Sulfotransferase 1A3 (SULT1A3)

A Dissertation

entitled

Functional Genomic Studies On The Genetic Polymorphisms Of The Human Cytosolic

Ahsan Falah Hasan Bairam

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in

Experimental Therapeutics

______Dr. Ming-Cheh Liu, Committee Chair

______Dr. Ezdihar Hassoun, Committee Member

______Dr. Zahoor Shah, Committee Member

______Dr. Caren Steinmiller, Committee Member

______Dr. Amanda Bryant-Friedrich, Dean College of Graduate Studies

The University of Toledo

May 2018

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author.

An Abstract of

Functional Genomic Studies On The Genetic Polymorphisms Of The Human Cytosolic Sulfotransferase 1A3 (SULT1A3)

Ahsan Falah Hasan Bairam

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in

Experimental Therapeutics (Pharmacology/Toxicology)

The University of Toledo

May 2018

Abstract

Previous studies have demonstrated the involvement of sulfoconjugation in the metabolism of catecholamines and serotonin (5-HT), as well as a wide range of xenobiotics including drugs. The study presented in this dissertation aimed to clarify the effects of coding single nucleotide polymorphisms (cSNPs) of the human SULT1A3 and

SULT1A4 genes on the enzymatic characteristics of the sulfation of catecholamines, 5-

HT, and selected drugs by SULT1A3 allozymes. Following a comprehensive search of different SULT1A3 and SULT1A4 genotypes, thirteen non-synonymous (missense) cSNPs of SULT1A3/SULT1A4 were identified. cDNAs encoding the corresponding SULT1A3 allozymes, packaged in pGEX-2T vector were generated by site-directed mutagenesis.

Recombinant SULT1A3 allozymes were bacterially expressed and affinity-purified.

iii

Purified SULT1A3 allozymes were found to exhibit differential sulfating activities toward dopamine (DA), epinephrine (EP), norepinephrine (NE), 5-HT, acetaminophen

(APAP), morphine, tapentadol, O-desmethyl tramadol (O-DMT), phenylephrine, and salbutamol, in comparison to the wild-type enzyme. Kinetic analyses further demonstrated differences in substrate affinity (as reflected by Km) and catalytic ativity (as reflected by Vmax) of different SULT1A3 allozymes. Collectively, the findings made provided useful information relevant to the differential metabolism of above-mentioned endogenous and xenobiotic compounds. Such information may eventually shed light on the correlation of particular SULT1A3/SULT1A4 genotypes to neuropathological disorders associated with abnormal levels of the monoamines that act as substrates for

SULT1A3. Furthermore, these results obtained may in the future aid in designing personalized regimens of relevant drugs in order to optimize their efficacy and mitigate their adverse effects for individuals with distinct SULT1A3/SULT1A4 genotypes.

Acknowledgements

I would like to express my appreciation and sincere thanks to Dr. Ming-Cheh Liu for being a wonderful advisor, who has always been available for help, excellent guidance, and support. I attribute the level of my doctorate degree to his encouragement, and without him this thesis would not have been completed or written.

I would also like to thank my committee members: Dr. Ezdihar Hassoun, Dr.

Zahoor Shah, and Dr. Caren Steinmiller for their time, encouragement and insightful comments.

I owe my deepest gratitude to my wife and my brother, who greatly supported me and my aspirations and dreams. To all my lab mates, especially, Dr. Katsuhisa Kurogi, thank you for listening and supporting me through this entire process.

Table of Contents

Abstract ...... iii

Acknowledgements ...... v

Table of Contents ...... vi

List of Tables…...... xii

List of Figures ...... xiv

List of Abbreviations ...... xvii

List of Symbols ...... xix

1. Introduction...... 1

1.1 Overview of Metabolism ...... 1

1.2 Phases of Metabolism ...... 2

1.2.1. Phase I Reactions ...... 2

1.2.2. Phase II Reactions...... 3

1.2.3. Phase III transporters...... 4

1.3. Sulfoconjugation...... 4

1.4. Sulfotransferases...... 6

1.4.1. SULT1...... 9

1.4.2. SULT2...... 11

1.4.3. SULT4...... 12

1.4.4. SULT6...... 13

1.5. Genetic variations...... 13

1.6. SULT1A3...... 17

1.6.1. Role of human SULT1A3 in the sulfation of endogenous

Substrates...... 18

1.6.2. Role of SULT1A3 in the sulfation of xenobiotics...... 19

1.6.3. Role of SULT1A3 in the sulfation of food compounds...... 20

1.6.4. Pathophysiological association and etiological role of

SULT1A3...... 20

2. Materials and Methods ...... 24

2.1. Materials...... 24

2.2. Methods...... 25

2.2.1. Database search...... 25

2.2.2. Generation of SULT1A3 cDNAs coding for SULT1A3

allozymes...... 26

2.2.3. Expression and purification of recombinant SULT1A3

allozymes...... 34

2.2.4. Analysis of differential sulfating activities of SULT1A3

allozymes toward endogenous and exogenous compounds...... 36

2.2.5. Analysis of differential sulfating activities of SULT1A3

allozymes toward xenobiotics...... 37

2.2.6. Statistical analysis...... 37

3. Sulfation of Catecholamines and Serotonin by SULT1A3 Allozymes...... 38

3.1. Introduction...... 40

vii

3.2. Materials and Methods...... 42

3.2.1. Materials...... 42

3.2.2. Methods...... 43

3.2.2.1. Database search...... 43

3.2.2.2. Generation, expression, and purification of

SULT1A3 allozymes...... 43

3.2.2.3. Enzymatic assay...... 44

3.2.2.4. Statistical analysis...... 44

3.3. Results...... 45

3.3.1. Analysis of human SULT1A3 and SULT1A4 single

nucleotide polymorphisms...... 45

3.3.2. Expression and purification of recombinant human

SULT1A3 allozymes...... 48

3.3.3. Enzymatic characterization of the SULT1A3 allozymes....48

3.3.4. Kinetic Analyses...... 55

3.4. Discussion...... 61

4. On the Molecular Basis underlying the Metabolism of Tapentadol through Sulfation.68

4.1. Introduction...... 70

4.2. Materials and Methods...... 72

4.2.1. Materials...... 72

4.2.2. Sulfotransferase assay...... 73

4.2.3. Examination of the sulfation of tapentadol by cultured

HepG2 human hepatoma cells and Caco-2 human epithelial

viii

colorectal adenocarcinoma cells...... 74

4.3. Results and Discussion...... 75

4.3.1. Differential sulfating activities of the human SULTs toward

tapentadol...... 75

4.3.2. pH-dependence of the sulfation of tapentadol by human

SULT1A3, SULT1A1 and SULT1C4...... 77

4.3.3. Kinetics of the sulfation of tapentadol by human SULT1A1,

SULT1A3, and SULT1C4...... 79

4.3.4. Metabolic sulfation of tapentadol in cultured cells and

sulfation of tapentadol by human organ specimens...... 80

4.4. Conclusions...... 82

5. Effects of Human SULT1A3/SULT1A4 Genetic Polymorphisms on the Sulfation of

Acetaminophen and Opioid Drugs by the Cytosolic Sulfotransferase SULT1A3………84

5.1. Introduction………………………………………………………………....86

5.2. Materials and methods…………………………………………………...... 88

5.2.1. Materials…………………………………………………..88

5.2.2. Database search……………………………………….…..88

5.2.3. Generation, expression, and purification of SULT1A3

Allozymes……………………………………………………….89

5.2.4. Enzymatic assay…………………………………………..89

5.2.5. Data analysis…………………………………..………….90

5.3. Results………………………………………………………………...…….90

5.3.1. Analysis of human SULT1A3 and SULT1A4 single

nucleotide polymorphisms……………………………………....91

5.3.2. Expression and purification of recombinant human

SULT1A3 allozymes……………………………...………...... 93

5.3.3. Enzymatic characterization of the SULT1A3 allozyme….95

5.3.4. Kinetic Analysis…………………………………………..99

5.4. Discussion………………………………………………………………….105

6. Impact of SULT1A3/SULT1A4 Genetic Polymorphisms on the Sulfation of

Phenylephrine and Salbutamol by human SULT1A3 Allozymes…………………...... 113

6.1. Introduction…………………………………………………………...……115

6.2. Methods…….…………………………..…………………………………..117

6.2.1. Database search……………………………………..……117

6.2.2. cDNA generation, and expression and purification of

SULT1A3 allozymes…………………………………………...118

6.2.3. Enzymatic assay………………………………………….120

6.2.4. Kinetic analysis…………………………………………..120

6.2.5. Data analysis……………………………………………..120

6.2.6. Materials…………………………………………………121

6.3. Results……………………………………………………………………...121

6.3.1. Analysis of human SULT1A3 and SULT1A4 SNPs, and

expression and purification of recombinant human SULT1A3

allozymes……………………………………………………….122

6.3.2. Enzymatic characterization of the SULT1A3 allozymes...122

6.3.3. Determination of kinetic parameters of the human SULT1A3

allozymes in mediating the sulfation of phenylephrine and

salbutamol………………………………………………………126

6.4. Discussion………………………………………………………………….128

7. pH dependence and Inhibitors……………………………………………………….134

7.1. pH dependence……………………………………………………………..134

7.1.1. Experimental procedure………………………………….134

7.1.2. Results and discussion…………………………………...134

7.2. Inhibitors………………………………………………………………...…137

7.2.1. Introduction………………………………………………137

7.2.2. Experimental procedure………………………………….138

7.2.2.1. Determination of the half maximal inhibitory

concentration (IC50)…………………...……………..…138

7.2.2.2. Analyzing SULT1A3 allozymes activity toward

dopamine with the inhibitors………………………..….139

7.2.3. Results and discussion…………………………………..139

7.2.3.1. IC50s of hesperetin and catechin with

SULT1A3……………………………………………….139

7.2.3.2. SULT1A3 allozymes activity toward DA with

hesperetin and catechin as inhibitors…………………...141

8. Summary of results and conclusions ………………………………………………...147

9. References……………………………………………………………………………150

List of Tables

1.1 Human sulfotransferases with their amino acid sequence length, gene location on

chromosomes, substrate specificity and gene cloning history...... 8

1.2 Xenobiotics that act as substrates for human SULT1A3 ...... 19

1.3 Food stuffs that act as substrates for human SULT1A3…………………………20

1.4 Pathophysiological association with human SULT1A3 enzyme ...... 23

2.1 List of single nucleotide polymorphisms in human SULT1A3 and SULT1A4

genes...... 26

2.2 List of selected missense coding SNPs in human SULT1A3 and SULT1A4

genes...... 27

2.3 List of additional missense coding SNPs in human SULT1A3 and SULT1A4

genes identified in a recent database reveiw……………………………………..28

2.4 List of selected single nucleotide polymorphisms with their designed mutagenic

primers of the human SULT1A3 and SULT1A4 genes...... 31

3.1 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

dopamine as a substrate………………………………………………………….57

3.2 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

epinephrine as a substrate………………………………………………………..58

xii

3.3 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

norepinephrine as a substrate…………………………………………………….59

3.4 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

serotonin as a substrate…………………………………………………………..60

4.1 Specific activities of the human SULT1A1, SULT1A3, and SULT1C4 with

tapentadol as a substrate…………………………………………………………76

4.2 Kinetic parameters of the sulfation of tapentadol by human SULT1A1,

SULT1A3, and SULT1C4……………………………………………………....80

4.3 Sulfating activities of human kidney, liver, lung, and small intestine cytosols

toward tapentadol as a substrate…………………………………….…………..82

5.1 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

acetaminophen as a substrate.……………………………………….…………100

5.2 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

morphine as a substrate.……………………………………….………….……102

5.3 Kinetic parameters of the wild-type human SULT1A3 and allozymes with

tapentadol as a substrate.………………………………….……...……….……103

5.4 Kinetic parameters of the wild-type human SULT1A3 and allozymes with O-

desmethyl tramadol as a substrate.…………………….……...……….…….…104

6.1 Kinetic parameters of the human SULT1A3 wild-type and allozymes with

phenylephrine as substrate……………………………………………………..126

6.2 Kinetic parameters of the human SULT1A3 wild-type and allozymes with

salbutamol as substrate…………………………………………………………128

xiii

List of Figures

1-1 Ribbon diagram of the structure of human SULT1A3-dopamine-PAP complex..18

2-1 Validation of mutant cDNAs harbored in NEB 5-alpha E. coli competent

cells of SULT1A3 allozymes by colony PCR...... 33

2-2 Validation of mutant cDNAs harbored in BL21 E. coli competent cells of

SULT1A3 allozymes by colony PCR...... 35

2-3 SDS-PAGE gel electrophoresis of the purified SULT1A3 allozymes...... 36

3-1 Amino acid sequence of the human SULT1A3 showing the locations of amino

acid residues involved in the SULT1A3/SULT1A4 cSNPs and segments/residues

reported to be involved in PAPS-binding, substrate-binding, and/or catalysis….46

3-2 Ribbon diagram of the structure of human SULT1A3-dopamine-PAP complex

showing the locations of amino acid residues involved in the

SULT1A3/SULT1A4 cSNPs………………………………………………….…47

3-3 Specific activities of the sulfation of dopamine (DA) by human SULT1A3

allozymes………………………………………………………………………...51

3-4 Specific activities of the sulfation of epinephrine (EP) by human SULT1A3

allozymes……………………………………………………………………...…52

3-5 Specific activities of the sulfation of norepinephrine (NE) by human SULT1A3

allozymes……………………………………………………………………...…53

xiv

3-6 Specific activities of the sulfation of serotonin (5-HT) by human SULT1A3

allozymes………………………………………………………………...………54

3-7 Kinetic analysis for the sulfation of catecholamines and serotonin by wild-type

human SULT1A3……………………………………………………………...... 56

4-1 Chemical structure of tapentadol……………………………………………...... 71

4-2 pH-dependence of tapentadol-sulfating activity of the human SULT1A1 (A),

SULT1A3 (B), and SULT1C4 (C)……………………………………………....78

4-3 Production and release of [35S]sulfated tapentadol by HepG2 human hepatoma

cells and Caco-2 human epithelial colorectal adenocarcinoma cells labeled with

[35S]sulfate in the presence of tapentadol…………………………………..…..81

5-1 Ribbon diagram of the structure of human SULT1A3-analgesic substrate-

PAP complex showing the locations of amino acid residues associated with

the SULT1A3/SULT1A4 cSNPs………………………………………………..92

5-2 Docking of analgesic substrates in the active site of SULT1A3………………..94

5-3 Specific activities of the sulfation of APAP by human SULT1A3 allozymes….96

5-4 Specific activities of the sulfation of morphine by human SULT1A3

allozymes…………………………………………………………………….….97

5-5 Specific activities of the sulfation of tapentadol by human SULT1A3

allozymes………………………………………………………………….…….98

5-6 Specific activities of the sulfation of O-DMT by human SULT1A3 allozymes..99

6-1 Human SULT1A3 protein structure showing locations of amino acids involved in

the SULT1A3/SULT1A4 cSNPs……………………………………………….119

6-2 Specific activities of the human SULT1A3 allozymes with phenylephrine as a

substrate………………………………………………………………………...123

6-3 Specific activities of the human SULT1A3 allozymes with salbutamol as a

substrate………………………………………………………………………...125

7-1 pH dependence of the human SULT1A3 wild-type and SULT1A3-N235T

allozyme with dopamine as substrate…………………………………………..136

7-2 Inhibition of the SULT1A3 catalyzed sulfation of dopamine by hesperetin

(A) and catechin(B)……………………………………………………………..140

7-3 Dopamine sulfation by SULT1A3 allozymes with hesperetin as inhibitor…….142

7-4 Dopamine sulfation by SULT1A3 allozymes with catechin as inhibitor………144

xvi

List of Abbreviations

APAP………………..Acetaminophen cDNA ...... Complementary Deoxyribonucleic Acid CHES ...... Sodium acetate, 2- (Cyclohexylamino) Ethanesulfonic Acid CYP ...... Cytochrome P-450

DA ...... Dopamine DHEA ...... Dehydroepiandrosterone DMSO ...... Dimethyl Sulfoxide DNA ...... Deoxyribonucleic Acid DTT ...... Dithiothreitol

E. coli ...... Escherichia Coli EP ...... Epinephrine

5-HT ...... Serotonin HEPES ...... N-2-Hydroxylpiperazine-N2-Ethanesulfonic xii

MES ...... 2- Morpholinoethanesulfonic Acid MOPS ...... β-naphthol, 3-(N-Morpholino) Propanesulfonic Acid

NCBI ...... National Center for Biotechnology Information NE ...... Norepinephrine

O-DMT………………O-desmethyl tramadol OD600 nm ...... Optical Density at 600 nm wave length

PAPs ...... 3‘-phosphoadenosine-5‘-phosphosulfate PCR ...... Polymerase Chain Reaction PPi ...... Pyrophosphate

SDS–PAGE ...... Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis

SULT1A1 ...... Human Cytosolic Sulfotransferases Family 1A Member 1 SULT1A2 ...... Human Cytosolic Sulfotransferases Family 1A Member 2

xvii

SULT1A3 ...... Human Cytosolic Sulfotransferases Family 1A Member 3 SULT1B1 ...... Human Cytosolic Sulfotransferases Family 1B Member 1 SULT1C1 ...... Human Cytosolic Sulfotransferases Family 1C Member 1 SULT1C2 ...... Human Cytosolic Sulfotransferases Family 1C Member 2 SULT1C3 ...... Human Cytosolic Sulfotransferases Family 1C Member 3 SULT1C4 ...... Human Cytosolic Sulfotransferases Family 1C Member 4 SULT1E1 ...... Human Cytosolic Sulfotransferases Family 1E Member 1 SULT2A1 ...... Human Cytosolic Sulfotransferases Family 2A Member 1 SULT2B1a ...... Human Cytosolic Sulfotransferases Family 2B Member 1a SULT2B1b ...... Human Cytosolic Sulfotransferases Family 2B Member 1b SULT4A1 ...... Human Cytosolic Sulfotransferases Family 4A Member 1 SULT6B1 ...... Human Cytosolic Sulfotransferases Family 6B Member 1 SULTs ...... Human Cytosolic Sulfotransferases enzymes

TAPS ...... 3-[N-Tris-(hydroxymethyl) Methylamino[-propanesulfonic acid] TLC ...... Cellulose Thin-Layer Chromatography Tris-HCl ...... Trisaminomethane Hydrocholoride

WTH………………..Wild-type enzyme with inhibitor

xviii

List of Symbols

C°...... Celsius g...... Gram Km ...... Michaelis Constant L ...... Liter mg ...... Milligram min ...... Minute ml ...... Milliliter mM ...... Millimolar mmol ...... Millimole nM ...... Nanomolar nmol ...... Nanomole SO3-...... Sulfonate Group Vmax ...... Maximal Velocity Vmax/Km……………Reflects catalytic efficiency

β ...... Angle of distortion μg ...... Mirogram μl ...... Microliter μM ...... Micromolar

xix

Chapter 1

Introduction

1.1. Overview of Metabolism

Endogenous compounds and the majority of xenobiotics, post their entry into the body, are subjected to metabolism. In general, the same metabolic pathways and enzymes utilized in the metabolism of endogenous compounds were found to work on the metabolism of xenobiotics. A large number of the metabolizing enzymes were recognized and shown to be expressed in nearly all tissues in the human body, with the highest levels of enzymes detected in the gastrointestinal tract and liver (Gonzalez, 2011).

The primary role of the metabolizing enzymes is to transfer a hydrophilic moiety into the substrates (endogenous/exogenous) to make them more hydrophilic derivatives, thereby enhancing their elimination (Mulder, 1989). Although the metabolizing enzymes are responsible mainly for deactivating the substrates, some compounds, such as prodrugs and procarcinogens, could be converted into more active metabolites (Gonzales and

Tukey, 2005).

1.2. Phases of Metabolism

The biotransformation of endogenous/xenobiotics compounds may proceed through three metabolic phases. Phase I, which involves addition of a functional group on the parent compound through the processes of oxidation, reduction, hydrolysis, cyclization, or de-cyclization. These functional groups represent the primary reaction sites that may subsequently be utilized by Phase II reactions (Gonzalez and Tukey, 2006).

Phase II conjugation reactions include the conjugation of the metabolites resulted from

Phase I, or other compounds that already display functional groups capable of being conjugated. Phase II conjugation reactions involve sulfoconjugation, glucuronidation, methylation, acetylation, and glutathione conjugation (Mulder, 1989). Phase III reactions involve groups of transporters that may participate in the excretion of Phase II metabolites or their metabolites through a system of efflux transporters (Coleman, 2005).

1.2.1. Phase I Reactions

The most common family of enzymes implicated in Phase I reactions are the cytochrome P450 (CYP) enzymes that constitute a superfamily of heme-containing proteins (Gonzalez, 2011). Some CYP enzymes were shown to be involved in the biosynthesis or metabolism of endogenous compounds such as steroids, cholesterol, and bile acids (Wilkinson, 2005). It has been pointed that there are more than 50 different

CYPs distinguished in humans, and the majority of these enzymes are involved in the metabolism process. CYPs superfamily is categorized into families and subfamilies

according to the amino acid sequence identity. Among the most common subfamilies of

CYP are CYP2C, CYP2D, and CYP3A subfamilies, with CYP3A4 shown to be expressed extensively in the liver, and is capable of biotransforming of more than 50% of the administered drugs (Blake et al., 2005; Gonzalez, 2011).

1.2.2. Phase II Reactions

Phase II reactions, also called conjugation reactions, involve the formation of hydrophilic metabolites to facilitate their elimination outside the body. These reactions have been shown to be catalyzed by several enzyme superfamilies including sulfotransferases (SULTs) (Weinshilboum et al., 1997), UDP-glucuronosyltransferases

(UGT) (Mackenzie et al., 1997), NAD(P)H:quinone oxidoreductase (NQO), NAD(P)H: menadione reductase (NMO) (Jaiswal, 1994), epoxide hydrolases (EPH) (Guenthner et al., 1989), glutathione S-transferases (GST) (Moscow and Dixon, 1993) and N- acetyltransferases (NAT) (Vatsis et al., 1995). Phase II enzyme superfamilies are classified into families and subfamilies of proteins that are encoded by different genes.

Studies revealed that members of each family or subfamily may have different substrate specificity, tissue expression, and could be induced or inhibited by xenobiotics (Hinson and Forkert, 1995). Furthermore, studies showed that the phase II pathway plays an important role in the metabolism and homeostasis of key endogenous compounds such as catecholamine neurotransmitters and thyroid hormones (Richard et al., 2001). In most cases, the conjugated metabolites are inactive compounds, which is why this pathway is considered an excretion and detoxification pathway. However, some prodrugs and

procarcinogens are converted into their active forms through conjugation (Mulder, 1989;

Gonzalez, 2011). Phase II enzymes are known to be present in the cytosol of the cell, with the exception of the glucuronidation enzymes that are localized in the endoplasmic reticulum (Gonzalez, 2011). It has been demonstrated that SULTs perform a protective function in the gastrointestinal tract and liver by converting the harmful dietary chemicals into less harmful sulfated metabolites (Dong et al., 2012; Falany, 1997). Both SULTs and UDP-glucuronosyltransferases were shown to catalyze the conjugation of nearly 40% of xenobiotics and perform the majority of the conjugation reactions in the body (Evans and Relling, 1999).

1.2.3. Phase III transporters

This phase includes several proteins, such as P-glycoprotein (P-gp) (Brinkmann and Eichelbaum, 2001), multidrug resistance associated protein (MRP) (Kerb et al.,

2001), and organic anion transporting polypeptide 2 (OATP2) (Tirona and Kim, 2002). It has been shown that these transporters are expressed in different tissues, such as liver, kidney, intestine, and brain, to provide barriers against drug infiltration. Consequently, they play critical roles in drug absorption, distribution, and excretion (Brinkmann and

Eichelbaum, 2001).

1.3. Sulfoconjugation

Sulfoconjugation, first reported in 1876 (Baumann, 1876), was shown to play a

vital role in the biotransformation and homeostasis of endogenous compounds such as catecholamines, bile acids, cholesterol, steroids and thyroid hormones, in addition to its role in the biotransformation of exogenous compounds/xenobiotics that include therapeutic agents (Falany and Roth, 1993; Weinshilboum and Otterness, 1994; Ko et al.,

2012; Kurogi et al., 2014). In general, sulfoconjugation is considered a detoxiﬁcation pathway as in the case of small endogenous substrates (such as DA) and most xenobiotics compounds (like acetaminophen (APAP)), resulting in more hydrophilic sulfated products and thereby helping in their elimination via the kidneys or liver. However, sulfoconjugation could be a metabolic activation pathway for some xenobiotics or procarcinogens yielding active mutagenic or carcinogenic compounds, such as N- hydroxy arylamines and hydroxymethyl polycyclic aromatic hydrocarbons (Falany, 1997;

Weinshilboum et al., 1997). For some compounds, like minoxidil, the sulfoconjugated metabolites are considered the biologically active forms of these molecules (Falany,

1997). The sulfate group represents a highly charged molecule which increases the water solubility of the recipient substrates and altering their affinity towards receptor/target

(Kotov et al., 1999). It was shown that sulfoconjugation plays an essential role in the homeostasis of some water-insoluble signaling compounds, such as steroids and oxysterols, like dehydroepiandrosterone (DHEA), thyroid hormones, vitamins, DA, and other critical biological components. These compounds may circulate in the plasma as relatively inactive sulfated forms to be used later, or until sulfatase enzymes remove the sulfate group and restore the primary structure of the compound before sulfation (Kotov et al., 1999; Bergner and Shapiro, 1981; Hashiguchi et al., 2011; Visser, 1996; Goldstein et al., 1999). Studies showed that the sulfoconjugation process requires an enzyme called

sulfotransferase (SULT) and a co-substrate (sulfate donor). The universal co-substrate for this metabolic pathway is the 3’-phosphoadenosine 5’-phosphosulfate (PAPS) which provides the sulfonate group (SO3ˉ), while the SULT enzyme catalyzes the transfer of the sulfonate to the hydroxyl or amino- group of the recipient molecule. The important role of PAPS in the sulfoconjugation pathway has been previously reviewed (Klaassen and

Boles, 1997). Studies showed that both the sulfonate acceptor molecule (substrate) and the sulfonate donor compound (PAPS) bind to their specific binding sites (amino acid residues) inside the SULT protein molecule, and this binding results in the transfer of sulfonate group and the release of the sulfoconjugated product and 3’-phosphoadenosine-

5’phosphate (PAP).

1.4. Sulfotransferases

SULTs represent a superfamily of enzymes that are responsible for sulfoconjugation reactions. Studies have identified two broad types of SULTs, membrane-bound and cytosolic SULTs. The membrane-bound SULTs (including tyrosylprotein sulfotransferase and carbohydrate sulfotransferases) are located in the

Golgi apparatus of the cell and were shown to play an important role in the sulfoconjugation of peptides (like CCK), lipids, proteins, and complex carbohydrates

(such as glycosaminoglycans) (Chapman et al., 2004). These enzymes, like heparan sulfotransferase, were reported to affect the structure and function of the substrates, which are mostly large molecular weight compounds (Falany, 1997). On the other hand, the cytosolic SULTs (like SULT1A1, SULT1A2 and SULT1A3) are responsible for the

biotransformation of small molecular weight xenobiotics and endogenous substrates such as neurotransmitters (Weinshilboum and Otterness, 1994; Ko et al., 2012; Kurogi et al.,

2014). Enzymatic functional assays have indicated the abilities of the cytosolic SULTs to sulfoconjugate a wide range of substrates, like phenols and amino groups of aryl amines, which indicate a broad substrate specificity for SULTs. This broad specificity could be related to the plastic binding sites/pocket and the presence of different forms of these enzymes, which allow the enzyme molecule to adopt varying conformations. Thus, sulfotransferases can interact with small phenols, L-shaped aromatic compounds, and fused ring molecules (Gamage et al., 2006).

Previous nomenclature system of SULT enzymes was based on their substrate specificities (such as monoamine or estrogen SULTs). Later, and because of the overlap in the substrate specificity that was demonstrated by several isoforms of SULTs, a new naming system was needed. Consequently, several international meetings were arranged to create a new nomenclature system. The new system depends on the amino acids identity to categorize SULTs into families and subfamilies, and it used “SULT” as the standard abbreviation for the cytosolic sulfotransferase superfamily. Indeed, SULTs sharing more than 45% of amino acid sequence identity were grouped into a single family

(like SULT1), while SULTs sharing more than or equal to 60% of amino acid sequence identity were grouped into subfamilies (Blanchard et al., 2004). The new nomenclature system has also taken into consideration the species from which the SULT is derived, which currently stands for three to five letter species abbreviation in parentheses (such as

(HUMAN) SULT1A3). Based on the recent naming system, the 13 human SULTs (as shown in Table 1.1) that belong to the SULT superfamily were categorized into four

families (SULT1, SULT2, SULT4, and SULT6), which are further grouped into eight subfamilies (Blanchard et al., 2004).

Table 1.1 Human sulfotransferases with their amino acid sequence length, gene location on chromosomes, substrate specificity and gene cloning history.

No. of Gene location Standard SULT1 References AA2 on chromosome substrate

Wilborn et al., 1993; 1A1 295 16p12.1 pNP3 Dooley et al., 1994; Zhu et al., 1996; 1A2 295 16p12.1 pNP Her et al., 1996 Dooley et al., 1994; Aksoy 1A3 295 16p11.2 DA and Weinshilboum, 1995; Zhu et al., 1993 1B1 296 4q13.3 Iodothyronines Fujita et al., 1997

Freimuth et al., 2000; Her et 1C2 296 2q12.3 pNP al., 1997; Sakakibara, 1998a Bile acids and Freimuth et al., 2000, 2004; 1C3 304 2q12.3 thyroid H.s Kurogi et al., 2017 Freimuth et al., 2000; 1C4 302 2q12.3 pNP Sakakibara et al., 1998a

1E1 294 4q13.1 E2 Aksoy et al., 1994

Otterness et al., 1992; 2A1 285 19q13.3 DHEA Kong et al., 1992

2B1a 350 19q13.3 Cholesterol Her et al., 1998

2B1b 365 19q13.3 Cholesterol Her et al., 1998

Walther et al., 1999; 4A1 284 22q13 unknown Falany et al., 2000

6B1 265 2p22.3 unknown Freimuth et al., 2004 1Refers to sulfotransferases. 2Refers to amino acid. 3Refers to p-nitrophenol.

1.4.1. SULT1

SULT1 (phenol sulfotransferase) family was reported to include four subfamilies,

SULT1A (phenol sulfotransferases), SULT1B (dopa/tyrosine and thyroid hormone sulfotransferases, SULT1C (hydroxyarylamine or acetylaminofluorene sulfotransferases), and SULT1E (estrogen sulfotransferases) (Weinshilboum et al., 1997). These subfamilies are different in their amino acid sequence and in their location on chromosomes.

SULT1A subfamily involves SULT1A1, SULT1A2, and SULT1A3/1A4 members. Furthermore, the genes of this subfamily are all mapped on a small region in the short arm of chromosome 16 (as shown in Table 1.1) and are thought to have risen as a result of gene duplication during the evolutionary process. The genes of SULT1A1 and

SULT1A2 were shown to share 93% of amino acid sequence identity. SULT1A1 cDNA was first isolated in 1993 from the human liver library (Wilborn et al., 1993). The

SULT1A1 enzyme showed high activity toward p-nitrophenol (pNP), which is now considered the standard (diagnostic) substrate for the enzyme, as well as minoxidil.

SULT1A1 was shown to retain approximately 90% of its sulfating activity toward pNP after treatment at 45°C for 15 min making it a thermostable enzyme. For SULT1A2, it was identified only in humans, and its cDNA was first cloned in 1995 from a human liver library. The purified form of SULT1A2 was found to exhibit lower sulfating activity toward pNP, minoxidil, and b-naphthol than SULT1A1 (Ozawa et al., 1998). In the case of SULT1A3 (previously named monoamine neurotransmitter-preferring phenol sulfotransferase, PST), the gene of this enzyme had been identified only in humans. It

appears that through evolutionary process humans have acquired the SULT1A3 gene which encoded a protein having a robust sulfoconjugating activity towards catecholamines, especially DA (Coughtrie, 1998; Dooley, 1998). On the other hand,

SULT1A3 gene was reported to show a lower level of amino acid identity (about 93-

90.5%) in relation to both SULT1A1 and SULT1A2 genes, and SULT1A3 gene was demonstrated to be located at a distance of 100 Kb from these two genes (Dooley, 1998).

In term of thermostability, SULT1A3 showed no sulfating activity towards DA after treatment at 45°C for 15 min, making it the thermolabile form of sulfotransferases.

SULT1B subfamily was shown to include SULT1B1 member. The cDNA of this enzyme was first cloned from the rat liver library in 1995, and the purified enzyme demonstrated a high substrate specificity towards 3,4-dihydroxyphenylalanine (L-dopa) and tyrosine, and it also demonstrated a sulfating activity with other endogenous substrates, such as pNP and thyroid hormones (Sakakibara et al., 1995). In 1997, the human form of SULT1B1 was first isolated and shown as the major SULT responsible for thyroid hormones sulfoconjugation (Fujita et al., 1997).

SULT1C subfamily involves three members, SULT1C2, SULT1C3, and

SULT1C4. Of these enzymes, SULT1C2 (previously named SULT1C1) was the first member of this subfamily to be cloned from the fetal liver-spleen library (Her et al.,

1997). Later in 2004, the SULT1C3 member was predicted to be present in three variants

(SULT1C3a, SULT1C3b, and SULT1C3d) (Freimuth et al., 2004). Among these variants, SULT1C3a displayed low sulfating activity with strict substrate specificity towards the hydroxyl-chlorinated biphenyls as substrates, whereas SULT1C3d demonstrated broader substrate specificity towards endogenous substrates, such as

thyroid hormones and bile acids, and also xenobiotics, like the hydroxyl-chlorinated biphenyls (Kurogi et al., 2017). SULT1C4 (previously named SULT1C2) was identified and shown to be expressed in the adult spinal cord, kidney, and ovary as well as fetal lung, heart, and kidney at the mRNA level (Sakakibara et al., 1998a). However,

SULT1C4 as protein, was only detected in fetal tissues (Stanley et al., 2005). To date, there are no known endogenous substrates for SULT1C2 and SULT1C4, but both these enzymes show sulfoconjugating activity toward pNP and N-hydroxy-2- acetylaminofluorene (procarcinogen) (Sakakibara et al., 1998a).

The last subfamily in the large SULT1 family was represented by SULT1E, which includes the member SULT1E1. The first cloning of cDNA of SULT1E1 from a human liver library was in 1994 (Aksoy et al., 1994). This enzyme has been widely studied because of its essential role in maintaining homeostasis of steroids, where it showed very high affinity (in nM range) towards 17β-Estradiol (E2) and estrone, as well as a number of exogenous estrogens, such as diethylstilbestrol and tamoxifen (Nash et al.,

1988; Falany and Falany, 1997; Falany et al., 1995). On the other hand, SULT1A1 and

SULT2A1 exhibited high sulfating activity with E2 and estrone as a substrate but at concentrations that were much higher than those of the physiological levels (Falany and

Falany, 1997; Falany et al., 1995). Additionally, iodothyronines were also shown to be sulfoconjugated by SULT1E1 (Kester et al., 1999).

1.4.2. SULT2

This family was categorized into two subfamilies, SULT2A and SULT2B. It was

reported that SULT2 family members could catalyze sulfoconjugation of hydroxyl groups of steroids (like dehydroepiandrosterone (DHEA), pregnenolone, cholesterol, and bile acids) (Javitt et al., 2001; Lindsay et al., 2008). The SULT2A1 member of the SULT2A subfamily was reported to be highly expressed in liver, intestine, and adrenal cortex

(Falany et al., 1989; Her et al., 1996b). Studies have demonstrated the standard endogenous substrate of SULT2A1 to be DHEA (Falany et al., 1989), where the enzyme catalyzes DHEA sulfoconjugation in the adrenal cortex yielding high plasma levels of

DHEA sulfate. This sulfated metabolite serves as a reservoir of DHEA molecules that could be transformed within various tissues, like prostate, into potent androgens and estrogens (Labrie et al., 1998). The second subfamily of SULT2, SULT2B, was reported to include two members, SULT2B1a and SULT2B1b, which are encoded at the same gene locus (Her et al., 1998). SULT2B1b exhibited high affinity for cholesterol as substrate, and is expressed in a wide range of tissues, such as skin, prostate, breast, endometrium, ovary, placenta, lung, intestine, platelets, kidney and muscle (Shimizu et al., 2003; Dongning et al., 2004; Geese and Raftogianis, 2001). Furthermore, SULT2B1a was shown to have higher sulfoconjugating activity towards pregnenolone and lower activity with cholesterol (Fuda et al., 2002). Although the expression of SULT2B1a mRNA has been detected in human brain (Shimizu et al., 2003), its protein expression, to date, has not been identified in human (Falany et al., 2006).

1.4.3. SULT4

The SULT4A1 cDNA was first cloned from human and rat brain cDNA libraries

(Falany et al., 2000). Studies showed that human and rat SULT4A1 were identical by

97% at the amino acid level and they have been distinguished as SULT4A1 isoform

(Blanchard et al., 2004). Both human and rat SULT4A1 enzymes have been described as orphan enzymes, because their endogenous or exogenous substrates are still unknown

(Sakakibara et al., 1998b).

1.4.4. SULT6

To date, one member, SULT6B1, has been identified in the SULT6 family and it was shown to be mainly expressed in human testis. However, the activity of SULT6B1 enzyme and its substrate specificity are still not fully characterized (Freimuth et al.,

2004).

1.5. Genetic variations

Genetic variations in SULT gene superfamily have gathered much attention in genomic and molecular epidemiological studies since the completion of human genomic project, that facilitated the integration of several biomarkers such as SNPs into genetic and epidemiological researches. This integration helps providing an excellent source of information on the relationship between human genotype and phenotypic variability

(disease risk), as well as in predicting pharmacological responses to drugs and their side effects and toxicity.

The human SULT1A1 was one of the first genes studied due to its essential role in the metabolism of small phenolic compounds and some carcinogens. A common

SULT1A1 allele, called SULT1A1*2, with an allele frequency of 31% in Caucasians, was detected and shown to associate with a deficient sulfating activity towards 4- nitrophenol (diagnostic substrate), and low thermal stability (Ozawa et al., 1998;

Raftogianis et al., 1997). Because of its potential role in sulfoconjugation of estrogens and anti-estrogens, SULT1A1 had been mainly studied in terms of its relationship with breast cancer and response to tamoxifen (selective estrogen receptor modulator, SERM).

In that field, some studies showed no association between SULT1A1 genetic variation and breast cancer (Dumas and Diorio, 2011; Reding et al., 2012), but other studies suggested that there was an association between a SULT1A1*2 allele and breast cancer in Asian women (Wang et al., 2010). Furthermore, some other studies have indicated improvement in the survival of individuals with high activity SULT1A1 allele,

SULT1A1*1, when treated with with tamoxifen as anticancer medication (Dasaradhi and

Shibutani et al., 1997; Mercer et al., 2010). The mechanism behind this improvement was believed to be associated with the high sulfating activity SULT1A1 allele, and that was found to be correlated with the induction of apoptosis in breast cancer cell lines

(Mercer et al., 2010). In detail, rapid sulfation of the active metabolites of tamoxifen has been shown to potentially induce apoptosis and to improve survival of individuals with high sulfating activity alleles of SULT1A1 (SULT1A1*1). Other hormone-sensitive types of cancers have also been studied and correlated with SULT1A1 genetic variations.

In a study that was conducted over five years on 700 men undergoing prostatectomy, a strong association of prostate cancer with the high activity SULT1A1*1 allele in

Caucasians was assessed, while African Americans showed no significant risk for prostate cancer (Borque et al., 2013). Additionally, studies have also demonstrated a correlation between SULT1A1 genetic variations and the increased risk for lung cancer due to its role in the detoxification of various environmental toxins (Arlt et al., 2005;

Coughtrie and Johnston, 2001; Zhang et al., 2012). Furthermore, another allele of

SULT1A1, designated SULT1A1*4, was also identified and shown to be associated with higher risk for esophageal squamous cell carcinoma (Shah et al., 2016).

SULT1A2 gene has very close proximity to SULT1A1 gene, and both of these genes are shown to be identical by approximately 96% homology at the amino acid sequence level (Dooley, 1998). Furthermore, both genes were shown to involve common genetic polymorphisms (Carlini et al., 2001). SULT1A2 had been reported to include three alleles, SULT1A2*1,*2 and *3, with different allelic frequencies in different ethnic groups (Carlini et al., 2001). Two of these alleles, SULT1A2*2 and SULT1A2*3, had been reported with low activity (Engelke et al., 2000; Ginsberg et al., 2010; Lu et al.,

2010), and different frequencies in different ethnic groups. Indeed, the frequency of

SULT1A2*2 was shown to be higher in Caucasians than in Asians individuals (38% versus 10%, respectively) (Carlini et al., 2001; Kim et al., 2005; Glatt et al., 2001).

However, SULT1A2*3 was found to be of a frequency of 10-11% in Africans and

Caucasians, but it was not detected in Asians (Carlini et al., 2001). For SULTA2*2 allele, studies have indicated it as a risk factor for early-onset breast cancer (Hou et al.,

2002). Studies showed that polymorphisms in SULT1A1/SULT1A2 were strongly associated with the mammographic density, which is one of the critical risk factors for breast cancers (Ellingjord-Dale et al., 2012). Additionally, studies demonstrated that

SULT1A2 has an essential role in detoxification or activation of carcinogens, such as aromatic amines and polycyclic aromatic hydrocarbons (Zheng et al., 2003). It has been reported that SULT1A2-Y62F allozyme could be a risk factor for bladder cancer because of its involvement in the activation and detoxification of the previously mentioned carcinogens (Figueroa et al., 2008).

In humans, DNA polymorphisms have been discovered in SULT1A3 genes, which could provide a useful tool for performing molecular genetic studies of the metabolism of endogenous and xenobiotic phenolic molecules. Recent advances in the molecular biology of the human SULT1A3 gene and the consequences associated with

SULT1A3 genetic variations are discussed in more details later in pathophysiological association and etiological role of SULT1A3.

Genetic variations were also detected in SULT1E1 enzyme, where several variants had been identified, and their association with the mammographic density, breast cancer, endometrial cancer and testicular germ cell tumors were studied. However, these variants did show significant associations with these risk factors (Daniels and Kadlubar,

2013). On the other hand, some genetic polymorphisms in SULT1E1 gene were shown to affect the activity of the enzyme towards endogenous substrates significantly. Indeed, three nonsynonymous cSNPs, G64>T, C95>T and C758>A, were detected in 120 human individuals (60 African-American and 60 Caucasian-American subjects) resulting in allozymes, SULT1E1-Asp22Tyr, -Ala32Val, and -Pro253His, respectively, with differential activities. Of these allozymes, SULT1E1-Asp22Tyr and -Ala32Val showed lower activity towards the sulfoconjugation of 17β-estradiol (E2) than the wild-type by about 90% and 42%, respectively. Whereas the SULT1E1-Pro253His allozyme exhibited

comparable activity to that of the wild-type. Furthermore, kinetic studies found the Km to be 2-3 times higher for Pro253His allozyme and more than five times higher for

Asp22Tyr allozyme than that of the wild-type, with E2 as substrate. These findings were suggested to increase the possibility of the genetic variations in SULT1E1 to affect the sulfation ability of estrogen, and that may result in several pathophysiological consequences, such as estrogen-dependent disorders and variations in the metabolism of the exogenous estrogens (Adjei et al., 2003).

1.6. SULT1A3

SULT1A3 (cf. Figure 1-1) is the enzyme responsible for sulfation of the amine neurotransmitters such as DA, EP, NE, and 5-HT, as well as certain iodothyronines, drugs, and dietary xenobiotics (Reiter et al., 1983). In adult humans, SULT1A3 expression is extremely low in liver and is predominant in the upper gastrointestinal tract

(Rubin et al., 1996), but a substantial expression is also found in other extra hepatic tissues such as the brain, lung, and platelets (Nowell and Falany, 2006). Unlike all other known members of the human SULT family, SULT1A3 exhibits a high degree of selectivity for DA, and interestingly, orthologs of the SULT1A3 enzyme have yet to be identified in other mammalian species. Genetic studies have revealed the duplication of the gene coding for SULT1A3 during the evolutionary process (Dooley, 1998;

Hildebrandt et al., 2004). These two genes, designated SULT1A3 and SULT1A4, are located on chromosome 16 and encode identical protein products that collaboratively work in sulfation of catecholamines (Hildebrandt et al., 2004; Gamage et al., 2006). This

probably reflects the important role the enzyme plays in producing sulfated catecholamines, a process that is relatively specific to humans (Dousa and Tyce, 1988).

Figure 1-1. Ribbon diagram of the structure of human SULT1A3-dopamine-PAP complex. The structure of SULT1A3 (Protein Data Bank code: 2A3R (Lu et al., 2005)) was edited using USCF Chimera, a molecular modeling software (Pettersen et al., 2004). DA (blue) and PAP (red) molecules in the structure are shown by bond structures.

1.6.1. Role of human SULT1A3 in the sulfation of endogenous substrates

SULT1A3 is the main SULT1A isoform that is responsible for catalyzing the sulfation of endogenous catecholamines, including DA, EP, NE, and 5-HT (Richard et al., 2001). Studies have shown that more than 90% of DA and approximately 80% of total EP and NE are present in sulfated form in circulation (Johnson et al., 1980; Falany,

1997). The elevation in DA level has been shown to lead to the induction of SULT1A3

expression to protect neurons from DA toxicity (Sidharthan et al., 2013). SULT1A3 also catalyzes the sulfation of 5-HT in the peripheral and central nervous system. 5-HT sulfate has been proposed as a biomarker for the evaluation of antidepressant effectiveness (Lozda and Purviņš, 2014). DA and 5-HT, on the other hand, serve as parent compounds for, respectively, EP/NE and melatonin (Goldstein et al., 1999;

Sandyk 2006).

1.6.2. Role of SULT1A3 in the sulfation of xenobiotics

Several studies have indicated the involvement of SULT1A3 in the metabolism of therapeutic agents, cf. Table 1.2.

Table 1.2 Xenobiotics that act as substrates for human SULT1A3. Substrate Action Reference

APAP1 Analgesic Reiter and Weinshilboum, 1982

Morphine Opioid analgesic Kurogi et al., 2014

Tapentadol Opioid analgesic Bairam et al., 2017

O-DMT2 Opioid analgesic Rasool et al., 2017

Salbutamol Beta-2 agonist Ko et al., 2012

Phenylephrine Decongestant Yamamoto et al., 2014

Ritodrine Beta-2 agonist Hui and Liu, 2015

1Refers to acetaminophen. 2Refers to O-desmethyl tramadol.

1.6.3. Role of SULT1A3 in the sulfation of food compounds

SULT1A3 is also responsible for the metabolism of a number of dietary compounds that carry a phenolic hydroxyl group. Table 1.3 shows a list of these compounds that have been confirmed to be substrates for SULT1A3.

Table 1.3 Food stuffs that act as substrates for human SULT1A3. Compound Definition Reference

Huang et al., 2009; Catechin flavanol Meng et al., 2012

Hesperetin flavanone Huang et al., 2009; Meng et al., 2012

Curcuminoids Natural phenols Lu et al., 2015

Chrysin and apigenin Naturally occurring flavones Lu et al., 2015

Ethanol Recreational drug, antiseptic, Kurogi et al., 2012, solvent and fuel. Eagle K, 2012

1.6.4. Pathophysiological association and etiological role of SULT1A3

It has been reported that catecholamines are metabolized extensively by sulfoconjugation, and deficiency of their metabolism can result in a build-up of DA, EP and NE (O’Reilly and Waring, 1993). These findings are consistent with studies that showed a decrease in SULT1A subfamily activity accompanying an increase in the circulating levels of catechols (Shattock and Whiteley, 2002). In addition, DA has been found to induce its own metabolism by SULT1A3 to protect neurons from damage, and 20

an abnormal SULT1A3 activity is a risk factor for DA-dependent neurotoxicity

(Sidharthan et al., 2013). Abnormalities in DA, EP and NE levels have been shown to correlate with some pathological conditions including neurodegenerative diseases, attention deficit hyperactivity disorder (ADHD), arrhythmias, and Type-2 diabetes

(Gupta and Kulhara, 2010; Ungless and Grace, 2012; Wu et al., 2012; Eagle, 2012 and

2014).

Moreover, patients diagnosed with autism are inclined to have impaired sulfoconjugation capacity of various endogenous compounds and xenobiotics, particularly DA and 5-HT (Alberti et al., 1999; O’Reilly and Waring, 1993).

Importantly, some autistic patients were found to have high levels of un-sulfated 5-HT and low levels of phenol sulfotransferase, which indirectly confirms the role of impaired sulfation in this disorder (O’Reilly and Waring, 1993). Several other studies have demonstrated a correlation between patients diagnosed with autism and decreased expression of SULT1A isoforms, SULT1A1 and SULT1A3, in the platelets and the gastrointestinal cells (Waring and Kovrza, 2000; Shattock and Whiteley, 2002).

More recent studies have reported a difactorial theory of impaired sulfation, which involves a combination of non-genetic and genetic predispositions. Non-genetic factors are essential contributors to the development of autism, and play an important role in potentiating the sulfation deficiency (Al-Yafee et al., 2011; Waring and Kovrza, 2000).

For example, children at early stages of their life have immature sulfotransferases in their developing central nervous system. High doses of APAP, for example, could saturate the compromised sulfotransferase enzyme, thereby potentiating neuronal damage (Liu and

Klaassen, 1996). It is possible that impaired sulfation capability could result in decreased

elimination of foods and chemicals, which contain phenols and amines. Significantly, the autistic subjects were shown to manifest worsening autistic behavior when they were administered compounds known to be metabolized by phenol sulfotransferase (O’Reilly and Waring, 1993).

Interestingly, genetic variations in SULT1A3 were first reported by studies of

Thomae et al., (2003), which demonstrated the presence of one non-synonymous SNP

(702 G>T) in SULT1A3 gene with higher allyl frequency in African Americans. The studies also reported that the variant allyl (Lys234Asn, NT 702 G>T) has a specific activity of only about 27% of that of the wild-type of SULT1A3 towards DA. Another functional genomic study revealed 11 novel polymorphisms, of which 3 are missense

SNPs. Two of these SNPs, C302T and C302A, were shown to decrease the enzyme specific activity towards DA using recombinant SULT1A3 allozymes that were transiently expressed in COS-1 cells (Hildebrandt et al., 2004). In addition, studies on four SULT1A3 allozymes revealed that their ritodrine-sulfating activity varied significantly (Hui and Liu, 2015).

Other studies have also demonstrated that the occurrence of SULT1A allozymes in combination with high doses of red wine, phenols, and polyphenols in food may precipitate/aggravate several pathological conditions including ADHD, sudden cardiac death, blood pressure changes, migraine, and type-2 diabetes as a result of catecholamines build-up (Eagle, 2012 and 2014). For more details, we listed some of the important pathophysiological conditions associated with abnormal human SULT1A3 level/function in Table 1.4.

Table 1.4 Pathophysiological association with human SULT1A3 enzyme. Pathophysiology Consequences References

- Substrates build up (High levels of Impaired sulfation or DA, EP, NE and 5-HT) and O’Reilly and Waring, decreased expression adverse reactions. 1993 level of SULT1A - The urine APAP-sulfate/ Alberti et al., 1999 isoforms, SULT1A1 APAP-glucuronide (PS/PG) Eagle, 2012 and 2014 and SULT1A3. ratio lower than control group Inhibit induction or DA-dependent neurodegenerative silencing RNA of Sidharthan et al., 2013 diseases SULT1A3 (SNPs: Lys234Asn, Pro101Leu, Reduce the specific activity Thomae et al., 2003 Pro101His and toward DA by varying degrees. Hui and Liu, 2015 Arg144Cys)

In view of the above-mentioned findings, an intriguing question is whether the genetic polymorphisms of SULT1A3/SULT1A4 may affect the homeostasis of catecholamines, that result in the above-mentioned pathological conditions. Based on the potential impact of genetic variations on the functioning of protein products, we hypothesize that missense single nucleotide polymorphisms (SNPs) of SULT1A3 and

SULT1A4 genes could lead to SULT1A3 allozymes with differential sulfating activities towards endogenous substrates including DA, EP, NE, 5-HT, as well as xenobiotic compounds including therapeutic agents. Moreover, by serving as substrates for

SULT1A3, xenobiotic compounds and naturally occurring phenols and polyphenols may exert inhibitory effects on the sulfation of endogenous catecholamines.

Chapter 2

Materials and Methods

2.1. Materials

Adenosine 5’-triphosphate (ATP), dithiothreitol (DTT), dimethyl sulfoxide

(DMSO), DA, EP, 5-HT, APAP, Catechin, N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES), 2-morpholinoethanesulfonic acid (MES), 2-(cyclohexylamino) ethanesulfonic acid (CHES), 3-[N-tris-(hydroxymethyl) methylamino]-propanesulfonic acid (TAPS), and 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS) were products of

Sigma Chemical Company (St. Louis, MO). NE, morphine, tapentadol, O-DMT, and hesperetin were purchased from Cayman Chemical Company (Ann Arbor, MI).

Cellulose thin-layer chromatography (TLC) plates were from EMD Millipore

Corporation (Burlington, MA). 3’-Phosphoadenosine-5’-phospho[35S]sulfate (PAP[35S]) was prepared using ATP and carrier-free [35S]sulfate based on a previously established protocol (Yanagisawa et al., 1998). DpnI restriction enzyme was purchased from

Thermo Fisher Scientific (Waltham, MA). Oligonucleotide primers were synthesized by

Eurofins Genomics (Louisville, KY). X-Ray films were products of Research Products

International Corporation (Mt Prospect, IL). Prime STAR GXL DNA Polymerase was

purchased from Clontech Laboratories, Inc. (Mountain View, CA). PCR kit was from G

Biosciences (St. Louis, MO). Protein molecular weight markers were from Bioland

Scientific LLC (Paramount, CA). QIAprep Spin Miniprep Kit was a product of QIAGEN

(Germantown, MD). Ecolume scintillation cocktail was from MP Biomedical LLC

(Irvine, CA). Glutathione Sepharose was purchased from GE Healthcare Life Sciences

(Pittsburgh, PA). HepG2 human hepatoma cell line (ATCC HB-8065) and Caco-2 human epithelial colorectal adenocarcinoma cell line (ATCC HTB-37) were obtained from American Type Culture Collection (Manassas, VA). Pooled human lung, liver, small intestine (duodenum and jejunum), and kidney cytosols were purchased from

XenoTech, LLC (Kansas City, KS). All other chemicals were of the highest grades commercially available.

2.2. Methods

2.2.1. Database search

A comprehensive search was performed for SULT1A3 and SULT1A4 SNP clones deposited in three databases located at, respectively, the U.S. National Center for

Biotechnology Information (NCBI), the UniProt Knowledgebase (UniProtKB) and

European Molecular Biology Laboratory-European Nucleotide Archive (EMBL-ENA).

Moreover, the NCBI PubMed was searched for previous studies (for example, Thomae et al., 2003; Hildebrandt et al., 2004; Hui and Liu, 2015) describing SNPs of these two genes, database review was completed in August 2016, since then additional SNPs have

been identified. It is important to identify polymorphisms that exist in both SULT1A3 and SULT1A4 genes. Based on the database search completed in August 2016, the identified SNPs were categorized according to their locations in each of the two genes, as listed in Table 2.1. Among 16 missense coding SNPs identified in both genes, 13 distinct SNPs were recognized and arranged in Table 2.2 according to their altered nucleotide/amino acid location in the cDNA/protein molecule, respectively. In a recent database review, additional SNPs were identified and listed in Table 2.3.

Table 2.1 List of single nucleotide polymorphisms in human SULT1A3 and SULT1A4 genes. SNP1 location SULT1A3 SULT1A4

3’-untranslated region (3’-UTR) 2 1

Intron regions 19 25

Synonymous coding SNPs 6 7

Nonsense coding SNP 1 -

Missense coding SNPs 10 6

Total 38 39 1Refers to single nucleotide polymorphism.

2.2.2. Generation of SULT1A3 cDNAs coding for SULT1A3 allozymes

Site-directed mutagenesis technique was employed to produce specific and intentional changes in the SULT1A3 cDNA that correspond to different variants of

SULT1A3 and SULT1A4 genes. First, according to the SNPs sites, we designed short

segments of nucleotide primers (37-base in length) with specific nucleotide changes (as shown in Table 2.4).

Table 2.2 List of selected missense coding SNPs in human SULT1A3 and SULT1A4 genes.

NT2 Allele AA4 SNP1 code number position in NT change frequency pos. AA residue change mRNA3 rs776817009/ 0.00035320 123 ACC⇒ CCC 7 T [Thr]⇒ P [Pro] rs754600221 0.00078903 rs767263838 0.0000112 126 TCC⇒ CCC 8 S [Ser]⇒ P [Pro] rs762151655/ 0.00006645 129 CGC⇒ TGC 9 R [Arg]⇒ C [Cys] rs752303630 0.00044968 rs757573592 0.00000914 133 CCG⇒ CTG 10 P [Pro]⇒ L [Leu] rs750575779/ 0.00004058 147 GTG⇒ ATG 15 V [Val]⇒ M [Met] rs758881470 0.00008234 rs553050853 0.0002 156 GTC⇒ TTC 18 V [Val]⇒ F [Phe] rs747088850 0.00001905 160 CCG⇒ CTG 19 P [Pro]⇒ L [Leu] rs751527244 0.00044613 406 CCC⇒ CTC 101 P [Pro]⇒ L [Leu] PMID5:15358107 ,0.025(AF6) 0.004 PMID:15358107 406 CCC⇒ CAC 101 P [Pro]⇒ H [His] (AF) 0.025 PMID:15358107 534 CGT⇒ TGT 144 R [Arg]⇒ C [Cys] (AF) 0.026 PMID:15358107 806 AAG⇒AAT 234 K [Lys]⇒ N [Asn] (AF) PMID:U34199.1 - 808 AAC⇒ ACC 235 N [Asn]⇒ T [Thr] Uniprot7:P0DMM9 PMID:U34199.1 - 973 AGC⇒ ACC 290 S [Ser]⇒ T [Thr] Uniprot:P0DMM9 1Refers to single nucleotide polymorphism. 2Refers to nucleotide. 3Refers to messenger ribonucleic acid. 4Refers to amino acid. 5Refers to PubMed database. 6Refers to African Americans. 7Refers to UniProt Knowledgebase (UniProtKB).

Table 2.3 List of additional missense coding SNPs in human SULT1A3 and SULT1A4 genes identified in a recent database reveiw.

NT2 SNP1 code Allele AA4 position in NT change number frequency pos. AA residue change mRNA3 rs1321459339 0.00002 105 ATG ⇒ GTG 1 M [Met]⇒ V [Val] rs1219858626 - 107 ATG ⇒ ATA 1 M [Met]⇒ I [Ile] rs1315221905 0.000008 115 ATC ⇒ ACC 4 I [Ile]⇒ T [Thr] rs1447149120 0.0002 130 CGC ⇒ CAC 9 R [Arg]⇒ H [His] rs1365088113 0.000008 139 CTG ⇒ CCG 12 L [Leu]⇒ P [Pro] rs1162480365 - 143 GAG⇒ GAC 13 E [Glu]⇒ D [Asp] rs1309692134 - 166 ATC ⇒ AAC 21 I [Ile]⇒ N [Asn] rs1267110457 - 182 GAG ⇒ GAC 26 E [Glu]⇒ D [Asp] rs1486791991 0.000008 184 GCA ⇒ GTA 27 A [Ala] ⇒ V [Val] rs1463122474 - 187 CTG ⇒ CAG 28 L [Leu]⇒ Q [Gln] rs1211675953 - 189 GGG ⇒ TGG 29 G [Gly]⇒ W [Trp] rs1237950686 - 192 CCC⇒ ACC 30 P [Pro]⇒ T [Thr] rs1482921573 - 195 CTG⇒ GTG 31 L [Leu] ⇒ V [Val] rs1158658024 0.00002 214 CGA ⇒ CAA 37 R [Arg]⇒ Q [Gln] rs1295287426 0.00003 219 GAT ⇒ AAT 39 D [Asp]⇒ N [Asn] rs1410064152 0.000008 223 GAC ⇒ GGC 40 D [Asp]⇒ G [Gly] rs1340308561 0.00002 235 AAC ⇒ AGC 44 N [Asn] ⇒ S [Ser] rs1334978971 - 241 TAC ⇒ TGC 46 Y [Tyr]⇒ C [Cys] rs1409633538 0.000008 247 AAG ⇒ ACG 48 K [Lys]⇒ T [Thr]

NT2 SNP1 code Allele AA4 position in NT change number frequency pos. AA residue change mRNA3 rs1249853589 0.000008 253 GGC ⇒ GCC 50 G [Gly]⇒ A [Ala] rs1173225749 - 282 ATG ⇒ GTG 60 M [Met]⇒ V [Val] rs1170991645 0.00005 297 GGC ⇒ AGC 65 G [Gly]⇒ S [Ser] rs1409564711 0.00004 300 GAC ⇒ AAC 66 D [Asp]⇒ N [Asn] rs1306634206 - 309 AAG ⇒ CAG 69 K [Lys]⇒ Q [Gln] rs1333603372 - 315 AAC ⇒ CAC 71 N [Asn]⇒ H [His] rs1029479460 0.00004 318 CGG ⇒ TGG 72 R [Arg]⇒ W [Trp] rs1275077644 - 319 CGG ⇒ CAG 72 R [Arg]⇒ Q [Gln] rs1231472640 - 328 ATC ⇒ ACC 75 I [Ile]⇒ T [Thr] rs1342834727 0.00006 333 GTA ⇒ ATA 77 V [Val]⇒ I [Ile] rs1204171913 0.00004 336 CGG ⇒ TGG 78 R [Arg]⇒ W [Trp] rs1270699829 0.0001 337 CGG ⇒ CAG 78 R [Arg]⇒ Q [Gln] rs1199771885 - 355 GTC ⇒ GAC 84 V [Val]⇒ D [Asp] rs1246380996 - 358 AAT ⇒ AGT 85 N [Asn]⇒ S [Ser] rs1394660678 0.000008 360 GAT ⇒ AAT 86 D [Asp]⇒ N [Asn] rs1477067521 0.000008 363 CCA ⇒ TCA 87 P [Pro] ⇒ S [Ser] rs1358156071 0.0001 403 CCG ⇒ CTG 100 P [Pro]⇒ L [Leu] rs1289387512 - 405 CCC ⇒ TCC 101 P [Pro]⇒ S [Ser] rs1210653013 - 409 CCA ⇒ CAA 102 P [Pro]⇒ Q [Gln] rs1248655783 0.00006 411 CGG ⇒ TGG 103 R [Arg]⇒ W [Trp]

NT2 SNP1 code Allele AA4 position in NT change number frequency pos. AA residue change mRNA3 rs1448943588 0.00005 412 CGG ⇒ CAG 103 R [Arg] ⇒ Q [Gln]

rs953995404 0.00002 421 AAG ⇒ AGG 106 K [Lys]⇒ R [Arg] rs1473318728 - 422 AAG ⇒ AAT 106 K [Lys] ⇒ N [Asn]

rs985341442 0.00002 432 CCC ⇒ TCC 110 P [Pro]⇒ S [Ser] rs1432211275 0.001 460 TTG ⇒ TGG 119 L [Leu] ⇒ W [Trp] rs1160880481 - 741 CGC ⇒ TGC 213 R [Arg]⇒ C [Cys] rs1412288244 - 742 CGC ⇒ CAC 213 R [Arg] ⇒ H [His] rs1286677533 - 756 GAG ⇒ CAG 218 E [Glu]⇒ Q [Gln] rs1396472143 - 762 ATG ⇒ GTG 220 M [Met] ⇒ V [Val] rs1333430796 - 763 ATG ⇒ ACG 220 M [Met]⇒ T [Thr] rs1353284914 - 782 CAC ⇒ CAG 226 H [His]⇒ Q [Gln] rs1230027168 - 784 ACG ⇒ ATG 227 T [Thr]⇒ M [Met] rs1289193119 - 803 AAG ⇒ AAC 233 K [Lys]⇒ N [Asn] rs1236970624 - 814 ATG ⇒ AGG 237 M [Met]⇒ R [Arg] rs1257894510 - 831 GTC ⇒ ATC 243 V [Val]⇒ I [Ile] rs1274293838 0.0032 916 GCG ⇒ GTG 271 A [Ala]⇒ V [Val] rs1366536057 - 948 GAG ⇒ AAG 282 E [Glu]⇒ K [Lys] 1Refers to single nucleotide polymorphism. 2Refers to nucleotide. 3Refers to messenger ribonucleic acid. 4Refers to amino acid.

Table 2.4 List of selected single nucleotide polymorphisms with their designed mutagenic primers of the human SULT1A3 and SULT1A4 genes. SULT1A3 Primers Allozymes 5´- ATGGAGCTGATCCAGGACC1CCTCCCGCCCGCCACTGG -3´ SULT1A3-T7P 5´- CCAGTGGCGGGCGGGAGGGGTCCTGGATCAGCTCCAT -3´ 5´- GAGCTGATCCAGGACACCCCCCGCCCGCCACTGGAGT -3´ SULT1A3-S8P 5´- ACTCCAGTGGCGGGCGGGGGGTGTCCTGGATCAGCTC -3´ 5´- CTGATCCAGGACACCTCCTGCCCGCCACTGGAGTACG -3´ SULT1A3-R9C 5´- CGTACTCCAGTGGCGGGCAGGAGGTGTCCTGGATCAG -3´ 5´- TCCAGGACACCTCCCGCCTGCCACTGGAGTACGTGAA -3´ SULT1A3-P10L 5´- TTCACGTACTCCAGTGGCAGGCGGGAGGTGTCCTGGA -3´ 5´- CGCCCGCCACTGGAGTACATGAAGGGGGTCCCGCTCA -3´ SULT1A3-V15M 5´- TGAGCGGGACCCCCTTCATGTACTCCAGTGGCGGGCG -3´ 5´- CTGGAGTACGTGAAGGGGTTCCCGCTCATCAAGTACT -3´ SULT1A3-V18F 5´- AGTACTTGATGAGCGGGAACCCCTTCACGTACTCCAG -3´ 5`- AGTACGTGAAGGGGGTCCTGCTCATCAAGTACTTTGC -3` SULT1A3- P19L 5`- GCAAAGTACTTGATGAGCAGGACCCCCTTCACGTACT -3` 5´- CTCTGAAAGACACACCGCTCCCACGGCTCATCAAGTC -3´ SULT1A3-P101L 5´- GACTTGATGAGCCGTGGGAGCGGTGTGTCTTTCAGAG -3´ 5´- CTCTGAAAGACACACCGCACCCACGGCTCATCAAGTC -3´ SULT1A3-P101H 5´- GACTTGATGAGCCGTGGGTGCGGTGTGTCTTTCAGAG -3´ 5´- TCCTACTACCATTTCCACTGTATGGAAAAGGCGCACC -3´ SULT1A3-R144C 5´- GGTGCGCCTTTTCCATACAGTGGAAATGGTAGTAGGA -3´ 5´- GTTCAAGGAGATGAAGAATAACCCTATGACCAACTAC -3´ SULT1A3-K234N 5´- GTAGTTGGTCATAGGGTTATTCTTCATCTCCTTGAAC -3´ 5´- TCAAGGAGATGAAGAAGACCCCTATGACCAACTACAC -3´ SULT1A3-N235T 5´- GTGTAGTTGGTCATAGGGGTCTTCTTCATCTCCTTGA -3´ 5´- TGGCAGGCTGCAGCCTCACCTTCCGCTCTGAGCTGTG -3´ SULT1A3-S290T 5´- CACAGCTCAGAGCGGAAGGTGAGGCTGCAGCCTGCCA -3´ 1letters in bold and underline are altered/mutated nucleotides (SNPs).

The concentration of the mutagenic primers used was 10 µM. Also, 1 µL of the wild-type SULT1A3 cDNA (which is packaged in the PGEX-2TK prokaryotic vector) 31

was used as a template to PCR-amplify the mutated SULT1A3 cDNAs. The PCR conditions of the side-directed mutagenesis consisted of an initial denaturation temperature for 2 minutes at 94 °C followed by 30 seconds denaturation at 94 °C through each cycle, an annealing step of 55 °C for 60 seconds, and an extension step of 72 °C for

7 minutes. 12 thermo cycles were conducted which terminated by a final extension of 7 minutes at 72 °C.

Post PCR amplification, DpnI restriction enzyme was used to digest the methylated wild-type cDNA at 37 °C for 30 minutes, leaving the cDNA (plasmid) of the

SULT1A3 allozyme intact. Subsequently, the plasmid that carries the mutated SULT1A3 cDNA was transformed into NEB 5-alpha E. coli competent cells. The protocol used for transformation in NEB 5-alpha cells included:

A. Thawing the tube of NEB 5-alpha Competent E. coli cells on ice until the last ice

crystals disappear.

B. Adding 1 µl (containing 1 pg-100 ng of the plasmid, mutant cDNA) to the cell

mixture, and carefully flicking the tube 4-5 times to mix cells and cDNA.

C. Leaving the mixture on ice for 30 minutes.

D. Heat shock at exactly 42 °C for exactly 30 seconds. Then, placing on ice for 5

minutes.

E. Adding 150 µl of Super Optimal broth with Catabolite (SOC) medium into the

mixture at room temperature and mixing vigorously, (250 rpm) at 37 °C for 60

minutes.

F. Mixing the cells thoroughly by flicking the tube and inverting, then spreading the

mixture onto a selection plate and incubation overnight at 37 °C.

Later, colony PCR was performed on selected NEB 5-alpha colonies to determine the presence or absence of insert DNA in the plasmid constructs. The conditions of colony PCR involved an initial denaturation for 2 minutes at 94 ℃ followed by 30 seconds denaturation at 94 ℃ during thermocycling, an annealing step of 55 °C for 30 seconds, then an extension temperature of 72 °C for 90 seconds. Thirty five thermo cycles were performed and ended by an extension temperature of 72 °C for 5 minutes.

The results of colony PCR conducted on the NEB 5-alpha clones of SULT1A3 allozymes, were shown in Figure 2-1.

Figure 2-1. Validation of mutant cDNAs harbored in NEB 5-alpha Competent E. coli competent cells of SULT1A3 allozymes by colony PCR. Positions of the DNA ladder are indicated on the left. 33

Positive colonies were grown for plasmid extraction using a Miniprep Kit. Post plasmid extraction and purification, the sequences of the “mutated” cDNAs were verified by nucleotide sequencing (Sanger et al., 1977), and were analyzed by Clustal Omega software to confirm the presence of desired SNP in the cDNA of each SULT1A3 allozyme.

2.2.3. Expression and purification of recombinant SULT1A3 allozymes

Plasmids carrying mutated SULT1A3 cDNA were transformed into BL21 competent E. coli cells using heat shock method that was based on the previously mentioned transformation protocol. Post transformation, the colonies were also analyzed by colony PCR to identify the colonies that have having the insert DNA in the plasmid constructs. The same previously mentioned colony PCR conditions were used, and the results are shown in Figure 2-2.

Positive colonies of the transformed BL21 cells were grown in large scale for 12 hours and induced with isopropyl β-D-1-thiogalactopyranoside (IPTG). Induced cells were collected and homogenized using an Aminco French press. A one-step purification of the recombinant SULT1A3 protein was conducted, using glutathione-Sepharose, followed by thrombin digestion. The purity of the SULT1A3 allozymes was examined using polyacrylamide SDS gel electrophoresis (cf. Figure 2-3) (Shapiro et al., 1967;

Laemmli, 1970), and the protein concentration was determined using the Bradford method (Bradford, 1976).

Figure 2-2. Validation of mutant cDNAs harbored in BL21 E. coli competent cells of SULT1A3 allozymes by colony PCR. Positions of the DNA ladder are indicated on the left.

- 170 kDa - 70 kDa

- 41 kDa

- 30 kDa

- 22 kDa

Figure 2-3. SDS-PAGE gel electrophoresis pattern of the purified SULT1A3 allozymes. SDS-PAGE was performed on a 12% gel, followed by Coomassie Blue staining. Positions of protein molecular weight markers are indicated on the right.

2.2.4. Analysis of differential sulfating activities of SULT1A3 allozymes towards endogenous and exogenous compounds

An established assay procedure was employed to determine the specific enzymatic activity of each allozyme using PAP[35S] as a sulfate donor toward DA, EP,

NE, 5-HT, APAP, morphine, tapentadol, O-DMT, phenylephrine, and salbutamol. The reaction was performed at pH 7.4 and at a temperature of 37 Cº for 10 min, followed by

TLC. Upon completion of TLC, autoradiography was performed using an X-ray film to reveal the sulfated product spot position. The spot was then cut out and the sulfated product therein was eluted for quantitative measurement using liquid scintillation counter. The outcomes in cpm obtained were used to calculate the specific activity, in

nmol, of sulfated product/min/mg of enzyme. Kinetic constants, Km and Vmax, were determined by the same protocol for each variant allozyme using different substrate concentrations, 0, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50, 75 and 100 µM for DA and EP; 0, 0.001,

0.1, 0.5, 1, 5, 10, 25, 50, 100, 150 and 200 µM for NE; 0, 1, 10, 50, 100, 125, 250, 500,

750 and 1000 µM for 5-HT. Moreover, the catalytic efficiency of the SULT1A3 allozymes was determined by considering both Vmax and Km.

2.2.5. Analysis of differential sulfating activities of SULT1A3 allozymes toward xenobiotics

The afore-described assay was employed to evaluate the specific activity, the kinetic constants, Km and Vmax, as well as the catalytic efficiency using a range of exogenous substrates concentrations, 0, 50, 66.6, 100, 200, and 500 µM for APAP; 0,

400, 500, 666.6, 1000, and 2000 µM for morphine; 0, 10, 12.5, 16.6, 25, 50, and 100 µM for tapentadol; 0, 25, 33.3, 50, 100, and 250 µM for O-DMT; 0, 0.5, 1, 2.5, 5, 10, 20, 30,

40, 50, 60, 70 and 80 µM for phenylephrine; and 0, 5, 10, 25, 50, 66.6, 100, 200, 500,

750, 1000 and 1500 µM for salbutamol.

2.2.6. Statistical analysis

Data obtained from the kinetic experiments were analyzed based on the non-linear regression and/or Lineweaver-Burk plot of the Michaelis-Menten equation to calculate the kinetic constants. GraphPad Prism 7 software was used in data analysis.

Chapter 3

Sulfation of Catecholamines and Serotonin by SULT1A3 Allozymes

Published in Biochemical Pharmacology 2018 Mar 8;151:104-113.

Ahsan F. Bairam1,2, Mohammed I. Rasool1,3, Fatemah A. Alherz1, Maryam S Abunnaja1, Amal A. El Daibani1, Saud A. Gohal1, Katsuhisa Kurogi1,4, Yoichi Sakakibara4, Masahito Suiko4, Ming-Cheh Liu1,*

1Department of Pharmacology, College of Pharmacy and Pharmaceutical Sciences, University of Toledo Health Science Campus, Toledo, OH 43614 USA 2Department of Pharmacology, College of Pharmacy, University of Kufa, Najaf, Iraq 3Department of Pharmacology, College of Pharmacy, University of Karbala, Karbala, Iraq 4Biochemistry and Applied Biosciences, University of Miyazaki, Miyazaki 889-2192 Japan

*Corresponding Author: Ming-Cheh Liu, Ph.D. Professor Department of Pharmacology College of Pharmacy and Pharmaceutical Sciences University of Toledo Health Science Campus 3000 Arlington Avenue Toledo, OH 43614 USA

Tel: (419) 383-1918 Fax: (419) 383-1909 E-mail [email protected]

Running Title: Sulfation of Catecholamines and Serotonin by SULT1A3 Allozymes 38

Keywords: Single nucleotide polymorphisms; cytosolic sulfotransferase; SULT1A3; sulfation; catecholamines; serotonin.

Abbreviations: DA, dopamine; EP, epinephrine; NE, norepinephrine; 5-HT, serotonin:

PAPS, 3’-phosphoadenosine-5’-phosphosulfate; SULT, cytosolic sulfotransferase; TLC; thin-layer chromatography; SNP, single nucleotide polymorphism.

Abstract

Previous studies have demonstrated the involvement of sulfoconjugation in the metabolism of catecholamines and serotonin. The current study aimed to clarify the effects of single nucleotide polymorphisms (SNPs) of human SULT1A3 and SULT1A4 genes on the enzymatic characteristics of the sulfation of dopamine, epinephrine, norepinephrine and serotonin by SULT1A3 allozymes. Following a comprehensive search of different SULT1A3 and SULT1A4 genotypes, twelve non-synonymous

(missense) coding SNPs (cSNPs) of SULT1A3/SULT1A4 were identified. cDNAs encoding the corresponding SULT1A3 allozymes, packaged in pGEX-2T vector were generated by site-directed mutagenesis. SULT1A3 allozymes were expressed and purified. Purified SULT1A3 allozymes exhibited differential sulfating activity toward catecholamines and serotonin. Kinetic analyses demonstrated differences in both substrate affinity and catalytic efficiency of the SULT1A3 allozymes. Collectively, these findings provide useful information relevant to the differential metabolism of dopamine,

epinephrine, norepinephrine and serotonin through sulfoconjugation in individuals having different SULT1A3/SULT1A4 genotypes.

3.1. Introduction

Catecholamines, including dopamine (DA), epinephrine (EP) and norepinephrine

(NE), and serotonin (5-hydroxytryptamine; 5-HT) constitute an important group of monoamine neurotransmitters/hormones that play key roles in the regulation of physiological processes such as mood, body temperature, heart rate, blood pressure, gastrointestinal motility and secretions, as well as the development of various neurological, psychiatric, endocrine, and cardiovascular diseases [1-4]. They are synthesized centrally and peripherally in, for example, the adrenal glands, gastrointestinal tract, kidneys, pancreas, and immune system [5-12]. Studies have shown that more than

98% of DA and approximately 80% of total EP and NE are present in the sulfated form in circulation [13,14]. For 5-HT, its sulfated derivative, 5-HT sulfate, has also been detected in blood and cerebrospinal fluids [15,16]. Thus, sulfation has been proposed to play important roles in the regulation and biotransformation of catecholamines as well as

5-HT [17-19].

In mammals, sulfation as catalyzed by the cytosolic sulfotransferases (SULTs) has been shown to be involved in the metabolism and elimination of xenobiotics as well as the homeostasis of key endogenous compounds such as catecholamines, 5-HT, steroid/thyroid hormones, cholesterol, and bile acids [20-22]. The SULTs mediate the transfer of a sulfonate group from the donor co-substrate, 3´-phosphoadenosine 5´-

phosphosulfate (PAPS), to the hydroxyl or amino group of an acceptor substrate compound [23]. While there are occasionally exceptions, sulfate-conjugated compounds generally become inactive and more hydrophilic and thus can be eliminated more easily from the body [21,22]. Of the 13 human SULTs, SULT1A3 has been identified as the main enzyme responsible for sulfating catecholamines and 5-HT [24,25]. It is noted that

SULT1A3 is found only in humans and closely related primates [26]. Interestingly, genomic studies have revealed the duplication of the gene coding for SULT1A3 during the evolutionary process [27,28]. Two genes, designated SULT1A3 and SULT1A4, located on chromosome 16 have been identified and shown to encode identical protein products, collectively called SULT1A3 [28,29]. Importantly, ethnic-specific inherited alterations in catecholamine sulfation in humans have been reported [30]. An intriguing question is whether the genetic polymorphisms of SULT1A3 and SULT1A4 may affect the enzymatic activity of the resulting SULT1A3 protein product and thus the homeostasis of catecholamines and 5-HT and possibly pathophysiological conditions associated with these latter compounds.

The current study was based on the hypothesis that nonsynonymous missense single nucleotide polymorphisms (SNPs) of SULT1A3 and SULT1A4 genes could lead to

SULT1A3 allozymes with differential sulfating activities toward DA, EP, NE and 5-HT.

We report in this paper a systematic database search for human SULT1A3 and SULT1A4

SNPs. Twelve missense SNPs were identified and the cDNAs and the corresponding

SULT1A3 allozymes were generated, expressed, and purified. Purified SULT1A3 allozymes were analyzed for their enzymatic characteristics toward catecholamines and

5-HT.

3.2. Materials and Methods

3.2.1. Materials

Adenosine 5’-triphosphate (ATP), dithiothreitol (DTT), dimethyl sulfoxide

(DMSO), N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES), DA, EP and 5-HT were products of Sigma Chemical Company (St. Louis, MO, USA). NE was purchased from Cayman Chemical Company (Ann Arbor, MI, USA). Cellulose thin-layer chromatography (TLC) plates were from EMD Millipore Corporation (Burlington, MA,

USA). 3’-Phosphoadenosine-5’-phospho[35S]sulfate (PAP[35S]) was prepared using ATP and carrier-free [35S]sulfate based on a previously established protocol [31].

Oligonucleotide primers were synthesized by Eurofins Genomics (Louisville, KY, USA).

X-Ray films were products of Research Products International Corporation (Mt Prospect,

IL, USA). Prime STAR GXL DNA Polymerase was purchased from Clontech

Laboratories, Inc. (Mountain View, CA, USA). PCR kit was from G Biosciences (St.

Louis, MO, USA). Protein molecular weight markers were from Bioland Scientific LLC

(Paramount, CA, USA). QIAprep Spin Miniprep Kit was a product of QIAGEN

(Germantown, MD, USA). Ecolume scintillation cocktail was from MP Biomedical LLC

(Irvine, CA, USA). Glutathione Sepharose was purchased from GE Healthcare Life

Sciences (Pittsburgh, PA, USA). All other chemicals were of the highest grades commercially available.

3.2.2. Methods

3.2.2.1. Database search

A comprehensive search was performed for SULT1A3 and SULT1A4 SNP clones deposited in two databases located at, respectively, the U.S. National Center for

Biotechnology Information (NCBI) and the UniProt Knowledgebase (UniProtKB).

Moreover, the NCBI PubMed was searched for previous studies (for example, Thomae et al. 2003 [30] and Hildebrandt et al. 2004 [28]) describing SNPs of these two genes.

3.2.2.2. Generation, expression, and purification of SULT1A3 allozymes

Site-directed mutagenesis was performed to generate cDNAs encoding SULT1A3 allozymes packaged in pGEX-2TK vector. Briefly, mutagenic primers (cf. Table 2.4 page 31) corresponding to specific SULT1A3/SULT1A4 missense cSNPs were designed and synthesized. Wild-type SULT1A3 cDNA packaged in pGEX-2TK prokaryotic vector was used as the template in conjunction with specific mutagenic primers to amplify mutated SULT1A3 cDNAs coding for different SULT1A3 allozymes. The sequences of the “mutated” cDNAs were verified by nucleotide sequencing [32]. The pGEX-2TK vector harboring individual mutated SULT1A3 cDNA was transformed into

BL21 E. coli cells. After induction of recombinant SULT1A3 expression by IPTG, affinity chromatography using glutathione-Sepharose was performed, followed by thrombin digestion to release purified recombinant SULT1A3 allozyme. The purity of

purified recombinant allozymes was analyzed by SDS-polyacrylamide gel electrophoresis

(SDS-PAGE) [33,34]. The concentrations of these allozymes were measured based on

Bradford protein assay [35].

3.2.2.3. Enzymatic assay

To analyze the sulfating activity of SULT1A3 allozymes toward DA, EP, NE and

5-HT, an established assay protocol was employed [36]. Two different concentrations were tested for each of the four substrates. Radioactive PAP[35S] was used as the sulfate donor. The assays were performed at pH 7.4 and allowed to proceed at 37ºC for 10 min, followed by TLC separation of the reaction mixtures. Upon completion of TLC, autoradiography was performed using an X-ray film to locate the position of sulfated product. The radioactive sulfated product spot was then cut out and the sulfated product therein eluted for the quantitative measurement of [35S]-radioactivity using a liquid scintillation counter. Specific activity of the SULT1A3 allozymes was calculated based on the [35S]-radioactivity determined. In kinetic experiments, different substrate concentrations, 0, 0.25, 0.5, 1, 2.5, 5, 10, 25, 50, 75 and 100 µM for DA and EP, 0, 0.001,

0.1, 0.5, 1, 5, 10, 25, 50, 100, 150 and 200 µM for NE, and 1, 10, 50, 100, 125, 250, 500,

750 and 1000 µM for 5-HT.

3.2.2.4. Statistical analysis

Data obtained from the kinetic experiments were analyzed based on the non-linear

regression of the Michaelis-Menten equation to calculate the kinetic constants. GraphPad

Prism 7 software was used in data analysis.

3.3. Results

3.3.1. Analysis of human SULT1A3 and SULT1A4 single nucleotide polymorphisms

SNPs of SULT1A3 and SULT1A4 genes, as identified in above-mentioned database search, were categorized according to the location of variations in each of the two genes. For the SULT1A3 gene, a total of 38 SNPs, including 2 in the 3’-untranslated region (3’-UTR), 19 in the intron regions, 6 synonymous cSNPs, one nonsense cSNP, and 10 missense cSNPs, were identified. For the SULT1A4 gene, a total of 39 SNPs, including 1 in the 3’-UTR, 25 in the intron regions, 7 synonymous cSNPs, and 6 missense cSNPs, were identified. Of the 16 missense cSNPs found for both SULT1A3 and SULT1A4 genes, 13 distinct amino acid alterations were found. The designated names and their SNP ID number for these 13 SNPs are: SULT1A3-T7P (Reference SNP

(rs)776817009/ rs754600221), SULT1A3-S8P (rs767263838), SULT1A3-R9C

(rs762151655/ rs752303630), SULT1A3-P10L (rs757573592), SULT1A3-V15M

(rs750575779/ rs758881470), SULT1A3-V18F (rs553050853), SULT1A3-P19L

(rs747088850), SULT1A3-P101L (rs751527244), SULT1A3-P101H, SULT1A3-R144C and SULT1A3-K234N [28], SULT1A3-N235T (UniProt P0DMM9) and SULT1A3-

S290T (UniProt P0DMM9). Figure 3-1 illustrates the locations of amino acid variations associated with above-mentioned cSNPs, together with previously reported

sequences/residues involved in PAPS-binding, substrate-binding, and/or catalysis.

Examination of the reported crystal structures of SULT1A3 [37] revealed that these amino acid residues are positioned close to the surface of the molecule (Figure 3-2).

Interestingly, many of them are associated with the three important loops/segments,

Asp66-Met77, Ser228-Gly259, and Lys85-Pro90, which have been proposed to be involved in the formation of the gate that governs the substrate selectivity [38] (cf.

Figure 3-2).

P P C

N M T

Figure 3-1. Amino acid sequence of the human SULT1A3 showing the locations of amino acid residues involved in the SULT1A3/SULT1A4 cSNPs and segments/residues reported to be involved in PAPS-binding, substrate- binding, and/or catalysis. Residues circled with white background are involved in PAPS-binding. Residues enclosed in square are involved in substrate-binding. Residue enclosed in diamond is involved in catalysis. Residues circled with black background refer to the locations of amino acid substitutions in the polypeptide chain of the SULT1A3 molecule. Residues circled with gray background refer to the substituting amino acids. The figure was generated using Protter, a web tool for interactive protein feature visualization [63].

Figure 3-2. Ribbon diagram of the structure of human SULT1A3-dopamine-PAP complex showing the locations of amino acid residues involved in the SULT1A3/SULT1A4 cSNPs. The structure of SULT1A3 (Protein Data Bank code: 2A3R [37]) was edited using USCF Chimera, a molecular modeling software [64]. DA and PAP molecules in the structure are shown by bond structures. Loops 1, 2, and 3 refer to Asp66-Met77, Ser228- Gly259, and Lys85-Pro90 segments previously reported to form a gate for substrate entry. Side chains of the amino acid residues involved in the SULT1A3/SULT1A4 cSNPs, Arg9, Pro10, Val15, Val18, Pro101, Arg144, Asn235, Ser290, are indicated by bond structures.

3.3.2. Expression and purification of recombinant human SULT1A3 allozymes

cDNAs corresponding to the twelve chosen SULT1A3 missense genotypes packaged in pGEX-2TK prokaryotic expression vector were individually transformed into BL21 E. coli host cells for the expression of SULT1A3 allozymes. To purify the

SULT1A3 allozymes, glutathione-Sepharose was used to fractionate the GST-SULT1A3 proteins from the transformed E. coli cell homogenates, followed by thrombin digestion to release SULT1A3 allozymes. Purified SULT1A3 allozymes appeared to be highly homogeneous as judged by SDS-PAGE. As shown in Figure 2-3 page 36, the apparent molecular weights of SULT1A3 allozymes were similar to the predicted molecular weight (34,196) of wild-type SULT1A3.

3.3.3. Enzymatic characterization of the SULT1A3 allozymes

Purified wild-type and SULT1A3 allozymes were characterized with regard to their sulfating activity with catecholamines and 5-HT as substrates. In the initial experiments, the specific activity of wild-type and SULT1A3 allozymes was determined using two different concentrations, one considerably below and the other close to the reported Km [6.46 ± 0.59, 9.16 ± 1.81, 10.65 ± 1.14 and 71.38 ± 7.99 µM], of each of the four substrates (DA, EP, NE and 5-HT). Results obtained are shown in Figures 3-3 - 3-

With DA as the substrate. At low substrate (un-saturating) concentration (0.5 µM),

SULT1A3-S8P showed a higher specific activity than the wild-type enzyme, while seven other SULT1A3 allozymes (SULT1A3-T7P to SULT1A3-P101L) displayed comparable specific activities with the wild-type (Figure 3-3A). In contrast, the specific activities determined for the other five allozymes (SULT1A3-P101H, SULT1A3-R144C,

SULT1A3-K234N, SULT1A3-N235T and SULT1A3-S290T) were remarkably lower than that of the wild-type enzyme. Among these five latter SULT1A3 allozymes,

SULT1A3-N235T exhibited much lower activity (16.4 % of that of the wild-type enzyme) than the other four. At higher substrate concentration (5 µM), eight SULT1A3 allozymes showed comparable or slightly higher specific activities, compared with the wild-type enzyme, whereas four allozymes (SULT1A3-P101H, SULT1A3-R144C,

SULT1A3-K234N and SULT1A3-N235T) showed notably lower DA-sulfating activity than the wild-type enzyme, with SULT1A3-N235T showing the lowest specific activity

(Figure 3-3B).

With EP as the substrate. At low substrate (un-saturating) concentration (1 µM), eight

SULT1A3 allozymes displayed higher specific activities than the wild-type enzyme, with

SULT1A3-P10L and SULT1A3-P101L showing the highest specific activities (Figure 3-

4A). The other four SULT1A3 allozymes showed lower specific activities than the wild- type, with SULT1A3-N235T displaying the lowest specific activity. At higher substrate concentration (10 µM), all SULT1A3 allozymes showed specific activities that were close to that of the wild-type enzyme except SULT1A3-N235T which displayed a specific activity nearly 10 times lower than the wild-type (Figure 3-4B).

With NE as the substrate. At low substrate (un-saturating) concentration (1 µM), all

SULT1A3 allozymes exhibited lower NE-sulfating activities than the wild-type enzyme

(Figure 3-5A). Among them, SULT1A3-R9C and SULT1A3-N235T showed much lower activities (~8 and 10 times, respectively) than the other ten SULT1A3 allozymes.

At higher substrate concentration (10 µM), all SULT1A3 allozymes displayed similarly lower specific activities than the wild-type enzyme, with SULT1A3-R9C and SULT1A3-

N235T again showing much lower specific activities than the rest (Figure 3-5B).

With 5-HT as the substrate. At low substrate (un-saturating) concentration (10 µM),

SULT1A3-S8P displayed a slightly higher activity than the wild-type enzyme, while the other eleven SULT1A3 allozymes all showed lower specific activities than the wild-type enzyme, with SULT1A3-R9C, SULT1A3-R144C and SULT1A3-N235T showing the lowest 5-HT-sulfating activity than the rest (Figure 3-6A). At higher substrate concentration (100 µM), four SULT1A3 allozymes, SULT1A3-T7P, SULT1A3-S8P,

SULT1A3-V15M and SULT1A3-P101H, displayed specific activities comparable to that of the wild-enzyme. The other eight SULT1A3 allozymes showed considerably lower specific activities than the wild-type enzyme, with SULT1A3-R9C, SULT1A3-R144C and SULT1A3-N235T again displaying much lower specific activities than the other five allozymes (Figure 3-6B).

(A) With 0.5 µM DA as substrate

(B) With 5 µM DA as substrate

Figure 3-3. Specific activities of the sulfation of dopamine (DA) by human SULT1A3 allozymes. Concentrations of dopamine used in the enzymatic assays were 0.5 µM (A) and 5.0 µM (B). Specific activity refers to nmol dopamine sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations. WT refers to wild- type SULT1A3.

(A) With 1 µM EP as substrate

(B) With 10 µM EP as substrate

Figure 3-4. Specific activities of the sulfation of epinephrine (EP) by human SULT1A3 allozymes. Concentrations of epinephrine used in the enzymatic assays were 1 µM (A) and 10 µM (B). Specific activity refers to nmol epinephrine sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations. WT refers to wild- type SULT1A3.

(A) With 1 µM NE as substrate

(B) With 10 µM NE as substrate

Figure 3-5. Specific activities of the sulfation of norepinephrine (NE) by human SULT1A3 allozymes. Concentrations of norepinephrine used in the enzymatic assays were 1 µM (A) and 10 µM (B). Specific activity refers to nmol norepinephrine sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations. WT refers to wild-type SULT1A3.

(A) With 10 µM 5-HT as substrate

(B) With 100 µM 5-HT as substrate

Figure 3-6. Specific activities of the sulfation of serotonin (5-HT) by human SULT1A3 allozymes. Concentrations of serotonin used in the enzymatic assays were 10 µM (A) and 100 µM (B). Specific activity refers to nmol serotonin sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations. WT refers to wild- type SULT1A3.

3.3.4. Kinetic Analyses

To examine further the impact of the amino acid variations on the catecholamine/5-HT-sulfating activity of the SULT1A3 allozymes, kinetic studies were performed. Assays were carried out using varying concentrations of each of the four substrates (DA, EP, NE and 5-HT) at pH 7.4. Figure 3-7 shows the concentration- dependent sulfation of DA, EP, NE and 5-HT, respectively, by the wild-type SULT1A3.

The arrow signs indicated the concentrations at which substrate inhibition was observed.

Data obtained from the kinetic experiments using the wild-type and each of the twelve

SULT1A3 allozymes were processed to generate Michaelis-Menten saturation curves and

Lineweaver-Burk plots using GraphPad Prism 7 software for the determination of kinetic constants (Km, Vmax, and Vmax/Km).

(A) (B) 4 0 4 0

) 3 0 3 0

y t

0 .2 0 )

v v

i 0 .4

m t

t /

c 0 .1 5

i i

A 0 .3

2 0 2 0

/ V

/ l

0 .1 0 i

/ o

i 0 .2

e e

0 .0 5

n p

p 0 .1

(

( S 1 0 S 1 0

- 0 .4 - 0 .2 0 .0 0 .2 0 .4 0 .6 0 .8 1 .0 1 .2 - 0 .2 0 .0 0 .2 0 .4 0 .6 0 .8 1 .0 1 .2

1 / S 1 / S 0 0 0 2 5 5 0 7 5 1 0 0 1 2 5 0 2 5 5 0 7 5 1 0 0 1 2 5 [Dopamine][ D o p a m i n (µM)e ] [Epinephrine][ E p i n e p h r i n e ](µM)

(  M ) (µM)(  M )

4 0 y

) 3 0

t 0 .2 5

)

i g

i 0 .4

v t / 3 0

i 0 .2 0

n A

0 .3 i

A 0 .1 5

m 2 0

i /

2 0 0 .2 f

o i

1 0 .1 0

p n

0 .1 p 0 .0 5

(

( S

S 1 0 1 0

- 0 .2 0 .0 0 .2 0 .4 0 .6 0 .8 1 .0 1 .2 - 0 .0 2 5 0 .0 0 0 0 .0 2 5 0 .0 5 0 0 .0 7 5 0 .1 0 0

1 / S 1 / S 0 0 0 5 0 1 0 0 1 5 0 2 0 0 2 5 0 0 2 5 0 5 0 0 7 5 0 1 0 0 0 1 2 5 0 [Norepinephrine][ N o r e p i n e p h r i n(µM)e ] [Serotonin][ S e r o t o n i n (µM)] (µM)(  M ) (µM)(  M ) Figure 3-7. Kinetic analysis for the sulfation of catecholamines and serotonin by wild- type human SULT1A3. Panels (A), (B), (C) and (D) illustrate the Michaelis–Menten saturation curves for the sulfation of dopamine (DA), epinephrine (EP), norepinephrine (NE), and serotonin (5-HT), respectively. The insets show the Lineweaver-Burk plots generated based on the data shown in each of the four panels. Arrow signs indicate the concentrations at which substrate inhibition started taking place. Data shown represent calculated mean ± standard deviation derived from three experiments.

With DA as the substrate. As shown in Table 3.1, the Km value (6.46 ± 0.59 µM) determined for the wild-type SULT1A3 was lower than those of all SULT1A3 allozymes.

Of the twelve SULT1A3 allozymes, SULT1A3-P101H, SULT1A3-R144C and

SULT1A3-N235T, displayed Km values (12.72 ± 3.29, 13.26 ± 2.99 and 12.91 ± 1.29

µM, respectively) that were approximately two times that (6.46 ± 0.59 µM) of the wild-

type. In terms of the Vmax, most SULT1A3 allozymes showed comparable values to that of the wild-type enzyme, except SULT1A3-K234N. The Vmax/Km values, reflecting the catalytic efficiency, of all SULT1A3 allozymes were all lower than that of the wild-type enzyme. Notably, three of them, SULT1A3-P101H, SULT1A3-R144C and SULT1A3-

N235T, showed calculated values (3.55, 3.38 and 3.33, respectively) that were nearly half of that (6.32) of the wild-type enzyme.

Table 3.1 Kinetic parameters of the wild-type human SULT1A3 and allozymes with dopamine as a substrate. SULT1A3 Vmax Km (µM) Vmax/Km allozymes (nmol/min/mg)

1A3-WT1 6.46 ± 0.59 40.82 ± 1.14 6.32 1A3-T7P 8.50 ± 2.06 36.76 ± 2.28 4.32 1A3-S8P 8.86 ± 1.70 44.15 ± 2.19 4.98 1A3-R9C 9.06 ± 2.07 45.48 ± 2.69 5.02 1A3-P10L 8.56 ± 2.35 42.82 ± 3.00 5.00 1A3-V15M 8.84 ± 2.11 45.26 ± 2.78 5.12 1A3-V18F 8.81 ± 2.41 41.32 ± 2.91 4.69 1A3-P101L 9.06 ± 1.39 43.18 ± 1.72 4.77 1A3-P101H 12.72 ± 3.29 45.10 ± 3.32 3.55 1A3-R144C 13.26 ± 2.99 44.77 ± 2.90 3.38 1A3-K234N 7.54 ± 2.09 30.74 ± 2.12 4.08 1A3-N235T 12.91 ± 1.29 42.99 ± 1.21 3.33 1A3-S290T 6.56 ± 1.77 35.03 ± 2.29 5.34 1Wild-type human SULT1A3.

With EP as the substrate. As shown in Table 3.2, with small fluctuations, the Km values determined for all SULT1A3 allozymes were comparable to that of the wild-type 57

enzyme, except for SULT1A3-N235T which showed a Km (200.1 ± 64.51 µM) more than twenty times that of the wild-type. A similar situation was found with the Vmax, with all

SULT1A3 allozymes showing values comparable to that of the wild-type SULT1A3, except for SULT1A3-N235T. Based on these data, the calculated Vmax/Km of SULT1A3-

N235T (0.13) was near 30 times lower than that of the wild-type (3.85). Of the rest of the SULT1A3 allozymes, only SULT1A3-S290T showed considerable lower value of

Vmax/Km than the wild-type.

Table 3.2 Kinetic parameters of the wild-type human SULT1A3 and allozymes with epinephrine as a substrate. SULT1A3 Vmax Km (µM) Vmax/Km allozymes (nmol/min/mg)

1A3-WT1 9.16 ± 1.81 35.30 ± 1.82 3.85 1A3-T7P 8.90 ± 0.89 33.72 ± 0.87 3.79 1A3-S8P 9.73 ± 0.47 35.60 ± 0.45 3.66 1A3-R9C 9.44 ± 0.40 30.65 ± 1.34 3.25 1A3-P10L 10.86 ± 0.48 38.66 ± 0.46 3.56 1A3-V15M 9.05 ± 1.22 34.38 ± 1.20 3.80 1A3-V18F 9.62 ± 1.08 30.69 ± 0.91 3.19 1A3-P101L 8.83 ± 1.23 34.97 ± 1.26 3.96 1A3-P101H 9.67 ± 1.71 33.95 ± 1.58 3.51 1A3-R144C 11.19 ± 1.69 34.70 ± 1.42 3.10 1A3-K234N 8.58 ± 1.24 29.30 ± 1.08 3.41 1A3-N235T 200.1 ± 64.51 25.85 ± 6.05 0.13 1A3-S290T 11.12 ± 0.45 29.60 ± 1.27 2.66 1Wild-type human SULT1A3.

With NE as the substrate. As shown in Table 3.3, all SULT1A3 allozymes showed

higher Km values than the wild-type enzyme, with SULT1A3-R9C and SULT1A3-N235T displaying much higher Km values (9.4 and 5.0 times that of the wild-type) than the rest.

The Vmax values determined for all SULT1A3 allozymes were all lower than that of the wild-type except SULT1A3-P101L, whereas SULT1A3-N235T showed the lowest Vmax value which was only 30% that of the wild-type enzyme. Accordingly, while all allozymes showed lower Vmax/Km than the wild-type, SULT1A3-R9C and SULT1A3-

N235T showed much lower values (~14 and 16 times lower, respectively) than the wild- type.

Table 3.3 Kinetic parameters of the wild-type human SULT1A3 and allozymes with norepinephrine as a substrate. SULT1A3 Vmax Km (µM) Vmax/Km allozymes (nmol/min/mg)

1A3-WT1 10.65 ± 1.14 42.53 ± 0.99 3.99 1A3-T7P 18.78 ± 2.91 27.34 ± 1.07 1.36 1A3-S8P 15.80 ± 3.02 32.62 ± 1.51 2.06 1A3-R9C 99.98 ± 15.44 27.91 ± 3.24 0.28 1A3-P10L 17.10 ± 1.85 37.23 ± 0.99 2.18 1A3-V15M 13.17 ± 2.12 36.13 ± 1.34 2.74 1A3-V18F 12.49 ± 3.53 27.82 ± 1.79 2.23 1A3-P101L 13.41 ± 2.10 42.86 ± 1.55 3.20 1A3-P101H 11.52 ± 2.54 35.92 ± 1.77 3.12 1A3-R144C 13.49 ± 2.71 36.77 ± 1.71 2.73 1A3-K234N 14.32 ± 2.70 32.43 ± 1.44 2.26 1A3-N235T 53.46 ± 4.76 12.88 ± 0.41 0.24 1A3-S290T 10.99 ± 1.62 22.92 ± 0.74 2.09 1Wild-type human SULT1A3.

With 5-HT as the substrate. As shown in Table 3.4, all SULT1A3 allozymes showed higher Km values than the wild-type (at 71.38 ± 7.99 µM), with SUT1A3-R9C,

SULT1A3-P10L, SULT1A3-P101L, SULT1A3-R144C, SULT1A3-N235T and

SULT1A3-S290T displaying much higher Km values (216.6 ± 27.32, 102.40 ± 15.99,

213.9 ± 33.26, 281.0 ± 9.16, 8112.0 ± 866 and 165.6 ± 21.58 µM, respectively) than the rest. With respect to Vmax, the fluctuations were smaller among SULT1A3 allozymes, except for SULT1A3-N235T which displayed a Vmax which was three times that of the wild-type.

Table 3.4 Kinetic parameters of the wild-type human SULT1A3 and allozymes with serotonin as a substrate. SULT1A3 Vmax Km (µM) Vmax/Km allozymes (nmol/min/mg)

1A3-WT1 71.38 ± 7.99 38.99 ± 0.98 0.55 1A3-T7P 72.38 ± 6.29 32.22 ± 2.68 0.45 1A3-S8P 72.75 ± 10.97 39.48 ± 1.45 0.54 1A3-R9C 216.60 ± 27.32 26.19 ± 1.15 0.12 1A3-P10L 102.40 ± 15.99 34.01 ± 1.46 0.33 1A3-V15M 83.18 ± 11.32 34.51 ± 1.20 0.41 1A3-V18F 78.08 ± 10.24 29.07 ± 0.95 0.37 1A3-P101L 213.90 ± 33.26 34.49 ± 1.87 0.16 1A3-P101H 76.49 ± 6.82 37.90 ± 2.90 0.50 1A3-R144C 281.00 ± 9.16 24.17 ± 1.30 0.09 1A3-K234N 73.41 ± 7.92 25.38 ± 1.66 0.35 1A3-N235T 8112.0 ± 866 117.50 ± 14.3 0.014 1A3-S290T 165.60 ± 21.58 26.98 ± 1.13 0.16 1Wild-type human SULT1A3.

Based on these data, six of the twelve SULT1A3 allozymes (SULT1A3-R9C, SULT1A3-

P10L, SULT1A3-P101L, SULT1A3-R144C, SULT1A3-N235T and SULT1A3-S290T) showed notably lower Vmax/Km than the wild-type enzyme.

3.4. Discussion

Previous studies have demonstrated sulfoconjugation as an important pathway in the biotransformation of catecholamines and 5-HT in humans, and SULT1A3 was identified as the major enzyme responsible for the sulfation of these monoamine neurotransmitters/hormones [24,25,39,40]. The current study aimed to systematically evaluate the effects of the genetic polymorphisms on the sulfating activity of SULT1A3 allozymes. Genetic polymorphism of human SULT1A3 was first reported in a study of a group of 232 individuals in which considerable variations in catecholamine-sulfating activity in the platelet samples prepared from these subjects were found [41]. In a later study using DNA samples from 60 African-American and 60 Caucasian-American subjects, a non-synonymous cSNP of the SULT1A3 gene was detected [30]. In a similar study, three additional non-synonymous cSNPs of SULT1A3 were found, and the corresponding SULT1A3 allozymes expressed were shown to exhibit varying DA- sulfating activity [28]. It therefore appears that the genetic polymorphisms may play a critical role in affecting the functional activity of SULT1A3 protein products, and such differences may possibly impact on the metabolism of catecholamine/5-TH through sulfation in individuals with different SULT1A3 and SULT1A4 genotypes. In the current study, we performed a systematic database search for human SULT1A3 and SULT1A4

SNPs. Thirteen missense cSNPs were identified. Site-directed mutagenesis was used to generate cDNAs for the expression of corresponding SULT1A3 allozymes. Twelve of the thirteen SULT1A3 allozymes were successfully expressed and purified, with one being present in inclusion body form and could not be purified.

The twelve SULT1A3 allozymes prepared were first analyzed for their catecholamine/5-HT-sulfating activity in comparison with the wild-type enzyme.

Activity data shown in Figures 3-3 - 3-6 revealed differential DA-, EP-, NE-, and 5-HT- sulfating activity among all twelve SULT1A3 allozymes. It was noted that the variations in DA-sulfating activities of SULT1A3 allozymes were markedly smaller than the variations in their sulfating activities toward EP, NE, and 5-HT. It should be pointed out that of the twelve SULT1A3 allozymes examined, four, SULT1A3-P101L, SULT1A3-

P101H, SULT1A3-R144C and SULT1A3-K234N, had been studied previously [28,30].

While the results reported in the previous studies showed some minor differences in comparison with the results obtained in the current study, the trend of the variations in their DA-sulfating activity appeared the same. It is noted that different DA and PAPS concentrations were used in the assays performed in the previous and current studies.

Moreover, purified SULT1A3 allozymes were used in the current study, as compared with transfected COS-1 cell lysates used in the previous studies [28,30].

Kinetic constants shown in Tables 3.1 - 3.4 revealed distinct substrate affinity (as reflected by the Km) and catalytic activity (as reflected by the Vmax) of different SULT1A3 allozymes in catalyzing the sulfation of DA, EP, NE, and 5-HT. It was noted that despite their considerable differences in Km and Vmax with each of the four substrates, variations in catalytic efficiency (as reflected by Vmax/Km) were found to be smaller with DA than

with any of the other three compounds as substrate. With DA as substrate, variations in

Vmax/Km were less than 47.3 % for all twelve SULT1A3 allozymes in comparison with the wild-type enzyme. With EP, NE, or 5-HT as substrate, variations in Vmax/Km were found to be as high as 99.96, 99.94, and 99.84 times, compared with the wild-type. For example, SULT1A3-N235T, which showed the lowest specific activities (cf. Figures 3-3

- 3-6) and catalytic efficiencies (Tables 3.1 - 3.4) among all SULT1A3 allozymes, while displaying a catalytic efficiency approximately 52.6 % that of the wild-type enzyme toward DA, exhibited much lower catalytic efficiencies (3.3 %, 6 %, and 2.5 %, respectively) toward EP, NE and 5-HT. Whether the lower degree of variations in DA- sulfating activity of SULT1A3 allozymes indicates the critical importance of the maintenance of the homeostasis of dopamine, in comparison with other monoamine compounds, remains to be clarified. As noted earlier, studies have shown that more than

98% of DA in circulation is present in sulfoconjugated form [15], and sulfoconjugation has been reported as a high capacity (not easily saturated) pathway involved in the biotransformation of DA [42,43]. Moreover, DA, among other monoamines, has been demonstrated to induce its own metabolism by SULT1A3, possibly for protecting neurons from elevated DA levels, and that abnormal SULT1A3 activity may pose as a risk factor for DA-associated neurotoxicity [44]. In relation to this latter point, it has been reported that abnormal levels of catecholamines and 5-HT and/or their conjugates correlated with certain pathological conditions, including neurodegenerative diseases [45-

47] attention deficit hyperactivity disorder (ADHD) [48,49], migraine [50,51], atrial fibrillation and blood pressure changes [51], and myocardial infarction [52,53].

Several crystal structures of SULT1A3 have been reported [26,37,54]. Some of the structural elements involved in the functioning of the enzyme include a catalytically important residue His108, the PAPS interacting regions (residues 45TYPKSGTT52,

Arg130, Ser138, and residues 257RKG259), the substrate binding regions (including particularly, residues Asp86 and Glu146) which were proposed to play crucial roles in substrate specificity and sulfating activity [37], the C-terminal dimerization motif

(residues Lys265-Glu274) with the sequence KXXXTVXXXE [55], as well as the N- terminal region that contains βA- and βB-sheets which were thought to be structural components important for the SULT folding [56]. Moreover, three loop segments,

Asp66-Met77, Ser228-Gly259, and Lys85-Pro90, have been proposed to be involved in the formation of a gate that governs the substrate selectivity (cf. Figures 3-1 and 3-2)

[38]. Of the SULT1A3 allozymes investigated, SULT1A3-T7P, SULT1A3-S8P and

SULT1A3-R9C contain amino acid substitutions in the N-terminal region. It was noted that the substitutions of a polar amino acid (Thr, Ser, or Arg) with a non-polar or turn- inducing amino acid (Pro or Cys) in these there SULT1A3 allozymes resulted in lower catalytic efficiencies toward the four substrates tested (DA, EP, NE and 5-HT). From the perspective of the substrate, the differences in the chemical structures of the four monoamine compounds may also contribute to the differential catalytic efficiencies of these SULT1A3 allozymes. In the case of SULT1A3-R9C allozyme, the replacement of

Arg, a positively charged amino acid, may possibly abolish H-bonding, salt-bridge, and/or van der Waals interactions [57-59]. Among the four monoamine substrates, NE and 5-HT were more highly affected by the R9C substitution, which might be related to the differences in the positions of their constituent functional groups. The substitution of

a non-polar or turn-inducing amino acid (Pro or Val) with a non-polar or an aromatic amino acid (Leu, Met, or Phe) in SULT1A3-P10L, SULT1A3-V15M and SULT1A3-

V18F also resulted in lower catalytic efficiencies. It appeared that Leu that replaces Pro in SULT1A3-P10L allozyme might have resulted in conformational changes that rendered the decrease in catalytic efficiency of this allozyme. Specifically, the substituted Val residue in SULT1A3-V15M and SULT1A3-V18F carries a more bulky side chain, which originally may compel the enzyme to adopt a relatively more restricted conformation. The results obtained with these two allozymes appeared to be compatible with the postulation that βA- and βB-sheets present in the N-terminal region represent important structural components of the SULT1A3 molecule [56]. It should be pointed out that the three N-terminal residues (Thr7, Ser8, and Arg9) as well as Val15, Val18, and Arg144 (as discussed below) are located near the proposed gate through which substrates must pass to enter the active site [38]. SULT1A3-P101L and SULT1A3-

P101H, both with a turn-inducing proline residue replaced by either a non-polar Leu or a basic His residue, also showed differential sulfating efficiencies toward the four monoamine substrates. A previous study indicated that amino acid residues 84-104, together with residues 145-154, are involved in reshaping the substrate binding pocket, narrowing its cavity volume, and enabling the substrate binding [37]. SULT1A3-R144C showed lower catalytic efficiencies toward the four substrates tested (particularly, DA and 5-HT). Substitution of a basic Arg residue with a non-polar Cys residue is considered non-conservative, which could in part explain the impairment in the catalytic efficiency of this allozyme. Additionally, Arg144 is located within the amino acid residues 143-148 segment, which has been proposed to contribute to substrate-binding

and catalysis of both human SULT1A1 and SULT1A3 [60]. Spatially, Arg144 residue is very close to the amino acid segment spanning residues 145-154, which has been proposed to be involved in the substrate binding pocket [37]. SULT1A3-K234N and

SULT1A3-N235T carry amino acid substitutions close to the C-terminal region. Both these two SULT1A3 allozymes showed lower catalytic efficiencies than the wild-type enzyme toward the four substrates tested, with SULT1A3-N235T displaying the lowest specific activity and catalytic efficiency with DA, EP, NE and 5-HT in fact among all 12

SULT1A3 allozymes analyzed. Lys234 and Asn235 residues in the wild-type enzyme are located in the α15 sheet as revealed in the SULT1A3 crystal structure. This region has been proposed to be involved indirect binding of PAPS. These two residues also may contribute to restricting the conformations that allow for substrate binding when the c- substrate (PAPS) is bound [56]. Moreover, Lys234 and Asn235 residues are associated with a segment (Loop 2; Ser228-Gly259) that constitutes the substrate access gate [38] that governs the substrate selectivity. In the case of SULT1A3-N235T, the bulky side chain of the substituting Thr may have more difficulty in fitting into the alpha-helical element as revealed in the SULT1A3 crystal structure. Previous studies have shown that a common SULT1A1 allozyme (SULT1A1-Asn235Thr) displayed a substantially higher

Km toward 4-nitrophenol [61,62]. For SULT1A3-S290T, although the substitution of Ser with Thr does not seem to be dramatic from the chemistry standpoint, it showed differential catalytic efficiencies toward monoamines, with a bigger variation with 5-HT and lower variation with DA. Whether these variations are due to its close proximity

(position 290) to the conserved KTVE motif as revealed in the SULT1A3 crystal structure [26,55] remains to be clarified.

To summarize, we have generated, expressed, and purified twelve of the thirteen known human SULT1A3 allozymes. Enzymatic characterization of the purified

SULT1A3 allozymes revealed differential substrate binding affinity and catalytic activity toward the four monoamines tested as substrates. These results may have implications in the differential metabolism of monoamine neurotransmitters in individuals with distinct

SULT1A3/ SULT1A4 genotypes that code for different SULT1A3 allozymes. Moreover, pending further studies, the results obtained may provide clues to the link of particular

SULT1A3/SULT1A4 genotype s to certain neuropathological disorders associated with abnormal levels of the monoamines that are used as substrates by SULT1A3.

Acknowledgments

This work was supported in part by a grant from National Institutes of Health (Grant #

R03HD071146).

Chapter 4

On the Molecular Basis underlying the Metabolism of Tapentadol through Sulfation

Published in European Journal of Drug Metabolism and Pharmacokinetics 2017; 42:793- 800.

Ahsan F. Bairam1, Mohammed I. Rasool1, Katsuhisa Kurogi1,2, Ming-Cheh Liu1,*

1Department of Pharmacology, College of Pharmacy and Pharmaceutical Sciences, University of Toledo Health Science Campus, Toledo, OH 43614 USA 2Biochemistry and Applied Biosciences, University of Miyazaki, Miyazaki 889-2192 Japan

Running Title: Metabolism of tapentadol through sulfation

Funding: This study was supported in part by a startup fund from the College of

Pharmacy and Pharmaceutical Sciences, The University of Toledo.

Conflict of Interest: Ahsan F. Bairam, Mohammed I. Rasool, Katsuhisa Kurogi and

Ming-Cheh Liu declare that they have no conflict of interest.

Abstract

Previous studies reported that tapentadol-sulfate represented one of the major metabolites of tapentadol excreted in urine. The current study aimed to identify the human SULT(s) that is(are) capable of sulfating tapentadol, and to examine whether tapentadol sulfation may occur in human cells and by human organ specimens. Thirteen human cytosolic sulfotransferases (SULTs), previously expressed and purified, as well as human organ cytosols, were analyzed for tapentadol-sulfating activity using an established sulfotransferase assay. Cultured HepG2 human hepatoma cells and Caco-2 human colon carcinoma cells were labeled with [35S]sulfate in the presence of different concentrations of tapentadol. Three of the thirteen human SULTs, SULT1A1,

SULT1A3, and SULT1C4, were found to display sulfating activity toward tapentadol.

Kinetic analysis revealed that in mediating the sulfation of tapentadol, SULT1A3 displayed the highest catalytic efficiency, followed by SULT1A1, and SULT1C4. Using cultured HepG2 human hepatoma cells and Caco-2 human colon carcinoma cells, the generation and release of sulfated tapentadol under metabolic conditions was demonstrated. Moreover, of the four human organ specimens (kidney, liver, lung, and

small intestine) tested, the cytosols prepared from small intestine and liver showed significant tapentadol-sulfating capacity. Taken together, the results derived from the current study provided a molecular basis underlying the sulfation of tapentadol in humans.

Key Points:

 Human SULT1A1, SULT1A3 and SULT1C4 were found to be capable of sulfating

tapentadol.

 SULT1A3 showed the strongest sulfating efficiency with tapentadol.

 Sulfated tapentadol was shown to be produced by cultured HepG2 and Caco-2 cells

and by human organ cytosols.

4.1. Introduction

Tapentadol (cf. Figure 4-1 for its chemical structure) is an analgesic typically taken for the alleviation of moderate to severe chronic pain such as that associated with diabetic peripheral neuropathy [1]. It is a centrally acting opioid, exerting its analgesic activity by acting both as a μ-opioid receptor agonist and as a norepinephrine reuptake inhibitor [1, 2]. In regard to its pharmacokinetics, conjugation reactions have been shown to be the main pathways for the biotransformation of tapentadol, being responsible for the deactivation of about 70% of the oral dose [3]. Main metabolites have been demonstrated to be tapentadol-glucuronide and tapentadol-sulfate, with only about 3% of

the drug eliminated unchanged by the kidneys. It is noted that tapentadol metabolites have been shown to be free of analgesic activity [3-6].

Figure 4-1. Chemical structure of tapentadol.

In vertebrates including humans, the cytosolic sulfotransferase (SULT)-mediated sulfation plays a significant role in the metabolism of both endogenous compounds, such as dopamine and other catecholamines, as well as xenobiotics including a variety of drugs

[7-9]. Sulfation is generally believed to result in the inactivation of substrate compounds

[10, 11], and sulfated metabolites, due to the negatively charged sulfate group, tend to be more water-soluble and therefore are more easily excreted from the body [12]. There are, however, occasional exceptions. For example, morphine-6-sulfate and morphine-6- glucuronide have been reported to exhibit greater potency as an analgesic than the parent compound and appear to play an important role in the action of morphine [13-15]. All

SULTs found in vertebrates constitute a gene superfamily. Within the SULT gene superfamily, members are categorized into SULT families, which are further divided into subfamilies [16, 17]. In humans, there are thirteen SULTs that are classified into four families; SULT1, SULT2, SULT4, and SULT6 [18]. SULT1 family, previously called the phenol sulfotransferase family, comprises eight members of which all have been

shown to exhibit sulfating activity toward phenolic substrate compounds [17]. Of the three members of the SULT2 family, SULT2A1 has been described as a dehydroepiandrosterone (DHEA) SULT [19], whereas SULT2B1a and SULT2B1b have been shown to be capable of catalyzing the sulfation of pregnenolone and cholesterol, respectively [20, 21]. The sole members of the SULT4 and SULT6 families, on the other hand, have not been characterized in regard to their physiological substrates [22-24].

We report in this communication a detailed analysis of the tapentadol-sulfating activity of all thirteen known human SULTs. In addition, the pH-dependence and kinetic characteristics of the three SULTs (SULT1A3, SULT1A1 and SULT1C4) that displayed sulfating activity toward tapentadol were analyzed. Furthermore, tapentadol sulfation by cultured human cells and by human organ cytosols was investigated.

4.2. Materials and Methods

4.2.1. Materials

Tapentadol HCL was purchased from Cerilliant. Adenosine 5’-triphosphate

(ATP), dithiothreitol (DTT), dimethyl sulfoxide (DMSO), p-nitrophenol (pNP), dopamine (DA), N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES), 2- morpholinoethanesulfonic acid (MES), 2-(cyclohexylamino)ethanesulfonic acid (CHES),

3-[N-tris-(hydroxymethyl) methylamino]-propanesulfonic acid (TAPS), 3-

(cyclohexylamino)-1-propanesulfonic acid (CAPS), minimum essential medium (MEM), and silica gel thin-layer chromatography (TLC) plates, these plates are products of Sigma

Chemical Company (St. Louis, MO, USA). Adenosine-3’-phosphate-5’- phospho[35S]sulfate (PAP[35S]) was prepared using ATP and carrier-free [35S]sulfate based on a previously established protocol [25]. Purified human SULTs, SULT1A1

(GenBank Accession # AAI10888.1), SULT1A2 (GenBank Accession # NP_001045.1),

SULT1A3 (GenBank Accession # AAH78144.1), SULT1B1 (GenBank Accession #

NP_055280.2), SULT1C2 (GenBank Accession # AAH05353.1), SULT1C3 (GenBank

Accession # NP_001307807.1), SULT1C4 (GenBank Accession # AAI25044.1),

SULT1E1 (GenBank Accession # EAX05597.1), SULT2A1 (GenBank Accession #

AAH20755.1), SULT2B1a (GenBank Accession # AAC78498.1), SULT2B1b (GenBank

Accession # AAC78499.1), SULT4A1 (GenBank Accession # CAG30474.1), and

SULT6B1 (GenBank Accession # AAI40798.1), were prepared as previously described

[26-28]. Cellulose TLC plates were from EMD Millipore. Ecolume scintillation cocktail was purchased from MP Biomedical. HepG2 human hepatoma cell line (ATCC HB-

8065) and Caco-2 human epithelial colorectal adenocarcinoma cell line (ATCC HTB-37) were obtained from American Type Culture Collection. Pooled human lung, liver, small intestine (duodenum and jejunum), and kidney cytosols were purchased from XenoTech,

LLC. Other chemicals were of the highest brand commercially available.

4.2.2. Sulfotransferase assay

The sulfating activity of purified recombinant human SULTs toward tapentadol was assayed based on a previously established protocol [29], with radioactive PAP[35S] as the sulfuryl donor. The assay mixture, following a 10 min reaction at 37oC, was

separated by TLC and analyzed for the [35S]sulfated tapentadol as previously described

[29]. The same protocol was employed for the analysis of pH-dependence of the tapentadol-sulfating activity of SULT1A1, SULT1A3, and SULT1C4 using different buffers (sodium acetate at 4.5, 5.0, and 5.5; MES at 6.0, and 6.5; HEPES at 7.0, 7.5, and

8.0; TAPS at 8.5; CHES at 9.0, 9.5, and 10.0; and CAPS at 10.5, 11.0, and 11.5) in different assay mixtures. To determine the kinetic constants of the sulfation of tapentadol by SULT1A1, SULT1A3, and SULT1C4, the assays were performed using varying concentrations (10, 12.5, 16.67, 25, 50, and 100 µM) of tapentadol as substrates at their respective optimum pH, as well as at neutral pH and pH 7.4 (the pH inside the cell [30-

34]). The activity data obtained were analyzed based on Michaelis-Menten kinetics using nonlinear-regression (GraphPad Prism). To assay for tapentadol-sulfating activity of human organ cytosols, the assay mixture was supplemented with 50 mM NaF (a phosphatase inhibitor that prevents PAPS degradation by the phosphatases that may be present in the human organ cytosols [35]), and the reaction time was 30 minutes.

4.2.3. Examination of the sulfation of tapentadol by cultured HepG2 human hepatoma cells and Caco-2 human epithelial colorectal adenocarcinoma cells

A previously established metabolic labeling procedure was employed to examine the metabolism of tapentadol by sulfation in HepG2 cells and Caco-2 cells. The cells were labeled in sulfate-free MEM containing [35S]sulfate and varying concentrations (1,

2, 4, 10, 20, 40, and 100 µM) of tapentadol. The labeling media, collected following an

18-hour incubation, were collected and analyzed by TLC as previously described [29].

4.3. Results and Discussion

To better understand the efficacy and the underlying basis for the adverse effects of tapentadol, it is necessary to find out more about its pharmacokinetics. As mentioned earlier, a significant portion of the oral dose of tapentadol was found to be directly metabolized through sulfate conjugation [3]. The current study aimed to identify the

SULT(s) that is(are) responsible for the sulfate conjugation of tapentadol, and to characterize its(their) enzymatic properties. Additionally, the sulfate conjugation of tapentadol was examined in cultured human cells and by cytosols prepared from human organs.

4.3.1. Differential sulfating activities of the human SULTs toward tapentadol

In an initial study, all thirteen known human SULTs previously prepared were evaluated for sulfating activity with tapentadol as a substrate. Activity data compiled in

Table 4.1 indicated that three (SULT1A1, SULT1A3, and SULT1C4) of the thirteen human SULTs (SULT1A1, SULT1A2, SULT1A3, SULT1B1, SULT1C2, SULT1C3,

SULT1C4, SULT1E1, SULT2A1, SULT2B1a, SULT2B1b, SULT4A1 and SULT6B1) displayed significant sulfating activities toward tapentadol. Of the three, SULT1A3 showed the strongest tapentadol-sulfating activity (2.74 nmol/min/mg enzyme) at neutral pH, while SULT1A1 and SULT1C4 displayed considerably lower activities (0.88 and

0.66 nmol/min/mg enzyme, respectively).

Table 4.1 Specific activities of the human SULT1A1, SULT1A3, and SULT1C4 with tapentadol as a substratea Specific Activity (nmol/min/mg)b

Substrate pH SULT1A1 SULT1A3 SULT1C4 7.0 0.88 ± 0.11 2.74 ± 0.08 0.66 ± 0.01

Tapentadol 7.4 1.71 ± 0.02 4.32 ± 0.11 0.79 ± 0.03

Optimumc 22.87 ± 0.13 21.92 ± 0.93 2.37 ± 0.06

Standardd 7.4 30.15 ± 0.54 7.15 ± 0.66 32.85 ± 0.38 (pNP) (DA) (pNP) aData shown represent mean ± standard deviation derived from three determinations. The final concentration of tapentadol tested in the assay mixture was 50 M. The limit of detection of tapentadol-sulfating activity is estimated to be approximately 0.1 pmol/min/mg. bSpecific activity refers to nmoles of product produced per minute per mg purified enzyme. cpH Optima for human SULT1A1, SULT1A3 and SULT1C4 were 10.5, 9.0, and 9.5, respectively. dStandard refers to representative substrate for each of the three SULTs. p-nitrophenol (pNP) was used for SULT1A1 and SULT1C4. Dopamine (DA) was used for SULT1A3.

At pH 7.4, the presumable pH inside the cell [30-34], the sulfating activity of

SULT1A3 toward tapentadol (4.32 nmol/min/mg enzyme) was also much higher than those of SULT1A1 and SULT1C4 (1.71 and 0.79 nmol/min/mg enzyme, respectively).

Whereas at their respective optimal pH, SULT1A1 and SULT1A3 showed comparable and much higher tapentadol-sulfating activities (22.87 and 21.92 nmol/min/mg enzyme, respectively) than did SULT1C4 (at 2.37 nmol/min/mg enzyme). Previous studies have demonstrated the expression of SULT1A3 at high levels in the small intestine and platelets and at low levels in the liver [36, 37]. In contrast, SULT1A1 was found to be mainly expressed in the liver [38, 39], and SULT1C4 was found to be expressed at high levels in fetal lung, kidney and at low levels in fetal heart, adult kidney, ovary and spinal

cord [26]. The expression of SULT1A3 and SULT1A1 in small intestine and liver implicates the possibility of the first-pass metabolism of tapentadol, and may explain, in part at least, the relatively low oral bioavailability (32%) of this drug [2, 4]. It is noted that other drugs such as isoprenaline had previously been reported to undergo extensive first-pass metabolism by SULT-mediated sulfation upon oral administration [40].

Another factor that may affect the bioavailability of tapentadol is the developmental expression of tapentadol-sulfating SULTs in the liver and small intestine

[41, 42]. Many drug-metabolizing enzymes are known to be poorly expressed during the fetal period [43, 44], whereas SULT enzymes have been reported to be exceptions [45].

Both SULT1A1 and SULT1A3 have been reported to be expressed even at fetal stages

[42]. At the beginning of postnatal life, there appears to be an elevation in the expression of SULT1A1 in the liver and a concomitant decrease in SULT1A3 expression in the liver and other tissues [41, 46]. On the other hand, SULT1C4 has been shown to be expressed at higher levels in fetuses than in adults [26]. These dynamic changes of tapentadol- sulfating SULTs during fetal development, through neonatal/child stages, onto adulthood may have impact on the bioavailability and pharmacokinetics when the drug is used during pregnancy or for different age groups of patients.

4.3.2. pH-dependence of the sulfation of tapentadol by human SULT1A3, SULT1A1 and SULT1C4

In an effort to characterize further the sulfation of tapentadol by SULT1A3,

SULT1A1 and SULT1C4, a pH-dependence experiment was performed. As shown in

Figure 4-2, SULT1A1, SULT1A3, and SULT1C4 displayed optimal tapentadol-sulfating SULT1A1 activity at, respectively, pH 10.5, 9.0, and 9.5. The pKa values of the two ionizable groups (-NH and -OH) of tapentadol molecule have beenSULT1A1 reported to be 9.34 and 10.45

[47]. It is possible that the protonated or deprotonated state of these functional groups may affect the interaction between the tapentadol molecule and corresponding amino acid residues of each of the three SULT enzymes in regard to substrate binding and catalysis,

and therefore their sulfating activity under different pH environments.

SULT1A3

SULT1A1 SULT1A3

SULT1C4

SULT1C4 SULT1A3

Figure 4-2. pH-dependence of tapentadol-sulfating activity of the human SULT1A1 (a), SULT1A3 (b), and SULT1C4 (c). Enzymatic assays were carried out under standard assay conditions as described in the Materials and Methods section using different buffer systems as indicated. Data shown represent calculated SULT1C4mean ± standard deviation derived from three independent (separate) experiments. Symbols used are closed diamond for the acetate buffer at pH 4.5-5.5; closed triangle for MES buffer at pH 6.0 and 6.5; closed circle for HEPES buffer at pH 7.0-8.0; open diamond for TAPS buffer at pH 8.5; open circle for CHES buffer at pH 9.0-10.0; and open triangle for CAPS buffer at pH 10.5-11.5.

4.3.3. Kinetics of the sulfation of tapentadol by human SULT1A1, SULT1A3, and

SULT1C4

The kinetics of the sulfation of tapentadol by human SULT1A1, SULT1A3, and

SULT1C4 were analyzed using varying concentrations of tapentadol as substrate at their respective optimum pH (10.5 for SULT1A1, 9.0 for SULT1A3, and 9.5 for SULT1C4), as well as neutral pH (7.0) and pH 7.4 (the presumable pH inside the cell) [30-34].

Kinetic constants calculated based on the results obtained are compiled in Table 4.2. Of the three SULT enzymes, SULT1C4 showed the lowest Km (20.20 M), followed by

SULT1A1 (38.17 M) and SULT1A3 (49.93 M) at their respective optimal pH. In regard to Vmax, SULT1A3 showed the highest values at all three pHs tested. Based on these results, the catalytic efficiency, as reflected by Vmax/Km, for the three enzymes is in the order SULT1A3 (0.63 ml/min/mg) > SULT1A1 (0.47 ml/min/mg) > SULT1C4 (0.08 ml/min/mg) at their optimal pH. Similar trend was also found for the catalytic efficiency determined for the three SULTs at neutral pH or pH 7.4.

It is noted that a previous study employing 14C-labeled tapentadol indicated that the maximum plasma concentration in tested human subjects reached was 2.45 µg/ml [6], an equivalent of 11.1 µM. While this plasma concentration is considerably lower than the Km values determined for each of the three tapentadol-sulfating SULTs as mentioned above, it is possible that the tapentadol may be more highly concentrated in cells that contain SULT1A1, SULT1A3, and/or SULT1C4 and therefore allow for their metabolism through sulfation. As described earlier, studies using animal models and

human subjects had revealed the production and urinary excretion of sulfated tapentadol

[3, 48].

Table 4.2 Kinetic parameters of the sulfation of tapentadol by human SULT1A1, SULT1A3, and SULT1C4a

Vmax/Km pH Vmax Km Vmax/Km (nmol/min/mg) (µM) (ml/min/mg) 7.0 0.39 ± 0.07 126.47 ± 9.99 0.003

SULT1A1 7.4 0.70 ± 0.05 93.17 ± 1.33 0.007

Optimumb 17.90 ± 0.49 38.17 ± 1.13 0.47

7.0 2.88 ± 0.09 165.69 ± 4.62 0.017

SULT1A3 7.4 24.42 ± 0.21 158.73 ± 1.37 0.153 Optimum 31.40 ± 1.77 49.93 ± 5.39 0.63

7.0 0.11 ± 0.03 131.14 ± 5.97 0.0008

SULT1C4 7.4 0.83 ± 0.06 129.03±10.48 0.006

Optimum 1.71 ± 0.06 20.20 ± 0.18 0.08 aData shown represent means ± standard deviation derived from three determinations. Kinetic parameters were determined based on Michaelis-Menten kinetics. bpH optima for human SULT1A1, SULT1A3 and SULT1C4 were 10.5, 9.0, and 9.5, respectively.

4.3.4. Metabolic sulfation of tapentadol in cultured cells and sulfation of tapentadol by human organ specimens

To gather evidence that sulfation of tapentadol may occur in cells of human organs, we first performed a metabolic labeling experiment using cultured cells. Two cell lines, HepG2 human hepatoma cells and Caco-2 human colon carcinoma cells, were

employed. Previous studies have demonstrated that HepG2 cells express a number of

SULTs including SULT1A subfamily (SULT1A1, SULT1A2, SULT1A3), SULT1E1, and SULT2A1, while Caco-2 cells express SULT1A1, SULT1A2, SULT1A3, SULT1B1,

SULT1C2, SULT1C4 and SULT2A1 [49-51]. Both these two cell lines therefore are equipped with enzymes that are capable of sulfating tapentadol. As shown in Figure 4-3, upon incubation in sulfate-free media containing [35S]sulfate and different concentrations of tapentadol, both HepG2 cells and Caco-2 cells were capable of producing [35S]sulfated tapentadol and releasing it into the labeling media in a concentration-dependent manner.

That these liver- or intestine-derived cells were capable of metabolism of tapentadol through sulfation may underscore the first-pass metabolism of tapentadol upon oral administration.

HepG2 cells Caco-2 cells C 1 2 3 4 5 6 7 C 1 2 3 4 5 6 7 77

Figure 3. Metaboling labeling of tapentadol by HepG2 and Caco-2 cells.

Origin

Figure 4-3. Production and release of [35S]sulfated tapentadol by HepG2 human hepatoma cells and Caco-2 human epithelial colorectal adenocarcinoma cells labeled with [35S]sulfate in the presence of tapentadol. The figure shows the autoradiographs taken from the plates at the end of the TLC analysis. Confluent HepG2 or Caco-2 cells were incubated in labeling media containing, respectively, 0, 1, 2, 4, 10, 20, 40, and 100 µM (corresponding to lanes 1-7) of tapentadol for 18 hours. C refers to the control labeling medium without added drug compounds. E refers to [35S]sulfated tapentadol enzymatically synthesized using human SULT1A3. The arrow indicates the radioactive spot corresponding to [35S]sulfated tapentadol.

To obtain further evidence for the sulfation of tapentadol in human organs, cytosols prepared from human organs (small intestine, liver, lung and kidney) were tested for tapentadol-sulfating activity using the assay procedure described in Materials and

Methods. As shown in Table 4.3, cytosols of small intestine and liver were indeed capable of mediating the sulfation of tapentadol; whereas the cytosols prepared from lung and kidney showed no detectable activity toward tapentadol. Notably, the tapentadol- sulfating activity detected for the intestine cytosol was nearly four times that detected for the liver cytosol. These results are in line with the much higher level of expression of

SULT1A3 in intestine than in liver [36, 37, 52]. Both intestine and liver have been reported to express considerable levels of SULT1A1, another tapentadol-sulfating SULT

[52].

Table 4.3 Sulfating activities of human kidney, liver, lung, and small intestine cytosols toward tapentadol as a substratea Specific Activity (pmol/min/mg)

Substrate Kidney Liver Lung Small Intestine

Tapentadol N.D.b 5.4 ± 0.1 N.D. 20.3 ± 3.2 aSpecific activity refers to pmol substrate sulfated/min/mg purified enzyme. Data shown represent mean ± SD derived from three determinations. The concentration of b tapentadol used in the assay mixture was 50 μM. N.D. refers to activity not detected, i.e., below detection limit which is estimated to be approximately 0.1 pmol/min/mg.

4.4. Conclusions

The current study revealed that of the thirteen known human SULTs, SULT1A1,

SULT1A3 and SULT1C4 were capable of sulfating tapentadol. Of the three, SULT1A3 82

showed the higher catalytic efficiency in catalyzing tapentadol sulfation, suggesting that

SULT1A3 is likely the major enzyme responsible for tapentadol sulfation in human body followed by SULT1A1 and SULT1C4. That both cultured HepG2 cells and Caco-2 cells, as well as small intestine and liver cytosols were capable of mediating the sulfation of tapentadol implied that small intestine and liver may represent major human organs responsible for metabolizing tapentadol through sulfation. These results may contribute to a better understanding about molecular basis underlying the pharmacokinetics of tapentadol. Finally, while it remains to be clarified, the differential expression of tapentadol-sulfating SULT1A1, SULT1A3, and SULT1C4 during fetal, neonatal, and child development onto adulthood may dictate the differential metabolism of tapentadol administered during pregnancy, or at different stages during neonatal/child development, or in adults.

Chapter 5

Effects of Human SULT1A3/SULT1A4 Genetic Polymorphisms on the Sulfation of Acetaminophen and Opioid Drugs by the Cytosolic Sulfotransferase SULT1A3

Published in Archives of Biochemistry and Biophysics

Ahsan F. Bairam1,2, Mohammed I. Rasool1,3, Fatemah A. Alherz1, Maryam S Abunnaja1, Amal A. El Daibani1, Katsuhisa Kurogi1,4, Masahito Suiko4, Yoichi Sakakibara4, Ming- Cheh Liu1,*

Tel: (419) 383-1918 Fax: (419) 383-1909 E-mail [email protected]

Running Title: Sulfation of acetaminophen and opioid drugs by human SULT1A3

Keywords: Single nucleotide polymorphism, human SULT1A3, acetaminophen, tapentadol, morphine, O-desmethyl tramadol.

Abbreviations: APAP, acetaminophen; O-DMT, O-desmethyl tramadol; PAPS, 3’- phosphoadenosine-5’-phosphosulfate; SULT, cytosolic sulfotransferase; TLC; thin-layer chromatography; SNP, single nucleotide polymorphism.

Abstract

Sulfoconjugation has been shown to be critically involved in the metabolism of acetaminophen (APAP), morphine, tapentadol and O-desmethyl tramadol (O-DMT). The objective of this study was to investigate the effects of single nucleotide polymorphisms

(SNPs) of human SULT1A3 and SULT1A4 genes on the sulfating activity of SULT1A3 allozymes toward these analgesic compounds. Twelve non-synonymous coding SNPs

(cSNPs) of SULT1A3/SULT1A4 were investigated, and the corresponding cDNAs were generated by site-directed mutagenesis. SULT1A3 allozymes, bacterially expressed and purified, exhibited differential sulfating activity toward each of the four analgesic compounds tested as substrates. Kinetic analyses of SULT1A3 allozymes further revealed significant differences in binding affinity and catalytic activity toward the four analgesic compounds. Collectively, the results derived from the current study showed clearly the impact of cSNPs of the coding genes, SULT1A3 and SULT1A4, on the sulfating activity of the coded SULT1A3 allozymes toward the tested analgesic compounds. These findings may have implications in the pharmacokinetics as well as the

toxicity profiles of these analgesics administered in individuals with distinct SULT1A3 and/or SULT1A4 genotypes.

5.1. Introduction

Acetaminophen (APAP) and opioids are frequently used, individually or in combination, for the clinical management of acute and chronic pain [1]. APAP is considered the safest and most popular drug prescribed as an analgesic and antipyretic

[2]. Opioids, on the other hand, are the most commonly prescribed drugs in the US for acute pain management. As is widely known, problems concerning diversion, overdose, and addiction, associated with the use of opioids are rising [3]. Of the opioids that are in use, morphine, tapentadol, and tramadol have been shown to exert their action primarily via interaction with μ-opioid receptors [4-6].

Pharmacokinetic studies have revealed that the primary metabolic pathways of

APAP in adults are glucuronidation and sulfoconjugation [7]. During prenatal and neonatal stages, however, sulfoconjugation constitutes the primary metabolic pathway of

APAP due to low levels of UDP-glucuronosyltransferases (UGTs) [8]. For some opioids, such as morphine, tapentadol, and tramadol, sulfoconjugation has also been shown to be an important metabolic pathway during prenatal and neonatal stages, while glucuronidation plays a quantitatively more important role in adults [9-12]. Studies have demonstrated that sulfate conjugates of APAP and tapentadol are inactive metabolites

[13, 14]. In the case of morphine, morphine-3-sulfate has been shown to exhibit little or no activity, whereas morphine-6-sulfate still possesses some analgesic activity [15]. For

tramadol, O-desmethyl tramadol (O-DMT) has been shown to be an active metabolite, which is inactivated by sulfation with sulfated derivative excreted in the urine [6].

Sulfation as mediated by the cytosolic sulfotransferase (SULT) enzymes is considered a key step in the biotransformation and homeostasis of some key endogenous compounds such as catecholamines and thyroid/steroid hormones, as well as the detoxification of xenobiotics including drugs [16-18]. Of the thirteen known human

SULTs [19], SULT1A3 has been shown to be a major enzyme responsible for the sulfation of morphine [20], APAP, tapentadol, and O-DMT [21-23]. Genomic studies have revealed that SULT1A3 is coded by two homologous genes, SULT1A3 and

SULT1A4, presumably derived from gene duplication during the evolutionary process, and both SULT1A3 and SULT1A4 genes are located on chromosome 16 [24-26].

Interestingly, single nucleotide polymorphisms (SNPs) of SULT1A3 and SULT1A4 have been reported [25]. It is possible that the SULT1A3 allozymes coded by missense SNPs of SULT1A3 and SULT1A4 may have differential sulfating activity toward APAP, morphine, tapentadol and O-DMT, thereby affecting their pharmacokinetics and thus their efficacy in individuals with different SULT1A3 and SULT1A4 genotypes.

In this study, we performed a comprehensive search for human SULT1A3 and

SULT1A4 cSNPs. cDNAs corresponding to the thirteen SULT1A3/SULT1A4 cSNPs identified were generated, and the coded SULT1A3 allozymes were bacterially expressed and purified by affinity chromatography. The twelve SULT1A3 allozymes that were successfully purified were analyzed for their enzymatic characteristics with APAP, morphine, tapentadol and O-DMT as substrates.

5.2. Materials and Methods

5.2.1. Materials

APAP, adenosine 5’-triphosphate (ATP), dimethyl sulfoxide (DMSO), dithiothreitol (DTT), and N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES) were products of Sigma Chemical Company. Morphine, tapentadol, and O-DMT were from Cayman Chemical. Cellulose thin-layer chromatography (TLC) plates were from

Merck (EMD Millipore Corporation). Carrier-free sodium [35S]sulfate was from

American Radiolabeled Chemicals. 3’-Phosphoadenosine-5’-phospho[35S]sulfate

(PAP[35S]) was synthesized using ATP and carrier-free [35S]sulfate according to a previously established protocol [27]. X-Ray films were from Research Products

International Corporation. Prime STAR® GXL DNA Polymerase was a product of

Clontech Laboratories, Inc. Protein molecular weight markers were from Bioland

Scientific LLC. PCR kit was a product of G-Biosciences. QIAprep® Spin Miniprep Kit was from QIAGEN. Ecolume scintillation cocktail was from MP Biomedical LLC.

Glutathione SepharoseTM was a product of GE Healthcare Bio-Sciences. All other chemicals were of the highest grades commercially available.

5.2.2. Database search

Three online databases, located at the websites of, respectively, the U.S. National

Center for Biotechnology Information (NCBI), the UniProt Knowledgebase

(UniProtKB), and previous genomic studies, were systematically searched for the non- synonymous cSNPs of the human SULT1A3 and SULT1A4 genes.

5.2.3. Generation, expression, and purification of SULT1A3 allozymes

Site-directed mutagenesis, in conjunction with mutagenic primers (cf. Table 2.4 page 31), was employed to generate the cDNAs encoding different SULT1A3 allozymes based on a previously described procedure [19]. Authenticity of the “mutated”

SULT1A3 cDNAs, packaged in pGEX-2TK prokaryotic expression vector, was verified by nucleotide sequencing [28]. To express SULT1A3 allozymes, “mutated” SULT1A3 cDNA/pGEX-2TK plasmids were individually transformed into competent BL21 E. coli cells. Upon induction of recombinant protein expression with IPTG, the cells were homogenized using an Aminco French Press. Recombinant SULT1A3 allozymes present in cell homogenates were purified using glutathione-Sepharose affinity chromatography based on a previously established procedure [29]. Purified recombinant SULT1A3 allozymes was analyzed for purity using SDS-polyacrylamide gel electrophoresis (SDS-

PAGE) [30,31]. Protein concentration of purified SULT1A3 allozymes was determined using Bradford protein assay [32].

5.2.4. Enzymatic assay

The sulfating activity of SULT1A3 allozymes toward APAP, morphine, tapentadol, or O-DMT was analyzed using an established enzymatic assay procedure

[20]. In an initial screening, three different concentrations of each of the four substrates were used, with radiolabeled PAP[35S] as the sulfate donor. The enzymatic assays were performed in 50 mM HEPES, pH 7.4, and allowed to proceed for 10 min at 37ºC, followed by TLC separation of the [35S]sulfated product present in the reaction mixture.

Upon completion of TLC, autoradiography was performed to locate the [35S]sulfated

35 product spot, which was then cut out and subjected to elution by H2O. [ S]-radioactivity associated with eluted [35S]sulfated product was measured using a liquid scintillation counter. The cpm count data obtained were used to calculate the specific activity in unit of nmol of sulfated product/min/mg of enzyme. In kinetic experiments, varying substrate concentrations (0, 50, 66.6, 100, 200, and 500 µM for APAP; 0, 400, 500, 666.6, 1000, and 2000 µM for morphine; 0, 10, 12.5, 16.6, 25, 50, and 100 µM for tapentadol; and 0,

25, 33.3, 50, 100, and 250 µM for O-DMT) were used based on the assay procedure described above.

5.2.5. Data analysis

Data obtained from the kinetic experiments were analyzed based on Michaelis-

Menten kinetics to calculate the kinetic constants of wild-type and SULT1A3 allozymes in mediating the sulfation of tested substrate compounds. GraphPad Prism 7 software was used in data analysis.

5.3. Results

5.3.1. Analysis of human SULT1A3 and SULT1A4 single nucleotide polymorphisms

A systematic analysis was performed to search for different human SULT1A3 and

SULT1A4 cSNPs deposited in two online databases located at the websites of the U.S.

National Center for Biotechnology Information (NCBI) and the UniProt Knowledgebase

(UniProtKB). SULT1A3/SULT1A4 cSNPs reported in previous studies were included in the compiled cSNP list. A total of 10 missense cSNPs was identified for the SULT1A3 gene, whereas 6 missense cSNPs were found for the SULT1A4 gene. In between the missense cSNPs found for the two genes, 3 were found to code for same amino acid changes. As a result, 13 distinct missense SULT1A3/SULT1A4 cSNPs remained at the conclusion of the analysis. The designated names and SNP ID numbers of these 13 cSNPs are: SULT1A3-T7P (Reference SNP (rs)776817009/ rs754600221), SULT1A3-

S8P (rs767263838), SULT1A3-R9C (rs762151655/ rs752303630), SULT1A3-P10L

(rs757573592), SULT1A3-V15M (rs750575779/ rs758881470), SULT1A3-V18F

(rs553050853), SULT1A3-P19L (rs747088850), SULT1A3-P101L (rs751527244),

SULT1A3-P101H, SULT1A3-R144C and SULT1A3-K234N [25], SULT1A3-N235T

(UniProt P0DMM9) and SULT1A3-S290T (UniProt P0DMM9). The reported crystal structure of SULT1A3 [33] was used to demonstrate the location of the amino acid residues associated with these SULT1A3/SULT1A4 cSNPs (Figure 5-1). It is noted that two of the aforementioned amino acid residues (SULT1A3-K234N and SULT1A3-

N235T) are positioned within the three loops, Asp66-Met77, Ser228-Gly259, and Lys85-

Pro90, which play an essential role in the configuration of the gate that controls the substrate entry and selectivity [34].

Figure 5-1. Ribbon diagram of the structure of human SULT1A3-analgesic substrate- PAP complex showing the locations of amino acid residues associated with the SULT1A3/SULT1A4 cSNPs. The structure of SULT1A3 (Protein Data Bank code: 2A3R [33]) was edited using USCF Chimera, a molecular modeling software [57]. Analgesic substrates, acetaminophen, morphine, tapentadol, and O-desmethyltramadol, and PAP in the structure are shown by bond structures. Analgesic substrates superimposed were docked into the active site of SULT1A3 using AutoDock Vina [58]. Loops 1, 2, and 3 refer to Asp66-Met77, Ser228-Gly259, and Lys85-Pro90 segments previously reported to form a gate for substrate entry [34]. Side chains of the amino acid residues associated with the SULT1A3/SULT1A4 cSNPs, Arg9, Pro10, Val15, Val18, Pro101, Arg144, Lys234, Asn235, Ser290, are indicated by bond structures.

Moreover, to help visualize the binding of the four analgesic substrate compounds with the SULT1A3 molecule, the substrate-binding pocket of SULT1A3 with superimposed dopamine (a prototype substrate) or analgesic substrates (APAP, morphine, tapentadol, and O-DMT), as well as the co-substrate, PAPS, were drawn and docked into the active site of the enzyme (Figure 5-2A). Figure 5-2B shows the hydrophilic and hydrophobic surfaces of the substrate-binding pocket, together with the substrate entry gate.

5.3.2. Expression and purification of recombinant human SULT1A3 allozymes

SULT1A3 allozyme cDNAs ligated to pGEX-2TK prokaryotic expression vector, prepared via site-directed mutagenesis (see the Materials and Methods) were individually transformed into BL21 E. coli cells. Upon induction of recombinant protein expression by IPTG in transformed cells, glutathione-Sepharose affinity chromatography was performed to fractionate the recombinant SULT1A3 allozymes from the E. coli cell homogenates. Afterward, bovine thrombin was used to free the recombinant SULT1A3 allozymes from the bound GST fusion proteins. It is noted that of the 13 SULT1A3 allozymes expressed, one was found to be present in the inclusion body form, and thus could not be further purified. The twelve SULT1A3 allozymes that were purified were analyzed by SDS-polyacrylamide gel electrophoresis. As shown in Figure 2-3 page 36, the apparent molecular weights of purified SULT1A3 allozymes were similar to that of the wild-type SULT1A3, which has a predicted molecular weight of 34,196.

(A) Dopamine Analgesic substrates

(B) Dopamine Analgesic substrates

Figure 5-2. Docking of analgesic substrates in the active site of SULT1A3. (A) Active site of SULT1A3 with dopamine (left panel) and superimposed analgesic substrates, acetaminophen (blue), morphine (pink), tapentadol (green), O- desmethyltramadol (orange) (right panel). Dashed lines show the hydrogen bonds with the dopamine. (B) Substrate binding pocket of SULT1A3 with dopamine (left panel) and superimposed analgesic substrates, acetaminophen (blue), morphine (pink), tapentadol (green), O- desmethyltramadol (orange) (right panel). Substrate binding pockets are shown in the hydrophobicity surface manners using USCF Chimera software. Red and blue color display the hydrophobic and hydrophilic surfaces, respectively.

5.3.3. Enzymatic characterization of the SULT1A3 allozymes

Purified SULT1A3 allozymes together with the wild-type enzyme were analyzed for their sulfating activity with APAP, morphine, tapentadol, and O-DMT as substrates.

In an initial study, three different concentrations (one well below reported Km, one close to Km, and one well above Km) of each of the four substrates were tested in the enzymatic assays. The activity data shown in Figures 5-3 – 5-6 are described below. It should be pointed out that considering the numerous steps involved in the sulfotransferase assay and the following TLC separation and scintillation counting, the data obtained should not be considered strictly quantitative, but rather semi-quantitative.

With APAP as the substrate. At low and mid substrate concentrations (100 and 600

µM, respectively), similar patterns of APAP-sulfating activities were found for the

SULT1A3 allozymes analyzed (Figure 5-3). Among them, SULT1A3-P101H showed a slightly higher specific activity than the wild-type enzyme, while the specific activities of

SULT1A3-V15M and SULT1A3-K234N were comparable to that of the wild-type. The rest of the SULT1A3 allozymes all displayed lower specific activities compared with the wild-type enzyme, with SULT1A3-N235T exhibiting the lowest specific activity. At high substrate concentration (1500 µM), while SULT1A3-P101H still displayed a specific activity that was slightly higher than the wild-type, the specific activities of all other allozymes were lower than the wild-type enzyme, with SULT1A3-N235T exhibiting the lowest specific activity.

SULT1A3 allozymes

Figure 5-3. Specific activities of the sulfation of APAP by human SULT1A3 allozymes. Concentrations of APAP used in the enzymatic assays were 100 µM (black), 600 µM (gray) and 1500 µM (white). Specific activity refers to nmol APAP sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

With morphine as the substrate. At all three substrate concentrations (250, 1000 and

2500 µM, respectively), SULT1A3-P101H displayed a specific activity nearly two times that of the wild-type enzyme (Figure 5-4). SULT1A3-P101L and SULT1A3-R144C showed specific activities comparable to that of the wild-type. The other nine SULT1A3 allozymes all displayed lower specific activities than the wild-type at varying degrees, with SULT1A3-N235T showing nearly null specific activities.

SULT1A3 allozymes

Figure 5-4. Specific activities of the sulfation of morphine by human SULT1A3 allozymes. Concentrations of morphine used in the enzymatic assays were 250 µM (black), 1000 µM (gray) and 2500 µM (white). Specific activity refers to nmol morphine sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

With tapentadol as the substrate. At all three substrate concentrations (5, 150, and 500

µM), two allozymes, SULT1A3-P101H and SULT1A3-R144C, showed higher specific activities when compared with the wild-type enzyme (Figure 5-5). The other ten

SULT1A3 allozymes all exhibited lower specific activities than the wild-type. Of these ten allozymes, SULT1A3-N235T exhibited the lowest activities, which were approximately 12%, 14%, and 22% that of the wild-type, at 5, 150, and 500 µM tapentadol, respectively.

SULT1A3 allozymes

Figure 5-5. Specific activities of the sulfation of tapentadol by human SULT1A3 allozymes. Concentrations of tapentadol used in the enzymatic assays were 5 µM (black), 150 µM (gray) and 500 µM (white). Specific activity refers to nmol tapentadol sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

With O-DMT as the substrate. At all three substrate concentrations (25, 125 and 600

µM), SULT1A3-P101H and SULT1A3R144C again showed higher specific activities than the wild-type as well as all other allozymes (Figure 5-6). SULT1A3-P10L,

SULT1A3-P101L and SULT1A3-S290T displayed specific activities comparable to that of the wild-type, whereas the other seven SULT1A3 allozymes displayed lower specific activities than the wild-type with SULT1A3-N235T again showing the lowest specific activity at all three substrate concentrations tested.

SULT1A3 allozymes Figure 5-6. Specific activities of the sulfation of O-DMT by human SULT1A3 allozymes. Concentrations of O-DMT used in the enzymatic assays were 25 µM (black), 125 µM (gray) and 600 µM (white). Specific activity refers to nmol O-DMT sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

5.3.4. Kinetic Analysis

Kinetic experiments were performed to investigate further the differential enzymatic characteristics of the SULT1A3 allozymes. The results were analyzed based on Lineweaver-Burk double reciprocal plots to calculate the kinetic constants: Km

(reflecting the substrate affinity), Vmax (reflecting the catalytic activity), and Vmax/Km

(reflecting the catalytic efficiency). The kinetic parameters determined for the wild-type and SULT1A3 allozymes are compiled in Tables 5.1 - 5.4.

With APAP as the substrate. As shown in Table 5.1, SULT1A3-P101H was the only one among the twelve allozymes showing a lower Km value (430 ± 20 µM) than that (630

± 40 µM) of the wild-type SULT1A3, while SULT1A3-K234N was the only one that exhibited a Km value comparable to that of the wild-type enzyme. The other ten

SULT1A3 allozymes all showed higher Km values than the wild-type SULT1A3.

Table 5.1 Kinetic parameters of the wild-type and SULT1A3 allozymes with acetaminophen as a substrate. SULT1A3 V K (µM) max V /K Allozymes m (nmol/min/mg) max m 1A3-WT1 630 ± 40 41 ± 3 0.07 ± 0.01 1A3-T7P 730 ± 40 38 ± 4 0.05 ± 0.01 1A3-S8P 670 ± 40 34 ± 3 0.05 ± 0.01 1A3-R9C 1250 ± 90 27 ± 6 0.02 ± 0.01 1A3-P10L 970 ± 80 32 ± 2 0.03 ± 0.01 1A3-V15M 720 ± 70 38 ± 3 0.05 ± 0.01 1A3-V18F 780 ± 40 33 ± 3 0.04 ± 0.01 1A3-P101L 980 ± 40 32 ± 2 0.03 ± 0.01 1A3-P101H 430 ± 20 39 ± 3 0.09 ± 0.01 1A3-R144C 1970 ± 120 28 ± 1 0.01 ± 0.01 1A3-K234N 630 ± 40 29 ± 2 0.05 ± 0.02 1A3-N235T 4500 ± 640 17 ± 1 0.004 ± 0.003 1A3-S290T 1050 ± 120 30 ± 1 0.03 ± 0.01 1Wild-type human SULT1A3.

Of them, SULT1A3-R9C, SULT1A3-R144C, SULT1A3-N235T, and SULT1A3-S290T allozymes displayed dramatically higher Km values (1250 ± 90, 1970 ± 120, 4500 ± 640, and 1050 ± 120 µM, respectively) when compared with the wild-type enzyme. In regard

100

to Vmax, the wild-type SULT1A3 showed the highest value of 41 ± 3 nmol/min/mg.

SULT1A3-N235T displayed a Vmax value of 17 ± 1 nmol/min/mg that was less than half that of the wild-type enzyme. Based on these results, the calculated Vmax/Km values showed that among the twelve SULT1A3 allozymes, only SULT1A3-P101H exhibited a

Vmax/Km value 1.28 times that of the wild-type enzyme, while the other eleven allozymes displayed lower Vmax/Km values than the wild-type SULT1A3. Among these allozymes,

SULT1A3-N235T allozyme showed the lowest Vmax/Km value, being more than 17 times less efficient than the wild-type enzyme.

With morphine as the substrate. The kinetic data shown in Table 5.2 indicated that of the twelve SULT1A3 allozymes, SULT1A3-P101H display a lower Km (3800 ± 300 µM) than the wild-type SULT1A3, while all other allozymes showed Km values higher than that (4600 ± 400 µM) of the wild-type. Among the latter allozymes, SULT1A3-N235T allozyme displayed the lowest Km value (10,000 ± 900 µM). Regarding the Vmax,

SULT1A3-P101H and SULT1A3-P101L displayed higher Vmax values (16 ± 2.5 and 11 ±

0.8 nmol/min/mg, respectively) than that (10 ± 0.6 nmol/min/mg) of the wild-type enzyme. Two allozymes, SULT1A3-T7P and SULT1A3-R144C, showed Vmax values (10

± 1.0 and 10 ± 0.8 nmol/min/mg, respectively) comparable to that of the wild-type

SULT1A3, while the remaining eight allozymes showed lower Vmax values than the wild- type. Notably, SULT1A3-N235T displayed the lowest Vmax values of 0.24 ± 0.03 nmol/min/mg. Based on these results, SULT1A3-P101H allozyme showed a Vmax/Km value that was 2 times higher than that of the wild-type SULT1A3, while the rest of allozymes all showed lower Vmax/Km values than the wild-type enzyme. Notably, the

101

Vmax/Km value of SULT1A3-N235T allozyme was 100 times lower than that of the wild- type SULT1A3.

Table 5.2 Kinetic parameters of the wild-type and SULT1A3 allozymes with morphine as a substrate.

SULT1A3 V x K (µM) ma V x/K Allozymes m (nmol/min/mg) ma m 1A3-WT1 4600 ± 400 10 ± 0.6 0.002 ± 0.001 1A3-T7P 5700 ± 300 10 ± 1.0 0.002 ± 0.001 1A3-S8P 7800 ± 400 9 ± 0.5 0.001 ± 0.001 1A3-R9C 5000 ± 400 4 ± 0.2 0.0008 ± 0.0003 1A3-P10L 5900 ± 500 8 ± 0.4 0.001 ± 0.001 1A3-V15M 5000 ± 300 9 ± 0.9 0.002 ± 0.001 1A3-V18F 5700 ± 600 8 ± 0.4 0.001 ± 0.001 1A3-P101L 6400 ± 600 11 ± 0.8 0.002 ± 0.001 1A3-P101H 3800 ± 300 16 ± 2.5 0.004 ± 0.001 1A3-R144C 7200 ± 300 10 ± 0.8 0.001 ± 0.00007 1A3-K234N 8300 ± 700 5 ± 0.4 0.0006 ± 0.0001 1A3-N235T 10000 ± 900 0.24 ± 0.03 0.00002 ± 0.00001 1A3-S290T 6200 ± 700 7 ± 0.7 0.001 ± 0.00003 1Wild-type human SULT1A3.

With tapentadol as the substrate. As shown in Table 5.3, two allozymes, SULT1A3-

P101H and SULT1A3-R144C, showed Km values (90 ± 10 and 110 ± 10 µM, respectively) lower than that (150 ± 10 µM) of the wild-type SULT1A3. The remaining ten SULT1A3 allozymes all displayed higher Km values than the wild-type enzyme.

Among them, SULT1A3-N235T allozyme showed the lowest Km value (840 ± 70 µM).

In regard to Vmax, SULT1A3-P101H and SULT1A3-R144C displayed Vmax values (30 ± 3 102

and 35 ± 2 nmol/min/mg, respectively) higher than that (27 ± 2 nmol/min/mg) of the wild-type enzyme, while the other ten allozymes all exhibited lower Vmax values. In particular, SULT1A3-N235T showed a Vmax value (13 ± 1 nmol/min/mg) which was less than half of that of the wild-type SULT1A3. Based on these results, two of the twelve

SULT1A3 allozymes, SULT1A3-P101H and SULT1A3-R144C, showed higher Vmax/Km values (being 2 and 1.8 times, respectively) than the wild-type SULT1A3, while the other ten allozymes showed lower Vmax/Km values. Notably, SULT1A3-N235T exhibited a

Vmax/Km value that was 8.5 times lower than the wild-type enzyme.

Table 5.3 Kinetic parameters of the wild-type and SULT1A3 allozymes with tapentadol as a substrate. SULT1A3 V ax K (µM) m V /K Allozymes m (nmol/min/mg) max m 1A3-WT1 150 ± 10 27 ± 2 0.17 ± 0.01 1A3-T7P 190 ± 10 26 ± 1 0.14 ± 0.01 1A3-S8P 480 ± 60 21 ± 1 0.04 ± 0.01 1A3-R9C 340 ± 40 21 ± 2 0.06 ± 0.01 1A3-P10L 320 ± 20 15 ± 1 0.05 ± 0.01 1A3-V15M 380 ± 30 24 ± 0.8 0.06 ± 0.01 1A3-V18F 320 ± 20 22 ± 0.5 0.07 ± 0.01 1A3-P101L 240 ± 20 26 ± 2 0.11 ± 0.01 1A3-P101H 90 ± 10 30 ± 3 0.35 ± 0.01 1A3-R144C 110 ± 10 35 ± 2 0.31 ± 0.02 1A3-K234N 550 ± 20 18 ± 0.3 0.03 ± 0.01 1A3-N235T 840 ± 70 13 ± 1 0.02 ± 0.01 1A3-S290T 210 ± 10 27 ± 1 0.13 ± 0.01 1Wild-type human SULT1A3.

103

With O-DMT as the substrate. As shown in Table 5.4, two SULT1A3 allozymes,

SULT1A3-P101H and SULT1A3-R144C, exhibited Km values (270 ± 30 and 350 ± 60

µM, respectively) lower than that (460 ± 50 µM) of the wild-type enzyme, while the rest of the allozymes all displayed higher Km values. Notably, SULT1A3-N235T showed the highest Km value (800 ± 65 µM) among these latter allozymes. In regard to Vmax, two allozymes, SULT1A3-P101H and SULT1A3-R144C, displayed Vmax values (24 ± 2 and

22 ± 3 nmol/min/mg) higher than that (16 ± 0.6 nmol/min/mg) of the wild-type enzyme, and three other allozymes (SULT1A3-P10L and SULT1A3-P101L, and SULT1A3-

S290T) showed Vmax values comparable to that of the wild-type SULT1A3.

Table 5.4 Kinetic parameters of the wild-type and SULT1A3 allozymes with O-desmethyl tramadol as a substrate. SULT1A3 V K (µM) max V /K Allozymes m (nmol/min/mg) max m 1A3-WT1 460 ± 50 16 ± 0.6 0.04 ± 0.01 1A3-T7P 500 ± 70 6 ± 0.8 0.01 ± 0.01 1A3-S8P 660 ± 90 4 ± 0.4 0.006 ± 0.001 1A3-R9C 510 ± 40 7 ± 0.6 0.01 ± 0.01 1A3-P10L 530 ± 90 16 ± 2 0.03 ± 0.01 1A3-V15M 570 ± 90 12 ± 2 0.02 ± 0.01 1A3-V18F 500 ± 30 6 ± 0.5 0.01 ± 0.01 1A3-P101L 540 ± 50 16 ± 2 0.03 ± 0.01 1A3-P101H 270 ± 30 24 ± 2 0.09 ± 0.01 1A3-R144C 350 ± 60 22 ± 3 0.06 ± 0.01 1A3-K234N 580 ± 60 12.5 ± 3 0.02 ± 0.01 1A3-N235T 800 ± 70 0.03 ± 0.005 0.00004 ± 0.00001 1A3-S290T 480 ± 60 15 ± 2 0.03 ± 0.01 1Wild-type human SULT1A3.

104

The calculated Vmax values of the remaining seven allozymes were notably lower than wild-type. SULT1A3-N235T further exhibited the lowest Vmax value of only 0.03 ± 0.005 nmol/min/mg. Based on these results, the calculated Vmax/Km values of SULT1A3-P101H and SULT1A3-R144C allozymes were, respectively, 2.25 and 1.5 times that of the wild- type enzyme. In contrast, the Vmax/Km values of the other ten allozymes were all lower than the wild-type SULT1A3. Notably, SULT1A3-N235T showed a Vmax/Km value that was 1,000 times lower than the wild-type enzyme.

5.4. Discussion

APAP and opioids, administered individually or in combination, are the most commonly used analgesics in the United States and Europe [1,3,33,34]. Because of their widespread use and potential adverse effects, it is important to understand better the mechanisms underlying individual differences in the metabolism and hence the efficacy and toxicity of these drugs. Inter-individual and ethnic variations in APAP and opioids metabolism have been reported [5,35-38]. Studies have shown that genetic polymorphisms of APAP-metabolizing enzymes could be the cause for the differences in

APAP metabolism and toxicity in different ethnic and racial groups [36,39,40]. It has been demonstrated that the analgesic activity and/or the side effect profiles of morphine and O-DMT depended on the genetically polymorphic enzyme cytochrome P450 2D6

[41,42]. Previous studies have revealed that sulfation is critically involved in the metabolism of APAP, morphine, tapentadol and O-DMT, and that the sulfation pathway is quantitatively more important at pre-and postnatal stages than in adulthood [8-12]. Of

105

the thirteen know human SULTs, SULT1A3 was shown to be a major enzyme responsible for the sulfation of these analgesic drugs [20-23]. In the current study, we first performed a comprehensive database search to identify missense cSNPs of human

SULT1A3 and SULT1A4 genes that code for the identical SULT1A3 protein. We were able to express and purify twelve of the thirteen SULT1A3 allozymes identified. Purified

SULT1A3 allozymes were analyzed for their sulfating activity with APAP, morphine, tapentadol, and O-DMT as substrates. Kinetic experiments were performed to further delineate the differential substrate-binding affinity and catalytic activity of these

SULT1A3 allozymes.

Specific activity data as shown in Figures 5-3 – 5-6 showed SULT1A3 allozymes with higher and lower specific activities than the wild-type. It was noticed that

SULT1A3-P101H allozyme showed higher specific activity than wild-type among other allozymes with the analgesic substrates. Previous studies showed SULT1A3-P101H with lower activity than wild-type toward ritodrine, tocolytic agent, as substrate [19]. It should be pointed out that three other allozymes, SULT1A3-P101L, SULT1A3-R144C and SULT1A3-K234N, also had been studied previously and shown lower sulfating activity with ritodrine [19]. Our study demonstrated these three allozymes with differential sulfating activities toward tested substrates, were SULT1A3-P101L allozyme also showed lower specific activities (about half) than that of wild-type with APAP and tapentadol at all concentrations tested, while it revealed comparable activity to that of wild-type with morphine and O-DMT. SULT1A3-R144C, on the other hand, exhibited more than two times lower activity with APAP, while its activity was comparable to that of wild-type with morphine and higher than wild-type with tapentadol and O-DMT. In

106

the case of SULT1A3-K234N, while the specific activity of SULT1A3-K234N allozyme with APAP and O-DMT were slightly lower than that of wild-type, they were much lower (more than two times) with morphine at the three concentrations tested, and near 7,

3 and 2 times lower than wild-type with 5, 150 and 500 µM tapentadol, respectively.

Some differences in the activities of the four allozymes have been noticed between studies which might be related to the differences in types and concentrations of substrates utilized. It is important to focus also on SULT1A3-N235T which showed the lowest specific activities among all twelve allozymes in comparison with the wild-type toward all substrates. Significantly, this allozyme revealed no detectable activity with morphine and O-DMT. Furthermore, it showed only about 3.8%, 10% and 15.5% of the wild-type activity with 100, 600 and 1500 µM APAP, respectively, and about 11.8%, 14.3% and

21.3% of the wild-type activity with 5, 150 and 500 µM tapentadol, respectively.

Kinetic data as listed in Tables 5.1 - 5.4 further pointed out the differences between SULT1A3 allozymes versus the wild-type, and they were in same line with specific activity findings. SULT1A3-P101H showed always higher affinities and catalytic efficiencies than the wild-type. Previous kinetic studies showed SULT1A3-

P101H allozyme with higher Km and lower catalytic efficiency toward ritodrine and dopamine as substrates [19,25]. Again, substrates, their concentrations and/or allozymes expression methods were different between studies which are possibly the causes behind variations in kinetic results between studies. On the other hand, all kinetic experiments of SULT1A3-N235T allozyme demonstrated low substrate binding affinity and sulfation efficiency.

107

Several crystal structures of the human SULT1A3 have been reported [43-45].

These studies have highlighted structural elements that are important in the catalysis

(residue His108), the PAPS-binding (residues 45TYPKSGTT52, Arg130, Ser138, and

257RKG259), the substrate-binding/specificity (residues Asp86 and Glu146) [45], the N- terminal βA- and βB-sheets (residues Leu12-Val15 and Val18-Ile21, respectively) important in the polypeptide folding [44,46], and the C-terminal dimerization motif

(residues Lys265-Glu274, with sequence KXXXTVXXXE) [47].

Six of the twelve SULT1A3 allozymes analyzed contain amino acid variations in the N-terminal region encompassing the above-mentioned βA- and βB-sheets, which have been proposed to be important in the polypeptide chain folding [46]. All these six allozymes have non-polar amino acids substitutions but with different characteristics, including non-turn-inducing vs. turn-inducing residues (SULT1A3-T7P, SULT1A3-S8P, and SULT1A3-P10L), aliphatic vs. thiol side chains (SULT1A3-R9C), aliphatic vs. S- methyl thioether side chain (SULT1A3-V15M), and non-aromatic vs. aromatic residues

(SULT1A3-V18F). The majority of these allozymes showed lower specific activities than that of the wild-type enzyme with the four analgesic compounds as substrates

(except with SULT1A3-V15M and SULT1A3-P10L that showed comparable activity towards APAP and O-DMT, respectively). The minor variations between these allozymes could be related to the differences in the chemical structure of the four analgesic compounds. In SULT1A3-T7P and SULT1A3-S8P, a polar amino acid (Ser or

Thr) was substituted with Pro, a turn-inducing amino acid residue. Such non- conservative type of amino acid substitutions probably induces unnecessary turn formation in the N-terminal region which might weaken the capacity of these two

108

allozymes (SULT1A3-T7P and SULT1A3-S8P) in sulfating the four analgesic substrates.

Studies have shown that tolerance to Pro substitution is not easily accommodated and the functional consequence may depend on the position in the overall structure [48].

SULT1A3-R9C allozyme involves a substitution of Arg with Cys at position 9 in the N- terminal region, which led to lower sulfating activities towards all four substrates. Arg is known to be a positively charged (basic) amino acid residue, which frequently forms salt- bridges with a negatively charged amino acid residue (Asp or Glu) to generate stabilizing hydrogen bonds that may be important for maintaining protein stability [49]. Such a role can not be fulfilled by a non-polar amino acid like Cys, which potentially may lead to formation of disulfide bonding with other Cys residues in the same protein molecule or in multi-polypeptide complex as in the case of SULT enzymes [50]. For SULT1A3-P10L, the Pro residue, located at position 10 in the wild-type SULT1A3, is near the edge of the

βA sheet in the N-terminal region. Previous studies have demonstrated that Pro is more frequently located at sharp turns such as at the edges of β-sheets, β-strands linking, kinks in transmembrane α-helices or within loops and disordered regions of proteins [51].

Substitution of Pro with Leu in SULT1A3-P10L rendered the allozyme with lower sulfating activities than the wild-type enzyme toward three (APAP, morphine and tapentadol) of the four substrates tested. Regarding SULT1A3-V15M and SULT1A3-

V18F, both these two allozymes involve the substitution of a valine residue with a S- methyl thioether side chain-containing or aromatic amino acid residue, with decreased sulfating activities towards the four tested analgesic substrates. Both Met and Phe possess larger side chains than Val, which may result in more restricted conformations.

Collectively, the decreased sulfating activities of SULT1A3 allozymes with amino acid

109

substitutions in the N-terminal region as elaborated above provide further support for the important structural role of the N-terminal βA- and βB-sheets in the SULT1A3 molecule as previously reported [46].

Three of the SULT1A3 allozymes examined, SULT1A3-P101L, SULT1A3-

P101H and SULT1A3-R144C, involve amino acid substitutions close to the catalytic residue (His108) and/or substrate binding residues (residues Asp86 and Glu146). The location of the Pro residue at position 101, in loop connecting α6 and βD, makes it not only close to the catalytic residue (His108) but also a part of the segment 84-104 that has been shown, together with residues 145-154, to be involved in substrate-binding and reshaping the substrate binding pocket [45]. SULT1A3-P101L showed comparable sulfating activities with morphine and O-DMT as substrates and slightly lower sulfating activities towards APAP and tapentadol compared with the wild-type enzyme. In contrast, SULT1A3-P101H showed higher sulfating activities than the wild-type towards all four substrates tested, indicating that His residue at this location may have a positive impact on the interaction with the four analgesic compounds tested as substrates. Indeed,

SULT1A3-P101H exhibited lower Km values than the wild-type with the four tested substrates, indicating clearly higher affinity towards these analgesic compounds. In the case of SULT1A3-R144C, this allozyme showed differential sulfating activity compared with the wild-type, ranging from lower activity with APAP, comparable activity with morphine, and higher activities with tapentadol and O-DMT. As discussed above, an Arg to Cys amino acid substitution can produce phenotype changes depending on the location in the protein molecule. As a result of this substitution, Cys may induce disulfide-bond formation with other cysteine residues, instead of salt-bridges formed by Arg with

110

negatively charged amino acids residues [50]. The location of Arg144 residue is within

143-148 segment of the SULT molecule, which has been shown to play an important role in substrate-binding and catalysis of both human SULT1A1 and SULT1A3 [52]. The

R144C substitution thus may lead to structural changes in the substrate-binding pocket, which in turn may affect the binding-affinity for the substrate. That the four analgesic substrates tested vary in their chemical structures with differential distribution of functional groups may explain the differences in sulfating activities of SULT1A3-R144C toward the four analgesic compounds.

Two of the tested allozymes, SULT1A3-K234N and SULT1A3-N235T, have amino acid substitutions near the PAPS binding sites. SULT1A3-K234N showed lower sulfating activities than the wild-type enzyme with all three opioids (morphine, tapentadol and O-DMT), while SULT1A3-N235T exhibited lower sulfating activities with all four substrates. The amino acid substitutions of these two allozymes are located at the α15 sheet which was postulated to contribute indirectly to the co-substrate (PAPS) binding as well as to restrict the conformations required for substrate binding when the

PAPS is bound to the protein molecule [46]. In addition, the very low sulfating activity of the SULT1A3-N235T might be related also to the difficulty in accommodating the bulky side chain of the Thr residue into the α-helical segment of the SULT1A3 crystal structure. The presence of Asn235 was shown to be important not only in SULT1A3, but also in SULT1A1 [53,54]. In contrast, SULT1A3-S290T, with serine replaced by a hydroxyl group-containing threonine, showed no dramatic differences from the wild-type in sulfating all four analgesic compounds tested.

111

In summary, the current study aimed to gather information concerning the effects of the genetic polymorphisms on the APAP, morphine, tapentadol and O-DMT-sulfating activity of SULT1A3 allozymes. Specific activity and kinetic data obtained showed clearly the differential sulfating activities of SULT1A3 allozymes toward the four analgesic compounds tested as substrates. These findings may underscore the differential capacity in sulfating APAP, morphine, tapentadol and O-DMT in different individuals.

Pending further studies, such information may in the future aid in designing personalized regimens of these analgesics to optimize their efficacy and mitigate the side effects for individuals with distinct SULT1A3/SULT1A4 genotypes.

Acknowledgments: This work was supported in part by a grant from National Institutes of

Health (Grant # R03HD071146).

112

Chapter 6

Impact of SULT1A3/SULT1A4 Genetic Polymorphisms on the Sulfation of Phenylephrine and Salbutamol by human SULT1A3 Allozymes

Ahsan F. Bairam1,2, Mohammed I. Rasool1,3, Fatemah A. Alherz1, Maryam S Abunnaja1, Amal A. El Daibani1, Saud A. Gohal1, Katsuhisa Kurogi1,4, Ming-Cheh Liu1,*

Tel: (419) 383-1918 Fax: (419) 383-1909 E-mail [email protected]

Running Title: Genetic polymorphism of human SULT1A3.

113

Keywords: SULT1A3 allozymes, phenylephrine, salbutamol, sulfoconjugation.

Abbreviations: PAP[35]S, 3’-phosphoadenosine-5’-phosphosulfate; SULT, cytosolic sulfotransferase; TLC; thin-layer chromatography; SNP, single nucleotide polymorphism.

Abstract

Objectives

Phenylephrine and salbutamol are important sympathomimetic drugs which are widely used to treat and/or control pathophysiological conditions, such as nasal congestion, hypotension, and asthma, in individuals of different age groups. Human cytosolic sulfotransferase (SULT) SULT1A3 has been shown to be critically involved in the metabolism of these therapeutic agents. The current study was performed to investigate the effects of single nucleotide polymorphisms (SNPs) of human SULT1A3 and

SULT1A4 genes on the enzymatic characteristics of the sulfation of phenylephrine and salbutamol by SULT1A3 allozymes.

Methods

Online databases were searched for SULT1A3/SULT1A4 nonsynonymous coding SNPs. cDNAs corresponding to the thirteen cSNPs identified were generated by site-directed mutagenesis. Coded SULT1A3 allozymes were bacterially expressed and affinity- purified. Purified SULT1A3 allozymes were analyzed for sulfating activity using an established assay procedure.

114

Results

Purified SULT1A3 allozymes displayed differential sulfating activities toward phenylephrine and salbutamol in comparison to the wild-type enzyme. Kinetic studies showed further significant variations in their substrate-binding affinity and catalytic activity toward phenylephrine and salbutamol.

Conclusions

The results obtained showed clearly the differential enzymatic characteristics of

SULT1A3 allozymes toward phenylephrine and salbutamol. Such information may contribute to a better understanding about the pharmacokinetics of these two drugs in individuals with distinct SULT1A3 and/or SULT1A4 genotypes.

Keywords: SULT1A3 allozymes, phenylephrine, salbutamol, sulfoconjugation.

6.1. Introduction

Phenylephrine and salbutamol are sympathomimetic drugs widely used to treat and/or control several pathophysiological conditions. Phenylephrine acts primarily as a

α1-agonist and is commonly used as an over-the-counter decongestant and as a vasopressor to elevate the blood pressure in patients with hypotension [1,2]. Salbutamol

(albuterol), also a sympathomimetic drug, is used as a bronchodilator for patients with asthma and chronic obstructive pulmonary disease (COPD), as well as a uterine relaxant

115

to prevent premature labor by acting as a β2-agonist [3,4,5]. Recent pharmacokinetic studies demonstrated that a significant fraction of these drugs is metabolized by sulfoconjugation in humans, forming inactive sulfated metabolites [4,6]. Approximately

47% of phenylephrine and 20-60% of salbutamol, administered orally, have been shown to be subjected to sulfation [4,7]. Studies have revealed that of the thirteen human cytosolic sulfotransferases (SULTs), SULT1A3 was the major SULT responsible for the sulfation of both these two drugs [8,9]. It is important to point out that orally administered salbutamol and other β2 agonists, although well absorbed from the gastrointestinal tract, may undergo extensive presystemic sulfation in the liver and intestine, leading to their inactivation and low systemic bioavailability [6,10,11,12]. In support of this notion, studies have shown that inhibition of SULT1A3 by components in beverages such as tea may sustain the systemic bioavailability of salbutamol [10].

In humans and other mammals, sulfation is known to be a major Phase II metabolic pathway that is involved in the inactivation and disposal of biologically active compounds [13,14,15]. The responsible SULT enzymes catalyze the transfer of a sulfonate group from the 3’-phosphoadenosine 5’-phosphosulfate (PAPS) to the hydroxyl or amino group of an acceptor substrate compound [16]. As noted earlier, the human

SULT1A3 has been demonstrated to be responsible for the sulfation of phenylephrine and salbutamol [8,9]. Interestingly, genomic studies have demonstrated the duplication of the gene encoding SULT1A3 during evolution process [17,18]. Both the SULT1A3 and

SULT1A4 genes were found to be located on chromosome 16 and both are considered transcriptionally active and encode identical protein products, collectively called

SULT1A3 [18]. In addition to gene duplication, genetic polymorphisms of both

116

SULT1A3 and SULT1A4 genes have been reported and distinct allelic frequencies of some SULT1A3 and SULT1A4 genotypes have been found for different ethnic groups

[19]. Importantly, several SULT1A3 allozymes, expressed in COS-7 cells, were shown to display differential sulfating activities toward dopamine and ritodrine (a β2 agonist)

[19,20].

In this study we aimed to systematically evaluate the effect of non-synonymous

(missense) single nucleotide polymorphisms (SNPs) of SULT1A3 and SULT1A4 on the sulfation of phenylephrine and salbutamol by SULT1A3 allozymes. A comprehensive database search was performed to identify the SULT1A3 and SULT1A4 missense SNPs and corresponding SULT1A3 allozymes were expressed and purified. Functional assays were performed on these allozymes with phenylephrine and salbutamol as substrates to analyze their sulfating activity and kinetic properties.

6.2. Methods

6.2.1. Database search

A systematic database search was performed at the websites of the U.S. National

Center for Biotechnology Information (NCBI) and the Universal Protein Knowledgebase

(UniProtKB) for missense cSNPs of human SULT1A3 and SULT1A4 genes, as well as at

PubMed for previous genomic studies that reported SULT1A3/SULT1A4 genotypes

[18,19].

117

6.2.2. cDNA generation, and expression and purification of SULT1A3 allozymes

cDNAs encoding SULT1A3 allozymes, harbored in pGEX-2TK expression vector, were generated via site-directed mutagenesis using mutagenic primers designed based on individual SULT1A3/SULT1A4 genotypes (Table 2.4 page 31). Briefly, the wild-type SULT1A3 cDNA packaged in pGEX-2TK, was used as a template, in conjunction with specific mutagenic primer sets, for the PCR-amplification of the cDNAs that encode different SULT1A3 allozymes. Nucleotide sequencing of the resulting

“mutated” SULT1A3 cDNAs was performed to verify the nucleotide, and thus the amino acid, variations [21] (cf. Figure 6-1, to illustrate the locations of amino acids associated with SULT1A3 cSNPs, in addition to the previously reported residues involved in catalysis, PAPS-binding, and substrate-binding). pGEX-2TK harboring individual

“mutated” cDNAs were individually transformed into competent BL21 E. coli cells for the expression of recombinant SULT1A3 allozymes. Fractionation of the expressed

SULT1A3 allozymes present in the E. coli cell lysate was performed using glutathione-

Sepharose, followed by thrombin digestion to release purified recombinant SULT1A3 allozymes. The purity and concentration of the purified SULT1A3 allozymes were determined by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Bradford protein assay, respectively [22,23].

118

A) B) P101

V15

N235 V18 S290 P10 R9 K234

R144

Figure 6-1. Human SULT1A3 protein structure showing locations of amino acids involved in the SULT1A3/SULT1A4 cSNPs. (A) Amino acid sequence of the human SULT1A3 demonstrating residues reported to be involved in PAPS-binding, substrate- binding, and/or catalysis. Residues circled with gray background are involved in PAPS-binding. Residue circled with white background is involved in catalysis. Residues circled with black background are involved in substrate-binding. Residues enclosed with diamond refer to the substituted amino acids. Protter, a web-based tool for interactive protein feature visualization, was used to generate this figure [35]. (B) Three dimensional diagram of the structure of human SULT1A3-dopamine-PAP complex. The PyMOL Molecular Graphics System software [36] was used to edit the structure of SULT1A3 (Protein Data Bank code: 2A3R [28]). Substrate (dopamine) and co-substrate (PAP) molecules in the structure are represented by yellow and black bond structures, respectively. Side chains of the substituted amino acid residues, Arg9, Pro10, Val15, Val18, Pro101, Arg144, Lys234, Asn235, Ser290, are shown by red bond structures.

119

6.2.3. Enzymatic assay

A previously established assay procedure [24] was used to analyze the sulfating activity of SULT1A3 allozymes. Phenylephrine and salbutamol, at two different concentrations (1 and 10 µM for phenylephrine, and 5 and 50 µM for salbutamol), were used as substrates. Reactions, with radiolabeled PAP[35S] as the sulfate donor and

HEPES at pH 7.4 as the buffer, were performed for 10 min at 37ºC, followed by TLC separation, and autoradiography to locate the spots of the [35S]sulfated phenylephrine or salbutamol. The located spots were cut out from the plate and the [35S]sulfated products therein were eluted with Milli-Q water and counted for [35S]-radioactivity using a liquid scintillation counter. Data obtained were used to compute the specific activities in nmol of sulfated product/min/mg of allozyme.

6.2.4. Kinetic analysis

To determine the kinetic parameters, Km, Vmax, and Vmax/Km, of SULT1A3 allozymes in mediating the sulfation of phenylephrine and salbutamol, enzymatic assays were performed using 0, 0.5, 1, 2.5, 5, 10, 20, 30, 40, 50, 60, 70 and 80 µM of phenylephrine or 0, 5, 10, 25, 50, 66.6, 100, 200, 500, 750, 1000 and 1500 µM of salbutamol as substrates.

6.2.5. Data analysis

120

Data obtained in the kinetic experiments were processed based on non-linear regression of the Michaelis-Menten equation to compute the kinetic constants. GraphPad

Prism 7 software was utilized in data analysis.

6.2.6. Materials

Phenylephrine and Ecolume scintillation cocktail were purchased from MP

Biomedicals, LLC. (Irvine, CA, USA) Salbutamol was from Alfa Aesar (Haverhill, MA,

USA). Dimethyl sulfoxide (DMSO), adenosine 5’-triphosphate (ATP), N-2- hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES), and dithiothreitol (DTT) were products of Sigma Chemical Company (St. Louis, MO, USA). 3’-Phosphoadenosine-5’- phospho[35S]sulfate (PAP[35S]) was prepared using ATP and free [35S]sulfate based on a previously established protocol [25]. Cellulose TLC plates were purchased from EMD

Millipore Corporation (Burlington, MA, USA). PCR kit was from G Biosciences (St.

Louis, MO, USA). Prime STAR® GXL DNA Polymerase was a product of Clontech

Laboratories, Inc. (Mountain View, CA, USA). QIAprep® Spin Miniprep Kit was a product of QIAGEN (Germantown, MD, USA). Protein molecular weight markers were from Bioland Scientific LLC (Paramount, CA, USA). Glutathione SepharoseTM was purchased from GE Healthcare Life Sciences (Pittsburgh, PA, USA). X-Ray films were obtained from Research Products International Corporation (Mt Prospect, IL, USA). All other chemicals were of the highest grades commercially available.

6.3. Results

121

6.3.1. Analysis of human SULT1A3 and SULT1A4 SNPs, and expression and purification of recombinant human SULT1A3 allozymes

Two SNP databases, located at the NCBI and UniProtKB websites, as well as relevant research articles stored at the PubMed website, were systematically searched to identify missense cSNPs of human SULT1A3 and SULT1A4 genes (cf. Table 2.1 page

26). In total, thirteen cSNPs that code for distinct SULT1A3 protein products were identified (cf. Table 2.2 page 27 for locations and amino acid variations). Of the thirteen potential SULT1A3 allozymes, twelve were successfully expressed and purified. Upon

SDS-PAGE, the molecular weights of all twelve SULT1A3 allozymes appeared similar to that of the wild-type SULT1A3 (34,196) (cf. Figure 2-3 page 36).

6.3.2. Enzymatic characterization of the SULT1A3 allozymes

Specific activities of purified SULT1A3 allozymes and the wild-type enzyme were analyzed using two different substrate concentrations, one approximately ten times lower and the other close to the reported Km of the wild-type SULT1A3 toward phenylephrine and salbutamol. Results obtained are shown in Figures 6-2 and 6-3.

With 1 µM phenylephrine as a substrate (cf. Figure 6-2A), five allozymes,

SULT1A3-P10L, -V15M, -V18F, -P101L, and -P101H, displayed specific activities comparable to that of the wild-type enzyme, while three allozymes, SULT1A3-T7P, -

122

S8P, and -R9C, exhibited slightly lower (86.5%, 84.5%, and 79.2%, respectively) sulfating activity than that of the wild-type.

B) With 10 µM Phenylephrine

Figure 6-2. Specific activities of the human SULT1A3 allozymes with phenylephrine as a substrate. Concentrations of phenylephrine used in the enzymatic assays were 1 µM (A) and 10 µM (B). Specific activity refers to nmol phenylephrine sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

123

The remaining four SULT1A3 allozymes exhibited much lower specific activities than the wild-type enzyme. Among these four allozymes, SULT1A3-N235T showed the lowest phenylephrine-sulfating activity, being only 16.8% of that of the wild-type. With

10 µM phenylephrine as a substrate (cf. Figure 6-2B), eight allozymes, SULT1A3-T7P, -

S8P, -P10L, -V15M, -V18F, -P101L, -P101H, -K234N, showed sulfating activities that were more than 75% of that of the wild-type enzyme. Among these eight allozymes,

SULT1A3-P101H showed a slightly higher activity than the wild-type, whereas

SULT1A3-R9C displayed an activity less than 75% of that of the wild-type. The specific activities determined for the remaining three allozymes, SULT1A3-R144C, -N235T, -

S290T, were much lower than that of the wild-type. In particular, SULT1A3-N235T exhibited an activity which was only 27.7% of that of the wild-type enzyme.

With 5 µM salbutamol as a substrate (Figure 6-3A), the wild-type SULT1A3 showed an activity higher than all twelve allozymes. Two of the latter, SULT1A3-

P101H and SULT1A3-R144C, exhibited only slightly lower activities, while three others,

SULT1A3-T7P, -P10L and -S290T, showed activities between 50-75% that of the wild- type. The remaining seven SULT1A3 allozymes displayed much lower specific activities, compared with the wild-type. Among these seven allozymes, SULT1A3-S8P and -N235T displayed the lowest activities, being only 15.2% and 20.6% that determined for the wild-type. With 50 µM salbutamol as a substrate (Figure 6-3B), SULT1A3-

P101H and -R144C allozymes exhibited comparable sulfating activities, whereas

SULT1A3-T7P, -P10L, -V15M, -V18F, -P101L, -K234N and -S290T displayed lower

(ranging 50-75%), compared with the wild-type. In contrast, the remaining two,

124

SULT1A3-S8P and -N235T, showed much lower activities (16.3% and 22.5% of that of the wild-type).

A) With 5 µM Salbutamol

B) With 50 µM Salbutamol

Figure 6-3. Specific activities of the human SULT1A3 allozymes with salbutamol as a substrate. Concentrations of phenylephrine used in the enzymatic assays were 5 µM (A) and 50 µM (B). Specific activity refers to nmol salbutamol sulfated/min/mg of purified allozyme. Data shown represent mean ± standard deviation derived from three determinations (n=6). WT refers to wild-type SULT1A3.

125

6.3.3. Determination of kinetic parameters of the human SULT1A3 allozymes in mediating the sulfation of phenylephrine and salbutamol

Kinetic constants of wild-type and SULT1A3 allozymes with phenylephrine as the substrate were determined. As shown in Table 6.1, ten allozymes displayed Km values close to that of the wild-type (10.22 ± 0.57 µM). Of the two remaining SULT1A3 allozymes, SULT1A3-R144C showed a Km value (26.99 ± 3.66 µM) 2.5 times that of the wild-type, while SULT1A3-N235T showed a Km value (207.00 ± 65.51 µM) nearly 20 times that of the wild-type.

Table 6.1 Kinetic parameters of the human SULT1A3 wild-type and allozymes with phenylephrine as substrate. SULT1A3 V K (µM) max V /K allozymes m (nmol/min/mg) max m 1A3-WT1 10.22 ± 0.57 44.34 ± 0.58 4.33 1A3-T7P 8.96 ± 1.02 37.17 ± 1.26 4.14 1A3-S8P 9.33 ± 0.82 37.74 ± 1.90 4.04 1A3-R9C 11.20 ± 0.83 33.90 ± 0.70 3.03 1A3-P10L 8.91 ± 0.62 34.33 ± 0.61 3.85 1A3-V15M 10.00 ± 0.49 43.48 ± 0.59 4.35 1A3-V18F 8.88 ± 0.99 37.04 ± 1.10 4.17 1A3-P101L 8.29 ± 0.53 35.34 ± 0.57 4.26 1A3-P101H 9.15 ± 0.84 44.35 ± 1.01 4.85 1A3-R144C 26.99 ± 3.66 32.19 ± 1.66 1.19 1A3-K234N 8.99 ± 1.00 31.90 ± 0.85 3.55 1A3-N235T 207.00 ± 65.51 90.83 ± 22.34 0.44 1A3-S290T 9.55 ± 1.08 23.89 ± 0.71 2.50 1Wild-type human SULT1A3.

126

In regard to Vmax, ten of the twelve allozymes showed Vmax values comparable to, albeit slightly lower than, that of the wild-type. Of the other two allozymes, SULT1A3-

N235T showed a Vmax value nearly two times that of the wild-type, while SULT1A3-

S290T exhibited a Vmax value only half of that of the wild-type enzyme. Based on these

Km and Vmax values, nine of the twelve SULT1A3 allozymes showed calculated Vmax/Km comparable to that of the wild-type enzyme. The other three (SULT1A3-R144C, -

N235T, and -S290T) showed Vmax/Km values that were 27.4%, 10.1%, and 57.7% of that of the wild-type.

Kinetic analysis of the wild-type and SULT1A3 allozymes were also performed with salbutamol as substrate and the results obtained are compiled in Table 6.2. Of the twelve allozymes examined, two allozymes, SULT1A3-P101H and -R144C, exhibited Km values (54.26 ± 4.29 and 57.75 ± 5.51, respectively) close to that of the wild-type (54.07

± 3.47 µM), while the other ten allozymes showed considerably higher Km values.

Among the latter, six allozymes, SULT1A3-S8P, -R9C, -V15M, -V18F, -K234N and -

N235T, showed substantially higher Km values than the other four allozymes. Notably, -

N235T exhibited a Km value which was 7.1 times that of the wild-type SULT1A3. In regard to Vmax, a single allozyme, one of the twelve allozyme, SULT1A3-R144C, displayed a slightly higher Vmax value (35.25 ± 0.66 nmol/min/mg) than that (34.27 ± 1.29 nmol/min/mg) determined for the wild-type enzyme, while the other eleven allozymes showed lower Vmax values than the wild-type. In particular, SULT1A3-S8P exhibited a

Vmax value (11.89 ± 0.31 nmol/min/mg), which was only one-third of that of the wild- type. The calculated Vmax/Km indicated that only two allozymes, SULT1A3-P101H and -

R144C, showed values (0.62 and 0.61, respectively) comparable to that of wild-type

127

(0.63), while the other ten allozymes all showed lower Vmax/Km values than with the wild- type. Like with phenylephrine, six allozymes, SULT1A3-S8P, -R9C, -V15M, -V18F, -

K234N and -N235T, exhibited dramatically lower catalytic efficiencies (11.1%, 20.6%,

26.9%, 43.9%, 36.5% and 11.1%) toward salbutamol than the wild-type enzyme.

Table 6.2 Kinetic parameters of the human SULT1A3 wild-type and allozymes with salbutamol as substrate. SULT1A3 V K (µM) max V /K allozymes m (nmol/min/mg) max m 1A3-WT1 54.07 ± 3.47 34.27 ± 1.29 0.63 1A3-T7P 71.83 ± 5.87 29.56 ± 0.50 0.49 1A3-S8P 172.00 ± 19.23 11.89 ± 0.31 0.07 1A3-R9C 243.00 ± 43.92 32.26 ± 1.51 0.13 1A3-P10L 88.50 ± 9.05 30.47 ± 0.66 0.34 1A3-V15M 173.20 ± 31.58 28.90 ± 1.26 0.17 1A3-V18F 118.80 ± 18.52 25.74 ± 0.90 0.22 1A3-P101L 90.77 ± 8.70 24.05 ± 0.49 0.26 1A3-P101H 54.26 ± 4.29 33.40 ± 0.51 0.62 1A3-R144C 57.75 ± 5.51 35.25 ± 0.66 0.61 1A3-K234N 107.10 ± 13.83 24.30 ± 0.69 0.23 1A3-N235T 386.30 ± 45.86 28.06 ± 1.85 0.07 1A3-S290T 87.78 ± 9.04 30.76 ± 0.67 0.35 1Wild-type human SULT1A3.

6.4. Discussion

Phenylephrine and salbutamol are widely used adrenergic agents that are prescribed for different routes of administration for patients suffering from a number of

128

conditions, including nasal and sinus congestion, hypotension, asthma and COPD

[1,2,3,5]. From the perspective of pharmacokinetic properties, these drugs have been shown by recent studied to be metabolized through sulfation in human body under the action of SULTs, particularly SULT1A3 [4,7,8,9]. In view of the critical role SULT1A3 in their metabolism, we were interested in examining the effects of genetic polymorphism on the sulfating activity of SULT1A3 allozymes towards these adrenergic drugs.

Previous studies have revealed that the gene coding for SULT1A3 had undergone duplication during the evolutionary process generating two genes, designated SULT1A3 and SULT1A4 genes, that encode identical protein products, collectively called SULT1A3

[18]. In this study, we therefore set out to gather information concerning the different

SULT1A3 and SULT1A4 genotypes (cSNPs) that code for SULT1A3 allozymes. In total, thirteen distinct SULT1A3/SULT1A4 cSNPs were identified. Site directed mutagenesis was employed to generate corresponding cDNAs, and SULT1A3 allozymes were expressed, purified, and characterized for their sulfating activity toward phenylephrine and salbutamol.

An initial analysis of the specific activities of the twelve SULT1A3 allozymes that were successfully expressed and purified revealed that eight of them displayed differential phenylephrine-sulfating activities comparable to that of the wild-type enzyme

(Figure 6-2). The other four SULT1A3 allozymes (-R144C, -K234N, -N235T, and -

S290T), on the other hand, showed activities considerably lower than that of the wild- type. The follow-up kinetic studies indicated the changes in Km (reflecting the substrate- binding affinity) and/or Vmax (reflecting the catalytic activity) that resulted in the

129

differential catalytic efficiency (as reflected by Vmax/Km) found for these SULT1A3 allozymes. In regard to their salbutamol-sulfating activity, a more varied pattern of the specific activities were determined for different SULT1A3 allozymes. The follow-up kinetic studies showed more highly variable changes in Km and/or Vmax, and, consequently, Vmax/Km. These results indicated clearly that the amino acid changes due to the cSNPs of the SULT1A3 and SULT1A4 genes indeed have a significant impact on the sulfating activity of the coded SULT1A3 protein products.

Previous studies on the crystal structure of SULT1A3 have revealed different amino acid residues and/or segments that play important roles in the activity of the enzyme. Among them are the N-terminal region comprising the βA- and βB-sheets

(residues Leu12-Val15 and Val18-Ile21, respectively) that has been shown to be important for the polypeptide folding [26,27], a catalytic residue (His108), co-substrate

(PAPS) binding regions (residues 45TYPKSGTT52, Arg130, Ser138, and 257RKG259), substrate-binding/specificity sites (residues Asp86 and Glu146) [28], and C-terminal region involving the dimerization motif (residues Lys265 to Glu274, with

KXXXTVXXXE sequence) [29]. In a recent modeling study, three loop segments,

Asp66-Met77, Ser228-Gly259, and Lys85-Pro90, have been proposed to form a gate that governs the substrate selectivity [30]. In light of these critical structural elements, it is an interesting question how the corresponding amino acid substitutions in different

SULT1A3 allozymes may affect their phenylephrine- and salbutamol-sulfating activity.

As noted above, two SULT1A3 allozymes, -R144C and -N235T, showed the lowest specific activities and catalytic efficiencies (about 27% and 10% of that of the wild-type, respectively) toward phenylephrine. In the case of SULT1A3-R144C, Arg is

130

known to be positively charged and may form salt-bridges with acidic (negatively charged) amino acid residues (Asp or Glu) establishing hydrogen bonds that may be critical to the functioning of the enzyme [31]. Upon replacement with Cys, the hydrogen bonds cannot be formed. It is noted that in the SULT1A3 molecule, Arg144 residue is located within the segment 143HRMEKA148, which has been shown to play a significant role in substrate-binding and catalysis in both SULT1A1 and SULT1A3 [32]. The

Arg144Cys substitution therefore may affect the substrate-binding affinity by causing structural changes in the substrate-binding pocket. As noted above, SULT1A3-N235T exhibited low sulfating activity and catalytic efficiency towards both phenylephrine and salbutamol. Asn235 is located within the α15 sheet secondary structure that was proposed to play an indirect role in PAPS-binding and may restrict the required conformations for substrate binding when the co-substrate, PAPS, is bound to the SULT molecule [27]. In addition, the bulky side chain of the substituting Thr residue could not be easily accommodated within the α15 helical structure, which may affect the binding of both co-substrate and substrate. This may explain the very low sulfating activity of

SULT1A3-N235T towards both substrates. Incidentally, Asn235Thr substitution has also been reported in a previous study to affect greatly the sulfating activity of SULT1A1 towards its diagnostic substrate, p-nitrophenol [33,34].

With salbutamol as the substrate, seven SULT1A3 allozymes, -S8P, -R9C, -

V15M, -V18F, -P101L, -K234N and -N235T, showed significantly lower sulfating activity and catalytic efficiencies than the wild-type enzyme. Among them, SULT1A3-

S8P exhibited the lowest sulfating activity with a dramatically reduced catalytic efficiency (about 11% of that of the wild-type). It is possible that the substituting proline

131

residue may impose an unfavorable turn in the N-terminal region, thereby affecting the conformation and thus the salbutamol-sulfating activity of this allozyme. In the case of

SULT1A3-R9C, the Arg to Cys substitution may disrupt hydrogen bonding which may be critical to the activity of the enzyme. Moreover, the potential of the consequential disulfide bond formation should not be overlooked. For SULT1A3-V15M and -V18F, these two allozymes involve substitution of an aliphatic with a S-methyl thioether side chain (SULT1A3-V15M) or an aromatic side chain (SULT1A3-V18F). Both Met and

Phe have bulkier side chains than Val, which at their locations may lead to more restricted conformations of the βA- and βB-sheets (spanning residues Leu12-Val15 and

Val18-Ile21, respectively) in the N-terminal region. The lower sulfating activity and catalytic efficiency of the allozymes with amino acids substitutions in the N-terminal region (SULT1A3-S8P, -R9C, -V15M, -V18F) provide support for the important structural role of this region in the SULT1A3 polypeptide molecule [27]. SULT1A3-

P101L involves the substitution of Pro with Leu within the loop connecting α6 and βD sheets, this location is near the catalytic residue His108 and is within the segment 84-104 that has been proposed to be involved in substrate binding and, together with the segment

145MEKAHPEPGT154, in reshaping the conformation of the substrate-binding pocket

[28]. Both SULT1A3-K234N and -N235T showed decreased salbutamol-sulfating activities with lower catalytic efficiencies (36.5% and 11.1%, respectively), compared with the wild-type enzyme. As noted earlier, both N235 and K234 are located within the

α15 sheet, which is involved in the binding of the co-substrate, PAPS, and substrate- binding [27], which may be the reason for their decreased salbutamol-sulfating activities.

132

To summarize, the current study aimed to collect data relevant to the impact of

SULT1A3/SULT1A4 genetic polymorphisms on the sulfating activity of the human

SULT1A3 towards phenylephrine and salbutamol. Both the specific activity and kinetic data revealed that human SULT1A3 allozymes indeed displayed differential sulfating activities and catalytic efficiencies with the two substrates. These results may underscore the differential metabolism of phenylephrine and salbutamol in individuals with different

SULT1A3/SULT1A4 genotypes. Such information may in the future help design personalized regimens of these two adrenergic drugs to improve their therapeutic efficacy and minimize their side effects.

Acknowledgments: This work was supported in part by a grant from National Institutes of Health (Grant # R03HD071146).

Conflict of interest: The authors declare no conflicts of interest.

133

Chapter 7 pH dependence and Inhibitors

7.1. pH dependence

7.1.1. Experimental procedure

In order to characterize further the sulfation of dopamine (diagnostic substrate), pH-dependence experiments were performed on wild-type SULT1A3 and SULT1A3-

N235T allozyme. SULT1A3-N235T allozyme was used due to the fact that this allozyme always showed the most differential (lower) activity and enzymatic catalytic efficiency toward all substrates tested. Different buffers were used (50 mM sodium acetate at 4.5 and 5; MES at 5.5, 6, and 6.5; HEPES at 7, 7.5 and 8; TAPS at 8.5; CHES at 9, 9.5 and

10; CAPS at 10.5, 11, and 11.5) to alter the pH level. The experimental procedure for pH-dependence studies was the same as that performed for specific activity experiments

(page 36), except for the differing buffers.

7.1.2. Results and discussion

134

As shown in Figure 7-1, wild-type SULT1A3 and SULT1A3-N235T allozymes showed different activities at different pH levels toward DA as substrate. Furthermore, the wild-type enzyme displayed wider range of activity than SULT1A3-N235T allozyme when using the same types of buffers. Indeed, wild-type SULT1A3 showed high activity at a pH range of 6-10.5, whereas SULT1A3-N235T allozyme exhibited high DA- sulfating activity only at a pH range of 7-9. On the other hand, both enzymes displayed the same optimal pH level of 7.5 which is interestingly very close to the inside pH of the the cells in human (about 7.4) (Roos and Boron, 1981; Bright et al., 1987; Madshus et al.,

1988). Studies showed that changing the pH of reaction solution/mixture could affect the ionization state of the acidic or basic amino acid residues in the protein molecule, which may affect the 3D structure of the protein. Consequently, the enzyme may lose part or all of its activity. In addition to effects on the enzyme, changing the pH could also affect the charge of the substrate which may alter its binding or catalytic activity (Dixon, 1953).

Based on that, it is possible that the protonated or deprotonated state of the DA ionizable functional groups (-NH and -OH), and the ionization state of the amino acid residues of the enzyme could affect the interaction between the substrate and corresponding amino acid residues, which may explain the differential activities at different pH levels for each enzyme (wild-type or SULT1A3-N235T). Furthermore, and as had been previously shown, the N235T SNP presents in a region proposed to be involved indirectly in PAPS binding that resulted in allozyme with lower activity than the wild-type (Allali-Hassani et al., 2007).

135

A) Wild-type SULT1A3 with DA

B) SULT1A3-N235T with DA

Figure 7-1. pH dependence of the human SULT1A3 wild-type and SULT1A3-N235T allozyme with dopamine as substrate.

136

7.2. Inhibitors

7.2.1. Introduction

Flavonoids are plant products that are found in large quantities in vegetables, fruits, beverages, such as tea and wine, and medicinal herbs (Harnly et al., 2006; Justesen et al., 1998). Human and animals ingest large amounts of flavonoids in their food due to their variety and low toxicity. Besides, several studies demonstrated their ability to act as antioxidant (Torres and Bobet, 2001; Cho, 2006), having anti-cancer and antimicrobial activities (Veluri et al., 2004), and many other biological responses. The flavonoids have been also found to act as substrates for SULT1A3 and can potentially inhibit this enzyme.

Among these flavonoids, catechin, and hesperetin, which exhibit substrate inhibition on recombinant SULT1A3 at high concentrations. For example, 100 µM of catechin was shown to inhibit SULT1A3 activity by 70% (Nishimuta et al., 2007). SULT1A3 is extensively expressed in the human intestinal tract (Chen et al., 2003). Therefore, ingestion of high amount of flavonoids, as well as the use of dietary supplements containing high amounts of these compounds may become clinically significant.

Moreover, high concentrations of these flavonoids could affect the absorption of therapeutic agents that undergo extensive pre-systemic sulfoconjugation, such as oral β2 agonists (Nagai et al., 2009). For example, significant part of orally administered ritodrine (β2 agonist) was shown to be eliminated by intestinal first pass sulfation, and studies showed that ingestion of grapefruit (rich in flavonoids) concomitantly with oral administration of ritodrine could inhibit the sulfating activity of SULT1A3 that resulted

137

in adverse drug reaction (Nishimuta et al., 2007). Hesperetin and catechin represent two different types of naturally occurring flavonoids: flavanone and flavanol, respectively.

Hesperetin (flavanones) is found at high concentrations in citrus fruits such as lemon, orange, lime, and grapefruit (Justesen et al., 1998; Kim et al., 2001; Gardana et al., 2007), while catechin (flavanols) represents the major constituent of green tea, grape seeds, chocolate, red wine, motherwort, and other herbs (Torres and Bobet, 2001; Mateus et al.,

2002; Fisher et al., 2003). Based on that, we hypothesized that the naturally occurring flavonoids, hesperetin and catechin, could further suppress the sulfating activity of the recombinant human SULT1A3 allozymes, as well as the wild-type SULT.

7.2.2. Experimental procedure

7.2.2.1. Determination of the half maximal inhibitory concentration (IC50)

Sulfation assays were employed to determine the specific enzymatic activity for the wild-type SULT1A3 using PAP[35S] as a sulfate donor toward one concentration of

DA and different concentrations of the inhibitor (hesperetin or catechin), 0, 1, 10, 50,

100, 250, 500, 750, and 1000 µM for hesperetin, and 0, 5, 10, 25, 50, 75, 100, 250, 500,

750, and 1000 µM for catechin. The reaction was performed at pH 7.4 and allowed to proceed at 37Cº for 10 min, followed by TLC. Post completion of TLC, autoradiography was performed using an X-ray film to locate the spot position of the sulfated. The spot then cut out and the sulfated product therein was eluted for quantitative measurement using liquid scintillation counter. The outcomes were obtained as cpm and were used to

138

calculate the specific activity in the unit of nmol of sulfated DA/min/mg of enzyme. Data were analyzed based on the non-linear regression of the log(inhibitor) versus response to determine the IC50 for both, hesperetin and catechin. GraphPad Prism 7 software was used in data analysis.

7.2.2.2. Analyzing SULT1A3 allozymes activity toward dopamine with the inhibitors

Post IC50 determinations with the wild-type enzyme, the sulfation assays were performed on the twelve SULT1A3 allozymes toward DA using the determined IC50 concentrations of each inhibitor. The obtained results in cpm were used to calculate the specific activities of all allozymes. Specific activity differences between allozymes versus wild type enzyme were analyzed using One-way ANOVA, followed by Dunnett’s multiple comparison test as post-hoc test., and asignificance level of p > 0.05 was used

GraphPad Prism 7 software was utilized in data analysis.

7.2.3. Results and discussion

7.2.3.1. IC50s of hesperetin and catechin with SULT1A3

As shown in Figure 7-2, the specific activity of the wild-type SULT1A3 toward

DA gradually decreased with increases in the concentration of the inhibitors (Hesperetin

139

or catechin), until it reached a constant inhibitory level. The identified IC50 of hesperetin and catechin were 21.92 and 81.35 µM, respectively.

Figure 7-2. Inhibition of the SULT1A3 catalyzed sulfation of dopamine by hesperetin (A) and catechin (B). Results of specific activity represent the mean ± standard deviation determined from three independent reactions (n=6).

140

Although the mean plasma concentration was shown to rarely exceed 1 µM after ingestion of flavonoid rich food or drink (Scalbert and Williamson, 2000; Yang et al.,

1998), the concentrations of various flavonoids can reach higher levels, up to millimolar range in human intestinal and faecal water with very high individual variations (Salucci et al., 2002; Jenner et al., 2005). Consequently, it seems that the level(s) of hesperetin and/catechin in the gastro-intestinal tract could greatly exceed their IC50 values, as determined with SULT1A3 wild-type enzyme. Studies showed hesperetin as a potent inhibitor of the human purified SULT1A3, as well as SULT1A1, SULT1E1, and

SULT2A1. Furthermore, catechin was also shown to exhibit inhibitory effect on

SULT1A3 and SULT1A1, but not SUL1E1 and SULT2A1 (Huang et al., 2009). In addition, studies have correlated the sulfation efficacy and potency of inhibition of hesperetin, catechin, and other dietary flavonoids with their C-ring structure, suggesting that these compounds may play a role in regulating human SULT activity.

Therefore, the sulfation of these dietary flavonoids could affect regulation of endogenous substrates (such as hormones and neurotransmitters), detoxification of therapeutic agents, and the bioactivation of procarcinogens and promutagens (Huang et al., 2009).

7.2.3.2. SULT1A3 allozymes activity toward DA with hesperetin and catechin as inhibitors

With 0.5 µM DA and 21.92 µM hesperetin. Specific activity data (cf. Figure 7-3) revealed that the wild-type enzyme treated with hesperetin has retained 72.6% of its DA-

141

sulfating activity in comparison to that without inhibitor. Moreover, all SULT1A3 allozymes showed lower DA-sulfating activity than that without hesperetin. Of these allozymes, SULT1A3-S8P allozyme activity has dropped to 50 % after the use of inhibitor, while the activity of four other allozymes, SULT1A3-R9C, SULT1A3-P10L,

SULT1A3-V15M, and SULT1A3-P101L, decreased by about one third with the use of inhibitor.

Figure 7-3. Dopamine sulfation by SULT1A3 allozymes with hesperetin as inhibitor. Concentrations of hesperetin and DA were 21.92 and 1 µM, respectively. Results represent mean ± standard deviation determined from three independent reactions (n=6). One-way ANOVA (Dunnett test) was performed to compare the activity of each allozyme versus the wild-type with hesperetin as inhibitor. WT, refers to wild-type SULT1A3. 1 (p < 0.05). 2 (p < 0.01). 3 (p < 0.001). 4 (p < 0.0001).

142

After performing Dunnett’s test to compare between each allozyme with the wild-type and 21.92 µM hesperetin (IC50), five allozymes namely, SULT1A3-T7P, SULT1A3-

S8P, SULT1A3-V15M, SULT1A3-V18F, and SULT1A3-P101L, demonstrated similar

DA-sulfating activity to that of the wild-type, and seven allozymes showed significantly lower activity than the wild-type enzyme. Among those seven allozymes, SULT1A3-

R9C and SULT1A3-P10L displayed significantly lower activity (p < 0.05) while the other allozymes exhibited much lower sulfating activity and more significant changes at p

< 0.01 (SULT1A3-P101H), p < 0.001 (SULT1A3-R144C, SULT1A3-K234N, and

SULT1A3-S290T), and p < 0.0001 (SULT1A3-N235T). Interestingly, SULT1A3-

N235T exhibited only 18.3% of the wild-type activity toward DA at p < 0.0001.

With 5 µM DA and 81.35 µM catechin. All SULT1A3 allozymes (including wild-type enzyme) showed lower DA-sulfating activity than that without inhibitor (cf. Figure 7-4).

It appears that catechin reduced the sulfating activity of the wild-type enzyme toward DA to 68 %, but the inhibitory effect of catechin on SULT1A3 allozymes was higher. For example, the activities of six allozymes, SULT1A3-R9C, SULT1A3-V15M, SULT1A3-

P101L, SULT1A3-P101H, SULT1A3-R144C, and SULT1A3-S290T declined to half, while two other allozymes, SULT1A3-S8P and SULT1A3-N235T, showed much lower sulfating activity of 35.5 % and 14.1 %, respectively, than that without inhibitor. With the One-way ANOVA-Dunnett’s test, seven allozymes, SULT1A3-T7P, SULT1A3-R9C,

SULT1A3-P10L, SULT1A3-V15M, SULT1A3-V18F, SULT1A3-P101L, and

SULT1A3-S290T, showed similar activity to that of the wild-type toward DA. In contrast, the DA-sulfating activities of the five other allozymes, SULT1A3-S8P, 143

SULT1A3-P101H, SULT1A3-R144C, SULT1A3-K234N, and SULT1A3-N235T, were significantly lower than that of the wild-type (p < 0.0001). Among these five,

SULT1A3-N235T allozyme exhibited only 8.7% of the wild-type activity toward DA with the IC50 of catechin. These findings further support the suggestion that the investigated flavonoids, hesperetin and catechin, can act as substrates and inhibitors for the human SULT1A3. In addition, the results of this study demonstrated the considerable inhibitory effects of hesperetin and catechin, on the mutant SULT1A3 allozymes.

Figure 7-4. Dopamine sulfation by SULT1A3 allozymes with catechin as inhibitor. Concentrations of catechin and DA were 81.35 and 5 µM, respectively. Results represent mean ± standard deviation determined from three independent reactions (n=6). One-way ANOVA (Dunnett’s test) was performed to compare the activity of each allozyme versus the wild-type with catechin as inhibitor. WT, refers to wild-type SULT1A3. 1 (p < 0.05). 2 (p < 0.01). 4 (p < 0.0001).

144

Consequently, ingestion of hesperetin and/or catechin rich food or beverages could lower the sulfating activity of the SULT1A3 wild-type, as well as the mutant allozymes toward endogenous substrates and xenobiotics including drugs. This may also indicate that these inhibitors may affect the physiological levels of endogenous substrates

(such as neurotransmitters and hormones) and the bioavailability of the drugs as well as the detoxification of toxins and carcinogens that are sulfoconjugated by SULT1A3.

Several studies have shown that some individuals express elevated plasma levels of catecholamines after ingestion of SULT1A inhibitors (Bamforth et al., 1993;

Coughtrie and Johnston, 2001; Eagle, 2012). These individuals were described as susceptible patients and proposed to have genetic variations that lead to low activity of the SULT1A phenotypes. It was concluded that SULT1A inhibition could have serious pathophysiological consequences such as changes in blood pressure, migraine headaches, arrhythmias and type 2 diabetes as a result of preventing normal catecholamine sulfoconjugation (Eagle, 2012). Recent studies also highlighted the association between ingestion of SULT1A inhibitors and symptoms of Attention-Deficit Hyperactivity

Disorder (ADHD), where SULT1A inhibition was proposed to increase the level of DA not only in plasma, but also in brain through DA inhibition of intestinal tyrosine hydroxylase (Eagle, 2014). Among SULT1A subfamily members, SULT1A3 was already demonstrated as the major enzyme in charge of catecholamine (especially DA) sulfation in humans (Reiter et al., 1983; Dooley, 1998). Moreover, SULT1A subfamily members, including SULT1A3, were described as a gut-blood barrier because of their capability to protect human from ingested catecholamines and xenobiotics including carcinogens (Eisenhofer et al., 1999). Based on that, individuals with genetic

145

polymorphism of SULT1A3 may therefore be more susceptible to side, toxic, or carcinogenic effects after exposure to xenobiotics that are sulfoconjugated by this enzyme. The SULT1A3 mediated sulfation of exogenous substrates was shown to be inhibited by naturally occurring flavonoids such as catechin. Indeed, studies revealed that the sulfation of ritodrine, β2 agonist, by SULT1A3 was inhibited by green and black tea infusions that contain mainly catechins (Hara et al., 1995; Lee et al., 1995). Green and black tea displayed potent inhibitory effect, up to 95% on SULT1A3 even at a concentration of 5%. Consequently, the bioavailability of drugs that are sulfated by intestinal SULT1A3 may increase leading to serious side effects (Nishimuta et al., 2005).

146

Chapter 8

Summary of Results and Conclusions

In this study, we have generated, expressed, and purified twelve of the thirteen known human cytosolic SULT1A3 allozymes that have missense cSNPs. Enzymatic characterization of the purified SULT1A3 allozymes revealed differential (lower and higher) specific activity, substrate binding affinity and catalytic activity toward the endogenous compounds tested as substrates, including DA, EP, NE, and 5-HT. Among the twelve allozymes, one allozyme, SULT1A3-N235T, showed the lowest sulfating activity with all aforementioned substrates. These findings may have implications in the differential biotransformation of monoamine neurotransmitters in individuals with distinct SULT1A3/SULT1A4 genotypes that code for different SULT1A3 allozymes.

Furthermore, and pending further studies, the results obtained may provide useful information as to the association of particular SULT1A3/SULT1A4 genotypes with certain neuropathological disorders that are associated with abnormal levels of these monoamines.

In addition, the current study also aimed to collect information concerning the implication of missense cSNPs on the sulfating activity of SULT1A3 toward several therapeutic agents that act as substrates for this enzyme. The analyzed compounds were

147

four analgesic agents (APAP, morphine, tapentadol, and O-DMT) and two sympathomimetic drugs (phenylephrine and salbutamol). Both the specific activity and kinetic data obtained showed clearly the differential sulfating activities of the twelve

SULT1A3 allozymes toward these substrates. Based on the results obtained, two allozymes, SULT1A3-P101H and SULT1A3-235T, exhibited remarkably the highest and lowest sulfating activity towards these analgesics, reapectively. These results may highlight the differential capacity in sulfating these analgesic and adrenergic compounds in different individuals. Pending further studies, such information may in the future aid in designing personalized regimens of these drugs to optimize their therapeutic efficacy and minimize the side effects for individuals with distinct SULT1A3/SULT1A4 genotypes.

The activities of the human SULT1A3 allozymes were further investigated with the presence of two inhibitory compounds: hesperetin and catechin, toward the standard endogenous substrate, DA. The results of this study have demonstrated considerable inhibitory effect of the compounds on the mutant SULT1A3 allozymes. Consequently, ingestion of hesperetin and/or catechin rich food or beverages could further lower the sulfating activity of the human SULT1A3 allozymes, as well as the wild-type toward endogenous substrates and xenobiotics including drugs. These also Indicate that these inhibitors may affect the normal physiological levels of endogenous substrates, such as neurotransmitters and hormones, and the bioavailability of the therapeutic agents as well as the detoxification of toxins and carcinogens that are sulfated by SULT1A3. Finally, individuals with genetic polymorphism of SULT1A3 may therefore be more vulnerable to certain neuropathological disorders associated with abnormal levels of these

148

monoamines. Additionally, those individuals could be more susceptible to the side, toxic, or carcinogenic effects after exposure to xenobiotics inactivated by SULT1A3 enzyme.

149

Chapter 9

References

References of chapter 1

Adjei A.A., Thomae B.A., Prondzinski J.L., Eckloff B.W., Wieben E.D., Weinshilboum R.M. Human estrogen sulfotransferase (SULT1E1) pharmacogenomics: gene resequencing and functional genomics. Br J Pharmacol 2003; 139:1373-1382. Aksoy I. A., Wood T. C., Weinshilboum R. Human liver estrogen sulfotransferase: Identiﬁcation by cDNA cloning and expression. Biochem Biophys Res Commun. 1994; 200:1621–1629. Aksoy I.A., Weinshilboum R.M. Human thermolabile phenol sulfotransferase gene (STM): molecular cloning and structural characterization. Biochem Biophys Res Commun 1995; 208:786-795. Alberti A., Pirrone P., Elia M., Waring R.H., Romano C. Sulphation deficit in ‘low functioning’ autistic children: a pilot study. Biol Psychiatry 1999; 46:420-424. Al-Yafee Y.A., Al-Ayadhi L.Y., Haq S.H., El-Ansary A.K. Novel metabolic biomarkers related to sulfur-dependent detoxification pathways in autistic patients of Saudi Arabia. BMC Neurol 2011; 11:139. Arlt V.M., Stiborova M., Henderson C.J., Osborne M.R., Bieler C.A., Frei E., Martinek V., Sopko B., Wolf C.R., Schmeiser H.H., Phillips D.H. Environmental pollutant and potent mutagen 3-nitrobenzanthrone forms DNA adducts after reduction by NAD(P)H:quinone oxidoreductase and conjugation by acetyltransferases and sulfotransferases in human hepatic cytosols. Cancer Res 2005; 65:2644-2652. Bairam A.F., Rasool M.I., Kurogi K., Liu M.C. On the Molecular Basis Underlying the Metabolism of Tapentadol Through Sulfation. Eur J Drug Metab Pharmacokinet 2017; 42:793-800.

150

Baumann E. Ueber Sulfosäuren im Harn. Berichte der deutschen chemischen Gesellschaft 1876; 9:54-58. Bergner E.A., Shapiro L.J. Increased cholesterol sulfate in plasma and red blood cell membranes of steroid sulfatase deficient patients. J Clin Endocrinol Metab 1981; 1:221-223. Blake M.J., Castro L., Leeder J.S., Kearns G.L. Ontogeny of drug metabolizing enzymes in the neonate. Semin Fetal Neonatal Med 2005; 10:123-38. Blanchard R.L., Freimuth R.R., Buck J., Weinshilboum R.M., Coughtrie M.W. A proposed nomenclature system for the cytosolic sulfotransferase (SULT) superfamily. Pharmacogenetics 2004: 14:199-211. Borque Á., del Amo J., Esteban L.M., Ars E., Hernández C., Planas J., Arruza A., Llarena R., Palou J., Herranz F., Raventós C.X., Tejedor D., Artieda M., Simon L., Martínez A., Carceller E., Suárez M., Allué M., Sanz G., Morote J. Genetic predisposition to early recurrence in clinically localized prostate cancer. BJU Int 2013; 4:549-558. Brinkmann U., Eichelbaum M. Polymorphisms in the ABC drug transporter gene MDRI. Pharmacogenomics J 2001; 1:59- 64. Carlini E.J., Raftogianis R.B., Wood T.C., Jin F., Zheng W., Rebbeck T.R., Weinshilboum R.M. Sulfation pharmacogenetics: SULT1A1 and SULT1A2 allele frequencies in Caucasian, Chinese and African-American subjects. Pharmacogenetics 2001; 11:57-68. Chapman E., Best MD, Hanson SR, Wong CH. Sulfotransferases: structure, mechanism, biological activity, inhibition, and synthetic utility. Angew Chem Int Ed Engl 2004; 43:3526-3548. Coleman M.D. Human drug metabolism: an introduction. Chichester, John Wiley 2005. Coughtrie M.W., Johnston L.E. Interactions between dietary chemicals and human sulfotransferases-molecular mechanisms and clinical significance. Drug Metab Dispos 2001; 29:522-528. Coughtrie M.W.H., Sharp S., Maxwell K., Innes N.P. Biology and function of the reversible sulfation pathway catalysed by human sulfotransferases and sulfatases. Chem Biol Interact 1998; 109:3-27. Daniels J., Kadlubar S. Sulfotransferase genetic variation: from cancer risk to treatment response. Drug Metab Rev 2013; 45:415-422. Dasaradhi L., Shibutani S. Identification of tamoxifen-DNA adducts formed by alpha- sulfate tamoxifen and alpha-acetoxytamoxifen. Chem Res Toxicol 1997; 10: 189-196.

151

Dong D., Ako R., Wu B. Crystal structures of human sulfotransferases: insights into the mechanisms of action and substrate selectivity. Expert Opin Drug Metab Toxicol 2012; 6:635-646. Dongning H., Meloche C.A., Dumas N.A., Frost A.R., Falany C.N. Different subcellular localization of sulphotransferase 2B1b in human placenta and prostate. Biochemical Journal 2004; 379:533-540. Dooley P.T. Cloning of the human phenol sulfotransferase gene family: three genes implicated in the metabolism of catecholamines, thyroid hormones and drugs Author links open overlay panel. Chem Biol Interact 1998; 109:29-41. Dooley T.P., Mitchison H.M., Munroe P.B., Probst P., Neal M., Siciliano M.J. Mapping of two phenol sulphotransferase genes, STP and STM, to 16p: candidate genes for Batten disease. Biochem Biophys Res Commun 1994; 1:482-489. Dousa M.K., Tyce G.M. Free and conjugated plasma catecholamines, DOPA and 3-O- methyldopa in humans and in various animal species. Proc Soc Exp Biol Med 1988; 188:427-434. Dumas I., Diorio C. Estrogen pathway polymorphisms and mammographic density. Anticancer Res 2011; 31:4369-4386. Eagle K. Toxicological effects of red wine, orange juice, and other dietary SULT1A inhibitors via excess catecholamines. Food Chem Toxicol 2012; 50:2243-2249. Eagle K. ADHD impacted by sulfotransferase (SULT1A) inhibition from artificial food colors and plant-based foods. Physiol Behav 2014; 135:174-179. Ellingjord-Dale M., Lee E., Couto E., Ozhand A., Qureshi S., Hofvind S., Van Den Berg D.J., Akslen L.A., Grotmol T., Ursin G. Polymorphisms in hormone metabolism and growth factor genes and mammographic density in Norwegian postmenopausal hormone therapy users and non-users. Breast Cancer Res 2012; 14: R135. Engelke C.E., Meinl W., Boeing H., Glatt H. Association between functional genetic polymorphisms of human sulfotransferases 1A1 and1A2. Pharmacogenetics 2000; 10:163-169. Evans W.E., Relling M.V. Pharmacogenomics: translating functional genomics into rational therapeutics. Science 1999; 5439:487-491. Falany C., Roth J.A. Properties of human cytosolic sulfotransferases involved in drug metabolism. In: Human Drug Metabolism; From Molecular Biology to Man. Jeffery E.H. (ed.). Florida, CRC Press 1993; p. 101-115. Falany CN, He D., Dumas N., Frost A.R., Falany J.L. Human cytosolic sulfotransferase 2B1: isoform expression, tissue specificity and subcellular localization. J Steroid Biochem Mol Biol 2006; 102:214-221.

152

Falany C.N., Vazquez M.E., Kalb J.M. Purification and characterization of human liver dehydroepiandrosterone sulphotransferase. Biochem J 1989; 260:641-646. Falany C.N., Xie X., Wang J., Ferrer J., Falany J.L. Molecular cloning and expression of novel sulphotransferase-like cDNAs from human and rat brain. Biochem J 2000; 346:857-864. Falany C.N., Krasnykh V., Falany J.L. Bacterial expression and characterization of a cDNA for human liver estrogen sulfotransferase. J Steroid Biochem Mol Biol 1995; 52:529-39. Falany J.L., Falany C.N. Regulation of estrogen activity by sulfation in human MCF-7 breast cancer cells. Oncol Res 1997; 9;589-596. Falany C.N. Enzymology of human cytosolic SULTs. FASEB J 1997; 11:206-216. Figueroa J.D., Malats N., García-Closas M., Real F.X., Silverman D., Kogevinas M., Chanock S., Welch R., Dosemeci M., Lan Q., Tardón A., Serra C., Carrato A., García-Closas R., Castaño-Vinyals G., Rothman N. Bladder cancer risk and genetic variation in AKR1C3 and other metabolizing genes. Carcinogenesis. 2008; 29:1955- 1962. Freimuth R.R., Raftogianis R.B., Wood T.C., Moon E., Kim U.J., Xu J., et al. Human sulfotransferases SULT1C1 and SULT1C2: cDNA characterization, gene cloning, and chromosomal localization. Genomics 2000; 2:157-165. Freimuth R.R., Wiepert M., Chute C.G., Wieben E.D., Weinshilboum R.M. Human cytosolic sulfotransferase database mining: identification of seven novel genes and pseudogenes. Pharmacogenomics J 2004; 4:54-65. Fuda H., Lee Y.C., Shimizu C., Javitt N.B., Strott C.A. Mutational analysis of human hydroxysteroid sulfotransferase SULT2B1 isoforms reveals that exon 1B of the SULT2B1 gene produces cholesterol sulfotransferase, whereas exon 1A yields pregnenolone sulfotransferase. J Biol Chem 2002; 277:36161-36166. Fujita K., Nagata K., Ozawa S., Sasano H., Yamazoe Y. Molecular cloning and characterization of rat ST1B1 and human ST1B2 cDNAs, encoding thyroid hormone sulfotransferases. J Biochem 1997; 122:1052-1061. Gamage N., Barnett A., Hempel N., Duggleby R.G., Windmill K.F., Martin J.L., et al. Human sulfotransferases and their role in chemical metabolism. Toxicol Sci 2006; 90:5-22. Geese W., Raftogianis R. Biochemical characterization and tissue distribution of human SULT2B1. Biochem Biophys Res Commun 2001; 288:280-289. Ginsberg G., Guyton K., Johns D., Schimek J., Angle K., Sonawane B. Genetic polymorphism in metabolism and host defense enzymes: implications for human health risk assessment. Crit Rev Toxicol 2010; 40:575-619. 153

Glatt H., Boeing H., Engelke C.E., Ma L., Kuhlow A., Pabel U., Pomplun D., Teubner W., Meinl W. Human cytosolic sulphotransferases: genetics, characteristics, toxicological aspects. Mutat Res 2001; 482:27-40. Goldstein D.S., Swoboda K.J., Miles J.M., Coppack S.W., Aneman A., Holmes C., et al. Sources and physiological significance of plasma dopamine sulfate. J Clin Endocrinol Metab 1999; 7:2523-2531. Gonzalez FJ, Coughtrie M, Tukey RH. Drug Metabolism. In: Chabner B.A., Brunton L.L., Knollmann B.C. (eds.), Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12nd ed. New York, McGraw-Hill 2011; p. 2084. Gonzales F.J., Tukey R.H. Drug metabolism. In: Brunton L.L., Lazo J.S., Parker K.L. (Eds.), Goodman and Gilman’s the Pharmacological Basis of Therapeutics. New York. McGraw-Hill, 2005. Guenthner T.M., Qato M., Whalen R., Glomb S. Similarities between catalase and cytosolic epoxide hydrolase. Drug Metab Rev 1989; 20:733-748. Gupta S., Kulhara P. What is schizophrenia: A neurodevelopmental or neurodegenerative disorder or a combination of both? A critical analysis. Indian J Psychiatry 2010; 52:21-27. Hashiguchi T., Kurogi K., Sakakibara Y., Yamasaki M., Nishiyama K., Yasuda S., et al. Enzymatic sulfation of tocopherols and tocopherol metabolites by human cytosolic sulfotransferases. Biosci Biotechnol Biochem 2011; 10:1951-1956. Her C., Kaur G.P., Athwal R.S., Weinshilboum R.M. Human sulfotransferase SULT1C1: cDNA cloning, tissue-specific expression, and chromosomal localization. Genomics 1997; 3:467-70.

Her C., Wood T.C., Eichler E.E., Mohrenweiser H.W., Ramagli L.S., Siciliano M.J., Weinshilboum R.M. Human hydroxysteroid sulfotransferase SULT2B1: two enzymes encoded by a single chromosome 19 gene. Genomics 1998; 3:284-295. Her C., Szumlanski C., Aksoy I.A., Weinshilboum R.M. Human jejunal estrogen sulfotransferase and dehydroepiandrosterone sulfotransferase Immunochemical characterization of individual variation. Drug Metab Dispos 1996; 24: 1328-1335. Hildebrandt M.A., Salavaggione O.E., Martin Y.N., Flynn H.C., Jalal S., Wieben E.D., Weinshilboum R.M. Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem. Biophys Res Commun 2004; 321:870-878. Hinson J.A., Forkert P.G. Phase II enzymes and bioactivation. Can J PhysioL PharmacoL 1995; 73:1407-1413. Hou M.F., Chen S.T., Chen J.C., Yeh K.T., Lee T.P. Chen C.M., Shih M.C., Lin C.C., Chang J.G. Sulfotransferase 1A2*2 is a risk factor for early-onset breast cancer. Int J Mol Med 2002; 10:609-612.

154

Huang C., Chen Y., Zhou T., Chen G. Sulfation of dietary flavonoids by human sulfotransferases. Xenobiotica 2009; 39:312-322. Hui Y., Liu M.C. Sulfation of ritodrine by the human cytosolic sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J Pharmacol 2015; 5:125- 129. Jaiswal A.K. Jun and Fos regulation of NAD(P)H: quinone oxidoreductase gene expression. Pharmacogenetics 1994; 4:1-10. Javitt N.B., Lee Y.C., Shimizu C., Fuda H., Strott C.A. Cholesterol and hydroxycholesterol sulfotransferases: identification, distinction from dehydroepiandrosterone sulfotransferase, and differential tissue expression. Endocrinology 2001; 142:2978-84. Johnson G.A., Baker C.A., Smith R.T. Radioenzymatic assay of sulfate conjugates of catecholamines and DOPA in plasma. Life Sci 1980; 26:1591-1598. Kerb R., Hoffmeyer S., Brinkmann U. ABC drug transporters: hereditary polymorphisms and pharmacological impact in MDR1, MRP1 and MRP2. Pharmacogenomics 2001; 2:51-64. Kester M.H., Kaptein E., Roest T.J., van Dijk C.H., Tibboel D., Meinl W., Glatt H., Coughtrie M.W., Visser T.J. Characterization of human iodothyronine sulfotransferases. J Clin Endocrinol Metab 1999; 84:1357-1364. Kim K.A., Lee S.Y., Park P.W., Ha J.M., Park J.Y. Genetic polymorphisms and linkage disequilibrium of sulfotransferase SULT1A1 and SULT1A2 in a Korean population: comparison of other ethnic groups. Eur J Clin Pharmacol 2005; 61:743-747. Klaassen C.D., Boles J.W. The importance of 3’-phosphoadenosine 5’- phosphosulfate (PAPS) in the regulation of sulfation. The FASEB J 1997; 11:404-418. Ko K., Kurogi K., Davidson G., Liu M.Y., Sakakibara Y., Suiko M., Liu M.C. Sulfation of ractopamine and salbutamol by the human cytosolic sulfotransferases. J Biochem 2012; 152:275-283. Kong A.N., Yang L., Ma M., Tao D., Bjornsson T.D. Molecular cloning of the alcohol/hydroxysteroid form (hSTa) of sulfotransferase from human liver. Biochem Biophys Res Commun 1992; 1:448-454. Kotov A., Falany J.L., Wang J., Falany C.N. Regulation of estrogen activity by sulfation in human Ishikawa endometrial adenocarcinoma cells. J Steroid Biochem Mol Biol 1999; 137-144. Kurogi K., Chen M., Lee Y., Shi1 B., Yan T. and Liu M. Sulfation of buprenorphine, pentazocine, and naloxone by human cytosolic sulfotransferases. Drug Metab Lett 2012; 6:109-115.

155

Kurogi K., Chepak A., Hanrahan M., Liu M.Y., Sakakibara Y., Suiko M., Liu M.C. Sulfation of opioid drugs by human cytosolic sulfotransferases: Metabolic labeling study and enzymatic analysis. Eur J Pharm Sci 2014; 62:40-48. Kurogi K., Shimohira T., Kouriki-Nagatomo H., Zhang G., Miller E.R., Sakakibara Y., Suiko M., Liu M.C. Human Cytosolic Sulphotransferase SULT1C3: genomic analysis and functional characterization of splice variant SULT1C3a and SULT1C3d. J Biochem 2017; 162:403-414. Labrie F., Bélanger A., Luu-The V., Labrie C., Simard J., Cusan L., Gomez J.L., Candas B. DHEA and the intracrine formation of androgens and estrogens in peripheral target tissues: its role during aging. Steroids 1998; 63:322-328. Lindsay J., Wang L.L., Li Y., Zhou S.F. Structure, function and polymorphism of human cytosolic sulfotransferases. Curr Drug Metab 2008; 9:99-105. Lozda R., Purviņš I. The serotonin-O-sulfate as a potential plasma surrogate biomarker. Neurotransmitter 2014; 1:e281. Liu L., Klaassen C.D. Different mechanism of saturation of acetaminophen sulfate conjugation in mice and rats. Toxicol Appl Pharmacol 1996; 139:128-134. Lu J., Li H., Zhang J., Li M., Liu M.Y., An X., Liu M.C., Chang W. Crystal structures of SULT1A2 and SULT1A1*3: insights into the substrate inhibition and the role of Tyr149 in SULT1A2. Biochem Biophys Res Commun 2010; 396:429-434. Lu J.H., Li H.T., Liu M.C., Zhang J.P., Li M., An X.M. Chang W.R. Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'- phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun 2005; 335:417-423. Lu X., Jiang K., Han L., Zhang M., Zhou Y., Ma Y., Zhou Y., Meng S. Sulfonation of curcuminoids: characterization and contribution of individual SULT enzymes. Mol Nutr Food Res 2015; 59:634-645. Mackenzie P.I., Owens I.S., Burchell B., Bock K.W., Bairoch A., Belanger A., FourneI- Gigleux S., Green M., Hum D.W., lyanagi T., Lancet D., Louisot P., Magdalou J., Chowdhury J.R., Ritter J.K., Schachter H., Tephly T.R. Tipton K.F., Nebert D.W. The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 1997; 7:255-269. Meng S., Wu B., Singh R., Yin T., Morrow J.K., Zhang S., Hu M. SULT1A3-mediated regiospecific 7-O-sulfation of flavonoids in Caco-2 cells can be explained by the relevant molecular docking studies. Mol Pharm 2012; 9:862-873. Mercer K.E., Apostolov E.O., Gamboa da Costa G., Yu X., Lang P., Roberts D.W., Davis W., Basnakian A.G., Kadlubar F.F., Kadlubar S.A. Expression of sulfotransferase isoform 1A1 (SULT1A1) in breast cancer cells significantly increases 4- hydroxytamoxifen-induced apoptosis. Int J Mol Epidemiol Genet 2010; 1:92-103.

156

Moscow J.A., Dixon K.H. Glutathione-related enzymes, glutathione and multidrug resistance. Cytotechnology 1993; 12:155-170. Mulder G.J. Conjugation reactions in drug metabolism. London, Taylor & Francis 1989. Nash A.R., Glenn W.K., Moore S.S., Kerr J., Thompson A.R., Thompson E.O. Oestrogen sulfotransferase: Molecular cloning and sequencing of cDNA for the bovine placental enzyme. Aust J Biol Sci 1988; 41:507-516. Nowell S., Falany C.N. Pharmacogenetics and human cytosolic sulfotransferases. Oncogene 2006; 25:1673-1678. O’Reilly B.A., Waring R.H. Enzyme and sulphur oxidation deficiencies in autistic children with known food/chemical intolerances. J Orthomol Med 1993; 8:198-200. Otterness D.M., Wieben E.D., Wood T.C., Watson W.G., Madden B.J., McCormick D.J., et al. Human liver dehydroepiandrosterone sulfotransferase: molecular cloning and expression of cDNA. Mol Pharmacol 1992; 5:865-872. Ozawa S., Tang Y.M., Yamazoe Y., Kato R., Lang N.P., Kadlubar F.F. Genetic polymorphisms in human liver phenol sulfotransferases involved in the bioactivation of N-hydroxy derivatives of carcinogenic arylamines and heterocyclic amines. Chem Biol Interact 1998; 109:237-248. Pettersen E.F., Goddard T.D., Huang C.C., Couch G.S., Greenblatt D.M. and Meng E.C. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 2004; 25:1605-1612. Raftogianis R.B., Wood T.C., Otterness D.M., Van Loon J.A., Weinshilboum R.M. Phenol sulfotransferase pharmacogenetics in humans: association of common SULT1A1 alleles with TS PST phenotype. Biochem Biophys Res Commun 1997; 239:298-304. Rasool M.I., Bairam A.F., Kurogi K., Liu M.C. On the sulfation of O-desmethyltramadol by human cytosolic sulfotransferases. Pharmacol Rep 2017; 69:953-958. Reding K.W., Chen C., Lowe K., Doody D.R., Carlson C.S., Chen C.T., Houck J., Weiss L.K., Marchbanks P.A., Bernstein L., Spirtas R., McDonald J.A., Strom B.L., Burkman R.T., Simon M.S., Liff J.M., Daling J.R., Malone K.E. Estrogen-related genes and their contribution to racial differences in breast cancer risk. Cancer Causes Control 2012; 23:671-681. Reiter C., Mwaluko G., Dunnette J., Van Loon J. and Weinshilboum R. Thermolabile and thermostable human platelet phenol sulfotransferase. Substrate specificity and physical separation. Naunyn Schmiedebergs Arch Pharmacol 1983; 324:140-147. Reiter C., Weinshilboum R.M. Acetaminophen and phenol: substrates for both a thermostable and a thermolabile form of human platelet phenol sulfotransferase. J Pharmacol Exp Ther 1982; 221:43-51.

157

Richard K., Hume R., Kaptein E., Stanley E.L., Visser T.J., Coughtrie M.W. Sulfation of thyroid hormone and dopamine during human development: ontogeny of phenol sulfotransferases and arylsulfatase in liver, lung, and brain. J Clin Endocrinol Metab 2001; 86:2734-2742. Rubin G.L., Sharp S., Jones A.L., Glatt H., Mills J.A., Coughtrie M.W. Design, production and characterization of antibodies discriminating between the phenol- and monoamine-sulphating forms of human phenol sulphotransferase. Xenobiotica 1996; 26: 1113-1119. Sakakibara Y., Takami Y., Zwieb C., Naakayama T., Suiko M., Nakajima H., Liu M.C. Puriﬁcation, characterization, and molecular cloningofa novel ratliver dopa/tyrosinesulfotransferase. J Biol Chem 1995; 270:30470-30478. Sakakibara Y., Yanagisawa K., Katafuchi J., Ringer D.P., Takami Y., Nakayama T., Suiko M., Liu M.C. Molecular cloning, expression, and characterization of novel human SULT1C sulfotransferases that catalyze the sulfonation of N-hydroxy-2- acetylaminofluorene. J Biol Chem 1998; 51:33929-33935. (a) Sakakibara Y., Yanagisawa K., Takami Y., Nakayama T., Suiko M., Liu M.C. Molecular cloning, expression, and functional characterization of novel mouse sulfotransferases. Biochem Biophys Res Commun 1998; 247:681-686. (b) Sandyk R. Serotonergic mechanisms in amyotrophic lateral sclerosis. Int J Neurosci 2006; 116:775-826. Shah I.A., Bhat G.A., Mehta P., Lone M.M., Dar N.A. Genotypes of CYP1A1, SULT1A1 and SULT1A2 and risk of squamous cell carcinoma of esophagus: outcome of a case-control study from Kashmir, India. Dis Esophagus 2016; 29:937- 943. Shattock P., Whiteley P. Biochemical aspects in autism spectrum disorders: updating the opioid-excess theory and presenting new opportunities for intervention. Expert Opin Ther Targets 2002; 6:175-183. Shimizu C., Fuda H., Yanai H., Strott C.A. Conservation of the hydroxysteroid sulfotransferase SULT2B1 gene structure in the mouse: pre- and postnatal expression, kinetic analysis of isoforms, and comparison with prototypical SULT2A1. Endocrinology 2003; 144:1186-1193. Sidharthan N.P., Minchin R.F., Butcher N.J. Cytosolic sulfotransferase 1A3 is induced by dopamine and protects neuronal cells from dopamine toxicity: role of D1 receptor- NMDA receptor coupling. J Biol Chem 2013; 288:34364-34374. Stanley E.L., Hume R., Coughtrie M.W.H. Expression profiling of human fetal cytosolic sulfotransferases involved in steroid and thyroid hormone metabolism and in detoxification. Mol Cell Endocrinol 2005; 240:32-42.

158

Thomae B.A., Rifki O.F., Theobald M.A., Eckloff B.W., Wieben E.D., Weinshilboum R.M. Human catecholamine sulfotransferase (SULT1A3) pharmacogenetics: functional genetic polymorphism. J Neurochem 2003; 87:809-819. Tirona R.G, Kim R.B. Pharmacogenomics of organic anion-transporting polypeptides (OATP). Adv Drug Deriv Rev 2002; 54:1343-1352. Ungless M.A., Grace A. A. Are you or aren't you? Challenges associated with physiologically identifying dopamine neurons. Trends Neurosci 2012; 35:422-430. Vatsis K.P., Weber W.W., Bell D.A., Dupret J.M., Evans D.A., Grant D.M., Hein D.W., Lin H.J., Meyer U.A., Relling M.V. et al. Nomenclature for N-acetyltransferases. Pharmacogenetics 1995; 5:1-17. Walther S., Dunbrack R., Raftogianis R. Cloning, expression and characterization of a human sulfotransferase, SULT4A1, that represents a novel SULT family. ISSX Proc. 1999; 15:195 Wang Z., Fu Y., Tang C., Lu S., Chu W.M. SULT1A1 R213H polymorphism and breast cancer risk: a meta-analysis based on 8454 cases and 11800 controls. Breast Cancer Res Treat 2010; 122:193-198. Weinshilboum R., Otterness D. Sulfotransferase enzymes, in Conjugation-Deconjugation Reactions. In: Drug Metabolism and Toxicity. Kaufmann F.C. (ed.). Berline, Springer-Verlag, 1994; pp. 45-78. Weinshilboum R.M., Otterness D.M., Aksoy I.A., Wood T.C., Her C., Raftogianis R.B. Sulfation and sulfotransferases 1: Sulfotransferase molecular biology: cDNAs and genes. FASEB J 1997; 11:3-14. Wilborn T.W., Comer K.A., Dooley T.P., Reardon I.M., Heinrikson R.L., Falany C.N. Sequence analysis and expression of the cDNA for the phenol-sulfating form of human liver phenol sulfotransferase. Mol Pharmacol 1993; 1:70-77. Wilkinson G.R. Drug metabolism and variability among patients in drug response. N Engl J Med 2005; 352:2211-2221. Wu J., Xiao H., Sun H., Zou L., Zhu L.Q. Role of dopamine receptors in ADHD: a systematic meta-analysis. Mol. Neurobiol 2012; 45:605-620. Yamamoto A., Kim J., Liu M.Y., Kurogi K., Sakakibara Y., Suiko M., Liu M.C. Sulfation of Phenylephrine by the Human Cytosolic Sulfotransferases. Drug Metab Lett 2014; 8:96-100. Zhang L., Huang M., Blair I.A., Penning T.M. Detoxication of benzo[a]pyrene-7,8-dione by sulfotransferases (SULTs) in human lung cells. J Biol Chem 2012; 287:29909- 29920.

159

Zheng L., Wang Y., Schabath M.B., Grossman H.B., Wu X. Sulfotransferase 1A1 (SULT1A1) polymorphism and bladder cancer risk: a case-control study. Cancer Lett 2003; 202:61-69. Zhu X., Veronese M.E., Bernard C.C., Sansom L.N., McManus M.E. Identification of two human brain aryl sulfotransferase cDNAs. Biochem Biophys Res Commun 1993; 1:120-127. Zhu X., Veronese M.E., Iocco P., McManus M.E. cDNA cloning and expression of a new form of human aryl sulfotransferase. Int J Biochem Cell Biol 1996; 28:565-571.

References of chapter 2

Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 7:248- 254.

Hildebrandt M.A., Salavaggione O.E., Martin Y.N., Flynn H.C., Jalal S., Wieben E.D., Weinshilboum R.M. Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem. Biophys Res Commun 2004; 321:870-878.

Hui Y., Liu M.C. Sulfation of ritodrine by the human cytosolic sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J Pharmacol 2015; 5:125- 129.

Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970; 15:680-685.

Sanger F., Nicklen S., Coulson A.R. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977; 74:5463-5467.

Shapiro A.L., Viñuela E., Maizel J.J. Molecular weight estimation of polypeptide chains by electrophoresis in SDS-polyacrylamide gels. Biochem Biophys Res Commun 1967; 28:815-20.

Yanagisawa K., Sakakibara Y., Suiko M., Takami Y., Nakayama T., Nakajima H., Takayanagi K., Natori Y., Liu M.C. cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase/adenosine 5'-phosphosulfate kinase enzyme. Biosci Biotechnol Biochem 1998; 62:1037-1040.

160

References of chapter 3

[1] Goldstein D. S., Swoboda K. J., Miles J. M., Coppack S. W., Aneman A., Holmes C., Lamensdorf I., and Eisenhofer G. (1999) Sources and physiological significance of plasma dopamine sulfate. J. Clin. Endocrinol. Metab. 84, 2523-2531.

[2] Goldstein D. S., Eisenhofer G. and Kopin I. J. (2003) Sources and significance of plasma levels of catechols and their metabolites in humans. J. Pharmacol. Exp. Ther. 305, 800-811.

[3] Sandyk R. (2006) Serotonergic mechanisms in amyotrophic lateral sclerosis. Int. J. Neurosci. 116, 775-826.

[4] Alex K. D. and Pehek E. A. (2007) Pharmacologic mechanisms of serotonergic regulation of dopamine neurotransmission. Pharmacol. Ther. 113, 296-320.

[5] Schultz W. (2007) Multiple dopamine functions at different time courses. Annu. Rev. Neurosci. 30, 259-288.

[6] Eisenhofer G., Kopin I. J. and Goldstein D. S. (2004) Catecholamine metabolism: a contemporary view with implications for physiology and medicine. Pharmacol. Rev. 56, 331-349.

[7] Buttarelli F. R., Fanciulli A., Pellicano C. and Pontieri F. E. (2011) The dopaminergic system in peripheral blood lymphocytes: from physiology to pharmacology and potential applications to neuropsychiatric disorders. Curr Neuropharmacol. 9, 278- 288.

[8] Lieberman M., Marks A., Peet A. (2013) Marks' Basic Medical Biochemistry, A Clinical Approach (4th ed.), p. 175. Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia.

[9] Moreira C. G., Russell R., Mishra A. A., Narayanan S., Ritchie J. M., Waldor M. K., Curtis M. M., Winter S. E., Weinshenker D. and Sperandio V. (2016) Bacterial Adrenergic Sensors Regulate Virulence of Enteric Pathogens in the Gut. MBio. 7, e00826-16.

[10] Gershon M. D. and Tack J. (2007) The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Gastroenterology. 132, 397-414.

[11] Mawe G. M., Coates M. D. and Moses P. L. (2006) Review article: intestinal serotonin

signalling in irritable bowel syndrome. Aliment. Pharmacol. Ther. 23, 1067-1076. 161

[12] Camilleri M. (2009) Serotonin in the gastrointestinal tract. Curr. Opin. Endocrinol. Diabetes. Obes. 16, 53-59.

[13] Johnson G. A., Baker C. A. and Smith R. T. (1980) Radioenzymatic assay of sulfate conjugates of catecholamines and DOPA in plasma. Life Sci. 26, 1591-1598.

[14] Falany C. N. (1997) Enzymology of human cytosolic SULTs. FASEB J. 11, 206-216.

[15] Lozda R. and Purviņš I. (2014) The serotonin-O-sulfate as a potential plasma surrogate biomarker. Neurotransmitter. 1, e281.

[16] Tyce G. M., Messick J. M., Yaksh T. L., Byer D. E., Danielson D. R. and Rorie D. K. (1986) Amine sulfate formation in the central nervous system. Fed. Proc. 45, 2247- 2253.

[17] Renskers K. J., Feor K. D. and Roth J. A. (1980) Sulfation of dopamine and other biogenic amines by human brain phenol sulfotransferase. J. Neurochem. 34, 1362- 1368.

[18] Costa J. L., Launay J. M. and Kirk K. L. (1983) Exploration of the role of phenolsulfotransferase in the disposition of serotonin in human platelets: implications for a novel therapeutic strategy against depression. Med. Hypotheses. 10, 231-246.

[19] Reiter C., Mwaluko G., Dunnette J., Van Loon J. and Weinshilboum R. (1983) Thermolabile and thermostable human platelet phenol sulfotransferase. Substrate specificity and physical separation. Naunyn. Schmiedebergs. Arch. Pharmacol. 324, 140-147.

[20] Mulder G. J. and Jakoby W. B. (1990) Sulfation in conjugation reactions, in Drug Metabolism (Mulder G. J. and Jakoby W. B., eds.), pp.107-161. Taylor and Francis, London.

[21] Falany C. and Roth J. A. (1993) Properties of human cytosolic sulfotransferases involved in drug metabolism, in Human Drug Metabolism; From Molecular Biology to Man (Jeffery E. H., ed.), pp. 101-115. CRC Press, Boca Raton, FL.

[22] Weinshilboum R. and Otterness D. (1994) Sulfotransferase enzymes, in Conjugation- Deconjugation Reactions in Drug Metabolism and Toxicity (Kaufmann F. C., ed.), pp. 45-78. Springer-Verlag, Berlin.

[23] Lipmann F. (1958) Biological sulfate activation and transfer. Science. 128, 575-580.

[24] Dousa, M. K. and Tyce, G. M. (1988) Free and conjugated plasma catecholamines, DOPA and 3-O-methyldopa in humans and in various animal species. Proc. Soc. Exp. Biol. Med. 188, 427-434.

162

[25] Yasuda S., Liu M. Y., Suiko M., Sakakibara Y. and Liu M. C. (2007) Hydroxylated serotonin and dopamine as substrates and inhibitors for human cytosolic SULT1A3. J. Neurochem. 103, 2679-2689.

[26] Dajani R., Cleasby A., Neu M., Wonacott A. J., Jhoti H., Hood A. M., Modi S., Hersey A., Taskinen J., Cooke R. M., Manchee G. R. and Coughtrie M. W. (1999) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. Molecular modeling and quantitative structureactivity relationship analysis demonstrate a molecular basis for sulfotransferase substrate specificity. J. Biol. Chem. 274, 37862– 37868.

[27] Dooley T. P. (1998) Cloning of the human phenol sulfotransferase gene family: three genes implicated in the metabolism of catecholamines, thyroid hormones and drugs. Chem. Biol. Interact. 109, 29-41.

[28] Hildebrandt M. A., Salavaggione O. E., Martin Y. N., Flynn H. C., Jalal S., Wieben E. D. and Weinshilboum R. M. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem. Biophys. Res. Commun. 321, 870-878.

[29] Gamage N., Barnett A., Hempel N., Duggleby R. G., Windmill K. F., Martin J. L., McManus M. E. (2006) Human sulfotransferases and their role in chemical metabolism. Toxicol. Sci. 90, 5-22.

[30] Thomae B. A., Rifki O. F., Theobald M. A., Eckloff B. W., Wieben E. D. and Weinshilboum R. M. (2003) Human catecholamine sulfotransferase (SULT1A3) pharmacogenetics: Functional genetic polymorphism. J. Neurochem. 87, 809-819.

[31] Yanagisawa K., Sakakibara Y., Suiko M., Takami Y., Nakayama T., Nakajima H.,

Takayanagi K., Natori Y. and Liu M. C. (1998) cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase/adenosine 5’- phosphosulfate kinase enzyme. Biosci. Biotechnol. Biochem. 62, 1037-1040.

[32] Sanger F., Nicklen S. and Coulson A. R. (1977) DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. U S A. 74, 5463-5467.

[33] Shapiro A. L., Viñuela E. and Maizel J. J. (1967) Molecular weight estimation of polypeptide chains by electrophoresis in SDS-polyacrylamide gels. Biochem. Biophys. Res. Commun. 28, 815-20.

[34] Laemmli U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227, 680-685.

[35] Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.

163

[36] Kurogi K., Chen M., Lee Y., Shi1 B., Yan T. and Liu M. (2012) Sulfation of buprenorphine, pentazocine, and naloxone by human cytosolic sulfotransferases. Drug Metab. Lett. 6, 109-115.

[37] Lu J. H., Li H. T., Liu M. C., Zhang J. P., Li M., An X. M. and Chang W. R. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'-phosphate. Biochem. Biophys. Res. Commun. 335, 417-423.

[38] Cook I., Wang T., Almo S.C., Kim J., Falany C.N. and Leyh T.S. (2013) The gate that governs sulfotransferase selectivity. Biochemistry. 52, 415-424.

[39] Ritchter D. (1940) The inactivation of adrenaline in vivo in man. J. Physiol. 98, 36I- 374.

[40] Weinshilboum R. M. (1986) Sulfate conjugation of neurotransmitters and drugs. Introduction. Fed. Proc. 45, 2220-2222.

[41] Price R. A., Cox N. J., Spielman R. S., Van Loon J. A., Maidak B. L. and Weinshilboum R. M. (1988) Inheritance of human platelet thermolabile phenol sulfotransferase (TL PST) activity. Genet. Epidemiol. 5, 1-15.

[42] Claustre J., Pequignot J. M., Bui-xuan B., Muchada R., Cottet-Emard R. M. and Peyrin L. (1990) Conjugation and deamination of circulating dopamine: relationship between sulfated and free dopamine in man. J. Auton. Nerv. Syst. 29, 175-181.

[43] Eisenhofer G., Coughtrie M. W. and Goldstein D. S. (1999) Dopamine sulphate: an enigma resolved. Clin. Exp. Pharmacol. Physiol. Suppl. 26, S41-53.

[44] Sidharthan N. P., Minchin R. F. and Butcher N. J. (2013) Cytosolic sulfotransferase 1A3 is induced by dopamine and protects neuronal cells from dopamine toxicity: role of D1 receptor-NMDA receptor coupling. J. Biol. Chem. 288, 34364-34374.

[45] Gupta S. and Kulhara P. (2010) What is schizophrenia: A neurodevelopmental or neurodegenerative disorder or a combination of both? A critical analysis. Indian J Psychiatry. 52, 21-27.

[46] Ungless M. A. and Grace A. A. (2012) Are you or aren't you? Challenges associated with physiologically identifying dopamine neurons. Trends Neurosci. 35, 422-430.

[47] Stokes A. H., Hastings T. G. and Vrana K. E. (1999) Cytotoxic and genotoxic potential of dopamine. J. Neurosci. Res. 55, 659-665.

[48] Wu J., Xiao H., Sun H., Zou L. and Zhu L. Q. (2012) Role of dopamine receptors in ADHD: a systematic meta-analysis. Mol. Neurobiol. 45, 605-620.

[49] Eagle K. (2014) ADHD impacted by sulfotransferase (SULT1A) inhibition from artificial food colors and plant-based foods. Physiol. Behav. 135, 174-179. 164

[50] Jones A. L., Roberts R. C., Colvin D. W., Rubin G. L. and Coughtrie M. W. (1995) Reduced platelet phenolsulphotransferase activity towards dopamine and 5- hydroxytryptamine in migraine. Eur. J. Clin. Pharmacol. 49, 109-114.

[51] Eagle K. (2012) Toxicological effects of red wine, orange juice, and other dietary SULT1A inhibitors via excess catecholamines. Food Chem. Toxicol. 50, 2243-2249.

[52] Benedict C. R. and Grahame-Smith D. G. (1979) Plasma adrenaline and noradrenaline

concentrations and dopamine-beta-hydroxylase activity in myocardial infarction with and without cardiogenic shock. Br. Heart J. 42, 214-220.

[53] Nadeau R. A. and de Champlain J. (1979) Plasma catecholamines in acute myocardial

infarction. Am. Heart J. 98, 548-554.

[54] Bidwell L. M., McManus M. E., Gaedigk A., Kakuta Y., Negishi M, Pedersen L. and

Martin J. L. (1999) Crystal structure of human catecholamine sulfotransferase. J. Mol. Biol. 293, 521-530.

[55] Petrotchenko E. V., Pedersen L. C., Borchers C. H., Tomer K. B. and Negishi M. (2001) The dimerization motif of cytosolic sulfotransferases. FEBS Letters. 490, 39- 43.

[56] Allali-Hassani A, Pan P. W., Dombrovski L., Najmanovich R., Tempel W., Dong A.,

Loppna P., Martin F., Thonton J., Edwards A. M., Bochkarev A., Plotnikov A. N., Vedadi M. and Arrowsmith C. H. (2007) Structural and Chemical Profiling of the Human Cytosolic Sulfotransferases. PLoS Biol. 5, e97.

[57] Flocco M. M. and Mowbray S. L. (1994) Planar stacking interactions of arginine and

aromatic side-chains in proteins. J. Mol. Biol. 235, 709-717.

[58] Gallivan J. P. and Dougherty D. A. (1999) Cation-pi interactions in structural biology. Proc. Natl. Acad. Sci. USA. 96, 9459-9464.

[59] Armstrong C. T., Mason P. E., Anderson J. L., Dempsey C. E. (2016) Arginine side chain interactions and the role of arginine as a gating charge carrier in voltage sensitive ion channels. Sci. Rep. 6, 21759.

[60] Chen G. and Chen X. (2003) Arginine Residues in the Active Site of Human Phenol Sulfotransferase (SULT1A1). J. Biol. Chem. 278, 36358-36364.

165

[61] Coughtrie M. W. (2002) Sulfation through the looking glass-recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2, 297-308.

[62] Zhu X., Veronese M. E., Iocco P. and McManus M. E. (1996) cDNA cloning and expression of a new form of human aryl sulfotransferase. Int. J. Biochem. Cell Biol. 28, 565-571.

[63] Omasits U., Ahrens C.H., Müller S. and Wollscheid B. (2014) Protter: interactive protein feature visualization and integration with experimental proteomic data. Bioinformatics. 30, 884-886.

[64] Pettersen E.F., Goddard T.D., Huang C.C., Couch G.S., Greenblatt D.M. and Meng E.C. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605-1612.

References of chapter 4

1. Kress HG. Tapentadol and its two mechanisms of action: Is there a new pharmacological class of centrally-acting analgesics on the horizon?. Eur J Pain. 2010;14:781-3. 2. Tzschentke TM, Christoph T, Kögel B, Schiene K, Hennies HH, Englberger W, Haurand M, Jahnel U, Cremers TI, Friderichs E, De Vry J. (-)-(1R,2R)-3-(3- dimethylamino-1-ethyl-2-methyl-propyl)-phenol hydrochloride (tapentadol HCl): a novel mu-opioid receptor agonist/norepinephrine reuptake inhibitor with broadspectrum analgesic properties. J Pharmacol Exp Ther. 2007;323:265-76. 3. Coulter C, Taruc M, Tuyay J, Moore C. Determination of tapentadol and its metabolite N-desmethyltapentadol in urine and oral fluid using liquid chromatography with tandem mass spectral detection. J Anal Toxicol. 2007;34:458- 63. 4. Raritan, NJ. Nucynta® ER (tapentadol) extended-release oral tablets C-II [package insert]. Janssen Pharmaceuticals, Inc. 2014. 5. Terlinden R, Kogel BY, Englberger W, Tzschentke TM. In vitro and in vivo characterization of tapentadol metabolites. Methods Find Exp Clin Pharmacol. 2012;32:31-8. 6. Terlinden R, Ossig J, Fliegert F, Lange C, Göhler K. Absorption, metabolism, and excretion of 14C-labeled tapentadol HCl in healthy male subjects. Eur J Drug Metab Pharmacokinet. 2007;32:163-9.

166

7. Kurogi K, Chepak A, Hanrahan MT, Liu M-Y, Sakakibara Y, Suiko M, Liu M-C. Sulfation of opioid drugs by human cytosolic sulfotransferases: Metabolic labeling study and enzymatic analysis. Eur J Pharm Sci. 2014;62:40-8. 8. Ko K, Kurogi K, Davidson G, Liu M-Y, Sakakibara Y, Suiko M, Liu M-C. Sulfation of ractopamine and salbutamol by the human cytosolic sulfotransferases. J Biochem. 2012;152:275-83. 9. Clements J, Critchley JA, Prescott LF. The role of sulphate conjugation in the metabolism and disposition of oral and intravenous paracetamol in man. Br J Clin Pharmacol. 1984;18:481-5. 10. Falany CN, Roth JA. Properties of human cytosolic sulfotransferases involved in the drug metabolism. In: Jeffery HE, ed. Human Drug Metabolism. From Molecular Biology to Man. Boca Raton: CRC Press; 1993. pp. 101-15. 11. Weinshilboum RM, Otterness DM. Sulfotransferase enzymes in conjugation- deconjugation reactions. In: Kaufman FC, ed. Drug Metabolism and Toxicology. Berlin: Springer-Verlag; 1994. pp. 45-78. 12. Falany CN, Ström P, Swedmark S. Sulphation of O-desmethyl naproxen and related compounds by human cytosolic sulfotransferases. Br J Clin Pharmacol. 2005;60:632-40. 13. Zuckerman A, Bolan E, de Paulis T, Schmidt D, Spector S, Pasternak GW. Pharmacological characterization of morphine-6-sulfate and codeine-6-sulfate. Brain Res. 1999;842:1-5. 14. Houdi AA, Kottayil S, Crooks PA, Butterfield DA. 3-0-Acetylmorphine-6-O-Sulfate: A Potent, Centrally Acting Morphine Derivative. Pharmacol Biochem Behav. 1996;53:665-71. 15. Pasternak GW, Pan YX. Mu opioids and their receptors: evolution of a concept. Pharmacol Rev. 2013;65:1257-317. 16. Glatt H. Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 2000;129:141-70. 17. Blanchard RL, Freimuth RR, Buck J, Weinshilboum RM, Coughtrie MW. A proposed nomenclature system for the cytosolic sulfotransferase (SULT) superfamily. Pharmacogenetics. 2004;14:199-211. 18. Hui Y, Liu MC. Sulfation of ritodrine by the human cytosolic sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J Pharmacol. 2015;761:125-9. 19. Cook IT, Leyh TS, Kadlubar SA, Falany CN. Structural rearrangement of SULT2A1: effects on dehydroepiandrosterone and raloxifene sulfation. Horm Mol Biol Clin Investig. 2010;1:81-7.

167

20. Javitt NB, Lee YC, Shimizu C, Fuda H, Strott CA. Cholesterol and hydroxycholesterol sulfotransferases: identification, distinction from dehydroepiandrosterone sulfotransferase, and differential tissue expression. Endocrinology. 2001;142:2978-84. 21. Falany CN, He D, Dumas N, Frost AR, Falany JL. Human cytosolic sulfotransferase 2b1: isoform expression, tissue specificity and subcellular localization. J Steroid Biochem Mol Biol. 2006;102:214-21. 22. Falany CN, Xie X, Wang J, Ferrer J, Falany JL. Molecular cloning and expression of novel sulphotransferase-like cDNAs from human and rat brain. Biochem J. 2000;346:857-64. 23. Lindsay J, Wang LL, Li Y, Zhou SF. Structure, function and polymorphism of human cytosolic sulfotransferases. Curr Drug Metab. 2008;9:99-105. 24. Runge-Morris M, Kocarek TA, Falany CN. Regulation of the cytosolic sulfotransferases by nuclear receptors. Drug Metab Rev. 2013;45:15-33. 25. Yanagisawa K, Sakakibara Y, Suiko M, Takami Y, Nakayama T, Nakajima H, Takayanagi K, Natori Y, Liu M-C. cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase/adenosine 5’-phosphosulfate kinase enzyme. Biosci Biotechnol Biochem.1998;62:1037-40. 26. Sakakibara Y, Yanagisawa K, Katafuchi J, Ringer DP, Takami Y, Nakayama T, Suiko M, Liu M-C. Molecular cloning, expression, and characterization of novel human SULT1C sulfotransferases that catalyze the sulfonation of N-hydroxy-2- acetylaminofluorene. J Biol Chem. 1998;273:33929-35. 27. Sakakibara Y, Takami Y, Nakayama T, Suiko M, Liu M-C. Localization and functional analysis of the substrate specificity/catalytic domains of human M-form and P-form phenol sulfotransferases. J Biol Chem. 1998;273:6242-47. 28. Suiko M, Sakakibara Y, Liu M-C. Sulfation of environmental estrogen-like chemicals by human cytosolic sulfotransferases. Biochem Biophys Res Commun. 2000;267:80-4. 29. Liu MC, Lipmann F. Decrease of tyrosine-O-sulfate-containing proteins found in rat fibroblasts infected with Rous sarcoma virus or Fujinami sarcoma virus. Proc Natl Acad Sci USA. 1984;81:3695-8. 30. Roos A, Boron WF. Intracellular pH. Physiol Rev. 1981;61:296-434. 31. Bright GR, Fisher GW, Rogowska J, Taylor DL. Fluorescence ratio imaging microscopy: temporal and spatial measurements of cytoplasmic pH. J Cell Biol. 1987;104:1019-33. 32. Madshus IH. Regulation of intracellular pH in eukaryotic cells. Biochem J. 1988;250:1-8.

168

33. Gerweck LE and Seetharaman K. Cellular pH Gradient in Tumor versus Normal Tissue: Potential Exploitation for the Treatment of Cancer. Cancer Res. 1996;56:1194-8. 34. Boron WF. Regulation of intracellular pH. Adv Physiol Educ. 2004;28:160-79. 35. Rens-Domiano S and Roth JA. Characterization of Tyrosylprotein Sulfotransferase from Rat Liver and Other Tissues. J Biol Chem. 1989;264:899-905. 36. Weinshilboum RM. Phenol sulfotransferase in humans: properties, regulation, and function. Fed Proc. 1986;45:2223-8. 37. Ganguly TC, Krasnykh V, Falany CN. Bacterial expression and kinetic characterization of the human monoamine-sulfating form of phenol sulfotransferase. Drug Metab Dispos. 1995;23:945-50. 38. Butler PR, Anderson RJ, Venton DL. Human platelet phenol sulfotransferase: partial purification and detection of two forms of the enzyme. J Neurochem. 1983;41:630- 9. 39. Stanley EL, Hume R, Visser TJ, Coughtrie MWH. Differential expression of sulfotransferase enzymes involved in thyroid hormone metabolism during human placental development. J Clin Endocrinol Metab. 2001;86:5944-55. 40. Conolly E, Davies DS, Dollery CT, Morgan CD, Paterson JW, Sandler M. Metabolism of isoprenaline in dog and man. Br J Pharmacol. 1972;46:458-72. 41. Richard K, Hume R, Kaptein E, Stanley EL, Visser TJ, Coughtrie MW. Sulfation of thyroid hormone and dopamine during human development: Ontogeny of phenol sulfotransferases and arylsulfatase in liver, lung and brain. J Clin Endocrinol Metab. 2001;86:2734-42. 42. Stanley EL, Hume R, Coughtrie MW. Expression profiling of human fetal cytosolic sulfotransferases involved in steroid and thyroid hormone metabolism and in detoxification. Mol Cell Endocrinol. 2005;240:32-42. 43. McCarver DG, Hines RN. The ontogeny of human drug-metabolizing enzymes: phase II conjugation enzymes and regulatory mechanisms. J Pharmacol Exp Ther. 2002;300:361-6. 44. Coughtrie MWH, Burchell B, Leaky JEA, Hume R. The inadequacy of perinatal glucuronidation-immunoblot analysis of the developmental expression of individual UDP-glucuronosyltransferase isoenzymes in rat and human-liver microsomes. Mol Pharmacol. 1988;34:729-35. 45. Coughtrie MWH. Sulfation through the looking glass-recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2002;2:297-308.

169

46. Vietri M, Pietrabissa A, Mosca F, Rane A, Pacific GM. Human adult and foetal liver suphotransferases: inhibition by mefenamic acid and salicylic acid. Xenobiotica. 2001;31:153-61. 47. Schneider J, Jahnel U, Linz K. Neutral effects of the novel analgesic tapentadol on cardiac repolarization due to mixed ion channel inhibitory activities. Drug Dev Res. 2010;71:197-208. 48. Wade WE, Spruill WJ. Tapentadol hydrochloride: a centrally acting oral analgesic. Clin Ther. 2009;31:2804-18. 49. Teubner W, Meinl W, Florian S, Kretzschmar M, Glatt H. Identification and localization of soluble sulfotransferases in the human gastrointestinal tract. Biochem J. 2007;404:207-15. 50. Westerink WM, Schoonen WG. Phase II enzyme levels in HepG2 cells and cryopreserved primary human hepatocytes and their induction in HepG2 cells. Toxicol In Vitro. 2007;21:1592-602. 51. Meinl W, Ebert B, Glatt H, Lampen A. Sulfotransferase forms expressed in human intestinal Caco-2 and TC7 cells at varying stages of differentiation and role in benzo[a]pyrene metabolism. Drug Metab Dispos. 2008;36:276-83. 52. Riches Z, Stanley EL, Bloomer JC, Coughtrie MW. Quantitative evaluation of the expression and activity of five major sulfotransferases (SULTs) in human tissues: the SULT “pie”. Drug Metab Dispos. 2009;37:2255-61.

References of chapter 5

[1] Li Wan Po A, Zhang WY (1997) Systematic overview of co-proxamol to assess analgesic effects of addition of dextropropoxyphene to paracetamol. BMJ 315: 1565- 1571.

[2] Bertolini A, Ferrari A, Ottani A, Guerzoni S, Tacchi R, Leone S (2006) Paracetamol: new vistas of an old drug. CNS Drug Rev 12: 250-275.

[3] Volkow ND, McLellan AT (2016) Opioid Abuse in Chronic Pain-Misconceptions and Mitigation Strategies. N Engl J Med 374: 1253-1263.

[4] Kelly E (2013) Efficacy and ligand bias at the μ-opioid receptor. Br J Pharmacol 169: 1430-1446.

[5] Fidman B, Nogid A (2010) Role of Tapentadol Immediate Release (Nucynta) in the Management of Moderate-to-Severe Pain. P T 35: 330-333, 357.

170

[6] Hennies HH, Friderichs E, Schneider J (1988) Receptor binding, analgesic and antitussive potency of tramadol and other selected opioids. Arzneimittelforschung 38: 877-880.

[7] Steventon GB, Mitchell SC, Waring RH (1996) Human metabolism of paracetamol (acetaminophen) at different dose levels. Drug Metabol Drug Interact 13: 111-1117.

[8] Adjei AA, Gaedigk A, Simon SD, Weinshilboum RM, Leeder JS (2008) Interindividual variability in acetaminophen sulfation by human fetal liver: implications for pharmacogenetic investigations of drug-induced birth defects. Birth Defects Res A Clin Mol Teratol 82: 155-165. [9] Besunder JB, Reed MD, Blumer JL (1988) Principles of drug biodisposition in the neonate. A critical evaluation of the pharmacokinetic-pharmacodynamic interface (Part I). Clin Pharmacokinet 14: 189-216.

[10] Choonara I, Ekbom Y, Lindström B, Rane A (1990) Morphine sulphation in children. Br J Clin Pharmacol 30: 897-900.

[11] Terlinden R, Ossig J, Fliegert F, Lange C, Göhler K (2007) Absorption, metabolism, and excretion of 14C-labeled tapentadol HCl in healthy male subjects. Eur J Drug Metab Pharmacokinet 32: 163-169.

[12] Wu WN, McKown LA, Liao S (2002) Metabolism of the analgesic drug ULTRAM (tramadol hydrochloride) in humans: API-MS and MS/MS characterization of metabolites. Xenobiotica 32: 411-425.

[13] Prescott LF (1983) Paracetamol overdosage. Pharmacological considerations and clinical management. Drugs 25: 290-314.

[14] Schneider J, Jahnel U, Linz K (2010) Neutral effects of the novel analgesic tapentadol on cardiac repolarization due to mixed ion channel inhibitory activities. Drug Dev Res 71: 197-208.

[15] Andersson M, Björkhem-Bergman L, Ekström L, Bergqvist L, Lagercrantz H, Rane A, et al. (2014) Detection of morphine-3-sulfate and morphine-6-sulfate in human urine and plasma, and formation in liver cytosol. Pharmacol Res Perspect 2: e00071.

[16] Mulder GJ, Jakoby WB, Sulfation in conjugation reactions, in: Mulder GJ, Jakoby WB, (Eds.), Drug Metabolism, Taylor and Francis, London, 1990, pp. 107-161.

[17] Falany C, Roth JA, Properties of human cytosolic sulfotransferases involved in drug metabolism, in: Jeffery EH, (Ed.), Human Drug Metabolism; From Molecular Biology to Man, CRC Press, FL, 1993, pp. 101-115.

171

[18] Weinshilboum R, Otterness D, Sulfotransferase enzymes, in: Kaufmann FC, (Ed.), Conjugation-Deconjugation Reactions in Drug Metabolism and Toxicity, Springer- Verlag, Berlin, 1994, pp. 45-78.

[19] Hui Y, Liu MC (2015) Sulfation of ritodrine by the human cytosolic sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J Pharmacol 5: 125-129.

[20] Kurogi K, Chepak A, Hanrahan MT, Liu MY, Sakakibara Y, Suiko M, Liu MC (2014) Sulfation of opioid drugs by human cytosolic sulfotransferases: metabolic labeling study and enzymatic analysis. Eur J Pharm Sci 1: 40-48.

[21] Yamamoto A, Liu MY, Kurogi K, Sakakibara Y, Saeki Y, Suiko M, Liu MC (2015) Sulphation of acetaminophen by the human cytosolic sulfotransferases: a systematic analysis. J Biochem 158: 497-504.

[22] Bairam AF, Rasool MI, Kurogi K, Liu MC (2017) On the Molecular Basis Underlying the Metabolism of Tapentadol Through Sulfation. Eur J Drug Metab Pharmacokinet 42: 793-800.

[23] Rasool MI, Bairam AF, Kurogi K, Liu MC (2017) On the sulfation of O- desmethyltramadol by human cytosolic sulfotransferases. Pharmacol Rep 69: 953- 958.

[24] Dooley TP (1998) Cloning of the human phenol sulfotransferase gene family: three genes implicated in the metabolism of catecholamines, thyroid hormones and drugs. Chem Biol Interact 109: 29-41.

[25] Hildebrandt MA, Salavaggione OE, Martin YN, Flynn HC, Jalal S, Wieben ED, et al. (2004) Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem. Biophys Res Commun 321: 870-878.

[26] Gamage N, Barnett A, Hempel N, Duggleby RG, Windmill KF, Martin JL, et al. (2006) Human sulfotransferases and their role in chemical metabolism. Toxicol Sci 90: 5-22.

[27] Yanagisawa K, Sakakibara Y, Suiko M, Takami Y, Nakayama T, Nakajima H, et al. (1998) cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase/adenosine 5'-phosphosulfate kinase enzyme. Biosci Biotechnol Biochem 62: 1037-1040.

[28] Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467.

[29] Harper S, Speicher DW (2011) Purification of proteins fused to glutathione S- transferase. Methods Mol Biol 681: 259-280.

172

[30] Shapiro AL, Viñuela E, Maizel JJ (1967) Molecular weight estimation of polypeptide chains by electrophoresis in SDS-polyacrylamide gels. Biochem Biophys Res Commun 28: 815-20.

[31] Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 15: 680-685.

[32] Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 7: 248-54.

[33] Lu JH, Li HT, Liu MC, Zhang JP, Li M, An XM, et al. (2005) Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'- phosphoadenosine 5'-phosphate. Biochem Biophys Res Commun 335: 417-423.

[34] Cook I, Wang T, Almo SC, Kim J, Falany CN, Leyh TS (2013) The gate that governs sulfotransferase selectivity. Biochemistry 52: 415-424.

[35] Mangus BC, Miller MG, Pharmacology application in athletic training, FA Davis, Pennsylvania, 2005.

[36] Aghababian, RV, Essentials of emergency medicine, Jones & Bartlett Publishers, Ontario, 2010.

[37] Zhao L, Pickering G (2011) Paracetamol metabolism and related genetic differences. Drug Metab Rev 43: 41-52.

[38] Critchley JA, Nimmo GR, Gregson CA, Woolhouse NM, Prescott LF (1986) Inter- subject and ethnic differences in paracetamol metabolism. Br J Clin Pharmacol 22: 649-57.

[39] Halling J, Weihe P, Brosen K (2008) CYP2D6 polymorphism in relation to tramadol metabolism: a study of faroese patients. Ther Drug Monit 30: 271-275.

[40] Darbari DS, Van Schaik RH, Capparelli EV, Rana S, McCarter R, Van den Anker J (2008) UGT2B7 promoter variant -840G>A contributes to the variability in hepatic clearance of morphine in patients with sickle cell disease. Am J Hematol 83: 200-202.

[41] Court MH, Peter I, Hazarika S, Vasiadi M, Greenblatt DJ, Lee WM (2014) Acute Liver Failure Study Group. Candidate gene polymorphisms in patients with acetaminophen-induced acute liver failure. Drug Metab Dispos 42: 28-32.

[42] Lee HS, Ti TY, Koh YK, Prescott LF (1992) Paracetamol elimination in Chinese and Indians in Singapore. Eur J Clin Pharmacol 43: 81-84.

173

[43] Kirchheiner J, Schmidt H, Tzvetkov M, Keulen JT, Lötsch J, Roots I, Brockmöller J (2007) Pharmacokinetics of codeine and its metabolite morphine in ultra-rapid metabolizers due to CYP2D6 duplication. Pharmacogenomics J 7: 257-265.

[44] Williams J, Bonnet F, Analgesics in anesthetic practice, in: Hardman JG, Hopkins PM, Struys MMRF, (Eds.), Oxford Textbook of Anaesthesia, Oxford University Press, Oxford, 2017, pp. 314.

[45] Dajani R, Cleasby A, Neu M, Wonacott AJ, Jhoti H, Hood AM, et al. (1999) X-ray crystal structure of human dopamine sulfotransferase, SULT1A3. Molecular modeling and quantitative structure activity relationship analysis demonstrate a molecular basis for sulfotransferase substrate specificity. J Biol Chem 274: 37862– 37868.

[46] Bidwell LM, McManus ME, Gaedigk A, Kakuta Y, Negishi M, Pedersen L et al. (1999) Crystal structure of human catecholamine sulfotransferase. J Mol Biol 293: 521-530.

[47] Allali-Hassani A, Pan PW, Dombrovski L, Najmanovich R, Tempel W, Dong A, et al. (2007) Structural and Chemical Profiling of the Human Cytosolic Sulfotransferases. PLoS Biol 5: e97.

[48] Petrotchenko EV, Pedersen LC, Borchers CH, Tomer KB, Negishi M (2001) The dimerization motif of cytosolic sulfotransferases. FEBS Letters 490: 39-43.

[49] Yohannan S, Yang D, Faham S, Boulting G, Whitelegge J, Bowie JU (2004) Proline substitutions are not easily accommodated in a membrane protein. J Mol Biol 341: 1- 6.

[50] Mendes MIS, Smith DEC, Vicente JB, De Almeida IT, Ben-Omran T, Salomons GS, et al. (2015) Small aminothiol compounds improve the function of Arg to Cys variant proteins: effect on the human cystathionine β-synthase p.R336C. Human Molecular Genetics 24: 7339-7348.

[51] Bass RB, Butler SL, Chervitz SA, Gloor SL, Falke JJ (2007) Use of Site-Directed Cysteine and Disulfide Chemistry to Probe Protein Structure and Dynamics: Applications to Soluble and Transmembrane Receptors of Bacterial Chemotaxis. Methods Enzymol 423: 25-51.

[52] Reiersen H, Rees AR (2001) The hunchback and its neighbours: proline as an environmental modulator. Trends Biochem Sci 26: 679-684.

[53] Chen G, Chen X (2003) Arginine Residues in the Active Site of Human Phenol Sulfotransferase (SULT1A1). J Biol Chem 278: 36358-36364.

174

[54] Coughtrie MW (2002) Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J 2: 297-308.

[55] Zhu X, Veronese ME, Iocco P, McManus ME (1996) cDNA cloning and expression of a new form of human aryl sulfotransferase. Int J Biochem Cell Biol 28: 565-571.

[56] Thomae BA, Rifki OF, Theobald MA, Eckloff BW, Wieben ED, Weinshilboum RM (2003) Human catecholamine sulfotransferase (SULT1A3) pharmacogenetics: functional genetic polymorphism. J Neurochem 87: 809-819.

[57] Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem. 25: 1605-1612.

[58] Trott O, Olson AJ (2010) AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem. 31: 455-461.

References of chapter 6

[1] Johnson DA, Hricik JG. The pharmacology of alpha-adrenergic decongestants. Pharmacotherapy. 1993;13:110S-115S.

[2] Horak F, Zieglmayer P, Zieglmayer R, Lemell P, Yao R, Staudinger H, et al. A placebo-controlled study of the nasal decongestant effect of phenylephrine and pseudoephedrine in the Vienna Challenge Chamber. Ann Allergy Asthma Immunol. 2009;102:116-120.

[3] Ullah MI, Newman GB, Saunders KB. Influence of age on response to ipratropium and salbutamol in asthma. Thorax. 1981;36:523-529.

[4] Boulton DW, Fawcett JP. The pharmacokinetics of levosalbutamol: what are the clinical implications? Clin Pharmacokinet. 2001;40:23-40.

[5] Starkey ES, Mulla H, Sammons HM, Pandya HC. Intravenous salbutamol for childhood asthma: evidence-based medicine? Arch Dis Child. 2014;99:873-877.

[6] Hochhaus G, Möllmann H. Pharmacokinetic/pharmacodynamic characteristics of the beta-2-agonists terbutaline, salbutamol and fenoterol. Int J Clin Pharmacol Ther Toxicol. 1992;30:342-362.

175

[7] Ibrahim KE, Midgley JM, Crowley JR, Williams CM. The mammalian metabolism of R-(-)-m-synephrine. J Pharm Pharmacol. 1983;35:144-147.

[8] Yamamoto A, Kim J, Liu MY, Kurogi K, Sakakibara Y, Suiko M, et al. Sulfation of phenylephrine by the human cytosolic sulfotransferases. Drug Metab Lett. 2014;8:96- 100.

[9] Ko K, Kurogi K, Davidson G, Liu MY, Sakakibara Y, Suiko M, et al. Sulfation of ractopamine and salbutamol by the human cytosolic sulfotransferases. J Biochem. 2012;152:275-283.

[10] Nishimuta H, Ohtani H, Tsujimoto M, Ogura K, Hiratsuka A, Sawada Y. Inhibitory effects of various beverages on human recombinant sulfotransferase isoforms SULT1A1 and SULT1A3. Biopharm Drug Dispos. 2007;28:491-500.

[11] Morgan DJ. Clinical pharmacokinetics of beta-agonists. Clin Pharmacokinet. 1990;18:270-294.

[12] Morgan DJ, Paull JD, Richmond BH, Wilson-Evered E, Ziccone SP. Pharmacokinetics of intravenous and oral salbutamol and its sulphate conjugate. Br J Clin Pharmacol. 1986;22:587-93.

[13] Falany CN, Roth JA. Properties of human cytosolic sulfotransferases involved in the drug metabolism Human Drug Metabolism. In: Jeffery, HE, ed. From Molecular Biology to Man. Boca Raton: CRC Press, 1993: 101-115.

[14] Mulder GJ, Jakoby WB. Sulfation. In: Mulder GJ, Jakoby WB, eds. Conjugation Reactions in Drug Metabolism. London: Taylor and Francis, 1990: 107-161.

[15] Weinshilboum RM, Otterness DM. Sulfotransferase enzymes. In: Kaufman FC, ed. Conjugation-deconjugation reactions in Drug Metabolism and Toxicity. Berlin: Springer-Verlag, 1994: 45-78.

[16] Lipmann F. Biological sulfate activation and transfer. Science. 1958;128:575-580.

[17] Dooley TP. Cloning of the human phenol sulfotransferase gene family: three genes implicated in the metabolism of catecholamines, thyroid hormones and drugs. Chem Biol Interact. 1998;109:29-41.

[18] Hildebrandt MA, Salavaggione OE, Martin YN, Flynn HC, Jalal S, Wieben ED, et al. Human SULT1A3 pharmacogenetics: gene duplication and functional genomic studies. Biochem Biophys Res Commun. 2004;321:870-878.

[19] Thomae BA, Rifki OF, Theobald MA, Eckloff BW, Wieben ED, Weinshilboum RM. Human catecholamine sulfotransferase (SULT1A3) pharmacogenetics: functional genetic polymorphism. J Neurochem. 2004;87:809-819.

176

[20] Hui Y, Liu MC. Sulfation of ritodrine by the human cytosolic sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J Pharmacol. 2015;761:125-129.

[21] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463-5467.

[22] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680-685.

[23] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254.

[24] Kurogi K, Chepak A, Hanrahan MT, Liu MY, Sakakibara Y, Suiko M, et al. Sulfation of opioid drugs by human cytosolic sulfotransferases: metabolic labeling study and enzymatic analysis. Eur J Pharm Sci. 2014;1:40-48.

[25] Yanagisawa K, Sakakibara Y, Suiko M, Takami Y, Nakayama T, Nakajima H, et al. cDNA cloning, expression, and characterization of the human bifunctional ATP sulfurylase/adenosine 5’-phosphosulfate kinase enzyme. Biosci Biotechnol Biochem. 1998;62:1037-1040.

[26] Bidwell LM, McManus ME, Gaedigk A, Kakuta Y, Negishi M, Pedersen L, et al. Crystal structure of human catecholamine sulfotransferase. J Mol Biol. 1999;293:521- 530.

[27] Allali-Hassani A, Pan PW, Dombrovski L, Najmanovich R, Tempel W, Dong A, et al. Structural and chemical profiling of the human cytosolic sulfotransferases. PLoS Biol. 2007;5:e97.

[28] Lu JH, Li HT, Liu MC, Zhang JP, Li M, An XM, et al. Crystal structure of human sulfotransferase SULT1A3 in complex with dopamine and 3'-phosphoadenosine 5'- phosphate. Biochem Biophys Res Commun. 2005;335:417-423.

[29] Petrotchenko EV, Pedersen LC, Borchers CH, Tomer KB, Negishi M. The dimerization motif of cytosolic sulfotransferases. FEBS Lett. 2001;490:39-43.

[30] Cook I, Wang T, Almo SC, Kim J, Falany CN, Leyh TS. The gate that governs sulfotransferase selectivity. Biochemistry. 2013;52:415-424.

[31] Betts MJ, Russell RB. Amino Acid Properties and Consequences of Substitutions. In: Barnes MR, Gray IC, eds. Bioinformatics for Geneticists. Chichester: John Wiley & Sons Ltd, 2003.

177

[32] Chen G, Chen X. Arginine Residues in the Active Site of Human Phenol Sulfotransferase (SULT1A1). J Biol Chem. 2003;278:36358-36364.

[33] Coughtrie MW. Sulfation through the looking glass-recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2002;2:297-308.

[34] Zhu X, Veronese ME, Iocco P, McManus ME. cDNA cloning and expression of a new form of human aryl sulfotransferase. Int J Biochem Cell Biol. 1996;28:565-571.

[35] Omasits U., Ahrens C.H., Müller S. and Wollscheid B. Protter: interactive protein feature visualization and integration with experimental proteomic data. Bioinformatics. 2014;30,884-886.

[36] The PyMOL Molecular Graphics System, Version 1.3, Schrödinger, LLC.

References of chapter 7

Allali-Hassani A, Pan PW, Dombrovski L, Najmanovich R, Tempel W, Dong A, et al. (2007) Structural and Chemical Profiling of the Human Cytosolic Sulfotransferases. PLoS Biol 5: e97.

Bamforth K.J., Jones A.L., Roberts R.C., Coughtrie M.W.H. Common food additives are potent inhibitors of human liver 17 alpha-ethinyloestradiol and dopamine sulphotransferases. Biochem Pharmacol 1993; 46:1713-1720.

Bright G.R., Fisher G.W., Rogowska J., Taylor D.L. Fluorescence ratio imaging microscopy: temporal and spatial measurements of cytoplasmic pH. J Cell Biol 1987; 104:1019-1033.

Chen G., Zhang D., Jing N., Yin S., Falany C.N., Radominska-Pandya A. Human gastrointestinal sulfotransferases: identification and distribution. Toxicol Appl Pharmacol 2003; 187:186-197.

Coughtrie M.W.H., Johnston L.E. Interactions between dietary chemicals and human sulfotransferases - molecular mechanisms and clinical significance. Drug Metab Dispos 2001; 29:522-528.

Dixon M. The effect of pH on the affinities of enzymes for substrates and inhibitors. Biochem J 1953; 55:161-170.

Dooley P.T. Cloning of the human phenol sulfotransferase gene family: three genes implicated in the metabolism of catecholamines, thyroid hormones and drugs Author links open overlay panel. Chem Biol Interact 1998; 109:29-41.

178

Eagle K. ADHD impacted by sulfotransferase (SULT1A) inhibition from artificial food colors and plant-based foods. Physiol Behav 2014; 135:174-179.

Eagle K. Toxicological effects of red wine, orange juice, and other dietary SULT1A inhibitors via excess catecholamines. Food Chem Toxicol 2012; 50:2243-2249.

Eisenhofer G., Coughtrie M.W., Goldstein D.S. Dopamine sulfate: an enigma resolved. Clin Exp Pharmacol Physiol Suppl 1999; 26:S41-S53

Fisher N.D., Hughes M., Gerhard-Herman M., Hollenberg N.K. Flavanol-rich cocoa induces nitric-oxidedependent vasodilation in healthy humans. J Hypertens 2003; 21:2281-2286.

Gardana C., Guarnieri S., Riso P., Simonetti P., Porrini M. Flavanone plasma pharmacokinetics from blood orange juice in human subjects. Br J Nutr 2007; 98:165-172.

Hara Y., Luo S.J., Wickremasinghe R.L., Yamanishi T. Specialissue on tea. Food Rev Int 1995; 11:371-542.

Harnly J.M., Doherty R.F., Beecher G.R., Holden J.M., Haytowitz D.B., Bhagwat S., Gebhardt S. Flavonoid content of U.S. fruits, vegetables, and nuts. J Agric Food Chem 2006; 54:9966-9977.

Huang C., Chen Y., Zhou T., Chen G. Sulfation of dietary flavonoids by human sulfotransferases. Xenobiotica 2009; 39:312-322.

Jenner A.M., Rafter J., Halliwell B. Human fecal water content of phenolics: the extent of colonic exposure to aromatic compounds. Free Radic Biol Med 2005; 38:763-772.

Justesen U., Knuthsen P., Leth T. Quantitative analysis of flavonols, flavones, and flavanones in fruits, vegetables and beverages by high-performance liquid chromatography with photodiode array and mass spectrometric detection. J Chromatogr A 1998; 799:101-110.

Kim H.K., Jeon W.K., Ko B.S. Flavanone glycosides from Citrus junos and their anti- influenza virus activity. Planta Med 2001; 67:548-549.

Lee M.-J., Wang Z.-Y., Li H., Chen L., Sun Y., Gobbo S., Balentine D.A., Yang C.S. Analysis of plasma and urinary tea polyphenols in human subjects. Cancer Epidemiol Biomark Prev 1995; 4:393-399.

Madshus I.H. Regulation of intracellular pH in eukaryotic cells. Biochem J 1988; 250:1- 8.

Mateus N., Silva A.M., Santos-Buelga C., Rivas-Gonzalo J.C., de Freitas V. Identification of anthocyaninflavanol pigments in red wines by NMR and mass spectrometry. J Agric Food Chem 2002; 50(7): 2110–2116. 179

Nagai M., Fukamachi T., Tsujimoto M., Ogura K., Hiratsuka A., Ohtani H., Hori S., Sawada Y. Inhibitory effects of herbal extracts on the activity of human sulfotransferase isoform sulfotransferase 1A3 (SULT1A3). Biol Pharm Bull 2009; 32:105-109.

Nishimuta H., Ohtani H., Tsujimoto M., Ogura K., Hiratsuka A., Sawada Y. Inhibitory effects of various beverages on human recombinant sulfotransferase isoforms SULT1A1 and SULT1A3. Biopharm Drug Dispos 2007; 28:491-500.

Nishimuta H., Tsujimoto M., Ogura K., Hiratsuka A., Ohtani H., Sawada Y. Inhibitory effects of various beverages on ritodrine sulfation by recombinant human sulfotransferase isoforms SULT1A1 and SULT1A3. Pharm Res 2005; 22:1406-1410.

Reiter C., Mwaluko G., Dunnette J., Van Loon J. and Weinshilboum R. Thermolabile and thermostable human platelet phenol sulfotransferase. Substrate specificity and physical separation. Naunyn Schmiedebergs Arch Pharmacol 1983; 324:140-147.

Roos A., Boron W.F. Intracellular pH. Physiol Rev 1981; 61:296-434.

Salucci M., Stivala L.A., Maiani G., Bugianesi R., Vannini V. Flavonoids uptake and their effect on cell cycle of human colon adenocarcinoma cells (Caco2). Br J Cancer 2002; 86:1645-1651.

Scalbert A., Williamson G. Dietary intake and bioavailability of polyphenols. J Nutr 2000; 130:2073S-2085S.

Torres J.L., Bobet R. New flavanol derivatives from grape (Vitis vinifera) byproducts. Antioxidant aminoethylthio-flavan-3-ol conjugates from a polymeric waste fraction used as a source of flavanols. J Agric Food Chem 2001; 49:4627-4634.

Yang C.S., Chen L., Lee M.J., Balentine D., Kuo M.C., Schantz S.P. Blood and urine levels of tea catechins after ingestion of different amounts of green tea by human volunteers. Cancer Epidemiol Biomarkers Prev 1998; 7:351-354.

180

181