Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Disassembly of the Mu transposase tetramer by the ClpX chaperone

Igor Levchenko, Li Luo, and Tania A. Baker Howard Hughes Medical Institute and Department of Biology, Massachusetts Institute of Technology, 68-523, Cambridge, Massachusetts 02139 USA

Mu transposition is promoted by an extremely stable complex containing a tetramer of the transposase (MuA) bound to the recombining DNA. Here we purify the Escherichia coli ClpX protein, a member of a family of multimeric ATPases present in prokaryotes and eukaryotes (the Clp family), on the basis of its ability to remove the transposase from the DNA after recombination. Previously, ClpX has been shown to function with the ClpP peptidase in protein turnover. However, neither ClpP nor any other protease is required for disassembly of the transposase. The released MuA is not modified extensively, degraded, or irreversibly denatured, and is able to perform another round of recombination in vitro. We conclude that ClpX catalyzes the ATP-dependent release of MuA by promoting a transient conformational change in the protein and, therefore, can be considered a molecular chaperone. ClpX is important at the transition between the recombination and DNA replication steps of transposition in vitro; this function probably corresponds to the essential contribution of ClpX for Mu growth. Deletion analysis reveals that the sequence at the carboxyl terminus of MuA is important for disassembly by ClpX and can target MuA for degradation by ClpXP in vitro. These data contribute to the emerging picture that members of the Clp family are chaperones specifically suited for disaggregating proteins and are able to function with or without a collaborating protease. [Key Words: Clp; Hspl04; transposition; phage Mu; replication] Received }uly 17, 1995; revised version accepted August 22, 1995.

Higher order protein-DNA complexes are often critical genome. This tetramer pairs the two ends of the Mu intermediates in initiation of transcription, recombina­ DNA, cleaves these ends, and joins the cleaved ends to a tion, and replication. Timely assembly and disassembly new DNA site in a reaction called strand transfer of these complexes is likely to be essential for the proper (Craigie and Mizuuchi 1987; Surette et al. 1987, 1991; function and regulation of these processes. The protein- Lavoie et al. 1991; Mizuuchi et al. 1992). A second Mu- DNA complexes involved in site-specific recombination encoded transposition protein, MuB, participates in and transposition are among the best understood and, strand transfer by activating MuA and delivering an in- therefore, useful for dissecting the general principles termolecular target site to the transposase complex (Ad- governing the assembly, organization, and disassembly zuma and Mizuuchi 1988; Baker et al. 1991; Surette and of such complexes. Chaconas 1991). Biochemical analysis of transposition by elements as Transposition is used for two steps in the phage Mu diverse as phage Mu, TnlO, Tn7, and human immuno­ life cycle: (1) integration of the Mu genome into that of deficiency virus (HIV) indicate that the transposase and the host cell during infection and (2) replicative ampli­ integrase proteins act by a similar mechanism (for re­ fication of the DNA during lytic growth. Although it is view, see Mizuuchi 1992) and function in stable multi­ well established that phage Mu uses transposition to rep­ meric complexes (Surette et al. 1987; Haniford et al. licate its genome, how replication is initiated after the 1991; Bainton et al. 1993; Ellison and Brown 1994). Al­ strand transfer reaction is not well understood. Mu rep­ though Mu transposase and HIV integrase have only a lication in vivo requires several essential Escherichia modest degree of amino acid sequence similarity (Baker coh genes that encode components of the host replica­ and Luo 1994), recent determination of the structures of tion machinery, indicating that Mu replication forks are the core domains of these proteins reveal remarkable similar to those used for chromosomal replication (Tous- similarities surrounding the active sites (Dyda et al. saint and Faelen 1974; Toussaint and Resibois 1983; 1994; Rice and Mizuuchi 1995). Resibois et al. 1984; Ross et al. 1986). Strand transfer Mu transposase (MuA) catalyzes the DNA cleavage complexes (STC) can be replicated efficiently in E. coli and joining reactions central to recombination. MuA is extracts made from uninfected cells indicating that no monomeric in solution but forms a stable tetramer upon Mu proteins other than MuA and MuB are required (Mi­ binding to specific sequences at each end of the phage zuuchi 1983), although the Mu arm functions stimulate

GENES & DEVELOPMENT 9:2399-2408 © 1995 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/95 $5.00 2399 Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Levchenko et al.

replication in vivo (Waggoner et al. 1981). Recently^ in joined by strand transfer. The releasing activity in the vitro replication with a more purified system confirmed extract was fractionated by chromatography; one activ­ roles for eight of the E. coli replication proteins and in­ ity behaved as a single component and was purified ex­ dicated that additional host factors are required (Krukli- tensively (see Materials and methods). The peak of re­ tis and Nakai 1994). leasing activity correlated with a 46-kD protein during In addition to the replication enzymes, the E. coli clpX several chromatography steps; the activity of fractions gene product is required for lytic growth of phage Mu from the penultimate column (Mono Q) is shown (Fig. (Mhammedi-Alaoui et al. 1994). The kinetics of the la,b). After Superose 6 chromatography, this 46-kD pro­ block in phage growth after induction of a lysogen indi­ tein was >90% pure (Fig. la). cate that ClpX functions after the first strand transfer Several lines of evidence established that the 46-kD reaction but before onset of extensive replication protein was the ClpX protein. The protein (1) reacted (Mhammedi-Alaoui et al. 1994). ClpX is a member of a efficiently with anti-ClpX antibody on a Western blot conserved family of ATPases (the Clp family) present in (data not shown); (2) supported degradation of a known prokaryotes and eukaryotes (Gottesman et al. 1990, substrate of the ClpXP protease in the presence of ClpP 1993). Many organisms, including E. coli have multiple and ATP (see below); and (3) was more abundant in ex­ family members, many of which are heat shock proteins. tracts made from cells overproducing ClpX than from The best studied Clp protein, E. coli ClpA, forms a com­ nonoverproducing cells. Active fractions of ClpX puri­ plex with the ClpP protein, a small serine protease (un­ fied from overproducing cells were >95% pure as judged related in sequence to the other Clp proteins) to promote by densitometery of a Coomassie Blue-stained SDS gel ATP-dependent degradation of specific proteins (Hwang (Fig. Ic). Release of MuA from the STC by purified ClpX et al. 1988; Katayama et al. 1988). ClpX was first purified was relatively efficient; in a reaction containing 1.3 based on its ability to degrade, with the ClpP protease, pmoles of MuA, 1.7 to 3.3 pmoles of ClpX gave rise to the replication initiator protein of phage k, XO protein protein-free product DNA within 5 min (data not (Wojtkowiak et al. 1993). However, although Mu growth shown). requires ClpX and some forms of the Mu repressor ap­ The ATP requirement for release of MuA from the pear to be degraded by ClpXP (Geuskens et al. 1992), Mu STC by ClpX was investigated by modifying the reaction propagates relatively normally in cipP-deficient cells (Mhammedi-Alaoui et al. 1994), indicating that the es­ sential role of ClpX in Mu growth does not involve pro­ tein degradation by ClpXP. In this study, we purify a factor from E. coli cell ex­ MonoQ. fractions Superose 6 overproduced ClpX tracts on the basis of its ability to displace the MuA tetramer from the DNA after strand transfer. This factor is the ClpX protein. ClpX catalyzes the ATP-dependent disassembly of the MuA tetramer into monomers with­ out detectable degradation and the released protein is active in another round of recombination. The impor­ tance of ClpX for Mu replication in vitro is also demon­ strated. Implications of these data for the pathway of Mu replication and the mechanism of action of the Clp pro­ tein family are discussed.

Results Purification of ClpX protein as a factor able to release MuA from the STC Upon completion of the cleavage and strand transfer re­ actions in vitro, MuA remains bound to the recombined Figure 1. ClpX removes MuA from strand transfer complexes. DNA in a protein-DNA complex called the STC or type [a] SDS-PAGE of ClpX fractions after Mono Q [left] and Super­ II transposome. Although noncovalent, this complex is ose 6 {right) chromatography. Arrow indicates ClpX protein. stable for days and resists treatment with 6 M urea and Prestained protein markers are myosin (h-chain) 214 kD, phos- heating to 65°C (Surette et al. 1987). Factors able to re­ phorylase Bill kD, BSA 74 kD, ovalbumin 45 kD, and carbonic move MuA from the STC were detected in crude E. coli anhydrase 29 kD. [b] MuA releasing activity of Mono Q frac­ tions of ClpX (5 |xl of each fraction [0.2-1.0 (x,g of total protein] extracts active in Mu DNA replication (data not shown). was added) assayed by agarose gel electrophoresis; arrow indi­ One assay used to detect removal of MuA from the DNA cates STC, bracket indicates topoisomers of free strand transfer depended on the difference in mobility between the STC DNA. The protein-DNA complexes and free DNA products and the strand transfer products on a native agarose gel. were visualized by staining of the gel with ethidium bromide The STC migrates as a single broad band that disappears (EtBr); a photograph of the negative is shown, (c) SDS-PAGE of with removal of MuA to give topoisomers of the DNA ClpX purified from overexpressing cells.

2400 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

ClpX disassembles the Mu transposase

conditions. Strand transfer normally involves MuB pro­ ClpX tein as well as MuA. MuB is an ATP-dependent nonspe­ + + + CIpP cific DNA-binding protein that targets strand transfer to + + intermolecular sites (Adzuma and Mizuuchi 1988; Baker ATP + - + et al. 1991). When MuA promotes strand transfer with­ out MuB and ATP^ recombination occurs using target -^kO sites within the donor plasmid (intramolecular strand transfer). ClpX disassembled efficiently the intramolec­ ular STC formed in the absence of MuB (Fig. 2). Removal of MuB from the reaction renders strand transfer insen­ Figure 3. Western blot analysis of degradation efficiency of the sitive to ATP allowing the role of ATP in ClpX-mediated XO protein by ClpXP protease. One hundred nanograms of \0 disassembly to be analyzed. ATP was necessary for de­ protein were incubated with 0.5 |jLg of ClpX protein (fraction tectable disassembly of the STC by ClpX; ATP[7S] did from Superose 6) under the conditions described in Materials and methods. Components of the reaction added are indicated not support the reaction, indicating that ATP hydrolysis on the top of each lane. is probably essential (Fig. 2).

ClpX disassembles the MuA tetramer without reaction. However, when ClpX and ATP were present, degradation MuA remained at the top of the gradient in the position ClpX was purified previously for its ability direct the of the monomeric MuA marker (fractions 1,2). These ClpP protease to degrade \0 protein (Wojtkowiak et al. fractions contained MuA that appeared to be full length 1993). In contrast, disassembly of MuA from the STC (75 kD) by SDS gel electrophoresis (Fig. 4a). Quantitative required ClpX but not ClpP. After gel filtration on Su­ Western blot analysis confirmed that the MuA released perose 6, ClpX fractions active in MuA release were free was not degraded even after prolonged incubation with from ClpP by Western blot analysis (data not shown). ClpX (data not shown). Disassembly was also monitored Furthermore, these fractions were unable to degrade \0 by protein cross-linking, which revealed that monomeric protein without addition of exogenous ClpP, confirming MuA was the form released from the STC (data not the absence of an enzymatic contamination (Fig. 3). shown). Thus, degradation of MuA by ClpXP does not appear to be the mechanism of disassembly of the STC. MuA released by ClpX is active To investigate the physical state of the released MuA, STCs were purified away from monomeric MuA by gel To investigate further the mechanism of ClpX action, filtration, treated with ClpX, and the products of the the ability of the released MuA to catalyze another re­ releasing assay were sedimented in a glycerol gradient combination reaction was tested. The released MuA (Fig. 4a). MuA sedimented with the DNA (fractions 4—9) (fraction 1 from a glycerol gradient analogous to that in when either ClpX or ATP was omitted from the releasing Fig. 4a) was incubated with ^^^P-labeled oligonucleotides carrying the Mu right end sequence (which served as the donor DNA) and an unlabeled target DNA [(1)X174 rep- licative form I (RFl)] (Fig. 4b). The released MuA pro­ duced labeled strand transfer products efficiently; the specific activity of the protein was comparable to that of transposase that had never been reacted with ClpX (Fig. 4b). This strand transfer reaction demands that MuA is able to bind specifically to DNA, form the tetramer, cat­ alyze strand transfer, and interact with MuB protein. STCII free DNA CDC products Clearly the MuA released by ClpX must be folded prop­ STCI erly. Therefore, these data argue that MuA is not exten­ sively modified, degraded, or irreversibly denatured as a result of being disassembled by ClpX. Thus, ClpX ap­ pears to release MuA from the STC by promoting a tran­ Figure 2. Requirement for ATP hydrolysis for ClpX releasing sient conformational change in the protein. activity. Components of the releasing reaction added are indi­ cated on the top of the each lane. The STC, the cleaved donor ClpX is important for Mu replication in vitro complex (CDC), which is similar in structure to the STC except the Mu DNA ends are cleaved but not yet joined to a new target Mu replicates by transposition; DNA synthesis on the site, and the free DNA products are indicated by arrows. The Mu portion of the DNA covalently joined by strand different types of free DNA product bands correspond to the transfer generates a cointegrate containing the new and different isomers that arise when different sites and strands on old target sequences and two copies of the phage DNA. the donor plasmid are used as targets during strand transfer; there are four families of structures (for details, see Maxwell et Mu DNA replicated poorly in an extract made from al. 1987). ClpX-deficient cells (Fig. 5a). This extract replicated a plasmid carrying the E. coli chromosomal origin [oriC] as

GENES & DEVELOPMENT 2401 Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Levchenko et al.

Sedimentation well as the control {clpX'*'] extract, indicating that the defect was specific for a factor required for Mu replica­ 12 3 4 5 6 7 8 9 101112 13 14 Fractions tion. Mu replication in the extract was restored by treat­ I'll I I I I I ment of the STCs with purified ClpX (Fig. 5b). Thus, ClpX is important for Mu-specific DNA replication in MuA vitro. A defect in Mu DNA replication in fractions from STC clpX~ cells has been reported by Nakai and Kruklitis (1995); they also find that efficient replication is restored by addition of ClpX protein to the in vitro reaction (H. Nakai, pers. comm.). I I I I I I I I I I I I

•MuA The carboxyl terminus of MuA is required for disassembly by ClpX and degradation by ClpXP The carboxy-terminal domain of MuA has been shown previously to be required for MuA-MuB interactions in vitro (Baker et al. 1991; Wu and Chaconas 1994). How­ ever, tetramers that contain a mixture of wild-type MuA and a deletion derivative lacking 47 amino acids from

1 2 3 4 5 6 7 8 91011121314 Fractions

Released MuA Release control MuA (/^l) (*^l) (ng) 0 2.5 5 10 0 2.5 5 10 0 6 12 25

single-end strand oriC mini-Mu transfer

k STC STC + ClpX pair-wise ^191^294,0 ^ipi^2p4p Replication (min) strand transfer

Donor DNA

Cointegrate

Figure 4. ClpX releases active MuA protein, {a] Analysis of released MuA by glycerol gradient sedimentation. {Top] Distri­ Donor bution of MuA in gradient fractions when STC was incubated without ClpX; {middle] distribution of MuA in gradient frac­ tions after incubation of the STC with ClpX and ATP; {bottom] migration of DNA from the top (•) and middle (A) panels and free MuA protein, (b) Agarose gel of strand transfer products made in reactions with different levels of released MuA. The Figure 5. ClpX rescues the replication defect of ClpX-defecient leftmost set of reactions contained released MuA, fraction 1 extracts, {a) Replication in vitro of the a mini-Mu plasmid and from glycerol gradient analogous to that shown in a-, the con­ a plasmid containing the E. coli chromosomal origin {oriC] in centration of MuA in this fraction was estimated to be 1 ng/|xl. extracts prepared from C600 {clpX'^] and pSG22101 cells The control for the released MuA (middle set of lanes) used the {clpX^] cells, {b] Replication of mini-Mu DNA in ClpX" ex­ same volume of material from glycerol gradient fractions in tract; the STCs in the samples on the right were treated with which the STC had not been treated with ClpX (as in a top). The purified ClpX before initiation of the replication reaction, rightmost set of reactions contain MuA that had not been used whereas those on the left were not treated with ClpX. Replica­ in a previous reaction. Arrows indicate donor DNA, and the tion was for the times as indicated. DNA products were cleaved strand transfer products that result from joining of one (single- with Hpal before electrophoresis. Arrows mark positions of the end strand transfer) or two (pair-wise strand transfer) of the do­ mini-Mu plasmid (donor) and the products of replicative trans­ nor oligonucleotides into the target DNA. position (cointegrate).

2402 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

ClpX disassembles the Mu tiansposase

the carboxyl terminus retain the ablity to interact with The last 8 amino acids at the carboxyl terminus of MuB protein but are not efficient substrates for initiation MuA are QNRRKKAI (Harshey et al. 1995). This se­ of Mu DNA repHcation in vitro (Nakai and Kruklitis quence appeared similar to the carboxy-terminal amino 1995). Therefore, we investigated the abiUty of deriva­ acidic sequence of XO protein (Sanger et al. 1982), PI Phd tives of MuA carrying deletions of the carboxyl-terminus protein (Lehnherr et al. 1993; Lehnherr and Yarmolinsky to be disassembled by ClpX. 1995), and the virulent derivatives of the Mu repressor ClpX was unable to disassemble STCs containing a (Geuskens et al. 1992; Laachouch et al. 1995); these pro­ MuA protein missing the last 48 amino acids (Fig. 6a) teins are all known or suspected substrates of the ClpXP (MuAl-615; described in Baker et al. 1991). In contrast, protease. Therefore, the ability of ClpXP to degrade MuA the STCs made with a MuA derivative lacking Id amino and the carboxy-terminal deletion derivatives was inves­ acids from the amino terminus were disassembled effi­ tigated. Purified ClpP protein was added to reactions ciently by ClpX (data not shown). To define more pre­ containing monomeric MuA, ClpX, and ATP. Under cisely the region of the carboxyl terminus required for these conditions, the full-length MuA monomer was de­ disassembly by ClpX, smaller carboxy-terminal dele­ graded by ClpXP, the variants lacking 4 or 8 amino acids tions were constructed by moving the truncations made were not degraded efficiently, and the protein with the as glutathionine S-transferase (GST) fusion proteins (Wu 48-amino-acid deletion was refractory to degradation and Chaconas 1994) into the MuA expression plasmid (Fig. 6b). These data suggest that the carboxy-terminal (see Materials and methods). STCs containing MuA sequence of MuA is recognized by ClpX during disassem­ missing either the last 4 or 8 amino acids were disassem­ bly and this recognition can result in ClpX-dependent bled less efficiently by ClpX than those made with full- degradation by ClpP in vitro. length MuA (Fig. 6a). These data suggest that the amino acid sequence at the extreme carboxyl terminus of MuA Discussion is important for disassembly and may be recognized di­ ClpX functions as a molecular chaperone to rectly by ClpX. The carboxy-terminal domain of MuA is disassemble the MuA tetramer. required for replicative transposition in vivo, but is not essential for the nonreplicative transposition that occurs The E. coli ClpX protein catalyzes disassembly of the during infection (Betermier et al. 1989; Desmet et al. MuA tetramer-DNA complex, the active form of MuA 1989); whether the requirement for this domain during responsible for transpositional recombination. Disas­ replicative transposition reflects the need for MuA-MuB sembly (1) depends on ATP, and probably on ATP hy­ interactions or MuA-ClpX interactions, or both, is not drolysis; (2) does not require the ClpP protease; (3) occurs yet clear. without degradation; and (4) releases active, monomeric MuA. Clearly, ClpX must recognize MuA and promote a transient conformational change in the protein to medi­ ate disassembly. Therefore, we conclude that ClpX func­ tions as a molecular chaperone during Mu transposition in vitro. Extracts made from ClpX-defective cells replicate Mu DNA poorly but maintain the ability to replicate a plas­ mid carrying the E. coli chromosomal origin. Therefore, these extracts must contain the essential £. coli replica­ tion fork proteins that are responsible for Mu DNA rep­ STC free DNA lication as well. Treatment of STCs with purified ClpX STC/CDC products before their introduction into the defective replication extract restores Mu replication. Thus, ClpX is important for Mu replication in vitro. In vivo, Mu replication is blocked by mutations in the clpX gene but proceeds nor­ mally in cipP-deficient cells, leading to the suggestion that ClpX might act alone during Mu replication as a

MuA wt A4 A 8 A48 chaperone or that ClpX may function with a protein time (min) |0 30 60l0 3060|03060|030 60 other than ClpP (Mhammedi-Alaoui et al. 1994) These MuA ^ data, taken together with the results presented here that ClpX recognizes MuA directly and disassembles the STC, strongly support the hypothesis that the chaperone Figure 6. Carboxy-terminal sequence of MuA is required for activity promoted by ClpX is the essential function of disassembly by ClpX and for degradation by ClpXP. \a] Strand this protein during phage replication. transfer complexes (STC) were made with wild-type MuA and with carboxy-terminal deletion variants lacking 4 (A4), 8 (A8), It has been reported previously that MuA prevents ini­ and 48 (A48) amino acids. The STC, CDC and free product tiation of Mu replication by purified host replication pro­ DNAs are indicated by arrows, (bj Western blot analysis of wild- teins in the absence of additional unidentified host fac­ type MuA and A4, A8, and A48 MuA variants incubated with tors (Kruklitis and Nakai 1994; Nakai and Kruklitis ClpXP for 0, 30, and 60 min at 30 °C. 1995); ClpX is very likely one of these additional factors.

GENES & DEVELOPMENT 2403 Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Levchenko et al.

The details of when ClpX functions with respect to other lysis by ClpP by catalyzing a chaperone-like function events necessary for repHcation initiation are not yet was proposed by Squires and Squires (1992) (see also clear; however, both in vivo and in vitro analyses now Gottesman and Maurizi 1992; Craig et al. 1994) and this place its role at the transition between recombination conclusion was strongly supported by the discovery that and assembly of the replication forks at the newly ClpA can function as a chaperone in vitro (Wickner et al. formed Mu DNA-host DNA junctions. The role of MuB 1994). ClpA, like ClpX, was purified for its ability to protein in Mu replication also needs to be clarified. The promote degradation in concert with ClpP (Hwang et al. requirement of MuB for Mu replication in vivo and in 1988; Katayama et al. 1988). The chaperone activity was vitro has been reported (Mizuuchi 1983; Chaconas et al. uncovered subsequently by the observation that ClpA, 1985), but in a reconstituted replication reaction MuB acting alone, could substitute in vitro for the Hsp70 was not found to be required (Kruklitis and Nakai 1994). chaperone, DnaK, and its co-chaperone DnaJ, in activat­ It is now apparent that ClpX and MuB recognize over­ ing the replication initiator protein of phage PI by con­ lapping regions at the carboxyl terminus of MuA, sug­ verting inactive dimers into active monomers (Wickner gesting that competition between MuB and ClpX for this et al. 1994). While this study on ClpX was nearing com­ region of MuA may be important during the transposi­ pletion, a publication appeared demonstrating that tion pathway. Preliminary results indicate that, in vitro, ClpX disaggregates heat-denatured kO protein in vitro high levels of MuB protein antagonize the MuA-releas- and exhibits XO protein-stimulated ATPase activity ing activity of ClpX (data not shown). (Wawrynow et al. 1995). In agreement with our charac­ terization of the mechanism by which ClpX disassem­ bles the MuA tetramer, this study concluded that ClpX The Clp protein family as chaperones and mediators has the activities normally attributed to a molecular of proteolysis. chaperone (Wawrynow et al. 1995). Thus, both of the Clp The mechanism by which ClpX disassembles the MuA ATPases known to function with the ClpP protease have tetramer and the way it targets proteins for degradation intrinsic chaperone activity in vitro; ClpX appears to by ClpP are probably closely related. Although we puri­ function as a chaperone in vivo as well (see discussion fied ClpX on the basis of assays that require only the above). chaperone activity, and the chaperone activity appears to Discovery that ClpA and ClpX are chaperones under­ be its essential function, MuA is also a substrate for deg­ scores that the unifying activity of the Clp ATPase fam­ radation by ClpXP in vitro. Both chaperone activity and ily is their chaperone activity rather than their ability to degradation require ATP and are sensitive to the specific promote proteolysis. There are several members of the amino acid sequence at the carboxyl terminus of MuA. Clp family for which a direct role in proteolysis has not As disassembly must involve recognition of MuA by been indicated. A Clp homolog from Saccharomyces cer- ClpX and an ATP hydrolysis-dependent conformational evisiae, Hspl04, appears to take apart protein aggregates change in MuA to destablize the stable tetramer, it is that arise during exposure of cells to high temperature, reasonable to conclude that during proteolysis by ClpXP, but does not appear to promote their degradation (Parsell ClpX recognizes the substrate and promotes a conforma­ et al. 1991). The closest E. coli homolog of Hspl04 is tional change in the target protein to render it suscepti­ ClpB; ClpB, like Hspl04, is a heat shock protein essen­ ble to peptide bond hydrolysis by the active sites in ClpP. tial for cell growth at high temperature (Kitagawa et al. In this regard, it is interesting that the MuA released 1991; Squires et al. 1991). ClpB has protein-stimulated from the STC is active, and therefore, must be folded ATPase activity, but has not been shown to function as properly. As MuA is a large, multidomain protein that an activator of degradation by ClpP (Woo et al. 1992). does not refold spontaneously and efficiently in vitro Thus, the Clp family members appear to be chaperones (data not shown), these data suggest either that ClpX specialized for protein disassembly. Whether the end re­ does not "globally" unfold MuA during disassembly or sult of this chaperone activity is a disassembled or de­ that after disassembly, ClpX promotes the accurate re­ graded version of the substrate protein probably depends folding of MuA. on several factors, including the substrate protein, the Although ClpXP can degrade MuA in vitro, ClpP is not Clp family member catalyzing the reaction, and the essential for Mu growth and replication. It is difficult to availability of a collaborating protease. tell if MuA is normally degraded by ClpXP. In vivo, both Electron microscopy reveals a striking similarity be­ physical and functional assays demonstrate that MuA is tween the ClpAP protease and proteasome complex of unstable (Pato and Reich 1982, 1984; Gama et al. 1990). eukaryotes and archaebacteria (Kessel et al. 1995; for a Mutations in hflA and hflB stabilize MuA (Gama et al. review of proteasome, see Peters 1994; Lowe et al. 1995). 1990), whereas a clpX mutation does not have a sub- Both protein complexes form a multimeric ring-shaped stainal effect (Mhammedi-Alaoui et al. 1994), indicating structure. Like ClpAP, the 26S proteosome complex con­ that the Hfl proteases, rather than ClpXP, are principally sists of a proteolytic core particle (20S proteasome) and a responsible for its degradation. However, it is possible ATPase-containing complex (19S cap complex). Degra­ that the pool of MuA in the STCs is usually degraded by dation of ubiquitinated proteins by 20S proteasome is ClpXP; this would explain why MuA is still functionally probably coupled to a chaperone-like activity of the 19S unstable in hfl defective host cells (Gama et al. 1990). complex. Thus, the coupling of chaperone-catalyzed pro­ The possibility that the Clp ATPases activate proteo­ tein unfolding and proteolytic degradation appears reca-

2404 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

ClpX disassembles the Mu ttansposase pitulated in multiple pathways of protein turnover. ClpX Mu-releasing reaction was loaded directly onto the DEAE cel­ is a promising candidate for mechanistic and structural lulose column equilibrated with buffer used for phosphocellu­ analysis of these processes. It is smaller than the other lose. Bound proteins were eluted with gradient of KCl from 50 Clp family members, yet it functions both as a chaper- to 400 mM. Fractions eluted at 250-300 mM KCl, active in Mu- releasing reaction, were directly loaded onto hydroxylapatite one and as a mediator of proteolysis; furthermore, it ap­ column (fraction I) , equilibrated with buffer A. Mu-releasing pears to recognize a defined region of MuA protein to activity was eluted by gradient of potassium phosphate (pH 7.2) initiate both processes. from 0 to 300 mM and was purified further by chromatography Roles for molecular chaperones in preventing protein on Affi-Gel Blue (eluted by KCl gradient from 100 to 800 mM), aggregation and helping proteins across membranes are heparin-Sepharose (eluted by KCl gradient from 0 to 250 mM), well established. In addition, chaperones have now been hydroxylapatite (fraction II) [gradient from 10 to 250 mM potas­ shown to be important for replication of phage PI (Wick- sium phosphate (pH 7.0)], Mono Q and Superose 6 (at conditions ner et al. 1994), phage X (Alfano and McMacken 1989; for described below). After Superose 6 ClpX was >90% pure as review, see Echols 1990|, and phage Mu (this study). determined by SDS-PAGE stained with Coomassie Blue. These three systems share the feature of utilizing protein ClpX protein was also purified from 20 grams of BL21- (DE3)pLysS cells containing overexpressing plasmid pET-3a/ complexes that are trapped in a specific configuration ClpX. Cell lysis was as described (Baker et al. 1993). Lysate was that prevents a reaction from continuing without the centrifuged at 20,000 rpm for 40 min (SS34 rotor; Sorvall). Clear input of energy by the chaperone. Many biological pro­ lysate was dialysed overnight against buffer B [25 mM Tris HCl cesses involve the construction of very stable protein (pH 7.5), 10% glycerol, 2 mM DTT, 0.1 mM EDTA], containing complexes that must be disassembled or destroyed even­ 50 mM KCl. Dialysed material was loaded on Q-Sepharose Fast tually. Mu transposition continues to be a useful system Flow column (Pharmacia), equilibrated with buffer B and 50 mM to study the mechanisms underlying assembly and dis­ of KCl. Proteins were eluted by gradient of KCl from 50 to 400 assembly of such complexes. mM. Fractions, containing ClpX (as determined by SDS-PAGE), were pooled and dialysed overnight against buffer B with 10 mM MgCl2. Dialysed material was loaded onto a heparin-Sepharose Materials and methods column (Pharmacia), equilibrated with the same buffer. Pro­ DMA teins were eluted by KCl gradient from 0 to 250 mM. Fractions containing ClpX were pooled. ClpX was purified further by ClpX gene was amplified by PCR from E. coli (strain C600, chromatography on Mono Q (PC 1.6/5) (elution by 50-400 mM New England Biolabs) chromosomal DNA, using primers KCl gradient) and gel filtration on Superose 6 (PC 3.2/30) (using designed based on the pubUshed sequence of (Gottesman buffer B with 150 mM KCl). After Superose 6 ClpX was >95% et al, 1993): TBI89: GGGAATTCCATATGACAGATAAACG- pure as determined by scanning of Coomassie Blue-stained SDS- CAAAG; TB190: GCGCGCGGATCCGCGGCTATTCACCA- PAGE. GATGCCTGTTGCGCTTC. The clpX gene was cloned using the Ndel and BamHl sites of the expression vector pET-3a (Novagene) (plasmid pET- 3a/ClpX). MuA deletion proteins lacking 4 (A4) and 8 (A8) Transposition reactions amino acids from the carboxyl terminus were PCR-ampli- Strand transfer reactions were performed as described previ­ fied from plasmids pN85 and pN81 (Wu and Chaconas 1994), ously (Baker et al. 1993). Reaction mixtures (25 jjil) contained 25 using primers: TB256: GGGAGCTGCATGTGTCAGAGG and mM HEPES/KOH (pH 7.8), 156 mM NaCl, 10 mM MgCl^, 2 mM TB258: CCCCGGCCGGCCGTGAATATCGCCGCCGCCAG- ATP, 15% glycerol, 10 |xg/ml of mini-Mu donor DNA (pSGl), AAACAAC. and 10 M-g/ml of <|)X174 DNA. The protein levels were HU, 3 The resulting PCR fragments were cloned into pWZ170 (Wu pmoles; MuB, 6.5 pmoles; MuA [A4, A8, or A48 MuA (1-615 and Chaconas 1994) a derivative of pMK591 (Baker et al. 1993). mutant) (Baker et al. 1991)], 1.33 pmoles. Reactions were incu­ The Mu donor DNA used in all experiments was pSGl (Baker bated at 30°C for 20 min. Intramolecular strand transfer reac­ and Luo 1994). 4>X174 RFI was (target DNA) purchased from tions were performed as above except that MuB, ({)X174 DNA, GIBCO-BRL. and ATP were omitted. Strand transfer reactions with ^^P-labeled oligonucleotides Proteins (0.0014 pmoles), containing R1R2 sequence of Mu DNA and MuA protein, A4, A8, and A48 (MuAl-615) were purified as <|)X174 phage DNA (0.0014 pmoles) were performed as described described in Baker et al. (1993). MuB and Hu proteins were the (Savilahti et al. 1995). same fractions described previously (Baker et al. 1994). ClpP protein was purified from cells containing the overexpressing plasmid pAED4/ClpP as described (Thompson and Maurizi MuA releasing reactions 1994). The \0 protein was purified from cells containing the overexpressing plasmid pRLM73 as described (Roberts and Mc­ Mu-releasing reactions were performed as follows. Mu strand Macken 1983). transfer reactions were supplemented by 8 mM ATP, 40 mM ClpX was purified from 325 grams of C600 cells based ini­ creatine phosphate, and 0.1 mg/ml creatine kinase; 2.5-5.0 tially on the activity in an Mu-releasing reaction and later by pmoles of ClpX protein (assuming a native molecular weight of following \0 degradation (with the addition of ClpP protein) as a tetramer) was added to start reaction. Creatine phosphate and well. Briefly, the method was as follows: fraction II, active in creatine kinase were omitted when reactions contained mini-Mu plasmid replication in vitro was chromatographed on ATP[7S] (5 mM). After incubation at 30°C for 60 min portions of a phosphocellulose PU column (Whatman), equilibrated with the samples were analyzed by gel electrophoresis as described buffer A [50 mM Tris HCl (pH 7.2), 10% glycerol, 2 mM DTT, 0.1 (Baker et al. 1993), except the gel and electrophoresis buffer mM EDTA] with 50 mM KCl. Flowthrough fraction active in contained 10 M-g/ml of heparin and 80 |xg/ml of BSA.

GENES & DEVELOPMENT 2405 Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Levchenko et al.

Glycerol gradient sedimentation of released MuA before publication. Steve Bell, Alan Grossman, Patrick Waller, Michael Maurizi and members of our laboratory provided help­ Intramolecular STCs were assembled as described above. Unre- ful comments on the manuscript. T.A.B. is a recipient of an acted MuA protein was removed as described (Baker et al. 1993) National Science Foundation Young Investigator Award. and the purified STCs were incubated with ClpX protein as The publication costs of this article were defrayed in part by described above. After completion of the reaction, NaCl was payment of page charges. This article must therefore be hereby added to 300 mM and samples (50 |JL1) were loaded onto 1.1-ml marked "advertisement" in accordance with 18 USC section glycerol gradients [14%-20%, with an 80% shelf containing 25 1734 solely to indicate this fact. mM HEPES/KOH (pH 7.8), 300 mM NaCl, 2 mM DTT, and 0.1 mM EDTA]. Gradients were run for 90 min at 55,000 rpm (4°C) using a TLS-55 rotor and fractionated by collecting 90-fjLl sam­ References ples from the top of the gradient. The distribution of DNA in Adzuma, K. and K. Mizuuchi. 1988. Target immunity of Mu the gradient fractions was determined by gel electrophoresis transposition reflects a differential distribution of MuB pro­ and quantitated using the gel print 20001 (Bio Photonics). The tein. Cell 53: 257-266. presence of MuA was determined by Western blot analysis. The Alfano, C. and R. McMacken. 1989. Heat shock protein-medi­ concentration of released MuA was estimated by scanning of ated disassembly of nucleoprotein structures is required for Western blots, developed with '^^I-labeled protein A on Phos- the initiation of bacteriophage X DNA replication. /. Biol. pholmager 445 SI. Chem. 264: 10709-10718. Sainton, R.G., K.M. Kubo, J. Feng and N.L. Craig. 1993. Tn7 Protein degradation by ClpXP transposition: Target DNA recognition is mediated by mul­ The X.O degradation conditions were as described (Wojtkowiak tiple Tn7-encoded protein in a purified in vitro system. Cell et al. 1993). Protein levels were as follows: 100 ng of X.O protein, 72:931—943. 0.5 mg of ClpX protein, and 1.0 mg of ClpP protein [fraction Baker, T.A. and L. Luo. 1994. Identification of residues in the from DEAE-cellulose (Wojtkowiak et al. 1993)). The reaction Mu transposase essential for catalysis. Proc. Natl. Acad. Sci. mixture (25 |JL1) was incubated for 60 min at 30°C. Degradation 91: 6654-6658. of XO was monitored by Western blot analysis. MuA degrada­ Baker, T.A., M. Mizuuchi, and K. Mizuuchi. 1991. MuB protein tion conditions were as follows: reactions (20 JJLI) contained 25 allosterically activates strand transfer by the transposase of mM HEPES/KOH (pH 7.8), 156 mM NaCl, 10 mM MgCl2, 10 mM phage Mu. Cell 65: 1003-1013. ATP, 15% glycerol, 200 ng of ClpX , 100 ng of ClpP, and 1 |xg of Baker, T.A., M. Mizuuchi, H. Savilahti, and K. Mizuuchi. 1993. MuA. Reactions were incubated at 30F8C. Samples were anal­ Division of labor among monomers within the Mu trans­ ysed by Western blot, using anti MuA antibody and '^^I-labeled posase tetramer. Cell 74: 723-733 . protein A. Blots were scanned on Phosphorlmager 445 SI. Baker, T.A., E. Krementsova and L. Luo. 1994. Complete trans­ position requires four active monomers in the Mu trans­ posase tetramer. Genes &. Dev. 8: 2416-2428. In vitro replication reactions Betermier, M., R. Alazard, V. Lefrere, and M. Chandler. 1989. Replication extracts (fraction II) were prepared as described Functional domains of bacteriophage Mu transposase: prop­ (Fuller et al. 1981) and in vitro replication of pBSoriC and the erties of C-terminal deletions. Mol. Microbiol. 3: 1159- mini-Mu DNA was performed as described previously (Fuller et 1I7I. al. 1981; Mizuuchi 1983; Kruklitis and Nakai 1994) Reaction Chaconas, G., E.B. Giddens, J.L. Miller, and G. Gloor. 1985. A mixture contained 25 mM of HEPES/KOH (pH 7.9), 40 mM of truncated form of the bacteriophage MuB protein promotes KCl, 10 mM MgCl^, 50 mg/ml of BSA, 4% polyethylene glycol conservative integration, but not replicative transcription, of 8000, 2 mM of ATP, 40 mM each of dATP, TTP, dCTP, dCTP, 40 Mu DNA. Cell 41: 857-865. mM of creatine phosphate, 0.1 mg/ml of creatine kinase, 30 Craig, E.A., J.S. Weissman, and A.L. Horwich. 1994. Heat shock |ig/ml of rifampicin, ('^H]TTP or ['^^PjdATP (for a final specific proteins and molecular chaperons: Mediators of protein con­ activity of 1000 cpm/pmole) and 0.5 |jLg of pBSoriC or STC. The formation and turnover in the cell. Cell 78: 365-372. reaction mixtures were incubated at 30°C for 60 min. The rep­ Craigie, R. and K. Mizuuchi. 1987. Transposition of Mu DNA: lication activity for oriC template was measured by scintilla­ Joining of Mu to target DNA can be uncoupled from cleavage tion counting of TCA-perceptible DNA. One hundred percent at the ends of Mu. Cell 51: 493-501. of replication activity for pBSoriC plasmid is equal of 96.8 Desmet, L., M. Faelen, M.J. Gamma, A. Ferhat, and A. Tous- pmoles of dTMP incorporated under standard conditions. The saint. 1989. Characterization of amber mutations in bacte­ replication activity for mini-Mu template was measured by riophage Mu transposase: A functional analysis of the pro­ scanning of dried agarose gels, containing '^^P-labeled DNA rep­ tein. Mol. Microbiol. 3: 1145-1158. lication products on Phosphorlmager 445 SI (Molecular Dynam­ Dyda, F., A.B. Hickman, T.M. Jenkins, A. Engelman, R. Craigie, ics). For enzymatic manipulations '^^P-labeled DNA replication and R.R. Davies. 1994. Crystal structure of the catalytic do­ products were purified as described (Kruklitis and Nakai 1994). main of HIV-1 integrase: Similarity to other polynucleotidyl Samples were digested with Hpal and analyzed by gel electro­ transferases. Science 266: 1981-1986 . phoresis. Dried gels were scanned on Phosphorlmager 445 SI. Echols, H. 1990. Nucleoprotein structures initiating DNA rep­ lication, transcription, and site-specific recombination. /. Acknowledgments Biol. Chem. 265: 14697-14700. Ellison, V. and P.O. Brown. 1994. A stable complex between We wish to thank Susan Gottesman for gifts of strains and an­ integrase and viral DNA ends mediates human immunode­ tibodies against ClpX and ClpP; Roger McMacken for antibody ficiency virus integration in vitro. Proc. Natl. Acad. Sci. to XO protein; Ross Inman for a strain overproducing XO; Ar­ 91: 7316-7320. thur Horwich for the strain overproducing ClpP; Zhen-guo Wu Fuller, R.S., J.M. Kaguni, and A. Kornberg. 1981. Enzymatic rep­ and George Chaconas for plasmids encoding deletions of do­ lication of the origin of the Escherichia coli chromosome. main III of MuA; and Hiroshi Nakai for communicating results Proc. Natl. Acad. Sci. 78: 7370-7374.

2406 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

ClpX disassembles the Mu transposase

Gama, M.-J., A. Toussaint, and M.L. Pato. 1990. Instability of 233: 414-428. bacteriophage Mu transposase and the role of host Hfl pro­ Lowe, J., D. Stock, B. Jap, P. Zwickl, W. Baumeister, and R. tein. Mol. Microbiol. 4: 1891-1897. Hubert. 1995. Crystal structure of the 20S proteasome from Geuskens, V., A. Mhammedi-Alaoui, L. Desmet, and A. Tous­ the archaeon T. acidophilum at 3.4 A resolution. Science saint. 1992. Virulence in bacteriophage Mu: A case of trans- 268:533-539. dominant proteolysis by the E. coli Clp serine-protease. Maxwell, A., R. Craigie, and K. Mizuuchi. 1987. B protein of EMBO f. 11:5121-5127. bacteriophage Mu is an ATPase that preferentially stimu­ Gottesman, S., C. Squires, E. Pichersky, M. Carrington, M. lates intermolecular DNA strand transfer. Proc. Natl. Acad. Hobbs, J.S. Mattick, B. Dalrymple, H. Kuramitsu, T. Shiroza, Sci. 84: 699-703. T. Foster, W.P. Clark, B. Ross, C.L. Squires, and M.R. Maur- Mhammedi-Alaoui, A., M. Pato, M. Gama, and A. Toussaint. izi. 1990. Conservation of the regulatory subunit for the Clp 1994. A new component of bacteriophage Mu replicatiive ATP-dependent protease in prokaryotes and eukaryotes. transposition machinery: The Escherichia coli ClpX protein. Proc. Natl. Acad. Sci. 87: 3513-3517. Mol. Microbiol. 11: 1109-1116. Gottesman, S., W.P. Clark, V. Crecy-Lagard, and M.R. Maurizi. Mizuuchi, K. 1983. In vitro transposition of bacteriophage Mu: 1993. ClpX, an alternative subunit for ATP-dependent Clp a biochemical approach to a novel replication reaction. Cell protease of E. coH. /. Biol. Chem. 268: 22618-22626. 35: 785-794. Gottesman, S. and M.R. Maurizi. 1992. Regulation by proteol­ Mizuuchi, K. 1992. Transpositional recombination: mechanis­ ysis: Energy-dependent proteases and their targets. Micro­ tic insights from studies of Mu and other elements. Annu. biol. Rev. 56:592-621. Rev. Biochem. 61: 1011-1051. Haniford, D.B., H.W. Benjamin, and N. Kleckner. 1991. Kinetic Mizuuchi, M., T.A. Baker, and K. Mizuuchi. 1992. Assembly of and structural analysis of a cleaved donor intermediate and a the active form of the transposase-Mu DNA complex: A crit­ strand transfer intermediate in TnlO transposition. Cell ical control point in Mu transposition. Cell 70: 303-311. 64:171-179 . Nakai, H. and R. Kruklitis. 1995. Disassembly of the bacterio­ Harshey, R.M., E.D. Getzoff, D.L. Baldwin, J.L. Miller, and G. phage Mu transposase for the initiation of Mu DNA replica­ Chaconas. 1985. Primary structure of phage mu transposase: tion. /. Biol. Chem. 270: 19591-19598. Homology to mu repressor. Proc. Natl. Acad. Sci. 82: 7676- Parsell, D.A., Y. Sanchez, J.D. Stitzel, and S. Lindquist. 1991. 7680. Hspl04 is a highly conserved protein with two essential nu- Hwang, B.J., K.M. Woo, A.L. Goldberg, and C.H. Chung. 1988. cleotide-binding sites. Nature 353: 270-273. Protease Ti, a new ATP-dependent protease in Escherichia Pato, M.L. and C. Reich. 1982. Instability of transposase activ­ coli contains protein-activated ATPase and proteolytic func­ ity: Evidence from bacteriophage Mu DNA replication. Cell tions in distinct subunits. /. Biol. Chem. 263: 8727-8734. 29:219-225. Katayama, Y., S. Gottesman, J. Pumphrey, S. Rudikoff, W.P. . 1984. Stoichiometric use of the transposase of bacterio­ Clark, and M.R. Maurizi. 1988. The two ATP-component, phage Mu. Cell 36: 197-202. ATP-dependent Clp protease of Escherichia coli. /. Biol. Peters, J.-M. 1994. Proteasomes: Protein degradation machines Chem. 263: 1522(>-15236. of the cell. Trends Biochem. Sci. 19: 377-382. Kessel, M., M.R. Maurizi, B. Kim, E. Kocsis, B. Trus, S.K. Singh, Resibois, A., M. Pato, P. Higgins, and A. Toussaint. 1984. Rep­ and A.C. Steven. 1995. Homology in structural organization lication of bacteriophage Mu and its mini-Mu derivatives. In between E. coli ClpAP protease and the eukaryotic 26 S pro- Proteins involved in DNA replication (ed. U. Hubscher and teasome. /. Mol. Biol. 250: 587-594. S. Spadari), pp. 69-76. Plenum Press, New York. Kitagawa, K., C. Wada, S. Yoshioka, and T. Yura. 1991. Espres- Rice, P.A. and K. Mizuuchi. 1995. Structure of the bacterio­ sion of ClpB, an analog of the ATP-depedent protease regu­ phage Mu transposase core: A common structural motif for latory subunit in Escherichia coli, is controlled by a heat DNA transposition and retroviral integration. Cell 82: 209- shock sigma factor, sigma 32. /. Bacteriol. 173: 4247-4253. 220. Kruklitis, R. and H. Nakai. 1994. Participation of the bacterio­ Roberts, J.D. and R. McMacken. 1983. The bacteriophage \0 phage MuA protein and host factors in the initiation of Mu protein: Isolation and characterization of the amplified ini­ DNA synthesis in vitro. /. Biol. Chem. 269: 16469-16477. tiator. Nucleic Acids Res. 11: 7435-7452. Laachouch, J.E., L. Desmet, V. Geuskens, R. Grimaud, and A. Ross, W., S.H. Shore, and M.M. Howe. 1986. Mutants of Esch­ Toussaint. 1995. Bacteriophage Mu repressor as a target for erichia coli defective for replicative transposition of bacte­ the E. coli ATP-dependent Clp protease. EMBO f. (in press). riophage Mu. /. Bacteriol. 167: 905-919. Lavoie, B.D. and G. Chaconas. 1990. Immunoelectron micro­ Sanger, F., A.R. Coulson, G.F. Hong, D.F. Hill, and G.B. Peter­ scopic analysis of the A, B, and HU protein content of bac­ son. 1982. Nucleotide sequence of lambda DNA. /. Mol. Biol. teriophage Mu transpososomes. /. Biol. Chem. 265: 1623- 162: 729-773. 1627. Savilahti, H., P.A. Rice, and K. Mizuuchi. 1995. Phage Mu trans­ Lavoie, B.D., B.S. Chan, R.G. Allison, and G. Chaconas. 1991. pososome core: Minimum DNA requirements for its assem­ Structural aspects of a higher order nucleoprotein complex: bly and function. EMBO f. (in press). Induction of an altered DNA structure at the Mu-host junc­ Squires, C. and C.L. Squires. 1992. The Clp proteins: Protein tion of the Mu type 1 transpososome. EMBO j. 10: 3051- regulators or molecular chaperons? /. Bacteriol. 174: 1081- 3059. 1085. Lehnherr, H. and M.B. Yarmolinsky. 1995. Addiction protein Squires, C.L., S. Pedersen, B.M. Ross, and C. Squires. 1991. ClpB Phd of plasmid prophage PI is a substrate of ClpXP serine is the Escherichia coli heat shock protein F84.1 /. Bacteriol. protease of Escherichia coli. Proc. Natl. Acad. Sci. 92: 3274— 173: 4254-4262. 3277. Surette, M.G. and G. Chaconas. 1991. Stimulation of the Mu Lehnherr, H., E. Maguin, S. Jafri, and M.B. Yarmolinsky. 1993. DNA strand cleavage and intramolecular strand transfer re­ Plasmid addiction genes of bacteriophage PI: doc, which actions by the Mu B protein is independent of stable binding causes cell death on curing of prophage, and phd, which pre­ of the Mu B protein to DNA. /. Biol. Chem. 266: 17306- vents host death when prophage is retained. /. Mol. Biol. 17313.

GENES & DEVELOPMENT 2407 Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Levchenko et al.

Surette, M.G., S.J. Buch, and G. Chaconas. 1987. Transposos- omes: Stable protein-DNA complexes involved in the in vitro transposition of bacteriophage Mu DNA. Cell 49: 253- 262. Surette, M. G., T. Harkness, and G. Chaconas. 1991. Stimula­ tion of the MuA protein-mediated strand cleavage reaction by the MuB protein, and the requirement of DNA nicking for stable type 1 transpososome formation. In vitro transposi­ tion characteristics of mini-Mu plasmids carrying terminal base pair mutations. /. Biol. Chem. 266: 3118-3124. Thompson, M.W. and M.R. Maurizi. 1994. Activity and speci­ ficity of Escherichia coli ClpAP protease in cleaving model peptide substrates. /. Biol. Chem. 69: 18201-18208. Toussaint, A. and M. Faelen. 1974. The dependence of temper­ ate phage Mu-1 upon the replication functions of E. coli K12. Mol. Gen. Genet. 131: 209-214. Toussaint, A. and A. Resibois. 1983. Phage Mu: Transposition as a life-style. In Mobile genetic elements (ed. J. Shapiro), pp. 105-158. Academic Press, New York. Waggoner, B.T., M.L. Pato, A. Toussaint, and M. Faelen. 1981. Replication of mini-Mu prophage DNA. Virology 113: 379- 387. Wawrzynow, A., D. Wojtkowiak, J. Marzsalek, B. Banecki, M. Jonsen, B. Graves, C. Georgopoulos, and M. Zylicz. 1995. The ClpX heat-shock protein of Escherichia coli, the ATP- dependent substrate specificity component of the ClpP-ClpX protease, is a novel molecular chaperone. EMBO f. 14: 1867- 1877. Wickner, S., S. Gottesman, D. Skowyra, J. Hiskins, K. McKen- ney, and M.R. Maurizi. 1994. A molecular chaperone, ClpA, functions like DnaK and DnaJ. Proc. Natl. Acad. Sci. 91: 12218-12222. Wojtkowiak, D., C. Georgopoulos, and M. Zylicz. 1993. Isola­ tion and characterization of ClpX, a new ATP-dependent specificity component of ClpP protease of E. coli. /. Biol. Chem. 268:22609-22617. Woo, K.M., K. Kim, A.L. Goldberg, D.B. Ha, and C.H. Chung. 1992. The heat-shock protein ClpB in Escherichia coli is a protein-activated ATPase. /. Biol. Chem. 267: 20429-20434. Wu, Z. and G. Chaconas. 1994. Characterization of a region in phage Mu transposase that is involved in interaction with the MuB protein. /. Biol. Chem. 269: 28829-28833.

2408 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press

Disassembly of the Mu transposase tetramer by the ClpX chaperone.

I Levchenko, L Luo and T A Baker

Genes Dev. 1995, 9: Access the most recent version at doi:10.1101/gad.9.19.2399

References This article cites 60 articles, 29 of which can be accessed free at: http://genesdev.cshlp.org/content/9/19/2399.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.

Copyright © Cold Spring Harbor Laboratory Press