Igem 2018 Lab Book

iGEM 2018 Lab Book

How to use this book

Welcome to the iGEM 2018 Lab Book. Here, we will record all our experiments, failures and success alike. This is our story. Our adventures begin now... But first, here are a few guidelines for using this online lab book.

Refer to your personal lab book

Every lab team member has a personal physical lab book. Here, we’re transfering all of our experiments into a signal lab book. All experiments should be recorded in an accurate, detailed, and complete manner in both personal and shared lab books. When transfering things to this book, be sure to include the include a reference to your lab book. Do this by including “Refer to your first and last name’s lab book, p.#” at the top left corner of the page, after the title of your experiment and date (see template). This will help keep things organized and allow us to check the original lab book and catch any transcription errors.

Use sufficiently descriptive titles

Instead of a table of contents, we’re gonna use the Outline feature of Google Docs. Be sure to write titles in “Heading 2” and the rest of your experiments in “normal text”. To make it easy to refer back to each experiment, give each one a descriptive title. Don’t just call it “PCR”, but rather “PCR of thing you’re trying to amplify - attempt 1”. For more detail about this, refer to templates of different experiments.

Follow given templates

To keep entries consistent, we’ve created templates for different experiments (PCR, digests, heat-shock, etc.). These can be found in the following pages. Simply copy, paste, and fill in the blanks.

Templates

General template for all entries:

Micro Team (write “other” if none) - Title of experiment

Your full name

Date Performed “Refer to your first and last name’s lab book, p.#”

If you followed the protocols in the protocol section of this book: “Followed experimental procedure performed protocol without any deviations”

If you followed the protocols in the protocol section of this book, but made a few changes: “Followed experimental procedure performed protocol with the following deviations: ● List deviations you made ● ...”

[...... Your results……………………………………………]

Protocols

Inoculation 1. Aseptically pipette 5 mL sterile liquid broth into a test tube. 2. Add appropriate antibiotic, if required, to desired concentration using a pipette. Volumes depend on antibiotic but there is a list stuck onto the -20℃ freezer in the iGEM lab. 3. When pipetting the antibiotic, tilt the test tube so that the broth is close enough to the top of the tube that you can add the antibiotic to the broth. Dropping it in won’t work because you will typically be adding ~ 2.5 μL and the drop will be too small to fall. 4. If inoculating from frozen stock, work quickly! This is very important because if the cells thaw completely they will have a shorter lifetime in the freezer. Always keep

frozen stocks on ice. 6. Take an autoclaved wooden inoculation stick and scrape some frozen stock from tube and dip the stick into liquid media and stir around. 7. Discard inoculation stick into another container, not the waste! Inoculation sticks are reusable. 8. If inoculating from a plate. Take a wooden stick and touch a colony on the plate then dip it into the liquid media and stir around. DON’T discard sticks. 9. Place the tubes in a 37℃ incubator on the shaker for 12-24 hours. If possible, angle the tubes because it improves oxygenation of the culture as it shakes.

Nanodrop The NanoDrop (ND-1000) is a small-scale spectrophotometer that can detect DNA concentration and give an estimate of sample purity.

1. Go to the“core facility” across from the elevator in B1. The door code is 933214 2. Open the nanodrop application on the computer and login to the iGEM account using the password “bio”. 3. Click on “Nucleic acid” then begin to initialize the unit. 4. Put some milliQ water on a KimWipe and wipe down the pedestal and sampling arm.

5. Add 1.0 μL of ddH2O, then 1.0μL of elution buffer to blank. 6. Load 1.0 μL of sample and click “Measure” to determine the concentration and absorbance ratios. Record these below. Between trials, wipe the machine with a kimwipe. Make sure to leave machine how you found it

Plasmid miniprep

1. Pellet 1–5 ml bacterial culture (not to exceed 15 OD units) by centrifugation for 30 seconds. Discard supernatant. 2. Resuspend pellet in 200 μl Plasmid Resuspension Buffer (B1) (pink). Vortex or pipet to ensure cells are completely resuspended. There should be no visible clumps. 3. Lyse cells by adding 200 μl Plasmid Lysis Buffer (B2) (blue/green). Invert tube immediately and gently 5–6 times until color changes to dark pink and the solution is clear and viscous. Do not vortex! Incubate for one minute.

4. Neutralize the lysate by adding 400 μl of Plasmid Neutralization Buffer (B3) (yellow). Gently invert tube until color is uniformly yellow and a precipitate forms. Do not vortex! Incubate for 2 minutes. 5. Clarify the lysate by spinning for 2–5 minutes at 16,000 x g. 6. Carefully transfer supernatant to the spin column and centrifuge for 1 minute. Discard flow-through. 7. Re-insert column in the collection tube and add 200 μl of Plasmid Wash Buffer 1. Plasmid Wash Buffer 1 removes RNA, protein and endotoxin. Centrifuge for 1 minute. Discarding the flow-through is optional. 8. Add 400 μl of Plasmid Wash Buffer 2 and centrifuge for 1 minute. 9. Transfer column to a clean 1.5 ml microfuge tube. Use care to ensure that the tip of the column has not come into contact with the flow-through. If there is any doubt, re-spin the column for 1 minute before inserting it into the clean microfuge tube. 10. Add ≥ 30 μl DNA Elution Buffer to the center of the matrix. Wait for 1 minute, then spin for 1 minute to elute DNA.

PCR

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for __ rxns (in uL)

Forward Primer (10 μM) 1

Reverse Primer (10 μM) 1

Taq/Q5/Phusion Master Mix 10

Sterile, nuclease-free water 8

Add template individually to each sample. Template may be a few cells (i.e. picked colony, small volume of liquid culture), or extracted/purified DNA (i.e. plasmid, genome, linear). Typically, add 1uL of ~1ng/uL extracted/purified DNA (dilute in nuclease-free water if needed) or 1uL of overnight culture. For colony PCR, simply touch the colony with a sterile tip and mix that into your reaction tube.

Thermocycler procedure: Q5 2X HF MM Taq MM Phusion MM

Step Temp time Temp time Temp time (in C) (in C) (in C)

Initial 98 30 sec 95 30 sec 98 30 sec denaturation denaturation 98 5-10 sec 95 15-30 sec 98 5-10 sec

annealing 50-72 * 10-30 sec 45-68 * 15-60 sec 45-72 * 10-30 sec

extension 72 20-30 sec/kb 68 1 min/kb 72 15-30 sec/kb

Final 72 2 min 68 5 min 72 5-10 min extension

hold 4 Infinity 4 Infinity 4 Infinity

* annealing temperature depends on the primers you’re using.

Note that this is for standard PCR (where your template is extracted DNA). If your template is DNA in cells (i.e. colony PCR), then initial denaturation should be 5-10 min to lyse the cells.

Gel electrophoresis Setting up your rig: 1. Usually we use the small rig with the corresponding small tray. 2. Tape the edges of the tray. This needs to be water-tight, as you will set your gel here.

Choosing a comb: There are several reasons you might want to run a gel, which correspond to different choices of comb. 1. If you are running a gel to visualize a result, use the comb with the smallest teeth, and use the side with the thinnest teeth. Usually you run a small amount of sample in a gel like this, so the wells don’t need to be large. 2. If you are running a gel for the purposes of gel extraction, use the comb with the largest teeth, and use the side with the thickest teeth. Usually you run a large amount of sample in a gel like this, so the wells need to be large.

Pouring and running your gel: 1. Add agarose into a flask to make the concentration of agarose 0.8-1.2% (e.g. 0.5 g agarose to make 50 mL 1% agarose gel) 2. Add desired amount of 1X TAE running buffer (50 mL for small tray use more if you are running a larger gel).

3. Microwave 30 seconds. Using rubber mitt, vigorously swirl the partially-dissolved agarose in the flask. 4. Microwave 15 seconds. Using rubber mitt, vigorously swirl the dissolved agarose in the flask. Visually inspect the solution to make sure there is no undissolved agarose floating in it. Keep microwaving (in short intervals) until fully dissolved. 5. Add Gel Red at 1:10 000 concentration (50 mL gel needs 5 μL gel red). 6. Pour gel into tray. 7. Put comb into place 8. Let it sit for 20 minutes - until gel loses some transparency and looks more “white”. 9. Once the gel has set, remove the tray from the rig and replace it in the rig so the ends of the tray are open. 10. Add additional 1X TAE running buffer to the rig. Buffer should cover the top of the gel. 11. Carefully remove comb from gel 12. Load samples and appropriate DNA ladder (generally a 1kb ladder is used). 13. Attach the lid to the gel rig and plug the lid into the electrophoresis machine.

Gel extraction

1. Weigh microfuge tube. 2. Excise the DNA fragment to be purified from the agarose gel using a razor blade, scalpel or other clean cutting tool. Use care to trim excess agarose. Transfer it to a 1.5 ml microcentrifuge tube and weigh the gel slice. 3. Add 4 volumes of Monarch Gel Dissolving Buffer to the tube with the slice (1mg of gel : 4uL of buffer). Note: ● Weight of gel piece extracted = (weigth of gel in microfuge tube) - (weight of microfuge tube) ● If the volume of the dissolved sample exceeds 800 μl, the loading of the sample onto the column should be performed in multiple rounds to not exceed the volume constraints of the spin column. 4. Incubate the sample between 37–55°C (typically 50°C), vortexing periodically until the gel slice is completely dissolved (generally 5–10 minutes). 5. Insert the column into collection tube and load sample onto the column. Spin for 1 minute, then discard flow-through. 6. Re-insert column into collection tube. Add 200 μl DNA Wash Buffer and spin for 1 minute. Discarding flow-through is optional. 7. Repeat wash (Step 6).

8. Transfer column to a clean 1.5 ml microfuge tube. Use care to ensure that the tip of the column has not come into contact with the flow-through. If in doubt, re-spin for 1 minute before placing into clean microfuge tube. 9. Add ≥ 6 μl of DNA Elution Buffer to the center of the matrix. Wait for 1 minute, and spin for 1 minute to elute DNA.

PCR/DNA purification

1. Dilute sample with DNA Cleanup Binding Buffer according to the table below. Mix well by pipetting up and down or flicking the tube. Do not vortex. A starting sample volume of 20–100 μl is recommended.

2. Insert column into collection tube and load sample onto column. Spin for 1 minute, then discard flow-through. 3. Re-insert column into collection tube. Add 200 μl DNA Wash Buffer and spin for 1 minute. Discard flow-through. 4. Repeat wash (Step 3). 5. Transfer column to a clean 1.5 ml microfuge tube. Use care to ensure that the tip of the column does not come into contact with the flow-through. If in doubt, re-spin for 1 minute to ensure traces of salt and ethanol are not carried over to next step. 6. Add ≥ 6 μl of DNA Elution Buffer to the center of the matrix. Wait for 1 minute, then spin for 1 minute to elute DNA.

Restriction digest

Sample

DNA

Enzyme 1

Enzyme 2

Buffer

ddH2O Total

● Add ingredients in a microfuge tube, mix by tapping.

● Spin down tube for 10 seconds in the mini centrifuge ● Incubate 20-40 minutes - 1 hour at 37 ˚C

Ligation

Sample Amount (in uL)

Vector DNA

Insert DNA

Ligase

Buffer

ddH2O Total

1. Formulate reaction mixture in a microfuge tube. 2. Mix by flicking tube and then briefly centrifuging. 3. Spin down tubes in the microcentrifuge so all the components are properly mixed. 3. Incubate at room temperature for a 2-4 hours. May also be left overnight.

Heat shock transformation 1. Acquire ice and enough competent cells for your experimental samples and controls. 2. Thaw competent cells on ice. 3. Get new 1.5ml tubes, and label them with your different sample names. One tube will be a positive control (e.g. uncut vector alone) to test if your transformation technique worked. 4. Add 50 μL of competent cells to each labelled tube and then add your DNA. If DNA is from a ligation, add the entire volume into the tubes. If it is from a miniprep, usually add 1-10 μL depending on the DNA concentration.

5. Incubate on ice for 30 minutes. 6. Heat shock at 42℃ for 45 seconds and then immediately put the tubes back onto ice. 7. Incubate on ice for 5 minutes 8. Add 750 μL of LB broth to each tube then incubate at 37℃ for 45 minutes - 1 hour with shaking. 9. After incubation you will plate the cells onto selective media so only transformants will grow.

Frozen stock preparation

1. Prepare an overnight culture of the cells that are to be made into frozen stock. 2. Aliquot 1 mL of overnight culture into a 1.5 mL microfuge tube. 3. Pellet cells by spinning for 1 minute at 16,000 x g. Discard supernatant. 4. Resuspend in 1 mL fresh liquid broth. 5. In a 1.5 mL cryovial tube, add 150 uL of stock glycerol solution. 6. To that cryovial, add 850 uL of freshly resuspended cells (from step 4). 7. Pipette up and down to mix. 8. Label cryovial tube appropriately and update the strain list. 9. Store in -80°C freezer.

Experiments

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 1-2 May 22, 2018 ● Aseptically inoculated frozen stock Waterloo iGEM Strain #108 DH5alpha (empty; without plasmids) into a 3 sterile test tubes containing 5 mL of LB each, using a sterile wooden inoculating for each tube ● Put the inoculated tubes and a negative control into the shaking 37°C incubator overnight ● This was done so the competent cells could be made, following the protocol titled “Preparation of calcium competent Escherichia coli and heat-shock transformation” by Chang, Angela Y., Chau, Vivian WY., Landas, Julius A., Pang, Yvonne in Volume 1:22-25 in the June 2017 JEMI Methods article. ● Excerpts of the protocol, namely the Materials and Methods, are shown below as they are intended to be followed tomorrow:

MATERIALS AND EQUIPMENT Materials: Competent cell preparation: • 1mL of overnight Escherichia coli (E. coli) culture • 100mL of 0.1M CaCl2 (ice cold) • 20mL of 0.1M CaCl2 with 15% glycerol solution (ice cold) • 100mL of fresh lysogeny broth (LB) media Heat-shock transformation: • 1pg - 100ng plasmid DNA (1-5uL) • 1mL of pre-warmed LB media or SOC media at 37°C • LB agar plates (with appropriate reagent for selective or screening) • Ice Equipment: • 37°C shaking incubator • 42C water bath • Spectrophotometer

METHODS

A. CaCl2 Buffers Preparation 1M CaCl2 (stock solution, 10x working concentration) • Weigh out 11.1g of anhydrous CaCl2 • Add to 80mL of dH2O • Mix solution until CaCl2 is fully dissolved • Top up to 100mL • Filter sterilize through a 0.22μm pore

0.1M CaCl2 (working solution) • Add 10mL of 1M CaCl2 to 90mL of dH2O for a 1:10 dilution • Filter sterilize through a 0.22μm pore

0.1M CaCl2 + 15% glycerol (working solution) • Mix 6mL 1M CaCl2 with 9mL sterile glycerol and 45mL dH2O

B. Overnight Culture(s) • Inoculate 1mL of LB with E. coli • Place in shaking incubator at 37°C and 200rpm • Incubate for 12-16 hours

C. Generation of Competent Cells (CaCl2 wash) Subculturing overnight culture: • Add 1mL of overnight culture to 99mL of fresh LB (1:100 dilution, no antibiotics) • Shake incubate at 37°C and 200rpm for 3-4 hours or until OD reaches 0.4 CaCl2 wash: • Ensure that all reagents (CaCl2 solutions, Oakridge tubes, centrifuge) are ice-cold or at 4°C • Separate culture into multiple Oakridge tubes • Place on ice for 20 minutes • Centrifuge at 4°C at 4000rpm for 10 minutes • Discard the supernatant by tipping tubes over a discard bin and then aspirating any remaining media

D. Heat-shock transformation Heat-shock: • Thaw competent cells on ice • Add 1-5μl (10pg-100ng) of plasmid (do not exceed 5μL for a 50μL cell aliquot) • Incubate on ice for 30 minutes • Heat-shock by placing in 42°C water bath for exactly 30 seconds • Place cells on ice for 2 minutes • Add 1mL pre-warmed LB or SOC medium • Shake incubate 37°C, 200rpm, 1 hour for outgrowth

Plating and incubation: • Spread plate 1:10 and 1:100 dilutions of the outgrowth cultures on warm selective and/or screening plates (e.g. Ampicillin and/or X-gal if required) • Incubate at 37°C for 12-16 hours

Plate observations: • Inspect plates for isolated colonies

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 2-4 May 23, 2018 ● After inoculating Strain #108 into 3 tubes of 5 mL of LB (rather than just 1 mL in the protocol shown above), and having them grow and the negative control not, subcultured one of the overnight cultures by adding 1 mL of one of the test tubes into 99 mL of fresh LB in a baffled flask according to protocol ○ This allowed a 1:100 dilution to be obtained ○ No antibiotics were added to any of the Lb due to the nature of the strain having no plasmids ○ DH5alpha (empty; without plasmids) into a 3 sterile test tubes containing 5 mL of LB each, using a sterile wooden inoculating for each tube ● Performed the same subculturing procedure for Nicole W, involving S17 rather than DH5alpha ● Placed the flasks in the shaking 37°C incubator ○ Will check the optical density (OD) following 3-4 hours of incubation to obtain an OD of 0.4 ● At 11:30am, checked the OD using the spectrophotometer in the Charles lab ○ Want an OD reading 0f 0.4 of the sample measured at a wavelength of 600 nm ○ At 11:45 am, the OD600 was 0.328 for DH5alpha ○ At 11:50 am, the OD600 was 0.475 for S17 ○ At 12:15 pm, the OD600 was 0.485 for DH5alpha ○ At 12:05 pm, the OD600 was 0.495 for S17 ● Both flasks were separated into ice cold Falcon tubes and placed on ice for 20 minutes once the appropriate OD was reached ● All the Falcon tubes were centrifuged at 4°C at 4000rpm for 10 minutes ● Following the protocol, the supernatant was discarded, and the pelleted cells were resuspended with 20mL ice-cold 0.1M CaCl2, followed by a period of incubation on ice for 30 minutes ● After the incubation, the Falcon tubes were again centrifuged at 4°C at 4000rpm for 10 minutes ● The supernatant was again discarded, and the pellets by resuspending in 5mL ice-cold 0.1M CaCl2 with 15% glycerol ○ Each pellet had 5 mL of CaCl2 added to it for resuspension ● Following resuspension, the cells were aliquoted into microcentrifuge tubes for storage in the -80°C Celsius freezer ○ In the 2 mL microcentrifuge tubes, the aliquots were 100 µL each ○ In the 0.6 mL microcentrifuge tubes, the aliquots were 200 µL each ● Then, the cells were tested with the iGEM Competent Cell Test Kit and plated ● The plates were incubated according to the protocol at 37°C overnight while inverted ● The protocol can be found at this link: http://parts.igem.org/Help:2018_Competent_Cell_Test_Kit ● The protocol, in particular the Materials and Methods, is also shown below:

Materials needed § 70% ethanol § Paper towels § Lab marker / Sharpie § 1.5 mL microcentrifuge tubes § Container for ice § Ice § Competent cell aliquot(s) § Competent Cell Test Kit § Agar plates with chloramphenicol § 42°C Waterbath (or hot water source and thermometer) § 37°C Incubators (oven and shaker) § SOC media § Sterile glass beads or sterile cell spreader § Pipettor § Pipette tips

Protocol estimated time: 30 minutes active, 1.5 hours incubation 1. Clean your working area by wiping down with 70% ethanol. 2. Thaw competent cells on ice. Label one 1.5 mL microcentrifuge tubes for each transformation and then pre-chill by placing the tubes on ice. § Do triplicates (3 each) of each concentration if possible, so you can calculate an average colony yield. 3. Spin down the DNA tubes from the Competent Cell Test Kit/Transformation Efficiency Kit to collect all the DNA into the bottom of each tube prior to use. A quick spin of 20-30 seconds at 8,000-10,000 rpm will be sufficient. Note: You should resuspend the DNA in each tube with 50 µL dH2O. 4. Pipet 1 µL of DNA into each microcentrifuge tube. 5. Pipet 50 µL of competent cells into each tube. Flick the tube gently with finger to mix. 6. Incubate on ice for 30 minutes. § Pre-heat waterbath now to 42°C. Otherwise, hot water and an accurate thermometer works, too! 7. Heat-shock the cells by placing into the waterbath for 45 seconds (no longer than 1 min). Be careful to keep the lids of the tubes above the water level and keep the ice close by. 8. Immediately transfer the tubes back to ice and incubate on ice for 5 minutes. 9. Add 950 µL of SOC media per tube and incubate at 37°C for 1 hour shaking at 200-300rpm. § Prepare the agar plates during this time: label them and add sterile glass beads if using beads to spread the mixture.

10. Pipet 100 µL from each tube onto the appropriate plate and spread the mixture evenly across the plate. Incubate at 37°C overnight or approximately 16 hours. Position the plates with the agar side at the top, and the lid at the bottom. 11. Count the number of colonies on a light field or a dark background, such as a lab bench. Use the following equation to calculate your competent cell efficiency. If you've done triplicates of each sample, use the average cell colony count in the calculation. § Efficiency (in CFU/µg) = [colonies on plate (CFU) / Amount of DNA plated (ng)] x 1000 (ng/µg) § Note: The measurement "Amount of DNA plated" refers to how much DNA was plated onto each agar plate, not the total amount of DNA used per transformation. You can calculate this number using the following equation: § Amount of DNA plated (ng) = Volume DNA added (1 µL) x concentration of DNA (refer to vial, convert to ng/µL) x [volume plated (100 µL) / total reaction volume (1000 µL)] Results Competent cells should have an efficiency of 1.5x10^8 to 6x10^8 CFU/µg DNA, where "CFU" means "colony-forming unit" and is a measurement of cells.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 5 May 24, 2018 ● Following testing the competent cells made with the competent cells test kit, plates were observed after the cells had incubated in LB for an hour and had been plated

Quantitative observations following testing of competent cells on LB agar plates with Chloramphenicol properly added to them DH5alpha on LB+Cm Colonies S17 on LB+Cm Colonies (CFU) (CFU)

10 pg/µL of Plasmid DNA 0 10 pg/µL of Plasmid DNA 0

10 pg/µL of Plasmid DNA 0 10 pg/µL of Plasmid DNA 0 (duplicate) (duplicate)

50 pg/µL of Plasmid DNA 5 50 pg/µL of Plasmid DNA 0

50 pg/µL of Plasmid DNA 3 50 pg/µL of Plasmid DNA 0 (duplicate) (duplicate) ● These results were not expected and show that there was a major error during the experiment ● The protocol will be repeated in the future to determine what went wrong

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 5 June 6, 2018 ● Repeated protocol for preparing competent cells using DH5alpha frozen stock Strain #108 ● Followed the same steps that had been followed the first time

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 5 June 7, 2018 ● Tested competent cells prepared yesterday using the Competent Cell Test Kit ○ Followed the protocol above, incubating the tubes for an hour in LB media following the heat-shock ○ Used plasmid DNA concentrations of 10 pg/µL and 50 pg/µL in triplicate for the heat-shock transformations

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 6 June 8, 2018 ● Observed the plates that had been prepared the following day, following the testing of the cells using the Competent Cell Test Kit

Quantitative observations following testing of competent cells on LB agar plates with Chloramphenicol DH5alpha on LB+Cm Colonies (CFU)

10 pg/µL of Plasmid DNA 0

10 pg/µL of Plasmid DNA (duplicate) 0

10 pg/µL of Plasmid DNA (triplicate) 0

50 pg/µL of Plasmid DNA 0

50 pg/µL of Plasmid DNA (duplicate) 9 - red colonies

50 pg/µL of Plasmid DNA (triplicate) 3 - red colonies

● Based on the poor results, began to trouble-shoot some of the results: ○ How healthy is the strain being used? It is a frozen stock ○ Should we incorporate flash-freezing in liquid nitrogen?

○ What positive control should we be using? We should be using one during the heat-transformation and when plating on the Cm plates (in order to test the antibiotic content of the plates) ○ Is the pg/µL concentration of DNA too small for the cells to uptake? Should we give the competent cells a concentration of DNA in ng/µL? ● Made addition notes after talking with Cody about making competent cells: ○ Use flash freezing to help preserve the cells ○ Aliquot the cells and keep them on ice for the future ○ When flash freezing, drop multiple microcentrifuge tubes in the container of liquid nitrogen at once ○ Fish out each tube with long tweezers available in the iGEM lab ○ Place all the tubes in a freezer box, and then place the box in the freezer ○ Note that this addition to the protocol should only be done by people who have take Cryosafety and Compressed Liquids and Gases training ● Threw out originally-made competent cells into the biohazardous waste bin, since they were not competent

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 7 June 12, 2018 ● Worked on preparing antibiotic plates for the new plasmids that had been delivered ○ pSKA397: Plasmid #80380; mini-Tn7 delivery plasmid with MetE under the cpcG2delta59 promoter; with Chloramphenicol and Ampicillin resistance; Vector Backbone pUC18R6KT-mini-Tn7T (Addgene #64958); CC118(lambdapir) ○ pSKA413: constitutive CcaS and CcaR with gfpmut3 under the cpcG2delta59 promoter; with Chloramphenicol resistance; Plasmid #80381; Vector Backbone pZE31; DH5alpha ○ SKA974: JT2-based E. coli; with Kanamycin resistance; Bacterial Strain #80403; deltametE Tn7::PcpcG2delta59-metE ● The proper concentrations for the antibiotics are shown below: ○ Ampicillin: Working concentration is 100 ug/mL ○ Chloramphenicol: Stock concentration is 25 mg/mL (in EtOH (100%Ethanol)) ○ Chloramphenicol: Working concentration is 25 ug/mL ○ Kanamycin: Stock concentration is 50 mg/mL ○ Kanamycin: Working concentration is 50 ug/mL ● The Chloramphenicol had been prepared already, but the Kanamycin was weighed out as 0.0509 g and 0.0503 g and each added to a mL of sterile water in a sterile microfuge tube and vortexed to mix ● The antibiotics were stored in the -20C freezer ● All the plates would have a 1:1000 dilution of the antibiotic in the agar media ○ Therefore the rate of antibiotic added to media is 1uL/1mL of media ● Cm plates had already been made, but Kanamycin plates had to be prepared ○ In the laminar flow hood, 50 µL of Kanamycin antibiotic was added to 50 mL of LB molten agar

○ The antibiotic was mixed within the media and then poured into plates ○ Once dried, the plates were stacked, sealed in a bag, and placed in the fridge, except for the ones that would be streaked ● SKA974 was streaked from its shipped tube onto 2 Km plates using sterile wooden inoculating sticks and put in the 37°C incubator ● pSKA413 was streaked from its shipped tube onto 2 Cm plates using sterile wooden inoculating sticks and put in the 37°C incubator ● The Chloramphenicol and Ampicillin would have to be made the following day

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 7 June 13, 2018 ● Made 2 L of LB for LB agar ○ 20 g of agar per 1000 mL of LB ○ Therefore 2 g of agar per bottle of 100 mL of LB ○ There will be approximately 20 bottles of LB agar made ● Tomorrow, will plan on inoculating plasmids (currently in the fridge), making plates, and making an O/N culture of DH5alpha to make competent cells

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 8 June 14, 2018 ● Chloramphenicol and Ampicillin plates were made ○ In the laminar flow hood, 100 µL of Chloramphenicol (working concentration of 25 ug/mL) and 100 µL of Ampicillin (working concentration of 100 ug/mL) antibiotics was added to 100 mL of LB molten agar ○ The antibiotic was mixed within the media and then poured into plates ○ Once dried, the plates were stacked, sealed in a bag, and placed in the fridge ● Prepared an O/N culture with DH5alpha Strain #108 with 5 mL of LB in a test tube ○ The bacteria was collected from the frozen stock in the freezer ○ A negative control was prepared as well ● Prepared O/N cultures of the plasmids that had been delivered from the plates that had been streaked ○ pSKA413: constitutive CcaS and CcaR; with Chloramphenicol resistance ○ SKA974: JT2-based E. coli; with Kanamycin resistance ● A single colony from each plasmid was put into a test tube using sterile wooden inoculating sticks with 5 mL of LB and 5 µL of the appropriate antibiotic, as shown above ● All the tubes were placed in the 37°C shaking incubator overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 8

June 15, 2018 ● The following morning, it was discovered that the negative control had contamination and growth was seen ● It was speculated that the contamination had occurred since the LB media used for the test tube had been taken from a previously opened bottle that had a small volume of LB left ● Plans for the following week are as follows: Prepare a LB plate with nalidixic acid and then streak DH5alpha onto it

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 8-9 June 18, 2018 ● Re-prepared O/N cultures of the plasmids that had been delivered from the plates that had been streaked on June 12, 2018 with antibiotics ○ pSKA413: constitutive CcaS and CcaR; with Chloramphenicol resistance ○ SKA974: JT2-based E. coli; with Kanamycin resistance ● A single colony from each plasmid was put into a test tube using sterile wooden inoculating sticks with 5 mL of LB and 5 µL of the appropriate antibiotic, as shown above ● A negative control with each antibiotic was prepared as well ● All the tubes were placed in the 37°C shaking incubator overnight

● DH5alpha Strain #108 frozen stock was streaked onto a LB agar plate using a sterile wooden inoculating stick and then placed in the 37°C incubator overnight ○ This was in preparation for making competent cells using the new Competent Cells Protocol ● pSKA397 was streaked from its shipped tube onto 2 Cm+Am plates using sterile wooden inoculating sticks and put in the 37°C incubator overnight ● IMPORTANT: After troubleshooting making competent cells, realized that during the stated resuspension, I, Nicole L, and Nicole W had vortexed the cells in the Falcon tubes in order to resuspend them. It was determined that this method of resuspension was too harsh! The cells should be resuspended via pipetting instead

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 9-10 June 19, 2018 ● Trying to use a new Competent Cells Protocol (found at the following link: http://parts.igem.org/Help:Protocols/Competent_Cells) ● It calls for CCMB80 Buffer: § CCMB80 buffer § 10 mM KOAc pH 7.0 (10 ml of a 1M stock/L)

§ 80 mM CaCl2.2H2O (11.8 g/L) § 20 mM MnCl2.4H2O (4.0 g/L) 19

§ 10 mM MgCl2.6H2O (2.0 g/L) § 10% glycerol (100 ml/L) § adjust pH DOWN to 6.4 with 0.1N HCl if necessary § adjusting pH up will precipitate manganese dioxide from Mn containing solutions. § sterile filter and store at 4°C § slight dark precipitate appears not to affect its function ● To make the 10 mM KOAc pH 7.0 (10 ml of a 1M stock/L), the following calculations were used: Molecular weight of KOAc: 98.14 g 98.14 g = 1 mol → 98.14 g = 49.07 → 10 mL * 1000 mL mol L L 0.5 L 1 M

-3 10 M = 1 mmol/L = 1 mM

● To make the 80 mM CaCl2.2H2O (11.8 g/L), the following calculations were used:

Molecular weight of CaCl2.2H2O: 147.01 g 0.08 M = x/1L = 0.08 mol 147.01 g = 1 mol = 147.01 g = 11.8 g mol L L L 147.01 g = 0.08 mol = 11.76 g = 5.88 g mol L L 0.5 L

● To make the 20 mM MnCl2.4H2O (4.0 g/L), the following calculations were used:

Molecular weight of MnCl2.4H2O: 197.91 g 197.91 g = 0.02 mol = 3.96 g = 1.98 g mol L L 0.5 L

● To make the 10 mM MgCl2.6H2O (2.0 g/L), the following calculations were used:

Molecular weight of MgCl2.6H2O: 203.03 g 203.03 g = 0.01 mol = 2.03 g = 1.02 g mol L L 0.5 L ● Once the iGEM lab obtains KOAc, then the buffer will be able to be made

● Frozen glycerol stocks of the plasmids were made, as described below ● Using the O/N cultures that were prepared yesterday, 500 µL of each culture was aseptically added to sterile tubes that contained 500 µL of filter-sterilized 50% glycerol (100% glycerol in deionized water) ● The tubes were then capped and gently mixed before being put into the -80°C freezer ● The strains were recorded in the Strain List as follows:

○ Strain #447 in iGEM Box 7: SKA974; Bacterial Strain #80403; Kanamycin Resistance; JT2; deltametE Tn7::PcpcG2delta59-metE ○ Strain #448 in iGEM Box 7: SKA974; Bacterial Strain #80403; Kanamycin Resistance; JT2; deltametE Tn7::PcpcG2delta59-metE ○ Strain #451 in iGEM Box 7 Backup: SKA974; Bacterial Strain #80403; Kanamycin Resistance; JT2; deltametE Tn7::PcpcG2delta59-metE ○ Strain #452 in iGEM Box 7 Backup: SKA974; Bacterial Strain #80403; Kanamycin Resistance; JT2; deltametE Tn7::PcpcG2delta59-metE ○ Strain #449 in iGEM Box 7: pSKA413; Plasmid #80381; Vector Backbone pZE31; Chloramphenicol Resistance; DH5alpha ○ Strain #450 in iGEM Box 7: pSKA413; Plasmid #80381; Vector Backbone pZE31; Chloramphenicol Resistance; DH5alpha ○ Strain #453 in iGEM Box 7 Backup: pSKA413; Plasmid #80381; Vector Backbone pZE31; Chloramphenicol Resistance; DH5alpha ○ Strain #454 in iGEM Box 7 Backup: pSKA413; Plasmid #80381; Vector Backbone pZE31; Chloramphenicol Resistance; DH5alpha

● Threw out the old competent cells that were made June 5, 2018 ○ They did not transform properly/efficiently ● Restreaked pSKA397 from its shipped tube onto 2 Cm+Am plates using sterile wooden inoculating sticks and put in the 37°C incubator overnight since the other 2 plates streaked yesterday had no isolated colonies (instead, there was heavy growth) ● LB plate that had been streaked yesterday with DH5alpha Strain #108 frozen stock had isolated colonies and so one colony was taken from the plate using a sterile wooden inoculating stick and inoculated into a sterile test tube with 5 mL of LB ○ The inoculated test tube was then placed in the 37°C incubator overnight ○ This was all done in preparation of the new Competent Cells Protocol from the iGEM website link

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 11-12 June 20, 2018 ● Began the new Competent Cells Protocol using the O/N culture of DH5alpha prepared yesterday from the freshly streaked LB plate ○ Part of the protocol is shown below Method

§ Room temperature will work. You can adjust this temperature somewhat to fit your schedule § Aim for lower, not higher OD if you can't hit this mark ○ Aseptically inoculated 99 mL of LB with 1 mL of “adjusted seed stock” (5 mL of O/N culture in LB that was started with a single colony from a streaked plate) ○ Placed the flask in the 37°C shaking incubator at 9:30 am

○ Checked the OD600 reading of 0.065 at 11:10pm ○ Checked the OD600 reading of 0.111 at 11:50pm ○ Checked the OD600 reading of 0.256 at 1:15pm ○ The culture appeared to be growing too slowly, so it would not be able to be used today 3. Fill an ice bucket halfway with ice. Use the ice to pre-chill as many flat bottom centrifuge bottles as needed (we have replaced flat bottom tubes with Falcon tubes) 4. Transfer the culture to the flat bottom centrifuge tubes. Weigh and balance the tubes using a scale ● Decided to make the CCMB80 buffer with the KOAc component, since did not prepare it yet (the Materials for the new Competent Cell Protocol are listed below) Materials

§ SOB (we have replaced SOB with LB media) § CCMB80 buffer § 10 mM KOAc pH 7.0 (10 ml of a 1M stock/L)

§ 80 mM CaCl2.2H2O (11.8 g/L) § 20 mM MnCl2.4H2O (4.0 g/L) § 10 mM MgCl2.6H2O (2.0 g/L) § 10% glycerol (100 ml/L) § adjust pH DOWN to 6.4 with 0.1N HCl if necessary § adjusting pH up will precipitate manganese dioxide from Mn containing solutions. § sterile filter and store at 4°C § slight dark precipitate appears not to affect its function ● Rather than make 1 L of CCMB80 buffer, made 300 mL since did not want to make a large volume for an untested protocol; the measurements are shown in brackets below § CCMB80 buffer § 10 mM KOAc pH 7.0 (10 ml of a 1M stock/L) → (3 mL of 1M stock/300 mL) 1M stock KOAc was made using the following calculation: 98.14 g/1000 mL = x/100 mL x = 9.81 g It was obtained from Barb Moffatt’s lab

§ 80 mM CaCl2.2H2O (11.8 g/L) → (3.54 g/300 mL) Sample Calculation: 11.8 g/1000 mL = x/300 mL x = 3.54 g

§ 20 mM MnCl2.4H2O (4.0 g/L) → (1.188 g/300 mL) § 10 mM MgCl2.6H2O (2.0 g/L) → (0.609 g/300 mL) § 10% glycerol (100 ml/L) → (30 mL /L)

§ adjust pH DOWN to 6.4 with 0.1N HCl if necessary § adjusting pH up will precipitate manganese dioxide from Mn containing solutions. § sterile filter and store at 4°C § slight dark precipitate appears not to affect its function ● Decided to combine all ingredients, top up the volume to 300 mL, and then filter sterilize the solution ● Tested the prepared KOAc solution for a pH of 7 with the pH paper ○ This was seen due to the colouring of the pH ● Added 30 mL of 10% glycerol to a beaker with the previously prepared chemical stocks ● Added 10 mL of KOAc ● Based on pH paper, the solution was between a pH of 6 and 7 (estimated to be 6.5, which is close to the desired 6.4) ● Added approximately 10 mL of deionized water ● Mixed the solution for 5 minutes ● Filter-sterilized the solution and placed it in a sterile bottle in the fridge at 4C

● Aseptically inoculated DH5alpha Strain #108 frozen stock into a sterile test tube with 5 mL of LB ○ The inoculated test tube was then placed in the 37°C incubator overnight ○ The frozen stock was used rather than a colony from a streaked plate since it had grown so slowly during the day ● Aseptically inoculated pSKA397 (Plasmid #80380) into a sterile test tube with 5 mL of LB and 5 µL each of Chloramphenicol and Ampicillin antibiotics ● Put the inoculated tube and a negative control into the 37°C incubator overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 12-14 June 21, 2018 ● Using the O/N culture of pSKA397 that was prepared yesterday (the negative control had no growth), 500 µL of culture was aseptically added to sterile tubes that contained 500 µL of filter-sterilized 50% glycerol (100% glycerol in deionized water) ● The tubes were then capped and gently mixed before being put into the -80°C freezer ● The strains were recorded in the Strain List as follows: ○ Strain #455 in iGEM Box 7: pSKA397: Plasmid #80380; mini-Tn7 delivery plasmid with MetE under the cpcG2delta59 promoter; with Chloramphenicol and Ampicillin resistance; Vector Backbone pUC18R6KT-mini-Tn7T (Addgene #64958); CC118(lambdapir) ○ Strain #456 in iGEM Box 7: pSKA397: Plasmid #80380; mini-Tn7 delivery plasmid with MetE under the cpcG2delta59 promoter; with Chloramphenicol and Ampicillin resistance; Vector Backbone pUC18R6KT-mini-Tn7T (Addgene #64958); CC118(lambdapir)

○ Strain #457 in iGEM Box 7 Backup: pSKA397: Plasmid #80380; mini-Tn7 delivery plasmid with MetE under the cpcG2delta59 promoter; with Chloramphenicol and Ampicillin resistance; Vector Backbone pUC18R6KT-mini-Tn7T (Addgene #64958); CC118(lambdapir) ○ Strain #458 in iGEM Box 7 Backup: pSKA397: Plasmid #80380; mini-Tn7 delivery plasmid with MetE under the cpcG2delta59 promoter; with Chloramphenicol and Ampicillin resistance; Vector Backbone pUC18R6KT-mini-Tn7T (Addgene #64958); CC118(lambdapir)

● Began the new Competent Cells Protocol using the O/N culture of DH5alpha prepared yesterday from frozen stock ○ The Method and deviations from it are shown below Method

1. Ethanol treat all working areas for sterility. 2. Inoculate 250 ml of SOB medium with 1 ml vial of seed stock and grow at 20°C to an OD600nm of 0.3. Use the "cell culture" function on the Nanodrop to determine OD value. OD value = 600nm Abs reading x 10 § This takes approximately 16 hours. § Controlling the temperature makes this a more reproducible process but is not essential. § Room temperature will work. You can adjust this temperature somewhat to fit your schedule § Aim for lower, not higher OD if you can't hit this mark ○ At 9:05am, 99 mL of LB was transferred into a 250 mL flask and aseptically inoculated with 1 mL of O/N culture ○ The inoculated flask was then placed in the shaking 37°C incubator ○ The OD600 measurement reading was 0.070 at 10:40am ○ The OD600 measurement reading was 0.142 at 11:25am ○ The OD600 measurement reading was 0.244 at 12:25pm ○ The OD600 measurement reading was 0.374 at 1:00pm 3. Fill an ice bucket halfway with ice. Use the ice to pre-chill as many flat bottom centrifuge bottles as needed (we have replaced flat bottom tubes with Falcon tubes) ○ The Styrofoam bucket was filled with ice and Falcon tubes were prechilled 4. Transfer the culture to the flat bottom centrifuge tubes. Weigh and balance the tubes using a scale § Try to get the weights as close as possible, within 1 gram. ○ This was done using Falcon tubes rather than flat bottom centrifuge tubes 5. Centrifuge at 3000g at 4°C for 10 minutes in a flat bottom centrifuge bottle. § Flat bottom centrifuge tubes make the fragile cells much easier to resuspend ○ Again, this was done using Falcon tubes instead of flat bottom tubes 6. Decant supernatant into waste receptacle, bleach before pouring down the drain. 7. Gently resuspend in 80 ml of ice cold CCMB80 buffer

§ Pro tip: add 40ml first to resuspend the cells. When cells are in suspension, add another 40ml CCMB80 buffer for a total of 80ml § Pipet buffer against the wall of the centrifuge bottle to resuspend cells. Do not pipet directly into cell pellet! § After pipetting, there will still be some residual cells stuck to the bottom. Swirl the bottles gently to resuspend these remaining cells ○ Instead of using a total of 80 ml of ice cold CCMB80, 50 mL was added to each flask 8. Incubate on ice for 20 minutes 9. Centrifuge again at 3000G at 4°C. Decant supernatant into waste receptacle, and bleach before pouring down the drain. 10. Resuspend cell pellet in 10 ml of ice cold CCMB80 buffer. § If using multiple flat bottom centrifuge bottles, combine the cells post-resuspension 11. Use Nanodrop to measure OD of a mixture of 200 μl SOC and 50 μl of the resuspended cells § Use a mixture of 200 μl SOC and 50 μl CCMB80 buffer as the blank ○ Used the following calculations to make a 1 mL blank for the spectrophotometer ○ LB : Cells ratio = 200 µL : 5 µL ratio ○ Therefore to get 1 mL (1000 µL) for the blank, a ratio of 960 µL of LB and 40 µL of the resuspended cells would be used. ○ The OD for the sample was seen to be 0.000 (zero) ○ Nicole Wang came and took over the protocol, and nanodropped the blank and sample using the Cell Culture setting on the Nanodrop. The A600 was measured as a value of 0.033. ○ Nicole Wang noted that at 3:50pm, white clumps had appeared as precipitate in the solution. They may have been dead cells, precipitated chemicals, etc. ○ The protocol was stopped here, since no cells were seen ○ Note: On June 22, 2018, after discussing with Clara it had been discovered that a calculation mistake had been made, and that the ratio was in fact 200 µL : 50 µL, not 200 µL : 5 µL ratio. Thus, the concentration of cells may have been too low to see. The pH of the CCMB80 buffer may have been incorrect as well since it was measured using pH paper and not a pH reader. The pH of the solution could have caused the cells to be eaten away at ○ Note: On July 5, 2018, Nicole Lassel thought that perhaps the cells had not been mixed well enough to begin with, and so the clumping was centrifuged cells that had not been properly resuspended with the pipette 12. Add chilled CCMB80 to yield a final OD of 1.0-1.5 in this test. 13. Incubate on ice for 20 minutes. Prepare for aliquoting § Make labels for aliquots. Use these to label storage microcentrifuge tubes/microtiter plates § Prepare dry ice in a separate ice bucket. Pre-chill tubes/plates on dry ice. 14. Aliquot into chilled 2ml microcentrifuge tubes or 50 μl into chilled microtiter plates

15. Store at -80°C indefinitely. § Flash freezing does not appear to be necessary 16. Perform test transformations to calculate your competent cell efficiency § Thawing and refreezing partially used cell aliquots dramatically reduces transformation efficiency by about 3x the first time, and about 6x total after several freeze/thaw cycles. § Good cells should yield around 100 - 400 colonies 5 § Transformation efficiency is (dilution factor=15) x colony count x 10 / µgDNA 8 § We expect that the transformation efficiency should be between 1.5x10 and 8 6x10 CFU/µgDNA

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 15 June 22, 2018 ● Discussed the issues seen yesterday when making competent cells with Clara ○ As described in the previous entry, a calculation mistake had been made when preparing the blank for the absorbance level reading, with the ratio being 200 µL : 50 µL instead of the mistakenly determined 200 µL : 5 µL ratio. Thus, the concentration of cells may have been too low to see and be measured. ○ The pH of the CCMB80 buffer may have been incorrect as well since it was measured using pH paper and not a pH reader. The pH of the solution could have caused the cells to be eaten away at. This theory was tested but the pH was still seen to be 6-7 according to the pH paper. It was not seen to be overly acidic or basic, and so it was deemed that the cells were not eaten away. ○ The manganese dioxide from Mn containing solutions may have precipitated from the CCMB80 buffer if the pH was too high, but this seemed unlikely as well. ● Made 1 L of liquid LB

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 15-16 June 25, 2018 ● Made 1X PBS from 10X PBS according to the following calculation: C1V1 = C2V2 (10X)V1 = (1X)(0.050 L) V1 = 0.005 L Therefore 5 mL of 10X will be combined with 45 mL of deionized water ● Tested the competent cells made on yesterday using the iGEM protocol for testing competent cells (the protocol is shown below, though has been previously written in this lab book)

● Materials needed § 70% ethanol § Paper towels § Lab marker / Sharpie § 1.5 mL microcentrifuge tubes § Container for ice § Ice § Competent cell aliquot(s) § Competent Cell Test Kit § Agar plates with chloramphenicol § 42°C Waterbath (or hot water source and thermometer) § 37°C Incubators (oven and shaker) § SOC media § Sterile glass beads or sterile cell spreader § Pipettor § Pipette tips Protocol: estimated time: 30 minutes active, 1.5 hours incubation 1. Clean your working area by wiping down with 70% ethanol. 2. Thaw competent cells on ice. Label one 1.5 mL microcentrifuge tubes for each transformation and then pre-chill by placing the tubes on ice. § Do triplicates (3 each) of each concentration if possible, so you can calculate an average colony yield. 3. Spin down the DNA tubes from the Competent Cell Test Kit/Transformation Efficiency Kit to collect all the DNA into the bottom of each tube prior to use. A quick spin of 20-30 seconds at 8,000-10,000 rpm will be sufficient. Note: You should resuspend the DNA in each tube with 50 µL dH2O. 4. Pipet 1 µL of DNA into each microcentrifuge tube. 5. Pipet 50 µL of competent cells into each tube. Flick the tube gently with your finger to mix. 6. Incubate on ice for 30 minutes. § Pre-heat waterbath now to 42°C. Otherwise, hot water and an accurate thermometer works, too! 7. Heat-shock the cells by placing into the waterbath for 45 seconds (no longer than 1 min). Be careful to keep the lids of the tubes above the water level and keep the ice close by. 8. Immediately transfer the tubes back to ice and incubate on ice for 5 minutes. 9. Add 950 µL of SOC media per tube and incubate at 37°C for 1 hour shaking at 200-300rpm. § Prepare the agar plates during this time: label them and add sterile glass beads if using beads to spread the mixture. 10. Pipet 100 µL from each tube onto the appropriate plate and spread the mixture evenly across the plate. Incubate at 37°C overnight or approximately 16 hours. Position the plates with the agar side at the top, and the lid at the bottom.

11. Count the number of colonies on a light field or a dark background, such as a lab bench. Use the following equation to calculate your competent cell efficiency. If you've done triplicates of each sample, use the average cell colony count in the calculation. § Efficiency (in CFU/µg) = [colonies on plate (CFU) / Amount of DNA plated (ng)] x 1000 (ng/µg) § Note: The measurement "Amount of DNA plated" refers to how much DNA was plated onto each agar plate, not the total amount of DNA used per transformation. You can calculate this number using the following equation: § Amount of DNA plated (ng) = Volume DNA added (1 µL) x concentration of DNA (refer to vial, convert to ng/µL) x [volume plated (100 µL) / total reaction volume (1000 µL)] ● Triplicates were made for each concentration of test plasmid of 10 pg/mL, 50 pg/mL, 100 pg/mL ● All the steps were followed, except for the following deviations: After 40 minutes of incubation on ice, the cells were heat-shocked in a 42C water bath for 45 seconds ● During the incubation period of 1 hour (in reality was 1 hour and 5 minutes) , LB agar plates were made in the laminar flow hood ○ 100 µL of Cm antibiotic was added to one 100 mL bottle of LB agar ○ The bottle was then mixed and then poured into plates and allowed to dry ● Following the incubation period of 1 hour and 5 minutes, the cells were plated and placed in the 37°C incubator at 3:00pm

● Prepared an O/N culture using a sterile wooden inoculating stick, bacteria from the frozen stock, and 5 mL of LB in a sterile test tube ● Incubated the test tube in the shaking incubator at 37°C at 6:45pm

Interlab - Calibration 1

Nicolette Shaw

June 25th 2018 Nicki Shaw

Solutions were pipetted into a black clear-bottom 96 well plate (ref: 655090, greiner bio-one) according to the iGEM headquarters 2018 interlab protocol.

LUDOX CL-X dd H2O (PCR water used)

1 0.0435 0.0283

2 0.0437 0.0285

3 0.0448 0.0286

4 0.0437 0.0295

Excitation filter: 595nm, width = 8

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 17 June 26, 2018 ● Using the O/N culture prepared yesterday, aseptically inoculated 1 mL of culture into 99 mL of LB in a baffled flask ● Placed the flask in the shaking 37°C incubator at 8:55am ● Checked the OD600 reading of 0.083 at 10:30am ● Checked the OD600 reading of 0.283 at 12:05am ● Checked the OD600 reading of 0.559 at 1:05am ● Since the OD was too high, the procedure for the competent cells was abandoned for the day ● Checked the plates that had been plated with the tested competent cells yesterday, with the results recorded below:

Quantitative observations following testing of competent cells on LB agar plates with Chloramphenicol DH5alpha on LB+Cm Colonies (CFU)

10 pg/µL of Plasmid DNA 0

10 pg/µL of Plasmid DNA (duplicate) 0

10 pg/µL of Plasmid DNA (triplicate) 0

50 pg/µL of Plasmid DNA 0

50 pg/µL of Plasmid DNA (duplicate) 0

50 pg/µL of Plasmid DNA (triplicate) 0

100 pg/µL of Plasmid DNA 0

100 pg/µL of Plasmid DNA (duplicate) 0

100 pg/µL of Plasmid DNA (triplicate) 0

● For all the triplicates for each concentration of 10 pg/mL, 50 pg/mL, and 100 pg/mL, there were 0 (zero) colonies seen on the plates. Thus, it was speculated that the cells were not competent and did not pick up the plasmid to protect them from the

antibiotic with resistance. However, it was also noted that no Cm plates were tested, and so may have been to strong for any cells to grow ○ It should be noted that these plates were again checked following 48 hours of incubation and still had no growth ○ The competent cells were thrown away on June 28 ● Prepared two test tubes of DH5alpha from frozen stock Strain #108 ○ Aseptically inoculated bacteria using sterile wooden inoculating sticks into 5 mL of LB ○ Added 5 µL of nalidixic acid (found in the -20C freezer; suggested by Leah Fulton because she had had success with selecting for the DH5alpha strain) ○ The nalidixic acid was added before the bacteria was, at a concentration of 30 mg/mL ○ The test tubes and the negative control were placed in the shaking incubator at 37°C ● Plans for tomorrow: Need to test the Cm antibiotic plates with positive and negative controls in order to determine if the antibiotic is strong enough/not too strong to kill the cells

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 18-19 June 27, 2018 ● In the morning, it was discovered that all the test tubes, both samples and negative control, had no growth ○ It was speculated that there was too much nalidixic acid used ○ Instead of using 5 µL of nalidixic acid, will use a lower volume ● Removed 1 mL of the 100 mL culture that had been prepared yesterday (and had been sitting out on the counter all day) and inoculated it into 4 mL of LB in a sterile test tube ● Placed the test tube in the shaking incubator at 37°C at 9:15am ○ Will try to grow it up to an OD600 of 2.000 (to match the other O/N culture) ○ This plan was abandoned since it was decided that a fresh, healthy culture should be used to make competent cells ● Worked on Interlab Study Calibration 2 with Dylan ○ Tested the P200 and P1000 pipettes with Dylan by using an analytical balance and MilliQ water to weigh out the fullest amounts (200 µL and 1000 µL) for each pipette ○ The data below has been copied and analyzed onto the Interlab Study Google Drive: Pipette Size P1000 P200

Trial 1 (grams) 0.98080 0.19878

Trial 2 (grams) 0.95651 0.20389

Trial 3 (grams) 0.98251 0.20373

Trial 4 (grams) 0.98190 0.20373

Trial 5 (grams) 0.98012 N/A

● Helped Dylan perform the Interlab Study Calibration 2 (shown in following entry) according to the protocol with the following deviations: ○ Used 2 mL microcentrifuge tubes instead of the specified 1.5 mL tubes ○ Used iGEM’s VWR pipettes since they were more accurate than the other brand of pipettes ○ Followed Interlab Study Protocol (Calibration 2: Particle Standard Curve - Microsphere Protocol) with the following deviations: ● Used a 2 mL Eppendorf tube instead of 1.5 mL

● Made O/N cultures of 5 mL of LB in sterile tubes in the following manner: ○ One test tube containing an inoculation from the frozen stock Strain #108 ○ One test tube containing a colony from a plate that had been streaked on June 18, 2018 ○ One test tube containing an inoculation from the frozen stock Strain #108 and 1.7 µL of nalidixic acid ○ One test tube containing an inoculation from the frozen stock Strain #108 and 2.5 ○ One test tube acting as a negative control, having been inoculated with a sterile wooden inoculating stick ● Placed all the tubes in the shaking 37°C incubator overnight

Interlab - Calibration 2

Dylan Perera, Nicole Lassel, Marina Robin

June 27th 2018 Refer to Marina Robin’s lab book, p.2

Followed Interlab Study Protocol (Calibration 2: Particle Standard Curve - Microsphere Protocol) with the following deviations: ● Used a 2 mL eppendorf tube instead of 1.5 mL

Results:

1 2 3 4 5 6 7 8 9 10 11 12

A .172 .110 .070 .050 .040 .035 .033 .052 .031 .030 .030 .029

B .198 .105 .051 .068 .041 .039 .032 .032 .030 .030 .030 .030

C .207 .103 .073 .052 .042 .035 .033 .032 .031 .031 .030 .029

D .237 .103 .082 .058 .041 .036 .033 .033 .030 .030 .031 .030 Excitation filter: 595nm

Interlab - Calibration 3

Dylan Perera, Marina Robin

June 28th 2018 Refer to Marina Robin’s lab book, p.3

Followed Interlab Study Protocol (Calibration 3: Fluorescence Standard Curve - Fluroescein Protocol) without deviation.

Results:

1 2 3 4 5 6 7 8 9 10 11 12

A .029 .030 .031 .030 .033 .033 .032 .033 .032 .032 .030 .03 1 1 9 8 3 9 5 5 4 7

B .029 .028 .029 .030 .030 .034 .032 .029 .029 .030 .030 .032 2 9 8 7 6 2 2 5 5 6 7 3

C .029 .030 .030 .030 .030 .028 .032 .031 .029 .030 .033 .031 8 5 2 8 9 5 4 7 8 4 8

D .034 .036 .033 .030 .030 .030 .029 .030 .030 .030 .032 .029 9 5 5 8 8 2 8 2 5 8 9 8

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 19-20 June 28, 2018 ● In the morning, it was discovered that all the tubes, excluding the negative control, had growth ● Decided to start the competent protocol using the test tube that contained inoculation from the frozen stock and 1.7 µL of nalidixic acid ● Aseptically added 1 mL of O/N culture from the chosen test tube into 99 mL of LB in a baffled flask ● Put the inoculated flask in the shaking 37°C incubator at 9:05am ○ Checked the OD600 reading of 0.082 at 10:45am ○ Checked the OD600 reading of 0.203 at 11:30am ○ Checked the OD600 reading of 0.290 at 12:00pm

○ Checked the OD600 reading of 0.350 at 12:20pm ○ Checked the OD600 reading of 0.426 at 12:30pm ● Once the OD was at 0.4, continued the protocol (both shown below and previously written in this lab book) titled “Preparation of calcium competent Escherichia coli and heat-shock transformation” by Chang, Angela Y., Chau, Vivian WY., Landas, Julius A., Pang, Yvonne in Volume 1:22-25 in the June 2017 JEMI Methods article

METHODS A. CaCl2 Buffers Preparation 1M CaCl2 (stock solution, 10x working concentration) • Weigh out 11.1g of anhydrous CaCl2 • Add to 80mL of dH2O • Mix solution until CaCl2 is fully dissolved • Top up to 100mL • Filter sterilize through a 0.22μm pore

0.1M CaCl2 (working solution) • Add 10mL of 1M CaCl2 to 90mL of dH2O for a 1:10 dilution • Filter sterilize through a 0.22μm pore

0.1M CaCl2 + 15% glycerol (working solution) • Mix 6mL 1M CaCl2 with 9mL sterile glycerol and 45mL dH2O

B. Overnight Culture(s) • Inoculate 1mL of LB with E. coli • Place in shaking incubator at 37°C and 200rpm • Incubate for 12-16 hours

C. Generation of Competent Cells (CaCl2 wash)

Subculturing overnight culture: • Add 1mL of overnight culture to 99mL of fresh LB (1:100 dilution, no antibiotics) • Shake incubate at 37°C and 200rpm for 3-4 hours or until OD reaches 0.4

CaCl2 wash: • Ensure that all reagents (CaCl2 solutions, Oakridge tubes, centrifuge) are ice-cold or at 4°C • Separate culture into multiple Oakridge tubes

• Place on ice for 20 minutes • Centrifuge at 4°C at 4000rpm for 10 minutes • Discard the supernatant by tipping tubes over a discard bin and then aspirating any remaining media

Resuspend each pellet with 20mL ice-cold 0.1M CaCl2, incubate on ice for 30 minutes • Centrifuge at 4°C at 4000rpm for 10 minutes • Discard the supernatant and combine pellets by resuspending in 5mL ice-cold 0.1M CaCl2 with 15% glycerol • Use for downstream transformation or store in -80°C freezer ● The protocol was followed properly, with the deviations as described below: ○ 2 Falcon tubes were used to hold the 100 mL of the culture from the baffled flask following the subculturing and growing up to the proper OD ○ The microcentrifuge tubes containing the aliquots of the cells were flash frozen to see if the competence and corresponding transformation efficiencies could be increased ○ The tubes that were flash frozen were marked with a circle, and the tubes that were not flash frozen before being stored in the -80°C freezer were marked with an X

● After observing that the competent cells that had been plated on June 25 and incubated for 48 hours at 37°C still had no growth, all the competent cells that had been made and aliquoted that day were thrown away Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 21 July 3, 2018 ● Leah tested the competent cells made on June 28 on Cm plates ○ We want to incubate the cells longer in the 37°C incubator ○ Trouble-shooting: With the low amounts of cells growing on the plates, could we be losing cells during the procedure? Are the cells being washed away and not centrifuged properly? ○ Is the Chloramphenicol antibiotic too strong on the plates? Are the cells dying because of the levels? ● Leah had made an overnight culture the day before on July 2, and the test tubes showed growth while the negative control did not have any growth ● Followed the protocol titled “Preparation of calcium competent Escherichia coli and heat-shock transformation” by Chang, Angela Y., Chau, Vivian WY., Landas, Julius A., Pang, Yvonne in Volume 1:22-25 in the June 2017 JEMI Methods article and aseptically subcultured 1 µL of overnight culture into 99 mL of LB in a baffled flask, and placed the flask in the 37°C shaking incubator at 10:20am ○ Checked the OD600 reading of 0.197 at 12:15pm ○ Checked the OD600 reading of 0.255 at 12:30pm ○ Checked the OD600 reading of 0.323 at 1:10pm ○ Checked the OD600 reading of 0.425 at 1:30pm

● Continued to follow the protocol, but this time ensured that cell suspension was truly performed through pipetting with the P1000 Pipetman, by evenly pipetting clumps of cells into smaller clumps and then to homogeneously be combined with the chemical solutions so that lots of turbidity was seen ● Used a TOTAL of 5 mL (split in 2.5 mL aliquots between the 2 Falcon tubes) of 0.1 M CaCl2 with 15% glycerol ● Flash froze the aliquots of 100 µL of cells and out them in the -80°C freezer

● Made 100 mL worth of LB agar and 200 mL of LB agar plates with Cm antibiotic (100 µL of Cm antibiotic per 100 mL of Lb agar) ● Leah tested the Cm plates to determine if the Cm levels were adequate

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 22-23 July 4, 2018 ● The Cm plates Leah tested worked well; the positive control grew well, and the negative control had no growth, as expected ● Since the results were expected and accepted, the competent cells made yesterday could be tested using the Competent Cell Test Kit provided by the iGEM Foundation, using the protocol shown below. There were some deviations noted below.

Protocol estimated time: 30 minutes active, 1.5 hours incubation 1. Clean your working area by wiping down with 70% ethanol. 2. Thaw competent cells on ice. Label one 1.5 mL microcentrifuge tubes for each transformation and then pre-chill by placing the tubes on ice. § Do triplicates (3 each) of each concentration if possible, so you can calculate an average colony yield. 3. Spin down the DNA tubes from the Competent Cell Test Kit/Transformation Efficiency Kit to collect all the DNA into the bottom of each tube prior to use. A quick spin of 20-30 seconds at 8,000-10,000 rpm will be sufficient. Note: You should resuspend the DNA in each tube with 50 µL dH2O. 4. Pipet 1 µL of DNA into each microcentrifuge tube. 5. Pipet 50 µL of competent cells into each tube. Flick the tube gently with your finger to mix. 6. Incubate on ice for 30 minutes. § Pre-heat waterbath now to 42°C. Otherwise, hot water and an accurate thermometer works, too! 7. Heat-shock the cells by placing into the waterbath for 45 seconds (no longer than 1 min). Be careful to keep the lids of the tubes above the water level, and keep the ice close by. 8. Immediately transfer the tubes back to ice, and incubate on ice for 5 minutes.

9. Add 950 µL of SOC media per tube, and incubate at 37°C for 1 hour shaking at 200-300rpm. § Prepare the agar plates during this time: label them, and add sterile glass beads if using beads to spread the mixture. 10. Pipet 100 µL from each tube onto the appropriate plate, and spread the mixture evenly across the plate. Incubate at 37°C overnight or approximately 16 hours. Position the plates with the agar side at the top, and the lid at the bottom. 1. DEVIATION: Following this incubation period spun the microcentrifuge tubes in the centrifuge for 1 minute at a speed of 13,000 rpm 2. Following the centrifugation, removed 800 µL of the media and then resuspended the cells on the walls of the tubes in the remaining 200 µL of LB media 1. This was to help ensure that the amount of cells was high, and that the best possible results could be obtained 3. Plated 150 µL of the resuspended cells in media onto Cm agar plates 4. Using sterile inoculating wooden sticks, streaked some liquid from each microcentrifuge tube onto LB agar, to see if cells would grow at all 5. Placed the plates in the 37°C incubator at 2:50pm for overnight 11. Count the number of colonies on a light field or a dark background, such as a lab bench. Use the following equation to calculate your competent cell efficiency. If you've done triplicates of each sample, use the average cell colony count in the calculation. § Efficiency (in CFU/µg) = [colonies on plate (CFU) / Amount of DNA plated (ng)] x 1000 (ng/µg) § Note: The measurement "Amount of DNA plated" refers to how much DNA was plated onto each agar plate, not the total amount of DNA used per transformation. You can calculate this number using the following equation: § Amount of DNA plated (ng) = Volume DNA added (1 µL) x concentration of DNA (refer to vial, convert to ng/µL) x [volume plated (100 µL) / total reaction volume (1000 µL)] ● Tested the pH of the 0.1 M CaCl2 solution Nicole L had made to determine if the cells were being eaten away by the acidity/basicity of the solution ○ The solution was measured to be at a pH of 6 (and so was determined to not be a cause of low transformation efficiency) ○ Cody suggested trying to perform transformation with a concentration of DNA at 1 ug/mL as opposed to the smaller amount being used of 1 pg/mL ● Prepared overnight culture of DH5alpha from frozen stock, Strain #108, in a sterile test tube of 5 mL LB, along with a negative control ● Prepared overnight culture of Strain #284 from frozen stock, in a sterile test tube of 5 mL LB with an added 5 µL of CM ○ This will be miniprepped in the future

Other - Miniprep pSB1C3 with RFP stuffer

Marina Robin July 5th 2018

Miniprep for Nicole’s Competent Cells.

Strain info: Strain # 284 // Name: pSB1C3 with RFP stuffer // Chassis/strain: DH5alpha // Plasmid backbone: pSB1C3 // Registry part: BBa_J04450 // Antibiotic resistance: Chloramphenicol

Followed Plasmid Miniprep protocol without deviation.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 23 July 5, 2018 ● The plates that had been made yesterday on July 4 were inspected following incubation ● The results are as follows: ○ LB agar plate with Cm and 50 pg/mL of DNA: 3 red colonies ○ LB agar plate with Cm and 100 pg/mL of DNA: 7 red colonies ○ LB agar plate with 50 pg/mL of DNA: full lawn of bacteria ○ LB agar plate with 100 pg/mL of DNA: full lawn of bacteria ○ LB agar plate with small streaks of the duplicate samples of the 50 and 100 pg/mL of DNA: All small streaks grew ● Marina performed a miniprep according to the protocol on the overnight culture made yesterday with Strain #284 ● Inoculated DH5alpha from previously prepared LB plate and from frozen stock, Strain #108, in separate sterile test tube of 5 mL LB, along with a negative control, and put both tubes in the shaking 37°C incubator to prepare an overnight culture

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 24 July 6, 2018 ● Checked the overnight cultures that had been prepared and saw that both grew, excluding the negative control as expected ● Followed the protocol titled “Preparation of calcium competent Escherichia coli and heat-shock transformation” by Chang, Angela Y., Chau, Vivian WY., Landas, Julius A., Pang, Yvonne in Volume 1:22-25 in the June 2017 JEMI Methods article and aseptically subcultured 1 µL of overnight culture (from the overnight culture that had

been prepared by taking one colony from the prepared LB plate) into 99 mL of LB in a baffled flask, and placed the flask in the 37°C shaking incubator at 10:00am ○ Checked the OD600 reading of 0.440 at 1:41pm ● Continued to follow the protocol, but as before ensured that cell suspension was truly performed through pipetting with the P1000 Pipetman, by evenly pipetting clumps of cells into smaller clumps and then to homogeneously be combined with the chemical solutions so that lots of turbidity was seen ● Deviation: On second centrifuge spin, spun for 20 minutes as opposed to 10 minutes ● During the centrifugation and incubation times, remade solution of 0.085 M CaCl2 and 15% glycerol ○ Prepared this by combining 4.25 mL of CaCl2 (previously prepared by Nicole L on May 16, 2018) with 0.75 mL of glycerol ● Used a TOTAL of 5 mL (split in 2.5 mL aliquots between the 2 Falcon tubes) of 0.1 M CaCl2 with 15% glycerol ● Flash froze the aliquots of 100 µL of cells and put them in the -80°C freezer ○ The tubes that the aliquots were put in were pre-chilled on dry ice

Measurement - Growth of Empty JT2 Max Reed, Cam Martin

Purpose of Experiment: To determine the growth rate of the JT2 strain without any plasmids. In “Automated optogenetic feedback control for precise and robust regulation of gene expression and cell growth” the growth rate of JT2 with plasmids encoding the CcaS/R system is reported as ~50 minutes under full induction of CcaS/R (ie. under green light). We want to see the growth rate of the empty strain in methionine-containing media as a point of comparison (may not be directly used though).

Refer to pages 1 and 2 of Max’s lab book.

Page 1 (July 7th): At 6 pm, inoculated 4 tubes. All had 2.5 mL of M9 (supplemented with 0.4 % glucose and 0.2 % casamino acids). M9 was made using Ingalls Lab supplies. See “Media Recipes” document in the “Big Boy” folder within the “Lab 2018” folder for the M9 recipe.

Tubes: (1) JT2 + Km (2) JT2 (3) Km (4) Nothing

Didn’t know if JT2 was supposed to be grown with Km or not, that’s why this nonsense is happening. Got JT2 from frozen stock 447.

Page 2 (July 8th):

As of noon, (1) and (2) both grew, (3) and (4) did not (yay!). As it turns out JT2 has genomic Km resistance.

Made 3 vials today: (1) 15 µL of overnight culture + 5 mL M9 + Km (2) 30 µL of overnight culture + 5 mL M9 + Km (3) 2.5 mL M9 + Km (-ve)

Note that the Km we used in this experiment was from the iGEM freezer and was at some mystery concentration. We added 1 µL of it per mL of M9, but we don’t know what that translates to as a final antibiotic concentration.

Put the vials in the water bath in the Ingalls lab at 12:27 pm.

Growth Data (from (2), because (1) mysteriously died for some reason):

Time Time (mins) OD Log Base 2 OD

2:15 pm 0 0.058 -4.10780329

2:48 pm 33 0.116 -3.10780329

3:14 pm 59 0.183 -2.450084446

3:38 pm 83 0.293 -1.77102743

4:01 pm 106 0.460 -1.120294234

Based on graphing the plot of Time (mins) vs Log Base 2 of OD, making a line of best fit for that plot, finding the slope of that line, and then taking its inverse, the doubling time of the empty JT2 strain is 36 minutes.

NOTE: The last OD measured actually read as 0.445, but upon diluting the bacterial sample with an equal amount of water, the spectrometer read 0.230. Generally the spectrometer in the Ingalls lab is inaccurate above an OD of 0.4 (it underestimates OD), so when OD is higher than 0.4 it is recommendable to dilute one’s sample. Diluting with water is acceptable when growing bacteria in M9, because M9 and water have identical OD600 values.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 24-25 July 9, 2018

● Leah tested the competent cells made on Friday, July 6 over the weekend, but the results showed very few cells on the transformation plates and thus the cells were deemed to be incompetent ● Aseptically inoculated 2 test tubes containing 5 mL of LB each with a colony of DH5alpha that was taken from a LB plate prepared on June 18 ● Also inoculated a negative control, and placed all the test tubes in the 37°C shaking incubator at 10:50am ● Clara performed miniprep and nanodropped them ● Aseptically inoculated 99 mL of LB with 1 mL of overnight culture of S17 from Max Reed ○ Placed flask in the 37°C shaking incubator at 12:50pm ● Checked the OD600 at 3:00pm for a reading of 0.467 ● Diluted the culture again by adding 2 mL of the culture to 98 mL of sterile LB in a sterile flask ○ Placed flask in the 37°C shaking incubator at 3:15pm ● Checked the OD600 at 4:15pm for a reading of 0.035

● Worked on testing calibration of scales in the iGEM Lab using weights from the CPCC Lab: ● Both the Sartorius Analytic Scale and the Sartorius LP4200S were balanced with the bubble in the centre ● Sartorius Analytic Scale: ○ Mass of the weight used: Actual reading from scale ○ 200 mg: 0.2003 g; 0.2002 g ○ 500 mg: 0.4998 g; 0.4998 g ○ 100 mg: 0.0999 g; 0.0999 g ○ 1 g: 0.9999 g; 0.9999 g ● Sartorius LP4200S: ○ Mass of the weight used: Actual reading from scale (range of weights) ○ 200 mg: 0.19 g (0.17 g - 0.21 g) ○ 500 mg: 0.49 g (0.46 g - 0.56 g) ○ 100 mg: 0.09 (continuously changing from 0.06-0.12) ○ 1 g: 0.99 (0.97-1.03)

Other - Miniprep of CcaS and CcaR Plasmids

Clara Fikry

July 9, 2018 “Refer to Clara Fikry’s lab book, p.1”

Followed Plasmid miniprep protocol with the following deviations: ● Did 3 minipreps from O/N cultures prepared by Max Reed: two from the 6r (CcaS plasmid) and one from the 6 culture (CcaR plasmid) (refer to p. 3 in Max’s book) ● All centrifugations were done at 13,000xg ● Step 1: used 1mL of O/N culture, spun for 1 minute

● Step 5: spun for 3 minutes ● Step 10: eluted in 30uL elution buffer Nanodrop: Sample DNA concentration (ng/uL)

6r (1) 12

6r (2) 19.2

6 48.6 All samples had peaks at 260, but the 6r samples had lower peaks. Samples were labelled and stored in the fridge (-4°C).

Other - Competent Cells

Leah Fulton + Nicki

July 9, 2018 “Refer to Leah Fulton’s lab book, p.1 - 3”

Ingall’s lab inoculated empty s17 on the 8th. Cells were diluted 1ml in 99mL of LB and incubated until they reached an OD of 0.47. They were then diluted again and grown to an OD of 0.368.

1. Place cells on ice once they reached an OD of 0.368 and chilled for 20-30min (swirling periodically for even cooling) 2. After 20 min split culture into 2 cold falcon tubes. 50ml each and then centrifuge at 4 degrees for 15min 13000g 3. Decant LB and resuspend each in 10mL cold MgcL2 4. Centrifuge for 15min at 4 degrees 13000g 5. Decant and re-suspend each in 10mL ice cold CaCl2 and sit on ice for 20min 6. Centrifuge 15 min 4 degrees 2000g (2 times because the pellet was garbage) 7. Decant and re-suspend in 5mL cold CaCl2 + 15% glycerol 8. Alliquate 50ul into sterile 1.5mL microfuge tubes on ice 9. Flash freeze tubes using liquid nitrogen and place in -80

-> Comp cells will be tested by Max

Buffer Prep

1M CaCl2 (10x stock) -22.2g in 160mL DH2O untill disolved and then top up to 200mL -filter sterilize

0.1M CaCl2 - 10mL of 1M CaCl2 stock

- 90mL DH2O - Filter sterilize

1M MgCl2 (10x stock) -40.66g in 160mL DH2O untill disolved and then top up to 200mL -filter sterilize

0.1M MgCl2 - 10mL of 1M MgCl2 stock - 90mL DH2O - Filter sterilize

0.1M CaCl2 + 15% gycerol (10x stock) - 6mL 1M CaCl2 - 9mL gycerol - 45 mL DH2O - Filter sterilize

Other - Heat Shock Test for Competent Cells Leah + Max

July 9, 2018 “Refer to Leah Fulton’s lab book, p.1 - 3”

Max tested the competent cells made above. He followed the iGEM heat shock protocol and spinned down the cells before plating (removing most of the LB but plating all the cells).

Tests:

a) 1ul 50pg of BBa_j04450 RFP (from 2017 comp cell test kit) b) 1ul 50pg of BBa_j04450 RFP (from 2017 comp cell test kit) c) 5ul 50pg of BBa_j04450 RFP (from 2017 comp cell test kit)

Results: After 24 at 37 degrees

a) 6 colonies b) 13 colonies c) 33 colonies

Transformation Efficiency TE = colonies/ ug / dilution = 33 / 0.00025ug/1 = 1.3 x 105 42

Good enough.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 25 July 10, 2018 ● Recap: On July 8, Leah tested competent cells prepared on July 6 and has determined that while they are able to grow on LB agar plates well, they have much difficulty growing on LB agar with Cm ○ Their transformation efficiency is very low ● The Cm plates have been tested, and the positive control has been able to grow well on them. Thus, it appears that the protocol for making the competent cells is simply not being successful

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 25 July 11, 2018 ● Prepared LB agar plates and LB agar plates with Chloramphenicol ○ Used 100 µL of Chloramphenicol for 100 mL of LB ● Prepared Chloramphenicol antibiotic: The stock concentration is 25 mg/mL of ethanol (25 mg is equal to 0.025 g) and the working concentration is 25 ug/mL ○ Made 5 mL worth of Chloramphenicol antibiotic by measuring out 0.125 g (actually 0.12538 g) of Chloramphenicol powder and combining it with 5 mL of 100% ethanol ○ Vortexed in a 15 mL Falcon tube and then aliquoted into 3 1.5 mL microcentrifuge tubes

Interlab - Transformation

Nicki, Leah July 11th, 2018 Please refer to pages 4-5 in Nicki’s lab book.

Transformed all 8 Parts from the Interlab 2018 Protocol according to the transformation protocol on p9-10. 1 microlitre of DNA was transformed into each S17 comp cells made by Leah and Nicki on July 9th. Each spread plated on Cm agar and streaked on LB. All Cm tests were negative, LB tests were all positive. The competent cells turned out to be incompetent. Leftover DNA was stored at -20 degrees, for later transformation into DH5alpha comp cells.

Measurement - Growth of J2T in MetE Dropout Media

Max, Cameron, Sebastian, Poonam

July 12th, 2018 Please refer to pages 9-12 in Poonam Furmah’s lab book, as well as page 6 of Max Reed’s book.

We are currently testing the growth of the JT2 strain in an M9 dropout media after filter sterilizing a wild-type (MetE+) strain of E.coli from the media. This experiment is to ensure that E. coli cells do not excrete methionine that can be taken up by J2T cells.

Procedure 1.) NCM (full strain name NCM3722) and JT2 were inoculated in LB on the night of July 11th. NCM was inoculated from a colony on a plate borrowed from the Ingalls lab, while JT2 was inoculated from frozen stock 447. 2.) NCM was grown overnight at 37 degrees. The culture reached and OD of 3.9 (had to be diluted by a factor of 13 and then the OD was taken and found to be 0.300). NCM is a healthy boi in LB. 3.) JT2 was of course also grown overnight. Though its OD was not taken, it looked unambiguously to be above 1. OD was not taken because JT2 was essentially being used to inoculate the test tubes at the end of the experiment, but should be taken in similar experiments in the future. 4.) At 12:30 pm on July 12th, NCM and JT2 were removed from the incubator. 5.) At 1:00 pm, M9 without methionine was prepared (this will be written as M9 - met). The recipe was as follows: a.) 1 mL 20% glucose b.) 5 mL of 5x M9 salts c.) 10 mL of 5x amino acid mix minus methionine (see recipe in the Media Recipes document within the Big Boy folder) d.) 40 µL of 2.5 M MgSO4. e.) 2 µL of 2.5 M CaCl2 f.) ~34 mL of autoclaved DI water 6.) At 1:30 pm, 75 µL of the NCM overnight culture in LB was spun down. The LB supernatant was removed with a pipette. The NCM was then resuspended in 10 mL of M9 - met. In theory the OD of the resultant mixture should have been 0.03 (0.075 mL / 10 mL * OD of 4 = OD of 0.03). 7.) At 3:00 pm, the OD of the NCM in M9 - met was taken and found to be 0.066. This meant it doubled about once (and probably took 30-60 minutes to adjust to the new media before it started growing). Max was a fool and thought the doubling time would be faster than this and it wasn’t but we all just need to live with the consequences of that. In the future incubate the methionine-producing strain for longer than 1.5 hours. 8.) The NCM in M9 - met was centrifuged in the core facility. It was brought up to a speed of 13000 RPM which took like 20 seconds and then it was immediately stopped because it was making a scary noise. (Note: for future reference, define better speed and spin time for the centrifuge). 9.) Supernatant was transferred to syringe with filter and filtered into test tube aseptically. Initially we used the small filter that iGEM has. You know, the 0.22 µm filter that is like 1 cm long and has a diameter of 5 mm. Anyway, filtering

using it was slow and painful so we switched to using one of the 0.22 µm filters with diameter 2 cm that the Ingalls lab has (the blue ones). 10.) 100 µL of JT2 cells from the overnight culture were spun down and the LB was drawn off. These were resuspended using 1 mL of M9 - met. This was then also spun down and supernatant was drawn off. Finally, the cells were once again resuspended in 1 mL of M9 - met. 11.) Experimental tubes were labelled and components were allocated according to the table below. 12.) All test tubes were placed in the 37 degrees incubator (shaker) at approximately 5 pm. 13.) At 8:30 am on July 13th, the tubes were observed to detect if there was growth or not. The results are simply presented as growth / some growth / no growth but future experiments should note precise OD.

Tests and Results Test Tube # Control Components Results

1 Experimental → M9 Dropout with No growth NCM removed (2 mL) → Added JT2 (25 uL) → KM (2 uL)

2 + → M9 Dropout with Minor growth* NCM removed (2 mL) → Stock culture NCM (2 uL)

3 + → M9 Dropout with Growth NCM removed (2 mL) → Added JT2 (25 uL) → KM(2 uL) → Met (100 uL)

4 - → M9 Dropout with No growth NCM removed (approx. 2 mL) → KM (2 uL)

5 - → Stock M9 No growth Dropout (2 mL) → KM (2 uL) → MetE (100 uL)

6 - → Stock M9 No growth Dropout (2 mL)

→ Added JT2 (25 uL) → KM (2 uL)

7 + → Stock M9 Growth Dropout (2 mL) → Added JT2 (25 uL) → KM (2 uL) → Met (100 uL)

* Okay so NCM should in theory be able to grow in M9, even if there’s no methionine. It should have a doubling time of something between 30 minutes and 60 minutes. NCM is a K12 derivative and doesn’t grow super well in minimal media but it should still grow. The low OD of the overnight culture is probably a product of us using a small inoculation volume and us leaving the overnight culture on the bench for like 4 or 5 hours, which might have killed some of the NCM cells. That’s just my guess though. We don’t actually need to grow NCM in M9 again though so this is all kind of a moot point. I’m rambling, I’ll stop now.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 25 July 12, 2018 ● Prepared chemical solutions of 0.1 M CaCl2 and 0.1 M MgCl2, to ensure that the chemical solutions were not the cause of the poor cell competence ● Preparation of 0.1 M CaCl2: ○ 1 M CaCl2 = 110.98 g/L ○ 0.1 M CaCl2 = 11.098 g/L of deionized water ○ 0.1 M CaCl2 = 5.549 g/ 0.5 L of deionized water ● Preparation of 0.1 M MgCl2: ○ 1 M MgCl2 = 203.30 g/L ○ 0.1 M MgCl2 = 20.33 g/L of deionized water ○ 0.1 M MgCl2 = 10.165 g/ 0.5 L of deionized water ● Both solutions were prepared and stirred to ensure they were fully dissolved, and then autoclaved

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 26-27 July 13, 2018 ● Began planning about what to prepare for SHAD Workshop: ○ Aliquot buffers for performing minipreps (prepare 4 kits, with some extras) ○ Organize pipettes and pipette tips ○ Have a gel prepared for gel electrophoresis ○ Inoculate BBa_04450 so then it can be used as a RFP

● Attempted to make competent cells with the following protocol (“Patrick’s protocol from 2016”)

Making CaCl2 Comp Cells Version 2.0

Caveat: Always under extreme aseptic technique, making sure to EtOH wipe down everything including your body (especially you Adrian cause you’re a dirty llama). All incubation periods should be done on a shaker. All steps after Step 4 should be done on ice.

1. Streak purify DH5a on LB-agar plate, no antibiotics. Incubate o/n at 37°C (12-16hrs). 2. Inoculate one colony from the plate into 5mL liquid LB w/ no antibiotics. **It might be wise to try and inoculate into other 5mL liquid LB tubes if your colony was big enough to inoculate more than just the no antibiotic 5mL LB culture.

3. Autoclave 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, 50mL of 0.085M CaCl2, a GSA bottle, and 250mL liquid LB. Filter sterilize 50% glycerol in MilliQ. 4. Inoculate the 5mL culture w/ no antibiotics into 250mL liquid LB w/ no antibiotics and grow to OD 0.4-0.5 in 37°C, checking using the UV-Spec with 1mm cuvettes. 5. Transfer the 250mL culture at the end of the incubation into the GSA bottle and refrigerate for 20mins at 4°C to stop the growth. **It might be wise to put the culture in the GSA bottle into the -20°C freezer for 5mins to stop the growth asap. 6. Pellet the culture using the centrifuge: 3K RPM, 10min, 4°C and decant the supernatant.

7. Resuspend in 125mL 0.1 MgCl2 using a pipette to vigorously break apart the aggregates. Incubate this solution at 4°C for minimum 30min up, but better if over 1hr. 8. Repeat step 6.

9. Resuspend in 200mL 0.1M CaCl2 using a pipette to vigorously break apart the aggregates. Incubate this solution at 4°C o/n (12-16hrs). 10. Repeat step 6.

11. Resuspend in 5mL 15% Glycerol - 0.085 CaCl2 using a pipette to vigorously break apart the aggregates. Aliquot 100µLinto ~50 1.5mL microfuge tubes and freeze at -80°C . Do not flash freeze.

Deviations from this protocol are as follows: 1. Streak purify DH5a on LB-agar plate, no antibiotics. Incubate o/n at 37°C (12-16hrs). ○ The DH5a plate had been plated on June 18, 2018 and kept in the fridge and so a colony was picked and used from this plate and inoculated into the 5mL of LB in 2. 2. Inoculate one colony from the plate into 5mL liquid LB w/ no antibiotics. ○ **It might be wise to try and inoculate into other 5mL liquid LB tubes if your colony was big enough to inoculate more than just the no antibiotic 5mL LB culture. ○ 2 test tubes with a single colony of DH5a were prepared, in addition to 1 negative control test tube on July 12, 2018

○ In the morning of July 13, 2018, the tubes were checked; the negative control did not grow, and the two DH5a tubes did

3. Autoclave 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, 50mL of 0.085M CaCl2, a GSA bottle, and 250mL liquid LB. Filter sterilize 50% glycerol in MilliQ.

● Inoculated 3mL of the second spare test tube of DH5alpha into 250mL ○ Then decided to abort this procedure as well due to time ● Made Chloramphenicol (Cm), Spectinomycin (Sp), Cm and Sp, and normal LB agar plates with Caleb Innes ○ Added 100µLof antibiotic for every 100mL of LB ● Made 2L of liquid LB media with Caleb ● Tested agar plates ○ Streaked Strain #257 on Cm, Sp, and Cm and Sp plates and DH5alpha Strains #108 and #109 onto LB plates (109 and 108 on new LB plates, and 108 also on an old LB plate)

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 27 July 14, 2018 ● Inspected plates prepared with Caleb ● DH5alpha Strain #108 grew on old LB plate (plate that had been previously tested) ● DH5alpha Strain #109 grew onto newly made LB plate ● All the other plates grew as expected, with the positive controls growing and the negative controls not growing

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 28-29 July 15, 2018 ● Attempted to make competent cells with the following protocol (“Patrick’s protocol from 2016”)

Making CaCl2 Comp Cells Version 2.0

Deviations from this protocol are as follows: 1. Streak purify DH5a on LB-agar plate, no antibiotics. Incubate o/n at 37°C (12-16hrs). ○ The DH5a plate had been plated on July 13, 2018 and so a colony was picked and used from this plate and inoculated into the 5mL of LB in 2. 2. Inoculate one colony from the plate into 5mL liquid LB w/ no antibiotics. ○ **It might be wise to try and inoculate into other 5mL liquid LB tubes if your colony was big enough to inoculate more than just the no antibiotic 5mL LB culture. ○ 2 test tubes with a single colony of DH5a were prepared, in addition to 1 negative control test tube on July 14, 2018 ○ In the morning of July 15, 2018, the tubes were checked; the negative control did not grow, and the two DH5a tubes did

3. Autoclave 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, 50mL of 0.085M CaCl2, a GSA bottle, and 250mL liquid LB. Filter sterilize 50% glycerol in MilliQ.

○ On July 12, 2018, 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, and multiple GSA bottles were autoclaved 4. Inoculate the 5mL culture w/ no antibiotics into 250mL liquid LB w/ no antibiotics and grow to OD 0.4-0.5 in 37°C, checking using the UV-Spec with 1mm cuvettes. ○ With aseptic technique, 250mL of LB was measured using a graduated cylinder and poured into a 500mL flask ○ Gently agitated the tube of DH5alpha and then added the entire 5mL into the flask containing 250mL of LB ○ Put into shaking incubator at 37°C at 10:00am ○ Checked the OD600 at 11:10pm for a reading of 0.096 ○ Checked the OD600 at 11:35pm for a reading of 0.139 ○ Checked the OD600 at 12:05pm for a reading of 0.234 ○ Checked the OD600 at 12:25pm for a reading of 0.332 ○ Checked the OD600 at 12:40pm for a reading of 0.327 ○ Checked the OD600 at 12:40pm for a reading of 0.327 ○ Checked the OD600 at 12:50pm for a reading of 0.387 9. Transfer the 250mL culture at the end of the incubation into the GSA bottle and refrigerate for 20mins at 4°C to stop the growth. a. **It might be wise to put the culture in the GSA bottle into the -20°C freezer for 5mins to stop the growth asap. b. Placed culture on ice for 20 minutes 10. Pellet the culture using the centrifuge: 3K RPM, 10min, 4°C and decant the supernatant. a. Prechilled centrifuge to ~4°C and then added the GSA bottles (one containing the culture in LB and the other acting as a balance with water) b. Due to the GSA bottles not being seal-tight, there was leakage in the centrifuge. Still able to see a large clump of centrifuged cells though.

11. Resuspend in 125mL 0.1 MgCl2 using a pipette to vigorously break apart the aggregates. Incubate this solution at 4°C for minimum 30min up, but better if over 1hr.

50 a. Incubated the cells on ice for 1 hour 12. Repeat step 6 (step 10 here), with centrifugation of 10 minutes

13. Resuspend in 200mL 0.1M CaCl2 using a pipette to vigorously break apart the aggregates. 14. Incubate this solution at 4°C o/n (12-16hrs). a. Incubated from 4:30pm until 10:05 am the following day

● Diluted 0.5mL of JT2 overnight culture (made by Leah July 15) into 5mL LB with 5µLKm ● Diluted 0.5mL of DH5alpha overnight culture (made by Leah July 15) into 5mL ○ Performed this twice, so that there were 2 tubes of diluted DH5alpha ● Incubated in shaking incubator at 37°C at 11:05am

Other- Miniprep CCas, CCar and CCas/CCar

Poonam July 15th, 2018 Refer to Page 13 in Poonam Furmah’s Lab Book

Strain Info DH5Alpha

Procedure Using 2 mL of sample from 24 hour inoculated culture of DH5-alpha for both CcaS, CcaR and CcaS/CcaR, the miniprep protocol was followed without any deviation. The results were nanodropped and compiled in the table below. All samples were then labelled and kept in iGem Lab Freezerbox “2018”.

Tests 2 mL of CcaS 2 mL of CcaR 2 mL of CcaS/CcaR

Results Sample Concentration Description of Freezerbox Label (ng/uL) Peak

CCas 68.8 Strong Peak @ 260 2 nm

CCar 25.7 Weak Peak @ 260 1 nm

CCas/CCar 90.2 Strong Peak @ 260 3 nm

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 29 July 16, 2018 ● Completed the protocol for the competent cells, as described below 15. Repeat step 6 (step 10 here). a. Centrifuged for 10 minutes, and then 10 minutes again to get proper pelleting b. Note that there were some breaks with the cells remaining at 4°C in the refrigerated centrifuge due to getting ice, liquid nitrogen, etc. 16. Resuspend in 5mL 15% Glycerol - 0.085 CaCl2 using a pipette to vigorously break apart the aggregates. 17. Aliquot 100 µL into ~50 1.5mL microfuge tubes and freeze at -80°C. a. Thought the protocol said not to, the tubes were flash-frozen using liquid nitrogen and then place in the -80°C in a freezer box b. Flask froze all tubes (excluding 6 tubes, which were meant as controls for flash freezing in case they did not work) and put in the -80°C freezer

Other - Competent cell test

Nicki July 16th, 2018 Please refer to page 6 in Nicki’s lab book.

Frozen Stock

Frozen Stock Unfrozen stock

1ul BBa_J04450 1ul BBa_J04450

2ul BBa_J04450 2ul BBa_J04450

The above transformations were performed according to the protocol on p9-10. With DNA from Test Plate 1, well P24 of the 2018 iGEM distribution kit (suspended according to the registry protocol). Tubes were spun down at 13rpm for 8 minutes and the pellet resuspended in 100uL of original broth. Then spread on Cm plates and streaked on an LB plate.

Results: Frozen Stock Unfrozen stock

1uL 7 red colonies, 1 white 3 red colonies, 3 white

2uL 5 red colonies 21 red colonies

LB: All streaks were positive.

Conclusion: These competent cells have inadequate efficiency and should not be used.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 29 July 17, 2018 ● Prepared materials for the SHAD Workshop, including making the agarose gel ● Helped run workshop involving miniprep and presentation

Measurement - Transformation of JT2 with CcaS/R v2.0

Max

July 17th, 2018 Refer to page 7 of Max Reed’s lab book

Transformed JT2 that already has the CcaS v2.0 plasmid inside it with the CcaR v2.0 plasmid. V2.0 is the particular version in use in the Ingalls lab. JT2 was previously transformed with the CcaS plasmid by Leah.

Followed Leah’s protocol for instant competent cells (see page 6 in Leah’s lab book). The only modification was that I used 2 µL of plasmid DNA instead of 1 µL. Also, though it’s not explicitly in the protocol Leah usually chills all tubes that cells are held in in the -80C freezer. I just put them on ice instead because I didn’t want to put them in the -80C. There was no higher minded reason than that.

Despite my lack of chilling, the transformation worked though! The positive control (untransformed cells grown on LB agar with no antibiotic) died which was really weird but the presence of the CcaS and CcaR plasmids was confirmed by streaking on a second plate (which grew), growing overnight in LB with spectinomycin and chloramphenicol (which grew), and then running the overnight sample on the flow cytometer (it was fluorescent). Transformation efficiency was also weirdly high but hey, not gonna complain. I made two frozen stocks; one is in Bingalls-Land in the optogenetics project box and the other is in the iGEM 2018 box.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 29 July 18, 2018 ● Prepared gel for gel electrophoresis for the SHAD Workshop using the recipe below: ○ Wanted to use a 50 mL tray for the electrophoresis rig ○ Combined 0.5 g of agarose and 50 mL of 1X TAE buffer ○ Added 5 µL of gel red once the agarose had melted in the microwave ○ Poured the gel and let it sit to solidify

Measurement - Assembled M9

Poonam July 18-19th, 2018 Refer to page 14 in Poonam Furmah’s lab book

Procedure Used the “media recipes” protocol online to assemble M9 salts, 1 M MgSO4, 1 M CaCl2 and 20% glucose. The following amounts were used to eventually assemble M9 on July 19th which will be used in further experiments.

Component Added

500 mL 10 x M9 Salts → 64 g of Na2HPO4*7H2O → 15 g KH2PO4 → 5 g NH4Cl → 2.5 g NaCl

10 mL 1 M CaCl2 1.11 g of CaCl2

50 mL 1 M MgSO4 6.01 g of MgSO4

50 mL 20% glucose 10 g glucose

100 mL M9 → 10 mL M9 Salts → 2 mL 20% glucose → 2 mL amino acids (-met) → 200 uL 1 M MgSO4 → 10 uL 1 M CaCl2 → 85.79 mL dH2O

Construction - Transform psB3C5 into DH5α cells

Dean, Nicole, Nicki July 19th, 2018 Please refer to Dean Stipanic’s lab book, p. 1

The objective of this experiment was to transform pSB3C5 (backbone includes p15A ori and CmR) into DH5α cells. This plasmid is to be used as the backbone for the GFP construct which will be a part of the blue light system. This plasmid has the desired ori and antibiotic resistance which is why it was chosen.

Resuspended psB3C5 from the 2017 distribution kit, plate 4, well 4D. Followed the protocol for heat shock transformation to transform psB3C5 into comp cells. Cells were then incubated for 1 hour and then plated on Cm plates and streaked on LB plates. Cells that

54 went through heat shock process with no added DNA were also plated and streaked as controls. Transformation was successful.

Construction - Inoculating pSB3C5, pSB1C3 & pSKA413-containing DH5α cells

Chirayu (Ray) Patel

July 19th, 2018 Please refer to Ray Patel’s lab book, p. 1

The construction team is trying to clone GFP into pSB3C5 (backbone includes p15A ori and CmR) for the blue light population, and remove GFPmut3 from pSKA413 (includes CcaS/CcaR) for the green light population.

This experiment was conducted at 3:45 PM to leave enough time for incubation before tomorrow’s plasmid miniprep. A single colony of pSB3C5-containing cells was selected from the “3 µL” LB agar plate corresponding to last night’s transformation, and inoculated with liquid LB containing chloramphenicol at a concentration of 25 µg/mL. Strain 346 (containing pSB1C3 with GFP cassette) and strain 449 (containing pSKA413 with CcaS/CcaR) were picked from frozen stocks (strain box 5 and 7, respectively) and each inoculated with liquid LB + Cm. All three test tubes were labelled and placed on a shaker in the 37°C incubator.

Followed inoculation protocol on p. 3-4 of online lab book without any deviations. Measurement - Growth of JT2 in Dropout M9 Media (Previously containing CcaS/CcaR JT2)

Max Reed, Sebastien Carman

July 19, 2018 Refer to Sebastien Carman’s lab book, p. 3-5

We are currently testing the growth of the empty JT2 strain in an M9 dropout media after filter sterilizing CcaS/CcaR JT2 from the media in the turbidostat. This experiment is to ensure that our CcaS/CcaR JT2 cells do not excrete methionine that can be taken up by other cells.

Procedure 1. CcaS/CcaR JT2 and empty JT2 were inoculated in LB on the night of July 18th. Inoculated straight from the transformation plate (see page 7 of Max’s lab book, or page 21 of the online lab book). Empty JT2 was grown overnight at 37 degrees. The culture reached an OD of 1.324 at ~20:00 July 19th.

2. CcaS/CcaR JT2 was grown overnight in the turbidostat. At 14:00 July 19, 150 µL was isolated, diluted with 300 µL of diH2O. This mixture gave an OD = 0.248, which was corrected to OD = 0.268 due to the fact that the OD was blanked against LB and not water yielding a OD before dilution of ~ 0.8 3. M9 without methionine was prepared by Poonam (this will be written as M9 - met). The recipe was as follows: a. 1 mL 20% glucose b. 5 mL of 5x M9 salts c. 10 mL of 5x amino acid mix minus methionine (see recipe in the Media Recipes document within the Big Boy folder) d. 40 µL of 2.5 M MgSO4. e. 2 µL of 2.5 M CaCl2 f. ~34 mL of autoclaved DI water 4. At ~1:30 pm, 650 µL of the CcaS/R v2.0 JT2 overnight culture in LB was spun down. The supernatant was removed with a pipette. The JT2 was then resuspended in 25 mL of M9 - met, spun down, aspirated and resuspended a final time in 25 mL of M9 - met with 25 µL of KM. These cells were placed in the turbidostat at 14:11 in rack #5 5. OD readings were frequently taken starting at 15:02, until we finally reached an OD = 0.382 at 19:32. At this point we moved from the Ingalls lab to iGEM to continue the experiment. 6. 50 µL of the CcaS/R v2.0 JT2 was set aside, and the rest of the CcaS/R v2.0 JT2 was spun down for 2 minutes at 13000 RPM in the core facility centrifuge. 7. Supernatant was transferred to syringe with filter and filtered into test tube aseptically using one of the 0.22 µm filters with diameter 2 cm that the Ingalls lab has (the blue ones). This yielded about 17mL of M9-met without CcaS/R v2.0 JT2 8. 100 µL of empty JT2 cells from an overnight culture grown in LB were spun down and the LB was drawn off. These were resuspended using 1 mL of M9 - met. This was then also spun down and supernatant was drawn off. Finally, the cells were once again resuspended in 1 mL of M9 - met. 9. Experimental tubes were labelled and components were allocated according to the table below. 10. All test tubes were placed in the 37 degrees incubator (shaker) at approximately 20:15. 11. ~ 11:30 on July 20th, the tubes were observed to detect if there was growth or not. The results are presented as OD readings in the table below.

Tests and Results Test Tube # Control Components Results

1 Experimental → M9 - met with OD = 0.265 CcaS/R v2.0 JT2 removed (3 mL) → Empty JT2 (50 µL)

2 + → M9 - met with OD = 0.016 CcaS/R v2.0 JT2

removed (3 mL) → CcaS/R v2.0 JT2 (50 µL)

3 + → M9 - met with OD = 0.797 CcaS/R v2.0 JT2 removed (3 mL) → Empty JT2 (50 µL) → Met (150 µL)

4 - → M9 - met with OD = -0.002 CcaS/R v2.0 JT2 removed (3 mL)

5 - → Stock M9 - met (3 OD = 0.018 mL) → Met (150 µL)

6 - → Stock M9 - met (3 OD = 0.233 mL) → Empty JT2 (50 µL)

7 + → Stock M9 - met (3 OD = 0.986 mL) → Empty JT2 (50 µL) → Met (150 µL)

Discussion

These results aren’t great. We had growth in some of our negatives, but let’s do some comparisons. Tube 3 is tube 1 with met added; similarly, tube 7 is tube 6 with met added. In both of these cases we observe that the addition of methionine causes an increase in growth for empty JT2. This leads us to believe that either CcaS/R v2.0 JT2 is capable of shedding methionine or the much more likely chance that somewhere along the line some degree of contamination caused the accidental addition of methionine to a supposedly methionine free environment. This second belief is further supported by the fact that the original experiment “Measurement - Growth of J2T in MetE Dropout Media” from July 12th saw little to no growth in similar tubes, and similar changes in growth between tubes 1 and 3, and 6 and 7. In future experiments, extreme precaution should be taken in all steps of the experiment to ensure that the materials used have been thoroughly cleaned. This stretches from the preparation of the M9 - met media to the experiment itself. Using disposable, single-use materials may be advisable.

Also, tube 2 died. Tube 2 shouldn’t have died. It’s especially confusing because empty JT2 inoculated in identical media (M9-met with CcaS/R v2.0 JT2 removed) grew but somehow JT2 with CcaS/R v2.0 in it did not. We’re not even really gonna bother interpreting this more,

57 we’re just gonna do it again. Maybe next time we’ll keep tube 2 under green light to ensure CcaS/R is active and MetE is being produced.

Construction - Miniprep of pSB3C5, pSB1C3 & pSKA413

Chirayu (Ray) Patel

July 20th, 2018 Please refer to Ray Patel’s lab book, p. 1

Bacterial growth was observed in all 3 test tubes from the inoculation on July 19th (see p. 20 of online lab book). Duplicates of 2 mL were prepared from each test tube for the plasmid miniprep. Centrifuged 2 mL of bacterial culture from each sample for 1 minute to pellet cells. Resuspended pellet in 200 μL of Plasmid Resuspension Buffer, lysed cells with 200 μL of Plasmid Lysis Buffer, and neutralized the lysate with 400 μL of Plasmid Neutralization Buffer. Plasmid DNA was bound to the spin column matrix following centrifugation, washed, and finally eluted (using 30 μL elution buffer) into a clean, labelled 1.5 mL microfuge tube. All 6 samples were stored inside a box labelled “2018” in the -20°C freezer. 1 µL from each sample was used for the nanodrop and results were recorded in the table below.

Followed plasmid miniprep protocol on p. 4-5 of online lab book with the following deviations: ● Centrifuged 2 mL of bacterial culture for 1 minute instead of 30 seconds to pellet cells

Results

Sample Concentration A260 values -20 Freezer Box (ng/µL) Position

B1 - pSB3C5 186.5 3.729 A4

B2 - pSB3C5 198.5 3.969 A5

G1 - pSB1C3 53.9 1.077 A6

G2 - pSB1C3 73.1 1.462 A7

C1 - pSKA413 59.5 1.190 A8

C2 - pSKA413 71.8 1.436 A9

Construction - Preparing Glycerol Stock of pSB3C5

Nicole Wang

July 20, 2018 “Refer to Nicole Wang’s lab book, p.#6” pSB3C5 was resuspended from the 2017 iGEM distribution kit, and transformed into DH5α cells on July 18, 2018. pSB3C5 will be used as the plasmid backbone for a GFP cassette. A successful transformant was inoculated by Ray Patel on July 19, 2018 to prepare this glycerol stock and miniprep the plasmid.

“Followed Frozen Stock Preparation protocol with the following deviations: ● Did not spin down cells and resuspend in fresh LB ● Mixed 500 uL of pSB3C5 overnight culture and 500 uL of 50% glycerol by inverting

Added frozen stock to the iGEM 2018 box in the -80°C freezer, as strain #26.

Construction - Confirming GFP expression in iGEM Strain 346

Nicole Wang

July 20, 2018 “Refer to Nicole Wang’s lab book, p.#7”

Purpose The construction team will clone the GFP cassette from the iGEM Strain 346 into pSB3C5 to mark the blue light-responsive population. The purpose of this experiment is to confirm that this GFP cassette is fluorescent and cells containing the GFP cassette can be detected by the flow cytometer.

Procedure 1. iGEM strain 346 (GFP Cassette in pSB1C3) was inoculated by Ray Patel on July 19, 2018 2. Overnight culture was diluted by inoculating 200 uL into 5 mL of fresh LB, and incubated in the 37°C water bath shaker, at about 10:00 am 3. At about 12:30 pm, the OD600 of the culture was ______4. ___ uL of cells were centrifuged at 13000 xg for 1 min 5. The supernatant was pipetted off, and the cells were resuspended in 200 uL of 1xPBS to obtain an OD of approximately 0.1 6. The sample was read on the flow cytometer and data was acquired at laser intensities of 5 mW, 10 mW, and 20 mW

Results

Histograms for the intensity of Ch 2 showed high levels of fluorescence, which increased as the laser intensity increased.

Conclusions Cells from the iGEM strain 346 were able to fluoresce green, and were easily detected by the flow cytometer.

Construction - Perform PCR for Photoreceptor Construct and Digest + Gel Extraction for GFP Construct

Ray, Nicki, Dean, Nicole W, Caleb

July 22nd, 2018 Please refer to Ray Patel’s lab book, p. 2-10

The construction team is trying to clone GFP into pSB3C5 (backbone includes p15A ori and CmR) for the blue light population, and construct the photoreceptor construct by PCR amplifying the ho1 + pcyA (photoreceptor), and SpecR + p15A (AbxOri) sequences from the Ingalls Lab CcaS plasmid for the green light population.

To begin, we miniprepped pSR43.6r (Ingalls Lab CcaS plasmid) from 5 mL of liquid culture containing LB + Sm. Duplicates of ~2 mL were prepared from the test tube and the plasmid miniprep protocol on p. 4-5 of the online lab book was followed without any deviation. Both samples were eluted using 30 µL of elution buffer, and nanodrop values were recorded:

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

CcaS 1 21.7 Weak, ragged B3

CcaS 2 33.5 Moderate, ragged B4

Next, two agarose gels were prepared in advance to verify the PCR for the photoreceptor construct, and gel extract the backbone and insert for the GFP construct. The lengths of our target fragment for the photoreceptor construct were 1.7 kb for “photo” and 2 kb for “AbxOri” (hence we decided to use 1.5% agarose for the diagnostic gel). The lengths of our desired sequences for gel extraction were 2.7 kb for the pSB3C5 “backbone” and 945 bp for the pSB1C3 “GFP insert” (hence we decided to use 1.0% agarose for this gel). The gel solution was prepared by adding the appropriate amount of agarose and TAE buffer along with gel red (guanosine was also added to the 1.0% gel to protect our DNA samples from damage by UV light).

The NEB Tm Calculator was used to estimate an appropriate annealing temperature for both of our PCR primer pairs.

AbxOri_SalI_F and Abx_Ori_XhoI_R:

Photo_XhoI_F and Photo_SalI_R:

Gradient PCR was chosen to determine the optimal annealing temperatures of our primers. The conditions for gradient PCR (using Q5 HF DNA Polymerase) were first determined:

AbxOri PCR Photo PCR

Step Temp (°C) Time Temp (°C) Time

Initial 98 30 sec 98 30 sec Denaturation

Denaturation 98 10 sec 98 10 sec

Annealing* [63, 65, 67, 30 sec [67, 68, 69, 30 sec 69, 71, 72] 70, 71, 72]

Extension 72 **50 sec 72 **45 sec

Final Extension 72 2 min 72 2 min

Hold 4 ∞ 4 ∞

*The annealing temperatures were determined based on the values estimated using the NEB Tm Calculator. We used a range of ± 5°C from the estimated temperature (to a max of 72 °C - extension temp) in order to determine the optimal annealing temperature.

**The extension times were determined based on the rate of extension by Q5 HF DNA polymerase (~ 25 sec/kb) and the length of our target sequences (1.7 kb for “photo” and 2 kb for “AbxOri”).

PCR Reaction Setup:

Component 20 µL reaction

MilliQ/Nuclease-free water 7 µL

10 µM Forward Primer 1 µL

10 µL Reverse Primer 1 µL

Template DNA 1 µL (diluted to 1 ng/µL)

Q5 2X HF Master Mix 10 µL

Gradient PCR Thermocycler Setup:

Tube (AbxOri samples) Temperature (°C) Tube # (Photo samples)

A 72.0 7

B 71.7 6

C 71.2 5

D 70.4 4

E 69.5 3

F 68.8 2

G 68.3 1

H 68.0 ---

7 photo samples and 8 AbxOri samples were prepared along with two negative controls - no primer (NP) and no template (NT) for both reactions. The thermocycler was set to run using the conditions stated on the previous page. Once finished, the samples were run on a 1.5% agarose gel @ 80 V for 53 minutes.

The above gel indicates that our PCR was successful; a single sharp band can be seen for samples at the optimal annealing temperatures, and no bands are visible for the negative controls. The optimal annealing temperature for photo primers was determined to be 71°C (average of samples 4, 5, 6 & 7) and the optimal annealing temperature for AbxOri primers was determined to be 68°C (average of samples F & G).

Samples 4, 5, 6 & 7 (photo) and F & G (AbxOri) were selected for further experimentation. The PCR fragments were cleaned up using the Monarch PCR & DNA Cleanup Kit Protocol (NEB #T1030), and nanodrop values were recorded:

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

PCR Photo Tube 4 47.9 Smooth, high B5

PCR Photo Tube 5 24.4 Little ragged, moderate B6

PCR Photo Tube 6 14.1 Ragged, low B7

PCR Photo Tube 7 68.0 Smooth, high B8

PCR AbxOri Tube F 27.8 Smooth, moderate B9

PCR AbxOri Tube G 26.2 Little ragged, moderate C1

These nanodrop values are lower than expected, but (hopefully) good enough to proceed with restriction digestion and ligation; tubes 4/7 and F/G will be used because they contain a higher concentration of our desired fragments.

Restriction Digests for GFP Construct:

pSB3C5 Backbone (Sample B1) pSB1C3 Insert (Sample G2)

Component 50 µL reaction Component 50 µL reaction

Nuclease-free water 38 µL Nuclease-free water 29 µL

10X NEB Buffer 3.1 5 µL (1X) 10X NEB Buffer 3.1 5 µL (1X)

DNA Sample *1 µg = 5 µL DNA Sample *1 µg = 14 µL

XbaI 1 µL XbaI 1 µL

PstI 1 µL PstI 1 µL

*The volume of DNA to be added was calculated based on the concentration of DNA (see nanodrop values on p. 26).

Samples were incubated at 37 °C for 1 hour, and then run on a 1.0% agarose gel @ 80 V for 1 hour.

The circled fragments (cut backbone and insert) were gel extracted using the Monarch DNA Gel Extraction Kit Protocol (NEB #T1020), and nanodrop values were recorded:

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

pSB3C5 Backbone 17.7 No peak at @ 260 C2

pSB1C3 Insert 426.4 Sharp peak @ 240 C3 (GFP) and drop @ 260

These nanodrop values are not reliable to proceed with ligation, so we are planning to re-do the digestion and gel extraction at a later time with new samples B1 (N) and G1 (N) which were miniprepped by Ray on July 24, 2018. Nanodrop values for the new samples are as follows:

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

B1 (N) - pSB3C5 161 Smooth, very high B1

G1 (N) - pSB1C3 57.3 Smooth, little broad B2

Measurement - Testing M9-met for met contamination

Sebastien Carman

July 23, 2018 - July 24, 2018 Sebastien Carman’s lab book, page 7

- Completed innoculations according to the following table - M9-met media and methionine used were the same as used in July 19-20 (refer to Sebastien Carman’s lab book pg 3-6) - Strain #447 was out of the -80 freezer for ~3 minutes - (+) was also done for comparison to July 19-20 results - Tubes placed in 37C shaker at ~20:10 July 23, 2018 - Tubes removed from 37C shaker at ~10:10 July 24, 2018 and ODs taken

Control Components Results

Experimental → 5mL M9-met OD = 0.078 → 5µL KM → Empty JT2 (strain #447) innoculation

(+) → 5mL M9-met OD = 0.837

→ 5µL KM → Empty JT2 (strain #447) innoculation → 250 µL methionine

(-) → 5mL M9-met OD = 0.006 → 5µL KM → 250 µL methionine

Discussion This indicates a change in OD of 0.837 - 0.078 = 0.759 with the addition of met (between Exp and (+)). During the July 19/20 experiments tubes 1 & 3 yielded an OD difference of 0.532 and tubes 6 & 7 an OD difference of 0.753 with similar differences in conditions, the addition of met. These results lead to the belief that there was slight methionine contamination in our M9-met media. Lower amounts of observed growth in the Exp and (+) tubes in this experiment versus the July 19/20 experiment are likely due to a shorter growth time.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 30 July 23, 2018 ● Helped the Interlab Study Team perform serial dilutions ● Prepared 2 L of LB agar with the following recipe (following protocol): ○ 10.00 g of yeast extract ○ 20.00 g of tryptone ○ 10.00 g of sodium chloride (NaCl) ○ 2 g of glucose ● Since there are 20 g of agar added to 1000 mL of deionized water, 40 g of agar will be added to 2000 mL of deionized water ● Since there will be 2 g of agar in each bottle containing 100 mL of LB solution, there will be approximately 20 bottles of LB agar prepared

Interlab - Counting Colonies

Marina Robin & Amanda Kuang

July 24, 2018

Refer to Marina Robin’s lab book, p. 6 Results:

Labelled Plate Number of Colonies 1A1 -3 31

1A1 -4 6 1A1 -5 3 1A2 -3 29 1A2 -4 0 1A2 -5 2 1A3 -3 57 1A3 -4 0 1A3 -5 0 1B1 -3 25 1B1 -4 3 1B1 -5 1 1B2 -3 20 1B2 -4 3 1B2 -5 1

1B3 -3 16 1B3 -4 2 1B3 -5 0 2A1 -3 101 2A1 -4 16 2A1 -5 1 2A2 -3 42 2A2 -4 12 2A2 -5 0 2A3 -3 99 2A3 -4 7 2A3 -5 1 2B1 -3 56 2B1 -4 7 2B1 -5 0 2B2 -3 87 2B2 -4 11 2B2 -5 2 2B3 -3 65 2B3 -4 2 2B3 -5 0

Construction - Digestion and Ligation of Photoreceptor and AbxOri PCR Products

Nicole Wang

July 25, 2018 Refer to Nicole Wang’s lab book, p. 15

Purpose ● Digest PCR products from July 22, 2018 with SalI and XhoI to create sticky ends ● Re-ligate these PCR products together to create the photoreceptor construct with SpR and p15A (aka. Reproduce plasmid pSR43_6 but without the CcaS gene)

Sample Name Concentration (ng/uL) Length (bp)

Photo 7 68 1734

Abx Ori F 27.8 2017

Digest Followed Restriction Digest protocol without any deviations ● Used Digest and Ligation Calculator ● Digested ~500 ng of DNA ● Incubated for 1 h at 37°C

Reagent Photo 7 (uL) Abx Ori F (uL)

DNA 7.35 18

SalI 0.5 0.5

XhoI 0.5 0.5

NEB 3:1 Buffer 2 2 milliQ H2O 9.65 0

Total Volume 20 21

DNA Cleanup Followed DNA/PCR purification protocol without any deviations ● Eluted 10 uL

Nanodrop

Sample Concentration 260/280 260/230 (ng/uL)

Photo 7 37.6 1.69 1.29

Abx Ori F 37.3 1.81 1.60

Ligation Followed Ligation protocol and used the Digest and Ligation Calculator with the following deviations: ● Incubated at room temperature for 25 min (Thermo Fisher’s T4 DNA Ligase User Guide protocol suggested 10 min at room temperature) ● Inactivated enzyme at 65°C for 10 min according to Thermo Fisher User Guide ● Used a 1:1 ratio of “insert”:”vector”

Sample 1:1 ratio (uL) No Ligase Control

Vector (Photo 7) 2.66 2.66

Insert (AbxOri) 3.14 3.14

10x Ligase Buffer 1 1

T4 DNA Ligase 1 0 milliQ H2O 2.2 3.2

Total Volume 10 10

Construction - Transformation of photoreceptor into DH5alpha

Dean Stipanic

July 26, 2018 Refer to Dean Stipanic’s lab book, p. 8

Followed heat shock transformation protocol without any deviations ● Plated sample with photoreceptor and no ligase control on sp plate ● Streaked both samples on LB plate

Measurement - Growth Rate Measurement of JT2 with CcaS/R v2.0

Max Reed

July 27, 2018 Refer to Nathan Braniff’s lab book (in the Ingalls Lab)

Alright so this experiment was a bit of a mess and it was sort of half for iGEM and half for the Ingalls lab so I didn’t write it in here for but now I am doing it because why not.

This was a test of my protocol for measuring growth rates of bacteria containing CcaS/R. CcaS/R has a response time of 6-10 hours, if you define response time as the time it takes to get steady-state concentration of the promoter product. Therefore, the bacteria should be held under constant light for several hours before the experiment begins (especially in iGEM’s case because the promoter product affects growth rate, which is what we are measuring).

The plan is such: grow a tube of bacteria in the turbidostat, while holding the OD at a certain threshold (the turbidostat does that by repeatedly diluting the sample in it when its OD exceeds the designated threshold). Then, after a long time, dilute the bacteria to a low OD and let them grow while measuring growth rate.

I had four samples. One’s pump failed so it’s OD got super high and I cancelled that experiment. One I accidentally set at a threshold that was too high so I cancelled that one too. One got a contaminated feed line, which messed up everything. Only one actually worked. Only one. It was JT2 with CcaS/R v2.0 grown under red light (2000/4095 red and 0/4095 green as per the turbidostat’s intensity settings) in complete M9. Its growth rate should give a maximum estimate of the growth rate of JT2 with CcaS/R v2.0 in M9. Sort of. Anyway here is the data for its OD:

TIME 7:13 7:37 8:08 8:24 8:54

OD 0.063 0.109 0.174 0.228 0.348

The first point kind of looks like an outlier but if you plot the log base 2 of the rest in excel, set a line of best fit, and then take the inverse of its slope, you get a doubling time of 45.7 minutes, which makes sense given that the reported “best doubling rate” of JT2 with CcaS/R in it is ~50 minutes.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 30 July 27, 2018 ● Prepared LB agar plates ● Made Spectinomycin (Sp) and Chloramphenicol (Cm) agar plates by adding 100 µL of Sp antibiotic into a bottle of 100 mL of molten LB agar and by adding 100 µL of Cm antibiotic into a completely different bottle of 100 mL of molten LB agar, respectively ○ These plates will have to be tested

Construction - Digestion and Ligation of psB3C5 and psB1C3

Nicole Wang, Nicki Shaw

July 29, 2018 Refer to Nicki Shaw’s lab book, p. 15-16

Purpose ● Digest pSB3C5 and pSB1C3 with PstI and XbaI, gel extract GPF cassette from pSB1C3 (smaller fragment) and backbone from psB3C5 ● If gel ran correctly: cleanup and re-ligate to create the GFP construct with CmR and p15A ori

Sample Concentration (ng/µL)

B1 - pSB3C5 186.5

G1 and G2 - pSB1C3 73.1

Digest Followed Restriction Digest protocol with the following recipe deviations: There was not enough G1 and G2 combined to perform the proper recipie uL reagents B1 G1 G2

DNA 5.4 8 1.8

XbaI 1 1

PstI 1 1

NEB 3% Buffer 5 2 mQH2O 37.6 24.4

Total Volume 50 50

After the 1% Gel was run (with psB3C5 in wells 2-3 and psB3C3 in wells 5-6) no product was found in for psB3C5, the original sample used was accidentally the diluted version.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 30 July 31, 2018 ● Made Kanamycin (Km) agar plates by adding 100 µL of Km antibiotic into a bottle of 100 mL of molten LB agar ● Tested the Cm, Sp, (made July 27) and Km (made July 31) plates ○ Used Strain #109 as a negative control for all plates ○ Cm: Positive control was Strain #115, in iGEM Box 2 in the -80°C freezer ○ Sp: Positive control was Strain #257, in iGEM Box 4 in the -80°C freezer ○ Km: Positive control was Strain #111, in iGEM Box 2 in the -80°C freezer ● Prepared O/N cultures using 5 mL of LB and 5 mL of Km antibiotic in each test tube to inoculate pDusk and pDawn, in addition to a negative control ● Aseptically streaked DH5alpha Strain #108 from frozen stock using a sterile wooden inoculating stick onto LB plate to get isolated colonies so competent cells could be made from a fresh plate

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 31 August 1, 2018 ● Prepared 2 L of LB media ● All the plates that were prepared last week and this week (Cm, Sp, Km) and tested yesterday were found to produce the expected results of growing the positive controls and inhibiting the negative controls from growing ● Aseptically streaked DH5alpha from LB plate in fridge that was originally streaked on June 19 ● Aseptically streaked pDusk (E. coli DH10B) and pDawn (E. coli BL21(DE3)) onto a Km plate from the overnight culture that had been prepared yesterday to get isolated colonies

Construction - Digestion and Ligation of psB3C5 and psB1C3

Dean Stipanic, Nicole Wang and Caleb

August 1, 2018 Refer to Dean Stipainc’s lab book, p. 9

Purpose ● Digest pSB3C5 and pSB1C3 with PstI and XbaI to create sticky ends ● Perform gel extraction and gel cleanup of insert(pSB1C3) and vector(pSB3C5) ● Re-ligate these products together to create the GFP construct with CmR and p15A ori

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

B1 (N) - pSB3C5 161 Smooth, very high B1

G1 (N) - pSB1C3 57.3 Smooth, little broad B2

Digest Followed Restriction Digest protocol without any deviations

Restriction Digests for GFP Construct:

pSB3C5 Backbone (Sample B1(N)) pSB1C3 Insert (Sample G1(N))

Component 25 µL reaction Component 25 µL reaction

Nuclease-free water 14.3 µL Nuclease-free water 3 µL

10X NEB Buffer 3.1 2.5 µL (1X) 10X NEB Buffer 3.1 5 µL (1X)

DNA Sample *1 µg = 6.2 µL DNA Sample *1 µg = 17.5 µL

XbaI 1 µL XbaI 1 µL

PstI 1 µL PstI 1 µL

Gel Extraction - Used 1% gel based on the size of the insert (900bp) and the backbone (2700bp) - Removed the inset band and the backbone band - Preformed cleanup protocol with no deviations Nanodrop

Sample Concentration (ng/µL) Description of Peak @ 260 nm

B1 (N) - pSB3C5 17.5 Smooth, high

G1 (N) - pSB1C3 21.8 Smooth, high

Ligation

- Followed ligation protocol with no deviations - Used ligation calculator in order to determine the values below

Vector + Insert No Insert No Ligase pSB3C5(vector) 5.71 5.71 5.71 pSB1C3(insert) 4.69 0 4.69

10x Ligase Buffer 1 1 1

Ligase 1 1 0

MilliQ Water 0 4.69 1

- Left ligation overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 31 August 3, 2018 ● Prepared overnight culture of Strain #397 from glycerol stocks using 5 mL of LB and 5 mL of Amp antibiotic in test tube, in addition to a negative control

BioBricks - Miniprep of Overnight Cultures of pSKA397

Steven Choi, Amanda Kuang

August 4, 2018 Refer to Steven’s Lab Book page #1

Purpose ● Overnight cultures were made from the frozen stocks of pSKA397 ● Miniprep was then conducted to isolate DNA from overnight cultures

Sample Concentration Description of -20 Freezer Box

(ng/µL) Peak @ 260 nm Position

pSKA397 #1 96.3 Smooth, very high BioBricks Row 1, #1

pSKA397 #2 90.1 Smooth, very high BioBricks Row 1, #2

pSKA397 #3 94.4 Smooth, very high BioBricks Row 1, #3

pSKA397 #4 104.9 Smooth, very high BioBricks Row 1, #4

BioBricks - PCR Attempt 1 of Miniprepped pSKA397 plasmid with MetE-F and MetE-R primers (#5 and #6 clear tubes in Primer 2018 box)

Steven Choi

August 4, 2018 Refer to Steven’s Lab Book page #2

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 4 samples with 1 negative control

Reagent Per reaction (in uL) Negative Control (in uL)

Forward Primer (10 μM) 1 1

Reverse Primer (10 μM) 1 1

Taq/Q5/Phusion Master Mix 10 10

Sterile, nuclease-free water 7 8

DNA (pSKA397 #4) 1 --

Total Volume 20uL 20uL

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 30 sec denaturation

denaturation 95 15-30 sec (20 sec)

annealing 64* 15-60 sec (45 sec) 30X extension 68 1 min/kb (2.25 minutes for MetE; thus 2 minutes and 15 seconds)

1x Final 68 5 min extension

1x hold 4 Infinity

* annealing temperature depends on the primers you’re using.

Forward: 5’ GCCGCTTCTAGatgacaatattgaatcacaccctcg 3’ Tm = 63.6ºC Reverse: 5’ AGCGGCACTAGTAATAATccccgacgcaagttctgc 3’ Tm = 67.1ºC

Concentration of primer = 10uM → 10,000nM

Construction -cPCR check of transformed photoreceptor products

Nicki Shaw

August 4, 2018 Refer to Nicki Shaw’s lab book, p. 17-19

Purpose ● Ran colony PCR to check that a full Abx Photo photoreceptor plasmid was transformed into DH5a (by Dean and Nicole)

PCR Followed PCR protocol without any deviations except 1uL colonies were taken from streaked plate.

Thermocycler procedure: Q5 2X HF MM

Cycles Step Temp (in C) time

1x Initial 98 5 min denaturation

1x Initial 98 30 sec denaturation

denaturation 98 10 sec

annealing 71 30 sec 30X extension 72 45 sec

1x Final 72 2 min extension

1x hold 4 Infinity

Gel Ran on 1% gel (5uL of ladder (2xquickload and mix of 3uL loading dye+1uL water+2uL sample) at 80V for 1 hours.

Conclusion: Next time use less loading dye maybe. Also there was a band for the positive control (original photo PCR product from gradient PCR -tube 6) and none for the negative control. There were bands for samples 1 and 5 close to the level of the positive control.

BioBricks - Diagnostic Gel of PCR’d pSKA397 using MetE-Forward and MetE-Reverse Primers (#5 and #6) Steven Choi

August 4, 2018 Refer to Steven’s Lab Book page #3

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 4 samples with 1 negative control

1% agarose gel (50mL) run at 80V for 1 hour

Lane #1 = Ladder

Lanes #2-5 = Samples #1 - #4

Lane #6 = Negative Control

Suggestions from Leah and Clara: ● To run another PCR, by first diluting the miniprepped samples to 1ng/uL

BioBricks - Re-Nanodrop of Miniprepped Samples #1-4

Steven Choi, Nicole Lassel

August 7, 2018 Refer to Steven’s Lab Book page #4

Purpose ● Re-nanodropped miniprepped samples prior to making dilutions for PCR

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

pSKA397 #1 127.9 Smooth, very high BioBricks Row 1, #1

pSKA397 #2 118.0 Smooth, very high BioBricks Row 1, #2

pSKA397 #3 112.4 Smooth, very high BioBricks Row 1, #3

pSKA397 #4 127.5 Smooth, very high BioBricks Row 1, #4

BioBricks - Dilution of Miniprepped Samples #1-4

Steven Choi, Nicole Lassel

August 7, 2018 Refer to Steven’s Lab Book page #4

Purpose ● Diluted miniprepped samples to 1ng/uL for PCR preparation ● Added 5.0uL of original sample to [(Initial concentration -1) x 5] volume of sterile water

Sample Concentration Volume After -20 Freezer Box (ng/µL) Dilution Position

Diluted pSKA397 #1 ~1.0 640uL BioBricks Row 3, #1

Diluted pSKA397 #2 ~1.0 590uL BioBricks Row 3, #2

Diluted pSKA397 #3 ~1.0 560uL BioBricks Row 3, #3

Diluted pSKA397 #4 ~1.0 640uL BioBricks Row 3, #4

BioBricks - PCR Attempt 2 of Diluted pSKA397 with MetE-F and MetE-R primers (#5 and #6 clear tubes in Primer 2018)

Steven Choi

August 7, 2018 Refer to Steven’s Lab Book page #5

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 6 samples with 2 negative controls

Reagent Per reaction (in uL) Negative Control - Negative Control - without DNA without primers (in (in uL) uL)

Forward Primer (10 1 1 -- μM)

Reverse Primer (10 1 1 -- μM)

Taq/Q5/Phusion 10 10 10 Master Mix

Sterile, 7 8 9 nuclease-free water

DNA (pSKA397 #4) 1 -- 1

Total Volume 20uL 20uL 20uL

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 30 sec denaturation

denaturation 95 15-30 sec (20 sec)

annealing 59-64* 15-60 sec (45 sec) 30X extension 68 1 min/kb (2.25 minutes for MetE; thus 2 minutes and 15 seconds)

1x Final 68 5 min extension

1x hold 4 Infinity

* Gradient PCR between 59-64ºC was used to determine optimal annealing temperature

Forward: 5’ GCCGCTTCTAGatgacaatattgaatcacaccctcg 3’ Tm = 63.6ºC Reverse: 5’ AGCGGCACTAGTAATAATccccgacgcaagttctgc 3’ Tm = 67.1ºC

BioBricks - Diagnostic Gel of PCR’d Diluted pSKA397 using MetE-Forward and MetE-Reverse Primers Steven Choi

August 7, 2018 Refer to Steven’s Lab Book page #6

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 6 samples with 2 negative controls

1% agarose gel (50mL) run at 100V for 45 minutes

Suggestions from Leah and Clara: ● To run another PCR gradient with temperatures ranging from 64ºC - 69ºC ● Also check that the next PCR attempt doesn’t have a band in the No DNA (-) control ● To continue with digestion for the PCR product that had an annealing temperature of 64ºC

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 31 August 7, 2018 ● Prepared O/N cultures using 5 mL of LB and 5 mL of Km antibiotic in each test tube to inoculate pDusk and pDawn, in addition to a negative control ● Prepared O/N culture of pSB1C3 (Strain #346, iGEM Strain Box 5) using 5 mL of LB and 5 mL of Chloramphenicol antibiotic ● Placed all prepared test tubes in the shaking incubator at 37°C overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 31 August 8, 2018 ● Made frozen glycerol stocks using the O/N cultures of pDusk and pDawn that had been prepared yesterday ● Added 500 µL of overnight culture to 500 µL of filter-sterilized 50% glycerol in sterile screw-cap 2 mL tubes and gently mixed before putting in the -80°C freezer ○ The E. coli DH10B; pDusk for RFP in dark; Kanamycin resistance were labelled as 459 and 460 (placed in iGEM Box 7) and 463 and 464 (placed in iGEM Box 7 Backup) ○ The E. coli BL21(DE3); pDawn for RFP in light; Kanamycin resistance were labelled as 461 and 462 (placed in iGEM Box 7) and 465 and 466 (placed in iGEM Box 7 Backup) ● Inoculated DH5alpha colony from plate streaked on July 31 into test tube with 5 mL of LB for making competent cells ● Nicki Shaw inoculated pSB3C5 from iGEM Box 1 (or iGEM 2018 Box) ● All prepared test tubes were placed in shaking incubator at 37°C overnight

BioBricks - Miniprep of Overnight Cultures of pSB1C3

Steven Choi

August 8, 2018 Refer to Steven’s Lab Book page #7

Purpose ● Overnight cultures were made from the frozen stocks of pSB1C3 ● Miniprep was then conducted to isolate DNA from overnight cultures

Sample Concentration Description of -20 Freezer Box (ng/µL) Peak @ 260 nm Position

pSB1C3 #1 127.8 Smooth, slightly tall BioBricks Row 5, #1

pSB1C3 #2 103.6 Smooth, very high BioBricks Row 5, #2

pSB1C3 #3 124.6 Smooth, very high BioBricks Row 5, #3

pSB1C3 #4 107.4 Smooth, not tall BioBricks Row 5, #4

BioBricks - PCR Cleanup of Isolated MetE Gene (from the day before - August 7th)

Steven Choi

August 8, 2018 Refer to Steven’s Lab Book page #8-9

Purpose ● PCR cleanup was conducted on the product arising from the annealing temperature of 64ºC

Sample Concentration (ng/µL) Description of Peak @ 260 nm

MetE 21.7 jagged, broad

BioBricks - PCR Attempt 3 of Diluted pSKA397 with MetE-F and MetE-R primers (#5 and #6 clear tubes in Primer 2018)

Steven Choi

August 9, 2018 Refer to Steven’s Lab Book page #10

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 6 samples with 2 negative controls

Reagent Per reaction (in uL) Negative Control - Negative Control - without DNA without primers (in (in uL) uL)

Forward Primer (10 1 1 -- μM)

Reverse Primer (10 1 1 -- μM)

Taq/Q5/Phusion 10 10 10 Master Mix

Sterile, 7 8 9 nuclease-free water

DNA (pSKA397 #4) 1 -- 1

Total Volume 20uL 20uL 20uL

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 30 sec denaturation

denaturation 95 15-30 sec (20 sec)

annealing 64-69* 15-60 sec (45 sec) 30X extension 68 1 min/kb (2.25 minutes for MetE; thus 2 minutes and 15 seconds)

1x Final 68 5 min extension

1x hold 4 Infinity

* Gradient PCR between 64-69ºC was used to determine optimal annealing temperature

Forward: 5’ GCCGCTTCTAGatgacaatattgaatcacaccctcg 3’ Tm = 63.6ºC Reverse: 5’ AGCGGCACTAGTAATAATccccgacgcaagttctgc 3’ Tm = 67.1ºC

BioBricks - Diagnostic Gel of PCR’d Diluted pSKA397 using MetE-Forward and MetE-Reverse Primers Steven Choi, Amanda Kuang, Nicole Lassel

August 9, 2018 Refer to Steven’s Lab Book page #11

Purpose: ● To isolate and amplify the MetE gene from pSKA397 plasmid ● 6 samples with 2 negative controls

1% agarose gel (50mL) run at 100V for 45 minutes

Notes: ● The band produced from the annealing temperature of 68ºC was determined to be the “optimal annealing temperature”, and was thus used for further experiments

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 32-33 August 9, 2018 ● Followed the protocol for preparing CaCl2 Competent Cells that had previously worked before (that had been followed on July 15) ● Deviations from this protocol are as follows:

1. Streak purify DH5a on LB-agar plate, no antibiotics. Incubate o/n at 37°C (12-16hrs). a. The DH5a plate had been streaked on July 31, 2018 and so a colony was picked and used from this plate and inoculated into the 5mL of LB on August 8, 2018 2. Inoculate one colony from the plate into 5mL liquid LB w/ no antibiotics. a. **It might be wise to try and inoculate into other 5mL liquid LB tubes if your colony was big enough to inoculate more than just the no antibiotic 5mL LB culture. b. 1 test tube with a single colony of DH5a was inoculated, in addition to 1 negative control test tube on August 8, 2018 c. In the morning of August 9, 2018, the tubes were checked; the negative control did not grow, and the DH5a tube did

3. Autoclave 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, 50mL of 0.085M CaCl2, a GSA bottle, and 250mL liquid LB. Filter sterilize 50% glycerol in MilliQ. a. These chemicals had been previously prepared 4. Inoculate the 5mL culture w/ no antibiotics into 250mL liquid LB w/ no antibiotics and grow to OD 0.4-0.5 in 37°C, checking using the UV-Spec with 1mm cuvettes. ○ With aseptic technique, 250mL of LB was measured using a sterile Falcon tube and poured into a 500mL flask ○ Gently agitated the tube of DH5alpha and then added the entire 5mL into the flask containing 250mL of LB ○ Put into shaking incubator at 37°C at 1:25am ○ Checked the OD600 at 2:40pm for a reading of 0.092 ○ Checked the OD600 at 3:15pm for a reading of 0.159 ○ Checked the OD600 at 3:40pm for a reading of 0.266 ○ Checked the OD600 at 4:00pm for a reading of 0.387 ○ Checked the OD600 at 4:10pm for a reading of 0.412 9. Transfer the 250mL culture at the end of the incubation into the GSA bottle and refrigerate for 20mins at 4°C to stop the growth. a. **It might be wise to put the culture in the GSA bottle into the -20°C freezer for 5mins to stop the growth asap. b. Placed culture in original flask on ice for 20 minutes c. After 26 minutes on ice, the contents of the flask were transferred to 5 Falcon tubes d. A Falcon tube filled with 50 mL of water was used as a balance in the centrifuge 10. Pellet the culture using the centrifuge: 3K RPM, 10min, 4°C and decant the supernatant. a. Prechilled centrifuge to ~4°C and then added the 6 Falcon tubes b. Set the centrifuge for the parameters above and spun the samples c. Ran the centrifuge for an additional 10 minutes to encourage more pelleting

11. Resuspend in 125mL 0.1 M MgCl2 using a pipette to vigorously break apart the aggregates. Incubate this solution at 4°C for minimum 30min up, but better if over 1hr. a. Used a total of 125 mL 0.1 M MgCl2, so that each of the 5 Falcon tubes had 25 mL each b. Resuspended the cells in the tubes with Steven

c. Cells incubated in 0.1 M MgCl2 on ice in the fridge for 1 hour and 10 minutes 12. Repeat step 6 (step 10 here), with centrifugation for a total of 20 minutes, followed by centrifugation with the same parameters for another 20 minutes since tubes had virtually no pelleting seen

13. Resuspend in 200mL 0.1M CaCl2 using a pipette to vigorously break apart the aggregates. a. Attempted to split the 200 µL between the 5 tubes b. Made a mistake by mixing up tubes with 25 mL of MgCl2 and 25 mL of caCl2, so threw away those tubes and used the remaining 3 tubes to hold 50 mL each c. Thus, instead of using 200 mL, used a total of 150 mL CaCl2 between the 3 Falcon tubes to help make the cells more concentrated (and because the Falcon tubes only held 50 mL each) 14. Incubate this solution at 4°C o/n (12-16hrs). a. Incubated from 8:15 pm until 11:30 am the following day

Measurement - Inoculation of JT2 Ccas/Ccar, Empty JT2

Poonam Furmah August 9, 2018 Refer to Poonam’s Lab Book page #15

Inoculated JT2 Ccas/Ccar and Empty JT2 (447) according to Inoculation protocol in Online Lab Book. Used 3 mL of LB, and the following antibiotics according to specific strain:

JT2 Ccas/Ccar Empty JT2

KM (1 uL) KM (1 uL) CM (1 uL) SP (1 uL)

These samples were then left in the shaker at 37 degrees, and will be used tomorrow to conduct the methionine experiment once more.

Construction - Inoculating pSB1C3 with GFP

August 9, 2018 Refer to Nicole Wang’s Lab Book page #20

-inoculated strain #346 (GFP in pSB1C3) and

Spring 2018 Co-op: Nicole Lassel’s Lab Notes

Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 33 August 10, 2018 ● Completed the protocol for the competent cells, as described below 15. Repeat step 6 (step 10 here). a. Centrifuged for 20 minutes to get proper pelleting b. Spun for additional 15 minutes to ensure proper pelleting 16. Resuspend in 5mL 15% Glycerol - 0.085 CaCl2 using a pipette to vigorously break apart the aggregates. 17. Aliquot 100µLinto ~50 1.5mL microfuge tubes and freeze at -80°C. a. Thought the protocol said not to, the tubes were flash-frozen using liquid nitrogen and then place in the -80°C in a freezer box ● Prepared and ran a gel using gradient samples that Steven had prepared ○ To prepare the gel, used 0.5008 g of agarose, 5 µL of Gel Red, and 50 mL of 1X TAE ○ Planned to load the gel in the following order: DNA Ladder // 64°C // 65°C // 66°C // 67°C // 68°C // 69°C // DNA Negative Control // Primer Negative Control // DNA Ladder ○ Loaded the samples by mixing together 1 µL of DNA sample, 4 µL of sterile water, and 1 µL of loading dye on a piece of parafilm (note that there may have been some evaporation for the first 5 samples since there was an interruption before they were loaded) ○ Ran the gel at a rate of 80V for 1 hour ○ The gel was imaged, and the printed image was placed in Steven’s notebook

● Miniprepped pSB1C3 (with GFP) and pSB3C5 (with RFP) for Nicole Wang for Construction according to the Plasmid Miniprep protocol with the following deviations: ○ Used 2 mL of O/N culture of each sample and pelleted for 1 minute in the first step ○ In Step 5, pelleted for 4 minutes ● Nanodropped the samples following the miniprep ○ pSB1C3 had a concentration value of 20.0 ng/µL (low peak) ○ pSB3C5 had a concentration value of 47.8 ng/µL (relatively high peak) ● Stored the samples in the fridge for Nicole Wang for Construction

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 34 August 11, 2018 ● Tested competent cells prepared yesterday following protocol from iGEM Competent Cell test kit with the following deviations: ● DEVIATION: Following this incubation period spun the microcentrifuge tubes in the centrifuge for 1 minute at a speed of 13,000 rpm ● Following the centrifugation, removed 800 µL of the media and then resuspended the cells on the walls of the tubes in the remaining 200 µL of LB media

○ This was to help ensure that the number of cells was high, and that the best possible results could be obtained ● Plated 150 µL of the resuspended cells in media onto Cm agar plates ○ This was done in triplicates for the concentrations of 50 pg/mL and 100 pg/mL plasmid DNA transformed in the cells ● Using sterile inoculating wooden sticks, streaked some liquid from the final triplicate of 50 pg/mL and 100 pg/mL onto LB agar, to see if cells would grow

Measurement - OD Measurement for Methionine Sharing Experiment

Max Reed August 11, 2018 Refer to Max’s Lab Book page #11

These are the ODs of the tubes for the methionine sharing experiment that Poonam set up on August 10th. The ODs were taken at 10:25 am and the blank was tap water (should have the same OD as our medium). Results are as follows:

Test Tube # Control Components Results

1 Experimental → M9 - met with OD = 0.010 CcaS/R v2.0 JT2 removed (3 mL) → Empty JT2 (50 µL)

2 + → M9 - met with OD = 0.820 CcaS/R v2.0 JT2 removed (3 mL) → CcaS/R v2.0 JT2 (50 µL)

3 + → M9 - met with OD = 0.799 CcaS/R v2.0 JT2 removed (3 mL) → Empty JT2 (50 µL) → Met (150 µL)

4 - → M9 - met with OD = -0.011 CcaS/R v2.0 JT2 removed (3 mL)

5 - → Stock M9 - met (3 OD = 0.004 mL)

→ Met (150 µL)

6 - → Stock M9 - met (3 OD = 0.005 mL) → Empty JT2 (50 µL)

7 + → Stock M9 - met (3 OD = 0.812 mL) → Empty JT2 (50 µL) → Met (150 µL)

Construction - GFP construct

Nicki Shaw, Nicole Wang, Caleb Innes August 12, 2018 Refer to Nicki’s Lab book page # 20-22

Transforming the GFP cassette from psb1C3 into the backbone of psb3C5

Digestion:

1% gel for extraction (with a pinch of guanosine) Extracted 0.945 kb band from psB1C3 (lower/smaller) and 2.7kb band from psb2c5 (higher/larger).

Extract Weights: Part Weight Binding Buffer Volumes psb3C5 0.11g 440uL psb1C3 0.10g 400uL

Biopricks part 0.10g 400uL

Followed Gel Extraction Protocol

Nanodrop Values

Part Concentration (ng/uL) 260/280 260/230 psb3C5 36.0 4.02 0.44 psb1C3 19.9 3.29 0.07

Biopricks part 2.05 2.05 0.21

Ligation recipe

There was not enough sample (10uL elution) to do both controls (ul) GFP plasmid No ligase ctrl

Vector 5.03 5.03

Insert 4.86 4.86

10 Ligase Buffer 1.20 1.20

Ligase 1.00 -

MilliQ - 0.91

Total Volume 12 12

August 13th - Transformation

Transformed into DH5a cells according to the protocol, plated on Cm (GFP and no ligase) and streaked on LB with the comp. cells control. (there was not much volume to spare so this control is a little less reliable.

BioBricks - PCR Cleanup of Isolated MetE Gene (at 68ºC annealing temperature) for Subsequent Digestion

Steven Choi, Amanda Kuang, Nicole Lassel

August 12, 2018 Refer to Steven’s Lab Book page #11

Notes: ● PCR cleanup was conducted on the product arising from the annealing temperature of 68ºC ● PCR Cleanup protocol was followed as outlined in the Protocols Book ● The samples were then nanodropped to determine their concentrations for subsequent digestion, along with the miniprepped pSB1C3 #1 that was made a few days ago

Sample Concentration (ng/µL) Description of Peak @ 260 nm

MetE 16.5 Short, jagged

pSB1C3 #1 84.8 High, smooth

BioBricks - Attempt 1: Restriction Enzyme Digest of Isolated MetE and Miniprepped pSB1C3 #1

Steven Choi, Amanda Kuang, Nicole Lassel

August 12, 2018 Refer to Steven’s Lab Book page #12

Reagent MetE Sample MetE pSB1C3 pSB1C3 Tube No Enzyme Sample Tube No Enzyme (-) Control (-) Control

DNA 5uL 5uL 5uL 5uL

Xba1 1uL -- 1uL --

Spe1 1uL -- 1uL --

2.1 Buffer 2uL 2uL 2uL 2uL

H2O 1uL 3uL 3uL 3uL

Total 10uL 10uL 10uL 10uL

Notes: ● Incubated tubes at 37ºC for 1 hour ● Accidentally created 2 MetE Sample Tubes that were the same, omitting the MetE (-) Control. However, since only a few bases would be cut off from the MetE fragment from digestion anyways, we figured that there would be no striking difference between the bands formed on the gel from the MetE Sample Tube and the MetE (-) Control Tube, since they would only differ by a few bases in size

Notes: ● Subsequent Gel Extraction of the pSB1C3 fragment was then conducted by Nicole Wang, as the Construction Team had already prepared a Gel Extraction Gel and allowed us to share. ○ Gel Extraction was conducted to separate the GFP cassette band from the pSB1C3 band

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 34 August 12, 2018 ● Prepared 2 L of LB ○ 500 mL was used to make 5 bottles each with 100 mL of LB agar (and 2 g of agar) ○ 150 mL was used to make 1 bottle with 150 mL of LB agar (with 3 g total of agar) ○ The remaining LB was used to make multiple bottles of liquid LB ● Inspected plates that had been prepared yesterday to test the newest batch of competent cells ○ LB plate without antibiotic containing small streaks of 50 pg/mL and 100 pg/mL of DNA transformed into competent cells grew on the LB plate ○ The Cm plates containing cells transformed with 50 pg/mL of plasmid DNA and that had been spun down contained no colonies, except for the first triplicate having 2 red colonies ○ The Cm plates containing cells transformed with 100 pg/mL of plasmid DNA and that had been spun down contained no colonies, except for the last triplicate having 6 red colonies

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 34

August 13, 2018 ● Aseptically streaked a colony of DH5alpha Strain #108 from plate made on July 31 using a sterile wooden inoculating stick onto LB plate in order to get isolated colonies so competent cells could be made from a fresh plate

BioBricks - Attempt 1: Gel Extraction/Cleanup of Digested pSB1C3 and Cleanup of Digested MetE Gene

Steven Choi, Amanda Kuang, Nicole Lassel, Nicole Wang

August 13, 2018 Refer to Steven’s Lab Book page #13

Notes: ● Cleanup was conducted as per outlined in the Protocol Book

Sample Concentration (ng/µL) Description of Peak @ 260 nm

Cleaned Up MetE 4.4 Short, jagged

Gel extracted pSB1C3 #1 17.5 High, smooth

BioBricks - Attempt 1: Ligation of Digested pSB1C3 and MetE Gene

Steven Choi, Amanda Kuang, Nicole Lassel

August 13, 2018 Refer to Steven’s Lab Book page #14

Reagent Sample Tube No DNA (MetE) (-) No Ligase (-) Negative Control Negative Control

pSB1C3 1.67 1.67 1.67

MetE 2.5 -- 2.5

10X Ligase Buffer 1 1 1

Ligase 1 1 --

H2O 4 6.5 5

Total ~10uL ~10uL ~10uL

Notes: ● Incubated tubes at room temperature for 1 hour

● Initial Volume for pSB1C3 = 5uL ○ 5uL/3 tubes = 1.67uL per tube

● Initial Volume for MetE = 5uL ○ 5uL/2 tubes = 2.5uL per tube

BioBricks - Attempt 1: Transformation of Ligated pSB1C3 and MetE Into DH5 Alpha E.coli Cells

Steven Choi, Amanda Kuang, Nicole Lassel

August 13, 2018 Refer to Steven’s Lab Book page #15

Notes: ● Transformation was conducted per outlined in the Protocol Book ● Heat shock conducted at 42ºC for 45 seconds ● 4 CM plates + 1 LB plate were used ○ Sample CM Plate ○ No MetE (-) Control CM Plate ○ No Ligase (-) Control CM Plate ○ LB Plate (+) Control to see if cells were actually viable ● Plates were incubated at 37ºC overnight

Results: ● Sample CM Plate → 30-50 colonies ● No MetE (-) Control CM Plate → no growth ● No Ligase (-) Control CM Plate → no growth ● LB Plate (+) Control Plate → lots of growth

Everything worked as intended!

100

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 35 August 14, 2018 ● Made 1X TAE buffer using previously-made 50X TAE buffer according to the following calculation: C1V1 = C2V2 (50X)V1 = (1X)(1000 mL) V1 = 20 mL Therefore 20 mL of 50X TAE buffer was added to 980 mL of deionized water and mixed in the large jug container ● Performed a heat shock transformation according to the protocol to again test competent cells made on August 10, using miniprepped plasmid DNA samples from Ray ● Designed primers with BioBricks team ● Ran a diagnostic gel with them using a gel made from 0.5045 g of Agarose, 5 µL of Gel Red, and 50 mL of 1X TAE buffer

BioBricks - Attempt 1: Colony PCR of Transformed pSB1C3+MetE Into DH5 Alpha E.coli Cells

Steven Choi, Amanda Kuang, Nicole Lassel

August 14, 2018 Refer to Steven’s Lab Book page #15-16

Reagent Per Sample No Colony No Primers (-) Miniprepped Tube DNA (-) Negative MetE (+) (13 tubes in Negative Control Positive total) Control Control

H2O 10 10 8 9

DNA Touched -- Touched 1uL of MetE Colony Colony

MetE-F Primer 1 1 -- 1

MetE-R Primer 1 1 -- 1

Taq 2xMM 10 10 10 10

Total 22uL 22uL 22uL 22uL

Patch Plate (CM Plate):

100

101

● Each patch area consists of 5uL of H2O mixed in with each designated colony ● Patch plate was placed in 37ºC incubator

101

102

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 10 minutes denaturation

denaturation 95 15-30 sec (20 sec)

annealing 68 15-60 sec (45 sec) 30X extension 68 1 min/kb (2.25 minutes for MetE; thus 2 minutes and 15 seconds)

1x Final 68 5 min extension

1x hold 4 Infinity

* Gradient PCR between 64-69ºC was used to determine optimal annealing temperature

Forward: 5’ GCCGCTTCTAGatgacaatattgaatcacaccctcg 3’ Tm = 63.6ºC Reverse: 5’ AGCGGCACTAGTAATAATccccgacgcaagttctgc 3’ Tm = 67.1ºC

102

103

Diagnostic Gel of Colony PCR Products: ● 1% Agarose Gel 50mL ● Run at 100V for 45 minutes

Notes: ● Bands in wells #11, #12, #13 were chosen for subsequent frozen stocks and sequencing

103

104

Construction - Miniprep of CcaS/R, pDawn, MetE, GFP, and photoreceptor construct (attempt #1)

Clara Fikry

August 14, 2018 “Refer to Clara Fikry’s lab book, p.2”

Followed Plasmid miniprep protocol with the following deviations: ● Did 7 minipreps from O/N cultures prepared by Leah and I (refer to p. 11 in Leah Fulton’s lab book): ○ two for CcaS/R ○ two for pDawn ○ one for MetE ○ one for GFP ○ one for photoreceptor construct ● All centrifugations were done at 13,000xg ● Step 1: used 1mL of O/N culture, spun for 1 minute ● Step 5: spun for 3 minutes ● Step 10: eluted in 30uL elution buffer

Nanodrop: Sample DNA concentration (ng/uL) pDawn (1) 19.7 pDawn (2) 19.9

MetE 17.7

GFP 14.8

Photoreceptor construct 17.0

CcaS/R (1) 14.0

CcaS/R (2) 14.1

Low yields. Questionable graphs. Will redo. Threw out all samples (except MetE which was used as a template for positive control in Biobrick’s colony PCR).

104

105

Construction - Miniprep of CcaS/R, pDawn, MetE, GFP, and photoreceptor construct (attempt #2)

Clara Fikry

August 14, 2018 “Refer to Clara Fikry’s lab book, p.3”

Followed Plasmid miniprep protocol with the following deviations: ● Did 5 minipreps from O/N cultures prepared by Leah and I (refer to p. 11 in Leah Fulton’s lab book): ○ one for CcaS/R ○ one for pDawn ○ one for MetE ○ one for GFP ○ one for photoreceptor construct ● All centrifugations were done at 13,000xg ● Step 1: used 3 mL of O/N culture, spun for 1 minute ● Step 5: spun for 3 minutes ● Step 10: eluted in 30uL elution buffer

Nanodrop: Sample DNA concentration (ng/uL) pDawn 50.4

MetE 84.8

GFP 92.7

Photoreceptor construct 32.9

CcaS/R 60.0

Beautiful, high 260 peaks. Now samples are in 2018 box in -20°C freezer.

Construction - Transformation of CcaS/R (PAKa413) and the Photoreceptor into JT2 -

Leah Fulton (with Isaac)

Refer to “ Leah’s lab book pg 11” Aug 14

Followed Instant Comp Cell Protocol in the Protocol folder.

105

106

Cells used for transformation: JT2 (SKA974) Incubated to an OD of 4.4 Incubated on ice for 1h

I did three transformations: 1. Photoreceptor in JT2 -> plated on Sp 2. Ccas/r in JT2 -> plated on cm 3. Photoreceptor + Ccas/r -> plated on cm/Sp

Incubated the plates at 37 for 24h

Results Aug 15

To my surprise all the transformations worked. There was greater than 100 colonies on all the plates. The double transformation was less efficient. This was expected.

I confirmed that this success was not a mistake by inoculating into LB with the proper antibiotics. The bacteria grew! (I included a negative control and it did not grow :)

I then made a frozen stock of the transformants 1-3 and placed them in the iGEM2018 box in the -80 freezer.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 35 August 15, 2018 ● Made LB agar plates ● Made Chloramphenicol (Cm) agar plates by adding 100 µL of Cm antibiotic into 100 mL of molten LB agar ○ These plates will have to be tested ● Aseptically inoculated larger colonies 11, 12, 13 from BioBrick patch plate that was spotted the previous day with Amanda and Steven into separate test tubes containing 5 mL LB broth and 5 µL of Cm antibiotic ● The 3 samples and a negative control were placed in the shaking incubator at 37°C overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 35 August 16, 2018

106

107

● Using the O/N cultures 11, 12, 13 that were prepared yesterday, made glycerol stocks by adding 500 µL of culture to 500 µL of filter-sterilized 50% glycerol in sterile screw-cap 2 mL tubes and gently mixed before putting in the -80°C freezer ○ These tubes were labelled as 459, 460, and 461 in the iGEM 2018 freezer box

Construction - Miniprep of CcaS/R and CcaS/R + photoreceptor construct

Clara Fikry

August 16, 2018 “Refer to Clara Fikry’s lab book, p.3”

Followed Plasmid miniprep protocol with the following deviations: ● Did 3 minipreps from O/N cultures from Leah’s JT2 transformants (refer to p. 12 in Leah Fulton’s lab book): ○ two for CcaS/R ○ one for CcaS/R and photoreceptor construct (from co-transformation ● All centrifugations were done at 13,000xg ● Step 1: used 3 mL of O/N culture, spun for 1 minute ● Step 5: spun for 3 minutes ● Step 10: eluted in 30uL elution buffer

Nanodrop: Sample DNA concentration (ng/uL)

CcaS/R (1) 250.8

CcaS/R (2) 289.8

CcaS/R + photoreceptor contstruct 243.0

Beautiful, high 260 peaks. Now samples are in 2018 box in -20°C freezer.

Construction - Digest of PSKA413 (CcaS/R) to remove GFP (attempt #2)

Clara Fikry

August 16, 2018 “Refer to Clara Fikry’s lab book, p.4” Attempt #1 was done by Leah (see Leah’s lab book p.13-14)

107

108

Sample Amount (uL)

Ccas/R (2) (miniprep from p.3 of my lab 3.5 book)

AccI 1

XbaI 1

Cutsmart 10X Buffer 1

Sterile diH2O 3.5

Total 10

● Add ingredients in a microfuge tube, mix by tapping. ● Spin down tube for 10 seconds in the mini centrifuge ● Incubate ~ 2 hours at 37 ˚C

Samples were then run on a 0.8% (50ml) gel with guanosine at 100V for 45min. L 1 2 3 4 L

108

109

Image saved as: 2018 - 08-16 Remove GFP attempt #2 L = 2-log ladder 1 = digested CcaS/R (2) from this experiment 2 = minipreped photoreceptor construct (from DH5alpha top of p.3 Clara’s lab book; p. 69 of this lab book) 3 = minipreped Ccas/R + photoreceptor (from JT2 transformants bottom of p.3 Clara’s lab book; p. 72 of this lab book) 4= minipreped Ccas/R (2) (from JT2 transformants bottom of p.3 Clara’s lab book; p. 72 of this lab book)

Messy. Did not gel extract. The problem was probably in the miniprep (p.72 of online lab book). Will redo miniprep.

Construction - Inoculating PSKA413

Clara Fikry

August 16, 2018 “Refer to Clara Fikry’s lab book, p.5”

Inoculated PSKA413 from DH5alpha (2018 box, tube #1)

Followed Innoculation from frozen protocol with the following deviations: ● Used 10mL LB and 10uL of Cm

Construction - Miniprep of PSKA413 (CcaS/R)

Clara Fikry

August 17, 2018 “Refer to Clara Fikry’s lab book, p.5”

Followed Plasmid miniprep protocol with the following deviations: ● Did 2 minipreps from O/N culture prepared above ○ two for PSKA413 (CcaS/R) ● All centrifugations were done at 13,000xg ● Step 1: used 3 mL of O/N culture, spun for 1 minute each mL ● Step 5: spun for 3 minutes ● Step 10: eluted in 30uL elution buffer

109

110

Nanodrop: Sample DNA concentration (ng/uL)

CcaS/R (1) 49.3

CcaS/R (2) 50.1

Good, high 260 peaks. Now samples are in 2018 box in -20°C freezer.

Ran 1% (50mL) gel at 100V for 45min to check plasmid integrity.

L 1 2 3 4 5 L

Saved as: 2018-08-07 PSKA413 Mini L = 2-log ladder 1 = minipreped Ccas/R + photoreceptor (from JT2 transformants bottom of p.3 Clara’s lab book; p. 72 of this lab book)

110

111

2 = minipreped Ccas/R (2) (from JT2 transformants bottom of p.3 Clara’s lab book; p. 72 of this lab book) 3 = minipreped Ccas/R (1) (from JT2 transformants bottom of p.3 Clara’s lab book; p. 72 of this lab book) 4= minipreped Ccas/R (2) (from DH5alpha p.5 Clara’s lab book; p. 74-5 of this lab book) 5= minipreped Ccas/R (1) (from DH5alpha p.5 Clara’s lab book; p. 74-5 of this lab book)

This miniprep (lanes 4 and 5) is much better than the last. Now samples are in 2018 box in -20°C freezer.

Construction - PCR of GFP from GFP-PSB1C3 plasmid (for pDawn characterization) - Attempt #1

Clara Fikry

August 17, 2018 “Refer to Clara Fikry’s lab book, p.6-7”

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

GFP_AseI_F2 (10 μM) 1 137.5

GFP_HindIII_R2 (10 μM) 1 11

Taq 2XMaster Mix 12.5 11

Taq polymerase 0.25 2.75

Sterile, di water 9.25 101.75

Template= minipreped GFP (p.3 of Clara’s lab book; p.69 from this lab book)

● Aliquoted 25uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1uL of template to 8 tubes (the other was a no template control)

Thermocycler procedure: Taq

Step Temp time

111

112

(in C)

Initial 95 30 sec denaturation denaturation 95 30 sec annealing 52-66 30 sec extension 68 50 sec

Final 68 5 min extension hold 4 Infinity 30 cycles

1uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples were then put in the fridge. L 1 2 3 4 5 6 7 8 9

L = 2-log ladder 1-8= pcr’s with increasing annealing temperatures from 52-66°C 9= no template control (anneal T = 52°C)

No bands (ladder is there just faint sorry for not enhancing contrast). Mistakes made: I added extra Taq, not realizing the Taq MM had some in it. Also aliquoted 25uL instead of

112

113

24uL into each tube.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes BioBricks - Inoculation of BioBricked MetE Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 36 August 19, 2018 ● Inoculated Strains 459, 460, and 461 (BioBricked MetE stocks; 11, 12, 13 large colonies from the patch plate) according to Inoculation protocol in Online Lab Book ● Aseptically added 5 mL of LB to 4 test tubes (3 samples and negative control) followed by 5 µL of CM antibiotic ● Using a sterile inoculating stick for each sample, inoculated each tube ○ Negative control was inoculated with a sterile wooden inoculating stick ● The samples were then put in the shaking incubator at 37°C overnight

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 36 August 20, 2018 ● Planned the PCR with Amanda and Steven ● Performed a heat shock transformation according to the Heat Shock Transformation protocol with the following deviations ○ Used miniprepped psbC13 samples 1, 2, 3, and 4 that BioBricks had prepared ○ Following the hour incubation in 750 µL, spun down the cells for 2 minutes in the centrifuge at 13,000 RPM and then removed 600 µL from the tubes ○ Resuspended the centrifuged cells in the remaining 200 µL and removed 100 µL for plating on Cm plates ○ This was done for a total of 8 plates ○ Used sterile wooden inoculating sticks to streak short lines of each of the 8 samples from the remaining 100 µL in the microfuge tube onto a LB plate for a control check for all the samples ● Made an O/N culture of DH5alpha competent cells using 5 µL of LB and a colony from the streak plate prepared August __ 2018 ○ In addition, a negative control was prepared and placed in the 37°C shaking incubator with the O/N culture

BioBricks - Attempt 1: Preparation of BioBricked MetE Sample for Sequencing

Steven Choi, Amanda Kuang, Nicole Lassel

113

114

August 20, 2018

Reagent Per Sample No Colony No Primers (-) Miniprepped Tube DNA (-) Negative pSB1C3 (+) (15 tubes in Negative Control Positive total) Control Control

H2O 7 8 9 7

DNA 1 uL (from O/N -- 1 uL (from O/N 1uL of cultures) cultures) miniprepped pSB1C3

VF2 Primer 1 1 -- 1

VR Primer 1 1 -- 1

Taq 2xMM 10 10 10 10

Total 20uL 20uL 20uL 20uL

114

115

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 10 minutes denaturation

denaturation 95 15-30 sec (20 sec)

annealing 58, 60, 62 15-60 sec (45 sec) 30X extension 68 1 min/kb (2.56 kb for MetE; thus 2 minutes and 30 seconds

1x Final 68 5 min extension

1x hold 4 Infinity

* Gradient PCR for the temperatures of 58, 60, and 62ºC was used to determine optimal annealing temperature for VF2 and VR primers

Diagnostic Gel of Colony PCR Products: ● 50 mL, 1% Agarose Gel ● Run at 100V for 45 minutes

Suggestions from Leah and Clara:

● Positive Control of just the pSB1C3 sample didn’t work, because it wasn’t diluted to 1ng/uL (too much template → causes not enough yield)

115

116

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #1

Clara Fikry

August 20, 2018 Refer to Clara Fikry’s lab book, p.7-8

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

MetE_NdeI_F2 (10 μM) 1 11

MetE_HindIII_R2 (10 μM) 1 11

Phusion 2XMaster Mix 12.5 137.5

Sterile, di water 9.5 104.5

Template= minipreped MetE (p.3 of Clara’s lab book; p.69 from this lab book)

● Aliquoted 24uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1uL of template (MetE/ psKA397) to 8 tubes (the other was a no template control)

Thermocycler procedure: Phusion MM

Step Temp time # of (in C) cycles

Initial 98 0:30 1 denaturation denaturation 98 0:10 30 annealing 55-72 0:30 extension 72 1:10

Final 72 5:00 1 extension hold 4 Infinity 1

116

117

1uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V (by Nicki). Samples were then put in the fridge. L 1 2 3 4 5 6 7 8 9

L = ladder 1-8= pcr’s with decreasing annealing temperatures from 72-55°C 9= no template control (anneal T = 55°C)

No bands. PCR failed.

Construction - PCR of GFP from GFP-PSB1C3 plasmid (for pDawn characterization) - Attempt #2

Nicki (and Clara)

August 20, 2018 Refer to Clara Fikry’s lab book, p.8 and Nicki’s lab book p.23-24.

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 10 rxns (in uL)

GFP_AseI_F2 (10 μM) 1 10

GFP_HindIII_R2 (10 μM) 1 10

Taq 2XMaster Mix 12.5 125

MiliQ water ?? ??

117

118

Template= ???

● Aliquoted 24uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1uL of template to 8 tubes (the other was a no template control)

Thermocycler procedure: Phusion MM

Step Temp time # of (in C) cycles

Initial 98 0:30 1 denaturation denaturation 98 0:10 30 annealing 55-72 0:30 extension 72 0:30

Final 72 5:00 1 extension hold 12 Infinity 1 30 cycles

1uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples were then put in the fridge. L 1 2 3 4 5 6 7 8 9

L = ladder 1-8= pcr’s with increasing annealing temperatures from 60-72°C 9= no template control (anneal T = 60°C) No bands. Did not work.

118

119

Measurement - Metabolic Load of MetE Expression Experiment

Max Reed

August 21, 2018 See pages 12 and 13 of Max’s lab book

It has been theorized that the level of MetE expressed by JT2 (under optogenetic induction) may impose a metabolic burden on the cell, thus slowing growth. This experiment is meant to test this hypothesis.

JT2 cells containing CcaS/R v2.0 (the one from Ingalls Lab) were taken from a plate (specifically the streak plate I made on July 18th 2018 from my transformation) and incubated in complete M9 (this was made with casamino acids and NOT our amino acid mix minus methionine). By growing in complete M9, there should be no benefit to making MetE (since the cell already has access to methionine) and the only effect of its expression should be negative.

The M9 used was a bit sketchy because it was actually made with spectinomycin (Sp) and chloramphenicol (Cm) at concentrations 50 µg/mL and 25 µL/mL respectively on August 14th. It was used for an experiment and hence was at room temperature for somewhere between 24 and 32 hours, then it was put in a fridge until it was used for this experiment. We used it because we don’t have any other Sp in our lab right now and supposedly these antibiotics are pretty stable.

Four sample tubes of JT2 with CcaS/R v2.0 in M9 were made. The inoculation occurred at ~10 am, whereupon the sample tubes were put in the turbidostat (which was moved to iGEM last week because MC is closed from August 21st until August 29th). The samples were put in positions 1, 3, 10, and 11 due to the fact that the stirring motors associated with these positions more or less work properly (also all these positions are near the front of the incubator and hence easy to access). The turbidostat was set to cycle between stirring for ~40 seconds and then leaving the samples unperturbed for 2 minutes.

Light settings for the tubes were as follows:

Rack (aka position) Green LED Value Red LED Value White LED Value

1 0 4095 0

3 0 4095 0

10 4095 0 0

11 4095 0 0

119

120

As one can see, samples 1 and 3 should have CcaS/R largely inactive, while samples 10 and 11 have it largely active. If the hypothesis is correct, 10 and 11 will grow slower than 1 and 3.

The flushing OD for the turbidostat was set arbitrarily high because we never actually want it to dilute the sample (we’re just watching cells grow from a low OD to a high OD one time).

The program name was JT2_completeM9_redOrGreen and was saved to my (Max’s) computer. The program began at 10:21 am. At ~5:25 pm my laptop (which was being used to run the MatLab script that runs the turbidostat) became unresponsive so I had to restart both it and the turbidostat program. The program JT2_completeM9_redOrGreen_part2 was started at 5:30 pm.

ODs throughout the experiment are reported here:

Time OD of 1 OD of 3 OD of 10 OD of 11

2:25 pm 0.005 0.033 0.065 0.020

2:55 pm 0.010 0.053 0.039 0.037

3:25 pm 0.023 0.078 0.059 0.056

3:54 pm 0.052 0.121 0.084 0.087

4:31 pm 0.087 0.207 0.139 0.129

5:12 pm 0.178 0.321 0.232 0.217

5:35 pm 0.235 0.378 0.291 0.271

6:10 pm 0.367 0.256 * 2 0.387 0.373

6:38 pm 0.166 * 3 0.192 * 3 0.166 * 3 0.167 * 3

7:01 pm 0.188 * 3 0.215 * 3 0.188 * 3 0.190 * 3

The last few rows have ODs that were take by diluting the sample in PBS either by a factor of two or three, that is what the “times 2” and “times 3” things are all about.

Anyway, here are some graphs of the data:

120

121

For the second graph I calculated instantaneous doubling time between each set of OD values. I probably should’ve kept measuring OD for longer but I had to leave the lab eventually. Anyway, it doesn’t look like there’s much difference in growth rate but this should probably be repeated to be certain.

AND NOW PART 2 OF THE EXPERIMENT

Haha there is more now. After the experiment ended and I took the four samples out of the turbidostat I was like “hm it would be nice if I could confirm that the samples grown under

121

122 green light really do have more GFP than those grown under red light” and then I decided to do the following.

I set up the four samples in the following order on the counter: 3, 10, 1, 11

I then put my phone on the counter in front of them and delicately balanced the yellow-coloured light filter in front of its camera. I turned on the bright blue LED I got from my father’s lab, turned off the lab lights, and then started recording with my camera while running the blue LED behind the samples. Here’s a screenshot of the movie (the blue LED is of course behind the second sample from the left):

I then rearranged the order so it was from left to right 11, 10, 1, 3 and repeated the procedure.

Next, I uploaded the movies onto my computer and cropped images of the sample vials when the blue LED was directly behind them. Here is an example (from the screenshot above):

122

123

Did you know you can open images in Python and break them down into RGB values? Because you can. I did that with every image, then by going over each pixel I got the “average” RGB value for each of the 8 samples. These averages were as follows:

Tube Sample Label Red Green Blue

3 11 77.1/255 224.9/255 191.9/255

10 12 121.5/255 232.5/255 198.1/255

1 13 59.4/255 216.8/255 183.9/255

11 14 118.1/255 233.4/255 200.9/255

11 21 136.8/255 240.7/255 220.0/255

10 22 114.3/255 227.6/255 200.5/255

1 23 61.0/255 207.2/255 178.7/255

3 24 66.6/255 209.0/255 179.7/255

It seems like the samples that are supposed to be highly fluorescent (10 and 11, which were grown under green light) are indeed distinguishable! They are most clearly brighter in the red column, maybe because there is probably basically no red derived from the blue light source (it does still give off a bit of green light, which may help saturate the green values). Anyway, the python program I used to find the above values is called “greenFluorescenceQuantifier.py” and it’s on our GitHub in the models folder.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Pages 36-37 August 21, 2018 ● Analyzed the competent cells that had been plated yesterday

123

124

○ Appears that the competent cells are not growing from the most recent batch which had been prepared on August __ ○ Thus, will use the overnight culture prepared last night to perform the Competent Cell procedure ● Followed the protocol for preparing CaCl2 Competent Cells that had previously worked before ● Deviations from this protocol are as follows: 1. Streak purify DH5a on LB-agar plate, no antibiotics. Incubate o/n at 37°C (12-16hrs). b. The DH5a plate had been streaked on August 13, 2018 and so a colony was picked and used from this plate and inoculated into the 5mL of LB. 2. Inoculate one colony from the plate into 5mL liquid LB w/ no antibiotics. d. **It might be wise to try and inoculate into other 5mL liquid LB tubes if your colony was big enough to inoculate more than just the no antibiotic 5mL LB culture. e. 1 test tube with a single colony of DH5a was inoculated, in addition to 1 negative control test tube on August 20, 2018 f. In the morning of August 21, 2018, the tubes were checked; the negative control did not grow, and the DH5a tube did

3. Autoclave 500mL of 0.1M MgCl2 500mL of 0.1M CaCl2, 50mL of 0.085M CaCl2, a GSA bottle, and 250mL liquid LB. Filter sterilize 50% glycerol in MilliQ. b. These chemicals had been previously prepared 4. Inoculate the 5mL culture w/ no antibiotics into 250mL liquid LB w/ no antibiotics and grow to OD 0.4-0.5 in 37°C, checking using the UV-Spec with 1mm cuvettes. ○ With aseptic technique, 250mL of LB was measured using a sterile Falcon tube and poured into a 500mL flask ○ Gently agitated the tube of DH5alpha and then added the entire 5mL into the flask containing 250mL of LB ○ Put into shaking incubator at 37°C at 11:45am ○ Checked the OD600 at 1:50pm for a reading of 0.266 ○ Checked the OD600 at 2:10pm for a reading of 0.338 ○ Checked the OD600 at 2:25pm for a reading of 0.410 9. Transfer the 250mL culture at the end of the incubation into the GSA bottle and refrigerate for 20mins at 4°C to stop the growth. e. **It might be wise to put the culture in the GSA bottle into the -20°C freezer for 5mins to stop the growth asap. f. Placed culture in original flask on ice for 25 minutes g. After 25 minutes on ice, the contents of the flask were transferred to 5 Falcon tubes h. A Falcon tube filled with 50 mL of water was used as a balance in the centrifuge 10. Pellet the culture using the centrifuge: 3K RPM, 10min, 4°C and decant the supernatant. c. Prechilled centrifuge to ~4°C and then added the 6 Falcon tubes d. Set the centrifuge spin time to 15 minutes to ensure proper pelleting

11. Resuspend in 125mL 0.1 M MgCl2 using a pipette to vigorously break apart the aggregates. Incubate this solution at 4°C for minimum 30min up, but better if over 1hr.

124

125

d. Prepared 0.1 M MgCl2 from 1 M MgCl2 using the following calculation: C1V1 = C2V2 (1M)V1 = (0.1M)(100 mL) V1 = 10 mL Therefore 10 mL of 1M MgCl2 was added to 90 mL of sterile deionized water and vortexed for proper mixing e. Incubated in 0.1 M MgCl2 (made from 1 M MgCl2) on ice for 2.5 hours in 2 Falcon tubes with a total of 100 ml (trying to make them more concentrated) 12. Repeat step 6 (step 10 here), with centrifugation for 15 minutes, followed by centrifugation with the same parameters for another 10 minutes since one tube had no cell clumping seen

13. Resuspend in 200mL 0.1M CaCl2 using a pipette to vigorously break apart the aggregates. d. Instead of using 200 mL, used a total of 100 mL between the 2 Falcon tubes to help make the cells more concentrated (and because the Falcon tubes only held 50 mL each) 14. Incubate this solution at 4°C o/n (12-16hrs). b. Incubated from 7:35 pm until 10:25 am the following day

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #2

Clara Fikry

August 21, 2018 Refer to Clara Fikry’s lab book, p.9-10

Trying again but with dilute and undilute template. Also using Q5

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 20 rxns (in uL)

MetE_NdeI_F2 (10 μM) 1.25 25

MetE_HindIII_R2 (10 μM) 1.25 25

Q5 2XMaster Mix 12.5 250

Sterile, di water 9.0 180

125

126

Template= undilute minipreped MetE (p.3 of Clara’s lab book; p.69 from this lab book) and dilute MetE (~1ng/ul)

● Aliquoted 24uL of Jumbo cocktail into each of the 17 (200uL) tubes ● Added 1uL of undilute template (MetE/ psKA397) to 8 tubes ● Added 1uL of dilute template (MetE/ psKA397) to 8 tubes ● (the other was a no template control)

Thermocycler procedure: Q5 2X HF MM

Step Temp time # of (in C) cycles

Initial 98 0:30 1 denaturation denaturation 98 0:10 25 annealing 55-71 0:30 extension 72 0:15

Final 72 2:00 1 extension hold 4 Infinity 1

5uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples were then thrown out because they were garbage.

L 1 2 3 4 5 6 7 8 9

126

127

L 1 2 3 4 5 6 7 8 9 10 L (2018-08-21-mete pcr.jpg in “gels” folder) L = ladder Top = dilute template ; bottom = undilute template 1-8= pcr’s with decreasing annealing temperatures from 71-55°C 9 = template only (not pcr product) (dilute = 5uL ; undilute = 1uL) 10 = no template control (anneal T = 55°C)

Dilute = (top) No bands. PCR failed. Undilute = (bottom) Same bands as template. Probably just template, not amplified product. PCR failed.

127

128

Construction - PCR of GFP from GFP-pSB1C3 plasmid (for pDawn characterization) - Attempt #3

Clara Fikry

August 21, 2018 Refer to Clara Fikry’s lab book, p.11-12

Trying again but with dilute and undilute template. Also using Q5

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 20 rxns (in uL)

GFP_AseI_F2 (10 μM) 1.25 25

MetE_HindIII_R2 (10 μM) 1.25 25

Q5 2XMaster Mix 12.5 250

Sterile, di water 9.0 180

Template= undilute minipreped GFP (p.3 of Clara’s lab book; p.69 from this lab book) and dilute GFP (~1ng/ul)

● Aliquoted 24uL of Jumbo cocktail into each of the 17 (200uL) tubes ● Added 1uL of undilute template (~92.7ng/uL) to 8 tubes ● Added 1uL of dilute template (~1ng/uL) to 8 tubes ● (the other was a no template control)

Thermocycler procedure: Q5 2X HF MM

Step Temp time # of (in C) cycles

Initial 98 0:30 1 denaturation denaturation 98 0:10 25 annealing 62-72 0:30 extension 72 1:00

128

129

Final 72 2:00 1 extension hold 4 Infinity 1

1uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples were then thrown out because they were garbage.

L 1 2 3 4 5 6 7 8 9

L 1 2 3 4 5 6 7 8 9 10 L (2018-08-21-gfp pcr.jpg in “gels” folder) L = ladder Top = dilute template ; bottom = undilute template 1-8= pcr’s with decreasing annealing temperatures from 72-62°C 9 = 1uL of template only (not pcr product)

129

130

10 = no template control (anneal T = 55°C)

Dilute = (top) No bands. PCR failed. Undilute = (bottom) Same bands as template. Probably just template, not amplified product. PCR failed. However there seems to be a lower band (~1kb, expected GFP size) in the last few wells of undilute pcrs.

Other - Testing ladders

Clara Fikry

August 21, 2018 Refer to Clara Fikry’s lab book, p.12

This was done to see if we can get nice ladder resolution. a= 1Kb+ ladder from NEB b= 1Kb ladder from thermo c= 2-log ladder from NEB

Loaded 5uL of each ladder and ran on a 1% (50mL) gel for 45min at 84V (7V/cm), as per Thermo’s instructions. a b c

b c a

(2018-08-21-ladder test.tif in “gels” folder)

1Kb Thermo ladder seems best. Obviously, I used their instructions…

130

131

Measurement - Growth curves of JT2 with CcaS/R v2.0 in complete M9

Max Reed

August 21, 2018 Refer to Max Reed’s lab book, p.12-13

Due to experiments I conducted for the Ingalls lab, I have strong evidence that the production of GFP does NOT affect the growth rate of cells; cells containing CcaS/R and GFP under the CcaR promoter grown under red light have identical growth rates to the same cells grown under green light. The purpose of this experiment is to assess whether or not the production of MetE affects growth rate; the strain used in this experiment contains CcaS/R, GFP under the CcaR promoter, AND MetE under the CcaR promoter.

Have 4 tubes in turbidostat. Each is a 40 mL tube containing ~25 mL of M9 (which DOES have methionine included). Since the production of methionine by MetE offers no advantage in this media, there may in theory be an observable decrease in growth rate in cells grown under green light due to the metabolic load imposed by MetE expression.

Using turbidostat positions 1, 3, 10, and 11. There were 2 minutes polling intervals separated by 40 seconds of stirring. The OD for flushing samples was set arbitrarily high. The sample tubes were inoculated with colonies from the streak plate of JT2 with CcaS/R v2.0 made from the transformation done on July 18th. These were the light levels:

Sample Red Green White

1 4095 0 0

3 4095 0 0

10 0 4095 0

11 0 4095 0

The media used was M9 + Sp (50 µg/mL) + Cm (25 µg/mL) prepared on August 14th. The program was named JT2_completeM9_redOrGreen, and it was started at 10:21 am.

Time OD 1 OD 3 OD 10 OD 11

2:25 pm 0.005 0.033 NA* 0.02

2:55 pm 0.01 0.053 0.039 0.037

3:25 pm 0.023 0.078 0.059 0.056

131

132

3:54 pm 0.052 0.121 0.084 0.087

4:31 pm 0.087 0.207 0.139 0.129

5:12 pm 0.178 0.321 0.232 0.217

5:35 pm 0.235 0.378 0.291 0.271

6:10 pm 0.367 0.512** 0.387 0.373

6:38 pm*** 0.498 0.576 0.498 0.501

7:01 pm*** 0.564 0.645 0.564 0.57

*This measurement was actually 0.065 but that was clearly wrong and I don’t know what happened. **This read as 0.476 but then I diluted the spectrometer sample by a factor of 2 and got 0.256, so I recorded 0.256 times 2. ***All samples at this time were obtained by combining 500 µL of sample with 1 mL of DI water, taking the OD of that, and then multiplying by 3.

Speaking as Future Max (I am writing this up as of September 6th because I forgot that I hadn’t done it until now lol), I’d advise NOT to dilute samples below an OD of 1 because yes dilution and multiplication does change the OD you get but that change seems to be by a factor close to 1 and it doesn’t vary strongly with OD (at least at ODs below 1).

Anyway, what then happened was I used every consecutive pair of data points to determine an “instantaneous doubling time” (roll with me here) and assigned the time for that instantaneous doubling time as the average of the times of the OD measurements I used to calculate it. So for instance, if the OD was 0.050 at 1:00 pm and 0.100 at 2:00 pm I would say that at 1:30 pm, the instantaneous doubling time was 60 minutes.

132

133

The graph of the instantaneous doubling times looks like this:

Now, it looks like the doubling time goes up over time, but it’s actually probably just going up with OD. Ideally doubling time would be consistent below an OD of ~1, but this seems to not be the case. This is crappy but I was starting to suspect it (based on Ingalls lab results). Luckily here we’re looking for a difference in growth rates, not absolute growth rates, so it doesn’t matter when the cells leave the exponential growth phase.

Anyway, I will now plot doubling time vs OD (the more logical x-axis, given the probable dependence of doubling time on OD and not on time). Taking my earlier example where OD is 0.100 at 1:00 pm and 0.200 at 2:00 pm, I would now say instead that the doubling time was 60 minutes at an OD of 0.150 (because that is the average of 0.100 and 0.200). The graph is as follows:

133

134

1 and 3 (red light) really don’t look that different from 10 and 11 (green light). This should be repeated to be careful, but this seems to indicate that MetE production has no substantial effect on growth rate.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 38 August 22, 2018 ● Completed the protocol for the competent cells, as described below 15. Repeat step 6 (step 10 here). c. Centrifuged for 20 minutes to get proper pelleting 16. Resuspend in 5mL 15% Glycerol - 0.085 CaCl2 using a pipette to vigorously break apart the aggregates. a. The 15% Glycerol - 0.085 CaCl2 in the tube was not properly mixed and vortexed before being added at a volume of 5 mL to one of the Falcon tubes with the clumped cells. Thus, in case the cells did not properly freeze due to a poor ratio of glycerol, the second Falcon tube of cells had 5 mL of 15% Glycerol - 0.085 CaCl2 added to it as well. Therefore they may have been a lower concentration of cells, but they may have been able to be frozen and revived better. b. The resuspension and aliquoting of the first tube with the unmixed glycerol mixture was performed by Nicole (tubes were coloured with a dark pink/light purple dot on the lid), whereas the resuspension and aliquoting of the second tube was performed by Clara (tubes were coloured with a blue dot on the lid) 17. Aliquot 100µLinto ~50 1.5mL microfuge tubes and freeze at -80°C. b. Thought the protocol said not to, the tubes were flash-frozen using liquid nitrogen and then place in the -80°C in a freezer box

● Max Reed then tested the Competent Cells

134

135

BioBricks - Attempt 2: Colony PCR of Transformed pSB1C3+MetE Into DH5 Alpha E.coli Cells

Steven Choi, Amanda Kuang

August 22, 2018 Refer to Amanda Kuang’s Lab Book #25

Reagent Per Sample No Colony No Primers (-) Miniprepped Tube DNA (-) Negative pSB1C3 (+) (18 tubes in Negative Control Positive Control total) Control

H2O 10 10 10 10

DNA Touched -- Touched 1uL of pSB1C3 #4 Colony Colony (in BioBricks Box)

VF2 Primer 1 1 -- 1

VR Primer 1 1 -- 1

Taq 2xMM 10 10 10 10

Total 22uL 22uL 22uL 22uL

Colony DNA samples #1-10 were obtained from the previous patch plate made from the 1st Colony PCR attempt

Patch Plate (CM Plate) for Sample Tubes A-D: ● 4 other colonies were collected from the original CM plate that was made after the 1st transformation attempt, and subsequently used for the colony PCR ● A second patch plate just for these 4 other colonies was also made on a CM plate ● Each patch area consists of 5uL of H2O mixed in with each designated colony ● Patch plate was placed in 37ºC incubator

Thermocycler procedure: Taq MM

Cycles Step Temp (in ͒C) time

1x Initial 95 10 minutes denaturation

denaturation 95 15-30 sec (20 sec)

135

136

annealing 58 15-60 sec (45 sec) 30X extension 68 1 min/kb (2 min 30 for MetE+few base pairs of pSB1C3)

1x Final 68 5 min extension

1x hold 4 Infinity

136

137

Diagnostic Gel for Colony PCR Products: ● 50mL, 1% agarose gel

Other - Checking Competent Cells made on August 22

Max Reed

August 22, 2018 Refer to Max Reed’s lab book, p.14

Testing the comp. Cells that Nicole L. made today. Will use the DNA in the comp. cell test kit. I used the 50 pg/µL tube (which had pSB1C3 with RFP I’m pretty sure). There were two slightly different sets of comp. cells made, with their tops coloured either blue or violet. I tested both sets. Here are the plates I made:

Sample Blue Violet

LB 1 5

LB + Cm 2 6

LB + Cm, 25 pg of DNA 3 7

LB + Cm, 50 pg of DNA 4 8

And here are the results (plates counted on August 23rd):

137

138

Plate Colonies

1 lawn

2 none

3 29

4 121

5 lawn

6 none

7 172

8 317

Yaaay they work.

Other - PCR to check GFP-pSB1C3 plasmid

Clara Fikry

August 22, 2018 Refer to Clara Fikry’s lab book, p.13

This PCR was done to check that the template I’ve been using for the construction GFP PCR (to put into pDawn) is actually GFP in pSB1C3. The VF2 and Vr primers bind the pSB1C3 backbone and should give a ~1200bp product if GFP is there. Mostly, this experiment was done to restore my faith in PCRs.

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL)

VR (10 μM) 1

VF2 (10 μM) 1

Taq 2XMaster Mix 10

Sterile, di water 7

This was added separately to 3 pcr tubes ● One was a no template control

138

139

● One received 1uL of ~1ng/uL GFP-pSB1C3 (which I’ve been using as template for construction GFP PCRs) ● One received 1uL of ~9-101ng/uL GFP-pSB1C3 (fresh dilution into sterile DI water made from original minipreped GFP-pSB1C3)

\ Taq MM

Step Temp time # of (in ͒C) cycles

Initial 95 10:00 1 denaturation

Denaturation 95 0:20 25

Annealing 60 0:45

Extension 68 1:20

Final 68 5:00 1 extension

Hold 4 infinity 1

5uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples are now in fridge. L NTC 1 2

139

140

L= 1 kb ladder NTC = no template control 1= ~1ng template used to make pcr product 2= ~9-10ng template used to make pcr product

(2018-08-22-gfp verif pcr.tif in “gels” folder)

It worked! Both samples 1 and 2 gave a band of the expected size (~1kb). This means PCR-ing from this template is possible. The template is probably not the reason why all the GFP construction PCRs I’ve done haven’t worked yet.

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #3

Clara Fikry

August 22-23, 2018 Refer to Clara Fikry’s lab book, p.15-16

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

MetE_NdeI_F2 (10 μM) 1 11

MetE_HindIII_R2 (10 μM) 1 11

Taq 2XMaster Mix 12.5 137.5

Sterile, di water 9.5 104.5

Template= minipreped MetE (p.3 of Clara’s lab book; p.69 from this lab book), diluted to ~1ng/uL

● Aliquoted 24uL of Jumbo cocktail into each of the 9 (200uL) tubes (all of this was prepared on ice for the first time) ● Added 1uL of template (MetE/ psKA397) to 8 tubes (the other was a no template control)

Thermocycler procedure:

140

141

Taq MM

Step Temp time # of (in ͒C) cycles

Initial 95 0:30 1 denaturation denaturation 95 0:20 25 annealing 45-68 0:45 extension 68 2:30

Final 68 5:00 1 extension hold 16 infinity 1

Let this go over night and ran the gel the next day. Note: I lost the NTC between the 30cm transfer from the ice box to the thermocycler.

5uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V.

L 1 2 3 4 5 6 7 8 L

L = 1Kb ladder 1-8= pcr’s with decreasing annealing temperatures from 68-45°C

(2018-08-23-MetE pcr worked!.tif in “gels” folder)

Bands of expected size for MetE (~2Kb) are seen in lanes 4-8. Last two are brightest and so

141

142 those samples were purified.

Construction - PCR/DNA cleanup of MetE amplified from pSKA397 plasmid (for pDawn experiments)

Clara Fikry

August 23, 2018 Refer to Clara Fikry’s lab book, p.17

Cleaned the two brightest bands from my last MetE PCR (attempt #3): samples 7 and 8 (G and H in thermocycler).

Followed NEB DNA cleanup kit protocol outline on p.8 of this lab book with the following deviations: ● Used 5:1 ratio in step 1 ● Eluted in 20uL

Nanodrop: Sample DNA concentration (ng/uL)

PCR’d MetE (G) 5.2

PCR’d MetE (H) 3.0

Very low concentrations. Terrible graphs (no peak, graph resembles exponential decay. Just like my hope is decaying). Will redo PCR (at 68°C annealing) and purification.

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #4

Clara Fikry

August 22-23, 2018 Refer to Clara Fikry’s lab book, p.18

Repeated PCR from attempt #3 (p.97 of this lab book; p.15-16 of Clara Fikry’s lab book) except with the following deviations: ● Only 3 samples (1-3) + 1 NTC (each prepared individually, not on ice) ● Annealing T = 68°C only

L 1 2 3 NTC

142

143

(2018-08-23-mete pcr high.tif in “gels” folder)

I realized (too late) that the bands I saw on attempt #3’s gel were at the lowest annealing temperatures, not the highest. So that’s why this PCR didn’t work. Will redo with a lower annealing temperature.

Other - Making Amino Acids Minus Methionine Mixture

Max Reed

August 23, 2018 Refer to Max Reed’s lab book, p.15

This was tedious, and so was the procedure. I followed the recipe Matt Scott gave us, which should be available on the drive in the “Media Recipes” document. See my book for additional details.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 38 August 23, 2018 ● The competent cells that Max Reed tested appear to work well and are competent ○ Refer to Max Reed’s lab book for details ○ Discovered that the microcentrifuge tubes that had been marked with a dark pink/light purple dot on the lid (representing that the glycerol and CaCl2 solution had not been mixed and vortexed before being added to the cells) worked better as competent cells as opposed to the ones with a blue dotted lid (mixed and vortexed glycerol mixture ○ The tubes with a blue dot on the lid still appeared to work, but just not as well

143

144

● Made Kanamycin antibiotic for the stock solution with a concentration of 50 mg/mL of water ○ Made a larger volume of Kanamycin with the same concentration ○ 500 mg (0.5000 g) per 10 mL deionized water ○ This antibiotic solution was filter-sterilized the following day, and until that occurred, it was stored in the 4C fridge

Construction - PCR of GFP from GFP-pSB1C3 plasmid (for pDawn characterization) - Attempt #4

Clara Fikry

August 23-24, 2018 Refer to Clara Fikry’s lab book, p.19-20

Here we go again. Now using Taq for more reasonable annealing temperatures.

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

GFP_AseI_F2 (10 μM) 1 11

MetE_HindIII_R2 (10 μM) 1 11

Taq 2XMaster Mix 12.5 137.5

Sterile, di water 9.5 104.5

Template= minipreped GFP (p.3 of Clara’s lab book; p.69 from this lab book) diluted to ~1ng/ul

● Aliquoted 24uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1uL of template (~1ng/uL) to 8 tubes ● (the other was a no template control)

Thermocycler procedure: Taq MM

Step Temp time # of (in ͒C) cycles

Initial 95 0:30 1

144

145 denaturation denaturation 95 0:20 25 annealing 55-68 0:45 extension 68 1:00

Final 68 5:00 1 extension hold 4 infinity 1

Let run overnight and ran gel the next day.

5uL of each pcr product was then run on a 1% (50mL) gel for 45 min at 100V. Samples were then thrown out. L 1 2 3 4 5 6 7 8 NTC

L = 1Kb ladder 1-8= pcr’s with decreasing annealing temperatures from 68-55°C

(2018-08-24 gfp pcr.tif in “gels” folder)

No bands. Didn’t work. What a surprise. May need to try lower annealing temperatures (45°C) or re-design primers?

145

146

Measurement - Growth Rates of JT2 CcaS/R v2.0 in M9 - Met

Max Reed

August 23, 2018 Refer to Max Reed’s lab book, p.16

Having established that the metabolic load of expressing MetE under full induction of CcaS/R is not particularly heavy (see Measurement - Metabolic Load of MetE Expression Experiment), we will now proceed to verify that in M9 media made without methionine different light levels give different growth rates.

JT2 CcaS/R v2.0 was grown overnight in M9, then left in the fridge for several hours. While it was in the fridge, M9 - Met was prepared, and 20-25 mL of the medium was placed into four sample vials. The overnight culture was taken out of the fridge. 200 µL were taken from it and spun down. The LB was removed and the cells were then resuspended in 200 µL of PBS. 50 µL of this resuspension was used to inoculate each of the four sample vials.

The sample vials were put in the incubator and the following light settings were used:

Sample Red Green White

1 4095 0 0

3 4095 0 0

10 0 4095 0

11 0 4095 0

At 7:48 pm, the lights were set using the command line and the vials were set to spin at 1800/4095 perpetually (except 11, which was set to 1500/4095). Ordinarily I would have kept the samples stirring intermittently but I needed to leave the lab and take my computer with me so all I could do was start stirring and set the lights (changing stirring or light intensity require a computer to be sending commands to the Arduino).

At 10:32 pm I returned, stopped the continuous stirring, and started the program “redVsGreenNoMet”, which was set to stir for 40 s then be still for 2 minutes.

The ODs measured are as follows:

Time Time (mins) OD 1 OD 3 OD 10 OD 11

11:00 0 0.01 0.012 0.012 0.013

146

147

11:39 39 0.015 0.017 0.022 0.025

12:18 78 0.027 0.026 0.047 0.048

12:45 105 0.028 0.031 0.071 0.07

1:20 140 0.035 0.04 0.115 0.114

1:57 177 0.043 0.052 0.191 0.187

2:38 218 0.061 0.069 0.296 0.301

0.032*2 0.036*2 0.160*2 0.161*2

3:12 252 0.080 0.088 0.387 0.407

0.043*2 0.047*2 0.210*2 0.218*2

The reason why the last two samples have two lines each is because each was measured twice; once normally (by putting 1 mL in a cuvette) and once after diluting by a factor of 2 by adding 1 mL PBS to that same cuvette.

The following is a table of the instantaneous doubling times:

Time Doubling of 1 Doubling of 3 Doubling of 10 Doubling of 11

19.5 66.67094036 77.6118877 44.59848747 41.33911287

58.5 45.99073381 63.62393341 35.61132486 41.44058917

91.5 514.6050645 106.4011767 45.36608405 49.60312756

122.5 108.7199302 95.17806585 50.30593689 49.74367813

158.5 124.5867853 97.75129145 50.55067604 51.82040563

197.5 81.27299955 100.4693293 64.87089909 59.7036471

235 86.91411891 96.89172435 87.91518159 78.11327807

Spring 2018 Co-op: Nicole Lassel’s Lab Notes Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 39 August 24, 2018 ● Filter-sterilized the Kanamycin antibiotic made yesterday with Nicole Wang ○ Put the labelled microcentrifuge tubes in the -20C freezer ● Threw out the ill-performing competent cells made August 10 ○ These cells were tested twice for competence and did not work ● Made LB agar plates (the ratio of agar to LB was unknown, since the bottle was made by Nicole Lassel in early May and not recorded)

147

148

● Made Spectinomycin + Chloramphenicol (Sp + Cm) agar plates by adding 100 µL of each antibiotic into a single bottle of 100 mL of molten LB agar ● Made Chloramphenicol (Cm) agar plates by adding 100 µL of Cm antibiotic into 100 mL of molten LB agar ● All these plates will have to be tested

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #5

Nicole Wang

August 24, 2018 Refer to Nicole Wang’s lab book, p.24-25

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

MetE_NdeI_F2 (10 μM) 1 11

MetE_HindIII_R2 (10 μM) 1 11

Taq 2XMaster Mix 12.5 137.5

Sterile, di water 9.5 104.5

Template= miniprepped MetE (p.3 of Clara’s lab book; p.69 from this lab book)

● Aliquoted 24 uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1 uL of template (MetE/ psKA397) to 8 tubes ● Added 1 uL of sterile diH2O to 1 tube (no template control)

Thermocycler procedure: Taq MM

Step Temp time # of (in C) cycles

Initial 98 0:30 1 denaturation

Denaturation 98 0:20 30

Annealing 45-55 0:45

148

149

Extension 72 2:30

Final 72 5:00 1 extension

Hold 4 0:00 1

Gradient temperatures: Column Temperature (°C)

A 55.0

B 54.2

C 52.9

D 51.0

E 48.6

F 46.9

G 45.7

H 45.0

Measurement - GFP vs Non Fluorescent Flow Test

Leah + Cam + Max

1. Inoculated GFP cassette strain #346 BBa_I20270 in DH5alpha (Fluorescent pop) and empty JT2 (non-fluorescent pop) 2. In the morning I diluted the overnight culture. 100ul of overnight in 3mL of LB + appropriate antibiotics (3ul km for JT2 and 3ul Cm for DH5alpha) 3. After 2 hours in the 37 incubator: JT2 (empty) OD = 0.777 DH5alpha(GFP) OD = 0.405 4. The empty JT2 strain was diluted to the same OD as the DH5alpha cells in order to obtain and even 50/50 mixture:

Final OD after dilution:

JT2 (empty) OD = 0.430 DH5alpha(GFP) OD = 0.405

5. 1mL of each sample was spun down and the LB was removed.

149

150

6. Then the pellet was resuspended in 1mL of PBS 7. The two 1mL samples were combined and vortexed in a 2ml tube. 8. 50ul was removed from this mixture and combined with 150ul of PBS and ran on the flow cytometer 9. The remaining 950ul was used for pour plating

(A) Flow Cytometry

The diluted 50/50 sample was run on the flow cytometer and the following data was acquired:

480 Laser at 10mW -> all and gated for beads 480 Laser at 50mW -> all and gated for beads 480 Laser at 100mW -> all and gated for beads 480 Laser at 200 mW -> all and gated for beads

*If I did this experiment again I would not go as high with laser. I would probably stick between 2 and 10 in order to avoid saturation of the GFP. Definitely no higher than 20.

Results ( Data analyzed by Max)

As it turns out the gating before acquiring the data messed with things a bit so analysis was done by gating the “All” data during analysis. https://docs.google.com/spreadsheets/d/1V1qBiPb2sILos2ZfWBzIFn6DfkjNlgWDuQcamzZY GG0/edit?usp=sharing

Fraction Re-gated Non-Fluorescent Fraction Fluorescent 10 mW 0.475733064 0.524266936 50 mW 0.467357513 0.532642487 100 mW 0.483822042 0.516177958 200 mW 0.482358627 0.517641373

(B) Pour Plating

Followed the pour plate protocol in the protocol folder in Big Boy.

150

151

Since I did not know what dilution would give me a countable plate I did a 10x serial dilution -1 -7 from 10 to 10 I plated each of the dilutions twice. Once on a plate with LB agar plate with Cm and once on a plate with LB agar with Km. The Cm plates will tell us how many cells are present from the fluorescent population and the Km plates will tell us how many cells are present for from the non-fluorescent population.

I also included a negative control to ensure that neither population could grow in the presence of the other antibiotic.

Results

Dilution Plate count Cm Plate count Km (Fluorescent) (non-Fluorescent)

10-1 TNTC TNTC 10-2 TNTC TNTC 10-3 TNTC TNTC 10-4 TNTC TNTC 10-5 117 113 10-6 >100 >100 10-7 >100 >100

CFU/ml 10mW fraction on flow

Non-fluorescent 11250 0.475733064

Fluorescent 11650 0.524266936

CFU/ml = (no. of colonies x dilution factor) / volume of culture plate

Conclusion

151

152

The results received on the flow are representative of the results from the pour plates.This means that the flow is most likely capable of giving accurate reading for a 50/50 Green fluorescent v.s non-fluorescent population.

Further experiments should be done to see if these results are repeatable for a 50/50 population and if the flow is accurate for other ratios.

Construction - PCR of GFP from GFP-pSB1C3 for pDAWN - Attempt #5

Max Reed

August 26, 2018 Refer to Max Reed’s lab book, p.17-18

I’m not on construction but I did this anyway. Now trying Taq polymerase again with even lower annealing temperatures. Making 8 samples plus a no template control plus a no primer control. Samples labelled A through H. I also prepared the reaction tubes on ice.

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

MetE_NdeI_F2 (10 μM) 1 11

MetE_HindIII_R2 (10 μM) 1 11

Taq 2X Master Mix 12.5 137.5

Sterile, DI water 9.5 104.5

The no primer control had 12.5 µL of Taq 2X MM and 11.5 µL of “sterile” DI water. Every sample had 1 µL of template DNA (except the no template control of course).

Thermocycler procedure (there were 30 cycles): Taq 2X HF MM

Step Temp time (in C)

Initial 95 30 sec denaturation denaturation 95 20 sec annealing 45-68 45 sec

152

153 extension 68 60 sec

Final 68 5 mins extension hold 4 Infinity

So I don’t have an image of the gel right now but basically nothing had anything except maybe G, which sort of had a band a bit higher than it should have been (1500 to 2000 bp by the ladder, while it should have been ~1000 bp).

However, I cleaned G and H and these were what I got:

Sample Concentration (ng/µL) 260/280 260/230

G 6.1 1.68 0.76

H 7.7 1.55 0.74

Therefore, I am inclined to say that none of them work. I’m starting to think we should do this in a different thermocycler.

Construction - PCR of MetE from pSKA397 plasmid (for pDawn experiments) - Attempt #6

Clara Fikry

August 27, 2018 Refer to Clara Fikry’s lab book, p.21

I tried my best to replicate PCR from attempt #3 (p.97 of this lab book; p.15-16 of Clara Fikry’s lab book): ● Same primers, template, thermocycler conditions, even prepared on ice ● But didn’t let the PCR go O/N, ran gel right away (1%, 50ml, 100V, 45min, 5uL of sample loaded)

L ABCDEFGH NTC

[ ]

153

154

(2018-08-23-mete pcr high.tif in “gels” folder)

Bans are expected size, ~2.5 kb. Not sure why they’re so smeared.

Construction - PCR cleanup of MetE (now with added restriction sites, for pDawn experiments)

Clara Fikry

August 27, 2018 Refer to Clara Fikry’s lab book, p.22

Cleaned samples A and H from Attempt #6 of the MetE pcr (previous page) following NEB cleanup kit protocol. ● 2:1 ratio in step 1 (since my amplicon is larger than 2kb. I did this wrong last time - see p.17 of my lab book) ● Eluted in 10uL

Sample Concentration (ng/uL) Graph description

MetE (A) 13.5 Bad. Bumpy exponential decay-ish.

MetE (H) 109.4 BEAUTIFUL peak at 260

A was thrown out. H was kept in 2018 freezer box #29.

Construction - PCR of GFP from GFP-pSB1C3 for pDAWN - Attempt #6

Clara Fikry

August 27, 2018 Refer to Clara Fikry’s lab book, p.23

Re-did attempt #5 (done by Max, see p.17 of his lab book) with the following deviations: ● Did not make a no primer control ● Prepared on ice ● Ran in the Charles Lab thermocycler

154

155

Did not work. The thermocycler said there were “184 errors or exceptions” during the run.

I’m giving up on these primers. Will design new primers for NEBuild assembly instead of traditional cloning.

Construction - PCR of GFP from GFP-pSB1C3 plasmid (for pDawn characterization) - with NEBuild primers

Clara Fikry

September 8, 2018 Refer to Clara Fikry’s lab book, p.24

Here’s the plan for NEBuild assembly:

I’m amplifying GFP with NEBuild primers shown above. I will digest pDawn with HindIII and NdeI then assemble as shown.

Followed PCR protocol with the following deviations:

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns

155

156

(in uL)

GFP_NEBuild_F (10 μM) 1 11

MetE_NEBuild_R (10 μM) 1 11

Taq 2XMaster Mix 12.5 137.5

Sterile, di water 9.5 104.5

Template= minipreped GFP (p.3 of Clara’s lab book; p.69 from this lab book) diluted to ~1ng/ul

● Aliquoted 24uL of Jumbo cocktail into each of the 9 (200uL) tubes ● Added 1uL of template (~1ng/uL) to 8 tubes ● (the other was a no template control)

Thermocycler procedure: Taq MM

Step Temp time # of (in ͒C) cycles

Initial 95 0:30 1 denaturation denaturation 95 0:20 25 annealing 55-68 0:45 extension 68 0:48

Final 68 5:00 1 extension hold 4 infinity 1

5uL of each pcr product was then run on a 1% (50mL) gel (with guianosine because also ran digests on this gel - see next few pages) for 42 min at 100V.

Construction - Digest of MetE gene (with added cut sites) and pDawn - Attempt #1

Clara Fikry

September 8, 2018

156

157

Refer to Clara Fikry’s lab book, p.25

Sample Amount (uL)

MetE (pcr clean’d, p.22 of my book, 9 ~109ng/uL)

NdeI thermo fast digest (new) 1

HindIII thermo fast digest (expired in 1 2017)

10X Buffer 2.1 (NEB) 2

Sterile diH2O 7

Total 20

Sample Amount (uL)

pDawn (miniprep’d, p.3 of my book, 20 ~50ng/uL)

NdeI thermo fast digest (new) 1

HindIII thermo fast digest (expired in 1 2017)

10X Buffer 2.1 (NEB) 3

Sterile diH2O 5

Total 30

● Add ingredients in a microfuge tube, mix by tapping. ● Spin down tube for 10 seconds in the mini centrifuge ● Incubate ~ 1h15 hours at 37 ˚C ● Heat inactivated at 80°C for 10 min

Ran pDawn on same gel as GFP NEBuild pcr from previous page:

[ ]

Top:

157

158 pDawn we received contains RFP. which is ~1 kb, so that’s probably what the lowest band in “2” is. The double cut backbone is ~7kb so it shouldn’t be the band above the RFP because that’s too small. I have no idea what that band is. The band I cut out seems to be the right size but may also be uncut plasmid.

Bottom: PCR worked! Samples C and H were cleaned.

Construction - PCR cleanup of GFP for NEBuild assembly

Clara, Poonam

September 8, 2018 Refer to Clara Fikry’s lab book, p.27

Cleaned samples C and H from GFP NEBuild pcr p.26 of my book) following NEB cleanup kit protocol. ● 5:1 ratio in step 1 ● Eluted in 10uL

Sample Concentration (ng/uL) Graph description

GFP- NEBuild (C) 12.8 Low peak at 260

GFP- NEBuild (H) 43.9 high peak at 260

C was thrown out. H was kept in 2018 freezer box #33.

Construction - PCR cleanup of digested MetE (for pDawn)

Clara, Poonam

September 8, 2018 Refer to Clara Fikry’s lab book, p.27

Cleaned MetE digested with HindIII and NdeI (p.25 of my book) following NEB cleanup kit protocol. ● 2:1 ratio in step 1 ● Eluted in 10uL

158

159

Sample Concentration (ng/uL) Graph description

Digested MetE 36.0 high peak at 260

Kept in 2018 freezer box #32.

Spring 2018 Co-op: Nicole Lassel’s Lab Notes BioBricks - Inoculation of Strain Containing BBa_J04450 Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 39 September 10, 2018 ● Inoculated Strain 284 according to Inoculation protocol in Online Lab Book ○ Wanted to use Strain 284 due to it containing the “pSB1C3 with RFP stuffer” with BBa_J04450 ● Aseptically added 5 mL of LB to 3 test tubes (2 samples and negative control) followed by 5 µL of CM antibiotic into each ● Using a sterile inoculating stick for each sample, inoculated each tube ○ Samples were inoculated from frozen stock from -80°C freezer ○ Negative control was inoculated with a sterile wooden inoculating stick ● The samples were then put in the shaking incubator at 37°C overnight

Nicki: (RAY please writeup your stuff) Ray’s Ccas/r V2 nanodrop values:

DNA 260/280 260/230 Good peak? concentration (ng/ul)

Tube 1 83.1 1.86 1.31 yas

Tube 2 110.1 1.84 1.42 YAS

Spring 2018 Co-op: Nicole Lassel’s Lab Notes BioBricks - Inoculation of Strains Containing BBa_J04450 Nicole Lassel Refer to Nicole Lassel’s Lab Book Page 39 September 11, 2018 ● On morning of September 11th, discovered that inoculated Strain 284 did not appear to grow ○ The two sample test tubes and the negative control all appeared the same, as clear LB ○ The tubes were left in the incubator for another day, just in case they were slowly growing

159

160

● Inoculated Strain 118 and 284 again (larger amounts taken due to it being an unhealthy strain according to Leah) according to Inoculation protocol in Online Lab Book ● Aseptically added 5 mL of LB to 5 test tubes (2 test tubes for each sample and a single negative control) followed by 5 µL of CM antibiotic into each ● Using a sterile inoculating stick for each sample, inoculated each tube ○ Samples were inoculated from frozen stock from -80 °C freezer ○ Negative control was inoculated with a sterile wooden inoculating stick ● The samples were then put in the shaking incubator at 37°C overnight

BioBricks - PCR of pSKA397 MetE

Nicole Wang September 11, 2018 “Refer to Nicole Wang’s Lab Book Page 26”

Purpose -PCR of pSKA397 to isolate MetE and add the appropriate overhangs for future Hi Fi Assembly of our biobrick. -conduct a gradient PCR to test out the new primers FP1 and RP1

Recipe: Reagent Per reaction (in uL) Jumbo cocktail for 11 rxns (in uL)

Forward Primer (10 μM) 1 11

Reverse Primer (10 μM) 1 11

Taq/Q5/Phusion Master Mix 10 110

Sterile, nuclease-free water 7 77

DNA template 1 n/a

Q5 2X HF MM

Step Temp Time (in C)

Initial 98 30 sec Denaturation

Denaturation 98 10 sec

Annealing 66-72 30 sec

160

161

Extension 72 2:15 sec

Final 72 2 min Extension

Hold 4 Infinity ● Note that the denaturation, annealing, and extension steps were done 30X

Gradient temperatures:

Row Temperature (°C)

A 72.0

B 71.6

C 70.9

D 69.7

E 68.2

F 67.2

G 66.4

H 66.0 -also included a no template control run at 69.7°C

Biobricks - Miniprep of Bba_J04450 (RFP)

Nicole Wang

September 12, 2018 “Refer to Nicole Wang’s lab book, p.28”

If you followed the protocols in the protocol section of this book: “Followed Miniprep protocol without any deviations”

Eluted 30 uL

Nanodrop Values

ng/uL Description of peak

RFP 92.0 Very nice

161

162

Biobricks - Miniprep of Ingalls’ CcaR

Nicole Wang

September 12, 2018 “Refer to Nicole Wang’s lab book, p.28”

If you followed the protocols in the protocol section of this book: “Followed Miniprep protocol without any deviations”

Eluted 30 uL

Nanodrop Values

ng/uL Description of peak

CcaR 137.8 Very nice

BioBricks - Gel of MetE PCR Products

Nicole Wang, Amanda Kuang

September 12, 2018 “Refer to Nicole Wang’s lab book, p.29”

If you followed the protocols in the protocol section of this book: “Followed gel electrophoresis protocol without any deviations”

162

163

1% agarose gel, stained with Gel Red, run at 100V for 83 min

Lane PCR Product Annealing Temperature (°C)

1 1 kb ladder n/a

2 A 72.0

3 B 71.6

4 C 70.9

5 D 69.7

6 E 68.2

7 F 67.2

8 G 66.4

9 H 66.0

10 No template control 69.7

PROBLEMS Bands are ~ 3000 bp but expected to be 2300 bp

Spring 2018 Co-op: Nicole Lassel’s Lab Notes BioBricks - PCR of Strain 284 Containing BBa_J04450 Nicole Lassel, Nicole Wang, Amanda Kuang 163

164

Refer to Nicole Lassel’s Lab Book Pages 40-41 September 12, 2018 ● It was seen that the Strain 284, inoculated on September 10 and left in incubator, did have growth ● Nicole W prepared a miniprep using the red-coloured overnight culture of 284 ● Amanda nanodropped the miniprepped sample that Nicole W had made and found the concentration to be 92.0 ng/µL ● Nicole L diluted the sample down to a concentration of 1 ng/µL with sterile water ○ The calculation for the dilution was as follows (using Steven’s method from page 4 of his lab book): C = 92.0 ng/µL 92 - 1 = 92 * 5 = 455 Therefore 455 µL of sterile deionized water will be added to 5 µL of sample ● The cocktail mix recipe for the PCR was prepared as follows:

Cocktail Mix Recipe for PCR of BBA_J04450 (to amplify backbone) using FP2 and RP2 Reagent Per reaction (µL) Jumbo cocktail for 12 reactions (µL)

Forward Primer (FP2) 1 12

Reverse Primer (RP2) 1 12

Q5 Master Mix 10 120

Sterile, nuclease-free water 7 84

DNA template 1 n/a

● The PCR was performed as follows: PCR of BBA_J04450 (to amplify backbone) using FP2 and RP2 Q5 2X HF MM

Step Temp (in °C) Time

Initial Denaturation 98 30 sec

Denaturation 98 10 sec

Annealing 58-68 30 sec

Extension 72 50 sec

Final Extension 72 2 min

Hold 4 Infinity ● Note that the denaturation, annealing, and extension steps were done 30X

164

165

● The samples were put in so that there was a gradient performed, as shown below:

PCR Product Annealing Temperature (°C)

A: Negative template control (replace 1 µL DNA with water) 68.0

B 67.2

C 66.0

D 64.1

E 61.7

F 59.9

G 58.7

H: Negative template control 58.0

● After the PCR was removed from the Thermocycler, it was placed in the fridge at 4 °C at 3:10 pm.

Construction - Removing GFP from Ccar Ingall’s Plasmid

Nicole Wang, Caleb Innis, Nicki Shaw September 12, 2018 “Refer to Nicki Shaw’s Lab Book Page 27-28”

Ccar Ingall’s Plasmid miniprepped according to the protocol, eluted in 30ul Nanodrop: 137.8 ng/ul

Digest: Performed according to protocol with the following mix In uL Ccar Negative Control

DNA 7.3 7.3

NdeI 1 0

3.1 NEB buffer 5 5 mQ H2O 36.7 37.7

165

166

V tot 50 50

Gel: 1.2% Gel extraction performed (larger 3.5kb band extracted). 420 bp GFP band ______.

BioBricks - Gel of BBa_J04450 Backbone PCR Products

Nicole Wang, Amanda Kuang

September 13, 2018 “Refer to Nicole Wang’s lab book, p.31”

“Followed gel electrophoresis protocol with the following deviations: ● Prepared a 1% agarose gel, but some leaked while solidifying. Continued to use the gel because the wells were still in tact.

1% agarose gel, stained with Gel Red, run at 100V for ~45 min

Lane Sample Annealing Temperature (°C)

1 1 kb ladder n/a

2 A 72.0

3 B 71.6

166

167

4 C 70.9

5 D 69.7

6 E 68.2

7 F 67.2

8 G 66.4

9 H 66.0

10 No template control 69.7

Discussion Upper bands are ~ 3000 bp but expected to be ~2500 bp. Lower bands found in first 2 PCR products (A and B) with a size of ~2000 bp.

BioBricks - Nanodrop of MetE and Bba_J04450 PCR Products

Nicole Wang, Amanda Kuang, Nicole Lassel

September 14, 2018 “Refer to Nicole Wang’s lab book, p.33”

Followed nanodrop protocol with no deviations.

Note: did not perform a PCR cleanup, so we used diH2O to blank.

Sample Concentration (ng/uL) 260/280 260/230

RFP backbone H 414.7 1.85 0.77

RFP backbone G 418.5 1.86 0.77

RFP backbone F 415.6 1.85 0.77

MetE insert A 426.3 1.83 0.76

MetE insert B 426.2 1.82 0.76

MetE insert C 441.3 1.79 0.77

All the chromatograms were smooth and nice. In all samples, there was a high peak at 230 nm and a lower second peak at 260 nm.

167

168

BioBricks - Preparation of M9 Plates (With and Without Methionine)

Nicole Wang September 13-14, 2018 “Refer to Nicole Wang’s lab book, p.32 and 34 ”

Methods 1. Measured out 10 mL of 10x M9 salts in a 100 mL graduated cylinder. Filled the graduated cylinder a volume of 97 mL with diH20 2. Combined diluted M9 salts and 1.50 g of agar in a bottle, and autoclaved 3. Next day: steamed the solidified media 4. Added 200 uL of 1M MgSO4, 10 uL of 1M CaCl2, and 2 mL of 20% glucose to the M9 salts solution and mixed. 5. Split the M9 mixture into 2 bottles containing roughly 60 mL and 40 mL. 6. Made 40 mL of M9 agar with Methionine by adding 800 uL of 10% casamino acids and mixing 7. Made 60 mL M9 agar without Methionine by adding 6 mL of 10x amino acids -met and mixing. 8. Poured M9 agar plates and allowed them to solidify 9. Set aside 1 of each type of M9 plate to test for DH5a growth. 10. Spread 40 uL of 0.1M IPTG + 15 uL of 25mg/mL Cm on plates for future transformation.

BioBricks - Testing DH5a and JT2 growth on M9 plates

Nicole Wang September 14, 2018 “Refer to Nicole Wang’s lab book, p.35

Methods 1. Obtain a M9 plate with methionine and a M9 plate without methionine 2. Split each plate in half (one for each E. coli strain) 3. Streak frozen stock of DH5a (Ingalls Strain 9) and methionine knockout JT2 (iGEM 2018 -80 box strain 3) onto each plate, in their respective halves.

BioBricks - Hi Fi Assembly for BioBrick PCR Products

Nicole Wang, Amanda Kuang September 15, 2018 “Refer to Nicole Wang’s lab book, p.36

168

169

Using NEBuilder HiFi DNA Assembly Cloning Kit to assemble the MetE and RFP backbone PCR products.

Reagent Volume (uL) Positive Control (uL)

DNA insert 1.80 10

Vector 1

Master mix 10 10 diH2O 7.2 0

Total Volume 20 20

Incubated samples at 50 °C for 15 min

BioBricks - Transformation of HiFi Assembly MetE BioBrick

Nicole Wang, Amanda Kuang September 15, 2018 “Refer to Nicole Wang’s lab book, p.37

Followed heat shock transformation protocol without any deviations.

Transformed 3 uL DNA into 50 uL competent cells 1. Assembled product plated onto M9 -Met + Cm + IPTG 2. Assembled product plated onto M9 +Met + Cm + IPTG 3. Assembled product plated onto LB + Cm + IPTG 4. Positive control (for assembly) plated onto LB -added 40 uL 0.1M IPTG and 15 uL 25mg/mL Cm on top of plate and spread using hockey stick on the required plates

Results - All plates had growth, but plates had many more colonies than expected, and some were red

BioBricks - Colony PCR to Screen MetE BioBrick (HiFi Product)

Nicole Wang, Amanda Kuang, Atmn Patel September 20, 2018 “Refer to Nicole Wang’s lab book, p.38

Followed PCR protocol without any deviations. ● Used VF2 and VR verification primers

169

170

Recipe: Reagent Per reaction (in uL) No template control

Forward Primer (10 μM) 1 1

Reverse Primer (10 μM) 1 1

Taq Master Mix 10 10

Sterile, nuclease-free water 8 8

DNA Touched colony none

Thermocycler procedure: Taq MM

Step Temp Time Cycles (in C) (min:s)

Initial 95 10:00 1 denaturation denaturation 95 0:20 30 annealing 58 0:45 extension 68 2:30

Final 68 5:00 1 extension hold 4 Infinity 1

-chose to extend for 2:30 because extension time should be ~1 min/kb ● RFP gene ~ 0.6 kb ● MetE gene ~ 2.3 kb ● Used 2:30 to have enough time for MetE to be synthesized -screened 3 colonies: ● C1: white colony ● C2: white colony ● C3: red colony

170

171

BioBricks - Gel of Colony PCR for MetE HiFi Assembly Products

Nicole Wang September 21, 2018 “Refer to Nicole Wang’s lab book, p.39

Followed gel electrophoresis protocol without any deviations. ● Made a 1% agarose gel by adding 0.5 g of agarose and 50 mL 1X TAE ● Prepared PCR product samples for gel by adding 1uL DNA to 4uL diH2O and 1uL 6x loading dye

Well Sample

1 n/a

2 1kb gene ruler

3 n/a

4 C1

5 C2

6 C3

7 No template control

8 n/a

9 1kb gene ruler

10 n/a

1% agarose gel stained with gel red, run for 1h at 100 V.

No bands were present for the C1 (white) colony. C2 was another white colony, and produced a band that was about 1.5-2.0 kb. C3 (red colony) produced a band size of approximately 1.5 kb. Colonies C1 and C2 were expected to contain the MetE insert, which should be about 2.5 kb. Colony C3 was expected to contain RFP, which should be about 1.1 kb. The C2 band was smaller than expected, while the C3 band was larger than expected.

171

172

BioBricks - Backbone Gradient PCR Attempt 2

Clara Fikry September 22, 2018 “Refer to Nicole Wang’s lab book, p.42

Ran a gradient PCR with higher annealing temperatures because Attempt 1 (see pg. 125 of online lab book/pg 31 of Nicole Wang’s lab book) produced 2 bands in the upper annealing temperatures (annealing temp 67.2° and 68 °C). Since the bands in Attempt 1 were larger than expected, wanted to see if the second band (smaller and fainter) was our desired product.

Followed PCR protocol without any deviations. ● Used FP2 and RP2 primers to amplify backbone of pSB1C3 ● Ran a no Q5 polymerase control

Recipe: Reagent Per reaction (in uL) Jumbo cocktail (11 rxns) uL

Forward Primer (10 μM) 1 11

Reverse Primer (10 μM) 1 11

Q5 Master Mix 12.5 137.5

Sterile, nuclease-free water 9.5 104.5

DNA (1 ng/uL) 1 11

Thermocycler procedure:

Q5 2X HF MM

Step Temp time Cycles (in C)

Initial 98 30 sec 1 denaturation denaturation 98 10 sec 30 annealing 60-72 30 sec extension 72 1 min 15 sec

Final 72 2 min 1

172

173 extension hold 4 Infinity 1

A B C D E F G H

72°C 71.2°C 70.0°C 68.1°C 65.7°C 63.9°C 62.7°C 60.0

BioBricks - Gel of Backbone Gradient PCR Attempt 2 Products

Nicole Wang September 24, 2018 “Refer to Nicole Wang’s lab book, p.44

Well Sample

1 1 kb gene ruler

2 A (72.0 °C)

3 B (71.2 °C)

4 C (70.0 °C)

5 D (68.1 °C)

6 E (65.7 °C)

7 F (63.9 °C)

8 G (62.7 °C)

9 H (60.0 °C)

10 No polymerase control 1% agarose gel stained with gel red, run at 100 V for 45 min.

Bands were between 2500-3500 bp

173

174

BioBricks - PCR of pSKA397 MetE Attempt 2

Nicole Wang, Nicole Lassel, Amanda Kuang September 24, 2018 “Refer to Nicole Wang’s lab book, p.45

Purpose ● Isolate MetE and add appropriate overhangs for HiFi assembly

Followed PCR protocol without any deviations. ● Used FP1 and RP1 primers to amplify MetE from pSKA397 ● Prepared a no template control

Recipe: Reagent Per reaction (in uL)

Forward Primer (10 μM) 1

Reverse Primer (10 μM) 1

Q5 Master Mix 10

Sterile, nuclease-free water 7

DNA (1 ng/uL) 1

Thermocycler procedure:

Q5 2X HF MM

Step Temp time Cycles (in C)

Initial 98 0:30 1 denaturation denaturation 98 0:10 30 annealing 68.2 0:30 extension 72 2:15

Final 72 2:00 1 extension hold 4 Infinity 1

174

175

-gel showed no bands

BioBricks - PCR of pSKA397 MetE Attempt 3

Nicole Wang September 26, 2018 “Refer to Nicole Wang’s lab book, p.47

Purpose ● Isolate MetE and add appropriate overhangs for HiFi assembly

Followed PCR protocol without any deviations. ● Used FP1 and RP1 primers to amplify MetE from pSKA397 ● Prepared a no template control

Recipe: Reagent Per reaction (in uL)

Forward Primer (10 μM) 1

Reverse Primer (10 μM) 1

Q5 Master Mix 10

Sterile, nuclease-free water 7

DNA (1 ng/uL) 1

Thermocycler procedure:

Q5 2X HF MM

Step Temp time Cycles (in C)

Initial 98 0:30 1 denaturation denaturation 98 0:10 30 annealing 68.2 0:30 extension 72 2:15

Final 72 2:00 1 extension

175

176 hold 4 Infinity 1

-gel showed no bands again

Construction - Gradient PCR for Ccar GFP primers

Nicki Shaw September 26, 2018 “Refer to Nicki Shaw’s lab book, p33.

Miniprepped ccar according to protocol (monarch plasmid prep) Eluted in 30ul Nanodrop: 117.2ng/ul (260/280=1.94, 260/230=1.50)

Ordered the following primers to screen pSR43_6 (ingalls Lab plasmid) for the contents of GFP FWD: GACTCTGGTAACGACGCTGACT REV: TTTTGCTGGCCTTTTGCTCACA

Gradient PCR: 2X Taq MM

Step Temp time (in C)

Initial 98 30 s denaturation denaturation 98 10 sec annealing 55-65 30 s extension 68 50 s

Final 68 5 min extension hold 4 Infinity

Reaction mix: (ul) 1X 10X

MilliQ 6.29 62.9

FWD (diluted to 10uM) 1 10

REV (diluted to 10uM) 1 10

176

177

Template 0.171 1.71

2X Taq MM 10 100

30 cycles:

Tube Temp (celcius)

A 65.0

B 64.2

C 63.0

D 61.1 NTC temp

E 58.7

F 56.9

G 55.7

H 55.0

Ran on gel :) It worked

177

178

First attempt at cPCR screening for GFP in digested plasmid:

2X Taq MM

Step Temp time (in C)

Initial 98 30 s denaturation denaturation 98 10 sec annealing 64.2 30 s extension 68 50 s

Final 68 5 min extension hold 4 Infinity

(ul) 1X 18X

MilliQ 7 128

FWD (diluted to 10uM) 1 18

REV (diluted to 10uM) 1 18

Template

2X Taq MM 10 180

Expected band sizes: With GFP: 874bp Without GFP: 427bp

Gel was run and no bands appeared (controls looked good), re-ran the same experiment with the re-plated colonies and some of them were successful (kind whack but okay).

178

179

Made frozen stock of colony #4 and 5 according to protocol Nanodrop: Colony 4: 135.9 ng/uL Colony 5: 104.9 ng/uL

Construction - PCR screening for JT2 no GFP ccas strain

Nicki Shaw September 30, 2018

Ordered the following primers to screen pSR43_6 (ingalls Lab plasmid) for the contents of GFP FWD: GACTCTGGTAACGACGCTGACT REV: TTTTGCTGGCCTTTTGCTCACA

179

180

Used NEB calculator to determine the ™

BioBricks - Nanodrop of PCR Products

Nicole Wang, Amanda Kuang September 28, 2018 “Refer to Nicole Wang’s lab book, p.49

Sample Concentration (ng/uL) 260/280 260/230

A - MetE 458.0 1.88 0.79

H - backbone 444.5 1.86 0.79

Both samples had smooth chromatograms. There was a large peak at about 230 nm and smaller peak at 260 nm.

BioBricks - HiFi Assembly “Original”

Nicole Wang, Amanda Kuang September 28, 2018 “Refer to Nicole Wang’s lab book, p.50

Purpose ● HiFi assembly of MetE and backbone PCR products. ● Repeat of previous attempt using MetE and backbone PCR products (See pg 36 of Nicole Wang’s lab book)

Followed NEBuilder HiFi Assembly protocol without any deviations. ● Used the NEBio Ligation Calculator to help calculate volumes of vector and insert DNA (2:1 ratio of insert to vector DNA)

Recipe: Reagent Volume ( uL)

Insert (A-MetE) 1.80

Vector (H-backbone) 1

Master Mix 10 diH2O 7.2

180

181

-incubated at 50°C for 15 min

BioBricks - HiFi Assembly “Fake”

Nicole Wang, Amanda Kuang September 28, 2018 “Refer to Nicole Wang’s lab book, p.52

Purpose ● HiFi assembly of synthesized MetE cassette into linearized (undigested) pSB1C3 backbone

Followed NEBuilder HiFi Assembly protocol without any deviations. ● Used the NEBio Ligation Calculator to help calculate volumes of vector and insert DNA (2:1 ratio of insert to vector DNA)

Sample Insert/Vector Length (bp) Concentration (ng/uL)

Synthesized MetE Cassette Insert 2693 10

Linearized pSB1C3 (undigested) Vector 2070 25

Recipe: Reagent Volume ( uL)

Insert 9.35

Vector 2

Master Mix 10 diH2O 7.2

-incubated at 50°C for 15 min

BioBricks - Transformation of HiFi Assembly MetE BioBrick

Amanda Kuang, Vincent Halim, Nicole Wang September 28, 2018 “Refer to Nicole Wang’s lab book, p.53

“Original” = original plan, HiFi assembly product of MetE in Bba_J04450 “Fake” = HiFi assembly using synthesized MetE cassette in linearized pSB1C3

181

182

Followed heat shock transformation protocol with the following deviations. ● Added 2 uL DNA into 50 uL NEBio competent cells (DH5a) ● Plated 100 uL of each “low concentration” transformation, by plating 100 uL after 1h incubation, without pelleting and concentrating the cells ● Plated 100 uL of each “high concentration” transformation by plating 100 uL after concentrating the cells ● Plated onto LB + Cm plates

Biobricks - Colony PCR of “Original” and “Fake” Transformants

Clara Fikry, Dylan Perera September 29, 2018 “Refer to Nicole Wang’s lab book, p.54-55

Colony PCR of successful transformants from “original” and “fake” HiFi Assembly

Followed PCR protocol with no deviations. ● Used VF2 and FR primers to verify the size of the insert

Cells were spot plated onto LB+Cm

Recipe: Reagent Per rxn (uL) Jumbo cocktail - Per 25 rxns (uL)

MilliQ 3 75

FWD (diluted to 10uM) 1 25

REV (diluted to 10uM) 1 25

2X Taq MM 10 250

Template 5 uL resuspended n/a cells in sterile water

2X Taq MM

Step Temp time cycles (in C)

Initial 95 10:00 1 denaturation denaturation 95 0:20 25 annealing 60 0:45

182

183 extension 68 3:00

Final 68 5:00 1 extension hold 4 Infinity 1

Protocol saved as “biobrick verif”

Results Hi Fi “FAKE”

------Hi Fi “Original"

183

184

185

There is a clear difference between the bands sizes produced from red colonies and beige colonies.

185

186

Doubling Time of DH5alpha in M9 (attempt #1) Leah, Clara, Caleb, Nicki &Seb

Oct 7th - refer to Leah’s lab book pg. 37

DH5alpha with GFPcm+ and the Photoreceptor sp+ was inoculated overnight in LB (Oct 6). The next morning (Oct 7) 100ul of overnight culture was inoculated into 25ml of drop out M9 (-methionine) with 25ul Cm and 25ul Sp. The overnight culture of DH5alpha was also inoculated into drop out M9 (-methionine) with thiamine (B1), 25ul cm and 25ul Sp in triplicates a-c.

M9 media with thiamine and without was used to determine if the absence of thiamine has a significant effect on the growth rate of DH5alpha.

Table 1. OD of DH5+GFP in M9 (-Methionine -Thiamine) Time a b c 11:48 0.012 0.014 0.011 1:30 0.022 00.20 0.020 2:00 0.047 0.051 0.054 2:20 0.075 0.074 0.072 2:40 0.090 0.090 0.090 3:00 0.102 0.101 0.100 3:20 0.137 0.131 0.138 3:40 0.176 0.172 0.176 4:00 0.231 0.220 0.217 4:20 0.276 0.279 0.302

186

187

4:40 0.348 0.358 0.388 5:00 0.420 0.425 0.473

Table 2. OD of DH5+GFP in M9 (-Methionine +Thiamine) Time d e 11:48 0.015 0.014 1:30 0.021 0.019 2:00 0.055 0.061 2:20 0.069 0.074 2:40 0.096 0.093 3:00 0.103 0.103 3:20 0.138 0.131 3:40 0.183 0.184 4:00 0.243 0.224 4:20 0.334 0.355 4:40 0.406 0.355 5:00 0.515 0.461

187

188

Sample Doubling Time (min) R2 A 62.2 0.995 b 58.3 0.996 c 54.8 0.996

E (M9 + B1) 52.2 0.995

F (M9 + B1) 57.0 0.995

Average doubling time:

DH5alpha + GFP/Photoreceptor in M9 media without B1: 58.43min DH5alpha + GFP/Photoreceptor in M9 media with B1: 54.6 min

There does not seem to be a significant effect on DH5alpha growth rate in absence of thiamine. However the cells were no washed before inoculating, so it is possible that the LB contaminated the media with a trace amount of thiamine. This experiment will be repeated with cells that have been washed before inoculating into M9.

188

189

Doubling Time of JT2_Ccas/r_GFP in M9 (4095 green)

Leah, Clara, Caleb, Nicki & Seb

Oct 7th - refer to Leah’s lab book pg. 36

The goal of this experiment is to determine the growth rate of JT2(metE knock out) with Ccas/r v2 under full green light.

JT2 with Ccas/r v2 was inoculated overnight in LB (Oct 6). The next morning (Oct 7) 100ul of overnight culture was inoculated into 25ml of drop out M9 (-methionine) with 25ul Cm and 25ul Sp. The cells were grown under medium red/green (2000/500) light for 3h to normalize the cells. After the 3h the cells were diluted to an OD below 0.05 and the lights were switched to full green (4095). The growth of the cells was monitored using OD 600 measurements every 20min for 3h.

Table 2. OD of JT2 + Ccas/r V2 in M9 (-Methionine ) Time a b 6:39pm 0.053 0.047 0.043

6:59 0.074 0.073 0.062

7:19 0.087 0.082 0.072 7:39 0.106 0.094 0.079 8:00 0.132 0.120 0.097 8:20 0.168 0.155 0.118 8:40* 0.217 0.200 0.158 9:00 0.282 0.255 0.189 9:20 0.369 0.34 0.239

189

190

9:40 0.491 0.381 0.455

* sample run on flow cytometer to observe GFP expression (2mw 488 laser)

Sample Doubling Time (min) R2 a 55.3 0.999 b 54.2 0.999 c 62.0 0.997

Average doubling time:

JT2 + Ccas/r v2 in M9 (methionine drop out) under full green light: 57.2min

The doubling time of JT2 (under full green) and DH5alpha are very similar. This is not what we were expecting to see. In previous experiments DH5alpha has had a significantly slower growth rate compared to JT2 in M9.

190

191

Doubling Time of DH5alpha_GFP in M9 (attempt #2) Leah

Oct 8th - refer to Leah’s lab book pg. 40

To avoid LB contamination when inoculating into M9 from the overnight culture the cells were washed 3x in phosphate buffer solution (PBS). - Centrifuge 1ml of cells for 1min - Remove liquid - Resuspend cells in 1ml PBS - Repeat

After being washed 100ul of DH5alpha with GFPcm+ and the Photoreceptor sp+ was inoculated into 25ml of drop out M9 (-methionine) with 25ul Cm and 25ul Sp. OD 600 values were monitored for 3h to determine doubling time.

To confirm that removing the LB before inoculation affects the growth rate of DH5alpha in M9 two sample were prepared without washing (table.2)

Table 1. OD of DH5+GFP in M9 (-Methionine -Thiamine) *Washed* Time a b c 4:20pm 0.028 0.043 0.025 6:05 0.059 0.042 0.049 6:25 0.050 0.058 0.067 6:45 0.122 0.074 0.089 7:05 0.148 0.081 0.157 7:25 0.174 0.115 0.157

191

192

7:45 0.225 0.206 0.188 8:05 0.321 0.299 0.312 8:25 0.421 0371 0.378

Table 2. OD of DH5+GFP in M9 (-Methionine -Thiamine) *Not Washed* Time a b 4:20pm 0.021 0.022 6:05 0.048 0.046 6:25 0.063 0.060 6:45 0.070 0.082 7:05 0.071 0.097 7:25 0.077 0.138 7:45 0.127 0.191 8:05 0.245 0.308 8:25 0.364 0.390

192

193

Sample Doubling Time (min) R2 A 46.1 0.996 b 35.7 0.957 c 44.1 0.960

E (not washed) 26.1 0.992

F (not washed) 38.6 0.985

Average doubling time:

DH5alpha + GFP/Photoreceptor in M9 media (washed): 42 DH5alpha + GFP/Photoreceptor in M9 media (not washed): 32.35

It seems as though washing the cells increases their doubling time but the doubling time is still lower than we are expecting for DH5alpha :(

What we know:

193

194

- Lb contamination in M9 decreases growth rate so cells must be washed before inoculation - Growth rate is still faster than we expected - Turns out when you inoculate straight from LB for the first part of the run the cells are still behaving as if they were growing in LB. Then for the second part of the run they adjust and show their true growth rate in M9. Solution: - Wash overnight cells before inoculating in M9 - Grow the cells in LB overnight. Inoculate into M9 in the morning and then start the experiment as normal in the evening but inoculating from the M9. This will give them time to adjust before our experiment starts.

Doubling Time of DH5alpha_GFP in M9 (attempt #3) Leah

Oct 11th - refer to Leah’s lab book pg. 41

Table 2. OD of DH5+GFP in M9 (-Methionine -Thiamine) *washed + pre-adjusted to M9* Time a b c 11:00pm 0.051 0.062 0.035 11:20 0.072 0.082 0.077 11:45 0.1 0.105 0.105 12:05 0.125 0.13 0.130 12:25 0.148 0.163 0.163 12:45 0.162 0.173 0.173 1:05 0.183 0.197 0.197 1:25 0.192 0.208 0.208

194

195

Sample Doubling Time (min) R2 A 153.6 0.976 b 161.0 0.972 c 161.0 0.972

DH5alpha + GFP/Photoreceptor in M9 media (washed): 158.5 min

There we go. This is the doubling time we were expecting from DH5alpha in M9. We now know that going forward we need to:

1. Wash the cells before transferring to M9 2. Introduce cells to M9 the morning before starting the experiment

= slow growing cells and a happy lab member :)

195

196

Doubling Time of JT2_Ccas/r_GFP in M9 (2000green/2000red)

Leah

Oct 11th - refer to Leah’s lab book pg. 42

Table 2. OD of JT2_Ccas/r_GFP in M9 drop out media (2000g/2000r) Time a b c 11:20 0.066 0.084 0.079 11:45 0.086 0.108 0.105 12:05 0.120 0.158 0.154 12:25 0.145 0.193 0.2053 12:45 0.187 0.252 0.268 1:05 0.297 0.368 0.384 1:25 0.400 0.484 0.495

196

197

Sample Doubling Time (min) R2 A 46.6 0.957 b 49.5 0.980 c 46.1 0.990

JT2 + Ccas/r v2 in M9 (methionine drop out) under 2000green 2000red light: 47.4min

197

198

Doubling Time of JT2_Ccas/r_GFP in M9 (2000green/4095red) Leah & Nicki

Oct 11th - refer to Nicki’s Lab book

Table 2. OD of JT2_Ccas/r_GFP in M9 drop out media (2000g/2000r) Time a b c 8:46 0.063 0.065 0.058 9:30 0.065 0.061 0.065 10:00 0.084 0.078 0.081 10:20 0.101 0.095 0.095 10:40 0.123 0.120 0.115 11:00 0.172 0.145 0.149 11:20 0.207 0.189 0.199 11:40 0.269 0.273 0.280 12:00 0.363 0.360 0.360 12:20 0.462 0.473 0.463 12:40 0.574 0.621 0.596 1:00 0.686 0.689 0.650

198

199

Sample Doubling Time (min) R2 A 80.7 0.990 b 73.8 0.995 c 79.5 0.996

JT2 + Ccas/r v2 in M9 (methionine drop out) under 2000green 4095red light: 78min

199

200

Doubling Time of DH5alpha_No GFP in M9 Leah & Nicki

Cells were adjusted to M9 and washed before starting the experiment.

Sample Doubling Time (min) R2 A 105.3 0.951 b 101.5 0.986 c 108.8 0.986

JT2 + Ccas/r v2 in M9 (methionine drop out) under 2000green 4095red light: 105.2 min

200

201

Doubling Time of JT2_CcaS/R_GFP in M9(drop out) Under Various Green Light Intensities Ratios Leah & Kingsley Refer to Leah’s lab book

Table: Growth Rates of JT2_Ccas/r_GFP under various intensities of green light in M9 drop out media Time Full Green Full Green Full Red Full Red Medium Medium Duplicate Duplicate Green Green Duplicate 6:40 0.049 0.046 0.038 0.038 0.043 0.043 7:15 0.031 0.034 0.026 0.024 0.032 0.032 7:44 0.038 0.040 0.029 0.028 0.037 0.039 8:05 0.044 0.049 0.032 0.031 0.044 0.047 8:50 0.086 0.077 0.053 0.038 0.082 0.092 9:10 0.086 0.099 0.046 0.047 0.086 0.105 9:30 0.121 0.104 0.050 0.052 0.105 0.133 9:50 0.142 0.149 0.074 0.068 0.147 0.151 10:10 0.162 0.194 0.067 0.071 0.179 0.227 10:35 0.218 0.261 0.081 0.087 0.265 0.330 10:55 0.263 0.335 0.086 0.097 0.343 0.420 11:15 0.329 0.435 0.096 0.115 0.454 0.524 11:35 0.431 0.482 0.125 0.137 0.574 0.568

Full Green: Red 4095/4095, Green 409/4095 Full Red: Red 4095/4095, Green 0/4095 Medium Green: Red 4095/4095, Green 2000/4095

*All populations were initialized for 3 hours under the light ratio that they are being tested under.

201

202

Population R2 Doubling Time (min) Average Doubling Time

Full Green 0.994 68.8

Full Green Duplicate 1.000 55.5 62.15

Full Red 0.957 90.3

Full Red Duplicate 0.995 91.4 90.85

Medium Green 0.998 48.8

Medium Green Duplicate 0.995 54.0 51.4

Co-Culture + Robots Unite

(i.e the understudy takes the stage)

Leah and Max Pg 45-46 in Leah’s Lab book

This experiment was supposed to be performed using the flow cytometer but it decided to break a week before wiki freeze. Instead, we decided to give the Robot a chance to shine.

The goal of this experiment is to see if competition is a problem between two populations with different growth rates(ii) and if two populations with similar growth rates will maintain a stable co-culture (i). The results we received from this experiment were inconclusive and will have to be repeated using the flow cytometer. Unfortunately, this experiment will not make it onto the wiki.

Procedure:

1. Cells were diluted into M9 and grown until they reached exponential phase, O.D ~0.1 2. Cells in exponential phase were diluted to match OD of each other closely and then mixed to make our desired populations

Population (i) : 50/50 Mix of DH5alpha+GFP and DH5alpha-GFP Population (ii): 50/50 Mix of DH5alpha +GFP and JT2+CcaS/R

202

203

3. The mixtures were then analyzed for green fluorescence levels using the robot at time 0 and in one hour increments following mixing. Populations were maintained at an OD of 0.05-0.3 to keep them in exponential phase.

We were only able to obtain 3 data points, 0, 1h, 2h. We observed GFP levels increasing from time 0 to 1 and decreasing from 1h to 2h. Since we do not know enough about our system and the Robots ability to track fluorescence we can not make a conclusion on how our co-cultures are behaving.

Biobricks - Testing MetE BioBrick in JT2

Nicole Wang, Leah Fulton October 15, 2018 “Refer to Nicole Wang’s lab book, p.61-62

Purpose: to test that the MetE BioBrick in JT2 will grow in M9 deficient methionine media.

Inoculated MetE BioBrick in JT2, empty JT2, and pSB3C5 in DH5a into 5 mL LB with the appropriate antibiotics

After growing overnight at 37 degrees, 1 mL of each culture was washed 3x with M9 with methionine, and 1 mL was washed 3x with M9 without methionine. 20 uL was inoculated into 5mL of M9 with or without methionine, with the appropriate antibiotics.

Plasmid E. coli strain Medium Antibiotic

MetE biobrick JT2 M9 - Met Cm Km (BBa_K2573000)

MetE biobrick JT2 M9 + Met Cm Km (BBa_K2573000)

None JT2 M9 - Met Km

None JT2 M9 + Met Km

BBa_J04450 DH5a M9 - Met Cm

BBa_J04450 DH5a M9 + Met Cm

Measured OD600 after inoculation. Grew overnight at 37 degrees, then measured OD.

203

204

Sample Initial OD Final OD Growth

JT2 empty (+ met) 0.011 1.262 Positive

JT2 empty (-met) 0.012 0.0752 Negative

Bba_K2573000 0.011 1.237 Positive Biobrick (+ met)

Bba_K257300 0.010 1.311 Positive Biobrick (-met)

Bba_J04450 in 0.005 1.420 Positive DH5a

Bba_J04450 in 0.006 1.506 Positive DH5a

The DH5a grew in both M9 +/- met which means the media is able to sustain growth. Empty JT2 in M9 without methionine did not grow, which is a control showing that it does not have a functional metE gene. Biobrick in JT2 was able to grow in M9 deficient media, meaning it worked!! (:

204