 2297-2312. Ganey, J. L., Balda, R. P. & King, R. M. (1993) Metabolic rate and evaporative water loss of mexican Spotted and Great Horned Owls. Wilson Bulletin, 105, 645-656. Garland, T. Jr., Harvey, P. H. & Ives, A. R. (1992) Procedures for the analysis of comparative data using phylogenetically independent contrasts. Systematic Biology, 41, 18-32. Garland, T. Jr., Dickerman, A. W., Janis, C. M. & Jones, J. A. (1993) Phylogenetic analysis of covariance by computer simulation. Systematic Biology, 42, 265-292. Garland, T. Jr. & Janis, C. M. (1993) Does metabolism/femur ratio predict maximal running speed in cursorial mammals? Journal of Zoology, 229, 133-151. Garland, T. Jr. & Carter, P. A. (1994) Evolutionary physiology. Annual Reviews in Physiology, 56, 579-621. Garland, T. Jr., Midford, P. E. & Ives, A. R. (1999) An introduction to phylogenetically based statistical methods, with a new method for confidence intervals on ancestral values. American Zoologist, 39, 374-388. Gates, D. M. (1980) Biophysical Ecology. Springer, New York. Gaucher, P., Paillat, P., Chappuis, C., Saint Jalme, M., Lotfikhah, F. & Wink, M. (1996) Taxonomy of the Houbara Bustard Chlamydotis undulata subspecies considered on the basis of sexual display and

genetic divergence. Ibis, 138, 273-282. REFERENCES Gelineo, S. (1964) Organ systems in adaptation: the temperature regulating system. In: Handbook of 349 Physiology, section 4, Adaptation to the Environment (ed D. B. Dill), pp. 259-282. American Physiological Society, Washington, DC. General Eastern (1993) General Eastern's Humidity Handbook. General Eastern, Woburn, Mass. Gerson, R. (1982) The Middle East: Landforms of a planetary desert through environmental changes. Striae, 17, 52-78. Gessaman, J. A. (1972) Bioenergetics of the Snowy Owl (Nyctea scandiaca). Arctic and Alpine Research, 4, 223-238. Gessaman, J. A. (1987) Energetics. Raptor Management Techniques Manual (eds B. A. Pendleton, B. A. Millsop, K. W. Cline & D. M. Bird), pp. 289-320. Yale University Press, New Haven. Gessaman, J. A. & Nagy, K. A. (1988) Energy metabolism: errors in gas-exchange conversion factors. Physiological Zoology, 61, 507-513. Getz, L. L. (1968) Relationship between ambient temperature and respiratory water loss of small mammals. Comparative Biochemistry and Physiology, 24, 335-342. Gittleman, J. L. & Kot, M. (1990) Adaptation: Statistics and a null model for estimating phylogenetic effects. Systematic Zoology, 39, 227-241. Goldstein, D. L. (1983) The effect of wind on avian metabolic rate with particular reference to Gambel's Quail. Physiological Zoology, 56, 485-492. Goldstein, D. L. (1984) The thermal environment and its constraint on activity in Desert Quail in summer. Auk, 101, 542-550. Goldstein, D. L. & Nagy, K. A. (1985) Resource utilization by Desert Quail: time and energy, food and water. Ecology, 66, 378-387. Goldstein, D. L. & Braun, E. J. (1989) Structure and concentrating ability in the avian kidney. American Journal of Physiology, 256, R501-R509. Golley, F. B. (1961) Energy values of ecological materials. Ecology, 42, 581-584. Gordon, M. S. & Olson, E. C. (1995) Invasions of the Land: the Transitions of Organisms from Aquatic to Terrestrial Life. Columbia University Press, New York. Gould, S. J. & Lewontin, R. C. (1979) The Spandrels of San Marco and the Panglossian paradigm. A critique of the adaptationist program. Proceedings of the Royal Society of London - Series B, 205, 581-598. Gould, S. J. & Vrba, E. S. (1982) Exaptation - a missing term in the science of form. Paleobiology, 8, 4-15. Grafen, A. (1989) The phylogenetic regression. Philosophical Transactions Royal Society B, 326, 199-257. Grayson, D. K. (1993) The Desert's Past. Smithsonian Institute Press, Washington. Greenwald, L., Stone, W. B. & Cade, T. J. (1967) Physiological adjustments of the Budgerigar (Melopsittacus undulatus) to dehydrating conditions. Comparative Biochemistry and Physiology, 22, 91-100. Greenwald, L. & Stetson, D. (1988) Urine concentration and the length of the renal papilla . News in Physiology Science, 3, 46-49. Grove, A. T. (1977) The geography of semi-arid lands. Philosophical Transactions Royal Society B, 278, 457-475. Hails, C. J. & Bryant, D. M. (1979) Reproductive energetics of a free-living bird. Journal of Animal Ecology, 48, 471-482. Hails, C. J. (1983) The metabolic rate of tropical birds. Condor, 85, 61-65. Hansen, T. F. (1997) Stabilizing selection and the comparative analysis of adaptation. Evolution, 51, 1341-1351. Hart, J. S. (1962) Seasonal acclimatization in four species of small wild birds. Physiological Zoology, 35, 224-236. Harvey, P. H. & Pagel, M. D. (1991) The Comparative Method in Evolutionary Biology. Oxford University Press, Oxford. Harvey, P. H., Pagel, M. D. & Rees, J. A. (1991) Mammalian metabolism and life histories. The American Naturalist, 137, 556-566. Hasegawa, M., Kishino, H. & Yano, T. (1985) Dating of the human-ape splitting by the molecular clock of mitochondrial DNA. Journal of Molecular Evolution, 22, 160-174. 350 Hau, M. (2001) Timing of breeding in variable environments: Tropical birds as model systems. Hormones and Behavior, 40, 281-290. Hayes, J. P. & Garland, T. Jr. (1995) The evolution of endothermy: testing the aerobic capacity model. Evolution, 49 , 836-847. Hayes, J. P. & Shonkwiler, J. S. (1996) Analyzing mass-independent data. Physiological Zoology, 69, 974-980. Hayssen, V. & Lacy, R. C. (1985) Basal metabolic rates in mammals: taxonomic differences in the allometry of BMR and body mass. Comparative Biochemistry and Physiology, 81A, 741-754. Hayworth, A. M. & Weathers, W. W. (1984) Temperature regulation and climatic adaptation in Black-billed and Yellow-billed Magpies. Condor, 86, 19-26. Hedrick, P. W. (1986) Genetic polymorphism in heterogeneous environments: A decade later. Annual Review of Ecology and Systematics, 17, 535-566. Heim de Balsac, H. (1936) Biogéographie des mammifères et des oiseaux de l'Afrique du Nord. Bulletin Biologique de France et Belgique, Suppl. 21, 1-447. Heisinger, J. F. & Breitenbach, R. P. (1969) Renal structural characteristics as indexes of renal adaptations for water conservation in the genus Sylvilagus. Physiological Zoology, 42, 160-172. Heldmaier, G. & Ruf, T. (1992) Body temperature and metabolic rate during natural hypothermia in endotherms. Journal of Comparative Physiology B , 162, 696-706. Hill, R. N. (1972) Determination of oxygen consumption by use of the paramagnetic oxygen analyzer. Journal of Applied Physiology, 33, 263. Hillenius, W. J. (1992) The evolution of nasal turbinates and mammalian endothermy. Paleobiology, 18, 17-29. Hillenius, W. J. (1994) Turbinates in therapsids: evidence for late Permian origins of mammalian endothermy. Evolution, 48, 207-229. Hillis, D. M. & Huelsenbeck, J. P. (1992) Signal, noise, and reliability in molecular phylogenetic analysis. Journal of Heredity, 83, 189-195. Hinds, D. S. & Calder, W. A. (1973) Temperature regulation of the Pyrrhuloxia and the Arizona Cardinal. Physiological Zoology, 46, 55-71. Hinds, D. S., Baudinette, R. V., MacMillen, R. E. & Halpern, E. A. (1993) Maximum metabolism and the aerobic factorial scope of endotherms. Journal of Experimental Biology, 182, 41-56. Hinsley, S. A., Ferns, P. N., Thomas, D. H. & Pinshow, B. (1993) Black-bellied Sandgrouse (Pterocles orientalis) and Pin-tailed Sandgrouse (Pterocles alchata): Closely related species with differing bioe- nergetic adaptations to arid zones. Physiological Zoology, 66, 20-42. Hinsley, S. A. (1994) Daily time budgets and activity patterns of sandgrouse (Pteroclididae) in contrasting arid habitats in Spain and Israel. Journal of Arid Environments, 26, 373-382. Hinsley, S. A. (1992) Bioenergetics of a desert specialist, the Double-banded Sandgrouse, and the problem of stress induced by experimental conditions. Comparative Biochemistry and Physiology, 102A, 433-439. Hochberg, Y. & Tamhane, A. C. (1987) Multiple Comparison Procedures. John Wiley & Sons, New York. Hoffman, T. C. M. & Walsberg, G. E. (1999) Inhibiting ventilatory evaporation produces an adaptive increase in cutaneous evaporation in Mourning Doves Zenaida macroura. Journal of Experimental Biology, 202, 3021-3028. Hou, L. H. & Zhang, J. (1993) A new fossil bird from lower Cretaceous of Liaoning. Vertebrata PalAsiatica, 7, 217-224. Houle, D. (1992) Comparing evolvability and variability of quantitative traits. Genetics , 130, 195-204. Houston, A. I. & McNamara, J. M. (1999) Models of Adaptive Behaviour. Cambridge University Press, Cambridge. Howell, T. R., Araya, B. & Millie, W. R. (1974) Breeding biology of the Gray Gull, Larus modestus. University of California Publications in Zoology, 104, 1-57. Högstedt, G. (1981) Effect of additional food on reproductive success in the Magpie (Pica pica). Journal

of Animal Ecology, 50, 219-229. REFERENCES Hudson, D. M. & Bernstein, M. H. (1981) Temperature regulation and heat balance in flying White- 351 necked Ravens, Corvus cryptoleucus. Journal of Experimental Biology, 90, 267. Hudson, J. W. & Kimzey, S. L. (1966) Temperature regulation and metabolic rhythms in populations of the House Sparrow, Passer domesticus. Comparative Biochemistry and Physiology, 17 , 203-217. Huey, R. B. (1987) Phylogeny, history and the comparative method. In: New Directions in Ecological Physiology (eds M. E. Feder, A. F. Bennett, W. Burggren & R. B. Huey), pp. 76-98. Cambridge University Press, Cambridge. Hulbert, A. J. & Else, P. L. (2000) Mechanisms underlying the cost of living in animals. Annual Reviews in Physiology, 62, 207-235. Hunt, C. B. (1983) Physiographic overview of our arid lands in the western U.S. In: Origin and Evolution of Deserts (eds S. G. Wells & D. R. Haragan), pp. 7-63. University of New Mexico Press, Albuquerque. Immelmann, K. (1973) Role of the environment in reproduction as source of "predictive" information. Breeding Biology of Birds (ed D. S. Farner), pp. 121-147. National Academy of Sciences, Washington, D.C. Jackson, D. C. & Schmidt-Nielsen, K. (1964) Counter-current heat exchange in the respiratory passages. Proceedings of the National Academy of Sciences, 51, 1192-1197. Janzen, D. H. (1995) Who survived the Cretaceous? Science, 268, 785. Johnson, D. H. (1979) Estimating nest success: the Mayfield method and an alternative. Auk, 96, 651-661. Johnson, O. W. (1974) Relative thickness of the renal medulla in birds. Journal of Morphology, 142, 277-284. Johnson, O. W. & Skadhauge, E. (1975) Structural-functional correlations in the kidneys and observations of colon and cloacal morphology in certain Australian birds. Journal of Anatomy, 120, 495-505. Johnson, R. E. (1968) Temperature regulation in the White-tailed Ptarmigan, Lagopus leucurus. Comparative Biochemistry and Physiology, 24, 1003-1004. Jones, C. R. (1982) The Kalahari of Southern Africa. The Geological Story of the World's Deserts. Striae, 17, 20-34. Kaiser, T. J. & Bucher, T. L. (1985) The consequences of reverse sexual size dimorphism for oxygen consumption, ventilation, and water loss in relation to ambient temperature in the Prairie Falcon, Falco mexicanus. Physiological Zoology, 58, 748-758. Kam, M., Degen, A. A. & Nagy, K. A. (1987) Seasonal energy, water, and food consumption of Negev Chukars and Sand Partridges. Ecology, 68, 1029-1037. Karasov, W. H. (1996) Digestive plasticity in avian energetics and feeding ecology. In: Avian Energetics and Nutritional Ecology (ed C. Carey), pp. 61-84. Chapman and Hall, New York. Keast, A. (1959) Australian birds: their zoogeography and adaptations to an arid continent. In: Biogeography and Ecology in Australia (eds A. Keast, R. L. Crocker & C. S. Christian ), pp. 89-114. Junk, The Hague. Kendeigh, S. C. (1969) Energy responses of birds to their thermal environment. Wilson Bulletin, 81, 441-449. Kendeigh, S. C., Dolnik, V. R. & Gavrilov, V. M. (1977) Avian energetics. In: Granivorous Birds in Ecosystems (eds J. Pinowski & S. C. Kendeigh), pp. 127-204. Cambridge University Press, Cambridge. Kennett, J. P. (1980) Palaeoceanographic and biogeographic evaluation of the southern ocean during the Cenozoic, and Cenozoic microfossil datums. Palaeogeography, Paleoclimatology and Palaeoecology, 31, 123-152. Kersten, M. & Piersma, T. (1987) High levels of energy expenditure in shorebirds: metabolic adaptations to an energetically expensive way of life. Ardea, 75, 175-187. Kersten, M., Bruinzeel, L. W., Wiersma, P. & Piersma, T. (1998) Reduced basal metabolic rate of migratory waders wintering in coastal Africa. Ardea, 86, 71-80. King, J. R. & Farner, D. S. (1961) Energy metabolism, thermoregulation and body temperature. In: Biology and Comparative Physiology of Birds, vol. II (ed A. J. Marshall), pp. 215-288. Academic Press, New York. King, J. R. (1974) Seasonal allocation of time and energy resources in birds. In: Avian Energetics (ed R. A. Paynter, Jr.), pp. 4-85. Nuttall Ornithological Club, Cambridge, Massachusetts. 352 Klaassen, M., Bech, C., Masman, D. & Slagsvold, G. (1989) Growth and energetics of Arctic Tern chicks (Sterna paradisaea). Auk, 106, 240-248. Klaassen, M. & Drent, R. H. (1991) An analysis of hatchling resting metabolism: in search of ecological correlates that explain deviations from allometric relations. Condor, 93, 612-629. Kleiber, M. (1961) The Fire of Life: An Introduction to Animal Energetics. Wiley and Sons, New York. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. & Wilson, A. C. (1989) Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences , 86, 6196-6200. Koeppen, B. M. & Stanton, B. A. (1997) Renal Physiology. Mosby-Year Book, Inc., St. Louis. Konarzewski, M. & Diamond, J. (1995) Evolution of basal metabolic rate and organ masses in laboratory mice. Evolution, 49, 1239-1248. Kooyman, G. L., Cherel, Y., Le Maho, Y., Croxall, J. P., Thorson, P. H. & Kooyman, C. A. (1992) Diving behavior and energetics during foraging cycles in King Penguins. Ecological Monographs, 62, 143-163. Köppen, W. (1931) Die Klimate der Erde. Walter de Gruyter and So., Berlin. Krebs, H. A. (1950) Body size and tissue respiration. Biochimica et Biophysica Acta, 4, 249-269. Lack, D. (1954) The Natural Regulation of Animal Numbers. Oxford University Press, Oxford. Lack, D. (1968) Ecological Adaptations for Breeding in Birds. Methuen, London. Lancaster, J., Lancaster, N. & Seely, M. K. (1984) Climate of the central Namib Desert. Madoqua, 14, 4-61. Lancaster, N. (1989) The Namib Sand Sea: Dune Forms, Processes and Sediments. A.A. Bolkema , Rotterdam. Larochelle, J. (1998) Comments on a negative appraisal of taxidermic mounts as tools for studies of ecological energetics. Physiological Zoology, 71, 596-598. Lasiewski, R. C., Acosta, A. L. & Bernstein, M. H. (1966) Evaporative water loss in birds - I. Characteristics of the open flow method of determination, and their relation to estimates of thermoregulatory ability. Comparative Biochemistry and Physiology, 19, 445-457. Lasiewski, R. C. & Dawson, W. R. (1967) A re-examination of the relationship between standard metabolic rate and body weight in birds. Condor, 69, 13-23. Lasiewski, R. C. & Snyder, G. K. (1969) Responses to high temperature in nestling Double-crested and Pelagic Cormorants. Auk, 86, 529-540. Lasiewski, R. C., Bernstein, M. H. & Ohmart, R. D. (1971) Cutaneous water loss in the Roadrunner and Poor-will. Condor, 73, 470-472. Lasiewski, R. C. & Seymour, R. S. (1972) Thermoregulatory responses to heat stress in four species of birds weighing approximately 40 grams. Physiological Zoology, 45, 106-118. Lee, K., Feinstein, J. & Cracraft, J. (1997) The phylogeny of ratite birds: Resolving conflicts between molecular and morphological data sets. In: Avian Molecular Evolution and Systematics (ed D. P. Mindell), pp. 173-211. Academic Press, San Diego. Lee, P. & Schmidt-Nielsen, K. (1971) Respiratory and cutaneous evaporation in the Zebra Finch: effect on water balance. American Journal of Physiology, 220, 1598-1605. Leroi, A. M. (1994) What does the comparative method reveal about adaptation? American Naturalist, 143, 381-402. Lessells, C. M. & Boag, P. T. (1987) Unrepeatable repeatabilities: a common mistake. Auk, 104, 116-121. Levy, A. (1964) The accuracy of the bubble meter for gas flow measurements. Journal of Scientific Instruments, 41, 449-453. Lewontin, R. C. (1969) The bases of conflict in biological explanation. Journal of Historical Biology, 2, 35-53. Lifson, N. & McClintock, R. (1966) Theory of use of the turnover rates of body water for measuring energy and material balance. Journal of Theoretical Biology, 12, 46-74. Lima, S. L. (1987) Clutch size in birds: a predation perspective. Ecology, 68, 1062-1070. Lindgren, E. (1973) Studies in the Ecology and Physiology of Three Species of Grass Parrots (Neophema Aves: Psittacidae). PhD-thesis University of Western Australia.

List, R. J. (1971) Smithsonian Meteorological Tables. Smithsonian Miscellaneous Collections, Washington, D.C. REFERENCES Lloyd, P. (1998) A Study of Namaqua Sandgrouse and Other Arid Zone Birds. PhD-thesis University 353 of Cape Town. Lloyd, P. (1999) Rainfall as a breeding stimulus and clutch size determinant in South African arid- zone birds. Ibis, 141, 637-643. Lochmiller, R. L. & Deerenberg, C. (2000) Trade-offs in evolutionary immunology: just what is the cost of immunity? Oikos, 88, 87-98. Louw, G. N. & Seely, M. K. (1982) Ecology of Desert Organisms. Longman, London, England. Lucas, A. M. & Stettenheim, P. R. (1972) Avian anatomy. Agricultural Handbook 362 U.S. Government Printing Office, Washington, DC. Lustick, S. (1969) Bird energetics: effects of artificial radiation. Science, 163, 387-390. Lustick, S., Talbot, S. & Fox, E. L. (1970) Absorption of radiant energy in Red-winged Blackbirds Agelaius phoeniceus. Condor, 72, 471-473. Lynch, M. (1988) The rate of polygenic mutation. Genetics Research Cambridge, 51, 137-148. Maclean, G. L. (1970a) The biology of the larks (Alaudidae) of the Kalahari sandveld. Zoologica Africana, 5, 7-39. Maclean, G. L. (1970b) Breeding behaviour of larks in the Kalahari sandveld. Annals of the Natal Museum, 20, 381-401. Maclean, G. L. (1974) Arid-zone adaptations in southern African birds. Cimbebasia, 2, 163-175. Maclean, G. L. (1996) Ecophysiology of Desert Birds. Springer-Verlag, Berlin Heidelberg. MacMillen, R. E. & Trost, C. H. (1967) Thermoregulation and water loss in the Inca Dove. Comparative Biochemistry and Physiology, 20, 263-273. MacMillen, R. E. (1990) Water economy of granivorous birds: a predictive model. Condor, 92, 379-392. MacMillen, R. E. & Baudinette, R. V. (1993) Water economy of granivorous birds: Australian parrots. Functional Ecology, 7, 704-712. Madsen, H. (1930) Quelques remarques sur la cause pouruoi les grand oiseaux au Soudan planent si haut au milieu de la journée. Videnskabelige Meddeleser Dansk Naturhistorisk Forening, Copenhagen, 8, 301-303. Maloney, S. K. & Dawson, T. J. (1993) Sexual dimorphism in basal metabolism and body temperature of a large bird, the Emu. The Condor, 95, 1034-1037. Maloney, S. K. & Dawson, T. J. (1994) Ventilatory accommodation of oxygen demand and respiratory water loss in a large bird, the Emu (Dromaius novaehollandiae), and a re-examination of ventilatory allometry for birds. Journal of Comparative Physiology B, 164, 473-481. Maloney, S. K. & Dawson, T. J. (1998) Changes in pattern of heat loss at high ambient temperature caused by water deprivation in a large flightless bird, the Emu. Physiological Zoology, 71, 712-719. Mandeville, J. P. (1990) Flora of Eastern Saudi Arabia. Kegan Paul International, London. Marder, J. & Ben-Asher, J. (1983) Cutaneous water evaporation - 1. Its significance in heat-stressed birds. Comparative Biochemistry and Physiology, 75A, 425-431. Marder, J., Gavrieli-Levin, I. & Raber, P. (1986) Cutaneous evaporation in heat-stressed Spotted Sandgrouse. Condor, 88, 99-100. Marder, J. & Arieli, Y. (1988) Heat balance of acclimated Pigeons (Columba livia) exposed to temperatures up to 60oC Ta. Comparative Biochemistry and Physiology, 91A, 165-170. Marder, J., Arieli, Y. & Ben-Asher, J. (1989) Defense strategies against environmental heat stress in birds. Israel Journal of Zoology, 36, 61-75. Marschall, U. & Prinzinger, R. (1991) Vergleichende Okophysiologie von funf Prachtfinkenarten (Estrildidae). Journal of Ornithology, 132, 319-323. Martin, A. W. & Fuhrman, F. A. (1955) The relationship between summated tissue respiration and metabolic rate in the mouse and the dog. Physiological Zoology, 28, 18-34. Martin, T. E. (1993) Nest predation and nest sites: new perspectives on old patterns. Bioscience, 43, 523-532. Martins, E. P. & Garland, T. Jr. (1991) Phylogenetic analyses of the correlated evolution of continuous characters: A simulated study. Evolution , 45, 534-557. 354 Martins, E. P. & Hansen, T. F. (1996) The statistical analysis of interspecific data: A review and evaluation of phylogenetic comparative methods. In: Phylogenies and the Comparative Method in Animal Behavior (ed E. P. Martins), pp. 22-75. Oxford University Press, New York. Masman, D., Daan, S. & Beldhuis, H. J. A. (1988) Ecological energetics of the Kestrel: daily energy expenditure throughout the year based on time-energy budget, food intake and doubly labeled water methods. Ardea, 76, 64-81. Mathieu-Costello, O., Agey, P. J., Quintana, E. S., Rousey, K., Wu, L. & Bernstein, M. H. (1998) Fiber capillarization and ultrastructure of Pigeon pectoralis muscle after cold acclimation. Journal of Experimental Biology, 201, 3211-3220. Mautz, W. J. (1982) Patterns of evaporative water loss. In: Biology of the Reptilia (eds C. Gans & F. H. Pough), pp. 443-481. Academic Press, London. Mayfield, H. F. (1975) Suggestions for calculating nest success. Wilson Bulletin, 87, 456-466. McFarland, D. & Baher, E. (1968) Factors affecting the feather posture in the Barbary Dove. Animal Behaviour, 16, 171-177. McGilp, J. N. (1932) Heat in the Interior of South Australia. South Australia Ornithology, 11, 160. McGinnies, W. G. (1979) Description and structure of arid ecosystems: general description of desert areas. Arid-land Ecosystems: Structure, Functioning and Management (eds D. W. Goodall, F. A. Perry & K. W. Howes), Cambridge University Press, Cambridge, UK. McNab, B. K. & Morrison, P. (1963) Body temperature and metabolism in subspecies of Peromyscus from arid and mesic environments. Ecological Monographs, 33, 63-82. McNab, B. K. (1970) Body weight and the energetics of temperature regulation. Journal of Experimental Biology, 53, 329-348. McNab, B. K. (1980) On estimating thermal conductance in endotherms. Physiological Zoology, 53, 145-156. McNab, B. K. (1986) The influence of food habits on the energetics of eutherian mammals. Ecological Monographs, 56, 1-19. McNab, B. K. (1988) Food habits and the basal rate of metabolism in birds. Oecologia, 77, 343-349. McNabb, F. M. A. (1969) A comparative study of water balance in three species of quail. I. Water turnover in the absence of temperature stress. Comparative Biochemistry and Physiology, 28, 1045-1058. McNabb, F. M. A. & Poulson, T. L. (1970) Uric acid excretion in Pigeons, Columba livia. Comparative Biochemistry and Physiology, 33, 933-939. McNabb, F. M. A. & McNabb, R. A. (1975) Proportions of ammonia, urae, urate and total nitrogen in avian urine and quantitative methods for their analysis on a single urine sample. Poultry Science, 54, 1498-1505. McNabb, F. M. A., McNabb, R. A., Prather, I. D., Conner, R. N. & Adkisson, C. S. (1980) Nitrogen excretion in Turkey vultures. Condor, 82, 219-223. McNamara, J. M. & Houston, A. I. (1986) The common currency for behavioral decisions. American Naturalist, 127, 358-378. Mead, J. I. (1987) Quaternary records of pika, Ochotona, in North America. Boreas, 16, 165-171. Mehlum, F., Gabrielsen, G. W. & Nagy, K. A. (1993) Energy expenditure by Black Guillemots (Cepphus grylle) during chick-rearing. Colonial Waterbirds, 16, 45-52. Meigs, P. (1953) Reviews of Research on Arid Zone Hydrology. UNESCO, Paris. Meigs, P. (1966) Geography of Coastal Deserts. UNESCO, Paris. Menon, G. K., Baptista, L. F., Elias, P. M. & Bouvier, M. (1987) Fine structural basis of the cutaneous water barrier in nestling Zebra Finches Peophila guttata. Ibis, 130, 503-511. Menon, G. K., Baptista, L. F., Brown, B. E., B.S. & Elias, P. M. (1989) Avian Epidermal differentiation II. Adaptive response of permeability barrier to water deprivation and replenishment. Tissue and Cell, 21, 83-92. Menon, G. K., Maderson, P. F. A., Drewes, R. C., Baptista, L. F., Price, L. F. & Elias, P. M. (1996) Ultrastructural organization of avian stratum conreum lipids as the basis for facultative cutaneous waterproofing. Journal of Morphology, 227, 1-13.

Merkt, J. R. & Taylor, C. R. (1994) "Metabolic switch" for desert survival. Proceedings of the National REFERENCES Academy of Sciences, 91, 12313-12316. 355 Michaeli, G. & Pinshow, B. (2001) Respiratory water loss in free-flying Pigeons. Journal of Experimental Biology, 204, 3803-3814. Miles, D. B. & Dunham, A. E. (1993) Historical perspectives in ecology and evolutionary biology: the use of phylogenetic comparative analyses. Annual Review of Ecology and Systematics, 24, 587-619. Miller, A. H. (1963) Desert adaptations of birds. Proceedings 13th International Ornithological Congress, 666-674. Mitchell, T. D. & Hulme, M. (2000) A country by country analysis of past and future warming rates. Tyndall Centre, UEA, Norwich, UK. Mock, P. J. (1991) Daily allocation of time and energy of Western Bluebirds feeding nestlings. The Condor, 93, 598-611. Montevecchi, W. A., Birt-Friesen, V. L. & Cairns, D. K. (1992) Reproductive energetics and prey harvest of Leach's Storm-petrels in the northwest Atlantic. Ecology, 73, 823-832. Moreno, J., Carlson, A. & Alatalo, R. V. (1988) Winter energetics of coniferous forest tits Paridae in the north: the implications of body size. Functional Ecology, 2, 163-170. Moreno, J. (1989) Variations in daily energy expenditure in nesting Northern Wheatears (Oenanthe oenanthe). The Auk, 106, 18-25. Moreno, J. & Carlson, A. (1989) Clutch size and the costs of incubation in the Pied Flycatcher Ficedula hypoleuca. Ornis Scandinavica, 20, 128. Moreno, J., Cowie, R. J., Sanz, J. J. & Williams, R. S. R. (1995) Differential response by males and females to brood manipulations in the Pied Flycatcher: energy expenditure and nestling diet. Journal of Animal Ecology, 64, 721-732. Moreno, J. & Sanz, J. J. (1996) Field metabolic rates of breeding Chinstrap Penguins (Pygoscelis antarctica) in the south Shetlands. Physiological Zoology, 69, 586-598. Mount, L. E. (1979) Adaptation to Thermal Environment. Edward Arnold, London. Mueller, P. & Diamond, J. (2001) Metabolic rate and environmental productivity: Well-provisioned animals evolved to run and idle fast. Proceedings of the National Academy of Sciences, 98, 12550-12554. Murrish, D. E. & Schmidt-Nielsen, K. (1970) Exhaled air temperature and water conservation in lizards. Respiration Physiology, 10, 151-158. Murrish, D. E. (1973) Respiratory heat and water exchange in penquins. Respiration Physiology, 19, 262-270. Nager, R. G., Ruegger, C. & Noordwijk, A. J. v. (1997) Nutrient or energy limitation on egg formation: a feeding experiment in Great Tits. Journal of Animal Ecology, 66 , 495-507. Nagy, K. A. (1975) Water and energy budgets of free-living animals: measurement using isotopically labeled water. In: Environmental Physiology of Desert Organisms (ed N. F. Hadley), pp. 227-245. Dowden, Hutchinson and Ross, Stroudsburg, PA.

Nagy, K. A. (1980) CO2 production in animals: analysis of potential errors in the doubly labeled water method. American Journal of Physiology, 238, R466-R473. Nagy, K. A. & Costa, D. P. (1980) Water flux in animals: analysis of potential errors in the tritiated water method. American Journal of Physiology, 238, R454-R465. Nagy, K. A., Siegfried, W. R. & Wilson, R. P. (1984) Energy utilization by free-ranging Jackass Penguins, Speniscus demersus. Ecology, 65, 1648-1655. Nagy, K. A. (1987) Field metabolic rate and food requirement scaling in mammals and birds. Ecological Monographs, 57, 111-128. Nagy, K. A. & Peterson, C. C. (1988) Scaling water flux rate in animals. University of California Publications in Zoology, 1. Nagy, K. A. & Obst, B. S. (1992) Food and energy requirements of Adélie Penguins (Pygoscelis adeliae) on the Antarctic peninsula. Physiological Zoology, 65, 1271-1284. Nagy, K. A., Girard, I. A. & Brown, T. K. (1999) Energetics of free-ranging mammals, reptiles and birds. Annual Review of Nutrition, 19, 247-277. Newton, S. F. & Newton, A. V. (1997) The effect of rainfall and habitat on abundance and diversity of 356 birds in a fenced protected area in the central Saudi Arabian desert. Journal of Arid Environments, 35, 715-735. Noy-Meir, I. (1973) Desert ecosystems: environment and producers. Annual Review of Ecology and Systematics, 4, 25-41. Nuttonson, M. Y. (1958) The Physical Environment and Agriculture of Australia with Special Reference to its Winter Rainfall Regions. American Institute of Crop Ecology, Washington, D.C. O'Connor, T. P. (1995) Metabolic characteristics and body composition in House Finches: effects of seasonal acclimatization. Journal of Comparative Physiology B, 165, 298-305. Obst, B. S., Nagy, K. A. & Ricklefs, R. E. (1987) Energy utilization by Wilson's Storm-petrel (Oceanites oceanicus). Physiological Zoology, 60, 200-210. Ohmart, R. D. & Lasiewski, R. C. (1971) Roadrunners: energy conservation by hypothermia and absorption of sunlight. Science, 172, 67-69. Pagel, M. D. & Harvey, P. H. (1988) Recent developments in the analysis of comparative data. Quarterly Review of Biology, 63, 413-440. Palumbi, S., Martin, A., Romano, S., McMillan, W. O., Stice, L. & Grabowski, G. (1991) The simple fool's guide to PCR, Version 2. Dept. of Zoology and Kewalo Marine Laboratory, University of Hawaii, Honolulu. Parsons, P. A. (1987) Evolutionary rates under environmental stress. Evolutionary Biology, 21, 311-347. Parsons, P. A. (1996) Conservation strategies: adaptation to stress and the preservation of genetic diversity. Biological Journal of the Linnean Society, 58, 471-482. Pätzold, R. (1994) Die Lerchen der Welt. Die Neue Brehm-Bucherei; Westarp Wissenschaften, Magdeburg. Pekins, P. J., Gessaman, J. A. & Lindzey, F. G. (1992) Winter energy requirements of Blue Grouse. Canadian Journal of Zoology, 70, 22-24. Pekins, P. J., Gessaman, J. A. & Lindzey, F. G. (1994) Field metabolic rate of Blue Grouse during winter. Canadian Journal of Zoology, 72, 227-231. Peltonen, L., Arieli, Y. & Marder, J. (1998) Adaptive changes in the epidermal structure of the heat- acclimated Rock Pigeon (Columba livia): a comparative electron microscopy study. Journal of Morphology, 235, 17-29. Peltonen, L., Arieli, Y., Pyörnilä, A. & Marder, J. (2000) Local cutaneous water barrier in cold- and heat-acclimated Pigeons (Columba livia) in relation to cutaneous water evaporation. Journal of Morphology, 246, 118-130. Perrins, C. M. & Moss, D. (1975) Reproductive rates in the Great Tit. Journal of Animal Ecology, 44, 695-706. Perrins, C. M. (1977) The role of predation in the evolution of clutch size. Evolutionary Ecology (eds B. Stonehouse & C. M. Perrins), pp. 181-191. University Park Press, Baltimore (Maryland). Peterson, C. C., Nagy, K. A. & Diamond, J. (1990) Sustained metabolic scope. Proceedings of the National Academy of Sciences USA, 87, 2324-2328. Pettit, T. N., Nagy, K. A., Ellis, H. I. & Whittow, G. C. (1988) Incubation energetics of the Laysan Albatross. Oecologia, 74, 546-550. Piersma, T., Cadee, N. & Daan, S. (1995) Seasonality in basal metabolic rate and thermal conductance in a long-distant migrant shorebird, the Knot (Calidris canutus). Journal of Comparative Physiology B, 165, 37-45. Piersma, T., Bruinzeel, L., Drent, R., Kersten, M., Van der Meer, J. & Wiersma, P. (1996) Variability in basal metabolic rate of a long-distance migrant shorebird (Red Knot, Calidris canutus) reflects shifts in organ sizes. Physiological Zoology, 69, 191-217. Piersma, T. & Lindström, A. (1997) Rapid reversible changes in organ size as a component of adaptive behaviour. Trends in Ecology and Evolution, 12, 134-138. Piersma, T., Gudmundsson, G. A. & Lilliendahl, K. (1999) Rapid changes in the size of different functional organs and muscle groups during refueling in a long-distance migrant. Physiological and Biochemical Zoology, 72, 405-415. Pohl, H. & West, G. C. (1973) Daily and seasonal variation in metabolic response to cold during rest

and forced exercise in the Common Redpoll. Comparative Biochemistry and Physiology, 45A, 851-867. REFERENCES Porter, W. P. (1969) Thermal radiation in metabolic chambers. Science, 166, 115-117. 357 Porter, W. P. & Gates, D. M. (1969) Thermodynamic equilibria of animals with environment. Ecological Monographs, 39, 227-244. Powers, D. R. & Nagy, K. A. (1988) Field metabolic rate and food consumption by free-living Anna's Hummingbirds (Calypte anna). Physiological Zoology, 61, 500-506. Powers, D. R. & Conley, T. M. (1994) Field metabolic rate and food consumption of two sympatric hummingbird species in southeastern Arizona. The Condor, 96, 141-150. Price, T. (1991) Morphology and ecology of breeding warblers along an altitudinal gradient in Kashmir, India. Journal of Animal Ecology, 60 , 643-664. Prinzinger, R., Prebmar, A. & Schleucher, E. (1991) Body temperature in birds. Comparative Biochemistry and Physiology, 99A, 499-506. Prosser, C. L. (1986) Adaptational Biology: Molecules to Organisms. Wiley and Sons, New York. Purvis, A. & Garland, T. Jr. (1993) Polytomies in comparative analyses of continuous characters. Systematic Biology, 42, 569-575. Ramsay, D. J. & Thrasher, T. N. (1984) The defense of plasma osmolality. Journal of Physiology Paris, 79, 416-420. Randall, D., Burggren, W. & French, K. (1997) Animal Physiology. Mechanisms and Adaptations. W.H. Freeman and Company, New York. Rauh, W. (1985) The Peruvian-Chilean deserts. In: Hot Deserts and Arid Shrublands (eds M. Evenari, I. Noy-Meir & D. W. Goodall), pp. 239-268. Elsevier, Amsterdam. Rawles, M. E. (1960) The integumentary system. In: Biology and Comparative Physiology of Birds (ed A. J. Marshall), pp. 189-240. Academic Press, New York. Reeve, J. & Abouheif, E. Phylogenetic Independence. Version 1.1. 1999. Department of Ecology and Evolution, SUNY at Stony Brook. Reyer, H. U. & Westerterp, K. (1985) Parental energy expenditure: a proximate cause of helper recruitment in the Pied Kingfisher (Ceryle rudis) Behavioral Ecology and Sociobiology, 17, 363-369. Reynolds, P. S. & Lee, R. M., III (1996) Phylogenetic analysis of avian energetics: passerines and non- passerines do not differ. American Naturalist, 147, 735-759. Reznick, D. (1985) Costs of reproduction: an evaluation of the empirical evidence. Oikos , 44, 257-267. Rice, W. R. (1989) Analyzing tables of statistical tests. Evolution, 43, 223-225. Richards, S. A. (1976) Evaporative water loss in domestic fowls and its partition in relation to ambient temperature. Journal of Agricultural Science, 87, 527-532. Ricklefs, R. E. & Hainsworth, F. R. (1968) Temperature dependent behavior of the Cactus Wren. Ecology, 49, 227-233. Ricklefs, R. E. (1969) An analysis of nesting mortality in birds. Smithsonian Contributions to Zoology, 9, 1-48. Ricklefs, R. E. (1974) Energetics of reproduction in birds. In: Avian Energetics (ed R. A. Paynter, Jr.), pp. 152-292. Nuttall Ornithological Club. Ricklefs, R. E. (1979) Adaptation, constraint, and compromise in avian postnatal development. Biological Reviews, 54, 269-290. Ricklefs, R. E. & Williams, J. B. (1984) Daily energy expenditure and water-turnover rate of adult European Starlings (Sturnus vulgaris) during the nestling cycle. The Auk, 101, 707-716. Ricklefs, R. E., Roby, D. D. & Williams, J. B. (1986) Daily energy expenditure by adult Leach's Storm- petrels during the nestling cycle. Physiological Zoology, 59, 649-660. Ricklefs, R. E. & Starck, J. M. (1996) Applications of phylogenetically independent contrasts: a mixed progress report. Oikos, 77, 167-172. Ricklefs, R. E., Konarzewski, M. & Daan, S. (1996) The relationship between basal metabolic rate and daily energy expenditure in birds and mammals. American Naturalist, 147, 1047-1071. Ricklefs, R. E. (1996) Avian energetics, ecology, and evolution. In: Avian Energetics and Nutritional Ecology (ed C. Carey), pp. 1-30. Chapman and Hall, New York. 358 Roberts, J. R. & Baudinette, R. V. (1986) Thermoregulation, oxygen consumption and water turnover in Stubble Quail, Coturnix pectoralis, and King Quail, Coturnix chinensis. Australian Journal of Zoology, 34, 25-34. Robinson, D. E., Campbell, G. S. & King, J. R. (1976) An evaluation of heat exchange in small birds. Journal of Comparative Physiology, 105, 153-166. Roby, D. D. & Ricklefs, R. E. (1986) Energy expenditure in adult Least Auklets and Diving Petrels during the chick-rearing period. Physiological Zoology, 59, 661-678. Roff, D. A. (1993) The Evolution of Life Histories. Kluwer Academic Publishers. Rolfe, D. F. S. & Brown, G. C. (1997) Cellular energy utilization and molecular origin of standard metabolic rate in mammals. Physiological Reviews, 77, 731-758. Rooke, I. J., Bradshaw, S. D. & Langworthy, R. A. (1983) Aspects of water, electrolyte and carbohydrate physiology of the Silvereye, Zosterops lateralis (Aves). Australian Journal of Zoology, 31, 695-704. Ruben, J. (1996) Evolution of endothermy in mammals, birds and their ancestors. In: Animals and Temperature: Phenotypic and Evolutionary Adaptation (eds I. A. Johnston & A. F. Bennett), pp. 347-376. Cambridge University Press, Cambridge. Rugg, D. J. & Buech, R. R. (1990) Analyzing time budgets with Markov chains. Biometrics, 46, 1123-1131. Saiki, R. K., Gelfand, D. H., Stoffel, S. J., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Enzyme directed enzymatic amplification of DNA with a thermostable polymerase. Science, 239, 487-491. Salzman, A. G. (1982) The selective importance of heat stress in gull nest location. Ecology, 63, 742-751. Schläpfer, A. (1988) Populationsökologie der Feldlerche Alauda arvensis in der intensiv genutzten Agrarlandschaft. Ornithologische Beobachter, 85, 305-371. Schleucher, E., Prinzinger, R. & Withers, P. C. (1991) Life in extreme environments: Investigations on the ecopysiology of a desert bird, the Australian Diamond Dove (Geopelia cuneata Latham). Oecologia, 88, 72-76. Schleucher, E. (1993) Life in extreme dryness and heat: a telemetric study of the behaviour of the Diamond Dove Geopelia cuneata in its natural habitat. Emu, 93, 251-258. Schlichting, C. D. & Pigliucci, M. (1998) Phenotypic Evolution. A Reaction Norm Perspective. Sinauer Associates, Inc., Sunderland, Massachusetts. Schmidt-Nielsen, B. & O'Dell, R. (1961) Structure and concentrating mechanism in the mammalian kidney. American Journal of Physiology, 200, 1119-1124. Schmidt-Nielsen, K. (1964) Desert Animals. Dover Publications, Inc., New York. Schmidt-Nielsen, K., Kanwisher, J. , Lasiewski, R. C., Cohn, J. E. & Bretz, W. L. (1969) Temperature regulation and respiration in the Ostrich. Condor, 71, 341-352. Schmidt-Nielsen, K., Hainsworth, F. R. & Murrish, D. E. (1970) Counter-current heat exchange in the respiratory passages: effect on water and heat balance. Respiration Physiology, 9, 263-276. Schmidt-Nielsen, K. (1981) Counter-current systems in animals. Scientific American, 244, 118-128. Schmidt-Nielsen, K. (1984a) Scaling. Why is Animal Size so Important? Cambridge University Press, Cambridge. Schmidt-Nielsen, K. (1984b) Animal Physiology: Adaptation and Environment. Cambridge University Press, Cambridge. Schmidt-Nielsen, K. (1997) Animal Physiology: Adaptation and Environment. Cambridge University Press, Cambridge. Scholander, P. F., Hock, R., Walters, V., Johnson, F. & Irving, L. (1950) Heat regulation in some arctic and tropical mammals and birds. Biological Bulletin, 99, 237-258. Schulz, H. & Seddon, P. (1996) Biology and status of the Houbara Bustard. In: Propagation of the Houbara Bustard (eds M. Saint Jalme & Y. Van Heezik), pp. 3-14. Kegan Paul International and National Wildlife Research Center, London, Riyadh. Scott, I. M., Yousef, M. K. & Johnson, H. D. (1976) Plasma thyroxine levels of mammals: desert and

mountain. Life Sciences, 19, 807-812. REFERENCES Seddon, P. (1996) Mahazat as-Sayd protected area master management plan Riyadh, Saudi Arabia, 359 National Commission for Wildlife Conservation and Development. Protected Areas Advisory Group. Seddon, P. J., Saint Jalme, M., Van Heezik, Y., Paillat, P., Gaucher, P. & Combreau, O. (1995) Restoration of Houbara Bustard populations in Saudi Arabia: developments and future directions. Oryx, 29, 136-142. Seely, M. K. (1978) The Namib dune desert: an unusual ecosystem. Journal of Arid Environments, 1, 117-128. Serventy, D. L. (1971) Biology of desert birds. In: Avian Biology (eds D. S. Farner & J. R. King), pp. 287-339. Academic Press, New York. Seymour, R. S. (1972) Convective heat transfer in the respiratory systems of panting animals. Journal of Theoretical Biology, 35, 119-127. Shantz, H. L. (1956) History and problems of arid lands development. In: The Future of Arid Lands (ed G. F. White), pp. 3-25. American Association for the Advancement of Science, Washington, D.C. Shishkin, V. S. (1980) The energetic estimation of trophic relations of the larks (Alaudidae) in the Caspian semi-desert. Zoologicheskii zhurnal, 59, 1204-1216. Shkedy, Y. & Safriel, U. N. (1991) Fat reserves of an opportunist and of a specialist species in the Negev desert. Auk, 108, 556-561. Shkedy, Y. & Safriel, U. N. (1992a) Niche breadth of two lark species in the desert and the size of their geographical ranges. Ornis Scandinavica , 23, 89-95. Shkedy, Y. & Safriel, U. N. (1992b) Nest predation and nestling growth rate of two lark species in the Negev Desert, Israel. Ibis, 134, 268-272. Shmida, A. (1985) Biogeography of the desert flora. In: Hot Deserts and Arid Shrublands (eds M. Evenari, I. Noy-Meir & D. W. Goodall), pp. 23-77. Elsevier , Amsterdam. Shobrak, M. (1996) Ecology of Lappet-faced Vulture Torgos tracheliotus in Saudi Arabia. PhD-thesis University of Glasgow, Scotland. Shobrak, M. (1998) Notes on the breeding and cooling behaviour of Hoopoe Larks Alaemon alaudipes in central Saudi Arabia. Sandgrouse, 20, 53-55. Sibley, C. G. & Ahlquist, J. E. (1990) Phylogeny and classification of birds: A study in molecular evolution. Yale University Press, New Haven, Connecticut. Sibley, C. G. & Monroe, B. L. (1990) Distribution and taxonomy of birds of the world. Yale University Press, New Haven. Skadhauge, E. (1981) Osmoregulation in Birds. Springer-Verlag, Berlin. Skutch, A. F. (1966) A breeding bird census and nesting success in Central America. Ibis , 108, 1-16. Smith, G. (1984) Climate. In: Sahara Desert (ed J. L. Cloudsley-Thompson), pp. 17-30. Pergamom Press, Oxford. Smith, R. M. (1969) Cardiovascular, Respiratory, Temperature, and Evaporative Water Loss Responses of Pigeons to Varying Degrees of Heat Stress. PhD-thesis Indiana University, Bloomington. Snyder, G. K. & Nestler, J. R. (1990) Relationships between body temperature, thermal conductance, Q10 and energy metabolism during daily torpor and hybernation in rodents. Journal of Comparative Physiology B, 159, 667-675. Spaepen, J. F. (1991) Survival rates of some full-grown birds migrating through Belgium. Le Gerfaut, 81, 207-216. Speakman, J. R. (1984) The Energy Costs of Foraging in Wading Birds (Charadrii). PhD-thesis University of Stirling, U.K. Speakman, J. R. (1997) Doubly Labelled Water. Chapman and Hall, London. Sperber, I. (1944) Studies on the mammalian kidney. Zoologisch Bidrag Fran Uppsala, 22, 249-432. SPSS (2000) User Manual. [10.0]. Chicago, IL, SPSS. Stallone, J. N. & Braun, E. J. (1985) Contributions of glomerular and tubular mechanisms to antidi- uresis in conscious domestic fowl. American Journal of Physiology, 249, F842-F850. 360 Starck, J. M. (1998) Non-independence of data in biological comparisons. A critical appraisal of current concepts, assumptions, and solutions. Theory Bioscience, 117, 109-138. Starck, J. M. & Ricklefs, R. E. (1998) Avian Growth and Development. Oxford University Press, New York. Starck, J. M. (1999) Structural flexibility of the gastro-intestinal tract of vertebrates - implications for evolutionary morphology. Zoologischer Anzeiger, 238, 87-101. Stearns, S. C. (1992) The Evolution of Life Histories. Oxford University Press, Oxford. Stephenson, A. H. & Minnich, J. E. (1974) Water turnover in free-living Song Sparrows in southeastern Wisconsin. American Zoologist, 14, 1257. Stevens, J. (1996) Applied Multivariate Statistics for the Social Sciences. Lawrence Erlbaum Associates, Mahwah, New Jersey. Suárez, F. & Manrique, J. (1992) Low breeding success in Mediterranean shrubsteppe passerines: Thekla Lark Galerida thekla, Lesser Short-toed Lark Calandrella rufescens, and Black-eared Wheatear Oenanthe hispanica. Ornis Scandinavica, 23, 24-28. Svensson, E. (1995) Avian reproductive timing: when should parents be prudent? Animal Behaviour, 49, 1569-1575. Svensson, E. & Nilsson, J. A. (1995) Food supply, territory quality, and reproductive timing in the Blue Tit (Parus caeruleus). Ecology, 76, 1804-1812. Swofford, D. L. (1998) Phylogenetic analysis using parsimony, Version 4. Sinauer Associates, Sunderland, Massachusetts. Tatner, P. & Bryant, D. M. (1986) Flight cost of a small passerine measured using doubly labelled water: implications for energetics studies. The Auk, 103, 169-180. Tatner, P. (1990) Energetic demands during brood rearing in the Wheatear Oenanthe oenanthe. Ibis, 132, 423-435. Taylor, C. R., Dmi'el, R., Fedak, M. & Schmidt-Nielsen, K. (1971) Energetic cost of running and heat balance in a large bird, the Rhea. American Journal of Physiology, 221, 597-601. Taylor, C. R., Weibel, E. R., Weber, J. M., Vock, R., Hoppeler, H., Roberts, T. J. & Brichon, G. (1996) Design of the oxygen and substrate pathways. I. Model and strategy to test symmorphosis in a netw- ork structure. Journal of Experimental Biology, 199, 1643-1649. Thomas, D. G. (1997) Arid environments: their nature and extent. In: Arid Zone Geomorphology: Process, Form and Change in Drylands (ed D. G. Thomas), pp. 2-12. John Wiley, New York . Thomas, D. H. & Maclean, G. L. (1981) Comparison of physiological and behavioural thermoregulation and osmoregulation in two sympatric sandgrouse species (Aves: Pteroclididae). Journal of Arid Environments, 4, 335-358. Thomas, D. W., Martin, K. & Lapierre, H. (1994) Doubly labelled water measurements of field metabolic rate in White-tailed Ptarmigan: variation in background isotope abundances and effect on CO2 production estimates. Canadian Journal of Zoology, 72, 1967-1972. Thompson, J. D., Gibson, T. J., Plewniak, T. F., Jeanmougin, F. & Higgins, D. G. (1997) The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 24, 4876-4882. Thornthwaite, C. W. (1948) An approach toward a rational classification of climate. Geographical Review, 38, 55-94. Tieleman, B. I., Williams, J. B., Michaeli, G. & Pinshow, B. (1999) The role of the nasal passages in the water economy of Crested Larks and Desert Larks. Physiological and Biochemical Zoology, 72, 219-226. Chapter 10. Tieleman, B. I. & Williams, J. B. (1999) The role of hyperthermia in the water economy of desert birds. Physiological and Biochemical Zoology, 72, 87-100. Chapter 11. Tieleman, B. I. & Williams, J. B. (2000) The adjustment of avian metabolic rates and water fluxes to desert environments. Physiological and Biochemical Zoology, 73, 461-479. Chapter 3.

Tieleman, B. I. & Williams, J. B. (2002a) Effects of food supplementation on behavioral decisions of REFERENCES Hoopoe Larks in the Arabian Desert: balancing water, energy and thermoregulation. Animal Behaviour, 361 63, 519-529. Chapter 14. Tieleman, B. I. & Williams, J. B. (2002b) Cutaneous and respiratory water loss in larks from arid and mesic environments. Physiological and Biochemical Zoology, 75, in press. Chapter 7. Tieleman, B. I., Williams, J. B., LaCroix, F. & Paillat, P. (2002a) Physiological responses of Houbara Bustards to high ambient temperatures. Journal of Experimental Biology, 205, 503-511. Chapter 12. Tieleman, B. I., Williams, J. B. & Bloomer, P. (2002b) Adaptation of metabolism and evaporative water loss along an aridity gradient. Proceedings of the Royal Society of London - Series B, in press. Chapter 4. Tieleman, B. I., Williams, J. B. & Buschur, M. E. (2002c) Physiological adjustments to arid and mesic environments in larks (Alaudidae). Physiological and Biochemical Zoology, 75, 305-313. Chapter 6. Tieleman, B. I., Williams, J. B., Buschur, M. E. & Brown, C. R. (2003) Phenotypic variation of larks along an aridity gradient: are desert birds more flexible? Ecology, in press. Chapter 5. Tinbergen, J. M. & Verhulst, S. (2000) A fixed energetic ceiling to parental effort in the Great Tit? Journal of Animal Ecology, 69, 323-334. Toloza, E. M., Lam, M. & Diamond, J. (1991) Nutrient extraction by cold-exposed mice: a test for digestive safety margins. American Journal of Physiology, 261, 608-620. Tracy, C. R. (1982) Biophysical modeling in reptilian physiology and ecology. In: Biology of the Reptilia (eds C. Gans & F. H. Pough), pp. 275-321. Academic Press, London. Tracy, R. L. & Walsberg, G. E. (2000) Prevalence of cutaneous evaporation in Merriam's Kangaroo Rat and its adaptive variation at the subspecific level. Journal of Experimental Biology, 203, 773-781. Tracy, R. L. & Walsberg, G. E. (2001) Developmental and acclimatory contributions to water loss in a desert rodent: investigating the time course of adaptive changes. Journal of Comparative Physiology B, 171, 669-679. Trevelyan, R., Harvey, P. H. & Pagel, M. D. (1990) Metabolic rates and life histories in birds. Functional Ecology, 4, 135-142. Trivers, R. L. (1972) Parental investment and sexual selection. In: Sexual Selection and the Descent of Man (ed B. Campbell), pp. 136-179. Heinemann, London. Trost, C. H. (1972) Adaptations of Horned Larks (Eremophila alpestris) to hot environments. The Auk, 89, 506-527. Utter, J. M. (1971) Daily Energy Expenditures of Free-living Purple Martins (Progne subis) and Mockingbirds (Mimus polyglottos) with a Comparison of Two Northern Populations of Mockingbirds. PhD-thesis Rutgers University. Utter, J. M. & LeFebvre, E. A. (1973) Daily energy expenditure of Purple Martins (Progne subis) during

the breeding season: estimates using D2O18 and time budget methods. Ecology, 54, 597-604. Valtin, H. (1983) Renal Function. Mechanisms Preserving Fluid and Solute Balance in Health. Little, Brown and Company, Boston. Van Devender, T. R. & Spaulding, W. G. (1983) Development of vegetation and climate in the southwestern United States. In: Origin and Evolution of Deserts (eds S. G. Wells & D. R. Haragan), pp. 131-156. University of New Mexico Press , Albuquerque. Vander Haegen, W. M., Owen, R. B. Jr. & Krohn, W. B. (1994) Metabolic rate of American Woodcock. Wilson Bulletin, 106, 338-343. Veghte, J. H. (1964) Thermal and metabolic responses of the Gray Jay to cold stress. Physiological Zoology, 37, 316-328. Via, S., Gomulkiewicz, R., De Jong, G., Scheiner, S. M., Schlichting, C. D. & Van Tienderen, P. H. (1995) Adaptive phenotypic plasticity: Consensus and controversy. Trends in Ecology and Evolution, 10, 212-216. Visser, G. H. & Schekkerman, H. (1999) Validation of the doubly labeled water method in growing precocial birds: the importance of assumptions concerning evaporative water loss. Physiological and Biochemical Zoology, 72, 740-749. 362 Visser, G. H., Boon, P. E. & Meijer, H. A. J. (2000a) Validation of the doubly labeled water method in Japanese Quail Coturnix c. japonica chicks: is there an effect of growth rate? Journal of Comparative Physiology B, 170, 365-372. Visser, G. H., Dekinga, A., Achterkamp, B. & Piersma, T. (2000b) Ingested water equilibrates isotopically with the body water pool of a shorebird with unrivaled water fluxes. American Journal of Physiology, 279, R1795-R1804. Vleck, C. M. & Vleck, D. (1979) Metabolic rate in five tropical bird species. Condor, 81, 89-91. Walker, C. A. (1981) New subclass of birds from the Cretaceous of South America. Nature, 292, 51-53. Wallace, A. R. (1858) On the tendency of varieties to depart indefinitely from the original type. Proceedings of the Linnean Society of London, 3, 53-62. Walsberg, G. E. (1977) Ecology and energetics of contrasting social systems in Phainopepla nitens (Aves: Ptilogonatidae). University of California Publications in Zoology, 108, 1-63. Walsberg, G. E. & King, J. R. (1978) The relationship of the external surface area of birds to skin surface and body mass. Journal of Experimental Biology, 76, 185-189. Walsberg, G. E. (1983) Avian ecological energetics. In: Avian Biology (eds D. S. Farner & J. R. King), pp. 161-220. Academic Press, New York. Walsberg, G. E. (1985) Physiological consequences of microhabitat selection in birds. In: Habitat selection in birds (ed M. L. Cody), pp. 389-413. Academic Press, New York. Walsberg, G. E. (1986) Thermal consequences of roost-site selection: the relative importance of three modes of heat conservation. Auk, 103, 1-7. Walsberg, G. E. (1990) Communal roosting in a very small bird: consequences for the thermal and respiratory gas environments. Condor, 92, 795-798. Walsberg, G. E. (1993) Thermal consequences of diurnal microhabitat selection in a small bird. Ornis Scandinavica, 24, 174-182. Walsberg, G. E. & Wolf, B. O. (1996) An appraisal of operative temperature mounts as tools for studies of ecological energetics. Physiological Zoology, 69, 658-681. Walter, H. & Lieth, H. (1967) Klimadiagramm - Weltatlas. VEB Gustav Fischer Verlag, Jena. Walter, H. (1986) The Namib Desert .In: Hot Deserts and Arid Shrublands (eds M. Evenari, I. Noy- Meir & D. W. Goodall), pp. 245-282. Elsevier, Amsterdam. Weathers, W. W. & Caccamise, D. F. (1975) Temperature regulation and water requirements of the Monk Parakeet, Myiopsitta monachus. Oecologia, 18, 329-342. Weathers, W. W. & Schoenbaechler, D. C. (1976) Regulation of body temperature in the Budgerygah, Melopsittacus undulatus. Australian Journal of Zoology, 24, 39-47. Weathers, W. W. (1977) Temperature regulation in the Dusky Munia (Lonchura fuscans). Australian Journal of Zoology, 25, 193-199. Weathers, W. W. & Caccamise, D. F. (1978) Seasonal acclimatization to temperature in Monk Parakeets. Oecologia, 35, 173-183. Weathers, W. W. (1979) Climatic adaptation in avian standard metabolic rate. Oecologia, 42, 81-89. Weathers, W. W., Shapiro, C. J. & Astheimer, L. B. (1980) Metabolic responses of Cassin's Finches (Carpodacus cassinii) to temperature. Comparative Biochemistry and Physiology, 65A, 235-238. Weathers, W. W. & Nagy, K. A. (1980) Simultaneous doubly labeled water (3HH18O) and time-budget estimates of daily energy expenditure in Phainopepla nitens. The Auk, 97, 861-867. Weathers, W. W. (1980) Seasonal and geographic variation in avian standard metabolic rate. Acta XVII Congressus Internationalis Ornithologicus. (ed R. Nöhring), pp. 283-286. Verlag der Deutschen Ornithologen-Gesellschaft, Berlin. Weathers, W. W. (1981) Physiological thermoregulation in heat-stressed birds: consequences of body size. Physiological Zoology, 54, 345-361. Weathers, W. W. & Van Riper, C., III (1982) Temperature regulation in two endangered Hawaiian honey-

creepers: the Palila (Psittirostra bailleui) and the Laysan Finch (Psittirostra cantans). Auk, 99, 667-674. REFERENCES Weathers, W. W., Weathers, D. L. & Van Riper, C., III (1983) Basal metabolism of the Apapane: 363 Comparison of freshly caught birds with long-term captives. The Auk, 100, 977-978. Weathers, W. W. & Nagy, K. A. (1984) Daily energy expenditure and water flux in Black-rumped Waxbills (Estrilda troglodytes). Comparative Biochemistry and Physiology, 77A, 453-458. Weathers, W. W. & Stiles, F. G. (1989) Energetics and water balance in free-living tropical hummingbirds. The Condor, 91, 324-331. Weathers, W. W. & Sullivan, K. A. (1989) Juvenile foraging proficiency, parental effort, and avian reproductive success. Ecological Monographs, 59, 223-246. Weathers, W. W., Koenig, W. D. & Stanback, M. D. (1990) Breeding energetics and thermal ecology of the Acorn Woodpecker in central coastal California. The Condor, 92, 341-359. Weathers, W. W. (1992) Scaling nestling energy requirements. Ibis, 134, 142-153. Weathers, W. W. & Sullivan, K. A. (1993) Seasonal patterns of time and energy allocation by birds. Physiological Zoology, 66, 511-536. Weathers, W. W. & Siegel, R. B. (1995) Body size establishes the scaling of avian postnatal metabolic rate: an interspecific analysis using phylogenetically independent contrasts. Ibis, 137, 532-542. Weathers, W. W., Paton, D. C. & Seymour, R. S. (1996) Field metabolic rate and water flux in necta- rivorous honeyeaters. Australian Journal of Zoology, 44, 445-460. Weathers, W. W. (1996) Energetics of postnatal growth. In: Avian Energetics and Nutritional Ecology (ed C. Carey), pp. 461-496. Chapman and Hall, New York. Weathers, W. W. (1997) Energetics and thermoregulation by small passerines of the humid, lowland tropics. Auk, 114, 341-352. Webster, M. D., Campbell, G. S. & King, J. R. (1985) Cutaneous resistance to water-vapor diffusion in pigeons and the role of the plumage. Physiological Zoology, 58, 58-70. Webster, M. D. & King, J. R. (1987) Temperature and humidity dynamics of cutaneous and respiratory evaporation in Pigeons, Columba livia. Journal of Comparative Physiology B, 157, 253-260. Webster, M. D. & Bernstein, M. H. (1987) Ventilated capsule measurements of cutaneous evaporation in Mourning Doves. The Condor, 89, 863-868. Webster, M. D. & Weathers, W. W. (1988) Effect of wind and air temperature on metabolic rate in Verdins, Auriparus flaviceps. Physiological Zoology, 61, 543-554. Weibel, E. R. (1998) Symmorphosis and optimization of biological design: introduction and questions. In: Principles of Animal Design. The Optimization and Symmorphosis Debate (eds E. R. Weibel, C. R. Taylor & L. Bolis), pp. 1-10. Cambridge University Press, Cambridge. Weiner, J. (1993) Physiological limits to sustainable energy budgets in birds and mammals: ecological implications. Trends in Ecology and Evolution, 7, 384-388. Welch, W. R. & Tracy, C. R. (1977) Respiratory water loss: a predictive model. Journal of Theoretical Biology, 65, 253-265. Wells, S. G., Bullard, T. F. & Smith, L. N. (1982) Origin and evolution of deserts in the Basin and Range of Colorado Plateau provinces of western North America. The Geological Story of the World's Deserts. Striae 17 (ed T. L. Smiley), pp. 101-111. Uppsala. Werger, M. A. (1986) The Karoo and southern Kalahari. In: Hot Deserts and Arid Shrublands (eds M. Evenari, I. Noy-Meir & D. W. Goodall), pp. 283-354. Elsevier, Amsterdam. West, G. C. (1972) The effect of acclimation and acclimatization on the resting metabolic rate of the Common Redpoll. Comparative Biochemistry and Physiology, 43A, 293-310. Westerterp, K. R. & Bryant, D. M. (1984) Energetics of free existence in swallows and martins (Hirundinidae) during breeding: a comparative study using doubly labeled water. Oecologia, 62, 376-381. Westoby, M., Leishman, M. R. & Lord, J. M. (1995) On misinterpreting the "phylogenetic correction". Journal of Ecology, 83, 531-534. Wiehn, J. & Korpimäki, E. (1997) Food limitation on brood size: experimental evidence in the eura- sian Kestrel. Ecology, 78, 2043-2050. 364 Wikelski, M., Lynn, S., Breuner, C., Wingfield, J. C. & Kenagy, G. J. (1999) Energy metabolism, testos- terone and corticosterone in White-crowned Sparrows. Journal of Comparative Physiology A, 185, 463-470. Williams, G. C. (1966) Adaptation and Natural Selection. Princeton University Press, Princeton, N.J. Williams, J. B. & Hansell, H. (1981) Bioenergetics of captive Belding's Savannah Sparrows (Passerculus sandwichensis beldingi). Comparative Biochemistry and Physiology, 69A, 783-787. Williams, J. B. & Nagy, K. A. (1984a) Validation of the doubly labeled water technique for measuring energy metabolism in Savannah Sparrows. Physiological Zoology, 57, 325-328. Williams, J. B. & Nagy, K. A. (1984b) Daily energy expenditure of Savannah Sparrows: comparison of time-energy budget and doubly-labeled water estimates. Auk, 101, 221-229. Williams, J. B. (1985) Validation of the doubly labeled water technique for measuring energy metabolism in starlings and sparrows. Comparative Biochemistry and Physiology, 80A, 349-353. Williams, J. B. & Nagy, K. A. (1985a) Daily energy expenditure by female Savannah Sparrows feeding nestlings. The Auk, 102, 187-190. Williams, J. B. & Nagy, K. A. (1985b) Water flux and energetics of nestling Savannah Sparrows in the field. Physiological Zoology, 58, 515-525. Williams, J. B. & Prints, A. (1986) Energetics of growth in nestling Savannah Sparrows: a comparison of doubly labelled water and laboratory estimates. Condor, 88, 74-83. Williams, J. B. (1987) Field metabolism and food consumption of the Savannah Sparrows during the breeding season. The Auk, 104, 277-289. Williams, J. B. (1988) Field metabolism of Tree Swallows during the breeding season. The Auk, 105, 706-714. Williams, J. B., Pacelli, M. M. & Braun, E. J. (1991a) The effect of water deprivation on renal function in conscious unrestrained Gambel's Quail (Callipepla gambelii). Physiological Zoology, 64, 1200-1216. Williams, J. B., du Plessis, M. A. & Siegfried, W. R. (1991b) Green Woodhoopoes Phoeniculus purpureus and obligate cavity roosting provide a test of the thermoregulatory insufficiency hypothesis. Auk, 108, 285-293. Williams, J. B., Withers, P. C., Bradshaw, S. D. & Nagy, K. A. (1991c) Metabolism and water flux of captive and free-living Australian parrots. Australian Journal of Zoology, 39, 131-142. Williams, J. B. (1992) Longevity of Dune Larks in the Namib Desert. Safring News, 21, 17-18. Williams, J. B., Siegfried, W. R., Milton, S. J., Adams, N. J., Dean, W. R. J., du Plessis, M. A., Jackson, S. & Nagy, K. A. (1993) Field metabolism, water requirements, and foraging behavior of wild Ostriches in the Namib. Ecology, 74, 390-404. Williams, J. B., Bradshaw, D. & Schmidt, L. (1995) Field metabolism and water requirements of Spinifex Pigeons (Geophaps plumifera) in Western Australia. Australian Journal of Zoology, 43, 1-15. Williams, J. B. (1996) A phylogenetic perspective of evaporative water loss in birds. The Auk, 113, 457-472. Williams, J. B. & du Plessis, M. A. (1996) Field metabolism and water flux of Sociable Weavers in the Kalahari Desert. Ibis, 138, 168-171. Williams, J. B. (1999) Heat production and evaporative water loss of Dune Larks from the Namib desert. The Condor, 101, 432-438. Williams, J. B., Tieleman, B. I. & Shobrak, M. (1999) Lizard burrows provide thermal refugia for larks in the Arabian desert. Condor, 101, 714-717. Chapter 13. Williams, J. B. & Tieleman, B. I. (2000) Flexibility in basal metabolic rate and evaporative water loss among Hoopoe Larks exposed to different environmental temperatures. Journal of Experimental Biology, 203, 3153-3159. Chapter 9. Williams, J. B. & Tieleman, B. I. (2001) Physiological ecology and behavior of desert birds. Current Ornithology, Volume 16 (eds V. Nolan & C. F. Thompson), pp. 299-353. Plenum Press, New York. Chapter 2. Williams, J. B. (2001) Energy expenditure and water flux of free-living Dune Larks in the Namib Desert: A test of the re-allocation hypothesis. Functional Ecology, 15, 175-185. Williams, O. B. & Calaby, J. H. (1985) The hot deserts of Australia. In: Hot Deserts and Arid Shrublands (eds M. Evenari, I. Noy-Meir & D. W. Goodall), pp. 269-299. Elsevier, Amsterdam.

Willoughby, E. J. (1968) Water economy of the Stark's Lark and Grey-backed Finchlark from the REFERENCES namib Desert of South West Africa. Comparative Biochemistry and Physiology , 27, 723-745. 365 Willoughby, E. J. (1969) Evaporative water loss of a small Xerophilous Finch, Lonchura malabarica. Comparative Biochemistry and Physiology, 28, 655-664. Willoughby, E. J. (1971) Biology of larks (Aves:Alaudidae) in the central Namib Desert. Zoologica Africana, 6, 133-176.

Withers, P. C. (1977) Measurements of VO2, VCO2 and evaporative water loss with a flow-through mask. Journal of Applied Physiology, 42, 120-123. Withers, P. C., Siegfried, W. R. & Louw, G. N. (1981) Desert Ostrich exhales unsaturated air. South African Journal of Science, 77, 569-570. Withers, P. C. (1983) Energy, water, and solute balance of the Ostrich, Struthio camelus. Physiological Zoology, 56, 568-579. Withers, P. C. & Williams, J. B. (1990) Metabolic rate and respiratory physiology of an arid-adapted australian bird, the Spinifex Pigeon. The Condor, 92, 961-969. Wolf, B. O. & Walsberg, G. E. (1996a) Thermal effects of radiation and wind on a small bird and implications for microsite selection. Ecology, 77, 2228-2236. Wolf, B. O. & Walsberg, G. E. (1996b) Respiratory and cutaneous evaporative water loss at high environmental temperatures in a small bird. Journal of Experimental Biology, 199, 451-457. Wolf, B. O., Wooden, D. M. & Walsberg, G. E. (1996) The use of thermal refugia by two small desert birds. Condor, 98, 424-428. Wolfenden, I. H. & Peach, W. J. (2001) Annual survival rates of Skylarks on a coastal dune system. In: The Ecology and Conservation of Skylarks Alauda arvensis (eds P. F. Donald & J. A. Vickery), pp. 79-89. RSPB, Sandy. Wright, P. A. (1995) Nitrogen excretion: three end products, many physiological roles. Journal of Experimental Biology, 198, 273-281. Yanes, M. & Suárez, F. (1997) Nest predation and reproductive traits in small passerines: a comparative approach. Acta Oecologica, 18, 413-426. Yarbrough, C. G. (1971) The influence of distribution and ecology on the thermoregulation of small birds. Comparative Biochemistry and Physiology, 39A, 266. Yousef, M. K. & Johnson, H. D. (1975) Thyroid activity in desert rodents: a mechanism for lowered metabolic rate. American Journal of Physiology , 229, 427-431. Zar, J. H. (1984) Biostatistical analysis. Prentice Hall Inc., Englewood Cliffs, New Jersey. Zar, J. H. (1996) Biostatistical Analysis. Prentice Hall Inc., Englewood Cliffs, New Jersey. Zubakov, V. A. & Borzenkova, I. I. (1990) Global paleoclimate of the late Cenozoic. Elsevier, Amsterdam.

366 Addresses of authors

Paulette Bloomer, Molecular Ecology and Evolution Program, Department of Genetics, University of Pretoria, 0002 Pretoria, South Africa

Chris Brown, Department of Zoology and Entomology, Rhodes University, P.O. Box 94, Grahamstown, 6140, South Africa (Present address: Hartpury College, Gloucestershire GL19 3BE, United Kingdom)

Mike Buschur, Department of Evolution, Ecology and Organismal Biology, Ohio State University, 1735 Neil Avenue, Columbus, OH 43210, USA

Frédéric Lacroix, Morocco Emirates Center for Wildlife Propagation, Province de Boulemane, BP47 Missour, Morocco

Gili Michaeli, Mitrani Center for Desert Ecology, Blaustein Institute for Desert Research and Department of Life Sciences, Ben-Gurion University, Midreshet Ben-Gurion, 84990 Israel

Patrick Paillat, National Wildlife Research Center, P.O. Box 1086, Taif, Saudi Arabia

Berry Pinshow, Mitrani Center for Desert Ecology, Blaustein Institute for Desert Research and Department of Life Sciences, Ben-Gurion University, Midreshet Ben-Gurion, 84990 Israel

Mohammed Shobrak, National Commission for Wildlife Conservation and Development, National Wildlife Research Center, P.O. Box 1086, Taif, Saudi Arabia

Irene Tieleman, Zoological Laboratory, University of Groningen, P.O. Box 14, 9750 AA Haren, The Netherlands, [email protected]

Henk Visser, Center for Isotope Research, University of Groningen, Nijenborgh 4, 9747 AG Groningen, and Zoological Laboratory, University of Groningen, P.O. Box 14, 9750 AA Haren, The Netherlands

Joe Williams, Department of Evolution, Ecology and Organismal Biology, Ohio State University, 1735 Neil Avenue, Columbus, OH 43210, USA REFERENCES

367