Isolation and Characterization of Polymorphic Microsatellite Loci From

Integrative Zoology 2019; 14: 318–322 doi: 10.1111/1749-4877.12331

1 LETTER TO THE EDITOR 1 2 2 3 3 4 4 5 5 6 6 7 Isolation and characterization of polymorphic microsatellite 7 8 8 9 loci from pale-edged stingray, Telatrygon zugei (Elasmobranchii, 9 10 10 11 Dasyatidae) 11 12 12 13 13 14 Fanglei SHI1,2*, Hui WANG3*, Atsuko YAMAGUCHI4, Baowei ZHANG3 and Jie ZHANG1 14 15 15 1 16 Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China, 16 2 3 4 17 University of Chinese Academy of Sciences, Beijing, China, School of Life Science, Anhui University, Hefei, China and Faculty 17 18 of Fisheries, Nagasaki University, Nagasaki, Japan 18 19 19 20 20 21 21 22 INTRODUCTION 2007). Despite the combination of known high biodi- 22 23 versity and heavy exploitation of elasmobranchs in Chi- 23 24 Sharks, skates and rays originated 400 Ma, with a na, there is little reliable information on the population 24 25 further radiation throughout every ocean, and play a vi- genetics of many shark and ray species. Consequent- 25 26 tal role in maintaining the balance of marine ecosys- ly, clarification of the population structure is crucial for 26 27 tems as top predators (Weigmann 2016). There are more conservation and management, especially for endan- 27 28 than 1000 species of sharks, skates, rays and chimae- gered elasmobranchs. 28 ras in the world, 244 of which are distributed in Chinese 29 Dasyatidae is one of the largest families of elasmo- 29 seas. That is, Chinese chondrichthyan fauna make up 30 branchs, comprising 19 genera and at least 86 living 30 at least one-fifth of the world’s extant species. Recent 31 species. They are distributed circumglobally in tropical, 31 habitat degradation and overexploitation have caused 32 subtropical and temperate waters (Nelson 2006; Last 32 sharp declines in many populations of elasmobranchs 33 et al. 2016). The pale-edged stingray, Telatrygon zugei 33 (White 2007; Dulvy et al. 2017). Environmental chang- 34 (Müller & Henle, 1841), is an inner continental stingray 34 es and loss of oceanic apex predators due to overfishing 35 of the Indo-West Pacific, typically found along the con- 35 could affect the migration routes and distribution of ba- 36 tinental shelf of the Gulf of Thailand, the Java Sea, and 36 toids (rays), resulting in community restructuring in the 37 the coastal waters off southern China and western Japan 37 coastal ecosystem (Yamaguchi et al. 2005; Myers et al. 38 at <100m (Kyne et al. 2012). T. zugei is consumed lo- 38 39 cally but also forms a significant component of the elas- 39 40 mobranch bycatch within the demersal fishery through- 40 41 out its range (White 2007). The fecundity of T. zugei is 41 42 very low, with females usually possessing only a sin- 42 43 Correspondence: Baowei Zhang, School of Life Science, gle embryo (White 2003). Because of high levels of ex- 43 44 Anhui University, Hefei 230039, China. ploitation and low resource resilience, T. zugei is listed 44 45 45 Email: [email protected] as near threatened (NT) by the IUCN (2017). 46 46 Jie Zhang, Key Laboratory of Animal Ecology and Microsatellite markers are widely used co-domi- 47 47 nant genetic markers and have proven to be optimal in 48 Conservation Biology, Institute of Zoology, Chinese Academy 48 assessing population structure for conservation genet- 49 of Sciences, Beijing 100101, China. 49 ics (Harper et al. 2003; Guyomard et al. 2006). In this 50 Email: [email protected] 50 study, we developed 9 highly polymorphic microsatel- 51 *These authors contributed equally to this work. 51

1 lite primers in the pale-edged stingray, which will allow along the Indo-West Pacific coastline from 6 locations: 1 2 for investigating the genetic diversity and population Ariake Bay in Japan (JP), the Gulf of Thailand (TLD) 2 3 genetic structure of T. zugei, as well as proposing scien- and the Andaman Sea (ADM), and 3 localities along the 3 4 tific evidence for management and conservation. coast of the East China and South China Seas, includ- 4 5 ing Shandong (SD), Guangdong (GD) and Hainan (HN) 5 6 MATERIALS AND METHODS (Table 1). Primers were tested on 92 T. zugei individu- 6 7 als to check the polymorphism of loci. PCR reactions 7 8 The screening process for microsatellites mainly ad- were performed in 20-μL volumes: 100 to 200 ng of ge- 8 9 hered to the FIASCO protocol (Zane et al. 2002). Ge- nomic DNA, 10 µL 2 × EasyTaq PCR Supermix (Trans- 9 10 nomic DNA was extracted from the fin tissue of one in- Gen Biotech) and 2.5 pmol of each primer pair (forward 10 11 dividual using the DNeasy Blood & Tissue kit (Qiagen). primer fluorescently labeled with FAM, HEX or TAM- 11 12 Approximately 250 ng DNA was digested by MesІ, and RA). The amplification was performed on an Applied 12 13 DNA fragments were ligated to the double-strand MesІ Biosystems (ABI) 2720 thermal cycler under the fol- 13 14 AFLP adaptor (MseI R:5′-GAC GAT GAG TCC TGA lowing conditions: an initial denaturing step at 95 °C for 14 15 G-3′ and MseI F: 5′-TAC TCA GGA CTC AT-3′). Then, 5 min, followed by 30 cycles of 30 s at 95 °C, with the 15 16 these DNA fragments were amplified with AFLP adap- annealing temperature at 50 °C or 55 °C for 30 s, and 40 16 17 tor-specific primers (MseI-N: 5′-GAT GAG TCC TGA s at 72 °C, and a 10-min extension at 72 °C. The PCR 17 18 GTA A-3′) for enrichment. The enriched DNA fragments products were separated on an ABI PRISM 3730 genetic 18 19 were hybridized with 5′-biotinylated probe (AC)12 and analyzer (Applied Biosystems) with a GS500 size stan- 19 20 (AG)12 for selection. The hybrid was restored to a dou- dard. 20 21 ble-strand pattern by PCR. The DNA strand was ligated To test the transferability of the microsatellite loci, 21 22 into the pEASY-T1 Simple Cloning Vector (TransGen) we also tested these loci for cross-amplification us- 22 23 and transformed into Trans5α chemically competent ing species from a different genus: Hemitrygon akajei, 23 24 cells (TransGen). The cells were plated on LB-ampicil- Hemitrygon bennetti, Neotrygon kuhlii and Himantura 24 25 lin plates supplemented with IPTG and X-Gal. Recom- microphthalma. Extractions and genotyping were con- 25 26 binants were screened by PCR with vector primers and ducted following the same protocol as above. 26 27 AC/AG primers. Clones with PCR products showing 27 Genotypes were analyzed using GENMARKER (ver- 28 multiple bands in 2% agarose electrophoresis were con- 28 sion 1.3, SoftGenetics LLC). Micro-Checker (van Oos- 29 sidered as positive clones and picked out for sequenc- 29 terhout et al. 2004) was used to detect genotyping errors 30 ing. Sequences were checked for microsatellites by 30 due to null alleles, stuttering or allele dropout. The num- 31 Tandem Repeat Finder (Benson 1999). We eliminated 31 ber of alleles (N ), observed heterozygosity (H ), ex- 32 sequences with any of the following conditions: (i) re- A O 32 pected heterozygosity (H ) and polymorphic information 33 peat units number less than 10; (ii) either side of flank- E 33 content (PIC) were calculated with software Cervus 3.03 34 ing sequence was not long enough for designing primer; 34 (Marshall et al. 1998). Departure from Hardy–Weinberg 35 and (iii) the core sequence had compound repeat units, 35 equilibrium (HWE) and linkage disequilibrium (LD) 36 such as diuncleotide and triuncleotide compound repeat 36 were tested with GENEPOP v3.4 (Raymond & Rousset 37 motifs. 37 1995). 38 A total of 92 T. zugei individuals were collected 38 39 39 40 40 41 41 42 Table 1 Sampling site information 42 43 43 Abbreviation Locality (sea area) Longitude Latitude Sample size 44 44 45 JP Japan (Arike Sound) 130.14–130.60°E 32.62–33.18°N 20 45 46 SD Shandong, China (Yellow Sea) 118.92–122.55°E 36.95–37.86°N 6 46 47 GD Fujian and Guangdong, China (East China Sea) 113.62–1189.20°E 22.45–25.37°N 14 47 48 HN Hainan, China (South China Sea) 108.63–110.15°E 20.05–18.25°N 20 48 49 49 TLD Thailand (Gulf of Thailand) 100.60–101.56°E 12.59–13.51°N 12 50 50 51 ADM Andaman Sea (Indian Ocean) 100.60–101.56°E 12.59–13.51°N 20 51

1 RESULTS loci. We also detected the genetic diversity of the 9 loci 1 2 in 6 populations. The number of alleles (NA) per locus 2 3 A total of 108 positive clones were picked up for se- ranged from 6 (locus DzuI45) to 56 (locus DzuI25). Ob- 3 quencing and 90 of them were sequenced successful- 4 served heterozygosities (HO) and expected heterozy- 4 ly; 50 unique sequences were chosen for primer de- 5 gosities (HE) ranged from 0.429 (locus DzuI57) to 1.0 5 6 sign and 20 primers were designed using Premier 5. (multiple loci) and 0.621 (locus DzuI45) to 0.989 (locus 6 7 These 20 primers were tested on 92 T. zugei individu- DzuII15), respectively. The PIC value ranged from 0.56 7 8 als by amplification. Of these 20 primers, 9 produced (locus DzuI45) to 0.96 (locus DzuII15). Overall, all loci 8 9 stable amplification results and showed high polymor- were highly polymorphic in all 6 populations (Table 3). 9 phism. The numbers of alleles per locus ranged from 20 10 Nine microsatellite loci were tested for cross-species 10 to 56, whereas the observed and expected heterozygosi- 11 amplification. We used all primer pairs to amplified -se 11 ty ranged from 0.604 to 0.935 and from 0.874 to 0.981, 12 quences successfully in Hemitrygon akajei, Hemitrygon 12 respectively (Table 2). There is no evidence for scoring 13 bennetti, Neotrygon kuhlii and Himantura microphthal- 13 error due to stuttering or large allele dropout and no ex- 14 ma. These highly polymorphic and non-species-specif- 14 istence of null alleles was found at any loci. No signifi- 15 ic microsatellites will be useful for further research to 15 cant departure from the genotype frequencies expected 16 investigate the genetic diversity, population structure 16 under the null hypothesis of Hardy–Weinberg equilib- 17 and conservation genetics of T. zugei and other Dasyatid 17 rium was detected after Bonferroni correction. No sig- 18 species. 18 19 nificant linkage association was found among all these 19 20 20 21 21 22 22 Table 2 Characteristics of the 9 microsatellite loci isolated from Telatrygon zugei locus name, primer sequences, repeat motif, allele 23 23 sizes, annealing temperature (Ta), number of alleles (N ), polymorphic information content (PIC), observed (H ) and expected (H ) 24 A O E 24 heterozygosities, and GenBank accession number 25 25 26 Repeat Size range GenBank 26 Locus Primer sequences (5′–3′) Ta (°C) NA HO HE PIC 27 motif (bp) accession number 27 28 F: TAMRA- 28 DzuI25 AGCCAACCATGAGTCTTCTTT (AC)58 50 142–230 56 0.611 0.981 0.975 KF555248 29 29 R: AATGCCTCTTTCTTTCTATGCTA 30 30 F: TAMRA-GCATCTGCATTCCGTCATA 31 DzuI31 (AC)16 50 206–282 39 0.880 0.954 0.946 KF555250 31 32 R: TTGCTCCTGCCAGATAAAGTC 32 33 F: FAM-GCCCAGCAGAATACAAGGTG 33 DzuI45 (GT)23 50 187–261 25 0.728 0.918 0.907 KF555249 34 R: CCATATCCAGGTTTACAGACAA 34 35 35 F: HEX- 36 36 DzuI46 CCGACGGAGGGATTACTTACT (AC)40 50 365–485 43 0.859 0.955 0.948 KF555251 37 37 R: TCTCCATAGCAGCAAACAATCA 38 F:TAMRA- 38 39 DzuI57 TGCCAAACAAAGTCACCCTCAC (AC)18 55 228–256 20 0.604 0.874 0.857 KF555253 39 40 R: GGACCAACAGTTCTAACCATCATC 40 41 F: HEX- 41 42 DzuI71 AGTCATCCGCCATCATCTACAAAT (AC)59 55 236–258 43 0.880 0.952 0.944 KF555254 42 43 R: GGTCAAGTGAAAGGGGAGGAAGT 43 44 F: HEX-CACCTATCCCACCCCCTCTA 44 DzuI82 (AC)24 55 130–204 43 0.912 0.965 0.958 KF555255 45 R: CGTCCCATTGTGTCTGTGATAAA 45 46 46 F: FAM-GATGCAAACTGTCTCCCTGTA 47 DzuII15 (AG)41 55 178–306 56 0.935 0.976 0.970 KF555256 47 48 R: GTCTGATGCCTTGCCCACTA 48 49 F: HEX- 49 50 DzuII64 TTTCTCCGGTGTTGCATTATTTGT (CT) 30 50 234–356 52 0.633 0.969 0.962 KF555257 50 51 R:AACTTCTTGCCTCCCTGTCATTTT 51

1 Table 3 Polymorphism information of the 9 loci in 6 populations 1 2 2 Locus JP SD GD 3 3 N H H PIC N H H PIC N H H PIC 4 A E O A E O A E O 4 DzuI25 27 0.976 0.8 0.949 7 0.933 0.8 0.82 14 0.929 0.429 0.887 5 5 6 DzuI31 12 0.889 0.9 0.852 8 0.894 1 0.8 14 0.915 0.714 0.873 6 7 DzuI45 6 0.621 0.6 0.56 10 0.955 1 0.864 14 0.923 0.857 0.881 7 8 DzuI46 11 0.88 0.9 0.84 9 0.939 1 0.847 11 0.923 0.857 0.88 8 9 DzuI57 10 0.876 0.85 0.837 7 0.933 0.6 0.82 12 0.921 0.429 0.877 9 10 DzuI71 15 0.872 0.95 0.835 8 0.924 1 0.83 15 0.926 0.786 0.884 10 11 DzuI82 14 0.862 0.85 0.826 9 0.978 1 0.868 13 0.929 1 0.886 11 12 12 DzuII15 18 0.915 1 0.884 10 0.97 0.833 0.879 24 0.989 1 0.952 13 13 DzuII64 11 0.842 0.75 0.8 5 0.893 0.25 0.746 18 0.958 0.714 0.919 14 14 15 Locus HN TLD ADM 15 16 NA HE HO PIC NA HE HO PIC NA HE HO PIC 16 17 DzuI25 21 0.966 0.526 0.937 15 0.946 0.583 0.899 18 0.951 0.6 0.92 17 18 DzuI31 20 0.95 0.85 0.922 21 0.92 1 0.945 19 0.954 0.85 0.926 18 19 DzuI45 15 0.912 0.9 0.88 11 0.989 0.167 0.871 15 0.905 0.9 0.873 19 20 DzuI46 17 0.945 0.8 0.916 17 0.97 0.833 0.926 23 0.965 0.85 0.939 20 21 DzuI57 8 0.821 0.45 0.773 6 0.754 0.583 0.691 9 0.845 0.65 0.803 21 22 22 DzuI71 19 0.954 0.85 0.926 16 0.967 0.833 0.922 23 0.964 0.9 0.937 23 23 DzuI82 25 0.974 1 0.948 20 0.982 0.833 0.938 20 0.955 0.85 0.927 24 24 25 DzuII15 31 0.986 0.9 0.96 16 0.96 1 0.915 15 0.885 0.85 0.85 25 26 DzuII64 24 0.969 0.7 0.942 16 0.96 0.667 0.915 19 0.96 0.45 0.933 26

27 HE, expect expected heterozygosity; HO, observed heterozygosity; NA, number of alleles; PIC, polymorphic informa- 27 28 tion content. 28 29 29 30 30 31 31 32 32 33 ACKNOWLEDGMENTS analyze DNA sequences. Nucleic Acids Research 27, 33 34 573–80. 34 We acknowledge the financial support provided by 35 Dulvy NK, Simpfendorfer CA, Davidson LNK et al. 35 the Strategic Priority Research Program of the Chi- 36 (2017). Challenges and priorities in shark and ray 36 nese Academy of Sciences (No. XDA19050202), the 37 conservation. Current Biology 27, R565–72. 37 National Science Fund of China (No. 31272287), the 38 Guyomard R, Mauger S, Tabet-Canale K et al. (2006). A 38 39 Ministry of Agriculture of China, Grants-in-aid for 39 Conservation of Fishery Resources under Grant No. type I and type II microsatellite linkage map of rain- 40 bow trout (Oncorhynchus mykiss) with presumptive 40 41 17162130135252095 and the JSPS Invitation Fellow- 41 ship Program for Research in Japan. We are grateful to coverage of all chromosome arms. BMC Genomics 7, 42 302. 42 43 Xiaoxue Zhu, Xin Huang and Tao Pan for their help in 43 Harper GL, Maclean N, Goulson D (2003). Microsat- 44 sampling and laboratory work. Special thanks to Mr 44 ellite markers to assess the influence of population 45 Xinming Feng, who made great effort to collect sam- 45 size, isolation and demographic change on the genet- 46 ples during fieldwork. Thanks to Paul Garber and Joel 46 ic structure of the UK butterfly Polyommatus bellar- 47 Corush for English editing. 47 gus. Molecular Ecology 12, 3349–57. 48 48 49 REFERENCES IUCN (2017). The IUCN Red List of Threatened Spe- 49 50 cies. [Cited 15 Mar 2017.] Available from URL: 50 Benson G (1999). Tandem repeats finder: A program to 51 http://iucnredlist.org/ 51

1 Kyne PM, Carlson JK, Ebert DA et al. (2012). The Con- ing and correcting genotyping errors in microsatellite 1 2 servation Status of North American, Central Amer- data. Molecular Ecology Notes 4, 535–8. 2 3 ican,and Caribbean Chondrichthyans, Technical re- Weigmann S (2016). Annotated checklist of the living 3 4 port. IUCN Species Survival Commission Shark sharks, batoids and chimaeras (Chondrichthyes) of 4 5 Specialist Group, Vancouver Canada. the world, with a focus on biogeographical diversity. 5 6 Last PR, Naylor GJ, Manjaji-Matsumoto BM (2016). A Journal of Fish Biology 88, 837. 6 7 7 revised classification of the family Dasyatidae (Chon- White WT (2003). Aspects of the biology of elasmo- 8 8 drichthyes: Myliobatiformes) based on new morpho- branchs in a subtropical embayment in Western Aus- 9 9 logical and molecular insights. Zootaxa 4139, 345– tralia and of chondrichthyan fisheries in Indonesia 10 10 68. (PhD dissertation). Murdoch University, Perth. 11 11 Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998). 12 White WT (2007). Species and size compositions and re- 12 Statistical confidence for likelihood-based paternity 13 productive biology of rays (Chondrichthyes, Batoidea) 13 inference in natural populations. Molecular Ecology 14 caught in target and non-target fisheries in eastern In- 14 7, 639–55. 15 donesia. Journal of Fish Biology 70, 1809–37. 15 16 Myers RA, Baum JK, Shepherd TD, Powers SP, Peter- Yamaguchi A, Kawahara I, Ito S (2005). Occurrence, 16 17 son CH (2007). Cascading effects of the loss of apex growth and food of longheaded eagle ray, Aetobatus 17 18 predatory sharks from a coastal ocean. Science 315, flagellum, in Ariake Sound, Kyushu, Japan. Environ- 18 19 1846–50. mental Biology of Fishes 74, 229–38. 19 20 Nelson J, Grande T, Wilson M (2016). Fishes of the Zane L, Bargelloni L, Patarnello T (2002). Strategies for 20 21 World. 5th edn. Wiley publishers, New York. microsatellite isolation: A review. Molecular Ecology 21 22 Raymond M, Rousset F (1995). Genepop (Version-1.2) 11, 1–16. 22 23 – Population-genetics software for exact tests and ec- 23 24 umenicism. Journal of Heredity 86, 248–9. SUPPLEMENTARY MATERIALS 24 25 van Oosterhout C, Hutchinson WF, Wills DPM, Shipley 25 26 P (2004). MICRO-CHECKER: Software for identify- Supplemental data 26 27 27 28 28 29 Cite this article as: 29 30 30 31 Shi F, Wang H, Yamaguchi A, Zhang B, Zhang J (2019). Isolation and characterization of polymorphic microsat- 31 32 ellite loci from pale-edged stingray, Telatrygon zugei (Elasmobranchii, Dasyatidae). Integrative Zoology 14, 32 33 318–22. 33 34 34 35 35 36 36 37 37 38 38 39 39 40 40 41 41 42 42 43 43 44 44 45 45 46 46 47 47 48 48 49 49 50 50 51 51