A CHEMICAL APPROACH TO DISTINGUISH ATP-DEPENDENT PROTEASES
By
JENNIFER FISHOVITZ
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation Advisor: Dr. Irene Lee
Department of Chemistry
CASE WESTERN RESERVE UNIVERSITY
January, 2011
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES Jennifer Fishovitz PhD Mary Barkley Irene Lee Thomas Gerken Anthony Berdis Michael Zagorski 11/19/10 TABLE OF CONTENTS
Title page 1
Committee Sign-off sheet 2
Table of Contents 3
List of Tables 5
List of Schemes 6
List of Figures 7
Acknowledgments 10
List of Abbreviations 11
Abstract 15
CHAPTER 1: INTRODUCTION 17
CHAPTER 2: COMPARISON OF INHIBITION OF BACTERIAL AND
HUMAN LON PROTEASE ACTIVITY 32
Introduction 33
Materials and Methods 35
Results and Discussion 42
Conclusions 56
CHAPTER 3: CHEMICAL TOOLS TO MONITOR ATP-DEPENDENT PEPTIDASE
ACTIVITY IN ISOLATED MITOCHONDRIA 57
Introduction 58
Materials and Methods 61 3
Results and Discussion 66
Conclusion 78
CHAPTER 4: DESIGN AND CHARACTERIZATION OF ClpXP SPECIFIC
N-TERMINAL BORONIC ACID INHIBITOR 79
Introduction 80
Materials and Methods 84
Results and Discussions 91
Conclusions 99
CHAPTER 5: CONCLUSIONS AND FUTURE DIRECTIONS 100
Introduction 101
Materials and Methods 103
Results and Discussion 106
Current status and future directions 116
BIBLIOGRAPHY 119
4
LIST OF TABLES
CHAPTER 2
2.1: Kinetic parameters for ADP inhibition of peptide cleavage by human Lon 43
2.2: Kinetic parameters of inhibition of human Lon peptidase activity by DBN93
as determined by global fitting of experimental data using DynaFit 52
CHAPTER 5
5.1: Enzyme-specific peptide substrates 117
5
LIST OF SCHEMES
Scheme 2.1: Noncompetitive inhibition 44
Scheme 2.2: One-and two-step inhibition mechanisms 50
6
LIST OF FIGURES
CHAPTER 1
1.1: Normal and Lon-deficient mitochondria 20
1.2: Cleavage of Insulin B chain by Lon and ClpXP 21
1.3: Domain layout of Lon protease monomer 23
1.4: Structures of Lon and ClpXP and simplified mechanism of proteolysis 24
1.5: Proposed mechanism for peptide hydrolysis by Lon 25
1.6: Continuous fluorescent peptidase assay used to monitor enzyme activity 27
CHAPTER 2
2.1: Structures of peptide-based substrates and inhibitors used in these
experiments 34
2.2: Phosphate does not inhibit the ATPase activity of hLon 47
2.3: Pre-steady state ATP hydrolysis by human Lon 48
2.4: Time-dependent inhibition of human Lon peptidase activity by DBN93 50
2.5: Global fitting of peptide cleavage time courses in the presence of varying
amounts of inhibitor 51
2.6: DBN93 inhibits protein degradation by human Lon 54
2.7: DBN93 does not significantly inhibit hLon ATPase activity in the presence
of λN protein stimulation 56
7
CHAPTER 3
3.1: Peptide-based substrates are used to monitor activity of human Lon
and human ClpXP 68
3.2: DBN93 does not inhibit human ClpXP peptidase activity 70
3.3: Identification of mitochondrial matrix proteins isolated from HeLa cells
by Western Blot analysis 72
3.4: ATP-dependent peptide cleavage of FRETN 89-98 by isolated mitochondria
is abolished by the addition of Lon specific inhibitor, DBN93 73
3.5: Immunodepletion of Lon from isolated mitochondria abolishes
ATP-dependent peptide cleavage of FRETN 89-98 75
3.6: Chase experiments show CBN93 inhibition of StAR degradation in isolated
mitochondria 77
CHAPTER 4
4.1: Complimentary peptide boronic acid strategies utilizing the P/S and
P’/S’ sites 83
4.2: Purified samples of ClpX and ClpP 87
4.3: N-terminal peptidyl boronic acids synthesized by the Santos group and
screened for ClpXP specific inhibitors 89
4.4: DBN93 inhibits casein degradation by human Lon but not ClpXP 93
4.5: Screening of N-terminal peptidic boronic acids using FRET 89-98
peptidase assay 95 8
4.6: WLS6a IC50 determination by fluorescent peptidase assay 96
4.7: Inhibition of ClpXP degradation of casein by WLS6a 98
4.8: WLS6a does not inhibit ClpXP ATPase activity 99
CHAPTER 5
5.1: Imidazole does not affect the ATPase activity of ClpX 108
5.2: Rate of ATPase activity by ClpX is not significantly affected by the
amount of ClpP 109
5.3: Determination of kinetic parameters for ATP hydrolysis by ClpXP 110
5.4: Screening FRETN 89-98 alanine scan peptides for cleavage by ClpXP,
human Lon, and E. coli Lon 113
5.5: Fluorescently labeled Cleptide is selectively cleaved by ClpXP in the
presence of ATP 114
5.6: Cleavage of Cleptide by ClpXP can be monitored using the fluorescent
peptidase assay 115
9
ACKNOWLEDGMENTS
I would first like to thank my advisor, Dr. Irene Lee, for her patience, support and open door. She was a great teacher and always available when I needed help or a boost of confidence.
I would be lost without the support of past and current lab members: Diana, Jessi and Hilary introduced me to “great days in the Lee lab” and convinced me that I was going to love Lon whether I wanted to or not. Jason Hudak worked as an undergraduate in our lab and spent a lot of time and energy cloning ClpXP for me to use. Many thanks go to Edward Motea for always making me laugh and providing the lab with great (paraphrased) music. Sandra Craig took me under her wing and taught me the intricacies of cell culture, thank you for your help and for assuring me the cells were tougher than I thought they were, at least until they weren’t. James Becker and Kristin synthesized a number of the peptides I used in my studies and Kristin synthesized boronic acid peptide. To the “newbies”, Iteen and Natalie, thanks for making sure I stopped at some point during the day to eat lunch. Now it’s your turn to love Lon like the rest of us.
Special thanks to Dr. Anthony Berdis for numerous instances of help over the years. Collaborations with Dr. Carolyn Suzuki at UMDNJ, Dr. Webster Santos and Ken Knott at Virginia Tech, and Anton Simeonov and Tim Foley at NIH have been invaluable and are much appreciated.
Last, but not least, I want to thank my family and friends, for their unwavering support and encouragement. Now when you ask me if my thesis is done, I can finally answer, “Yes.”
10
LIST OF ABBREVIATIONS
λN Lambda N protein: a λ phage protein that allows E. coli RNA polymerase to transcribe through termination signals in the early operons of the phage
AAA+ ATPases Associated with a variety of cellular Activities
Abu Aminobutyric acid
Abz Anthranilamide
ACN Acetonitrile
ADP Adenosine diphosphate
Aloc Allyloxycarbonyl
ATP Adenosine triphosphate
BME Beta-mercaptoethanol
Boc tert-Butyloxycarbonyl
BSA Bovine Serum Albumin
Bz Benzoic acid amide
Cam Chloramphenicol
Cbz Carboxybenzyl
CBN93 Non-fluorescent C-terminal boronic acid,
Cbz-YRGIT-Abu-B(OH)2
Cleptide Y(NO2)-FAPHMALVPV-K(Abz)
dansyl 5-(dimethylamino)naphthalene-1-sulfonyl chloride
DBN93 fluorescent C-terminal boronic acid,
dansyl-YRGIT-Abu-B(OH)2
DE52 diethylaminoethyl cellulose anion exchange resin used in purification of Lon 11
DMEM Dulbecco's Modified Eagle Medium
DMSO dimethyl sulfoxide
DTT dithiothreitol
E. coli Escherichia coli, a gram negative bacteria
EDTA Ethylenediaminetetraacetic acid eLon E. coli Lon protease
FBS Fetal Bovine Serum
Fmoc Fluorenylmethyloxycarbonyl
FRET Fluorescence Resonance Energy Transfer
FRETN 89-98 Y(NO2)-YRGITCSGRQ-K(Abz)
FRETN 89-98Abu Y(NO2)-YRGIT-Abu-SGRQ-K(Abz)
HATU (2-(7-Aza-1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate)
hClpXP Human ClpXP protease
HeLa Immortal cervical cancer cells widely used in scientific research
HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)
hLon Human Lon protease
IPTG Isopropyl-β-D-thio-galactoside
Kburst Burst rate constant for ATP hydrolysis
kcat Vmax/[E]
kcat/Km Substrate specificity constant
Ki Inhibition constant
Km Michaelis constant equal to [substrate] required to reach ½ Vmax
kobs rate/[E]
Kan kanamycin 12
KPi Potassium phosphate
LB Lauria-Bertani medium
Mg(OAc)2 Magnesium actetate
Mito Mitochondria isolated from HeLa cells
MOPS 3-(N-morpholino)propanesulfonic acid
N Hill coefficient
NaCl Sodium chloride
NaPi Sodium phosphate
Ni-NTA agarose Nickel-nitrilotriacetic acid agarose: resin used to purify 6xHis- tagged proteins
NO2 Nitro
P11 Phosphocellulose cation exchange resin used to purify Lon
PCR Polymerase chain reaction
PEI-cellulose Polyethyleneimine-cellulose
pen/strep Penicillin/Streptomycin
Pi Inorganic phosphate
S. Typhimurium Salmonella enterica serovar Typhimurium
SB Super Broth
SDS Sodium Dodecyl Sulfate
SDS-PAGE Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis
SSD Sensor and Substrate Discrimination
StAR Steroidogenic Acute Regulatory protein
TBST Tris-buffered saline containing 0.05% Tween 20
TFA trifluoroacetic acid
Tris tris(hydroxymethyl)aminomethane 13
UV ultraviolet v rate
14
A Chemical Approach to Distinguish ATP-dependent Proteases
Abstract
By
JENNIFER FISHOVITZ
Mammalian Lon and ClpXP are two ATP-dependent proteases that are found in the mitochondrial matrix and have been implicated in protecting the mitochondria against damage from oxidative stress. Our lab is interested in understanding the role of
Lon and ClpXP in the regulation of levels of oxidatively damaged proteins. There has been shown to be a transient increase in ATP-dependent proteolysis activity following oxidative stress, but there has been no functional assay to distinguish between the activities of these two enzymes. Previously, genetic knock-down studies have been employed with similar proteases, but can lead to changes in cellular metabolism that obscure the accurate detection of substrates. Because Lon and ClpXP have been shown to have different peptide cleavage specificities in degrading protein substrates, I have developed a series of chemical tools which allow for the profiling these enzymes individually at a post-translational level. I now have enzyme-specific peptide substrates and enzyme-specific inhibitors that can be used to inactivate one protease while analyzing the activity of the other in order to identify their respective role in maintenance of mitochondrial function in healthy and oxidatively damaged tissue. These compounds are used in isolated mitochondria to monitor the activity of the individual protease. The information gathered in these studies will lead to the development of potent inhibitors of
15
human Lon and ClpXP, specific peptide substrates, and a method to identify physiologically relevant protein substrates of each enzyme in normal and damaged
mitochondria.
16
CHAPTER 1
INTRODUCTION
17
The mitochondria are known as the powerhouse of mammalian cells because they generate adenosine triphosphate (ATP) which provides chemical energy to carry out a number of processes to maintain the health of the overall cell. ATP is generated by the electron transport chain in the mitochondrial matrix which also produces a large amount of reactive oxygen species (ROS). ROS can cause damage to proteins within the mitochondria and accumulation of ROS and damaged proteins leads to mitochondrial dysfunction and cell death (1, 2).
Mitochondrial dysfunction has been implicated in aging and a number of diseases such as Parkinson’s disease and Alzheimer’s disease (3-7). Therefore, the damaged proteins must be removed, a task that is attributed to proteases within the mitochondria (8, 9).
Lon and ClpXP are two ATP-dependent proteases that are nuclear encoded and contain mitochondrial targeting sequences (10-12) to localize in the mitochondrial matrix (13-15) that have been proposed to remove oxidatively damaged proteins to maintain the integrity of the mitochondria (16-23). As shown in Figure 1.1, in yeast mitochondria that is deficient of Lon, large protein aggregate accumulate and damage the mitochondria compared to normal mitochondria. Recently, it has been shown that ATP-dependent proteolytic activity can be up-regulated by cellular oxidative stress, especially during cardiac ischemia/reperfusion (24, 25). However, this increase in ATP-dependent proteolytic activity has thus far been attributed to Lon without accounting for the contribution of ClpXP. As both Lon and ClpXP are localized in the mitochondrial matrix and have similar functions, it is reasonable to believe ClpXP also functions
18
to degrade oxidatively damaged proteins, most likely with substrate specificity that is different from that of Lon. Indeed, it has already been shown that although
Lon and ClpXP degrade Insulin B chain at two identical sites, each enzyme also cleaves at unique sites (Figure 1.2) (14, 26), indicating that differences in substrate specificity can be exploited to design selective peptide substrates and inhibitors to monitor the activity of the individual enzymes. Herein, I discuss the first quantitative, selective study of Lon activity in the presence of ClpXP from isolated mitochondria and live cells using chemical tools developed in our lab to study the mechanism of the bacterial homolog of Lon.
Structure and function of Lon and ClpXP
Lon and ClpXP are categorized as members of the AAA+ (ATPases associated with a variety of cellular activities) family of proteins. This large family of proteins is involved in DNA replication, transcription, membrane fusion, and proteolysis (27-30). A common feature of this protein family is an ATPase module consisting of the Walker A and Walker B motifs as well as a proposed Sensor and Substrate Discrimination (SSD) domain that interacts with protein substrates
(31). Both Lon and ClpXP share these characteristics. The domain layout of Lon is shown in Figure 1.3, containing an N domain which has been proposed to play a role in substrate recognition (32), the ATPase module for ATP hydrolysis and a
P domain where the Ser-Lys catalytic dyad is located. Like other AAA+ proteins,
Lon and ClpXP oligomerize into ring-like structures, forming a central cavity through which protein substrates are translocated to the proteolytic site for
19
Normal mitochondria Lon-deficient mitochondria
Figure 1.1: Normal and Lon-deficient mitochondria. Adapted from (33).
20
Figure 1.2: Cleavage of Insulin B chain by Lon and ClpXP. Sites of cleavage by each enzyme are indicated by arrows. Although Lon and ClpXP share some cleavage sites, their unique cleavage sites can be exploited to design enzyme- specific peptide substrates and inhibitors.
21
degradation (34), however, their oligomeric structures differ from one another.
While Lon contains its ATPase and proteolytic domains on a single polypeptide
monomer which requires Mg+, but not ATP to oligomerize into a hexamer (35-
37), the functional ClpXP oligomeric form is comprised of a ClpX ATPase and
ClpP proteolytic subunits and requires binding of ATP to complex as two ClpP
heptamers which are flanked on one or both ends by ClpX hexamers (14, 38).
Figure 1.4 shows the structures and simplified mechanism of protein degradation
by Lon and ClpXP. In the presence of ATP, a conformational change takes
places to allow for unfolding and translocation of the protein substrate through
the central cavity to the proteolytic site where it is degraded into small peptide
products. Unfolding and translocation of the protein have been proposed to be
the rate-limiting step of the reaction (39). The proposed mechanism for peptide
bond cleavage by Lon is shown in Figure 1.5, with the active site Ser acting as a
nucleophile to attack the carbonyl carbon at the scissile site to create a
tetrahedral intermediate, leading to product release. While the coordination of
ATPase and proteolytic activities are not completely clear in the mechanism of
human Lon and ClpXP, the individual activities can be monitored by experiments
designed in our lab that have been previously used to elucidate the mechanism
of bacterial Lon.
22
+ - H3N - -CO2
Figure 1.3: Domain layout of Lon protease monomer. The N domain is
implicated in substrate recognition. The AAA+ module where ATP hydrolysis takes place is conserved in members of the AAA+ family of proteins. The P
domain contains the Ser-Lys catalytic dyad where peptide bond cleavage occurs.
23
Lon ClpXP
Protein substrate
ClpX: ATPase
ATPase ATP subunit domain ClpP: protease
subunit protease ADP domain + Pi
Peptide products
Figure 1.4: Structures of Lon and ClpXP and simplified mechanism of proteolysis. In addition to ATP hydrolysis, there is unfolding and translocation of the protein substrate through the central cavity to the proteolytic site where it is degraded into small peptide products.
24
C-terminal product
Acyl-enzyme N-terminal product intermediate O O-
N CH C N CH C OH H H
H O H O Ser O Ser H H H H2N + Lys H2N Lys
Figure 1.5: Proposed mechanism for peptide hydrolysis by Lon. The active site
Ser of Lon acts as a nucleophile, attacking the carbonyl of the scissile bond. This results in a tetrahedral intermediate and upon collapse, the C-terminal product is released. A water molecule attacks the carbonyl of the acyl-enzyme intermediate,
creating a second tetrahedral intermediate. The collapse of this intermediate
leads to the release of the N-terminal product and regeneration of the active site.
25
Use of previously developed chemical tools to monitor protease activity
Although in the mitochondria Lon and ClpXP target folded proteins, the unfolding and subsequent degradation present a number of complex factors that would have to be taken into account in studying their removal by these proteases. To demonstrate proof of principle and produce an initial mechanism of action, we routinely use unstructured proteins such as the bacterial Lon substrate
λN (26), or small peptides to monitor the ATPase and protease activities of Lon.
Our lab has developed a fluorescent peptide substrate denoted as FRETN 89-98 to be used in a continuous peptidase assay. This 11-mer peptide was derived from the sequence of the λN protein (26) that contains an anthranilamide donor and 3-nitrotyrosine quencher and one cleavage site for Lon (40). Upon cleavage by Lon protease in the presence of ATP hydrolysis (Figure 1.6), the peptide separates into two pieces, and shows an increase in fluorescence as the quencher is separated from the fluorophore. Protease activity is measured by monitoring fluorescence emission over time. The fluorescent trace contains a short lag phase, followed by a linear phase, then a plateau of fluorescence indicating substrate depletion. The slope of the linear phase corresponds to the rate of peptide degradation which can be converted to observed rate constants for comparative studies. This peptide design and assay provides a method to modify the sequence of the peptide and add various fluorophores and quenchers to identify specific substrates of Lon and ClpXP.
26
FRETN 89-98
+ - H N-Y(NO )-RGITC-SGRQ-K(Abz)-CO2 3 2
λex=320nm, λem=420nm
+ATP
Fluorescence -ATP Enzyme, ATP
Time
+H3N-Y(NO2)-RGITC-
+ -SGRQ-K(Abz)-CO2-
Figure 1.6: Continuous fluorescent peptidase assay used to monitor enzyme activity.
27
These studies of E. coli and S. Typhimurium Lon provide a starting point for the study of human Lon. Bacterial and human Lon have long been thought to be similar in their mechanisms as E. coli Lon can substitute for the function of mitochondrial Lon in yeast (41). However, in the following chapters, I describe experiments that compare the activity of human and bacterial Lon homologs and identify differences that illustrate the need for a detailed mechanistic study of human Lon. In Chapter 2, I examine the effect of ADP levels on the peptidase activity of human Lon and compare the resulting inhibition constants to those determined for E. coli Lon. I also look at inhibition of human Lon by the peptidyl boronic acid identified as a potent inhibitor of S. Typhimurium Lon.
Bacterial Lon has been studied by our lab in an effort to elucidate the mechanism of action and determine the rate-limiting step of the reaction. The results from these experiments are used to provide a starting point for the study of human Lon as it has been shown to have overlapping substrate specificity to bacterial Lon (42). FRETN 89-98 has been used to probe the activity of E. coli
Lon by monitoring pre-steady state peptide cleavage via stopped-flow fluorescence spectroscopy and pre-steady state ATP hydrolysis by chemical- quench-flow. In the time course of peptide cleavage, there is a lag prior to steady-state peptide hydrolysis (43, 44) which was attributed to the existence of a step prior to peptide cleavage that is not able to be detected using fluorescence techniques. As it had already been established that peptide cleavage is enhanced by ATP hydrolysis (40, 43) and Lon contains both ATPase and protease activities, the ATP hydrolysis activity on a pre-steady state time scale 28
was monitored under identical conditions using a chemical-acid-quench assay.
During the time frame in which there is a lag in peptide cleavage, a burst in ADP production was seen (44), suggesting that ATP hydrolysis occurs prior to peptide cleavage and the rate limiting step occurs after ATP hydrolysis, possibly the release of ADP from the active site of Lon. Steady state inhibition constants for
ADP were determined using the fluorescent peptidase assay. ADP was shown to inhibit peptide cleavage of FRETN 89-98 with inhibition constants in the low micromolar range, indicating that ADP binds tightly to the active site of Lon and
ADP release could be the rate-limiting step in the mechanism of E. coli Lon.
Although it is implicated that human Lon protects the mitochondria from damage, it has been demonstrated that Lon deficient S. Typhimurium showed protection against virulence (45). This implicates S. Typhimurium Lon as a possible therapeutic target. As Lon belongs to the family that includes the 26S proteasome, a starting point for identification of potential inhibitors of Lon activity
was those compounds that have already been identified as inhibitors of the
proteasome. Our lab has screened a number of proteasome inhibitors against S.
Typhimurium Lon. Using the fluorescent peptide substrate FRETN 89-98 and a
continuous spectroscopic assay, IC50 values for seven proteasome inhibitors
were determined (42). Of these compounds, two were identified as potent Lon
inhibitors, MG132 and MG262, though both are ~2000-fold more potent against
the proteasome. These two compounds have an identical peptide sequence,
differing only in the functional moiety located at the C-terminus. MG132 contains
an aldehyde group while MG262 contained a boronate moiety. The IC50 of
29
MG262 is ~40-fold less than that of MG132, suggesting that the boronate moiety is key in the inhibition of Lon. Other compounds containing the boronate moiety were tested for inhibition of Lon, but had much higher IC50 values. The fact that
the boronic acid moiety alone is not enough to inhibit Lon in at least the low-
micromolar range gives credence to the need for a peptide moiety that binds to
the enzyme in addition to the existence of boronic acid to interact with the active site. To this end, a peptidyl boronic acid compound, DBN93 (dansyl-YRGIT-Abu-
B(OH)2, was synthesized that contains the sequence of a product of peptide
hydrolysis by Lon and a boronic acid moiety. The inhibition of S. Typhimurium
Lon by this compound has been studied in detail and identify it as a potent
inhibitor of proteolytic activity (46).
As the activity of Lon differs among the bacterial and human homologs, it
is reasonable to assume that human Lon and ClpXP are also different in their
substrate specificity and mechanism of action although they are both found in the
mitochondrial matrix and have similar functions. In Chapter 3, I discuss the
identification of an enzyme-specific peptide substrate and the use of the peptidyl
boronic acid inhibitor to selectively monitor the activity of Lon in isolated
mitochondria and live cells. The use of isolated mitochondria to monitor ATP-
dependent proteolytic activity has been well established (47), but here I describe the first quantitative detection of Lon activity in mitochondria and method to inactivate Lon in the cell and monitor the effects of oxidative stress. Chapter 4 described the development and characterization of a ClpXP specific boronic acid inhibitor that can be used in the future to inactivate ClpXP to monitor changes in
30
mitochondrial integrity and identify protein targets. Finally, Chapter 5 describes a
number of preliminary studies that build on the results of the previous chapters to develop a peptide substrate that would be used to specifically monitor ClpXP activity as well as future directions of the project.
31
CHAPTER 2
COMPARISON OF INHIBITION OF BACTERIAL AND HUMAN LON
PROTEASE ACTIVITY
32
Lon preferentially degrades damaged or misfolded proteins at its
proteolytic site while ATP is bound and hydrolyzed into ADP at its ATPase site.
The ATPase function of the protease is assumed to be modulated by ATP/ADP
levels. An excess of ADP would inhibit continued hydrolysis of ATP, thereby
inhibiting protein degradation. The effect of ADP on proteolytic activity of E. coli
Lon has been studied by our lab, producing inhibition constants in the low
micromolar range (43). Although bacterial and human Lon have similiarities,
including the steady-state kinetic parameters of ATPase activity(42), our lab has
discovered differences in their protease activity (42). To further uncover the
mechanism of action by human Lon in an effort to exploit the differences between the analogs for drug design and protein targets, I have tested the effect of ADP on human Lon peptidase activity using the fluorescent assay developed by Lee and Berdis (40) and our lead peptide substrate, FRETN 89-98 (Figure 2.1).
From the peptide sequence , our lab has developed a peptidyl boronic acid (DBN93, Figure 2.1) to target the proteolytic active site of Lon, which has been shown to inhibit the bacterial enzyme homolog (46). Because the peptide from which this inhibitor was derived is a substrate of both bacterial and human
Lon, we predict that it would also be a potent inhibitor of the human enzyme. In this chapter, I discuss the inhibition of human Lon by DBN93 and the determination of kinetic parameters from global fitting of experimental data. I compare these results to those published for bacterial Lon and discuss the implications for future inhibitor design.
33
Figure 2.1: Structures of peptide-based substrates and inhibitors used in these experiments. FRETN 89-98 is derived from the sequence of the endogenous
Lon substrate, λN protein. FRETN 89-98Abu contains an Aminobutyric acid substitution for Cys. The peptidyl boronic acid inhibitor, DBN93, was derived from a product of FRETN 89-98 peptide hydrolysis by Lon with a boronic acid moiety on the carboxyl end to interact with the active site of the protease.
34
Materials and Methods
Materials. Tris, IPTG, chromatography media, DTT, Mg(OAc)2, trypsin, kanamycin, chloramphenicol, ATP, dansyl chloride, DMSO, Tween 20, and all other materials were purchased from Fisher, Sigma, and Amresco.
General methods. All reactions conditions are listed as final concentrations.
Enzyme concentrations are reported as monomer concentration as quantified by
Bradford Assay (48) or absorbance at 280 nm using the molar extinction coefficient (49). Peptides were quantified by extinction coefficient at A280. In order to correct for the inner filter effect, at concentrations of FRETN 89-98 above 100
µM, the peptide used is a mixture of 10% FRETN 89-98 and 90% a non- fluorescent analogue containing a tyrosine in place of the nitro-tyrosine and benzoic acid on the lysine in place of the anthranilamide. All reactions were run at 37 ºC unless otherwise stated.
Expression and purification of human Lon protease. Human Lon was expressed and purified as previously described (42) with the following modifications. Human Lon expressed in Rosetta (DE3) cells were grown at 37 ºC in superbroth (SB, per L: 30 g tryptone, 20 g yeast extract, 10 g MOPS pH 7.5) containing 30 µg/mL kanamycin and 34 µg/mL chloramphenicol until they reached an OD600 of 1.0 at which they were induced with 1 mM IPTG for 1 hr at
37 ºC. After induction, cells were harvested at 3000 x g at 4 ºC. Pelleted cells
35
were combined and resuspended in 50 mM KPi lysis buffer (all buffers contain 5 mM BME, 20% glycerol, and 0.01% Tween 20 unless otherwise stated) and lysed in a Dounce homogenizer three times. For complete lysis, cells were sonicated for 5 min in 15 sec pulses at 100 V. Cell lysate was cleared by centrifugation at 20000 x g for 2 hr at 4 ºC. Cleared lysate was immediately loaded onto a P11 column equilibrated in lysis buffer and the flow through was collected. The column was then washed with 0.1 M KPi wash buffer until protein
was no longer coming off the column. Finally, Lon was eluted with a linear
gradient of 0.1 M KPi to 0.5 M KPi buffer, collected in 20 mL fractions. Fractions
were tested for protein content by Bradford dye and positive fractions were
analyzed by SDS-PAGE. Fractions containing Lon were combined and diluted to
a final KPi concentration of 110 mM then loaded onto a DE52 column
equilibrated in 110 mM KPi buffer. Flow through of the load was collected and the protein was eluted with 120 mM KPi buffer. The load was concentrated using
Amicon YM-30 MWCO membrane. Load and elution fractions were analyzed by
SDS-PAGE and Lon positive fractions were combined and concentrated to ~6
mL. Protein was loaded onto a Sepharose S-300 gel filtration column equilibrated
in hLon storage buffer (50 mM HEPES, 75 mM KPi pH 7, 5 mM DTT, 1 mM
Mg(OAc)2, 150 mM NaCl, 20% glycerol, 0.01% Tween 20) and eluted with buffer.
Fractions were analyzed by SDS-PAGE and Lon positive fractions were
combined, concentrated, quantified, aliquoted, and stored at -80 ºC.
36
Peptide Synthesis. Synthesis of FRETN 89-98, FRETN 89-98Abu, and DBN93
(Figure 2.1) were performed as previously described (43, 46).
ADP inhibition of human Lon peptidase activity. Reactions containing 50 mM
HEPES (pH 8.0), 5 mM Mg(OAc)2, 2 mM DTT, 300 nM hLon and varying amounts of FRETN 89-98 and ADP were initiated by the addition of 50 µM ATP.
Peptide cleavage was monitored at 420 nm (excitation = 320 nm) on a
FluoroMax-3 fluorometer (Horiba Group) at 37 °C. The rate of peptide cleavage was determined by the slope of a line tangent to the linear phase of the time course and normalized by the rate of complete peptide cleavage by trypsin.
Observed rate constants were determined by dividing by the concentration of enzyme. Kinetic parameters were determined by global fitting of the data using the program EnzFitter (BioSoft) and equation 2.1 for non-competitive inhibition
(50).
n kcat S kobs Equation 2.1 I n I K' 1 S 1 Kis Kii
Where kobs is the observed rate constant for peptide cleavage, kcat is the maximum rate constant, S is peptide substrate concentration, n is the Hill coefficient, and K’ is the observed Michaelis constant for the peptide substrate. I is the inhibitor concentration, and Kis and Kii are the dissociation constants for
37
binding of inhibitor to free enzyme and enzyme:substrate complex, respectively.
K’ is converted to the true Michaelis constant (Km) using Equation 2.2.
log K' log K Equation 2.2 m n
Effect of phosphate on steady-state ATPase activity. Reactions containing
50 mM HEPES (pH 8), 5 mM Mg(OAc)2, 2 mM DTT, 150 nM hLon in the absence
and presence of 1 mM sodium phosphate (NaPi, pH 7.2) were initiated with 1 mM
[α-32P]ATP and incubated at 37 °C. Aliquots were quenched at various time points (0-15 min) in 0.5 N formic acid and 3 µL was spotted on a PEI-cellulose
TLC plate and developed in 0.3 M KPi (pH 3.4). The amount of ADP produced
was determined from using equation 2.3
ADPDLU ADP *ATP i Equation 2.3 ATPDLU ADPDLU
Where [ADP] is amount of ADP produced, DLU is density light units quantified and [ATP]i is the initial concentration of ATP.
Chemical quench ATPase assay. Pre-steady state time courses of ATP hydrolysis were performed on a KinTek rapid-chemical-quench-flow instrument.
All solutions contained 50 mM HEPES (pH 8), 5 mM Mg(OAc)2, and 2 mM DTT.
A 15 µL solution of human Lon (6 µM final) and casein (10 µM final) was rapidly
mixed with a solution of ATP (500 µM final) containing [α-32P] ATP at 37 ºC for 38
varying times (0-3 s) then quenched with 0.5 N formic acid and extracted with
phenol/chloroform/isoamyl alcohol (25:24:1, pH 6.7). 3 µL of the aqueous layer were spotted on PEI-cellulose and the amount of ADP produced was determined from equation 2.3 as described above.
To determine rate constants, the average amount of ADP produced (0-400 msec) from at least three trials is plotted against time and fit to equation 2.4
Y A (ek burst t ) C Equation 2.4
Where Y is [ADP] in micromolar, A is the burst amplitude, kburst is the burst rate constant in per seconds, C is the end point in micromolar, and t is time in
seconds.
Inhibition of human Lon peptidase activity by DBN93. Fluorescent peptidase
assays were performed on a Fluoro-Max 3 spectrophotometer (Horiba group). All
reactions contained 50 mM Tris (pH 8.1), 5 mM Mg(OAc)2, 150 mM NaCl, 2 mM
DTT, 1 mM peptide and 150 nM human Lon. After 1 min at 37 °C, 1 mM ATP was added. After an additional 90 sec, varying amounts of DBN93 was added and fluorescent emission at 420 nm was monitored for 2400 sec with excitation
at 320 nm. A mixture of 10% fluorescent/90% non-fluorescent peptide (Figure
2.1) was used to avoid complications arising from the inner filter effect. All experiments were performed at least in duplicate.
39
Determination of kinetic parameters of inhibition of human Lon by DBN93.
Kinetic parameters for the inhibition of human Lon by boronic acid peptide
DBN93 were derived using methods previously used for S. Typhimurium Lon (46,
51). For reactions containing no inhibitor, steady state velocities were determined
from the linear phase of the reaction time course using Kaleidagraph (Synergy).
For reactions containing inhibitor, the steady state velocities were determined by
fitting the reaction time course using Prism 4 (GraphPad) with equation 2.5
vi vss kint er t P vsst 1 e Equation 2.5 kint er
where P is the amount of peptide cleaved, νss is the final steady-state rate, t is
time, νi is the initial rate, and kinter is the rate constant for the interconversion of
νss and νi.
Apparent Ki values were determined by fitting ν/ν0 vs [I] to equations 2.6
and 2.7,
2 v E I K app E I K app 4E I i 1 i i Equation 2.6 v0 2E
2 v E I K *app E I K *app 4E I ss 1 i i Equation 2.7 v0 2E
app *app where E is enzyme concentration, I is inhibitor concentration, Ki and Ki are the apparent inhibition constants for initial and steady-state phases, respectively.
.
40
* Apparent Ki and Ki values from experimental data were converted to true
* Ki and Ki values by equation 2.8
[S] app Equation 2.8 Ki Ki 1 Km
where S is substrate concentration and Km is the reported Km value for the
peptide (42).
Inhibition of human Lon protein degradation by DBN93. Reactions containing
50 mM Tris (pH 8.1), 15 mM Mg(OAc)2, 5 mM DTT, 10 µM λN or StAR protein,
and 1 µM hLon were initiated with 5 mM ATP and incubated at 37 °C in the
absence and presence of 10 µM DBN93. At t=0, 10, 20, 30, 40, 60 min reaction
aliquots were quenched with SDS-PAGE loading dye. Each time point was
loaded onto a 12.5% SDS-PAGE gel and stained by Coomassie Brilliant Blue.
Effect of DBN93 on radioactive steady-state ATPase assay. Steady-state
ATPase activity was monitored as described above. Briefly, reactions containing
50 mM HEPES (pH 8), 5 mM Mg(OAc)2, 2 mM DTT, 150 nM hLon, and 10 μM λN protein in the absence and presence of 2 μM DBN93 were initiated with 1mM [α-
32P]ATP. The amount of ATP hydrolyzed was determined using equation 2.3 as
described above.
41
Results and Discussion
ADP inhibition of peptide cleavage by human Lon. Steady-state peptidase
time courses were run in the presence of Km level ATP (42), varying amounts of
peptide substrate and varying amounts of ADP. The rate of each time course
was quantified by the slope of a line tangent to the linear phase of the time
course. The resulting rate constant data was analyzed using the global fitting
program EnzFitter (BioSoft) and fitting of the data to Equation 2.1 for non-
competitive inhibition yielded kinetic parameters shown in Table 2.1. The values
of Kis (~ 1100 µM) and Kii (~3500 µM) refer to the dissociation constants of
inhibitor binding to free enzyme and enzyme:substrate complex, respectively
(Scheme 2.1). When compared to the parameters determined for bacterial Lon
at Km,ATP: Kis = 1 µM, Kii = 7 µM (43), it can be seen that ADP binds ~500-1000- fold less tightly to human Lon than it does to bacterial Lon, making its inhibitory effect on peptidase activity weaker. This result suggests that while ADP release may be rate-limiting in the mechanism of bacterial Lon (43, 44), it is more likely
human Lon has a different rate-limiting step for enzymatic turnover which occurs
after chemistry, a distinction between the mechanisms that must be explored
further in the future.
Effect of phosphate on steady-state ATPase activity. As Lon catalyzes the
hydrolysis of ATP to yield ADP and inorganic phosphate, the detection of burst
kinetics could be attributed to the slow product Pi release step. To determine if
42
Parameter Human Lon
-1 kcat (sec ) 6.0 ± 0.1
Km (µM) 1000 ± 100
n 1.33 ± 0.01
Kii (µM) 3500 ± 600
Kis (µM) 1000 ± 200
Table 2.1: Kinetic parameters for ADP inhibition of peptide cleavage by human
Lon.
43
Scheme 2.1: Noncompetitive inhibition. Inhibitor binding to free enzyme and enzyme:substrate complex is described by Kis and Kii, respectively.
44
this is the case, I compared the rates of ATPase activity in the absence and
presence of 1 mM NaPi as described in Materials and Methods. As shown in
Figure 2.2, the rate of ATP hydrolysis in the presence of 1mM NaPi is not
significantly inhibited, suggesting the phosphate release is not the rate-limiting step in the mechanism. Combined with the fact that ADP binds very weakly to
human Lon, these results indicate that the rate limiting step occurs after chemistry but are not associated with release of either product.
Chemical quench ATPase assay. Radioactive chemical-quench experiments were run to examine ATP hydrolysis by human Lon in the pre-steady state
region. This method allows for rapid mixing and acid-quenching to monitor the
reaction on a millisecond time scale. The presence of a burst in the ATPase time
course (Figure 2.3a) provides further evidence that the rate limiting step is after
ATP hydrolysis, suggesting ADP release or possibly a conformational change. As
I have shown that ADP does not bind as tightly to human Lon as it does to
bacterial Lon, substrate translocation is most likely the rate limiting step. The full
time course is triphasic, showing a burst in ADP production followed by a slow
transition phase prior to a linear phase indicating steady-state ATP turnover. As
this unusual time course cannot be fit to the classic burst equation, the initial
burst phase (0 – 400 msec) is fit to a single exponential equation (Equation 2.4)
to determine the burst amplitude (Figure 2.3b). This value was determined to be
3.2 ± 0.3 µM, which corresponds to the concentration of active enzyme in the
experiment. As the amount of Lon monomer I used was assumed to be 6 µM,
45
Figure 2.2: Phosphate does not inhibit the ATPase activity of hLon. Rates of
ATP hydrolysis were determined in the absence and presence of 1 mM sodium phosphate. As the rate in the presence of phosphate is not significantly decreased, this confirms that product release is most likely not the rate-limiting step of the mechanism of Lon activity.
46
(a)
(b)
Figure 2.3: Pre-steady state ATP hydrolysis by human Lon. (a) The full time course is triphasic: a burst in ADP production followed by a slow transition phase then steady-state turnover and does not fit to a traditional burst equation. (b) The burst phase between 0 and 400 msec is fit to Equation 2.4 to yield a burst
-1 amplitude of 3.2 ± 0.3 µM and kburst of 10 ± 3 sec . The presence of a burst indicates that a step after ATP hydrolysis is rate-limiting.
47
this indicates that I am seeing only a half-burst amplitude, a trend that has also
been seen in the pre-steady state activity of E. coli Lon, indicating that not all of
the ATPase sites in the Lon complex are active under these reaction conditions.
Further experiments will be done in the future to probe the active site
concentration and the similarities in ATPase activity between E. coli and human
Lon.
Site-directed inhibition of human Lon by DBN93. To further evaluate the
potency of DBN93 towards the inhibition of hLon, the kinetic parameters of
inhibition were determined using the method previously developed for bacterial
Lon using FRETN 89-98 as the reporter probe (46). As with S. Typhimurium
Lon, the peptidase activity of hLon was inhibited by DBN93 in a time-dependent
manner, illustrated by the two distinct rates of peptide cleavage in the
representative time course shown in Figure 2.4a: vi for the initial rate and vss for the final rate before substrate depletion. The rate constant for the interconversion of the two rates, kinter, can also be quantified (51). The vi and vss rates decrease
to different degrees with the increase in [DBN93] (Figure 2.4b), suggesting a two-
step mechanism of inhibition. Analysis of this data yielded the following inhibition
* constants: Ki = 1.35 ± 0.19 µM and Ki = 0.014 ± 0.001 µM. To support the two-
step mechanism, the experimental time courses were globally fitted to both a
one- and a two-step inhibition mechanism (Scheme 2.2) using the nonlinear
fitting program Dynafit (Biokin) (52) (Figure 2.5). The experimental data fit best
to the two-step mechanism and the resulting kinetic parameters presented in 48
k inter v ss
v i
(b)
Figure 2.4: Time-dependent inhibition of human Lon peptidase activity by
DBN93. (a) Representative time course of peptide cleavage by human Lon in the
presence of inhibitor. The time course contains an initial linear phase (vi) anda
steady-state linear phase (vss) with kinter as the rate constant of the
interconversion between the two phases. (b) The rates of these phases (vi ■; vss▲) can be determined by fitting the data to equations 2.6 and 2.7 to yield
* inhibition constants Ki and Ki as described in Materials and Methods.
49
Scheme 2.2: One-and two-step inhibition mechanisms which were fit to the reaction time courses of varying [DBN93] using the global fitting program,
DynaFit.
0.50µM DBN93
0.75µM 1.00µM 1.25µM 1.50µM 1.75µM 2.00µM
Figure 2.5: Global fitting of peptide cleavage time courses in the presence of varying amounts of inhibitor. Black lines indicate experimental data, gray lines are the best fit of the two-step inhibition mechanism shown in Scheme 2.2. The kinetic parameters determined from this fit are outlined in Table 2.2.
50
Table 2.2 agree closely with those obtained by determining the kinetic
parameters individually through analyzing the plots shown in Figure 2.4b as done
previously for S. Typhimurium Lon (46). Through mechanistic characterization, it
is discerned that DBN93 inhibits hLon via a two-step mechanism with an overall
* Ki of 21 nM. This value is similar to that determined for S. Typhimurium Lon.
However, it is interesting to note that the Ki values, which reflect binding of the inhibitor to the enzyme, of hLon and bacterial Lon exhibit a similar difference as the previously reported Km values of FRETN 89-98 in the two enzymes (~4-6-fold higher for hLon). The Km of FRETN 89-98 is 300 µM and 1300 µM for bacterial
and human Lon, respectively (42). Taken together, these results suggest that
even a peptidyl sequence that weakly interacts with the proteolytic active site of
Lon is sufficient to confer inhibition by the boronic acid functionality.
Inhibition of human Lon protein degradation by DBN93. To evaluate the
efficacy of DBN93 inhibiting the proteolytic activity of hLon, the ATP-dependent
degradation of two protein substrates, λN and Steroidogenic Acute Regulatory
(StAR) protein, an endogenous substrate of hLon (53, 54), were examined in the
presence and absence of the inhibitor. As the peptide sequence in DBN93 is
found in the Lon-specific substrate FRETN 89-98Abu and λN protein, we
predicted that the protease activity of hLon would be inhibited. As shown in
Figure 2.6, Lon degrades both λN (a) and StAR (b) within 20 min in the presence
of ATP. However, in the presence of 10 µM DBN93, Lon-mediated degradation of
51
S. Typhimurium Parameter Human Lon Lon†
5 -1 -1 k3 (x10 M s ) 4.3 ± 0.2 1.0 ± 0.3
-1 k4 (s ) 0.060 ± 0.002 0.022 ± 0.007
Ki (μM) 1.37 0.216
-1 k5 (s ) 0.0090 ± 0.0004 0.0032 ± 0.0003
-1 k6 (s ) 0.00014 ± 0.00001 0.00028 ± 0.00002
Ki* (μM) 0.021 0.017
Table 2.2: Kinetic parameters of inhibition of human Lon peptidase activity by
DBN93 as determined by global fitting of experimental data using DynaFit. The resultant values are compared to those previously determined for bacterial Lon.
Reported errors are s.e.m.
†Data previously published (46)
52
(a) -DBN93 +DBN93
Time (min) 0 10 20 30 40 60 0 10 20 30 40 60 hLon -
λN -
-DBN93 +DBN93 (b)
Time (min) 0 10 20 30 40 60 0 10 20 30 40 60 hLon -
StAR-
Figure 2.6: DBN93 inhibits protein degradation by human Lon. Protein substrates λN (a) and StAR (b) were digested with human Lon in the presence of
ATP at 37 °C. Complete degradation of the proteins was inhibited by the addition
of 10 µM DBN93.
53
λN and StAR is not observed even after 60 min. While the inhibition of λN
degradation is expected as the peptide sequence of DBN93 is derived from one
of the products, it is not found in StAR. However, the interaction of YRGIT-Abu in
DBN93 with Lon likely directs the electrophilic boronic acid functionality to react with the proteolytic site Ser.
DBN93 does not affect Lon ATPase activity. The ATPase activity of
mitochondrial Lon has been proposed to possess chaperone-like functions
independent of its proteolytic activity (22). Since DBN93 inhibits hLon in the
presence of ATP, it is conceivable that DBN93 inhibits only the proteolytic, but
not the ATPase functionality. As shown previously, the ATPase activity of Lon is
stimulated by peptide or protein substrate (40, 55, 56). Using a radiolabeled
assay, we demonstrated that the λN protein-stimulated ATPase activity of hLon
was only slightly affected by DBN93 (Figure 2.7). Therefore, as a chemical
genetic tool, this inhibitor should allow for the specific evaluation of the proteolytic
activity. While genetic techniques deplete the cell of both ATPase and proteolytic
activities, the chemical inhibitor DBN93 will only deactivate the proteolytic site in
a dose-dependent manner, thereby permitting the direct evaluation of the
physiological functions of Lon as a protease in cell culture. To the best of our knowledge, the chemical inhibitor described here is the only way to confer this kind of selectivity in deactivating the proteolytic activity of Lon.
54
Figure 2.7: DBN93 does not significantly inhibit hLon ATPase activity in the presence of λN protein stimulation. Reactions measuring the amount of radiolabeled ATP hydrolyzed by human Lon in the absence and presence of
DBN93 were run. The addition of inhibitor does not affect the ATPase activity of human Lon, indicating that DBN93 interacts with the proteolytic site to inhibit activity.
55
Conclusion. In this chapter, I have discussed the differences in inhibition of bacterial and human Lon by ADP and the peptidyl boronic acid, DBN93. As shown by the data, ADP binds with much lower affinity to human Lon than it does to bacterial Lon. ADP release has been proposed to be the rate-limiting step in the mechanism of bacterial Lon, but the low affinity of ADP for human Lon suggests that there is a different rate-limiting step. Pre-steady state ATP hydrolysis experiments discussed here show a burst in ADP production, suggesting that the slow step in the mechanism is after ATP hydrolysis.
When comparing the effect of the peptidyl boronic acid inhibitor, DBN93, on bacterial and human Lon, I showed that the overall potency of the compound
* (Ki ) was similar between the two, in the low nanomolar range. The discovery that overall potency of the inhibitor (Ki*) is not necessarily reflected in the binding affinity of the inhibitor for the enzyme (Ki), indicates that even a peptide sequence that binds with weak affinity can inhibit protease activity. This information will be useful in the design of inhibitors that will be specific for bacterial Lon, but do not affect the activity of human Lon.
56
CHAPTER 3
CHEMICAL TOOLS TO MONITOR ATP-DEPENDENT PEPTIDASE ACTIVITY
IN ISOLATED MITOCHONDRIA
57
ATP-dependent proteases are energy-powered proteolytic machines that
coordinately link ATP hydrolysis with peptide bond cleavage (57, 58) and govern
a protein quality control system dedicated to the elimination of oxidatively
damaged, misfolded and unassembled proteins (55, 59, 60). In mammalian
mitochondria, human Lon (hLon) and ClpXP (hClpXP) are the only soluble ATP- dependent proteases in the matrix (61) and their respective in vivo functions
have yet to be clearly defined. In biochemical experiments using purified
proteins, Lon and ClpXP are apparently promiscuous and degrade some of the
same proteins; however, these proteases exhibit distinct peptide cleavage sites
specificities within a protein substrate (12, 14, 26). Knowledge of the respective
peptide cleavage specificities of Lon and ClpXP can be used to design peptidyl
substrates and inhibitors, which distinguish these proteases and permit the
interrogation of their respective physiological functions. An additional benefit of
such chemical biological tools is the ability to rapidly and/or transiently down-
regulate enzymatic activity without altering protease expression or manipulating
mitochondrial or cellular metabolism. The development of specific chemical tools
is also necessary to probe the functions of Lon and ClpXP upon transient
changes in the metabolism in mitochondria, such as oxidative stress. In an
animal model of cardiac ischemia, an increase in oxidatively modified
mitochondrial matrix proteins following reperfusion is correlated with an increase
in ATP-dependent proteolytic activity, which is then followed by a decrease in
oxidized proteins (62). Similarly, treatment of isolated mitochondria with a H2O2
generating system results in the stimulation of energy-dependent proteolytic
58
activity (62, 63). These data suggest that ATP-dependent proteases play a crucial role in the turnover of oxidatively modified proteins in the mitochondrial matrix. Of the two ATP-dependent proteases found in mitochondrial matrix, Lon has been specifically implicated in targeting oxidatively damaged proteins, as results have shown that it degrades mildly oxidized aconitase (64, 65). The evaluation of ATP-dependent protease activity in mammalian mitochondria, cultured cells or tissues has been performed without rigorously controlling for the contributions of ClpXP or the other membrane-associated ATP-dependent proteases. The exploitation of cleavage site specificity to design enzyme- selective substrates will therefore aid in determining the functions of these two matrix proteases individually and in protein mixture.
Our previous studies on Lon have employed a fluorogenic peptide
substrate, Y(NO2)-RGITCSGRQK(Abz), FRETN 89-98 (Figure 2.1), which
contains residues 89-98 of the endogenous Lon substrate, λN protein (26), to
monitor peptidase activity. This peptide also contains an anthranilamide/nitro-
tyrosine fluorescence donor/quencher pair flanking the cleavage site at Cys-Ser.
In the presence of ATP, the rate of peptide cleavage can be quantified by
monitoring an increase in fluorescence emission over time (40). From the
sequence of this peptide, we have developed a peptidyl boronic acid (DBN93,
Figure 2.1) to target the proteolytic active site of Lon, which has been shown to
inhibit the bacterial enzyme homolog (46). Because the peptide from which this
inhibitor was derived is a substrate of both bacterial and human Lon, we
predicted that it would be a potent inhibitor of the human enzyme. The results
59
from Chapter 2 show that DBN93 is indeed a potent inhibitor of human Lon, with an overall inhibition constant similar to that for bacterial Lon. As hLon and hClpXP have been shown to degrade the same protein at different cleavage sites, it is suggested that they have different substrate specificities. Though I showed in the previous chapter that a lower binding affinity for the peptidyl moiety does not necessarily affect the overall potency of an inhibitor, it is reasonable to assume that at least minimal binding of the peptide is necessary for inhibition. Identification of a peptide sequence that does not bind to hClpXP can lead to the design of a boronic acid inhibitor that will specifically inhibit hLon and not hClpXP, thereby lending service as a selective chemical probe to interrogate the physiological functions of Lon. This approach provides the tools needed to elucidate the mechanism by which hLon is regulated in mitochondria, especially in response to stress, and is general enough that it could be easily adapted to monitor mitochondrial ClpXP or the membrane-bound ATP- dependent protease activities in future studies.
In this chapter, I discuss the use of the fluorescently labeled peptide substrate FRETN 89-98 to monitor ATP-dependent activity in mitochondria isolated from HeLa cells. HeLa are an immortal cell line derived from cervical cancer cells that are regularly used in scientific research (66). The results discussed here suggest that Lon and ClpXP are able to be individually monitored even in a mixture of proteins such as isolated mitochondria using the chemical tools that have been developed in our lab.
60
Materials and Methods
Materials. DMEM media, FBS was purchased from USA Scientific, penicillin/streptomycin, Amphotericin B, gentamycin, 0.25% trypsin/EDTA. All other materials were purchased from Fisher, Sigma or Amresco.
Fluorescent peptidase assay to identify selective peptide substrate and inhibitor. Reactions containing 50 mM HEPES (pH 8.0), 5 mM Mg(OAc)2, 2 mM
DTT, 200 nM purified hLon or hClpXP, 100 µM FRETN 89-98 or FRETN 89-
98Abu, and 500 µM ATP were run on a FluoroMax-3 fluorometer at 37 °C as described in Chapter 2. For Lon reactions, HEPES, Mg(OAc)2, DTT, peptide and
Lon were incubated for 1 min at 37 °C prior to initiation with ATP. For ClpXP reactions, HEPES, Mg(OAc)2, DTT, ClpX, ClpP, and ATP were incubated for 1 min at 37ºC prior to initiation with peptide. For reactions containing inhibitor,
DBN93 was added after an additional 90 sec incubation at 37ºC following the initiation with ATP or peptide to allow the reaction to go past the initial lag phase.
Growing HeLa cells. HeLa cells were grown to passage 6 in DMEM/F12 media containing 10% FBS and 1% penicillin/streptomycin with Amphotericin B in 150 mm tissue culture plates. Plates were incubated at 37 °C at 5% CO2 until 100% confluent, then trypsinized and harvested.
61
Isolation of mitochondria from HeLa cells. Intact mitochondria was isolated
from 120 x 106 HeLa cells using the Mitochondria Isolation Kit for Mammalian
Cells from Pierce (Rockford, IL). Per the manufacturer recommendations, 20 x
106 HeLa cells were resuspended in 800 µL ice cold Reagent A and EDTA (pH 8)
was added to a final concentration of 0.2 mM. The cells were vortexed at medium
speed for five seconds and incubated on ice for exactly 2 min before being
transferred to a chilled 2 mL Dounce homogenizer and lysed on ice with 60 strokes as recommended by the manufacturer. The homogenized cells were then transferred to a polycarbonate centrifuge tube and 800 µL of Reagent C and 0.2
mM final EDTA (pH 8) were added. The homogenizer was rinsed with 200 µL
Reagent A and the rinse was added to the centrifuge tube which was inverted
three times to mix. This procedure was repeated until all 120 x 106 cells were
lysed. The mixture was then centrifuged at 700 x g for 10 min at 4 ºC to pellet cell
debris. The supernatant was transferred to a new centrifuge tube and further
centrifuged at 3000 x g for 15 min at 4 ºC to isolate mitochondria from cytosol
and lysozomal and peroxisomal contaminants. The supernatant was removed
and the pellet containing mitochondria was resuspended in 500 µL Reagent C.
The suspension was divided in two equal parts and centrifuged at 12000 x g for 5
min at 4 ºC. The supernatant was removed and the pellet in tube 1 was
resuspended in 50 µL 50 mM KPi (pH 7), 20% glycerol, 0.1% Tween 20. The
mitochondria was then put through a CentriSpin-10 column (Princeton
Separations) equilibrated in the same buffer to remove small molecular weight
contaminants and stored at 4 °C. The amount of protein present in the isolated
62
mitochondria was quantified using the Bradford assay using BSA as a standard
(48). The second tube of isolated mitochondria was immunodepleted of Lon as
detailed below.
Western Blot analysis of isolated mitochondria. The presence and relative
amount of the respective protease complex components in mitochondria isolated
from 120 x 106 HeLa cells suspended in 100 μl of 50 mM KPi, 20% glycerol,
0.1% Tween 20 buffer were extrapolated by Western Blot Analysis. Known amounts of purified hLon, hClpP, or hClpX as reference standards were compared to a sample of partially purified isolated mitochondrial protein mixture.
The amount of each enzyme present in the mitochondrial sample (mito) was approximated and divided by the volume of sample loaded on the gel to yield ng protein/μl mito. This concentration was then converted to number of copies/cell.
This analysis suggests the proteins exist in approximately the following concentrations: 5000 copies of Lon/cell, 5000 copies of ClpX/cell, and 2000 copies of ClpP/cell.
Immunodepletion of human Lon from isolated mitochondria. Antiserum raised against hLon was purified by incubating production bleed with nitrocellulose containing purified hLon protein and eluting the purified antibody from the nitrocellulose using 100 mM glycine (pH 2.5). Mitochondria isolated from
HeLa cells as described above were resuspended in 50 µL of 25 mM Tris pH 7.5,
100 mM NaCl, 0.1% Tween 20 immunoprecipitation buffer and incubated
63
overnight at 4 °C with 100 µL of the purified anti-hLon. This mixture was then
added to Protein A Agarose (Pierce) that was previously blocked with 1% BSA in
TBST and rotated at 4 °C for two hours. After incubation, the mixture was
centrifuged at 2500 x g for 2 min to pellet the Protein A agarose bound to
antibody and hLon. The supernatant containing isolated mitochondria lysate
depleted of Lon was removed and subjected to a CentriSpin-10 column
equilibrated in 50 mM KPi, 20% glycerol, 0.1% Tween 20. The amount of protein
was quantified by a Bradford assay, using BSA as a standard.
Monitoring specific activity from isolated HeLa mitochondria. Reactions
containing 50 mM HEPES, 5 mM Mg(OAc)2, 2 mM DTT, 1 mM FRETN 89-98 and
1 mM ATP were incubated at 37 °C for 1 min. 5 µg of the purified isolated
mitochondria as quantified by Bradford assay was added and cleavage of
peptide was observed by monitoring the fluorescent emission at 420 nm (λex=320 nm) for 20 min in the absence and presence of 1 mM ATP and 10 µM inhibitor
DBN93.
Inhibition of StAR degradation in COS-1 cells. The experiment testing the stability of StAR in cells treated with DBN93 was done by the Suzuki Lab at
University of Medicine and Dentistry of New Jersey using a method modified from Granot et al (53), on Day 1, two 6 cm dishes of COS-1 cells (1.2 x 106) were
transfected with pCMV5 StAR-his plasmid and two with the pCMV5 control
vector. For each dish of cells, 3 mg of plasmid and 7.5 ml Lipofectamine 2000
64
were diluted in 250 ml OPTI-MEM medium and then added to the cells incubated
in DMEM medium. After 5 hrs, FBS was added to 10%. On Day 2, the two
dishes of cells were split into seven 6 cm dishes. On Day 3, the cells were
incubated in methionine-free DMEM for 30 min prior to labeling for 60 min with
methionine- and cysteine- free DMEM containing [35S]methionine
(100mCi/ml;Trans35S-Label, ICN). The non-fluorescent boronic acid inhibitor,
CBN93 (Figure 3.1) was added to a final concentration of 20 µM 15 min before
the onset of the chase, as well as during the chase. Cells were chased in
complete DMEM medium (10% FBS, penicillin/streptomycin) and harvested at
the time points indicated and then stored at -80 °C. Cellular protein was extracted in lysis buffer (50 mM Tris, pH 7.4, 300 mM NaCl, 0.5% Triton X-100)
containing a protease inhibitor cocktail (Roche Applied Science) on ice for 30
min. The lysates were centrifuged at 13,000 rpm for 30 min. The cell extracts
were pre-cleared with 20 ml Protein G for 2-4 hrs at 4 °C on a rocker, and the extracts were incubated with 10-15 ml anti-his tag antibody (Santa Cruz
Biotechnology SC-8036) overnight at 4 °C on a rocker. The next day, 40 ml of
Protein G agarose was added and incubated for 2 h at 4 °C. The Protein G agarose complexes were washed in ice-cold wash buffer three times, and once with ice cold PBS. Immunoprecipitated radiolabeled protein(s) present in the pulse and chase extracts, were separated electrophoretically on 11% SDS-PAGE and visualized by autoradiography or PhosphorImaging.
65
Results and Discussion
Fluorescent peptide reporter of ATP-dependent proteolysis. The identification of different cleavage profiles of oxidized insulin B by Lon and ClpXP
reported by Maurizi and others (14, 26) (Figure 1.2) lends the possibility of
generating specific peptide substrate reporters for the proteases. As such, the
peptide reporter FRETN 89-98 (Figure 2.1), which has been shown to be
degraded by bacterial and human Lon (40) will be at least a preferred, if not
specific, substrate of hLon, but not hClpXP. Indeed, under identical conditions,
the rate of hLon meditated ATP-dependent FRETN89-98 cleavage was 5-fold
faster than that of hClpXP (Figure 3.1a). By contrast, the FRETN 89-98Abu
(Figure 2.1), where the Cys at the cleavage site of FRETN 89-98 is replaced with
the non-natural amino acid aminobutyric acid (Abu), was only cleaved by hLon
and not hClpXP (Figure 3.1b). These results demonstrate that specific probes
for monitoring ATP-dependent protease activity can be generated by exploiting
the differences in their peptide cleavage specificities, a task that is not easily
accomplished with protein substrates as reporters. Furthermore, the peptide
FRETN 89-98 could be used to monitor the activities of purified hLon or hClpXP
individually in vitro or the total contribution of ATP-dependent protease activity in
a mitochondrial matrix sample whereas FRETN 89-98Abu can be used to
selectively monitor the activity of hLon in the presence of hClpXP.
66
(a) FRETN 89-98
Lon + ATP
ClpXP + ATP
Lon - ATP
(b) FRETN 89-98Abu
Lon + ATP
ClpXP + ATP
Figure 3.1: Peptide-based substrates are used to monitor activity of human Lon and human ClpXP. (a) FRETN 89-98 is cleaved by both human Lon (black) and human ClpXP (dark gray) in the presence of ATP with different efficacies. The time course in the absence of ATP is shown in light gray. (b) FRETN 89-98Abu is a specific substrate for human Lon (black) and is not cleaved by human ClpXP
(dark gray).
67
Generation of selective inhibitor, DBN93. The preferential cleavage of FRETN
89-98Abu peptide by hLon suggests that the hydrolyzed peptide product
YRGIT(Abu) would be bound to the proteolytic site of hLon but not hClpP.
Therefore, derivatizing the carboxyl terminal of YRGIT(Abu) with a boronic acid moiety, which acts as an electrophile to sequester the proteolytic site Ser in Lon, should generate a mechanism-based inhibitor that blocks proteolysis. This chemical tool will aid in evaluating the contribution of hLon in protein quality control in mammalian mitochondria. The peptidyl boronic acid dansyl-YRGIT-
Abu-B(OH)2, abbreviated as DBN93 (Figure 2.1), contains part of the sequence derived from a hydrolyzed peptide product generated from λN, as well as FRETN
89-98, degradation by Lon (46). The amino terminal of DBN93 is also derivatized with a dansyl group to offer the opportunity to probe its mechanism of interaction with Lon if needed (67).
The specificity of DBN93 towards hLon is confirmed by the observation that the cleavage of FRETN 89-98 by purified hClpXP was not affected by up to
4 µM DBN93 (Figure 3.2), a condition that would have completely inhibited Lon
(46). This result highlights the usefulness of exploiting the peptide sequence of substrates and inhibitors to develop specific compounds which can be used to determine the physiological functions of ATP-dependent proteases. Despite the promiscuity of protein substrate specificity and lack of defined peptide cleavage specificity in Lon, a proteolytic site-specific inhibitor can be generated from the hydrolyzed peptide product.
68
Figure 3.2: DBN93 does not inhibit human ClpXP peptidase activity. ClpXP degradation of FRETN89-98 is not inhibited by DBN93. 300 nM ClpP and 900 nM
ClpX were preincubated with 1 mM ATP at 37 °C for 1 min prior to the addition of
1 mM FRETN89-98. After 90 s, 0 µM (black), 1 µM (light gray) or 4 µM (dark gray) DBN93 was added and the reaction was monitored for 1500s.
69
Inhibition of mitochondrial protein mixture. To assess the ability of our peptide reporter to detect ATP-dependent protease activity, and the efficacy of
DBN93 to selectively inhibit hLon in biological samples containing hClpXP, we evaluated the cleavage of FRETN 89-98 in mitochondrial matrix proteins isolated from HeLa cell cultures. These proteins were isolated using a method that presumably removed mitochondrial membranes and were thus free of membrane bound ATP-dependent protease contamination. The presence of hLon and hClpXP in the isolated protein mixture was confirmed by Western Blot analysis using antibodies against each enzyme (Figure 3.3). The lower molecular weight of ClpP in the mitochondrial matrix protein mixture might be due to autoprocessing of ClpP as reported previously (68) or the fact that the purified protein standard contains a 6x His-tag, which increases the molecular weight.
To monitor peptidase activity, 5 µg of the isolated matrix protein mixture was incubated with 100 µM FRETN 89-98 with and without the addition of 1 mM
ATP. As shown in Figure 3.4, an increase in fluorescence emission signal attributed to FRETN 89-98 cleavage over time is detected in the 1 mM ATP time course. By comparison, there is little change in fluorescence intensity over the same time period when no additional ATP is present. This observation confirms that ATP-dependent cleavage of FRETN 89-98 is detectable in mitochondrial protein mixture isolated from cell culture. When the Lon inhibitor, DBN93, was added to the FRETN 89-98 cleavage reaction containing 1 mM ATP, the peptidase signal was reverted to the background level, where ATP was omitted
(Figure 3.4). This result suggests that FRETN 89-98 was detecting only hLon 70
25ng 10ng 5ng 1ng Mito (a) α-hLon
25ng 10ng 5ng 1ng Mito
(b)
α-ClpX 25ng 10ng 5ng 1ng 0.5ng Mito (c)
α-ClpP
Figure 3.3: Identification of mitochondrial matrix proteins isolated from HeLa cells. Western blots of mitochondria isolated from HeLa cells visualized with antibodies against known amounts of (a) human Lon, (b) ClpX, or (c) ClpP as indicated to approximate amount of enzyme in the isolated mitochondria. The amounts above the blots indicate the amount of purified protein ran as a reference to approximate the amount of each protease in the mito sample.
71
+ ATP
- ATP
+ ATP + DBN93
Figure 3.4: ATP-dependent peptide cleavage of FRETN 89-98 by isolated mitochondria is abolished by the addition of Lon specific inhibitor, DBN93.
Cleavage of 100 µM FRETN 89-98 by 5 µg of the purified mitochondrial matrix protein mixture was monitored in the absence (black) and presence (dark gray)
of 1 mM ATP. The addition of 10 μM DBN93 inhibited ATP-dependent peptidase activity (light gray) to intrinsic levels.
72
activity in the protein mixture. As discovered earlier, purified hClpXP is at least
5-fold less efficient in mediating the ATP-dependent cleavage of FRETN 89-98
(Figure 3.1a); therefore, the lack of detectable ClpXP activity in the isolated HeLa mitochondrial matrix proteins could be attributed to the presence of a relatively low concentration of functional hClpXP complex. This possibility is tentatively supported by the estimation (from Western Blot analysis) that there are ~ 5000 copies of Lon, 5000 copies of ClpX, and 2000 copies of ClpP per cell, yielding a theoretical concentration of hLon exceeding that of hClpXP by ~ 2.5-fold
(5000/2000).
To confirm that I am able to detect only Lon activity from isolated mitochondria using FRETN 89-98, I immunodepleted the isolated mitochondria of human Lon and tested the sample for ATP-dependent activity. As shown in
Figure 3.5, in the presence of ATP (black), the rate of peptide cleavage is similar to that in the absence of ATP (dark gray), indicating that Lon activity is no longer able to be detected. The addition of DBN93 to the reaction did not decrease the rate of peptide cleavage as it did in the mitochondria that still contained Lon.
Taken together, the peptidase assay accurately measures the respective
ATP-dependent protease activity based on their specific concentrations in the sample. Based on this observation, I propose that the combined usage of specific fluorescent peptide substrates and the boronic acid inhibitor demonstrates a viable chemical strategy to detect hLon and/or hClpXP activity in biological samples. As the deactivation of mitochondrial Lon does not require any genetic
73
Figure 3.5: Immunodepletion of Lon from isolated mitochondria abolishes ATP- dependent peptide cleavage of FRETN 89-98. In the presence of ATP (black), there is an increase in the rate of peptide cleavage by mitochondria containing
Lon over that in the absence of ATP (dark gray). Upon addition of 10 µM DBN93
(light gray), ATP-dependent peptide cleavage was brought back down to the
background rate in the mitochondria containing Lon. In mitochondria
immunodepleted of Lon (IP), there is no increase in peptide cleavage in the
presence of ATP (white crosshatch) over that in the absence of ATP (gray
crosshatch). Error bars indicate the standard error from least three trials.
74
manipulation, the chemical approach described herein should be applicable to the profiling of Lon and/or ClpXP activities in mitochondrial protein matrix isolated from primarily cell cultures and animal tissues that are not easily amendable to genetic manipulation.
Inhibition of StAR protein degradation in vivo. To assess the cell permeability of the boronic acid inhibitor, we tested whether treatment of cells with CBN93 will downregulate Lon activity and lead to increased StAR stability using a previously employed method (53). The relative amount of StAR present in the presence or absence of CBN93 was determined by immunoprecipitation of StAR, SDS-PAGE and autoradiography. As shown in Figure 3.6, higher levels of 35S-Met labeled
StAR were detected at 2, 4, and 8 hours in the cells treated with 20 µM CBN93.
This result supports the notion that the peptidyl boronic acid inhibitor CBN93 exhibits cell permeability in cultured cells. As the non-fluorescent analog,
CBN93, inhibits the degradation of the endogenous substrate StAR in cell culture, this inhibitor should be able to enter isolated mitochondria to target Lon, thereby allowing the identification of substrates of this enzyme by proteomic techniques, as well as physiological functions by monitoring alterations in mitochondrial function within minutes to hours. Since the active-site directed approach used for generating specific reagents for monitoring Lon exploits the interaction between the enzyme and peptide substrate, we propose that the same strategy can be employed to develop specific chemical reagents to study other ATP-dependent proteases which may be indistinguishable by their protein
75
- CBN93 + CBN93
Chase (h) 0 2 4 8 0 2 4 8 StAR
Figure 3.6: Chase experiments show CBN93 inhibition of StAR degradation in
isolated mitochondria. Degradation of 35S Met-labeled StAR protein by isolated mitochondria was monitored in the absence and presence of 20 μM CBN93. The
amount of 35S- labeled StAR remaining in the mitochondria was quantified by
radiography.
76
substrates but not peptide cleavage specificities. One caveat is that in addition to
mitochondrial Lon, StAR is also degraded by the proteasome which is found in
the cytosol, but not the matrix of mitochondria. It is possible that the increased levels of StAR observed in the cell culture study reflect a combined CBN93 block of the proteasome and Lon. This ambiguity further reiterates the non-selective nature of protein substrate, and the need to develop specific peptide substrates as activity probes for ATP-dependent proteases.
77
Conclusion. In this chapter, I have shown that the fluorescent peptide substrate
for Lon and ClpXP (FRETN 89-98) can be used to monitor ATP-dependent
activity of mitochondria isolated from HeLa cells. As shown by Western Blot
analysis, the amount of ClpXP present in the mitochondria is approximately 2.5-
fold less than the amount of Lon. As ClpXP is about 5-fold less efficient at
cleaving FRETN 89-98, it is understandable that I would not be able to detect
peptide cleavage by ClpXP under the conditions of the experiment. To confirm that I was able to only detect Lon activity, I immunodepleted the mitochondria of
Lon and tested for peptidase activity. The rate of peptide cleavage was nearly identical in the absence and presence of ATP, confirming that the ATP- dependent activity that I was able to detect was due to Lon activity.
78
CHAPTER 4
DESIGN AND CHARACTERIZATION OF ClpXP SPECIFIC N-TERMINAL
BORONIC ACID INHIBITOR
79
As discussed in Chapter 3, ClpXP cleaves FRETN 89-98 with about 5-fold
less efficiency than human Lon (Figure 3.1a). Upon substitution of Cys with Abu,
the peptide is no longer cleaved by ClpXP, making it a specific substrate to
monitor Lon activity. A hydrolyzed peptide product of FRETN 89-98Abu was
used to design a potent inhibitor of bacterial and human Lon (DBN93), with an
overall inhibition constant of 21 nM, which is similar to that which was found for
bacterial Lon (17 nM) (46). When tested against ClpXP, it was found that up to 4
µM DBN93, there was no inhibition of peptidase activity (Figure 3.2). As such,
DBN93 has been identified as a chemical tool that can monitor Lon activity in mitochondria isolated from HeLa cells. The success with the design of DBN93 as a Lon-specific inhibitor suggests that a peptidyl moiety that binds tightly to ClpXP along with a boronate moiety to interact with the active site could produce an inhibitor that is specific to ClpXP, allowing for its selective monitoring even in the presence of other proteases. To this end, in collaboration with the Santos Lab at
Virginia Tech, a series of peptidyl boronic acid compounds were synthesized and tested against both human Lon and ClpXP to identify promising inhibitor candidates.
Peptidic α-amino boronic acids are excellent inhibitors of proteases because of the ability of Lewis basic residues located in the enzyme active site to bind to the empty p-orbital of boron forming a stable “ate” complex, which mimics the tetrahedral intermediate formed during amide bond hydrolysis (69-73). When the protease substrate is known, this strategy becomes attractive because the P-
80
site residues can readily be incorporated to provide a good starting point for inhibitor development (Figure 4.1). It is well-known that substrate selectivity within the enzyme active site relies heavily on both the P/S- and P’/S’-site complementarity. However, current methods incorporating the boronic acid moiety only take advantage of the binding pocket on P/S side of the scissile amide bond (C-terminal boronic acid). In this chapter, I report the characterization of a series of N-terminal peptidic boronic acids that were synthesized to harvest the potential of residues on the opposite side (P’-sites). In collaboration with the Santos group, we reason that the P’-sites may provide unique selectivity for a number of biologically important proteases. In the design of N-terminal peptidic boronic acids, the carboxyl group is replaced with a boronic acid moiety and the nitrogen derived from the scissile amide bond is changed to carbon because the B-N bond is labile. The terminal boronic acid residue can be conveniently modified to incorporate both natural and unnatural amino acid functional groups. To evaluate the utility of this approach, I compared the inhibition profiles of a series of N-terminal peptidic boronic acids toward human
Lon and ClpXP. As previously discussed, both of these enzymes are present in mitochondrial matrix (17), therefore, the observed up-regulation in ATP- dependent proteolytic activity upon oxidative stress (62, 63) could be attributed to one or both enzymes. The contribution of the respective proteases in protecting mitochondria from oxidative stress is not fully known. Therefore, the development of a selective inhibitor against the respective protease will provide
81
S1' S2
P2 O P1' O H H N N N N H H O P1 O P2'
S2' S1 protease
HO OH P1' H Tetrahedral peptide N peptide N Intermediate H O P O 1
OH OH P1' H peptide N B B peptide OH HO O O P1 C-terminal peptidic boronic acid N-terminal peptidic boronic acid
Prior Work Current Work
Figure 4.1: Complimentary peptide boronic acid strategies utilizing the P/S and
P’/S’ sites.
82
valuable chemical tools to interrogate the physiological functions of the two
mitochondrial proteases. Furthermore, several physiological protein substrates
have been identified for human Lon but not for human ClpXP. The availability of
selective inhibitors should benefit the identification of physiological substrates of
hClpXP when used in conjunction with proteomic studies.
This chapter describes the purification of recombinant ClpX and ClpP and
confirms the inability of C-terminal peptidyl boronic acid, DBN93, to inhibit ClpXP
protease activity. I also discuss the screening of the series of N-terminal boronic
acid compounds that were synthesized by the Santos Lab at Virginia Tech in
order to identify a specific ClpXP inhibitor. A boronic acid compound was indeed
identified as an inhibitor of ClpXP peptidase activity and I determined its IC50 value. I also confirmed specificity of this inhibitor by testing its effect on protein degradation by hLon and ClpXP. The results gathered from these experiments provide a starting point for development of a potent, ClpXP specific inhibitor that can be used to monitor ClpXP activity in vitro and later in vivo.
83
Materials and Methods
Materials. Oligonucleotides were purchased from IDT. Ni-NTA agarose was purchased from Qiagen. All other reagents and materials were purchased from
Fisher, Sigma, and Amresco.
Cloning of recombinant ClpX and ClpP. Using a modified method of Kang et al
(14), the ClpP gene was amplified from genomic DNA by Jason Hudak using
oligonucleotides oJH075 (5’-GACCCGGCATATGCCGCTCATTCCCATCG-3’)
and oJH114 (5’-GGCCCAGCTCGAGGGTGCTAGCTG-3’). The ClpX gene was
amplified from genomic DNA using oligonucletoides oJH073 (5’-
CACCAGCACATATGGCCTCAAAAGATG G-3’) and oJH115 (5’-
GCAATATGACCTCGAGGCTGTTTGCAG-3’). The resultant PCR products were cloned into the NdeI and XhoI sites of pET24c and transformed into XL1Blue cell line for sequencing confirmation. The ClpX plasmid contained a mutation E373K which was changed back to wild-type using Quick-Change kit from Qiagen with primers oJH125 (5’-
CATCAGCAGGAGGAAAAATGAAAAGTATCTTGGATTTGGAACACC -3’) and oJH126 (5’- GGTGTTCCAAATCCAAGATACTTTTCATTTTTCCTCCTGCTGATG
-3’). Following sequence confirmation, the plasmids ClpP and ClpX were transformed into Rosetta (DE3).
84
Purification of recombinant ClpX and ClpP. Recombinant wild type His-tagged
human ClpX and human ClpP were overexpressed in Rosetta (DE3) using the
plasmids ClpX and ClpP, respectively. Cells were grown in SB containing 30
μg/mL kanamycin and 34 μg/mL chloramphenicol at 37 °C to OD600 ~0.7.
Cultures were then induced with 0.5 mM IPTG for 21 hours at 25 °C. Cells were
harvested and pellets were resuspended in loading buffer containing 50 mM Tris
(pH 8.1), 150 mM NaCl, 10 mM imidazole, 15% glycerol and 0.05% Tween 20,
then lysed by homogenization and sonication. Lysate was applied to Ni-NTA
agarose column equilibrated in loading buffer. The column was washed with 5 column volumes of loading buffer, with flow-through collected. The column was then washed with 8 volumes of wash buffer containing 50 mM Tris (pH 8.1), 500 mM NaCl, 10 mM imidazole, 15% glycerol and 0.05% Tween 20, with the flow- through collected. The column was eluted with 5 column volumes elution buffer containing 50 mM Tris (pH 8.1), 300 mM NaCl, 200 mM imidazole, 15% glycerol and 0.05% Tween 20, with 1 mL fractions collected. Collected fractions were analyzed on 12.5% SDS-PAGE gels stained by Coomassie. Fractions containing purified protein were pooled and concentrations were determined by Bradford assay (48), using BSA as a standard. Protein was then aliquoted and stored at
-80 °C Purified aliquots of ClpX and ClpP are shown in Figure 4.2 after SDS-
PAGE analysis, with molecular weights of ~64 kDa and ~25 kDa, respectively.
85
MW (kDa)
170 135 100 72 ClpX
55
40
33
24 ClpP
17
Figure 4.2: Purified samples of ClpX and ClpP.
86
Steady state peptidase activity of ClpXP. ClpXP peptidase activity was monitored using a previously designed assay which utilizes FRETN 89-98 (40) as described in Chapter 2. Reactions containing 50 mM HEPES (pH 8.1), 5 mM
Mg(OAc)2, 2 mM DTT, 900 nM ClpX and 300 nM ClpP were incubated in the
absence and presence of 1 mM ATP for 1 min at 37 °C. Reactions were initiated
by the addition of 500 μM FRETN 89-98 and fluorescence emission was
monitored for 1200 sec. In all assays, a mixed substrate was used (90% non-
fluorescent 10% fluorescent as described in Chapter 2) to avoid the inner filter effect (43).
Human ClpXP steady-state inhibition of protein degradation. Reactions containing 50 mM Tris (pH 8.1), 15 mM Mg(OAc)2, 5 mM DTT, 2 µM hClpX, 2 µM
ClpP, and 5 mM ATP were incubated at 37 °C for 1 min prior to the addition of
10µM casein in the absence and presence of 10 μM DBN93. Reaction aliquots were quenched in SDS loading dye at t=0, 30, 60, 90 min. Each time point was loaded onto a 12.5% SDS-PAGE gel and stained by Coomassie Brilliant Blue.
Synthesis of N-terminal boronic acid compounds. N-terminal boronic acid compounds (Figure 4.3) were synthesized by the Santos lab at Virginia Tech as published (74).
Screening of N-terminal boronic acid compounds as specific inhibitors of
ClpXP. To screen the effect of various compounds on the peptidase activity of
87
Figure 4.3: N-terminal peptidyl boronic acids synthesized by the Santos group and screened for ClpXP specific inhibitors. The peptide sequence GRQAY was derived from the sequence of the second product of FRETN 89-98 peptide hydrolysis by Lon (see Figure 1.6).
88
Lon and ClpXP, reactions containing 50 mM HEPES (pH 8.1), 5 mM Mg(OAc)2, 2 mM DTT, 300 nM human Lon or human ClpXP, and 20 μM various inhibitors were incubated for 30 min at room temperature. For the Lon assays, the reactions were then incubated for 1 min at 37 °C prior to initiation by the addition of 500 µM FRETN 89-98 and 1 mM ATP. For ClpXP assays, after incubation at room temperature for 30 min, 1 mM ATP was added and the reaction was further incubated at 37 °C for 1 min. The reaction was then initiated by the addition of
500 µM FRETN 89-98 and fluorescent emission was monitored for 1200 sec at
420 nm with excitation at 320 nm. Observed rate constants were determined as previously described and were normalized by dividing by the kobs for the reaction
in the absence of modulator. All experiments were performed in triplicate.
Compounds that inhibited ClpXP, but not human Lon were further tested at a concentration of 1 mM using the same fluorescent assay.
IC50 determination of lead N-terminal boronic acid compound, WLS6a.
Reactions contained 50 mM HEPES (pH 8.1), 5 mM Mg(OAc)2, 2 mM DTT, and
300 nM ClpXP. Varying amounts of inhibitor were added and the reaction was
incubated at room temperature for 30 min. The reaction was incubated with 1
mM ATP for 1 min at 37°C, then initiated with the addition of 500 μM FRETN 89-
98. Observed rate constants were normalized as described above and plotted against concentration of WLS6a and fit to Equation 4.1 (75) using Prism 4
(GraphPad)
89
v 1 i Equation 4.1 v [I] 0 1 IC50
where [I] is concentration of inhibitor and IC50 is the concentration of inhibitor at which cleavage is inhibited by 50%.
WLS6a inhibition of protein degradation. Reactions containing 50 mM HEPES
(pH 8.1), 15 mM Mg(OAc)2, 5 mM DTT, 2μM ClpXP, and 1 mM WLS6a were incubated at 37 °C for 1 min prior to the addition of 5 mM ATP. Following further incubation for 1 min at 37 °C, reactions were initiated with 10 μM casein.
Reaction aliquots were quenched in SDS loading dye at t=0, 5, 15, 30, 60, 120 minutes. Each time point was loaded onto a 12.5% SDS-PAGE gel and stained by Coomassie Brilliant Blue.
Effect of WLS6a on steady-state ATPase activity of ClpXP. Reactions containing 50 mM HEPES (pH 8), 5 mM Mg(OAc)2, 2 mM DTT, 300 nM ClpXP, in the absence and presence of 1 mM WLS6a were initiated with 1 mM [α-32P] ATP and incubated at 37 ºC. Reaction aliquots were quenched with 0.5 N formic acid at various time points (0-15 min) and 3 µL were spotted on PEI-cellulose TLC plates. The plates were developed in 0.3 M KPi (pH 3.4) and the amount of ADP
produced was quantified by PhosphorImaging as described in Chapter 2.
90
Results and Discussion
Degradation of casein by ClpXP. To confirm the inability of DBN93 to inhibit the protease activity of ClpXP, the degradation of α-casein, a known protein substrate of both Lon and ClpXP (12, 14), was examined in the presence and absence of the inhibitor. As I have shown that the peptide from which the sequence of DBN93 is derived is not a substrate of ClpXP and that the peptidase activity of ClpXP was not affected by up to 4 µM DBN93, the degradation of protein substrate should also not be inhibited. As shown in Figure 4.4, under identical experimental conditions, DBN93 inhibited α-casein degradation by hLon
(Figure 4.4a), but not by hClpXP (Figure 4.4b), as expected. This result confirms that the peptide sequence of substrates and inhibitors can be exploited develop specific compounds which can be used to determine the physiological functions of ATP-dependent proteases.
Screening of N-terminal boronic acid compounds as specific inhibitors of
ClpXP. As illustrated in the previous chapter, hClpXP shows the expected ATP- dependent cleavage of the fluorescent peptide, illustrated by an increase in fluorescence emission which can be monitored in the absence and presence of modulators. Using a FRET assay previously developed for hLon (76), I adapted the same protocol to determine inhibitors for hClpXP using FRETN 89-98 as the substrate. These potential inhibitors peptidyl N-terminal boronic acid compounds were synthesized by the Santos group at Virginia Tech. The peptide sequence
91
-DBN93 +DBN93 (a) Time (min) 0 10 20 30 0 10 20 30
hLon -
casein-
-DBN93 (b) +DBN93 Time (min) 0 30 60 120 0 30 60 120
ClpX -
casein- ClpP-
Figure 4.4: DBN93 inhibits casein degradation by human Lon but not ClpXP. (a)
1 μM hLon or (b) 2 μM ClpX and 2 μM ClpP (b) were reacted at 37 °C with 10 μM casein and 5 mM ATP in the absence and presence of 10 μM DBN93. Reaction aliquots were quenched at specified time points in SDS-PAGE loading dye and run on a 12.5% gel, then stained by Coomassie.
92
was derived from the carboxy product of peptide hydrolysis by Lon (Figure 1.5).
Initial screening of N-terminal peptidic boronic acids WLS6a-6g (Figure 4.3) at 20
µM indicated that diasteromers 6g1 and 6g2 inhibited both hLon and hClpXP but
6b showed no inhibition of either enzyme (Figure 4.5a). In contrast, WLS6a, 6e and 6f inhibited hClpXP but not Lon. Encouraged by these results, I then tested these compounds at a higher concentration (1 mM) and discovered that the proteolytic activity of hClpXP was almost completely inhibited (>90%) by N- terminal boronic peptide WLS6a in a time-dependent manner while hLon was unaffected (Figure 4.5b). 6e and 6f also inhibited hClpXP, but to a lesser extent.
IC50 determination of lead compound, WLS6a. After identifying compound
WLS6a as the most effective inhibitor from the series, I performed experiments
under steady-state conditions to estimate its potency. Fitting the kobs values of
peptide cleavage against varying amounts of WLS6a to equation 4.1 yielded an
IC50 of 29 ± 9 µM (Figure 4.6). Detailed kinetic assays to elucidate the
mechanism of inhibition as well as true inhibition constants for WLS6a are
currently underway using an optimized peptidase assay.
WLS6a inhibition of casein degradation by ClpXP. To confirm that WLS6a is
a selective inhibitor of hClpXP, I performed a secondary assay and investigated
whether compound WLS6a inhibited hClpXP and hLon mediated protein
degradation using SDS-PAGE analysis. I used casein as the substrate as it is
known to be a protein substrate for both hLon and hClpXP (77, 78). As
93
(a)
(b) B
Figure 4.5: Screening of N-terminal peptidic boronic acids using FRET 89-98 peptidase assay. (a) 20 μM or (b) 1 mM putative inhibitor was incubated with
300 nM hLon (black) or hClpXP (gray) at rt for 30 min prior to addition of ATP and FRETN 89-98 substrate. All values are the average of three experiments.
94
Figure 4.6: WLS6a IC50 determination by fluorescent peptidase assay. Rates of
FRETN 89-98 cleavage by ClpXP in the presence of varying amounts of WLS6a were determined using the fluorescent peptidase assay. Rates were normalized by dividing by the rate in the absence of inhibitor and plotted against WLS6a concentration. Data were fit to equation 4.1 as described in Materials and
Methods and an IC50 of 29 ± 9uM was determined.
95
expected, casein was completely degraded by hLon in the absence of inhibitor while minimal inhibition is observed in the presence of inhibitor as a small amount of casein persisted after 15 min of incubation (Figure 4.7a). It is clear, however, that casein is completely hydrolyzed after 30 min. In the presence of hClpXP, proteolytic cleavage of casein was complete within 2 h in the absence of inhibitor but almost fully intact during the same time course of the experiment upon incubation with inhibitor WLS6a (Figure 4.7b). These results are in complete agreement with the FRET assay and suggest that WLS6a is a selective inhibitor for hClpXP over hLon, even at a concentration of 1 mM. To the best of our knowledge, compound WLS6a is the first reported selective inhibitor for hClpXP. Although the exact mechanism of inhibition is currently unknown, this discovery should facilitate the understanding of role of hClpXP and hLon in the mitochondria.
WLS6a does not inhibit the ATPase activity of ClpXP. To confirm that the boronic acid compound WLS6a was inhibiting only the protease activity of ClpXP,
ATPase actvity assays were done in the presence of 1 mM WLS6a. As expected, even at a high concentration of WLS6a, there is no inhibition of ClpX ATPase activity (Figure 4.8).
96
A - WLS6a + WLS6a (a) Tim e (m in ) 0 5 15 30 0 5 15 30
Human Lon
Casein product
B (b) - WLS6a
Time (min) 0 5 15 30 60 120
ClpX
Casein ClpP product
+ WLS6a
ClpX
Casein ClpP product
Figure 4.7: Inhibition of ClpXP degradation of casein by WLS6a. Reactions
containing 1 µM hLon (a) or hClpXP (b) were incubated for 1 min at 37 °C in the absence and presence of 1 mM WLS6a. 5 mM ATP was added and the ClpXP reactions were further incubated for 1 min at 37 °C before initiation with 10 µM casein. Aliquots were quenched at specified time points and run on a 12.5%
SDS-PAGE gel.
97
Figure 4.8: WLS6a does not inhibit ClpXP ATPase activity. Reactions containing 300 nM ClpXP in the absence (black) and presence (gray) of 1mM
WLS6a and casein were initiated with [α-32P] ATP. The addition of ClpXP inhibitor does not affect the ATPase activity of ClpXP, confirming that the inhibitor interacts with the protease site to inhibit protease activity.
98
Conclusions. In this chapter, I have shown that the C-terminal boronic acid inhibitor, DBN93, which I showed to be a potent inhibitor of human Lon activity, does not affect the protease activity of ClpXP. In an effort to identify a boronic acid inhibitor that would be specific for ClpXP and not Lon, a series of N-terminal peptidyl boronic acids were synthesized by the Santos Lab at Virginia Tech. I screened these compounds and identified three potential ClpXP inhibitors. Upon further studies at higher concentration of inhibitor, I identified a single compound,
WLS6a which does indeed inhibit only ClpXP protease activity and not the activity of human Lon. I then monitored ClpXP cleavage of FRETN 89-98 in the presence of varying amounts of WLS6a to determine an IC50 value of ~29 µM.
More in-depth kinetic studies of the inhibition of ClpXP activity by this compound are necessary to determine true inhibition constants. The ideal inhibitor would have an inhibition constant in the low nanomolar range, but as WLS6a does not inhibit human Lon even at higher concentrations (1 mM), it will be a useful tool in selectively monitoring the activity of ClpXP in the future as DBN93 was used to detect Lon activity in isolated mitochondria (Chapter 3). The peptide sequence of the N-terminal boronic acid compounds can also be varied to possibly identify a more potent inhibitor.
99
CHAPTER 5
CONCLUSIONS AND FUTURE DIRECTIONS
100
In Chapters 2-4, I have discussed experiments that exploit the differences
in three ATP-dependent proteases. In previous studies from our lab, it has been
shown that ADP inhibits the peptidase activity of E. coli Lon (43) and proposed
that the step after ATP hydrolysis is rate limiting, which could be attributed to
ADP release (44, 55). In Chapter 2, I looked at the inhibition of human Lon
peptidase activity by ADP and determined inhibition constants for comparison to
those published for E. coli Lon. As described in the previous chapters, I have identified a peptide substrate that is cleaved by human Lon, but not human
ClpXP (FRETN 89-98Abu), a peptidyl boronic acid inhibitor that inhibits only human Lon and not ClpXP protease activity (DBN93), and a boronic acid inhibitor that only inhibits ClpXP and not human Lon protease activity (WLS6a). I have also shown in Chapter 3 that DBN93 can be used to abolish ATP-dependent peptidase activity of mitochondria isolated from HeLa cells. These results suggest that by identifying a peptide substrate that binds with high affinity to
ClpXP and a potent inhibitor of ClpXP will allow for the selective monitoring of
ClpXP activity in isolated mitochondria and live cells. The identification of
WLS6a as a ClpXP-specific inhibitor as described in Chapter 4 provides a starting point for the development of a more potent inhibitor that will help elucidate the mechanism of ClpXP protease activity, but there is still a need for a specific peptide substrate of ClpXP.
To this point, I am able to use experiments that have been previously developed for the study of Lon mechanism to begin to understand the activity of
ClpXP. This chapter describes the preliminary experiments I have done to
101
identify and characterize specific peptide substrates of ClpXP which can later be used to develop potential specific inhibitors for use studies of isolated mitochondria and live cells. Because the ClpXP complex contains individual
ATPase and proteolytic components, I must look at both activities. I begin by describing the determination of kinetic parameters for the ATPase activity of ClpX using the steady-state radioactive ATPase assay. As I showed in Chapter 3, Lon and ClpXP have different affinities for our lead peptide substrate, FRETN 89-98, so I began experiments to determine the kcat and Km for its cleavage by ClpXP to compare to those published for human Lon. I also introduce experiments that lead to the design of ClpXP specific substrates and inhibitors.
102
Materials and Methods
Radioactive steady-state ATPase activity assay. Steady-state ATPase
activity was monitored as previously described in Chapter 2. To test the effect of
imidazole concentration on ATPase activity by ClpXP, reactions containing 50
mM HEPES (pH 8), 5 mM Mg(OAc)2, 2 mM DTT, 100 nM ClpX, with and without
the addition of 40 mM imidazole (pH 8) were initiated with 1 mM [α-32P]ATP. The
reaction was incubated at 37 °C and aliquots were quenched in 0.5 N formic acid
at various time points (0-15 min). The rate of ATP hydrolysis was determined as
described in Chapter 2.
To examine the effect of ClpP on ClpX ATPase activity, reactions
containing 300 nM ClpX and varying amounts of ClpP were initiated with 1 mM α-
32P-ATP and aliquots were quenched in 0.5 N formic acid at various time points
(0-15 min).The rates of ATP hydrolyzsis were determined as previously
described.
For the determination of kcat and Km values of ClpX ATPase activity, reactions containing 300 nM ClpX and 100nM ClpP were initiated with varying amounts of [α-32P]ATP and incubated at 37 °C. Reaction aliquots were removed
at various time points (0-15 min) and quenched in 0.5 N formic acid and the
amount of ATP hydrolysis was determined as described above.
Steady state ATP-dependent FRETN 89-98 peptidase assay. Reactions
containing 50 mM HEPES (pH 8.0), 5 mM Mg(OAc)2, 2 mM DTT, 900 nM ClpX, 103
300nM ClpP, and ATP were incubated at 37 °C for 1 min prior to addition of
fluorescently labeled peptide. An increase in fluorescence emission at 420 nm
(λex= 320 nm) was monitored as described in Chapter 2.
For the determination of kcat and Km for peptide cleavage of FRETN 89-98, varying amounts of peptide (10-1000 µM) were added to initiate the reaction in the presence of 1 mM ATP. The amount of peptide hydrolyzed was measure by determining the maximum fluorescence generated per micromolar peptide after complete digestion with trypsin. The steady-state rate of the reaction was determined from the slope of a line tangent to the linear portion of the time course was converted to an observed rate constant, kobs, by dividing by the
concentration of enzyme used in the assay. Upon completion of experimental
data from time courses with higher concentrations of peptide, kinetic parameters
will be determined by fitting the kobs data versus concentration of peptide to equation 5.2
k * S n k cat Equation 5.2 obs n n K m S
Where kobs is the observed rate constant in per second, kcat is the maximal rate
constant in per second, S is the concentration of peptide in micromolar, n is the
Hill coefficient, and Km is the concentration of substrate at half maximal rate in
micromolar.
To identify peptides of interest from a library of peptides containing alanine
substitutions for each residue of FRETN 89-98 (79), continuous fluorescent 104
peptidase activity assays were done as described above with 50 µM peptide and
1 mM ATP in the presence of 900 nM ClpX and 300 nM ClpP or 300 nM hLon.
To compare the peptides in the library, the rate of cleavage of each alanine
substituted peptide was normalized by dividing by the rate of cleavage of the lead
peptide FRETN 89-98.
ATP-dependent cleavage of fluorescently labeled Cleptide. Reactions
containing 50 mM HEPES (pH 8), 5 mM Mg(OAc)2, 2 mM DTT, 900 nM ClpX,
300 nM ClpP and 1 mM ATP were initiated with varying amounts of fluorescently labeled Cleptide (14) and peptide cleavage was monitored for 900 sec at 37 °C.
The amount of peptide hydrolyzed was measure by determining the maximum fluorescence generated per micromolar peptide after complete digestion with chymotrypsin. The steady-state rate of peptide cleavage was determined by the slope of a line tangent to the linear phase of the time course which was converted to kobs by dividing by the enzyme concentration used in the assay.
105
Results and Discussion
Determination of kinetic parameters for ClpX ATPase activity. As the storage
buffer of ClpXP contains 200 mM imidazole, I tested what effect the
concentration of imidazole had on ClpXP ATPase activity. As shown in Figure
5.1, the addition of 40 mM imidazole had no influence on the rate of ATP
hydrolysis by ClpX.
As the ATPase component, ClpX, complexes with the proteolytic
component, ClpP, to form the functional protease, I wanted to know what effect
the presence of ClpP has on the ATPase activity of ClpX. To determine this, I
varied the amount of ClpP in the reaction and compared the resulting rates of
ATP hydrolysis. As shown in Figure 5.2, the amount of ClpP in the reaction has no effect on the rate of ATP hydrolysis.
For the determination of kinetic parameters kcat and Km for ATP hydrolysis
by ClpXP, I used the radioactive steady-state ATPase assay. Rates of ClpXP
ATPase activity were determined as described in Materials and Methods, and
converted to kobs values by dividing by the concentration of ClpX. These observed rate constants were plotted against initial ATP concentration and the data was fit to the Hill equation as data assumed a sigmoidal function (Figure
-1 5.3). Fitting of this data provided a kcat of 2 ± 0.2 sec , a Km of 330 ± 40 µM, and
a Hill coefficient of 1.5 ± 0.2. A Hill coefficient greater than 1 suggests positive
cooperativity; binding of ATP to one active site of the ClpX complex affects the
binding and hydrolysis of ATP of the other active sites.
106
Figure 5.1: Imidazole does not affect the ATPase activity of ClpX. The rate of
ATP hydrolysis by ClpX was determined in the presence of an additional 40 mM imidazole, which did not affect
107
Figure 5.2: Rate of ATPase activity by ClpX is not significantly affected by the amount of ClpP. The rates of radiolabeled-ATP hydrolysis by 300 nM ClpX in the presence of varying amounts of ClpP were determined by PhosphorImaging as described in Materials and Methods.
108
Figure 5.3: Determination of kinetic parameters for ATP hydrolysis by ClpXP.
The observed rate constants from time courses in the presence of varying amounts of ATP were fit to the Hill equation to yield kcat and Km values of 2 ± 0.1 sec-1 and 330 ± 40 µM, respectively.
109
ClpXP cleavage of FRETN 89-98. Observed rate constants for cleavage of
FRETN 89-98 by ClpXP were determined by dividing the rate of the time course
by the concentration of ClpP used in the assay as previously described. At this
point, the Vmax does not seem to be reached, therefore, reactions with higher
concentrations of FRETN 89-98 will have to be done in order to determine a kcat
and Km for cleavage by ClpXP. These kinetic parameters can be compared to
those for human Lon. As I have already shown that under certain experimental
conditions, ClpXP cleaves FRETN 89-98 less efficiently than Lon, I expect the
specificity constant, defined as kcat/Km, for ClpXP to be less than that of human
Lon, which has been published to be 4.5 x 103 M-1sec-1 (42).
Alanine scan peptides with ClpXP. A library of peptides have been synthesized
in our lab by substituting each residue of our lead peptide 89-98FR with alanine.
This library has been used to identify the residues important for eLon activity (79)
and led to the suggestion that I91, C93 and R96 are necessary for peptide
recognition by Lon. As a peptide with alanine substitutions at each of these
residues was not cleaved by bacterial Lon, it provided a possible peptide that
would be specifically cleaved by ClpXP and could be used in mixtures of ClpXP
and Lon, such as in mitochondrial extract, to selectively monitor ClpXP activity.
Each peptide was synthesized with the Abz/nitrotyrosine fluorescent
donor/quencher pair for use with our continuous steady state peptidase assay.
Steady state time courses were run with both hLon and ClpXP in the presence of
110
ATP and the rates were normalized to that of FRETN 89-98 (Figure 5.4). This
study identified peptides that were cleaved at a higher efficiency by ClpXP than
by both bacterial and human Lon and at a higher efficiency than FRETN 89-98
(R89A, G90A, G95A, R96A). As was predicted, the peptide with the triple alanine
substitution which was not cleaved by bacterial Lon was also not cleaved by
human Lon, but was cleaved by ClpXP. We have named this peptide hClp001 as
it is the first ClpXP-specific peptide substrate identified in our lab. Although this
peptide is cleaved with less efficiency than FRETN 89-98, it does provide a
specific peptide substrate that can be used to monitor the activity of ClpXP in
isolated mitochondria in the future.
Cleavage of fluorescently labeled Cleptide. The sequence of Cleptide
(FAPHMALVPV, Figure 5.5) has been identified by Maurizi and others (14) as a substrate of ClpXP. We have labeled this sequence with a Lys(Abz) group on the C-terminus and a (3-NO2)Tyr on the N-terminal for use in our continuous steady-state peptidase assay. As shown in Figure 5.5, this peptide is indeed cleaved by ClpXP, but not by human Lon in the presence of ATP. This result provides us with another ClpXP-specific peptide substrate whose sequence can be exploited to design specific inhibitors for the enzyme. As we are interested in the kinetic parameters of cleavage of this peptide by ClpXP, I have begun experiments to determine kcat and Km values. As shown in Figure 5.6, I have not
yet tested a concentration of peptide where Vmax has been reached, therefore, a
non-fluorescent analogue of the Cleptide will have to be synthesized and used in
111
Figure 5.4: Screening FRETN 89-98 alanine scan peptides for cleavage by
ClpXP (black), human Lon (gray) and E. coli Lon (white) (79). The peptide with alanine substitutions at I91, C93, and R96 is cleaved by ClpXP, but not human or bacterial Lon, though less efficiently than FRETN 89-98.
112
Y(NO )-FAPHMALVPV-K(Abz) 2
ClpXP + ATP
hLon + ATP
ClpXP - ATP
Figure 5.5: Fluorescently labeled Cleptide is selectively cleaved by ClpXP in the presence of ATP. 50 µM peptide was cleaved by 300 nM enzyme in the presence
(ClpXP: black, hLon: light gray) and absence (dark gray) of 1 mM ATP.
113
Figure 5.6: Cleavage of Cleptide by ClpXP can be monitored using the
fluorescent peptidase assay. kobs values were determined by taking the slope of a line tangent to the linear phase of the cleavage time course in per sec and converted to µM/sec by normalizing with the fluorescence upon complete digestion with chymotrypsin then dividing by enzyme concentration. A complete kinetic workup will be done to determine kcat and Km values for Cleptide cleavage.
114
combination with the fluorescent peptide to monitor cleavage at higher concentrations of peptide while avoiding the inner filter effect.
115
Current status and future directions. To this point, I have begun experiments to decipher the mechanism of ClpXP ATPase and proteolytic activities. In addition to the peptide substrates that have been previously used in our lab to study Lon mechanism (FRETN 89-98 and FRETN 89-98Abu, Table 5.1), I have identified two ClpXP specific peptides (hClp001 and Cleptide, Table 5.1), and begun the steady-state characterization of cleavage of the Cleptide by ClpXP.
The results of the casein digest analyzed by mass spectrometry will allow for the design of additional specific peptide substrates, as well as inhibitors that can be used in isolated mitochondria and live cells as I have used DBN93 to inhibit Lon as described in Chapter 3. The use of chemical tools such as peptide substrates and inhibitors should contribute to the identification of physiologically relevant protein substrates of each enzyme and the mechanisms by which they degrade these proteins to protect the integrity of the mitochondria and overall health of the cell.
The experiments utilizing the fluorescent peptide substrates and inhibitors to monitor peptidase activity in isolated mitochondria and live cell survival are the first of their kind to be done in our lab. It was an interesting change of pace to be able to take the results of experiments done on purified proteins in a cuvette and apply them to physiologically relevant models. One drawback to using isolated
mitochondria is that so much protein is needed to get a good signal on the
fluorometer that a large amount of HeLa cells have to be grown to isolate enough
mitochondria. The design of a peptide substrate that is more efficiently cleaved
by human Lon should give a better signal and require less mitochondria. As of
116
Cleaved Cleaved Peptide Name Sequence by by hLon? hClpXP?
FRETN 89-98 Y(NO2)-RGITCSGRQ-K(Abz) Yes Yes
FRETN 89- Y(NO )-RGIT-Abu-SGRQ-K(Abz) Yes No 98Abu 2
hClp001 Y(NO2)-RGATASGAQ-K(Abz) No Yes
Cleptide* Y(NO2)-FAPHMALVPV-K(Abz) No Yes
Table 5.1: Enzyme-specific peptide substrates.
117
right now, ClpXP peptidase activity is not able to be detected from the isolated mitochondria, partly due to the lower amount of ClpXP in the mitochondria compared to Lon and the absence of a peptide that is cleaved efficiently enough by ClpXP to be able to see fluorescent signal. Hopefully using the fluorescently labeled Cleptide will allow for detection of ClpXP activity.
In summary, the results I have presented in the previous chapters provide key information towards the development of a mechanism for proteolysis by human Lon and ClpXP. The chemical tools that have been identified and characterized can be used in proteomic studies to identify physiologically relevant protein substrates of each enzyme. Discovery of what proteins Lon and
ClpXP function to remove after oxidative damage due to aging or disease will certainly advance our knowledge of not only the individual enzymes, but the cause of the disease in general, which would lead to more effective drug design to prevent or treat cell damage.
118
BIBLIOGRAPHY
1. Friguet, B., Bulteau, A.-L., and Petropoulos, I. (2008) Mitochondrial protein
quality control: Implications in ageing, Biotechnology Journal 3, 757-764.
2. Bulteau, A. L., Szweda, L. I., and Friguet, B. (2006) Mitochondrial protein
oxidation and degradation in response to oxidative stress and aging, Exp
Gerontol 41, 653-657.
3. Shastry, B. S. (2003) Neurodegenerative disorders of protein aggregation,
Neurochem Int 43, 1-7.
4. Jenner, P. (2003) Oxidative stress in Parkinson's disease, Annals of
Neurology 53, S26-S38.
5. Bowling, A. C., and Beal, M. F. (1995) Bioenergetic and oxidative stress in
neurodegenerative diseases, Life Sciences 56, 1151-1171.
6. Schapira, A. (1996) Oxidative stress and mitochondrial dysfunction in
neurodegeneration., Current Opinion in Neurology 9, 260-264.
7. Beckman, K. B., and Ames, B. N. (1998) The Free Radical Theory of
Aging Matures, Physiol. Rev. 78, 547-581.
8. Gottesman, S., and Maurizi, M. R. (1992) Regulation by proteolysis:
energy-dependent proteases and their targets, Microbiol. Rev. 56, 592-
621.
9. Rosen, R., Biran, D., Gur, E., Becher, D., Hecker, M., and Ron, E. (2002)
Protein aggregation in Escherichia coli: role of proteases., FEMS Microbiol
Lett 207, 9-12.
119
10. Corydon, T. J., Wilsbech, M., Jespersgaard, C., Andresen, B. S., Borglum,
A. D., Pedersen, S., Bolund, L., Gregersen, N., and Bross, P. (2000)
Human and mouse mitochondrial orthologs of bacterial ClpX, Mamm
Genome 11, 899-905.
11. de Sagarra, M. R., Mayo, I., Marco, S., Rodriguez-Vilarino, S., Oliva, J.,
Carrascosa, J. L., and Casta n, J. G. (1999) Mitochondrial localization and
oligomeric structure of HClpP, the human homologue of E. coli ClpP, J
Mol Biol 292, 819-825.
12. Wang, N., Gottesman, S., Willingham, M. C., Gottesman, M. M., and
Maurizi, M. R. (1993) A human mitochondrial ATP-dependent protease
that is highly homologous to bacterial Lon protease, Proc. Natl. Acad. Sci.
USA 90, 11247-11251.
13. Kang, S. G., Dimitrova, M. N., Ortega, J., Ginsburg, A., and Maurizi, M. R.
(2005) Human mitochondrial ClpP is a stable heptamer that assembles
into a tetradecamer in the presence of ClpX, J Biol Chem 280, 35424-
35432.
14. Kang, S. G., Ortega, J., Singh, S. K., Wang, N., Huang, N. N., Steven, A.
C., and Maurizi, M. R. (2002) Functional proteolytic complexes of the
human mitochondrial ATP-dependent protease, hClpXP, J Biol Chem 277,
21095-21102.
15. van Dyck, L., and Langer, T. (1999) ATP-dependent proteases controlling
mitochondrial function in the yeast Saccharomyces cerevisiae., Cell Mol.
Life Sci. 56, 825-842.
120
16. Davies, K. J., and Lin, S. W. (1988) Oxidatively denatured proteins are
degraded by an ATP-independent proteolytic pathway in Escherichia coli,
Free Radic Biol Med 5, 225-236.
17. Käser, M., and Langer, T. (2000) Protein degradtion in mitochondria, Cell
Dev. Biol 11, 181-190.
18. van Dyck, L., Pearce, D. A., and Sherman, F. (1994) PIM1 encodes a
mitochondrial ATP-dependent protease that is required for mitochondrial
function in the yeast Saccharomyces cerevisiae, J. Biol. Chem. 269, 238-
242.
19. Wagner, I., Arlt, H., van Dyck, L., Langer, T., and Neupert, W. (1994)
Molecular chaperones cooperate with PIM1 protease in the degradation of
misfolded proteins in mitochondria, EMBO J. 13, 5135-5145.
20. Langer, T., and Neupert, W. (1996) Regulated protein degradation in
mitochondria, Experentia 52, 1019-1157.
21. Rep, M., and Grivell, L. A. (1996) The role of protein degradation in
mitochondrial function and biogenesis, Curr. Genet. 30, 367-380.
22. van Dijl, J. M., Kutejova, E., Suda, K., Perecko, D., Schatz, G., and
Suzuki, C. K. (1998) The ATPase and protease domains of yeast
mitochondrial Lon: roles in proteolysis and respiration-dependent growth,
Proc Natl Acad Sci U S A 95, 10584-10589.
23. van Dyck, L., Neupert, W., and Langer, T. (1998) The ATP-dependent
PIM1 protease is required for the expression of intron-containing genes in
mitochondria, Genes Dev. 12, 1515-1524.
121
24. Bota, D. A., and Davies, K. J. (2001) Protein degradation in mitochondria:
implications for oxidative stress, aging and disease: a novel etiological
classification of mitochondrial proteolytic disorders, Mitochondrion 1, 33-
49.
25. Bulteau, A. L., Lundberg, K. C., Ikeda-Saito, M., Isaya, G., and Szweda, L.
I. (2005) Reversible redox-dependent modulation of mitochondrial
aconitase and proteolytic activity during in vivo cardiac
ischemia/reperfusion, Proc. Natl. Acad. Sci. U S A 102, 5987-5991.
26. Maurizi, M. R. (1987) Degradation in vitro of bacteriophage lambda N
protein by Lon protease from Escherichia coli., J. Biol. Chem. 262, 2696-
2703.
27. Hanson, P. I., and Whiteheart, S. W. (2005) AAA+ proteins: have engine,
will work., Nature Rev. Mol. Cell. Biol. 6, 519-529.
28. He, T. C., Jiang, N., Zhuang, H., and Wojchowski, D. M. (1995)
Erythropoietin-induced recruitment of Shc via a receptor phosphotyrosine-
independent, Jak2-associated pathway, J. Biol. Chem. 270, 11055-11061.
29. Neuwald, A. F., Aravind, L., Spouge, J. L., and Koonin, E. V. (1999) AAA+:
A Class of Chaperone-Like ATPases Associated with the Assembly,
Operation, and Disassembly of Protein Complexes, Genome Res. 9, 27-
43.
30. Ogura, T., and Wilkinson, A. J. (2001) AAA+ superfamily ATPases:
common structure--diverse function, Genes Cells 6, 575-597.
122
31. Smith, C. K., Baker, T. A., and Sauer, R. T. (1999) Lon and Clp family
proteases and chaperones share homologous substrate- recognition
domains, Proc Natl Acad Sci U S A 96, 6678-6682.
32. Li, M., Rasulova, F., Melnikov, E. E., Rotanova, T. V., Gustchina, A.,
Maurizi, M. R., and Wlodawer, A. (2005) Crystal structure of the N-
terminal domain of E. coli Lon protease, Protein Sci 14, 2895-2900.
33. Suzuki, C. K., Suda, K., Wang, N., and Schatz, G. (1994) Requirement for
the yeast gene LON in intramitochondrial proteolysis and maintenance of
respiration, Science 264, 273-276 and 891.
34. Lupas, A., Flanagan, J. M., Tamura, T., and Baumeister, W. (1997) Self-
compartmentalizing proteases, Trends Biochem Sci 22, 399-404.
35. Park, S. C., Jia, B., Yang, J. K., Van, D. L., Shao, Y. G., Han, S. W., Jeon,
Y. J., Chung, C. H., and Cheong, G. W. (2006) Oligomeric structure of the
ATP-dependent protease La (Lon) of Escherichia coli, Mol Cells 21, 129-
134.
36. Rudyak, S. G., Brenowitz, M., and Shrader, T. E. (2001) Mg2+-linked
oligomerization modulates the catalytic activity of the Lon (La) protease
from Mycobacterium smegmatis, Biochemistry 40, 9317-9323.
37. Rotanova, T. V., Botos, I., Melnikov, E. E., Rasulova, F., Gustchina, A.,
Maurizi, M. R., and Wlodawer, A. (2006) Slicing a protease: structural
features of the ATP-dependent Lon proteases gleaned from investigations
of isolated domains, Protein Sci 15, 1815-1828.
123
38. Gottesman, S., Clark, W. P., de Crecy-Lagard, V., and Maurizi, M. R.
(1993) ClpX, an alternative subunit for the ATP-dependent Clp protease of
Escherichia coli. Sequence and in vivo activities., J. Biol. Chem. 268,
22618-226226.
39. Kenniston, J. A., Baker, T. A., Fernandez, J. M., and Sauer, R. T. (2003)
Linkage between ATP consumption and mechanical unfolding during the
protein processing reactions of an AAA+ degradation machine, Cell 114,
511-520.
40. Lee, I., and Berdis, A. J. (2001) Adenosine triphosphate-dependent
degradation of a fluorescent lambda N substrate mimic by Lon protease.,
Anal. Biochem. 291, 74-83.
41. Teichmann, U., van Dyck, L., Guiard, B., Fischer, H., Glockshuber, R.,
Neupert, W., and Langer, T. (1996) Substitution of PIM1 protease in
Mitochondria by Escherichia coli Lon protease, J. Biol. Chem. 271, 10137-
10142.
42. Frase, H., Hudak, J., and Lee, I. (2006) Identification of the proteasome
inhibitor MG262 as a potent ATP-dependent inhibitor of the Salmonella
enterica serovar Typhimurium Lon protease, Biochemistry 45, 8264-8274.
43. Thomas-Wohlever, J., and Lee, I. (2002) Kinetic characterization of the
peptidase activity of Escherichia coli Lon reveals the mechanistic
similarities in ATP-dependent hydrolysis of peptide and protein substrates,
Biochemistry 41, 9418-9425.
124
44. Vineyard, D., Patterson-Ward, J., Berdis, A. J., and Lee, I. (2005)
Monitoring the timing of ATP hydrolysis with activation of peptide cleavage
in Escherichia coli Lon by transient kinetics, Biochemistry 44, 1671-1682.
45. Matsui, H., Suzuki, M., Isshiki, Y., Kodama, C., Eguchi, M., Kikuchi, Y.,
Motokawa, K., Takaya, A., Tomoyasu, T., and Yamamoto, T. (2003) Oral
immunization with ATP-dependent protease-deficient mutants protects
mice against subsequent oral challenge with virulent Salmonella enterica
serovar typhimurium, Infect Immun 71, 30-39.
46. Frase, H., and Lee, I. (2007) Peptidyl boronates inhibit Salmonella
enterica serovar Typhimurium Lon protease by a competitive ATP-
dependent mechanism, Biochemistry 46, 6647-6657.
47. Bulteau, A. L., Ikeda-Saito, M., and Szweda, L. I. (2003) Redox-dependent
modulation of aconitase activity in intact mitochondria, Biochemistry 42,
14846-14855.
48. Bradford, M. M. (1976) A rapid and senstive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding., Anal Biochem 72, 248-254.
49. Gill, S. C., and von Hippel, P. H. (1989) Calculation of Protein Extinction
Coefficients from Amino Acid Sequence Data, Analytical Biochemistry
182, 319-326.
50. Cleland, W. W. (1979) Statistical analysis of enzyme kinetic data, Methods
Enzymol 63, 103-138.
125
51. Copeland, R. A. (2005) Evaluation of Enzyme Inhibitors in Drug Discovery:
A Guide for Medicinal Chemists and Pharmacologists, John Wiley & Sons,
Hoboken, NJ.
52. Kuzmic, P. (1996) Program DYNAFIT for the analysis of enzyme kinetic
data: application to HIV proteinase, Anal Biochem 237, 260-273.
53. Granot, Z., Kobiler, O., Melamed-Book, N., Eimerl, S., Bahat, A., Lu, B.,
Braun, S., Maurizi, M. R., Suzuki, C. K., Oppenheim, A. B., and Orly, J.
(2007) Turnover of mitochondrial steroidogenic acute regulatory (StAR)
protein by Lon protease: the unexpected effect of proteasome inhibitors,
Mol Endocrinol 21, 2164-2177.
54. Ondrovicova, G., Liu, T., Singh, K., Tian, B., Li, H., Gakh, O., Perecko, D.,
Janata, J., Granot, Z., Orly, J., Kutejova, E., and Suzuki, C. K. (2005)
Cleavage Site Selection within a Folded Substrate by the ATP-dependent
Lon Protease, J. Biol. Chem. 280, 25103-25110.
55. Goldberg, A. L., Moerschell, R. P., Chung, C. H., and Maurizi, M. R.
(1994) ATP-dependent protease La (Lon) from Escherichia coli, Meth.
Enzymol. 244, 350-375.
56. Waxman, L., and Goldberg, A. L. (1986) Selectivity of intracellular
proteolysis: protein substrates activate the ATP-dependent protease (La),
Science 232, 500-503.
57. Goldberg, A. L., and Waxman, L. (1985) The role of ATP hydrolysis in the
breakdown of proteins and peptides by protease La from Escherichia coli,
J Biol Chem 260, 12029-12034.
126
58. Menon, A. S., Waxman, L., and Goldberg, A. L. (1987) The energy utilized
in protein breakdown by the ATP-dependent protease (La) from
Escherichia coli, J Biol Chem 262, 722-726.
59. Gur, E., and Sauer, R. T. (2008) Recognition of misfolded proteins by Lon,
a AAA(+) protease, Genes & Development 22, 2267-2277.
60. Maurizi, M. R. (1992) Proteases and protein degradation in Escherichia
coli, Experentia 48, 178-201.
61. Tatsuta, T., and Langer, T. (2009) AAA proteases in mitochondria: diverse
functions of membrane-bound proteolytic machines, Research in
Microbiology 160, 711-717.
62. Bulteau, A. L., Lundberg, K. C., Ikeda-Saito, M., Isaya, G., and Szweda, L.
I. (2005) Reversible redox-dependent modulation of mitochondrial
aconitase and proteolytic activity during in vivo cardiac
ischemia/reperfusion, Proc Natl Acad Sci U S A 102, 5987-5991.
63. Sweetlove, L. J., Heazlewood, J. L., Herald, V., Holtzapffel, R., Day, D. A.,
Leaver, C. J., and Millar, A. H. (2002) The impact of oxidative stress on
Arabidopsis mitochondria, Plant J 32, 891-904.
64. Bota, D. A., and Davies, K. J. (2002) Lon protease preferentially degrades
oxidized mitochondrial aconitase by an ATP-stimulated mechanism, Nat
Cell Biol 4, 674-680.
65. Bota, D. A., Van Remmen, H., and Davies, K. J. (2002) Modulation of Lon
protease activity and aconitase turnover during aging and oxidative stress,
FEBS Lett 532, 103-106.
127
66. Masters, J. R. (2002) HeLa cells 50 years on: the good, the bad and the
ugly, Nat Rev Cancer 2, 315-319.
67. Patterson-Ward, J., Huang, J., and Lee, I. (2007) Detection and
characterization of two ATP-dependent conformational changes in
proteolytically inactive Escherichia coli lon mutants by stopped flow kinetic
techniques, Biochemistry 46, 13593-13605.
68. Maurizi, M. R., Clark, W. P., Kim, S.-H., and Gottesman, S. (1990) Clp P
Represents a Unique Family of Serine Proteases, J Biol Chem 265,
12546-12552.
69. Matthews, D. A., Alden, R. A., Birktoft, J. J., Freer, S. T., and Kraut, J.
(1975) X-ray crystallographic study of boronic acid adducts with subtilisin
BPN' (Novo). A model for the catalytic transition state, J. Biol. Chem. 250,
7120-7126.
70. Matteson, D. S., Sadhu, K. M., and Lienhard, G. E. (1981) R-1-Acetamido-
2-phenylethaneboronic acid. A specific transition-state analog for
chymotrypsin J. Am. Chem. Soc 103, 5241-5242.
71. Kinder, D. H., and Katzenellenbogen, J. A. (1985) Acylamido boronic
acids and difluoroborane analogs of amino acids: potent inhibitors of
chymotrypsin and elastase, J. Med. Chem. 28, 1917-1925.
72. Shenvi, A. B. (2002) a-Aminoboronic acid derivatives: effective inhibitors
of aminopeptidases, Biochemistry 25, 1286-1291.
128
73. Kettner, C. A., and Shenvi, A. B. (1984) Inhibition of the serine proteases
leukocyte elastase, pancreatic elastase, cathepsin G, and chymotrypsin
by peptide boronic acids, J. Biol. Chem. 259, 15106-15114.
74. Knott, K., Fishovitz, J., Thorpe, S. B., Lee, I., and Santos, W. L. (2010) N-
Terminal peptidic boronic acids selectively inhibit human ClpXP, Organic
& Biomolecular Chemistry 8, 3451-3456.
75. Copeland, R. A. (2000) Enzymes: A Practical Introduction to Structure,
Mechanism, and Data Analysis, 2nd ed., John Wiley & Sons, Inc., New
York.
76. Frase, H., Hudak, J., and Lee, I. (2006) Identification of the proteasome
inhibitor MG262 as a potent ATP-dependent inhibitor of Salmonella
enterica serovar Typhimurium Lon protease, Biochemistry 45, 8264-8274.
77. Kang, S. G., Ortega, J., Singh, S. K., Wang, N., Huang, N. N., Steven, A.
C., and Maurizi, M. R. (2002) Functional proteolytic complexes of the
human mitochondrial ATP-dependent protease, hClpXP, J. Biol. Chem.
277, 21095-21102.
78. Wang, N., Gottesman, S., Willingham, M. C., Gottesman, M. M., and
Maurizi, M. R. (1993) A human mitochondrial ATP-dependent protease
that is highly homologous to bacterial Lon protease, Proc. Natl. Acad. Sci.
USA 90, 11247-11251.
79. Patterson-Ward, J., Tedesco, J., Hudak, J., Fishovitz, J., Becker, J.,
Frase, H., McNamara, K., and Lee, I. (2009) Utilization of sunthetic
peptides to evaluate the importance of substrate interaction at the
129
proteolytic site of Escherichia coli Lon protease, Biochim Biophys Acta
1794, 1355-1363.
130