DOCSLIB.ORG

Mouse Mettl8 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Mettl8 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Mettl8 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Mettl8 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Mettl8 gene (NCBI Reference Sequence: NM_145524 ; Ensembl: ENSMUSG00000041975 ) is located on Mouse chromosome 2. 10 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 10 (Transcript: ENSMUST00000112186). Exon 3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Mettl8 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-88G11 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. Exon 3 starts from about 12.37% of the coding region. The knockout of Exon 3 will result in frameshift of the gene. The size of intron 2 for 5'-loxP site insertion: 24644 bp, and the size of intron 3 for 3'-loxP site insertion: 11288 bp. The size of effective cKO region: ~1361 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 3 10 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Mettl8 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7092bp) | A(26.95% 1911) | C(22.87% 1622) | T(28.12% 1994) | G(22.07% 1565) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 70993826 70996825 3000 browser details YourSeq 198 1381 2106 3000 81.9% chr15 - 81789869 81790408 540 browser details YourSeq 195 1382 2044 3000 90.2% chr7 - 79230216 79230918 703 browser details YourSeq 186 1399 2033 3000 89.4% chr7 + 34542459 34727773 185315 browser details YourSeq 182 1360 1627 3000 87.4% chr10 + 21666532 22020221 353690 browser details YourSeq 174 1523 2109 3000 87.0% chr15 + 55247930 55248504 575 browser details YourSeq 172 1382 1690 3000 88.4% chr9 + 98332567 98332899 333 browser details YourSeq 171 1382 1639 3000 86.9% chr11 - 115851210 115851900 691 browser details YourSeq 167 1404 1736 3000 87.8% chr5 - 131412499 131412862 364 browser details YourSeq 156 1382 1612 3000 84.5% chr4 - 136125866 136126088 223 browser details YourSeq 155 1388 1627 3000 84.8% chr1 + 164925321 164925556 236 browser details YourSeq 150 1979 2179 3000 88.9% chr17 - 35677078 35677272 195 browser details YourSeq 149 1382 1607 3000 83.3% chr7 - 135348883 135349103 221 browser details YourSeq 149 1388 1627 3000 85.8% chr19 + 40507678 40507916 239 browser details YourSeq 149 1396 1736 3000 90.4% chr11 + 102473466 102473872 407 browser details YourSeq 148 1388 1611 3000 83.2% chr9 - 64539354 64539573 220 browser details YourSeq 148 1390 1627 3000 82.6% chr10 - 77214021 77214253 233 browser details YourSeq 146 1382 1701 3000 88.4% chr1 - 37629156 37629489 334 browser details YourSeq 146 1382 1626 3000 85.5% chr10 + 24222066 24222301 236 browser details YourSeq 145 1403 1608 3000 88.1% chr10 - 76933262 77203619 270358 Note: The 3000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr2 - 70990234 70993233 3000 browser details YourSeq 165 686 2239 3000 91.8% chr10 + 77031159 77222535 191377 browser details YourSeq 155 730 2294 3000 91.0% chr16 - 35899616 36122826 223211 browser details YourSeq 146 2132 2312 3000 91.0% chr17 + 65431198 65431384 187 browser details YourSeq 142 2130 2303 3000 89.0% chr13 - 45601138 45601309 172 browser details YourSeq 140 2130 2306 3000 87.0% chr16 - 21639548 21639716 169 browser details YourSeq 138 2130 2304 3000 87.6% chr14 - 124501897 124502066 170 browser details YourSeq 134 2130 2304 3000 85.8% chr11 - 22624571 22624739 169 browser details YourSeq 132 2130 2303 3000 86.8% chr4 - 11313839 11314011 173 browser details YourSeq 132 2132 2304 3000 87.8% chr15 + 79341207 79341374 168 browser details YourSeq 132 2131 2302 3000 88.9% chr14 + 80542392 80542568 177 browser details YourSeq 131 2133 2307 3000 91.7% chr14 - 9625952 9626148 197 browser details YourSeq 130 2130 2290 3000 90.7% chr5 - 132569450 132569611 162 browser details YourSeq 130 2132 2304 3000 85.7% chr10 - 109624303 109624470 168 browser details YourSeq 128 2123 2279 3000 91.8% chr4 - 126993192 126993829 638 browser details YourSeq 127 2131 2303 3000 84.1% chr5 - 141288622 141288785 164 browser details YourSeq 127 2133 2279 3000 91.8% chr16 + 30551788 30551933 146 browser details YourSeq 126 2137 2294 3000 89.7% chr4 - 3249753 3249906 154 browser details YourSeq 124 2133 2303 3000 86.4% chr4 - 4413571 4413738 168 browser details YourSeq 124 2130 2279 3000 92.0% chr2 + 155661992 155662143 152 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Mettl8 methyltransferase like 8 [ Mus musculus (house mouse) ] Gene ID: 228019, updated on 8-Oct-2019 Gene summary Official Symbol Mettl8 provided by MGI Official Full Name methyltransferase like 8 provided by MGI Primary source MGI:MGI:2385142 See related Ensembl:ENSMUSG00000041975 Gene type protein coding RefSeq status REVIEWED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Tip; BC004636 Summary This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from Expression this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008] Orthologs Ubiquitous expression in thymus adult (RPKM 2.3), CNS E11.5 (RPKM 2.1) and 28 other tissues See more human all Genomic context Location: 2; 2 C2 See Mettl8 in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (70964561..71056388, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (70802618..70893663, complement) Chromosome 2 - NC_000068.7 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 11 transcripts Gene: Mettl8 ENSMUSG00000041975 Description methyltransferase like 8 [Source:MGI Symbol;Acc:MGI:2385142] Gene Synonyms TIP Location Chromosome 2: 70,964,561-71,055,583 reverse strand. GRCm38:CM000995.2 About this gene This gene has 11 transcripts (splice variants), 188 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 1 phenotype. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Mettl8- ENSMUST00000112186.8 2347 388aa ENSMUSP00000107804.2 Protein coding CCDS50600 A2AUU0 TSL:2 204 GENCODE basic APPRIS P2 Mettl8- ENSMUST00000100037.8 2254 341aa ENSMUSP00000097615.2 Protein coding - B0R0U1 TSL:1 202 GENCODE basic APPRIS ALT2 Mettl8- ENSMUST00000090849.5 1842 163aa ENSMUSP00000088359.5 Protein coding - Q8CA70 TSL:1 201 GENCODE basic Mettl8- ENSMUST00000121586.7 1151 281aa ENSMUSP00000113642.1 Protein coding - A2AUU0 TSL:5 205 GENCODE basic Mettl8- ENSMUST00000140293.1 592 110aa ENSMUSP00000118026.1 Protein coding - F6W103 CDS 5' 209 incomplete TSL:3 Mettl8- ENSMUST00000148876.7 2473 304aa ENSMUSP00000115855.1 Nonsense mediated - A2AUU0 TSL:1 210 decay Mettl8- ENSMUST00000112179.8 2297 206aa ENSMUSP00000107800.2 Nonsense mediated - A2AUU0 TSL:2 203 decay Mettl8- ENSMUST00000149181.7 743 148aa ENSMUSP00000119863.1 Nonsense mediated - F6Q7P7 CDS 5' 211 decay incomplete TSL:5 Mettl8- ENSMUST00000124208.1 1597 No - Retained intron - - TSL:1 206 protein Mettl8- ENSMUST00000124781.1 833 No - Retained intron - - TSL:5 208 protein Mettl8- ENSMUST00000124273.1 390 No - Retained intron - - TSL:5 207 protein Page 6 of 8
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genomic Approaches to Reproductive Disorders
    Genomic Approaches to Reproductive Disorders Aleksandar Rajkovic Dept Obstetrics Gynecology and Reproductive Sciences University of Pittsburgh Magee Womens Research Institute Pittsburgh, PA Preconceptional Care Scope • Half of Pregnancies are Unintended • Medical Conditions • Mental Conditions • Immunization History • Nutritional Issues • Family History/Genetic Risk • Occupational/Environmental Exposures • Tobacco/Drug Abuse • Social Issues Preconceptional genetic screening Ethnic: Sickle cell disease Tay–Sachs disease Pan-ethnic: cystic fibrosis fragile X syndrome Spinal muscular atrophy Mendelian Inheritance • 5593 phenotypes for which molecular basis known • 3452 genes with phenotype causing mutation • Over 15,000 mutations to date known Preconceptional Pan Ethnic Testing • Screens for known mutations in more than 100 genes, easy on genetic counsellors • The screen is pan-ethnic • Useful also for couples undergoing IVF and potentially PGD • 1:5 will be carriers of a Mendelian disorder. • $600 (529 Euros) for the couple Genetic Counselling • Objective of the test • Test Methodology • Type of sample required (parents, siblings) • Possible outcomes (abnormal results, result of unknown clinical significance) ClinVar Stars and their interpretation Number of golden stars No submitter provided an interpretation with assertion criteria (no assertion criteria provided), none or no interpretation was provided (no assertion provided) At least one submitter provided an interpretation with assertion criteria (criteria provided, single submitter)
    [Show full text]
  • Hyperphosphorylation Repurposes the CRL4B E3 Ligase to Coordinate Mitotic Entry and Exit
    Research Collection Doctoral Thesis Identification and Characterization of Novel Cullin 4-based E3 Ligases in Somatic Cell Division Author(s): da Graça Gilberto, Samuel Filipe Publication Date: 2017 Permanent Link: https://doi.org/10.3929/ethz-b-000219014 Rights / License: In Copyright - Non-Commercial Use Permitted This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library DISS. ETH NO. 24583 Identification and characterization of novel Cullin 4-based E3 ligases in somatic cell division A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich) Presented by SAMUEL FILIPE DA GRAÇA GILBERTO MSc in Biochemistry, University of Lisbon Born on 21.02.1988 Citizen of Portugal Accepted on the recommendation of Prof. Dr. Matthias Peter Prof. Dr. Anton Wutz 2017 Table of contents 1. General introduction ..................................................................................................................1 1.1. The ubiquitylation machinery ....................................................................................................... 1 1.2. Principles of cell cycle regulation: a focus on CRLs and the APC/C .............................................. 3 1.3. Cullin-4 RING E3 ligases: cell-cycle regulation and beyond ........................................................ 14 1.4. Functional distinctions between CUL4A and CUL4B ..................................................................
    [Show full text]
  • Deletion of DDB1- and CUL4- Associated Factor-17 (Dcaf17) Gene
    www.nature.com/scientificreports OPEN Deletion of DDB1- and CUL4- associated factor-17 (Dcaf17) gene causes spermatogenesis defects Received: 27 October 2017 Accepted: 31 May 2018 and male infertility in mice Published: xx xx xxxx Asmaa Ali1, Bhavesh V. Mistry1, Hala A. Ahmed1, Razan Abdulla1, Hassan A. Amer3, Abdelbary Prince3, Anas M. Alazami2, Fowzan S. Alkuraya 2 & Abdullah Assiri 1,4,5 DDB1– and CUL4–associated factor 17 (Dcaf17) is a member of DCAF family genes that encode substrate receptor proteins for Cullin-RING E3 ubiquitin ligases, which play critical roles in many cellular processes. To unravel the function of DCAF17, we performed expression profling of Dcaf17 in diferent tissues of wild type mouse by qRT-PCR and generated Dcaf17 knockout mice by gene targeting. Expression profling of Dcaf17 showed highest expression in testis. Analyses of Dcaf17 transcripts during post-natal development of testis at diferent ages displayed gradual increase in Dcaf17 mRNA levels with the age. Although Dcaf17 disruption did not have any efect on female fertility, Dcaf17 deletion led to male infertility due to abnormal sperm development. The Dcaf17−/− mice produced low number of sperm with abnormal shape and signifcantly low motility. Histological examination of the Dcaf17−/− testis revealed impaired spermatogenesis with presence of vacuoles and sloughed cells in the seminiferous tubules. Disruption of Dcaf17 caused asymmetric acrosome capping, impaired nuclear compaction and abnormal round spermatid to elongated spermatid transition. For the frst time, these data indicate that DCAF17 is essential for spermiogenesis. Infertility is a global health problem that afects 15% of couples worldwide1,2. Almost half of these infertility cases are attributed to male infertility, where about 75% of all the male factor infertility attributed to defective sper- matogenesis3–5.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Woodhouse-Sakati Syndrome: Clinical and Molecular Study on a Qatari Family with C2orf37 Gene Mutation
    Woodhouse-Sakati Syndrome: Clinical and Molecular Study on a Qatari Family with C2orf37 Gene Mutation Sara Al-Khawaga, Basma Haris, Reem Hasnah, Saras Saraswathi, Amira Saeed, Sanaa Sharari, Idris Mohammad, Khalid Hussain 1Department of Pediatric Medicine, Division of Endocrinology, Sidra Medicine, Doha, Qatar. E-mail: [email protected] Disclosure-None of the authors have any potential conflict of interest. INTRODUCTION Woodhouse-Sakati syndrome (WSS) is rare autosomal recessive condition characterized by progressive extrapyramidal signs, mental retardation, hypogonadism, alopecia, and diabetes mellitus. The age at disease onset, manifestation and severity of specific symptoms differs significantly among individuals with this syndrome and even among affected members of the same family. The gene C2orf37, which is responsible for WSS, located on chromosome 2q22.3-q35. OBJECTIVE(S) To describe the clinical and genetic characteristics of Woodhouse- Sakati Syndrome diagnosed in three siblings fom the state of Qatar. CASE REPORT The phenotype of the three siblings included hypogonadism, alopecia, diabetes mellitus, and different degrees of mental retardation ranging from mild to severe. Whole Exome Sequencing (WES) analysis was performed in the patients and their parents. Figure 2. Sanger sequencing of the three affected siblings with WSS. METHODS The patient’s genomic DNA was used. Next-generation sequencing using an Illumina system was used to capture the exonic region and CONCLUSION flanking splice junctions of the genome. Xome Analyzer was used to • Mutations in DCAF17 account for the features analyze the sequence variants all potentially pathogenic variants of Woodhouse-Sakati syndrome. were confirmed using Capillary sequencing. Sequence and copy • The exact mechanisms behind hormonal abnormalities and number alterations were reported according to the Human Genome the other signs and symptoms remain unclear.
    [Show full text]
  • Oncoscore: a Novel, Internet-Based Tool to Assess the Oncogenic Potential of Genes
    www.nature.com/scientificreports OPEN OncoScore: a novel, Internet- based tool to assess the oncogenic potential of genes Received: 06 July 2016 Rocco Piazza1, Daniele Ramazzotti2, Roberta Spinelli1, Alessandra Pirola3, Luca De Sano4, Accepted: 15 March 2017 Pierangelo Ferrari3, Vera Magistroni1, Nicoletta Cordani1, Nitesh Sharma5 & Published: 07 April 2017 Carlo Gambacorti-Passerini1 The complicated, evolving landscape of cancer mutations poses a formidable challenge to identify cancer genes among the large lists of mutations typically generated in NGS experiments. The ability to prioritize these variants is therefore of paramount importance. To address this issue we developed OncoScore, a text-mining tool that ranks genes according to their association with cancer, based on available biomedical literature. Receiver operating characteristic curve and the area under the curve (AUC) metrics on manually curated datasets confirmed the excellent discriminating capability of OncoScore (OncoScore cut-off threshold = 21.09; AUC = 90.3%, 95% CI: 88.1–92.5%), indicating that OncoScore provides useful results in cases where an efficient prioritization of cancer-associated genes is needed. The huge amount of data emerging from NGS projects is bringing a revolution in molecular medicine, leading to the discovery of a large number of new somatic alterations that are associated with the onset and/or progression of cancer. However, researchers are facing a formidable challenge in prioritizing cancer genes among the variants generated by NGS experiments. Despite the development of a significant number of tools devoted to cancer driver prediction, limited effort has been dedicated to tools able to generate a gene-centered Oncogenic Score based on the evidence already available in the scientific literature.
    [Show full text]
  • Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation Chip-Sequencing Data Processing Pipeline
    Bioinformatics Tools for the Analysis of Gene-Phenotype Relationships Coupled with a Next Generation ChIP-Sequencing Data Processing Pipeline Erinija Pranckeviciene Thesis submitted to the Faculty of Graduate and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Cellular and Molecular Medicine Department of Cellular and Molecular Medicine Faculty of Medicine University of Ottawa c Erinija Pranckeviciene, Ottawa, Canada, 2015 Abstract The rapidly advancing high-throughput and next generation sequencing technologies facilitate deeper insights into the molecular mechanisms underlying the expression of phenotypes in living organisms. Experimental data and scientific publications following this technological advance- ment have rapidly accumulated in public databases. Meaningful analysis of currently avail- able data in genomic databases requires sophisticated computational tools and algorithms, and presents considerable challenges to molecular biologists without specialized training in bioinfor- matics. To study their phenotype of interest molecular biologists must prioritize large lists of poorly characterized genes generated in high-throughput experiments. To date, prioritization tools have primarily been designed to work with phenotypes of human diseases as defined by the genes known to be associated with those diseases. There is therefore a need for more prioritiza- tion tools for phenotypes which are not related with diseases generally or diseases with which no genes have yet been associated in particular. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) is a method of choice to study the gene regulation processes responsible for the expression of cellular phenotypes. Among publicly available computational pipelines for the processing of ChIP-Seq data, there is a lack of tools for the downstream analysis of composite motifs and preferred binding distances of the DNA binding proteins.
    [Show full text]
  • The Emerging Role for Cullin 4 Family of E3 Ligases in Tumorigenesis T ⁎ ⁎ Ji Chenga,B,1, Jianping Guob,1, Brian J
    BBA - Reviews on Cancer 1871 (2019) 138–159 Contents lists available at ScienceDirect BBA - Reviews on Cancer journal homepage: www.elsevier.com/locate/bbacan Review The emerging role for Cullin 4 family of E3 ligases in tumorigenesis T ⁎ ⁎ Ji Chenga,b,1, Jianping Guob,1, Brian J. Northb, Kaixiong Taoa, Pengbo Zhouc, , Wenyi Weib, a Department of Gastrointestinal Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China b Department of Pathology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215, USA c Department of Pathology and Laboratory Medicine, Weill Cornell Medicine, 1300 York Ave., New York, NY 10065, USA ARTICLE INFO ABSTRACT Keywords: As a member of the Cullin-RING ligase family, Cullin-RING ligase 4 (CRL4) has drawn much attention due to its CRL4, Cullin 4 broad regulatory roles under physiological and pathological conditions, especially in neoplastic events. Based on E3 ligases evidence from knockout and transgenic mouse models, human clinical data, and biochemical interactions, we PROTACs summarize the distinct roles of the CRL4 E3 ligase complexes in tumorigenesis, which appears to be tissue- and Tumorigenesis context-dependent. Notably, targeting CRL4 has recently emerged as a noval anti-cancer strategy, including Targeted therapy thalidomide and its derivatives that bind to the substrate recognition receptor cereblon (CRBN), and anticancer sulfonamides that target DCAF15 to suppress the neoplastic proliferation of multiple myeloma and colorectal cancers, respectively. To this end, PROTACs have been developed as a group of engineered bi-functional che- mical glues that induce the ubiquitination-mediated degradation of substrates via recruiting E3 ligases, such as CRL4 (CRBN) and CRL2 (pVHL).
    [Show full text]
  • Download 20190410); Fragmentation for 20 S
    ARTICLE https://doi.org/10.1038/s41467-020-17387-y OPEN Multi-layered proteomic analyses decode compositional and functional effects of cancer mutations on kinase complexes ✉ Martin Mehnert 1 , Rodolfo Ciuffa1, Fabian Frommelt 1, Federico Uliana1, Audrey van Drogen1, ✉ ✉ Kilian Ruminski1,3, Matthias Gstaiger1 & Ruedi Aebersold 1,2 fi 1234567890():,; Rapidly increasing availability of genomic data and ensuing identi cation of disease asso- ciated mutations allows for an unbiased insight into genetic drivers of disease development. However, determination of molecular mechanisms by which individual genomic changes affect biochemical processes remains a major challenge. Here, we develop a multilayered proteomic workflow to explore how genetic lesions modulate the proteome and are trans- lated into molecular phenotypes. Using this workflow we determine how expression of a panel of disease-associated mutations in the Dyrk2 protein kinase alter the composition, topology and activity of this kinase complex as well as the phosphoproteomic state of the cell. The data show that altered protein-protein interactions caused by the mutations are asso- ciated with topological changes and affected phosphorylation of known cancer driver pro- teins, thus linking Dyrk2 mutations with cancer-related biochemical processes. Overall, we discover multiple mutation-specific functionally relevant changes, thus highlighting the extensive plasticity of molecular responses to genetic lesions. 1 Department of Biology, Institute of Molecular Systems Biology, ETH Zurich,
    [Show full text]
  • Dcaf17 (NM 001165982) Mouse Tagged ORF Clone – MG219128
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG219128 Dcaf17 (NM_001165982) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Dcaf17 (NM_001165982) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Dcaf17 Synonyms: 2810055O12Rik; 4833418A01Rik; A030004A10Rik; A930009G19Rik; AI448937 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MG219128 representing NM_001165982 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCCGGACCCGGAAGGCCAATGTGTGCCGCAGGCTGAGTCGCCGGGCTCTGGGCTTCTATGCACGCG ACGCAGGCGTGGTGCAGAGGACGAACCTGGGCATCCTGCGGGCGCTGGTGTGCCAGGAGAGTACTAAATT TAAGAATGTTTGGACAACTCATTCCAAGTCACCTATAGCCTATGAGAGAGGAAGAATATATTTTGACAAT TACCGGTGCTGTGTCAGCAGTGTTGCATCAGAGCCAAGAAAACTTTATGAAATGCCAAAATGTTCCAAAT CAGAAAAAATTGAGGATGCTTTATTATGGGAATGCCCAGTGGGAGACATACTTCCTGACCCATCAGACTA TAAATCCTCACTCATAGCCCTGACTGCTCATAATTGGCTGCTTCGTATATCCGCAACTACAGGGGAAGTC CTGGAGAAAATATACCTTGCTTCCTACTGCAAATTCAGGTACCTGAGCTGGGACACACCTCAGGAGGTCA TCGCAGTGAAGTCGGCTCAGAACAAAGGCTCCGCAGCGGCTCGCCAGGCAGGCACTTCACCACCCGTTTT GTTGTACCTCGCAGTGTTCCGGGTTCTGCCCTTTTCACTTGTAGGGATTCTAGAGATCAACAAAAAGGTT TTTGAGAATGTCACAGATGCTACCTTGTCACATGGAATCCTGATTGTGATGTACAGCTCGGGACTAGTCA GACTCTACAGCTTCCAAGCCATCATCGAACAGACTCACCACCTCCACTCTTTGAAGTTTCATCTCTGGAG AACGCATTCCAGATTGGAGGCCATCCTTGGCACTACATCATCACGCCTAATAAGAAGAAACAGAAAGGAG
    [Show full text]
  • Woodhouse-Sakati Syndrome: a Case Report from Indonesia
    Case Report DOI: 10.7860/JCDR/2019/38431.12481 Internal Medicine Woodhouse-Sakati Syndrome: A Case Section Report from Indonesia LUCKY AZIZA ABDULLAH BAWAZIR ABSTRACT Woodhouse-Sakati Syndrome (WSS) is an extremely rare autosomal recessive neuroendocrine disease with loss of function mutation of DCAF17 gene, located on chromosome 2q31. This report discusses the first documented case of suspected WSS in Indonesia in a 20-year-old female patient with multiple metabolic abnormalities, delayed puberty, secondary osteoporosis, hydronephrosis, colitis, and recurrent urinary tract infection, possibly due to partial urinary retention. The patient was treated with 6 units of insulin aspart (three times a day) and 8 units of insulin Detemir (once a day) for diabetes mellitus. She also received Levothyroxine for hypothyroidism; calcitriol for osteoporosis; as well as bladder training and antibiotics for recurrent urinary tract infection. Within the last one year, the patient has been admitted to hospital three times due to uncontrolled blood glucose level and clinical manifestation of urinary tract infection and colitis. Although the patient has been treated in a top referral hospital in Indonesia, problems in confirming diagnosis of Woodhouse-Sakati syndrome in this patient still persists due to the absence of facilities for genetic sequence analysis and limitations of financial coverage for the patient and her family. Keywords: Delayed secondary sexual characteristics, Metabolic abnormalities, Young adult CASE REPORT A 20-year-old female reported with generalised body weakness since one week prior to hospital admission. She decided to go to hospital only after the weakness of her body worsened, which was three hours prior to hospital admission.
    [Show full text]