Journal of the Marine Biological Association of the United Kingdom http://journals.cambridge.org/MBI

Additional services for Journal of the Marine Biological Association of the United Kingdom:

Email alerts: Click here Subscriptions: Click here Commercial reprints: Click here Terms of use : Click here

Habitat correlation of Symbiodinium diversity in two reef­building coral species in an upwelling region, eastern Hainan Island, China

G. Zhou, H. Huang, J. Lian, C. Zhang and X. Li

Journal of the Marine Biological Association of the United Kingdom / Volume 92 / Issue 06 / September 2012, pp 1309 ­ 1316 DOI: 10.1017/S0025315411001548, Published online: 21 October 2011

Link to this article: http://journals.cambridge.org/abstract_S0025315411001548

How to cite this article: G. Zhou, H. Huang, J. Lian, C. Zhang and X. Li (2012). Habitat correlation of Symbiodinium diversity in two reef­building coral species in an upwelling region, eastern Hainan Island, China. Journal of the Marine Biological Association of the United Kingdom, 92, pp 1309­1316 doi:10.1017/S0025315411001548

Request Permissions : Click here

Downloaded from http://journals.cambridge.org/MBI, IP address: 202.40.139.167 on 02 Nov 2012 Journal of the Marine Biological Association of the United Kingdom, 2012, 92(6), 1309–1316. # Marine Biological Association of the United Kingdom, 2011 doi:10.1017/S0025315411001548 Habitat correlation of Symbiodinium diversity in two reef-building coral species in an upwelling region, eastern Hainan Island, China g. zhou1,2, h. huang1,2, j. lian1, c. zhang1 and x. li1 1Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China, 2National Experiment Station of Tropical Marine Biology, Sanya 572000, China

Reef-building corals are fundamental to the most diverse marine ecosystems, and the coral–dinoflagellate (zooxanthellae) associations on fine scale remains largely unknown. Spatial variation in the diversity of symbiotic dinoflagellates of two scler- actinian coral species was studied in an upwelling region near Qinlan Harbor in eastern Hainan Island, China. Results showed that stress-tolerant Symbiodinium trenchi in individual colonies of Galaxea fascicularis occurred more frequently in shallow back-reef than in deep fore-reef. The higher symbiont diversity was found in colonies of G. fascicularis in shallow and close to the harbour mouth whereas the coral Pocillipora damicornis always harboured Symbiodinium internal transcribed spacer 2 (ITS2) types C1c or C42a. Furthermore, both corals were found to simultaneously contain Symbiodinium ITS2 types belonging to two distinct phylogenetic clades (C and D). This indicates that the distribution of genetically distinct Symbiodinium may correlate with light regime and possibly temperature in some (but not all) colonies at particular locations, which we interpret as holobiont acclimation to the local environmental conditions. Therefore, we conclude that reef-building corals can adapt to the local environment by harbouring genetically distinct symbionts but depend on their respective sym- biont transmission modes.

Keywords: scleractinian coral, Symbiodinium, symbiosis, South China Sea

Submitted 6 January 2011; accepted 8 August 2011; first published online 21 October 2011

INTRODUCTION Consequently, investigating the patterns of diversity in coral– algal symbioses on a variety of spatial scales with specific habi- The success of coral reefs largely depends on the symbiotic tats is important for understanding the tolerance and adapta- relationships between reef invertebrates and dinoflagellates of bility of coral species to natural and anthropogenic the genus Symbiodinium (Freudenthal, 1962). Disruption of perturbations. these interactions produces coral bleaching, which is widely The patterns of coral–Symbiodinium associations depend considered to be one of the biggest threats to the health of largely on the specificity of the symbioses (Baker, 2003; coral reefs today (Hoegh-Guldberg et al., 2007). Currently, LaJeunesse et al., 2004, 2008; Garren et al., 2006). Although a nine clades (A–I) of Symbiodinium have been identified as dis- much debated issue, studies have suggested symbiont trans- tinct lineages based on nuclear ribosomal DNA (rDNA) and mission mode have effect on symbiont diversity and specificity, chloroplast 23S rDNA (LaJeunesse, 2002; Santos et al., 2002; especially apparent in corals with a vertical symbiont trans- Pochon & Gates, 2010), with each clade containing numerous mission strategy, in which symbionts are passed directly from Symbiodinium types often resolved using the internal tran- the maternal colony to the offspring (Baker, 2003; Barneah scribed spacer (ITS) regions (ITS1 and ITS2: e.g. LaJeunesse et al., 2004; van Oppen, 2004; Stat et al., 2008). Specificity of et al., 2003, 2004; van Oppen, 2004). Previous investigations host–symbiont associations also depends largely on the host have shown that distinct symbiont types exhibit physiologically (Baker, 2003; Weis, 2008). Additionally, the host–symbiont diverse as well as distinct ecological functions (Sampayo et al., partnerships differ not only between coral taxa but also 2007, 2008; Frade et al., 2008; LaJeunesse et al., 2010). Recent between conspecific populations at both large (Loh et al., 2001; studies have highlighted the high genetic diversity within the Rodriguez-Lanetty et al., 2001) and small scales (Oliver & genus Symbiodinium, which raised the possibility that reef Palumbi, 2009), as well as showing clear patterns of depth zona- corals’ tolerance to bleaching and environmental stress may tion (Sampayo et al.,2007;Fradeet al., 2008). For example, a lati- vary according to their symbiotic associations (Baker, 2003). tudinal pattern was observed in the coral Plesiastrea versipora along the eastern Australian coast, with a transition of Symbiodinium types occurring from clade C to clade B in the cooler, high latitude communities (Rodriguez-Lanetty et al., Corresponding author: H. Huang 2001). The symbiotic dinoflagellates of reef-building corals are Email: [email protected] sensitive to changes such as temperature, irradiance and

1309 1310 g. zhou et al.

turbidity. The combinations of corals and their symbionts may MATERIALS AND METHODS be environmentally determined (Toller et al., 2001; Garren et al., 2006). It has also been shown that some symbiont types Study site and sampling were better suited to withstand environmental pressure than others (Baker, 2003). For instance, Berkelmans & van Oppen Gaolong Bay is located on the north-eastern coast of Hainan (2006) found that Symbiodinium type D displaced symbiont Island, the second largest island in China and in the northern type C in corals transplanted from a clear water habitat in the part of the South China Sea (Figure 1). Wind-induced southern Great Barrier Reef (GBR) to a more turbid and Qiongdong Upwelling in northern Hainan Island during the warmer inshore reef in the centre of the GBR. summer (June to September: Jing et al., 2009) exposes corals However, little is known concerning the fine-scale diversity to cool and nutrient-rich waters and in addition, locations for Symbiodinium spp. populations inhabiting coral species near Qinlan Harbor and estuarine zones of the Wenchang with different symbiont transmission mode (Stat et al., River and the Wenjiao River. The water quality here is par- 2008), particularly in an extreme environment. Given the pro- ticularly affected by several external physical factors, the jected global changes expected to affect the coral reefs most important of which are coastal development and (Hoegh-Guldberg et al., 2008), there is a critical need to by-passing of vessels to Qinlan Harbor contributing to turbid- conduct more research on patterns of host–symbiont associ- ity. Therefore, such extreme environmental conditions can ations from different habitats, as differences in symbiosis may potentially affect the coral and symbiont. partially explain and help predict how coral communities Corals were sampled at five sites with increasing distance respond to environmental change. away from Qinlan Harbor by SCUBA diving (Figure 1). At Herein, we examined the diversity of Symbiodinium associ- each site, approximately 5 cm2 fragments of coral Galaxea fas- ated with two scleractinian corals, Galaxea fascicularis cicularis were sampled at two depths (shallow back-reef: 3 m (Linnaeus, 1767) and Pocillopora damicornis (Linnaeus, 1758), and deep fore-reef: 8 m) and Pocillipora damicornis was using denaturing gradient gel electrophoresis (DGGE) analysis sampled at the shallow depth due to limited distribution. In of polymerase chain reaction (PCR) amplified fragments of all cases, coral colonies were collected at least separated by ITS2 rDNA. Galaxea fascicularis and P. damicornis are two eco- 5 m to avoid sampling possible clones formed by fragmenta- logically dominant reef-building corals in the Pacific as well as in tion. The samples were preserved in 100% ethyl alcohol the tropical regions of the South China Sea. Galaxea fascicularis (EtOH) at room temperature. is a bleaching resistant species which acquires Symbiodinium from the external environment each generation (horizontal DNA extraction, PCR and DGGE transmission); Pocillopora damicornis is a bleaching sensitive species with a vertical symbiont transmission strategy Total DNA was extracted using the modification of protocol (Richmond & Hunter, 1990). We attempted to characterize described in Lin et al. (2006). Briefly, the fragments were pre- the main environmental factors which drive the distribution served in the DNA isolation buffer (containing 0.1 M EDTA, pattern of Symbiodinium in Gaolong Bay, near Qinlan Harbor 1% (w /v) sodium dodecyl sulphate, 10% (w /v) cetyltrimethy- of Hainan Island, China. The results contribute to our under- lammonium bromide). Proteinase K (Promega) was then standing of the flexibility of coral–Symbiodinum and the local added to a final concentration of 0.5 mg/ml, prior to incu- adaptation. bation at 558C for at least 10 hours. DNA was then isolated

Fig. 1. Map of study locations along eastern coast of Hainan Island, China. habitat correlation of symbiodinium in corals 1311 by adding 17 ml of 5M NaCl and incubating at 558C for 10 August 2010. Seawater temperature, salinity and pH were minutes, followed by one chloroform extraction and one measured in situ using an Orion multiparameter apparatus. phenol-chloroform extraction. DNA was then purified by The transparency was measured using a 30 cm diameter, being passed twice through DNA Clean and Concentrator black and white Secchi disc attached to a rope marked at columns (Zymo Research, Orange, CA). The DNA was resus- 0.5 m intervals. The distance from harbour mouth to study pended in 50 ml aliquots of TE buffer and stored at –208C site was calculated using GPS location; it represents the degree until PCR was performed. to which sites are influenced by the harbour environment. The Symbiodinium ITS2 region was analysed using DGGE in combination with DNA sequencing of dominant bands. ′ Data analysis The ITS2 was amplified using the primers: ITS2 clamp (5 - CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGC Spatial patterns in Symbiodiniun community structure were CCGG-GATCCATATGCTTAAGTTCAGCGGGT-3′)andexamined by multivariate techniques using the PRIMER soft- ITSintfor2 (5′-GAATTGCAGAACTCCGTG-3′) with a touch- ware package (v. 6.0) (Clarke & Warwick, 2001). Samples down PCR protocol following LaJeunesse (2002). PCR products were grouped according to depth and sampling stations and were loaded on 8% (w/v) polyacrylamide gels with a denaturant differences tested by the analysis of similarities test (Clarke & gradient of 20–60% (where 100% is defined as 7 M urea and Warwick, 2001). Canonical correspondence analysis (CCA) 40% (v/v) formamide). Electrophoresis was performed with was performed using CANOCO 4.5 (ter Braak, 1995) to the D-code System (Bio-Rad, USA) using 0.5 × TAE buffer explore the relationship between environmental variables and at 608C for 14 hours at 100 V. Gels were stained for the members of Symbiodinium communities in G. fascicularis. 30 minutes in 1 × TAE buffer containing ethidium bromide A Monte Carlo permutation test based on 199 random permu- (0.5 mg/l) and photographed with UV transillumination. tations was used to test the null hypothesis that Symbiodinium Distinct ITS2–DGGE profiles (fingerprints) were character- compositions were unrelated to environmental variables. ized by sequencing of the dominant bands (Figure 2). Bands were excised from the gel, eluted in DNase free water overnight, reamplified with a reverse primer lacking the GC-clamp, and RESULTS sequenced directly on an ABI 3730 automated DNA sequencer (Applied Biosystems, Foster City, USA). Newly characterized Environmental parameters fingerprints diagnostic of an ecologically distinct symbiont were given an alphanumeric name as described before Environmental conditions differed a little along the gradient (LaJeunesse, 2002). The capital letter of these taxonomic desig- from the near-harbour mouth to outer locations (Table 1). nators refers to the particular clade of Symbiodinium and the Transparency was lower at the near-harbour mouth than at numbers and lower case letters refer to bands diagnostic of outer locations. The temperature in the shallow back-reef the DGGE fingerprint. ITS2 sequences were deposited in was higher than in the deep fore-reef. In site 3, the average GenBank (Accession Nos: HQ650834–HQ650839). temperature was 26.468C and 24.968C in shallow back-reef and deep fore-reef, respectively. The salinity and pH had no significant difference among sites (P , 0.05). Environmental data Seawater temperature, salinity, pH and transparency were Symbiodinium identification obtained for each site through the collection during this Analyses by PCR–DGGE of ITS2 enabled the identification of study. In addition, seawater temperatures were recorded 6 distinctive Symbiodinium ITS2 types (three clade C and two every ten minutes with HOBO Temperature Loggers clade D) across 179 samples from two coral species. Colonies (+0.18C) at the depths of 3 and 8 m at site 3 during May to of P. damicornis from all sites contained either Symbiodinium ITS2 type C1c (N ¼ 60 of 74) or C42a (N ¼ 13 of 74), but occasionally, one colony from site 1 had mixed symbioses of both C1c and D1. Colonies of G. fascicularis possessed either C1, C21a, Symbiodinium trenchi (formerly D1a), and/ or combinations of these from all sites. Symbiodinium trenchi is typically restricted to G. fascicularis at both shallow and deep depth in this study. Figure 2 shows the different DGGE band profiles obtained from G. fascicularis and P. damicornis. Heteroduplexes were usually produced from the mismatching of intragenomic variants during the PCR process that largely reported in previous studies (LaJeunesse, 2002; LaJeunesse et al., 2003; Thornhill et al., 2007). Symbiont types that were designated C1 followed by Fig. 2. Representative polymerase chain reaction (PCR)-denaturing gradient a lowercase letter (e.g. C1c) indicated that their genomes gel electrophoresis fingerprinting analysis of the internal transcribed spacer 2 contain the C1 sequence and a codominant sequence, C1c. regions of Symbiodinium types observed in Galaxea fascicularis and Pocillopora damicornis. (A) Galaxea fascicularis; (B) Pocillopora damicornis. Closed arrowheads indicate the prominent bands diagnostic of a particular Fine-scale coral–Symbiodinium associations profile that are excised and sequenced. Bands in the upper part of a profile are heteroduplexes that form during PCR or due to other reasons (Thornhill The distribution of symbionts associated with G. fascicularis et al., 2007, 2010, open arrowheads). showed no significant effect of sites (r ¼ 0.422, P ¼ 0.117). 1312 g. zhou et al.

Table 1. Environmental variables at all sampling sites (1–5). S, shallow back-reef; D, deep fore-reef.

Site Environmental data

Depth (m) Temperature (8C) Salinity (ppt) pH Transparency (m) Distance to harbour mouth (km)

1S 3 26.8 33.2 8.168 3.8 2.94 2S 3 26.4 33.4 8.028 6.55 2D 8 26.2 33.1 8.017 8 6.55 3S 3 26.9 33.2 8.132 9.89 3D 8 26.3 33.1 8.118 8 9.89 4S 3 26.3 33.2 8.115 4.91 4D 8 26 33.3 8.106 5 4.91 5S 3 27 33.2 8.102 7.40 5D 8 26.5 33.4 8.074 8 7.40

Colonies of G. fascicularis on the deep fore-reefs harboured types C1 and C21a. In some cases, there was a slight decrease mainly C1 (N ¼ 47 of 105) and C21a (N ¼ 33 of 105), and in the proportion of the S. trenchi from shallow back-reef to to a lesser extent S. trenchi (N ¼ 10 of 105), with some colo- deep fore-reef (Figure 3). In other case, colonies of G. fascicu- nies (N ¼ 13 of 105) harboured both S. trenchi and one of the laris collected from both depths at site 5 hosted types C1 or

Fig. 3. Frequency of Symbiodinium internal transcribed spacer 2 types in Galaxea fascicularis at shallow back-reef and deep fore-reef from all sites (1–5, see Figure 1). S, shallow back-reef; D, deep fore-reef. habitat correlation of symbiodinium in corals 1313

C21a exclusively. Similarly, symbiont diversity within P. Table 2. Summary of canonical correspondence analysis (CCA) between damicornis did not differ significantly among sites. It appeared Symbiodinium internal transcribed spacer 2 types in Galaxea fascicularis that the C symbiont was more commonly found among P. and different environmental variables. damicornis than G. fascicularis, and were entirely dominated Axis 1 Axis 2 by Symbiodinium C1c at all sites (Figures 1 & 4). Results from CCA ordination of Symbiodinium types in G. fascicularis Eigenvalues 0.282 0.047 and environment indicate that the abiotic factors partly influ- Species–environment correlations 0.935 0.663 enced the symbiont community, explaining 76% of the total Cumulative percentage variance of species data 65.8 76.7 variance (Table 2; Figure 5). Symbiodinium types in clade C of species–environment relation 85.8 100.0 were significantly and positively related to depth and distance Sum of all eigenvalues 0.428 from the harbour mouth (Figure 5). Sum of all canonical eigenvalues 0.328 Variance explained by the CCA 76.64%

DISCUSSION et al., 2004), temperature (Rowan et al., 1997; Tchernov The present study demonstrates that fine-scale diversity of et al., 2004) or available nutrients (Fitt & Cook, 2001), that Symbiodinium in populations of two reef-building corals may be acting synergistically (Frade et al., 2008). In this with different symbiont transmission modes from a study, CCA revealed that depth, distance and transparency harbour–estuary–upwelling region. It highlights the impli- accounted for the patterns of association between cations of ecological and evolutionary processes in coral– Symbiodinium and G. fascicularis. For G. fascicularis, deep algal associations. fore-reef and the locations with increasing distance from the harbour mouth appeared to sustain less diverse symbiont communities than shallow and near the harbour mouth Symbiont variation and functional diversity areas, which is likely due to higher light intensity and turbidity The dominance of Symbiodinium clade C in G. fascicularis found in the shallow and closed to the harbour mouth in the and P. damicornis in the present study is consistent with present study. This may also partly explain the higher relative their prevalence in cnidarian symbioses in the Indo-Pacific abundance of S. trenchi in the shallow and turbid habitats, (Loh et al., 2001; LaJeunesse et al., 2003, 2008), as well as in which was usually associated with G. fascicularis from other dominant corals from the South China Sea (Huang et al., regions in the Pacific (LaJeunesse et al., 2004). By contrast, 2006; Dong et al., 2009). Almost all Symbiodinium types P. damicornis hosted predominantly Symbiodinium ITS2 described here have been reported in the previous studies type C1c or C24a at all sites. It has been found that certain from the same host across the Pacific, including the GBR symbionts have adaptations to particular ecological niche and Okinawa (LaJeunesse et al., 2003, 2004). A single excep- (Rowan et al., 1997; Sampayo et al., 2007). ITS2 types in tion is the type C42a, which is firstly detected in P. damicornis Symbiodinium clade D generally associates with corals from in the present study, whereas the closely related symbiont C42 environments of both high and low temperature and signifi- has been reported in P. damicornis from the GBR (Sampayo cant terrestrial impacts, and some of them have been charac- et al., 2007). However, there were no shared symbiont types terized as heat or stress tolerant types (Rowan et al., 1997; observed between the G. fascicularis and P. damicornis, Toller et al., 2001; Garren et al., 2006; Thornhill et al., which may indicate the host–symbiont specificity as shown 2006a; Mostafavi et al., 2007; Oliver & Palumbi, 2009). by others (LaJeunesse et al., 2008; Thornhill et al., 2009). In contrast to S. trenchi, D1 is a distinct type of Fine-scale symbiont variation in corals could be caused by Symbiodinium in clade D and this type is specific to the environmental factors such as light intensity (Iglesias-Prieto genus Pocillopora in the Pacific (LaJeunesse et al., 2008,

Fig. 4. Frequency of Symbiodinium internal transcribed spacer 2 types in Pocillopora damicornis at shallow back-reef from all sites (1–5, see Figure 1). Numbers of individual colonies sampled are provided in parentheses. 1314 g. zhou et al.

Fig. 5. Canonical correspondence analysis ordination diagram of Symbiodinium types data in Galaxea fascicularis with respect to environmental factors.

2010). It had been reported that corals in the genus Pocillopora ecological function of different types within each harbouring Symbiodinium D1 were mostly unaffected while Symbiodinium clade (LaJeunesse et al., 2004; Sampayo et al., the colonies possessing C1b-c were once bleached during an 2007, 2008). extreme cold-water event (LaJeunesse et al., 2010). Some Symbiodinium types in clade C have been described as sensi- tive to both thermal and light stress and are generally located Host–symbiont lifecycle and symbiont in deep water (Rowan et al., 1997; Berkelmans & van Oppen, diversity 2006). The abundance of type C1 and C21a in association with G. fascicularis increased with both increasing distance from According to present knowledge, the mode of transmission of the harbour mouth and the deeper water; this pattern indi- symbionts between host generations may also have a strong cated that these symbionts are well adapted to the low light influence on symbiont diversity and the specificity of corals (or temperature) and clearer water. Nevertheless, most of and Symbiodinium (LaJeunesse et al., 2003, 2004; Thornhill the colonies of P. damicornis associated with Symbiodinium et al., 2006b; Stat et al., 2008). LaJeunesse et al. (2004) C1c and C42a were likely to be better adapted to the showed that coral hosts from Hawaii harboured a high shallow and turbid environment. However, it is worthy of number of unique symbiont types that could be due to the note that clade C types are still the most abundant symbiont predominance of coral hosts which are vertical transmitters in both G. fascicularis and P. damicornis in all locations, and in Hawaiian reefs. Similarly, Barneah et al. (2004) observed this may indicate that functions of symbionts in clade C are that symbiont clade correlated with mode of symbiont trans- complex. In the example from the 2006 GBR bleaching mission in Red Sea soft corals. Several studies proposed that event, corals that originally hosted the putatively thermal sus- corals with vertical transmission mode are expected to be ceptible Symbiodinium clade C2 switched either to clade D or more specific and stable for their symbionts than corals C1, suggesting that members of clade C1 are also more resist- acquiring their symbionts horizontally from the surrounding ant than C2 (Jones et al., 2008). Consequently, substantial evi- environment (Loh et al., 2001; LaJeunesse et al., 2004, 2008; dence demonstrates that the variants within clade C have Thornhill et al., 2006b). In contrast to these results, van different thermal properties (LaJeunesse et al., 2003; Jones Oppen (2004) found that mode of symbiont transmission et al., 2008; Sampayo et al., 2008). Because the distribution does not affect the levels of symbiont diversity in of P. damicornis was limited to the shallow water, the depth Indo-Pacific acroporid corals (Montipora spp. and Acropora patterns were not known in the present study. However, spp.), suggesting that vertical transmitters are more flexible Sampayo et al. (2007) reported that P. damicornis associated than previously thought (Thornhill et al., 2006b). In the with multiple symbionts showed a strong zonation with present study, both G. fascicularis and P. damicornis with depth. The presence of clades C and D in both G. fascicularis different symbiont transmission mode can have multiple sym- and P. damicornis colonies may be due to exposure to more bionts. This pattern has also been revealed in previous studies environmental variability conditions, and may indicate a and the exact correlation between symbiont diversity and potential adaptation to the environment (Thornhill et al., transmission modes is still not well understood (but see 2006a). All together, these may further ensure the complex Barneah et al., 2004; van Oppen, 2004; Thornhill et al., habitat correlation of symbiodinium in corals 1315

2006b; Stat et al., 2008). Nevertheless, an open transmission related coral species over large depth ranges. Molecular Ecology 17, mode could offer G. fascicularis the flexibility and opportunity 691–703. to associate with locally adapted symbiont types as potentially Garren M., Walsh S.M., Caccone A. and Knowlton N. (2006) Patterns of seen in this study and proposed by others (LaJeunesse, 2002; association between Symbiodinium and members of the Montastraea Stat et al., 2008). The relationship between symbiont trans- annularis species complex on spatial scales ranging from within colo- mission mode and host–Symbiodinium associations certainly nies to between geographic regions. Coral Reefs 25, 503–512. deserves further investigation. Hoegh-Guldberg O., Mumby P.J., Hooten A.J., Steneck R.S., Greenfield In summary, we have shown that the symbiotic dinoflagel- P., Gomez E., Harvell C.D., Sale P.F., Edwards A.J., Caldeira K., lates of two widely distributed coral species with different Knowlton N., Eakin C.M., Iglesias-Prieto R., Muthiga N., symbiont transmission mode are variable at the fine-scale Bradbury R.H., Dubi A. and Hatziolos M.E. (2007) Coral reefs (,15 km), and may partly be due to fluctuating conditions under rapid climate change and ocean acidification. Science 318, of light and turbidity, exposure to the seasonal upwelling 1737–1742. waters and symbiont acquisition mode. A considerable amount of work remains to be done to elucidate the seasonal Hoegh-Guldberg O., Mumby P.J., Hooten A.J., Steneck R.S., Greenfield P., Gomez E., Harvell C.D., Sale P.F., Edwards A.J., Caldeira K., effects on coral and Symbiodinium of exposure to summer Knowlton N., Eakin C.M., Iglesias-Prieto R., Muthiga N., upwelling conditions. Additionally, further experimental ana- Bradbury R.H., Dubi A. and Hatziolos M.E. (2008) Coral adaptation lyses are needed to explain the mechanisms that result in these in the face of climate change—response. Science 320, 315–316. observed association patterns. Unravelling the patterns of host–Symbiodinium associations is essential to understanding Huang H., Dong Z., Huang L. and Zhang J. (2006) Restriction fragment the adaptive capacity of corals by a rapidly changing environ- length polymorphism analysis of large subunit rDNA of symbiotic dinoflagellates from scleractinian corals in the Zhubi Coral Reef of ment, and may be particularly important in the complex the Nansha Islands. Journal of Integrative Plant Biology 48, 148–152. regions. Iglesias-Prieto R., Beltran V.H., LaJeunesse T.C., Reyes-Bonilla H. and Thome P.E. (2004) Different algal symbionts explain the vertical dis- ACKNOWLEDGEMENTS tribution of dominant reef corals in the eastern Pacific. Proceedings of the Royal Society of London, Series B—Biological Sciences 271, 1757– 1763. The authors would like to thank X. Lei and J. Yang for assist- ing with the sample collection. This research was supported by Jing Z., Qi Y., Hua Z. and Zhang H. (2009) Numerical study on the grants from the National Natural Science Foundation summer upwelling system in the northern continental shelf of the of China (grant number 40830850), the National Key South China Sea. Continental Shelf Research 29, 467–478. Technology Research and Development Program of the Jones A.M., Berkelmans R., van Oppen M.J.H., Mieog J.C. and Sinclair Ministry of Science and Technology of China (grant number W. (2008) A community change in the algal endosymbionts of a scler- 2009BAB44B01) and the Main Direction Program of actinian coral following a natural bleaching event: field evidence of Knowledge Innovation of the Chinese Academy of Sciences acclimatization. Proceedings of the Royal Society of London, Series (grant number KZCX2-YW-227). B—Biological Sciences 275, 1359–1365. LaJeunesse T.C. (2002) Diversity and community structure of symbiotic dinoflagellates from Caribbean coral reefs. Marine Biology 141, 387– REFERENCES 400. LaJeunesse T.C., Loh W.K.W., van Woesik R., Hoegh-Guldberg O., Baker A.C. (2003) Flexibility and specificity in coral–algal symbiosis: Schmidt G.W. and Fitt W.K. (2003) Low symbiont diversity in diversity, ecology, and biogeography of Symbiodinium. Annual southern Great Barrier Reef corals, relative to those of the Review of Ecology, Evolution, and Systematics 34, 661–689. Caribbean. Limnology and Oceanography 48, 2046–2054. Barneah O., Weis V.M., Perez S. and Benayahu Y. (2004) Diversity of LaJeunesse T.C., Bhagooli R., Hidaka M., DeVantier L., Done T., dinoflagellate symbionts in Red Sea soft corals: mode of symbiont Schmidt G.W., Fitt W.K. and Hoegh-Guldberg O. (2004) Closely acquisition matters. Marine Ecology Progress Series 275, 89–95. related Symbiodinium spp. differ in relative dominance in coral reef Berkelmans R. and van Oppen M.J.H. (2006) The role of zooxanthellae host communities across environmental, latitudinal and biogeographic in the thermal tolerance of corals: a ‘nugget of hope’ for coral reefs in gradients. Marine Ecology Progress Series 284, 147–161. an era of climate change. Proceedings of the Royal Society of London, Series B—Biological Sciences 273, 2305–2312. LaJeunesse T.C., Bonilla H.R., Warner M.E., Wills M., Schmidt G.W. and Fitt W.K. (2008) Specificity and stability in high latitude Clarke K.R. and Warwick R.M. (2001) Changes in marine communities: eastern Pacific coral–algal symbioses. Limnology and Oceanography an approach to statistical analysis and interpretation. 2nd edition. 53, 719–727. Plymouth, UK: PRIMER-E Ltd. LaJeunesse T.C., Smith R., Walther M., Pinzon J., Pettay D.T., Dong Z., Huang H., Huang L. and Li Y. (2009) Diversity of symbiotic McGinley M., Aschaffenburg M., Medina-Rosas P., algae of the genus Symbiodinium in scleractinian corals of the Xisha Cupul-Magana A.L., Perez A.L., Reyes-Bonilla H. and Warner Islands in the South China Sea. Journal of Systematics and Evolution M.E. (2010) Host–symbiont recombination versus natural selection 47, 321–326. in the response of coral–dinoflagellate symbioses to environmental Fitt W.K. and Cook C.B. (2001) The effects of feeding or addition of dis- disturbance. Proceedings of the Royal Society of London, Series B— solved inorganic nutrients in maintaining the symbiosis between dino- Biological Sciences 277, 2925–2934. flagellates and a tropical marine cnidarian. Marine Biology 139, 507– Lin S.J., Zhang H., Hou Y., Miranda L. and Bhattacharya D. (2006) 517. Development of a dinoflagellate-oriented PCR primer set leads to Frade P.R., De Jongh F., Vermeulen F., Van Bleijswijk J. and Bak detection of picoplanktonic dinoflagellates from Long Island Sound. R.P.M. (2008) Variation in symbiont distribution between closely Applied and Environmental Microbiology 72, 5626–5630. 1316 g. zhou et al.

Loh W.K.W., Loi T., Carter D. and Hoegh-Guldberg O. (2001) Genetic Proceedings of the National Academy of Sciences of the United States of variability of the symbiotic dinoflagellates from the wide ranging coral America 101, 13531–13535. species Seriatopora hystrix and Acropora longicyathus in the ter Braak C.J. (1995) Ordination. In Jongman R.H., ter Braak C.J. and Indo-West Pacific. Marine Ecology Progress Series 222, 97–107. Van Tongeren O.F. (eds) Data analysis in community and landscape Mostafavi P.G., Fatemi S.M.R., Shahhosseiny M.H., Hoegh-Guldberg ecology. Cambridge: Cambridge University Press, pp. 91–173. O. and Loh W.K.W. (2007) Predominance of clade D Thornhill D.J., LaJeunesse T.C., Kemp D.W., Fitt W.K. and Schmidt Symbiodinium in shallow-water reef-building corals off Kish and G.W. (2006a) Multi-year, seasonal genotypic surveys of coral-algal Larak Islands (Persian Gulf, Iran). Marine Biology 153, 25–34. symbioses reveal prevalent stability or post-bleaching reversion. Oliver T.A. and Palumbi S.R. (2009) Distributions of stress-resistant Marine Biology 148, 711–722. coral symbionts match environmental patterns at local but not Thornhill D.J., Fitt W.K. and Schmidt G.W. (2006b) Highly stable sym- regional scales. Marine Ecology Progress Series 378, 93–103. bioses among western Atlantic brooding corals. Coral Reefs 25, Pochon X. and Gates R.D. (2010) A new Symbiodinium clade 515–519. (Dinophyceae) from soritid foraminifera in Hawai’i. Molecular Thornhill D.J., Lajeunesse T.C. and Santos S.R. (2007) Measuring rDNA Phylogenetics and Evolution 56, 492–497. diversity in eukaryotic microbial systems: how intragenomic variation, Richmond R.H. and Hunter C.L. (1990) Reproduction and recruitment pseudogenes, and PCR artifacts confound biodiversity estimates. of corals: comparisons among the Caribbean, the tropical Pacific and Molecular Ecology 16, 5326–5340. the Red Sea. Marine Ecology Progress Series 60, 185–203. Thornhill D.J., Xiang Y., Fitt W.K. and Santos S.R. (2009) Reef ende- Rodriguez-Lanetty M., Loh W., Carter D. and Hoegh-Guldberg O. mism, host specificity and temporal stability in populations of symbio- tic dinoflagellates from two ecologically dominant Caribbean corals. (2001) Latitudinal variability in symbiont specificity within the wide- PLoS ONE 4, e6262. spread scleractinian coral Plesiastrea versipora. Marine Biology 138, 1175–1181. Thornhill D.J., Kemp D.W., Sampayo E.M. and Schmidt G.W. (2010) Comparative analyses of amplicon migration behavior in differing Rowan R., Knowlton N., Baker A. and Jara J. (1997) Landscape ecology denaturing gradient gel electrophoresis (DGGE) systems. Coral Reefs of algal symbionts creates variation in episodes of coral bleaching. 29, 83–91. Nature 388, 265–269. Toller W.W., Rowan R. and Knowlton N. (2001) Zooxanthellae of the Sampayo E.M., Franceschinis L., Hoegh-Guldberg O. and Dove S Montastraea annularis species complex: patterns of distribution of (2007) Niche partitioning of closely related symbiotic dinoflagellates. four taxa of Symbiodinium on different reefs and across depths. Molecular Ecology 16, 3721–3733. Biological Bulletin. Marine Biological Laboratory, Woods Hole 201, Sampayo E.M., Ridgway T., Bongaerts P. and Hoegh-Guldberg O. 348–359. (2008) Bleaching susceptibility and mortality of corals are determined and by fine-scale differences in symbiont type. Proceedings of the National Academy of Sciences of the United States of America 105, 10444–10449. van Oppen M.J.H. (2004) Mode of zooxanthella transmission does not affect zooxanthella diversity in acroporid corals. Marine Biology 144, Santos S.R., Taylor D.J., Kinzie R.A. III, Hidaka M., Sakai K. and 1–7. Coffroth M.A. (2002) Molecular phylogeny of symbiotic dinoflagel- lates inferred from partial chloroplast large subunit (23S)-rDNA Correspondence should be addressed to: sequences. Molecular Phylogenetics and Evolution 23, 97–111. H. Huang Stat M., Loh W.K.W., Hoegh-Guldberg O. and Carter D.A. (2008) Key Laboratory of Marine Bio-resources Sustainable Symbiont acquisition strategy drives host–symbiont associations in Utilization, South China Sea Institute of Oceanology, the southern Great Barrier Reef. Coral Reefs 27, 763–772. Chinese Academy of Sciences Tchernov D., Gorbunov M.Y., Devargas C., Yadav S.N., Milligan A.J., 164 West Xingang Road, Guangzhou, 510301, People’s Haggblom M. and Falkowski P.G. (2004) Membrane lipids of sym- Republic of China biotic algae are diagnostic of sensitivity to thermal bleaching in corals. email: [email protected]